Yuichi Endo

Paroxysmal nocturnal hemoglobinuria is an acquired hematopoietic disease characterized by abnormal blood cell populations in which the biosynthesis of the glycosylphosphatidylinositol (GPI) anchor is deficient. Deficiency of surface expressions of GPI-anchored complement inhibitors leads to complement-mediated hemolysis. Here we report that PIG-A, which participates in the early step of GPI anchor biosynthesis, is the gene responsible for paroxysmal nocturnal hemoglobinuria. Affected granulocytes and B lymphocytes had the same somatic mutation of PIG-A, indicating their clonal origin from a multipotential hematopoietic stem cell. We localized PIG-A to the X chromosome, which accounts for expression of the recessive phenotype of the somatic mutation and the fact that the same one of the multiple biosynthetic steps is affected in all patients so far characterized.

Summary: Innate immunity was formerly thought to be a non‐specific immune response characterized by phagocytosis. However, innate immunity has considerable specificity and is capable of discriminating between pathogens and self. Recognition of pathogens is mediated by a set of pattern recognition receptors, which recognize conserved pathogen‐associated molecular patterns (PAMPs) shared by broad classes of microorganisms, thereby successfully defending invertebrates and vertebrates against infection. Lectins, carbohydrate‐binding proteins, play an important role in innate immunity by recognizing a wide range of pathogens. Mannose‐binding lectin (MBL) and ficolin are lectins composed of a lectin domain attached to collagenous region. However, they use a different lectin domain: a carbohydrate recognition domain (CRD) is responsible for MBL and a fibrinogen‐like domain for ficolin. These two collagenous lectins are pattern recognition receptors, and upon recognition of the infectious agent, they trigger the activation of the lectin‐complement pathway through attached serine proteases, MBL‐associated serine proteases (MASPs). A similar lectin‐based complement system, consisting of the lectin–protease complex and C3, is present in ascidians, our closest invertebrate relatives, and functions in an opsonic manner. We isolated several lectins homologous to MBLs and ficolins and several MASPs in invertebrates and lower vertebrates, and herein we discuss the molecular evolution of these molecules. Based on these findings, it seems likely that the complement system played a pivotal role in innate immunity before the evolution of an acquired immune system in jawed vertebrates.

Unique among known human herpesviruses, Kaposi's sarcoma–associated herpesvirus (KSHV or HHV-8) encodes chemokine-like proteins (vMIP-I and vMIP-II). vMIP-II was shown to block infection of human immunodeficiency virus–type 1 (HIV-1) on a CD4-positive cell line expressing CCR3 and to a lesser extent on one expressing CCR5, whereas both vMIP-I and vMIP-II partially inhibited HIV infection of peripheral blood mononuclear cells. Like eotaxin, vMIP-II activated and chemoattracted human eosinophils by way of CCR3. vMIP-I and vMIP-II, but not cellular MIP-1α or RANTES, were highly angiogenic in the chorioallantoic assay, suggesting a possible pathogenic role in Kaposi's sarcoma.

Directional migration moves cells rapidly between points, whereas random migration allows cells to explore their local environments. We describe a Rac1 mechanism for determining whether cell patterns of migration are intrinsically random or directionally persistent. Rac activity promoted the formation of peripheral lamellae that mediated random migration. Decreasing Rac activity suppressed peripheral lamellae and switched the cell migration patterns of fibroblasts and epithelial cells from random to directionally persistent. In three-dimensional rather than traditional two-dimensional cell culture, cells had a lower level of Rac activity that was associated with rapid, directional migration. In contrast to the directed migration of chemotaxis, this intrinsic directional persistence of migration was not mediated by phosphatidylinositol 3'-kinase lipid signaling. Total Rac1 activity can therefore provide a regulatory switch between patterns of cell migration by a mechanism distinct from chemotaxis.

IgM is the first antibody to be produced in a humoral immune response and plays an important role in the primary stages of immunity. Here we describe a mouse Fc receptor, designated Fc alpha/microR, and its human homolog, that bind both IgM and IgA with intermediate or high affinity. Fc alpha/microR is constitutively expressed on the majority of B lymphocytes and macrophages. Cross-linking Fc alpha/microR expressed on a pro-B cell line Ba/F3 transfectant with soluble IgM or IgM-coated microparticles induced internalization of the receptor. Fc alpha/microR also mediated primary B lymphocyte endocytosis of IgM-coated Staphylococcus aureus. Thus, Fc alpha/microR is involved in the primary stages of the immune response to microbes.

Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by loss of immune tolerance and sustained production of autoantibodies. Multiple and profound T cell abnormalities in SLE are intertwined with disease expression. Both numerical and functional disturbances have been reported in main CD4+ T helper cell subsets including Th1, Th2, Th17, regulatory, and follicular helper cells. SLE CD4+ T cells are known to provide help to B cells, produce excessive IL-17 but insufficient IL-2, and infiltrate tissues. In the absence of sufficient amounts of IL-2, regulatory T cells, do not function properly to constrain inflammation. A complicated series of early signaling defects and aberrant activation of kinases and phosphatases result in complex cell phenotypes by altering the metabolic profile and the epigenetic landscape. All main metabolic pathways including glycolysis, glutaminolysis and oxidative phosphorylation are altered in T cells from lupus prone mice and patients with SLE. SLE CD8+ cytotoxic T cells display reduced cytolytic activity which accounts for higher rates of infection and the sustenance of autoimmunity. Further, CD8+ T cells in the context of rheumatic diseases lose the expression of CD8, acquire IL-17+CD4-CD8- double negative T (DNT) cell phenotype and infiltrate tissues. Herein we present an update on these T cell abnormalities along with underlying mechanisms and discuss how these advances can be exploited therapeutically. Novel strategies to correct these aberrations in T cells show promise for SLE treatment.

Abstract Both ficolins and mannose-binding lectin (MBL) are lectins characterized by the presence of collagen-like and carbohydrate-binding domains in a subunit, although their carbohydrate-binding moieties are quite different. A fibrinogen-like domain is in ficolins, and a carbohydrate recognition domain is in MBL. On binding to pathogens, human MBL activates the complement system via the lectin pathway in association with two types of MBL-associated serine proteases (MASP), MASP-1 and MASP-2 and its truncated form, small MBL-associated protein (sMAP, also called MAp19). We report here that ficolin/P35, a human serum ficolin, was found to copurify with MASPs and sMAP. MASPs that were complexed with ficolin/P35 exhibited proteolytic activities against complement components C4, C2, and C3. The ficolin/P35-MASPs-sMAP complex that was bound to Salmonella typhimurium activated complement. These findings indicate that ficolin/P35 is a second collagenous lectin capable of activating the lectin pathway and thus plays a role in innate immunity.

Collectins are C-type animal lectins with both collagenous and carbohydrate recognition domains and are involved in the first line host defense against pathogens. We report here a novel Ca(2+)-dependent and GlcNAc-binding lectin consisting of subunits of 35 kDa (P35) with a collagen-like sequence. When P35 is isolated from human serum, it forms a homopolymer by means of intermolecular disulfide bonding, as is the case with collectins. P35 cDNA was cloned from a human liver cDNA library, and the deduced amino acid sequence of 313 residues revealed that the mature form of P35 consists mainly of collagen- and fibrinogen-like domains. The latter contained two potential Ca(2+)-binding sites that may be involved in carbohydrate binding. The overall sequence of P35 was highly homologous to porcine ficolins alpha and beta. Northern blots of various human tissues showed that the major product of the 1.3-kilobase-long P35 transcript is expressed in liver. P35 enhanced phagocytosis of Salmonella typhimurium by neutrophils, suggesting an opsonic effect via the collagen region. P35 was found to bind to GlcNAc-conjugated bovine serum albumin, a neoglycoprotein, as well as to neoglycolipids containing complex-type oligosaccharides derived from glycoproteins, suggesting that P35 recognizes GlcNAc residues such as those found in microbial glycoconjugates and complex-type oligosaccharides. Therefore, P35 represents a new type of GlcNAc-binding lectin with structural and functional similarities to collectins involved in innate immunity.

Effects of Glutaraldehyde Exposure on Human Health: Tomoko Takigawa, et al. Department of Public Health, Okayama University Graduate School of Medicine, Dentistry and Pharmaceutical Sciences —Glutaraldehyde (GA) is widely used in the industrial, scientific and biomedical fields. Many adverse health effects on humans have been reported in association with biomedical uses of GA, with 2–3.5% aqueous GA solution generally used for cold sterilization and GA exposure ranges of 0.001 to 2.6 ppm for this type of use. GA is metabolized extensively to CO 2 , but urinary excretion of it is low. Sensory irritant effects, sensitization of skin and respiratory organs and other symptoms have been reported among endoscopy nurses and medical radiation technologists. The prevalence of chronic bronchitis and nasal symptoms in humans is significantly correlated with peak concentrations of GA exposure. The extent of primary skin irritation depends on the duration and site of contact, and the severity of symptoms is dose‐related. Chronic inhalation affects the nose and respiratory tract, and lesions become severe with prolonged duration of exposure. Increases in neither mortality nor tumor incidence have been found in workers with less than 0.2 ppm GA exposure, no evidence of carcinogenic activity has been obtained in experimental animal studies. There has been no clear evidence of genetic toxicity of GA in either in vitro or in vivo studies, and neither developmental nor reproductive toxicity has been found in humans or animals. To prevent hazards from GA exposure, use of closed‐system, fully automated washing machines is recommended, since numerous symptoms have been found in individuals with less than 0.05 ppm GA exposure, the recommended peak exposure limit in many countries.

Three types of ficolins have been identified in humans: L-ficolin, M-ficolin, and H-ficolin. Similar to mannose-binding lectin, L-ficolin and H-ficolin are the recognition molecules in the lectin complement pathway. Another human ficolin, M-ficolin, is a nonserum ficolin that is expressed in leukocytes and lung; however, little is known about its physiologic roles. In this study, we report the characterization of M-ficolin in terms of its protein localization and lectin activity. M-ficolin was localized in secretory granules in the cytoplasm of neutrophils, monocytes, and type II alveolar epithelial cells in lung. M-ficolin precipitated with mannose-binding lectin-associated serine proteases (MASP)-1 and MASP-2 in a co-immunoprecipitation assay, indicating that M-ficolin forms complexes with MASP-1 and MASP-2. M-ficolin-MASP complexes activated complement on N-acetylglucosamine (GlcNAc)-coated microplates in a C4 deposition assay. M-ficolin bound to several neoglycoproteins bearing GlcNAc, N-acetylgalactosamine, and sialyl-N-acetyllactosamine, suggesting that M-ficolin can recognize the common carbohydrate residues found in microbes. Indeed, M-ficolin bound to Staphylococcus aureus through GlcNAc. These results indicate that M-ficolin, like its family members, functions as a recognition molecule of the lectin complement pathway and plays an important role in innate immunity.

Interlaminar fracture toughness and delamination fatigue crack growth behavior were investigated for carbon fiber (CF)/epoxy laminates with the self-same epoxy interleaf. The matrix epoxy with a thickness of 50 μm was chosen as the interleaf material in order to clarify the effect of resin-rich layer thickness on the delamination fatigue crack growth behavior. Tests under mode I loading were carried out using double cantilever beam specimens. For tests under mode II loading, three-point end notched flexure specimens were used for interlaminar fracture toughness tests, while four-point end notched flexure specimens were used for delamination fatigue tests. The mode I properties (interlaminar fracture toughness and delamination fatigue threshold) of these epoxy-interleaved CFRP laminates were almost identical to those of the laminates without interleaf (base CFRP laminates). The effect of epoxy interleaf was completely different under mode II loading. The mode II interlaminar fracture toughness for the epoxy-interleaved laminates was 1.6 (initial value) and 3.4 (propagation value) times higher than that for the base CFRP laminates. The mode II delamination fatigue threshold of the epoxy-interleaved laminates was 2–2.3 times higher than those of the base CFRP laminates. While the toughness of the interleaf is the key factor under mode I, the thickness of interlayer is the key factor under mode II. The difference in the effect of the self-same epoxy interlayer on the interlaminar fracture properties under modes I and II loadings was discussed on the bases of the fractographic observations and mechanism considerations.

Kaposi's sarcoma-associated herpesvirus (KSHV) encodes 3 genes that are homologous to cellular chemokines. vMIP-III, the product of open reading frame K4.1, is the most distantly related to human chemokines and has yet to be characterized. We have examined the interaction of vMIP-III with chemokine receptors, its expression in KS lesions, and its in ovo angiogenic properties. We show expression of vMIP-III in KS lesions and demonstrate the stimulation of angiogenesis by this chemokine, like vMIP-I and vMIP-II, in the chick chorioallantoic membrane assay. vMIP-III does not block human immunodeficiency virus entry through the coreceptors CCR3, CCR5, or CXCR4. However, vMIP-III is an agonist for the cellular chemokine receptor CCR4. CCR4 is expressed by TH2-type T cells. Consistent with this, vMIP-III preferentially chemoattracts this cell type. Because of these biologic properties and because it is expressed in KS lesions, vMIP-III may play an important role in the pathobiology of KS.

Do electrons prefer to visit planes or spheres? Reorganization energies for intramolecular electron transfer involving a 3D acceptor (C60) and a 2D acceptor (NIm; see scheme) have been determined. Comparison of reorganization energies for the intra- versus intermolecular electron transfer has provided, for the first time, valuable insight into the intrinsic reorganization energies relating to different molecular shapes.

The lectin complement pathway is initiated by binding of mannose-binding lectin (MBL) and MBL-associated serine protease (MASP) to carbohydrates. In the human lectin pathway, MASP-1 and MASP-2 are involved in the proteolysis of C4, C2 and C3. Here we report that the human MBL-MASP complex contains a new 22 kDa protein [small MBL-associated protein (sMAP)] bound to MASP-1. Analysis of the nucleotide sequence of sMAP cDNA revealed that it is a truncated form of MASP-2, consisting of the first two domains (i.e. the first internal repeat and the epidermal growth factor-like domain) with four different C-terminal amino acids. sMAP mRNAs are expressed in liver by alternative polyadenylation of the MASP-2 gene, in which a sMAP-specific exon containing an in-frame stop codon and a polyadenylation signal is used. The involvement of sMAP in the MBL-MASP complex suggests that the activation mechanism of the lectin pathway is more complicated than that of the classical pathway.

The Kaposi's sarcoma-associated herpesvirus (KSHV) (or human herpesvirus 8) open reading frame (ORF) K15 encodes a putative integral transmembrane protein in the same genomic location as latent membrane protein 2A of Epstein-Barr virus. Ectopic expression of K15 in cell lines revealed the presence of several different forms ranging in size from full length, approximately 50 kDa, to 17 kDa. Of these different species the 35- and 23-kDa forms were predominant. Mutational analysis of the initiator AUG indicated that translation initiation from this first AUG is required for K15 expression. Computational analysis indicates that the different forms detected may arise due to proteolytic cleavage at internal signal peptide sites. We show that K15 is latently expressed in KSHV-positive primary effusion lymphoma cell lines and in multicentric Castleman's disease. Using a yeast two-hybrid screen we identified HAX-1 (HS1 associated protein X-1) as a binding partner to the C terminus of K15 and show that K15 interacts with cellular HAX-1 in vitro and in vivo. Furthermore, HAX-1 colocalizes with K15 in the endoplasmic reticulum and mitochondria. The function of HAX-1 is unknown, although the similarity of its sequence to those of Nip3 and Bcl-2 infers a role in the regulation of apoptosis. We show here that HAX-1 can form homodimers in vivo and is a potent inhibitor of apoptosis and therefore represents a new apoptosis regulatory protein. The putative functions of K15 with respect to its interaction with HAX-1 are discussed.

We previously reported a new type of signal-transducing adaptor molecule, STAM, which was shown to be involved in cytokine-mediated intracellular signal transduction. In this study, we molecularly cloned a 110-kDa phosphotyrosine protein inducible by stimulation with interleukin 2 (IL-2). The 110-kDa molecule was found to be a human counterpart of mouse Hrs (hepatocyte growth factor-regulated tyrosine kinase substrate) and to be associated with STAM. Tyrosine phosphorylation of Hrs is induced rapidly after stimulation with IL-2 and granulocyte-macrophage colony-stimulating factor as well as hepatocyte growth factor. The mutual association sites of Hrs and STAM include highly conserved coiled-coil sequences, suggesting that their association is mediated by the coiled-coil structures. Exogenous introduction of the wild-type Hrs significantly suppressed DNA synthesis upon stimulation with IL-2 and granulocyte-macrophage colony-stimulating factor, while the Hrs mutant deleted of the STAM-binding site lost such suppressive ability. These results suggest that Hrs counteracts the STAM function which is critical for cell growth signaling mediated by the cytokines. We previously reported a new type of signal-transducing adaptor molecule, STAM, which was shown to be involved in cytokine-mediated intracellular signal transduction. In this study, we molecularly cloned a 110-kDa phosphotyrosine protein inducible by stimulation with interleukin 2 (IL-2). The 110-kDa molecule was found to be a human counterpart of mouse Hrs (hepatocyte growth factor-regulated tyrosine kinase substrate) and to be associated with STAM. Tyrosine phosphorylation of Hrs is induced rapidly after stimulation with IL-2 and granulocyte-macrophage colony-stimulating factor as well as hepatocyte growth factor. The mutual association sites of Hrs and STAM include highly conserved coiled-coil sequences, suggesting that their association is mediated by the coiled-coil structures. Exogenous introduction of the wild-type Hrs significantly suppressed DNA synthesis upon stimulation with IL-2 and granulocyte-macrophage colony-stimulating factor, while the Hrs mutant deleted of the STAM-binding site lost such suppressive ability. These results suggest that Hrs counteracts the STAM function which is critical for cell growth signaling mediated by the cytokines. Activation of tyrosine kinases is an initial biochemical event in intracellular signal transduction from cytokine receptors after their bindings with ligands. Although most of the cytokine receptors do not contain any consensus motif of tyrosine kinase, several families of tyrosine kinases, such as the Src family tyrosine kinases, Jak family tyrosine kinases, Syk/ZAP70 family tyrosine kinases, and other family tyrosine kinases (Fes and Tec), are known to be associated with the cytoplasmic domains of cytokine receptors (1Taniguchi T. Science. 1995; 268: 251-255Crossref PubMed Scopus (676) Google Scholar). Upon activation of the tyrosine kinases, cytokine receptor subunits are phosphorylated on tyrosine residues, which results in association of the receptor subunits with signal transducers and activators of transcription (Stats) 1The abbreviations used are: Stat, signal transducer and activator of transcription; SH, Src homology; IL, interleukin; GM-CSF, granulocyte-macrophage colony-stimulating factor; ITAM, immunoreceptor tyrosine-based activation motif; HGF, hepatocyte growth factor; EGF, epidermal growth factor; PDGF, platelet-derived growth factor; NTPase, nucleotide triphosphatase; PBL, peripheral blood leukocytes; PHA, phytohemagglutinin; mAb, monoclonal antibody; HA, hemagglutinin; FISH, fluorescence in situ hybridization; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; FCS, fetal calf serum; bp, base pair(s); kb, kilobase pair(s). via interaction between the phosphorylated tyrosine residues of receptor subunits and the Src homology 2 (SH2) domains of Stats, and subsequently the Stats are tyrosine-phosphorylated by the Jak family tyrosine kinases to be activated as transcription factors (2Darnell J.E. Kerr I.M. Stark G.R. Science. 1994; 264: 1415-1421Crossref PubMed Scopus (5062) Google Scholar, 3Ihle J.N. Cell. 1996; 84: 331-334Abstract Full Text Full Text PDF PubMed Scopus (1268) Google Scholar). For example, interleukin-2 (IL-2) induces activation of Lck (Fyn or Lyn), Syk, and Jak1, all of which are associated with the IL-2 receptor β chain, and Jak3, which is associated with the IL-2 receptor γc chain, together with activation of other signaling molecules such as phosphatidylinositol 3-kinase and Shc/Grb2/Sos/Ras/Raf1/mitogen-activated protein kinase cascade (4Sugamura K. Asao H. Kondo M. Tanaka N. Ishii N. Nakamura M. Takeshita T. Adv. Immunol. 1995; 59: 225-277Crossref PubMed Google Scholar). Stat5 associated with the IL-2 receptor β chain is activated by Jak3 but not Jak1 upon IL-2 stimulation (5Higuchi M. Asao H. Tanaka N. Oda K. Takeshita T. Nakamura M. Snick J.V. Sugamura K. Eur. J. Immunol. 1996; 26: 1322-1327Crossref PubMed Scopus (41) Google Scholar, 6Hou J. Schindler U. Henzel W.J. Wong S.C. McKnight S.L. Immunity. 1995; 2: 321-329Abstract Full Text PDF PubMed Scopus (189) Google Scholar, 7Oakes S.A. Candotti F. Johnston J.A. Chen Y.-Q. Ryan J.J. Taylor N. Liu X. Hennighausen L. Notarangelo L.D. Paul W.E. Blaese R.M. O'Shea J.J. Immunity. 1996; 5: 605-615Abstract Full Text PDF PubMed Scopus (111) Google Scholar). IL-3/granulocyte-macrophage colony-stimulating factor (GM-CSF) also seems to activate Stat5 through Jak2 (8Mui A.L. Wakao H. O'Farrell A.M. Harada N. Miyajima A. EMBO J. 1995; 14: 1166-1175Crossref PubMed Scopus (541) Google Scholar, 9Nakamura N. Chin H. Miyasaka N. Miura O. J. Biol. Chem. 1996; 271: 19483-19488Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Activation of Stat5 has been shown to be involved in signaling for DNA synthesis mediated by IL-2 and IL-3 in certain cell lines (10Friedmann M.C. Migone T.S. Russell S.M. Leonard W.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 2077-2082Crossref PubMed Scopus (170) Google Scholar, 11Mui A.L. Wakao H. Kinoshita T. Kitamura T. Miyajima A. EMBO J. 1996; 15: 2425-2433Crossref PubMed Scopus (377) Google Scholar). Jak3 and Jak2 are also known to be essential for induction of c-myc and c-fos upon stimulation with IL-2 and GM-CSF, respectively (12Kawahara A. Minami Y. Miyazaki T. Ihle J.N. Taniguchi T. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8724-8728Crossref PubMed Scopus (99) Google Scholar, 13Watanabe S. Itoh T. Arai K. J. Biol. Chem. 1996; 271: 12681-12686Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar). The target genes for Stat5, such as OSM(oncostatin M), c-fos, pim-1, Id-1, and CIS (cytokine inducible SH2-containing protein) have been defined (11Mui A.L. Wakao H. Kinoshita T. Kitamura T. Miyajima A. EMBO J. 1996; 15: 2425-2433Crossref PubMed Scopus (377) Google Scholar, 14Yoshimura A. Ichihara M. Kinjyo I. Moriyama M. Copeland N.G. Gilbert D.J. Jenkins N.A. Hara T. Miyajima A. EMBO J. 1996; 15: 1055-1063Crossref PubMed Scopus (196) Google Scholar), but there is no evidence for involvement of Stat5 in c-myc induction. Therefore, we suspected that signaling molecule(s) other than Stat5 would be involved in the signaling pathway immediately downstream of the Jaks for induction of c-myc. To search for such molecule(s), we have investigated cellular phosphotyrosine proteins induced by IL-2 stimulation, and detected several phosphotyrosine molecules distinct in molecular masses. Among them, the 75-kDa molecule was identified as the β chain of IL-2 receptor, and a cDNA encoding the 70-kDa molecule was cloned and identified as a novel signal-transducing adaptor molecule, which we named STAM, containing an SH3 domain and a tyrosine cluster region including an immunoreceptor tyrosine-based activation motif (ITAM) (15Takeshita T. Arita T. Asao H. Tanaka N. Higuchi M. Kuroda H. Kaneko K. Munakata H. Endo Y. Fujita T. Sugamura K. Biochem. Biophys. Res. Commun. 1996; 225: 1035-1039Crossref PubMed Scopus (69) Google Scholar). We also succeeded in determination of a partial amino acid sequence of the 110-kDa phosphotyrosine molecule induced by IL-2 stimulation, and here demonstrated that the 110-kDa molecule is a human counterpart of mouse Hrs. Hrs containing a double zinc-finger motif was reported previously to be a phosphotyrosine protein induced by stimulation with hepatocyte growth factor (HGF), epidermal growth factor (EGF), and platelet-derived growth factor (PDGF), and localized in the cytoplasm (16Komada M. Kitamura N. Mol. Cell. Biol. 1995; 15: 6213-6221Crossref PubMed Scopus (145) Google Scholar). Very recently, Hrs-2, a rat homolog of Hrs, which is different in the C terminus, has been reported to have nucleotide triphosphatase (NTPase) activity and be associated with SNAP-25, possibly modulating vesicular transport (17Bean A.J. Seifert R. Chen Y.A. Sacks R. Scheller R.H. Nature. 1997; 385: 826-829Crossref PubMed Scopus (113) Google Scholar). However, the biological significance of Hrs has not yet been elucidated. On the other hand, we have recently demonstrated that STAM is directly associated with and phosphorylated by Jak3 and Jak2 upon stimulation with IL-2 and GM-CSF, respectively, and involved in signaling for DNA synthesis and c-myc induction mediated by IL-2 and GM-CSF (18Takeshita T. Arita T. Higuchi M. Asao H. Endo K. Kuroda H. Tanaka N. Murata K. Ishii N. Sugamura K. Immunity. 1997; 6: 449-457Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). The present study documents that Hrs is associated with STAM and implicated in regulation of intracellular signal transduction mediated by IL-2 and GM-CSF. Cell lines used were a human T cell line, MOLTβ, which is a MOLT-4 transfectant clone expressing the exogenous β and endogenous γc chains of IL-2 receptor (19Takeshita T. Ohtani K. Asao H. Kumaki S. Nakamura M. Sugamura K. J. Immunol. 1992; 148: 2154-2158PubMed Google Scholar); a mouse IL-3-dependent pro-B cell line, BAF-B03 (20Hatakeyama M. Mori H. Doi T. Taniguchi T. Cell. 1989; 59: 837-845Abstract Full Text PDF PubMed Scopus (302) Google Scholar); a human GM-CSF-responsive cell line, TF-1 (21Kitamura T. Terasawa T. Chiba S. Kuwaki T. Miyagawa K. Piao Y.F. Miyazono K. Urabe A. Takaku F. J. Cell. Physiol. 1989; 140: 323-334Crossref PubMed Scopus (716) Google Scholar); a SV40-transformed monkey kidney cell line, COS7; human B cell lines, Raji and Daudi; a human T cell line, Jurkat; a human monocytic cell line, THP-1; a human eosinophilic cell line, Eol-3; a human myelogenic cell line, KU812; and a human GM-CSF-dependent cell line, M-TAT (22Minegishi N. Minegishi M. Tsuchiya S. Fujie H. Nagai T. Hayashi N. Yamamoto M. Konno T. J. Biol. Chem. 1994; 269: 27700-27704Abstract Full Text PDF PubMed Google Scholar). TF-1 and M-TAT were maintained in RPMI 1640 medium supplemented with 10% FCS and recombinant GM-CSF. BAF-B03 was maintained in RPMI 1640 medium supplemented with 10% FCS, 20% conditioned medium derived from culture supernatant of WEHI-3 cell line (as a source of IL-3) and 50 μm 2-mercaptoethanol. COS7 was maintained in Dulbecco's modified Eagle's medium supplemented with 10% FCS. Other cell lines were maintained in RPMI 1640 medium supplemented with 10% FCS. Peripheral blood leukocytes (PBL) from a healthy donor were treated with 1.0% phytohemagglutinin (PHA) (Difco) for 2 days and maintained in RPMI 1640 medium supplemented with 10% FCS and 1 nmIL-2. pSRB5 and pSRG1 are human IL-2 receptor β and γc chain expression plasmids, respectively (19Takeshita T. Ohtani K. Asao H. Kumaki S. Nakamura M. Sugamura K. J. Immunol. 1992; 148: 2154-2158PubMed Google Scholar, 23Takeshita T. Asao H. Ohtani K. Ishii N. Kumaki S. Tanaka N. Munakata H. Nakamura M. Sugamura K. Science. 1992; 257: 379-382Crossref PubMed Scopus (813) Google Scholar), and hGMRα and hGMRβ are human GM-CSF receptor α and βc chain expression plasmids, respectively (24Sakamaki K. Miyajima I. Kitamura T. Miyajima A. EMBO J. 1992; 11: 3541-3550Crossref PubMed Scopus (295) Google Scholar, 25Watanabe S. Muto A. Yokota T. Miyajima A. Arai K. Mol. Biol. Cell. 1993; 4: 983-992Crossref PubMed Scopus (37) Google Scholar). pENL is a β-galactosidase expression plasmid. Human recombinant cytokines used here were IL-2 (obtained from Ajinomoto Co. Ltd., Japan) and GM-CSF (Hoechst Japan). Monoclonal antibodies (mAbs) used were TUS-1 (IgG1) specific for STAM (15Takeshita T. Arita T. Asao H. Tanaka N. Higuchi M. Kuroda H. Kaneko K. Munakata H. Endo Y. Fujita T. Sugamura K. Biochem. Biophys. Res. Commun. 1996; 225: 1035-1039Crossref PubMed Scopus (69) Google Scholar), 12CA5 (IgG2b) specific for influenza virus hemagglutinin (HA) epitope (Boehringer Mannheim), 4G10 (IgG2b) (Upstate Biotechnology Inc.) and PY20 (ICN Biomedicals) specific for phosphotyrosine, PC61 specific for the mouse IL-2 receptor α chain (26Lowenthal J.W. Corthesy P. Tougne C. Lees R. MacDonald H.R. Nabholz M. J. Immunol. 1985; 135: 3988-3994PubMed Google Scholar), TUm122 specific for the mouse IL-2 receptor β chain (27Nemoto T. Takeshita T. Ishii N. Kondo M. Higuchi M. Satomi S. Nakamura M. Mori S. Sugamura K. Eur. J. Immunol. 1995; 25: 3001-3005Crossref PubMed Scopus (38) Google Scholar). A human Hrs-specific mAb, Imos-1, was prepared by immunizing mice with glutathione S-transferase fusion protein of an Hrs peptide (amino acid position from Arg221 to Asn447) using pGEX-4T-2 plasmid (Pharmacia Biotech Inc.). Imos-1 is useful for immunoblotting but not immunoprecipitation. Polyclonal anti-Hrs antibody immunoprecipitable for human Hrs was also prepared in rabbits by immunization with the glutathione S-transferase-Hrs fusion protein. Immunoprecipitation was carried out as described elsewhere (5Higuchi M. Asao H. Tanaka N. Oda K. Takeshita T. Nakamura M. Snick J.V. Sugamura K. Eur. J. Immunol. 1996; 26: 1322-1327Crossref PubMed Scopus (41) Google Scholar). In brief, cells were lysed in Nonidet P-40 cell extraction buffer (1% Nonidet P-40, 25 mm Tris-HCl, pH 7.5, 140 mm NaCl, 10 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 20 μg/ml aprotinin, 1 mm Na3VO4), and immunoprecipitated with indicated antibodies. The immunoprecipitates were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred to polyvinylidene difluoride filters (Millipore). After blocking with 3% bovine serum albumin in phosphate-buffered saline containing 0.1% Tween 20 or Tris-buffered saline containing 0.1% Tween 20 for blotting with anti-phosphotyrosine mAbs, 4G10 and PY20, the filters were then incubated with indicated antibodies, followed by incubation with anti-mouse IgG coupled with horseradish peroxidase and visualized by using the enhanced chemiluminescence (ECL) detection system (Amersham Life Science). Based on a partial amino acid sequence (GQTVHDEVANK) of pp110, a pair of primers, A3F (5′-GG(AGCT)CA(AG)AC(AGCT)GT(TC)-3′) and AR (5′-(TC)TT(AG)TT(AGCT)GC(AGCT)AC(TC)TC-3′), were chemically synthesized. To isolate a cDNA coding for pp110, we prepared poly(A)+ RNA from MOLTβ, and synthesized first-strand cDNA from the poly(A)+ RNA as a template and AR primer with the First-Strand cDNA synthesis kit (Pharmacia). DNA fragments were amplified by polymerase chain reaction (PCR) method with A3F and AR primers, and the first strand cDNA as a template. We isolated a 33-bp DNA fragment, and the amino acid sequence deduced from the nucleotide sequence of this fragment included the amino acid sequence directly determined with the purified pp110. Using the 33-bp fragment as a probe, we isolated five cDNA clones from a oligo(dT)-primed cDNA library of PHA-stimulated PBL, and sequenced them. All the five cDNA clones sequenced were identical and the longest clone (clone 1) had an open reading frame coding for 777 amino acids, which included the GQTVHDEVANK sequence. To confirm that clone 1 contains full-length cDNA, the 5′ end of clone 1 cDNA was amplified with the Marathon cDNA amplification kit (CLONTECH), and an additional 42 bp of cDNA upstream of the 5′ end of clone 1 was obtained. This sequence contains an in-frame stop codon at 45 bp upstream of the first methionine codon, and the sequence around the first methionine (nucleotides 76–78) matches the favorable Kozak consensus sequence. Together with these results, clone 1 was confirmed to contain a full-length cDNA encoding pp110. Clone 1 coding for pp110 was subcloned into pKU2-Hyg expression vector at the XhoI and XbaI sites, and pKU-Hrs was obtained as an expression plasmid for pp110. pKU-HdC1 and pKU-HdC2 are expression plasmids for the C-terminal truncation mutants of Hrs, named Hrs-dC1 and Hrs-dC2, respectively, which were deleted up to nucleotides 1786 and 1429 from pKU-Hrs with exonuclease III and mung bean nuclease, respectively, and then a multiple-termination linker (pGCTAGGTAGGTAGTCTAGACTACCTACCTAGC) was inserted. pKU-HdM is an expression plasmid for the mutant deleted from Ser432 to Met573 of Hrs, named Hrs-dM. For preparation of pKU-HdM, we amplified Hrs DNA by PCR method with two pairs of primers, 5′-TGGAGACAGATTGGGAGTCC-3′ and 5′-TAAAGGTACCGAGTCATTGGTGATGCTG-3′, or 5′-AAAAGGTACCCGCAGCCGGAGGTGTGCT-3′ and 5′-GGGAGGTGTGGGAGGTTTTT-3′, respectively, and with pKU-Hrs as a template. Amplified DNA fragments were digested with KpnI, and the resultant fragments were ligated to each other and then digested with BglII and XbaI. The digested fragment was ligated to pKU-Hrs vector after removal of the BglII-XbaI fragment. The wild-type and mutants of Hrs were subcloned into pCXN2 expression vector (28Niwa H. Yamamura K.-I. Miyazaki J.-I. Gene (Amst.). 1991; 108: 193-200Crossref PubMed Scopus (4619) Google Scholar). pKU-HrsHA is an expression plasmid for the HA-epitope (YPYDVPDYASG)-tagged Hrs (Hrs-HA). For preparation of pKU-HrsHA, we amplified Hrs DNA by PCR method with two pairs of primers, 5′-ATATCTCGAGCCCGCGGCGTCGGGTTT-3′ and 5′-ATAATCCGGAACATCATATGGATACCCCATGGCGACCTCCAG-3′, or 5′-ATGTTCCGGATTATGCTAGCGGAGGGCGAGGCAGCGGCACC-3′ and 5′-TCGCAGATCTGCAAAATG-3′, respectively, and with pKU-Hrs as a template. Amplified DNA fragments were digested with AccIII and ligated to each other, and then digested with XhoI and BglII. Digested fragments were ligated to pKU-Hrs vector after removal of the XhoI-BglII fragment. pKU-HrsHA expresses Hrs-HA, which consists of the HA-epitope linked to Gly2 at the N terminus of Hrs. For HA-tagging to all the Hrs mutants, pKU-HdC1, pKU-HdC2, and pKU-HdM were digested with BglII and XbaI, and the resultant fragments were ligated into pKU-HrsHA vector at the BglII and XbaI sites. These expression vectors were named pKU-HdC1HA, pKU-HdC2HA, pKU-HdC3HA, and pKU-HdMHA, respectively. All the constructed plasmids were sequenced with an Applied Biosystems model 373A DNA sequencer. Northern blot analyses were performed as described previously (29Asao H. Takeshita T. Ishii N. Kumaki S. Nakamura M. Sugamura K. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 4127-4131Crossref PubMed Scopus (114) Google Scholar). In brief, poly(A)+RNA derived from various human cell lines was purified with guanidinium isothiocyanate extraction and oligo(dT) column (Oligotex™) (Takara Shuzo Co.), and Multiple Tissue Northern blot containing poly(A)+ RNA preparations derived from various human tissues were purchased (CLONTECH). 2 μg of poly(A)+ RNA derived from each cell lines were electrophoresed on 1% agarose gel containing formaldehyde, and transferred to GeneScreen membrane (NEN Life Science Products). A 2.9-kb fragment of Hrs cDNA and 0.5-kb fragment of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) cDNA were used as probes for hybridization after labeling with [α-32P]dCTP. Radioactivity was measured with a Bio-Image Analyzer BAS 1500 (Fuji Film). The chromosomal location of human Hrs gene was determined by fluorescence in situ hybridization (FISH). FISH to bromodeoxyuridine-synchronized metaphase chromosomes was performed by using a 2.9-kb-long cDNA of human Hrs as a probe, as described previously (30Endo Y. Onogi S. Umeki K. Yamamoto I. Kotani T. Ohtani S. Fujita T. Genomics. 1995; 25: 760-761Crossref PubMed Scopus (33) Google Scholar). 150 ng of biotin-labeled cDNA probe was hybridized with metaphase spreads prepared from primary culture of human PBL. Slides were incubated with fluorescein isothiocyanate-conjugated avidin DCS. Fluorescein isothiocyanate signals were then amplified by incubation with biotin-conjugated goat anti-avidin D. The preparations were counterstained with propidium iodide and examined under a laser scanning microscope. BAF-B03 cells without starvation for IL-3 and serum were transfected with indicated doses of Hrs plasmids and 5 μg of pENL, together with 2 μg of pSRB5 and pSRG1 or 2 μg of hGMRα and hGMRβ by electroporation, and 1 × 105 cells/well were seeded in 96-well plates. Subsequently, the cells were stimulated either with 3 nm human IL-2 in the presence of anti-mouse IL-2 receptor α chain mAb, PC61, and anti-mouse IL-2 receptor β chain mAb, TUm122, or with 20 ng/ml human GM-CSF for 24 h in triplicate. [3H]Thymidine was added at 1.0 μCi/well 4 h before termination of incubation. The incorporated [3H]thymidine was counted with 1450 MicroBeta™ liquid scintillation counter (Pharmacia). The β-galactosidase activity was also assayed for confirmation of comparable transfection efficiency in each sample. An IL-2-induced phosphotyrosine protein, pp110, detected previously (15Takeshita T. Arita T. Asao H. Tanaka N. Higuchi M. Kuroda H. Kaneko K. Munakata H. Endo Y. Fujita T. Sugamura K. Biochem. Biophys. Res. Commun. 1996; 225: 1035-1039Crossref PubMed Scopus (69) Google Scholar), was purified from immunoprecipitates of MOLTβ cell lysates with anti-phosphotyrosine mAb, 4G10, in two-dimensional gel electrophoresis, and amino acid sequence of its peptide fragment was successfully determined. Based on a partial amino acid sequence of the pp110, the full length of a cDNA clone encoding the pp110 was isolated as described under “Experimental Procedures.” The deduced amino acid sequence of the pp110 was found to be 93% homologous to that of mouse Hrs, indicating that the pp110 is the human counterpart of mouse Hrs. Deduced amino acid sequences were compared among human Hrs, mouse Hrs (16Komada M. Kitamura N. Mol. Cell. Biol. 1995; 15: 6213-6221Crossref PubMed Scopus (145) Google Scholar), and rat Hrs-2 (17Bean A.J. Seifert R. Chen Y.A. Sacks R. Scheller R.H. Nature. 1997; 385: 826-829Crossref PubMed Scopus (113) Google Scholar), all of which contain double zinc-finger motifs, proline-rich regions, proline- and glutamine-rich regions, putative coiled-coil sequences, and nucleotide-binding sites, and their schematic structures are shown in Fig.1 A. The N terminus containing 180 amino acid residues showed 99% homology among them, and the regions containing the double zinc-finger motif, proline-rich region, proline- and glutamine-rich region, and putative coiled-coil sequence were also highly homologous. However, the C-terminal 147 amino acid residues of Hrs-2 were not included in human and mouse Hrs. The chromosomal location of human Hrs gene was determined by FISH with Hrs cDNA probes. The human Hrs gene was mapped on chromosome 17q25 (Fig. 1 B). We investigated expression of Hrs mRNA in various human tissues and cell types. Hrs mRNA was detected as a 3.0-kb band in all the tissues and cell types tested, including spleen, lymph node, thymus, appendix, PBL, bone marrow, fetal liver, heart, brain, placenta, lung, liver, skeletal muscle, kidney, and pancreas (Fig.2 A), T and B lymphoid cell lines (MOLTβ, Jurkat, Daudi, and Raji), non-lymphoid hematopoietic cell lines (THP-1, TF-1, Eol-3, KU812, K562, and M-TAT), and PHA-treated PBL (PHA-PBL) (Fig. 2 B). These results suggest that human Hrs is ubiquitously expressed in a variety of human tissues and cell lines. Since human Hrs was originally detected as an IL-2-induced phosphotyrosine protein, and mouse Hrs has been shown to be tyrosine-phosphorylated by stimulation with HGF, EGF, and PDGF, we examined tyrosine phosphorylation of Hrs upon stimulation with IL-2. MOLTβ cells were lysed before and after IL-2 stimulation. Their lysates were immunoprecipitated with anti-Hrs antibody and then immunoblotted with anti-phosphotyrosine mAbs, 4G10 and PY20 (Fig.3 A). Tyrosine-phosphorylated Hrs was detected at a 110-kDa molecular mass in the cell lysates after IL-2 stimulation but not before IL-2 stimulation. Immunoblotting with anti-Hrs mAb indicated comparable expressions of Hrs before and after IL-2 stimulation. Similarly, GM-CSF stimulation of TF-1 cells also induced tyrosine phosphorylation of Hrs (data not shown). These results indicate that tyrosine phosphorylation of Hrs is induced by stimulation with IL-2 and GM-CSF, as well as HGF, EGF, and PDGF. In addition to the 110-kDa Hrs, phosphotyrosine molecules with 120-kDa and 70-kDa molecular masses were detected in the Hrs immunoprecipitate, suggesting that the 120-kDa and 70-kDa molecules may be coimmunoprecipitated with Hrs. The kinetic study of IL-2-induced tyrosine phosphorylation of Hrs was done with MOLTβ cells (Fig.3 B). Tyrosine-phosphorylated Hrs became detectable within 3 min of IL-2 stimulation, and maximized at 5 min. Since we previously found that STAM has a 70-kDa molecular mass and is tyrosine-phosphorylated upon stimulation with a wide variety of cytokines including IL-2, GM-CSF, EGF and PDGF, we considered the possibility that the 70-kDa phosphotyrosine molecule detected in the immunoprecipitate of Hrs is STAM. To examine this possibility, we performed coimmunoprecipitation assays between Hrs and STAM with MOLTβ cells. They were treated or untreated with IL-2, and their lysates were immunoprecipitated with rabbit anti-Hrs antibody, preimmune serum, or anti-STAM mAb. The immunoprecipitates were separated by SDS-PAGE, and then immunoblotted with anti-STAM mAb or anti-Hrs mAb, respectively. Irrespective of IL-2 stimulation, Hrs was apparently coimmunoprecipitated with STAM, or vice versa(Fig. 4). These results indicate that Hrs is physically associated with STAM without IL-2 stimulation. To gain insight into the association site of Hrs with STAM, we further carried out coimmunoprecipitation between various deletion mutants of Hrs and STAM. Firstly, we prepared HA-tagged Hrs, Hrs-dC1, Hrs-dC2, and Hrs-dM, which are the wild-type Hrs, and three mutants of Hrs deleted of the C terminus up to Gln571, of the C terminus up to Gln452, and of the portion between Ser432 and Met573, respectively, as shown in Fig.5 A. COS7 cells were transiently transfected with the wild-type STAM and the wild-type Hrs or Hrs mutants, their lysates were immunoprecipitated with anti-STAM mAb, and then immunoblotted with anti-HA mAb or anti-STAM mAb. STAM was coimmunoprecipitated with Hrs-dC1 as well as the wild-type Hrs, but not with Hrs-dC2 and Hrs-dM (Fig. 5 B, upper blot). Conversely, the cell lysates were immunoprecipitated with anti-HA mAb, and immunoblotted with anti-STAM mAb or anti-HA mAb. The wild-type Hrs and Hrs-dC1 but not Hrs-dC2 and Hrs-dM mutants was coimmunoprecipitated with STAM (Fig. 5 C, upper blot). The expression levels of the wild-type and mutants of Hrs and STAM were confirmed to be comparable among transfections (Fig. 5, B, C, and E, lower blots). These results suggest that the portion between Gln452 and Leu570 of Hrs includes the binding site for STAM. Next, we examined the association of STAM mutants with the wild-type Hrs. DSH3, DIT, and DY2 mutants of STAM are deleted of the SH3 domain, ITAM region and the tyrosine cluster region, respectively (Fig. 5 D). COS7 cells were transiently transfected with the wild-type STAM, DSH3, DIT, and DY2 together with HA-tagged wild-type Hrs, their lysates were immunoprecipitated with anti-STAM mAb, and then immunoblotted with anti-HA mAb. Hrs was coimmunoprecipitated equally well with the wild-type STAM and DSH3 mutant STAM, but weakly with DY2 mutant STAM, while DIT mutant STAM was not coimmunoprecipitated with Hrs (Fig.5 E). These results indicated that the ITAM region, in particular, the amino acid position between Glu356 and Leu370, of STAM includes the association site for Hrs. The SH3 domain of STAM is not involved in the association with Hrs. Hrs-2, a rat homolog of Hrs, was recently reported to include two putative coiled-coil sequences in the amino acid position between Gln450 and Asp477, and between Met515 and Arg544 (17Bean A.J. Seifert R. Chen Y.A. Sacks R. Scheller R.H. Nature. 1997; 385: 826-829Crossref PubMed Scopus (113) Google Scholar), which correspond to the STAM-binding site of Hrs. The amino acid sequence of Hrs was hence searched for a coiled-coil sequence with COILS 2.1 program (31Lupas A. Dyke M.V. Stock J. Science. 1991; 252: 1162-1164Crossref PubMed Scopus (3483) Google Scholar). A highly conserved coiled-coil sequence (p = 0.99) was detected at the amino acid position between Leu470 and Arg497 of Hrs (Fig.6 A). Although rat Hrs-2 contained two putative coiled-coil sequences, not only human Hrs but also mouse Hrs contained only one putative coiled-coil sequence. The coiled-coil sequence of Hrs was deleted in Hrs-dM mutant, which lost STAM binding activity. The amino acid sequence of STAM was also searched for a coiled-coil sequence in a similar manner. STAM also contained a putative coiled-coil sequence (p = 0.96) at the amino acid position between Ile350 and Glu377 (Fig. 6 B). Most of the coiled-coil sequence of STAM was included in the ITAM region at the amino acid position between Ser355 and Gln388, of which the deletion mutant, DIT, lacked Hrs binding activity. DY2 mutant of STAM carrying a weak Hrs binding activity is deleted of a C-terminal half from Tyr371, including a small region consisting of 7 amino acid residues (from Tyr371 to Glu377) of the total 28 amino acid residues of the coiled-coil sequence of STAM. These results suggest a possible involvement of the coiled-coil structures of Hrs and STAM in their association. Since STAM is involved in signaling for DNA synthesis mediated by IL-2 and GM-CSF, we investigated the effect of Hrs on DNA synthesis mediated by IL-2 and GM-CSF. BAF-B03 cells without starvation for IL-3 and serum were transiently transfected with the wild-type Hrs or Hrs-dM mutant, together with human IL-2 receptor β and γc genes or human GM-CSF receptor α and βc genes. They were then stimulated with human IL-2 or GM-CSF, respectively, and assayed for [3H]thymidine incorporation. Transfection with the wild-type Hrs resulted in 76% and 73% inhibition of [3H]thymidine incorporation induced by IL-2 and GM-CSF, respectively, in comparison with the control, whereas Hrs-dM mutant, which has no binding site for STAM, induced little if any inhibition of [3H]thymidine incorporation upon stimulation with IL-2 and GM-CSF (Fig. 7, A and B). The suppression of [3H]thymidine uptake mediated by IL-2 and GM-CSF was dose-dependent on the wild-type Hrs plasmids (Fig. 7, C and D). These results suggest that Hrs has the ability to inhibit signaling for DNA synthesis mediated by IL-2 and GM-CSF, and that Hrs-STAM association is a prerequisite for such activity. Mouse Hrs was molecularly identified as a phosphotyrosine protein induced by stimulation with HGF, EGF, and PDGF, but its biological significance has not yet been elucidated (16Komada M. Kitamura N. Mol. Cell. Biol. 1995; 15: 6213-6221Crossref PubMed Scopus (145) Google Scholar). We here demonstrated that human Hrs is implicated in regulation of intracellular signal transduction mediated by cytokines through interaction with STAM, which we have already shown to be associated with Jak3 and Jak2 tyrosine kinases, and involved in signaling for cell growth and c-mycinduction mediated by IL-2 and GM-CSF (15Takeshita T. Arita T. Asao H. Tanaka N. Higuchi M. Kuroda H. Kaneko K. Munakata H. Endo Y. Fujita T. Sugamura K. Biochem. Biophys. Res. Commun. 1996; 225: 1035-1039Crossref PubMed Scopus (69) Google Scholar, 18Takeshita T. Arita T. Higuchi M. Asao H. Endo K. Kuroda H. Tanaka N. Murata K. Ishii N. Sugamura K. Immunity. 1997; 6: 449-457Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Human Hrs was shown to have structural characteristics similar to mouse Hrs, such as a double zinc-finger motif, a proline-rich region, and a proline- and glutamine-rich region, and found to be rapidly tyrosine-phosphorylated upon stimulation with cytokines such as IL-2 and GM-CSF with similar kinetics to stimulation with HGF (16Komada M. Kitamura N. Mol. Cell. Biol. 1995; 15: 6213-6221Crossref PubMed Scopus (145) Google Scholar). These observations suggest that Hrs is possibly involved in signaling induced by a wide variety of cytokines and growth factors, which well correlates with its ubiquitous expression among various human tissues and cell types. Although receptors for HGF, EGF, and PDGF carry tyrosine kinases in themselves (32Ullrich A. Schlessinger J. Cell. 1990; 61: 203-212Abstract Full Text PDF PubMed Scopus (4619) Google Scholar), and receptors for IL-2 and GM-CSF are associated with non-receptor type tyrosine kinases such as the Jak family and Src family (1Taniguchi T. Science. 1995; 268: 251-255Crossref PubMed Scopus (676) Google Scholar), tyrosine kinase(s) catalyzing Hrs phosphorylation has not yet been detected. Since STAM directly associates with Jak3 and Jak2 (18Takeshita T. Arita T. Higuchi M. Asao H. Endo K. Kuroda H. Tanaka N. Murata K. Ishii N. Sugamura K. Immunity. 1997; 6: 449-457Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar), it is possible that Hrs is phosphorylated by Jak3 and Jak2 upon stimulation with IL-2 and GM-CSF, respectively. Hrs was revealed to bind to STAM, suggesting a possible biological significance of Hrs in cytokine-mediated signal transduction. The association between Hrs and STAM exists in cells even before ligand stimulation, because IL-2 stimulation did not affect their coimmunoprecipitation. The STAM-association site of Hrs was identified to locate in the portion between Gln452 and Leu570, which includes a highly conserved coiled-coil sequence. Furthermore, using DIT mutant STAM deleted of the ITAM region, the Hrs-binding site of STAM was determined to locate in the ITAM region, which also contains most of a highly conserved coiled-coil sequence. These results suggest the possibility that Hrs forms a complex with STAM through interaction between their coiled-coil structures. The weaker association of DY2 mutant STAM with Hrs than the wild-type STAM may be explained by deletion of a small part (seven amino acids) of the coiled-coil sequence of STAM. So far, the ITAM region of STAM is also known to be involved in association with Jak3 and Jak2 (18Takeshita T. Arita T. Higuchi M. Asao H. Endo K. Kuroda H. Tanaka N. Murata K. Ishii N. Sugamura K. Immunity. 1997; 6: 449-457Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). However, DY2 mutant STAM, retaining Hrs binding activity, completely lost the ability for association with the Jaks. Furthermore, the Jaks do not contain any highly conserved coiled-coil sequence (data not shown). These observations suggest that the Hrs-binding site of STAM does not completely overlap the Jak-binding site of STAM, and the coiled-coil sequence of the ITAM region may not be involved in the interaction with the Jaks. It has been demonstrated that native intrinsic STAM is involved in signaling for DNA synthesis mediated by IL-2 and GM-CSF, since the STAM mutant deleted of the SH3 domain functions as a dominant negative effect on such signal transduction (18Takeshita T. Arita T. Higuchi M. Asao H. Endo K. Kuroda H. Tanaka N. Murata K. Ishii N. Sugamura K. Immunity. 1997; 6: 449-457Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). In the present study, exogenous introduction of Hrs associated with STAM induced suppression of DNA synthesis mediated by IL-2 and GM-CSF. Hrs-dM mutant lacking the STAM-binding site, however, restored DNA synthesis mediated by the cytokines, suggesting that the interaction of Hrs with STAM may result in negative regulation of DNA synthesis induced by the cytokines. These observations further suggest that STAM is associated with signaling molecules, which either positively or negatively regulate DNA synthesis mediated by IL-2 and GM-CSF. Hrs is thought to be a signaling molecule negatively regulating DNA synthesis mediated by the cytokines. In contrast, molecule(s) associated with the SH3 domain of STAM may contribute to the positive effect, because the SH3 domain of STAM is essentially involved in signaling for DNA synthesis mediated by IL-2 and GM-CSF (18Takeshita T. Arita T. Higuchi M. Asao H. Endo K. Kuroda H. Tanaka N. Murata K. Ishii N. Sugamura K. Immunity. 1997; 6: 449-457Abstract Full Text Full Text PDF PubMed Scopus (130) Google Scholar). Since stimulation of cells with IL-2 and GM-CSF induced DNA synthesis even in cells expressing endogenous Hrs, the negative effect of Hrs on DNA synthesis may not be dominant in signaling pathways from the cytokine receptors. It is also interesting to examine whether Hrs affects the signaling for c-mycinduction, where STAM is implicated. Such study to define the functional significance of Hrs in intracellular signal transduction is currently in progress. Together with the evidence for the physical association between Hrs and STAM, the apparent effects of exogenous Hrs on DNA synthesis mediated by the cytokines suggest the implication of endogenous Hrs in the cytokine-mediated signaling pathways. Very recently, an Hrs-homologous rat protein, Hrs-2, has been molecularly cloned and demonstrated to have NTPase activity with four nucleotide-binding sites in itself (17Bean A.J. Seifert R. Chen Y.A. Sacks R. Scheller R.H. Nature. 1997; 385: 826-829Crossref PubMed Scopus (113) Google Scholar). NTPase activity of Hrs remains to be tested. However, since Hrs was also shown to have three nucleotide-binding sites, it is also predicted to have NTPase activity. Little is known about any relationship between molecules carrying NTPase activity and regulation of signaling for gene expression and DNA synthesis. Hrs-2 was shown to bind to SNAP-25, which is considered to modulate vesicular transport, and in fact, recombinant Hrs-2 inhibited calcium-triggered noradrenaline release from PC12 cells (17Bean A.J. Seifert R. Chen Y.A. Sacks R. Scheller R.H. Nature. 1997; 385: 826-829Crossref PubMed Scopus (113) Google Scholar). Interaction, however, between Hrs and SNAP-25 is still unknown, but since expression of SNAP-25 is specific for nerve tissues (33Oyler G.A. Higgins G.A. Hart R.A. Battenberg E. Billingsley M. Bloom F.E. Wilson M.C. J. Cell Biol. 1989; 109: 3039-3052Crossref PubMed Scopus (690) Google Scholar), SNAP-25 may not be implicated in the Hrs-induced regulation of signaling for DNA synthesis mediated by the cytokines. Moreover, it is still obscure the exact relationship between genes coding for Hrs and Hrs-2, because a single mRNA band but not two distinct mRNA bands was detected in all the tissues and cell types tested with Hrs probes, which are highly homologous to Hrs-2. Hrs together with STAM, both of which are tyrosine-phosphorylated upon stimulation with a variety of cytokines and growth factors, may contribute to the general understanding of signal-transducing pathways from receptors for such ligands. We thank Dr. S. Watanabe for providing pKU2-Hyg plasmids and Dr. S. Moffatt for critically reading the manuscript.

Innate immunity relies critically upon the ability of a few pattern recognition molecules to sense molecular markers on pathogens, but little is known about these interactions at the atomic level. Human L- and H-ficolins are soluble oligomeric defence proteins with lectin-like activity, assembled from collagen fibers prolonged by fibrinogen-like recognition domains. The X-ray structures of their trimeric recognition domains, alone and in complex with various ligands, have been solved to resolutions up to 1.95 and 1.7 A, respectively. Both domains have three-lobed structures with clefts separating the distal parts of the protomers. Ca(2+) ions are found at sites homologous to those described for tachylectin 5A (TL5A), an invertebrate lectin. Outer binding sites (S1) homologous to the GlcNAc-binding pocket of TL5A are present in the ficolins but show different structures and specificities. In L-ficolin, three additional binding sites (S2-S4) surround the cleft. Together, they define an unpredicted continuous recognition surface able to sense various acetylated and neutral carbohydrate markers in the context of extended polysaccharides such as 1,3-beta-D-glucan, as found on microbial or apoptotic surfaces.

Mannose-binding protein (MBP) plays an important role in host defense by recognizing sugar residues on certain pathogens and activating the complement cascade. Recently, we described a new protease, designated MBP-associated serine protease (MASP) which is required for complement activation by MBP. We have cloned the cDNA that encodes this protease and found that the deduced amino acid sequence contains an epidermal growth factor-like domain, two short consensus repeats and a serine protease domain. The overall structure of MASP is similar to serine proteases of the first complement component complex, C1r-C1s. Unlike C1r-C1s, however, MASP has a histidine loop structure common to many serine proteases such as trypsin and chymotrypsin. The MASP gene was mapped on the long arm of chromosome 3 which is different from C1r-C1s as well as from trypsin and chymotrypsin. These findings suggest that MASP may have emerged prior to C1r-C1s from a common ancestor. This implies that MBP-MASP, a complex of lectin and serine protease, presumably evolved prior to adaptive immune recognition involving antibody and the classical complement pathway.

Neural crest is induced at the junction of epidermal ectoderm and neural plate by the mutual interaction of these tissues. In previous studies, BMP4 has been shown to pattern the ectodermal tissues, and BMP4 can induce neural crest cells from the neural plate. In this study, we show that epidermally expressed Delta1, which encodes a Notch ligand, is required for the activation and/or maintenance of Bmp4 expression in this tissue, and is thus indirectly required for neural crest induction by BMP4 at the epidermis-neural plate boundary. Notch activation in the epidermis additionally inhibits neural crest formation in this tissue, so that neural crest generation by BMP4 is restricted to the junction.

The complement system plays an important role in innate immunity. In the lectin complement pathway, mannose-binding lectin (MBL) and ficolins act as recognition molecules, and MBL-associated serine protease (MASP) is a key enzyme. It has been suggested that MASP-2 is responsible for the activation of C4. Other serine proteases (MASP-1 and MASP-3) are also associated with MBL or ficolins; however, their functions are still controversial. In this study, a MASP-1- and MASP-3-deficient mouse model (MASP1/3(-/-)) was generated by a gene targeting strategy to investigate the roles of MASP-1 and MASP-3 in the lectin pathway. Serum derived from MASP1/3(-/-) mice showed significantly lower activity of both C4 and C3 deposition on mannan-agarose, and this low activity was restored by the addition of recombinant MASP-1. MASP-1/3-deficient serum showed a significant delay for activation of MASP-2 compared with normal serum. Reconstitution of recombinant MASP-1 in MASP-1/3-deficient serum was able to promote the activation of MASP-2. From these results, we propose that MASP-1 contributes to the activation of the lectin pathway, probably through the activation of MASP-2.

The complement system is an essential component of innate immunity, participating in the pathogenesis of inflammatory diseases and in host defense. In the lectin complement pathway, mannose-binding lectin (MBL) and ficolins act as recognition molecules, and MBL-associated serine protease (MASP) is a key enzyme; MASP-2 is responsible for the lectin pathway activation. The function of other serine proteases (MASP-1 and MASP-3) is still obscure. In this study, we generated a MASP-1– and MASP-3–deficient mouse model (Masp1/3−/−) and found that no activation of the alternative pathway was observed in Masp1/3−/− serum. Mass spectrometric analysis revealed that circulating complement factor D (Df) in Masp1/3−/− mice is a zymogen (pro-Df) with the activation peptide QPRGR at its N terminus. These results suggested that Masp1/3−/− mice failed to convert pro-Df to its active form, whereas it was generally accepted that the activation peptide of pro-Df is removed during its secretion and factor D constitutively exists in an active form in the circulation. Furthermore, recombinant MASP-1 converted pro-Df to the active form in vitro, although the activation mechanism of pro-Df by MASP-1 is still unclear. Thus, it is clear that MASP-1 is an essential protease of both the lectin and alternative complement pathways.

The complement system plays a key role in host defense against pneumococcal infection. Three different pathways, the classical, alternative and lectin pathways, mediate complement activation. While there is limited information available on the roles of the classical and the alternative activation pathways of complement in fighting streptococcal infection, little is known about the role of the lectin pathway, mainly due to the lack of appropriate experimental models of lectin pathway deficiency. We have recently established a mouse strain deficient of the lectin pathway effector enzyme mannan-binding lectin associated serine protease-2 (MASP-2) and shown that this mouse strain is unable to form the lectin pathway specific C3 and C5 convertases. Here we report that MASP-2 deficient mice (which can still activate complement via the classical pathway and the alternative pathway) are highly susceptible to pneumococcal infection and fail to opsonize Streptococcus pneumoniae in the none-immune host. This defect in complement opsonisation severely compromises pathogen clearance in the lectin pathway deficient host. Using sera from mice and humans with defined complement deficiencies, we demonstrate that mouse ficolin A, human L-ficolin, and collectin 11 in both species, but not mannan-binding lectin (MBL), are the pattern recognition molecules that drive lectin pathway activation on the surface of S. pneumoniae. We further show that pneumococcal opsonisation via the lectin pathway can proceed in the absence of C4. This study corroborates the essential function of MASP-2 in the lectin pathway and highlights the importance of MBL-independent lectin pathway activation in the host defense against pneumococci.

Congenital isolated thyroid-stimulating hormone (TSH) deficiency is an autosomal recessive disease that manifests as hypothyroidism (cretinism), causing severe mental and growth retardations. Patients were found to have a single base substitution in the codon for the 29th amino acid of the TSH beta subunit gene. The alteration is in the center of the so-called CAGYC region, which consists of an amino acid sequence conserved among all of the known glycoprotein hormone beta subunits. No other nucleotide substitutions have been found in the gene thus far sequenced. Microinjection of the mutated beta mRNAs into Xenopus laevis oocytes led to the formation of conformationally altered beta polypeptides that could not associate with alpha subunits. The mutation created a new recognition site for the enzyme MaeI. Southern blot hybridization of genomic DNA digested with MaeI showed that the patients were homozygous and their parents were heterozygous for the mutation. This test was also used to examine other family members for the disease.

Recurrence of glioma frequently occurs within the marginal area of the surgical cavity due to invading residual cells. 5-Aminolevulinic acid (5-ALA) fluorescence-guided resection has been used as effective therapeutic modalities to improve discrimination of brain tumour margins and patient prognosis. However, the marginal areas of glioma usually show vague fluorescence, which makes tumour identification difficult, and the applicability of 5-ALA-based photodynamic therapy (PDT) is hampered by insufficient therapeutic efficacy in glioma tissues.To overcome these issues, we assessed the expression of ferrochelatase (FECH) gene, which encodes a key enzyme that catalyses the conversion of protoporphyrin IX (PpIX) to heme, in glioma surgical specimens and manipulated FECH in human glioma cell lines.Prominent downregulation of FECH mRNA expression was found in glioblastoma tissues compared with normal brain tissues, suggesting that FECH is responsible for PpIX accumulation in glioblastoma cells. Depletion of FECH by small interference RNA enhanced PpIX fluorescence after exposure to 5-ALA concomitant with increased intracellular PpIX accumulation in glioma cells. Silencing of FECH caused marked growth inhibition and apoptosis induction by PDT in glioma cells.These results suggest that knockdown of FECH is a potential approach to enhance PpIX fluorescent quality for optimising the subjective discrimination of vague fluorescence and improving the effect of 5-ALA-PDT.

Somatic mutation of PIGA in hematopoietic stem cells causes deficiency of glycosyl phosphatidylinositol–anchored proteins in paroxysmal nocturnal hemoglobinuria (PNH) that underlies the intravascular hemolysis but does not account for expansion of the PNH clone. Immune mechanisms may mediate clonal selection but appear insufficient to account for the clonal dominance necessary for PNH to become clinically apparent. Herein, we report 2 patients with PNH whose PIGA-mutant cells had a concurrent, acquired rearrangement of chromosome 12. In both cases, der(12) had a break within the 3′ untranslated region of HMGA2, the architectural transcription factor gene deregulated in many benign mesenchymal tumors, that caused ectopic expression of HMGA2 in the bone marrow. These observations suggest that aberrant HMGA2 expression, in concert with mutant PIGA, accounts for clonal hematopoiesis in these 2 patients and suggest the concept of PNH as a benign tumor of the bone marrow.

Ficolins are a family of oligomeric proteins consisting of an N-terminal collagen-like domain and a C-terminal globular fibrinogen-like domain. They are novel lectins that employ the fibrinogen-like domain as a functional domain. Ficolins specifically recognize N-acetyl compounds such as N-acetylglucosamine, components of bacterial and fungal cell walls, and certain bacteria. Like mannose-binding lectin (MBL), ficolins circulate in complexes with MBL-associated serine proteases (MASPs). MASP complexes form with ficolins and MBL, thereby activating the complement through the lectin pathway. Upon binding of ficolins and MBL to carbohydrates on pathogens, MASPs convert to active forms, and subsequently activate the complement. The activated complements lead to pathogen phagocytosis, aggregation and lysis. In humans, three ficolins (L-, M- and H-ficolins) have been identified, which exhibit differences in tissue expression, protein location site, ligand-binding and bacteria-recognition, suggesting a specific role of each ficolin. In addition, these ficolins form complexes with three MASPs (MASP-1, MASP-2 and MASP-3) and two nonenzymatic proteins (sMAP and MAP-1), suggesting a highly sophisticated organization and regulated activation of the ficolin-dependent lectin pathway. This review provides an overview of our current knowledge of ficolins, especially human ficolins and their mouse homologues. We also discuss their possible physiological roles in innate immunity, especially their defensive role against bacterial infection.

Mannose-binding lectin (MBL)-associated serine proteases (MASPs) are responsible for activation of the lectin complement pathway. Three types of MASPs (MASP-1, MASP-2, and MASP-3) are complexed with MBL and ficolins in serum. Although MASP-1 and MASP-2 are known to contribute to complement activation, the function of MASP-3 remains unclear. In this study, we investigated the mechanism of MASP-3 activation and its substrate using the recombinant mouse MASP-3 (rMASP-3) and several different types of MASP-deficient mice. A proenzyme rMASP-3 was obtained that was not autoactivated during preparation. The recombinant enzyme was activated by incubation with Staphylococcus aureus in the presence of MBL-A, but not MBL-C. In vivo studies revealed the phagocytic activities of MASP-1/3-deficient mice and all MASPs (MASP-1/2/3)-deficient mice against S. aureus and bacterial clearance in these mice were lower than those in wild-type and MASP-2-deficient mice. Sera from all MASPs-deficient mice showed significantly lower C3 deposition activity on the bacteria compared with that of wild-type serum, and addition of rMASP-3 to the deficient serum restored C3 deposition. The low C3 deposition in sera from all MASPs-deficient mice was probably caused by the low level factor B activation that was ameliorated by the addition of rMASP-3. Furthermore, rMASP-3 directly activated factors B and D in vitro. These results suggested that MASP-3 complexed with MBL is converted to an active form by incubation with bacterial targets, and that activated MASP-3 triggered the initial activation step of the alternative complement pathway.

The endowment effect—the tendency for owners (potential sellers) to value objects more than potential buyers do—is among the most widely studied judgment and decision-making phenomena. However, the current research is the first to explore whether the effect varies across cultures. Given previously demonstrated cultural differences in self-construals and self-enhancement, we predicted a smaller endowment effect for East Asians compared with Westerners. Two studies involving buyers and sellers of a coffee mug (Study 1a) and a box of chocolates (Study 1b) supported this prediction. Study 2 conceptually replicated this cultural difference by experimentally manipulating independent and interdependent self-construals. Finally, Study 3 provided evidence for an underlying self-enhancement mechanism: Cultural differences emerged when self-object associations were made salient, but disappeared when self-object associations were minimized. Thus, the endowment effect may be influenced by the degree to which independence and self-enhancement (vs. interdependence and self-criticism) are culturally valued or normative.

We have observed a deeply bound state of the |$\Xi ^{-}$|–|${}^{14}{\rm N}$| system that decayed into twin single-hypernuclei in nuclear emulsion exposed in the E373 experiment at KEK-PS. The process is uniquely identified as |$\Xi ^{-} + {}^{14}{\rm N} \rightarrow {{}^{10}_{\Lambda }{\rm Be}} + {{}^{5}_{\Lambda }{\rm He}}$|⁠. We have measured the binding energy of the |$\Xi ^{-}$|–|${}^{14}{\rm N}$| system, |$B_{\Xi ^{-}}$|⁠, to be |$4.38 \pm 0.25$|MeV, which is significantly larger than that of the |$\Xi ^{-}$|–|${}^{14}{\rm N}$| 3|$D$| atomic state (0.17 MeV), if both single-hypernuclei are emitted in the ground state from at-rest capture of a |$\Xi ^{-}$| hyperon. If the |${{}^{10}_{\Lambda }{\rm Be}}$| nucleus is produced in an excited state, the |$B_{\Xi ^{-}}$| value mentioned above decreases by the excitation energy. Model calculations based on known values for |${{}^{9}{\rm Be}}$| excited states have predicted two excited states in the bound region. Even in the case of |${{}^{10}_{\Lambda }{\rm Be}}$| production in the highest excited state, the |$B_{\Xi ^{-}}$| value is far from the 3|$D$| atomic level of the |$\Xi ^{-}$|–|${}^{14}{\rm N}$| system by more than 3.7 standard deviations. The event provides the first clear evidence of a deeply bound state of the |$\Xi ^{-}$|–|${}^{14}{\rm N}$| system by an attractive |$\Xi$|N interaction.

Abstract Dysregulation of autophagy has been implicated in various cardiovascular diseases. Trastuzumab, a humanized monoclonal antibody, binds to HER2 domain IV and is approved for the treatment of HER2-positive breast cancer. Trastuzumab therapy is associated with considerable cardiotoxicity, the mechanism of which remains unclear. HER2 signaling plays a pivotal role in cardiomyocyte development and survival and is essential for the prevention of cardiomyopathy. However, a direct link has not been confirmed between trastuzumab-induced cardiomyopathy and impaired HER2 signaling. Our data reveal a novel mechanism by which trastuzumab dysregulates HER2 signaling and impairs basal autophagic process in human primary cardiomyocytes. Specifically, trastuzumab treatment leads to the phosphorylation of HER1-Y845 and HER2-Y1248 and the activation of Erk. This in turn results in upregulation of mTOR signaling pathway and subsequently inhibition of autophagy in primary cardiomyocytes and C57BL/6 mice. Trastuzumab-induced downregulation of autophagy is further supported by the fact that trastuzumab treatment reduces protein levels of autophagosome-associated signaling molecules such as Atg 5-12, Atg 7, Atg 14, and Beclin 1. We further demonstrated that trastuzumab-mediated inhibition of autophagy resulted in the increased production of reactive oxygen species (ROS) in cardiomyocytes. Pertuzumab, another anti-HER2 therapeutic mAb binding to HER2 domain II, fails to modulate HER2 signaling and is unable to inhibit autophagy and to increase ROS production in cardiomyocytes. This study provides novel mechanistic insights into trastuzumab-induced cardiotoxicity, which may assist in formulating novel approaches for clinical management of trastuzumab-induced cardiomyopathy. Mol Cancer Ther; 15(6); 1321–31. ©2016 AACR.

Recently, 5-aminolevulinic acid-based photodynamic therapy (ALA-PDT) is being widely used in cancer therapy owing to the tumor-specific accumulation of photosensitizing protoporphyrin IX (PpIX) after the administration of ALA. In the present study, by focusing on genes involved in the porphyrin biosynthesis pathway, we aimed to explore biomarkers that are predictive for the efficacy of ALA-PDT. We used five lines of human gastric cancer cells to measure the ALA-based photocytotoxicity. ALA-induced production of PpIX in cancer cells was quantified by fluorescence spectrophotometry. To examine the potential involvement of PEPT1 and ABCG2 in the ALA-PDT sensitivity, stable cell lines overexpressing PEPT1 were established and ABCG2-specific siRNA used. We observed that three cell lines were photosensitive, whereas the other two cell lines were resistant to ALA-based photocytotoxicity. The ALA-based photocytotoxicity was found to be well correlated with intracellular PpIX levels, which suggests that certain enzymes and/or transporters involved in ALA-induced PpIX production are critical determinants. We found that high expression of the peptide transporter PEPT1 (ALA influx transporter) and low expression of the ATP-binding cassette transporter ABCG2 (porphyrin efflux transporter) determined ALA-induced PpIX production and cellular photosensitivity in vitro. PEPT1 and ABCG2 are key players in regulating intracellular PpIX levels and determining the efficacy of ALA-based photocytotoxicity against gastric cancer cells in vitro. Evaluation of the expression levels of PEPT1 and ABCG2 genes could be useful to predict the efficacy of ALA-PDT. Primers specific to those target genes are practical and useful biomarkers for predicting the photo-sensitivity to ALA-PDT.

Abstract Background The occurrence of bile duct injury (BDI) during laparoscopic cholecystectomy (LC) is an important medical issue. Expert surgeons prevent intraoperative BDI by identifying four landmarks. The present study aimed to develop a system that outlines these landmarks on endoscopic images in real time. Methods An intraoperative landmark indication system was constructed using YOLOv3, which is an algorithm for object detection based on deep learning. The training datasets comprised approximately 2000 endoscopic images of the region of Calot's triangle in the gallbladder neck obtained from 76 videos of LC. The YOLOv3 learning model with the training datasets was applied to 23 videos of LC that were not used in training, to evaluate the estimation accuracy of the system to identify four landmarks: the cystic duct, common bile duct, lower edge of the left medial liver segment, and Rouviere’s sulcus. Additionally, we constructed a prototype and used it in a verification experiment in an operation for a patient with cholelithiasis. Results The YOLOv3 learning model was quantitatively and subjectively evaluated in this study. The average precision values for each landmark were as follows: common bile duct: 0.320, cystic duct: 0.074, lower edge of the left medial liver segment: 0.314, and Rouviere’s sulcus: 0.101. The two expert surgeons involved in the annotation confirmed consensus regarding valid indications for each landmark in 22 of the 23 LC videos. In the verification experiment, the use of the intraoperative landmark indication system made the surgical team more aware of the landmarks. Conclusions Intraoperative landmark indication successfully identified four landmarks during LC, which may help to reduce the incidence of BDI, and thus, increase the safety of LC. The novel system proposed in the present study may prevent BDI during LC in clinical practice.

In an emulsion-counter hybrid experiment performed at J-PARC, a Ξ− absorption event was observed which decayed into twin single-Λ hypernuclei. Kinematic calculations enabled a unique identification of the reaction process as Ξ−+14N→10ΛBe+5ΛHe. For the binding energy of the Ξ− hyperon in the Ξ−−14N system a value of 1.27±0.21 MeV was deduced. The energy level of Ξ− is likely a nuclear 1p state which indicates a weak ΞN–ΛΛ coupling.Received 28 October 2020Revised 19 November 2020Accepted 23 December 2020DOI:https://doi.org/10.1103/PhysRevLett.126.062501© 2021 American Physical SocietyPhysics Subject Headings (PhySH)Research AreasHypernuclei & mesic nucleiNuclear Physics

Neogenesis of lymphatic vessel and lymphatic invasion is frequently found in the stroma of cancers, but the mechanisms of this phenomenon remain unclear. Vascular endothelial growth factor C (VEGF-C) is known to be the only growth factor for the lymphatic vascular system, and its receptor has been identified as Flt4. To clarify the mechanism of lymphatic invasion in cancer, we studied the expression of VEGF-C and flt4 genes in gastric cancer tissues. VEGF-C mRNA was mainly expressed in primary tumors (15 of 32; 47%), but the frequency of VEGF-C mRNA expression was low in normal mucosa (4 of 32; 13%). In primary tumors, there was a significant relationship between VEGF-C and flt4 mRNA expression. In contrast, Flt4 was mainly expressed on the lymphatic endothelial cells but not in cancer cells. A strong correlation was found between VEGF-C expression and lymph node status, lymphatic invasion, venous invasion, and tumor infiltrating patterns. Cancer cells in the lymphatic vessels frequently showed intracytoplasmic VEGF-C immunoreactivity. Furthermore, there was a close correlation between VEGF-C tissue status and the grade of lymph node metastasis. Patients with high expression of VEGF-C protein had a significantly poorer prognosis than did those in low VEGF-C expression group. By the Cox regression model, depth of wall invasion, lymph node metastasis, and VEGF-C tissue status emerged as independent prognostic parameters, and the VEGF-C tissue status was ranked third as an independent risk factor for death. These results strongly suggest that cancer cells producing VEGF-C may induce the proliferation and dilation of lymphatic vessels, resulting in the development of invasion of cancer cells into the lymphatic vessel and lymph node metastasis.

Mannose-binding lectin-associated serine protease (MASP) is a newly identified member of the serine protease superfamily. MASP is involved in host defense against pathogens through a novel system of complement activation, designated the lectin pathway. To elucidate the origin of the lectin pathway and the molecular evolution of MASP, we cloned six MASP cDNAs from five vertebrate species going from mammal to cyclostome. An alignment of the amino acid sequences deduced from the cDNAs revealed the presence of two different lineages of the MASP gene. This classification was supported by the precise correlation with two types of exon organization for the protease domain. One of the two lineages is unique in that a single exon encodes the protease domain, unlike most other serine proteases. All members of this group, termed the AGY type, have an AGY codon at the active site serine. A phylogenetic tree suggests that the AGY type diverged from another lineage, termed the TCN type, before the emergence of primitive vertebrates. Furthermore, the presence of MASP or MASP-like sequences in most vertebrate species suggests that the lectin pathway functions extensively in vertebrates and that its origin is traced back to the invertebrate stage.

We previously cloned a novel human lectin, designated P35, with both collagen-like and fibrinogen-like domains. P35 recognizes GlcNAc residues and is opsonic toward microorganisms. The overall structure of P35 closely resembles those of two pig ficolins that are putative TGF-beta 1-binding proteins. In this study, we analyzed the exon-intron structure and chromosomal location of the P35 gene as well as its structural relationship to splicing variants. In addition, we isolated another distinct genomic clone corresponding to the upstream region of a P35-related gene that has an exon organization closely resembling that of the P35 gene. The sequences of exons in the P35-related gene were identical to the cDNA sequence reported for "human ficolin." Northern blotting revealed that the P35 gene is expressed mainly in liver, whereas the P35-related gene is expressed in lung and peripheral blood leukocytes, demonstrating tissue-specific expression of these two genes. Both genes were assigned to a closely related region of chromosome 9 at 9q34.

The lectin complement pathway in innate immunity is closely related to the classical complement pathway in adaptive immunity, with respect to the structures and functions of their components. Both pathways are initiated by complexes consisting of collagenous proteins and serine proteases of the mannose-binding lectin (MBL)-associated serine protease (MASP)/C1r/C1s family. It has been speculated that the classical pathway emerged after the lectin pathway, and that the activation mechanism of the latter was partially conserved. The classical and lectin pathways can be traced back to at least cartilaginous fish and ascidian (urochordata), respectively. To elucidate the evolution of the complement system, we isolated and characterized a GlcNAc-binding lectin from sera of lamprey (agnathans), the most primitive vertebrate that lacks the classical pathway. Lamprey GlcNAc-binding lectin was an oligomer consisting of 24-kDa subunits. cDNA and phylogenetic analyses revealed that the lamprey GlcNAc-binding lectin is an orthologue of mammalian C1q, a collagenous subcomponent of the first component involved in binding to immunoglobulins in the classical pathway. Lamprey C1q copurified with MASP-A, a serine protease of the MASP/C1r/C1s family, which exhibited proteolytic activity against lamprey C3. Surface plasmon resonance analysis showed that lamprey C1q specifically bound to GlcNAc, but not various other carbohydrates tested. These results suggest that C1q may have emerged as a lectin and may have functioned as an initial recognition molecule of the complement system in innate immunity before the establishment of adaptive immunity such as immunoglobulins in the cartilaginous fish.

Living organisms have strong defense mechanisms against invading microorganisms as survival strategies. One of the defense mechanisms is the complement system, composed of more than 30 serum and cell surface components. This system collaborates in recognition and elimination of pathogens as a part of both the innate and acquired immune systems. The two collagenous lectins, mannose-binding lectin (MBL) and ficolins, are pattern recognition proteins acting in innate immunity and, upon recognition of the pathogens, they trigger the activation of the lectin complement pathway through attached serine proteases (MASPs). A similar lectin-based complement system, consisting of the lectin-protease complex and C3, is present in ascidians, our closest invertebrate relatives and in lamprey, the most primitive vertebrate. Furthermore, a lamprey N-acetylglucosamine (GlcNAc)-binding lectin was identified as the orthlogue of mammalian C1q, and lamprey MASP is suggested as the prototype of MASP-2/C1r/C1s, indicating that the classical complement pathway arose as a part of the innate immune system. Thus, the complement system is one of the most highly organized innate immune systems in invertebrates and jawless vertebrates, and this system has survived in vertebrates with its core components little changed for 600–700 million years.

Ficolins are animal lectins with collagen-like and fibrinogen-like domains. They are involved in the first line of host defense against pathogens. Human ficolin/P35 as well as mannose-binding lectin (MBL) activates the complement lectin pathway in association with MBL-associated serine proteases. To elucidate the origin and evolution of ficolins, we separated approximately 40 kDa (p40) and approximately 50 kDa (p50) N-acetylglucosamine-binding lectins from hemolymph plasma of the solitary ascidian. Binding assays revealed that p40 recognizes N-acetyl groups in association with a pyranose ring and that p50 recognizes N-acetylglucosamine alone. Based on the amino acid sequences of the proteins, we isolated two clones each of p40 and p50 from the ascidian hepatopancreas cDNA and determined the entire coding sequences of these clones. Because all of the clones contained both collagen-like and fibrinogen-like domains, we concluded that these were homologs of the mammalian ficolin family and designated ascidian ficolins (AsFCNs). The fibrinogen-like domain of the AsFCNs shows 45.4-52.4% amino acid sequence identity with the mammalian ficolin family. A phylogenetic tree of the fibrinogen-like sequences shows that all the fibrinogen-like domains may have evolved from a common ancestor that branched off an authentic fibrinogen. These results suggest that AsFCNs play an important role with respect to ascidian hemolymph lectin activity and the correlation of different functions with binding specificity.

Many eukaryotic cell surface proteins are bound to the membrane via the glycosylphosphatidylinositol (GPI) anchor that is covalently linked to their carboxy-terminus. The GPI anchor precursor is synthesized in the endoplasmic reticulum (ER) and post-translationally linked to protein. We cloned a human gene termed PIG-B (phosphatidylinositol glycan of complementation class B) that is involved in transferring the third mannose. PIG-B encodes a 554 amino acid, ER transmembrane protein with an amino-terminal portion of approximately 60 amino acids on the cytoplasmic side and a large carboxy-terminal portion of 470 amino acids within the ER lumen. A mutant PIG-B lacking the cytoplasmic portion remains active, indicating that the functional site of PIG-B resides on the lumenal side of the ER membrane. The PIG-B gene was localized to chromosome 15 at q21-q22. This autosomal location would explain why PIG-B is not involved in the defective GPI anchor synthesis in paroxysmal nocturnal hemoglobinuria, which is always caused by a somatic mutation of the X-linked PIG-A gene.

Object. The aim of this study was to assess whether aneurysm surgery can be performed in patients with ruptured cerebral aneurysms by using three-dimensional computerized tomography (3D-CT) angiography alone, without conventional catheter angiography. Methods. In a previous study, 60 patients with subarachnoid hemorrhage (SAH) from ruptured aneurysms were prospectively evaluated using both 3D-CT and conventional angiography, which resulted in a 100% accuracy for 3D-CT angiography in the diagnosis of ruptured aneurysms, and a 96% accuracy in the identification of associated unruptured aneurysms. The results led the authors to consider replacing conventional angiography with 3D-CT angiography for use in diagnosing ruptured aneurysms, and to perform surgery aided by 3D-CT angiography alone without conventional angiography. Based on the results, 100 consecutive patients with SAH who had undergone surgery in the acute stage based on 3D-CT angiography findings have been studied since December 1996. One hundred ruptured aneurysms, including 41 associated unruptured lesions, were detected using 3D-CT angiography. In seven of 100 ruptured aneurysms, which included four dissecting vertebral artery aneurysms, two basilar artery (BA) tip aneurysms, and one BA—superior cerebellar artery aneurysm, 3D-CT angiography was followed by conventional angiography to acquire diagnostic confirmation or information about the vein of Labbé, which was needed to guide the surgical approach for BA tip aneurysms. All of the ruptured aneurysms were confirmed at surgery and treated successfully. Ninety-three patients who underwent operation with the aid of 3D-CT angiography only had no complications related to the lack of information gathered by conventional angiography. The 3D-CT angiography studies provided the authors with the aneurysm location as well as surgically important information on the configuration of its sac and neck, the presence of calcification in the aneurysm wall, and its relationship to the adjacent vessels and bone structures. Conclusions The authors believe that 3D-CT angiography can replace conventional angiography in the diagnosis of ruptured aneurysms and that surgery can be performed in almost all acutely ruptured aneurysms by using only 3D-CT angiography without conventional angiography.

Mannose-binding lectin (MBL) is a C-type lectin involved in the first line of host defense against pathogens and it requires MBL-associated serine protease (MASP) for activation of the complement lectin pathway. To elucidate the origin and evolution of MBL, MBL-like lectin was isolated from the plasma of a urochordate, the solitary ascidian Halocynthia roretzi, using affinity chromatography on a yeast mannan-Sepharose. SDS-PAGE of the eluted proteins revealed a major band of approximately 36 kDa (p36). p36 cDNA was cloned from an ascidian hepatopancreas cDNA library. Sequence analysis revealed that the carboxy-terminal half of the ascidian lectin contains a carbohydrate recognition domain (CRD) that is homologous to C-type lectin, but it lacks a collagen-like domain that is present in mammalian MBLs. Purified p36 binds specifically to glucose but not to mannose or N-acetylglucosamine, and it was designated glucose-binding lectin (GBL). The two ascidian MASPs associated with GBL activate ascidian C3, which had been reported to act as an opsonin. The removal of GBL-MASPs complex from ascidian plasma using Ab against GBL inhibits C3-dependent phagocytosis. These observations strongly suggest that GBL acts as a recognition molecule and that the primitive complement system, consisting of the lectin-proteases complex and C3, played a major role in innate immunity before the evolution of an adaptive immune system in vertebrates.

Ficolin is a multimeric protein consisting of an N-terminal collagen-like domain and a C-terminal fibrinogen-like domain. The structure is similar to mannose-binding lectin (MBL) and complement C1q owing to the collagen-like stalk. Accumulating data indicate that a key function of ficolin is to recognize the carbohydrate moieties on pathogens as a pattern-recognition molecule. Two or three kinds of ficolin have been identified in each species of mammals. They are similar but with some differences in the expression site, location site, ligand-binding specificity and ability to form complexes with MBL-associated serine proteases (MASPs). Like MBL, some ficolins are serum lectins and can form a complex with MASPs and small MBL-associated protein (sMAP). This complex activates the complement through "the lectin pathway". Our recent study suggests that ficolin acts through two distinct routes: the lectin pathway and a primitive opsonophagocytosis. All these observations suggest that ficolins function in clearance of non-self, based on their location sites and their molecular features.

STAM containing an SH3 (Src homology 3) domain and an immunoreceptor tyrosine-based activation motif was previously revealed to be implicated in signaling pathways immediately downstream of Jak2 and Jak3 tyrosine kinases associated with cytokine receptors. We molecularly cloned a novel molecule interacting with the SH3 domain of STAM, which was named AMSH (associatedmolecule with the SH3 domain of STAM). AMSH contains a putative bipartite nuclear localization signal and a homologous region of a c-Jun activation domain-binding protein 1 (JAB1) subdomain in addition to a binding site for the SH3 domain of STAM. AMSH mutant deleted of the C-terminal half conferred dominant negative effects on signaling for DNA synthesis and c<i>-myc</i> induction mediated by interleukin 2 and granulocyte macrophage-colony-stimulating factor. These results suggest that AMSH plays a critical role in the cytokine-mediated intracellular signal transduction downstream of the Jak2/Jak3·STAM complex.

The recent identification of two mannose-binding lectin-associated serine protease clones from Halocynthia roretzi, an ascidian, suggested the presence of a complement system in urochordates. To elucidate the structure and function of this possibly primitive complement system, we have isolated cDNA clones for ascidian C3 (AsC3) and purified AsC3 protein from body fluid. The deduced primary structure of AsC3 shows overall similarity to mammalian C3, including a typical thioester site with the His residue required for nucleophilic activation of the thioester. AsC3 has a two-subunit chain structure, and the alpha-chain is cleaved at a specific site near to the N terminus upon activation. Ascidian body fluid contains an opsonic activity which enhances phagocytosis of yeast by ascidian blood cells, and Ab against AsC3 inhibits this opsonic activity. These results indicate that the complement system played a pivotal role in innate immunity by enhancing phagocytosis before the emergence of the vertebrates and well ahead of the establishment of adaptive immunity, which is believed to have occurred at about the time of the appearance of cartilaginous fish.

Expression of Sox2, which encodes an HMG-box-type transcription factor, is down-regulated in the neural plate when neural crest segregates from dorsal neural tube and remains low during crest cell migration. Sox2 expression is subsequently up-regulated in some crest-derived cells in the developing peripheral nervous system and is later restricted to glial sublineages. Misexpression of Sox2 and mutant forms of Sox2 both in neural plate explants and in embryonic ectoderm reveals that Sox2 inhibits neural crest formation as a transcriptional activator. Similar manipulation of Sox2 function in migratory and postmigratory neural crest-derived cells indicates that Sox2 regulates proliferation and differentiation in developing peripheral nervous system. Developmental Dynamics 229:74-86, 2004.

Many membrane proteins are anchored to the cell membrane by glycosylphosphatidylinasitol (GPI). The core structure and biosynthesis of the GPI anchor are well conserved in eukaryote cells. We previously cloned a human PIGA gene that participates in GPI anchor biosynthesis. We have now cloned complementary and genomic DNA of Pig-a, the mirine homologue of PIGA , and compared its function and gene structure with those of PIGA . The deduced amino acid sequence of mouse PIG-A is 88% identical with that of human PIG-A. Transfection of Pig-a DNA complemented the defects of both a PIG-A-deficient murine cell line and a PIG-A-deficient human cell line, demonstrating that functions of mouse and human PIG-A are conserved. Like human PIGA, the chromosomal Pig-a gene has six exons and spans approximately 16 kb. Moreover, Pig-a was mapped to X-F3/4, which is syntenic to human Xp22.1, where PIGA is located. Thus, murine Pig-a provides a good animal model to study paroxysmal nocturnal hemoglobinuria, a disease caused by a somatic mutation of PIGA. Database analysis demonstrated that a yeast gene, SPT14, is homologous to Pig-a and PIGA and that these genes are members of a glycosyltransferase gene family.

This paper investigates the system-level throughput performance of non-orthogonal access with minimum mean squared error-based linear filtering followed by a successive interference canceller (MMSE-SIC) in the cellular uplink. Although non-orthogonal access employing the MMSE-SIC achieves the entire region of the multiuser capacity in a multiple access channel (MAC), which should be beneficial in enhancing the total user throughput and cell-edge user throughput simultaneously compared to orthogonal access, the multiplexing of multiple users within the same frequency block increases the inter-cell interference in the context of the cellular uplink. The aim of the transmission power control method investigated in this paper is to mitigate the inter-cell interference increase due to non-orthogonal user multiplexing. We employ a weighted proportional fair (PF)-based multiuser scheduling scheme to achieve a good tradeoff between the total user throughput and cell-edge user throughput. Simulation results show that non-orthogonal access employing the MMSE-SIC using the proposed transmission power control significantly enhances the system-level throughput performance compared to orthogonal access, which is widely used in 3.9 and 4G mobile communication systems.

Laparoscopic hepatectomy was initially reported in 1992. However, the reported experiences are scarce, and this operation has not been a standard procedure until now. The aims of this study were to assess our results of laparoscopy-assisted left lateral hepatectomy for hepatocellular carcinoma (HCC) and to compare them with those of open conventional procedures.From 1984 to 2002, left lateral hepatectomy for HCC less than 5 cm in diameter was carried out in 21 patients. Ten patients received a laparoscopy-assisted procedure, and remaining 11 patients received an open procedure.There were no significant differences in the operation time, blood loss, resected liver weight, and resection margin between the 2 groups. The total time that analgesics were given, body temperature on postoperative day 1, weight loss on postoperative day 7, and postoperative hospital stay in the laparoscopic group were significantly better than in the conventional group. With regard to the long-term prognosis, there were no differences in patient survival or disease-free survival rates between the 2 groups.Laparoscopy-assisted left lateral hepatectomy for HCC is superior to the conventional open surgery in terms of its short-term results and does not cause the long-term survival to deteriorate. Therefore, laparoscopic hepatectomy may be an alternative choice for treatment of HCC.

A detection method widely used of late in cancer surgery is 5-aminolevulinic acid-based photodynamic diagnosis (ALA-PDD), which relies on the tumor-specific accumulation of photosensitizing protoporphyrin IX (PpIX) after the administration of ALA. In this regard, we recently reported that peptide transporter PEPT1 and human ATP-binding cassette transporter ABCG2 are key players in regulating intracellular PpIX levels. In the present study, we re-evaluated in vivo the expression of genes involved in the porphyrin biosynthesis pathway.Using quantitative real-time (qRT)-PCR, we measured the mRNA levels in a clinical specimen of bladder cancer from a patient who had been subjected to ALA-PDD.We confirmed that PEPT1 and ABCG2 are major contributors to the regulation of tumor-specific PpIX accumulation. qRT-PCR analysis revealed a predominantly high level of PEPT1 mRNA and a very low level of ABCG2 mRNA in the bladder cancer, corresponding to the roles of these genes in vitro. These findings were further confirmed by immunohistochemical studies with PEPT1- and ABCG2-specific antibodies.The induction of PEPT1 gene and the suppression of ABCG2 gene expression are among the key molecular mechanisms underlying tumor-specific PpIX accumulation after the administration of ALA in bladder cancer.

We conducted two studies to explore psychological consequences of a mobile lifestyle. In Study 1, we found that participants who were randomly assigned to think about a mobile lifestyle used more loneliness and sadness-related words and anticipated having fewer friends in the future than those who thought about a stable lifestyle (or a typical day as a control). In Study 2, we replicated this finding with a non-college sample. In addition, we found that those in the mobility condition reported being more motivated to expand their social network. Finally, the effect of mobility on the motivation to expand social networks was mediated by anticipated loneliness and sadness.

Neural crest cells are a transient stem cell-like population appearing during vertebrate embryonic development. Generation of the cranial neural crest is known to require a balanced combination of FGF and BMP levels. However, it is poorly understood how the functions of such growth factors are controlled in the extracellular space. Anosmin is an extracellular matrix protein implicated in FGF signaling and mutated in Kallmann syndrome. Here, we demonstrate that anosmin is synthesized locally in the cranial neural crest of chicken embryos and is essential for cranial neural crest formation. Anosmin upregulates FGF8 and BMP5 gene expression; it also enhances FGF8 activity while inhibiting BMP5 and WNT3a signaling. Taken together, our data establish that the matrix protein anosmin is required for cranial neural crest formation, with functional modulation of FGF, BMP, and WNT.

The major obstacles to treatment of pancreatic cancer are the highly invasive capacity and resistance to chemo- and radiotherapy. Glycogen synthase kinase 3β (GSK3β) regulates multiple cellular pathways and is implicated in various diseases including cancer. Here we investigate a pathological role for GSK3β in the invasive and treatment resistant phenotype of pancreatic cancer.Pancreatic cancer cells were examined for GSK3β expression, phosphorylation and activity using Western blotting and in vitro kinase assay. The effects of GSK3β inhibition on cancer cell survival, proliferation, invasive ability and susceptibility to gemcitabine and radiation were examined following treatment with a pharmacological inhibitor or by RNA interference. Effects of GSK3β inhibition on cancer cell xenografts were also examined.Pancreatic cancer cells showed higher expression and activity of GSK3β than non-neoplastic cells, which were associated with changes in its differential phosphorylation. Inhibition of GSK3β significantly reduced the proliferation and survival of cancer cells, sensitized them to gemcitabine and ionizing radiation, and attenuated their migration and invasion. These effects were associated with decreases in cyclin D1 expression and Rb phosphorylation. Inhibition of GSK3β also altered the subcellular localization of Rac1 and F-actin and the cellular microarchitecture, including lamellipodia. Coincident with these changes were the reduced secretion of matrix metalloproteinase-2 (MMP-2) and decreased phosphorylation of focal adhesion kinase (FAK). The effects of GSK3β inhibition on tumor invasion, susceptibility to gemcitabine, MMP-2 expression and FAK phosphorylation were observed in tumor xenografts.The targeting of GSK3β represents an effective strategy to overcome the dual challenges of invasiveness and treatment resistance in pancreatic cancer.

In the innate immune system, a variety of recognition molecules provide the first-line host defense to prevent infection and maintain endogenous homeostasis. Ficolin is a soluble recognition molecule, which senses pathogen-associated molecular patterns on microbes and aberrant sugar structures on self-cells. It consists of a collagen-like stalk and a globular fibrinogen-like domain, the latter binding to carbohydrates such as N-acetylglucosamine. Ficolins have been widely identified in animals from higher invertebrates to mammals. In mammals, ficolins form complexes with mannose-binding lectin-associated serine proteases (MASPs), and ficolin-MASP complexes trigger complement activation via the lectin pathway. Once activated, complement mediates many immune responses including opsonization, phagocytosis, and cytokine production. Although the precise function of each ficolin is still under investigation, accumulating information suggests that ficolins have a crucial role in host defense by recognizing a variety of microorganisms and interacting with effector proteins.

An artificial receptor for pro MMP ‐9 was created by fusing tissue inhibitor of MMP ‐1 ( TIMP ‐1) with type II transmembrane mosaic serine protease ( MSP ‐T1). Expression of MSP ‐T1 in 293T cells induced binding of pro MMP ‐9, which was processed by MMP ‐2 activated by membrane type 1 MMP ( MT 1‐ MMP ). HT 1080 cells transfected with the MSP ‐T1 gene produced activated MMP ‐9 in collagen gel, and addition of pro MMP ‐2 to the culture augmented it, which resulted in intensive collagen digestion. These cells metastasized into chick embryonic liver more than control cells. Treatment of HT 1080 cells with concanavalin A in the presence of exogenous pro MMP ‐2 induced activation of not only pro MMP ‐2 but also pro MMP ‐9. Knockdown of MT 1‐ MMP or TIMP ‐2 expression with si RNA suppressed activation of both pro MMP ‐2 and pro MMP ‐9. Transfection of TIMP ‐1 si RNA suppressed cell binding and activation of pro MMP ‐9, but not pro MMP ‐2 activation. Knockdown of a disintegrin and metalloproteinase 10 ( ADAM 10) expression reduced cell binding and processing of pro MMP ‐9. These results suggest that pro MMP ‐9, which binds to a receptor complex containing TIMP ‐1 and ADAM 10, is activated by the MT 1‐ MMP / MMP ‐2 axis, and MMP ‐9 thus activated stimulates cellular proteolysis and metastasis.

Background Liquid biopsies enable the detection of circulating tumor DNA (ctDNA). However, the clinical significance of KRAS-mutated ctDNA for pancreatic cancer has been inconsistent with respect to its prognostic and predictive potential. Methods and findings A total of 422 blood samples were collected from 78 patients undergoing treatments for localized and metastatic pancreatic ductal adenocarcinoma. KRAS mutation in tissues and KRAS ctDNA levels in plasma were determined by RASKET and droplet digital polymerase chain reaction. Longitudinal monitoring of KRAS ctDNA was performed to assess its significance for predicting recurrence and prognosis and for evaluating therapeutic responses to chemotherapy compared with carbohydrate antigen 19–9 (CA19-9). In 67 tumor tissues, discrepancies in point mutations of KRAS were rarely observed among individual patients, implying that one targeted point mutation of KRAS can be determined in tumor tissues prior to longitudinal blood monitoring. One-time blood assessment of KRAS-mutated ctDNA before surgery or chemotherapy was not clearly associated with recurrence and prognosis. Sequential blood monitoring was performed in 39 patients who underwent surgery for potentially resectable tumors. Increased CA19-9 levels were significantly associated with recurrence, but not prognosis (P<0.001, P = 1.0, respectively), whereas emergence of KRAS ctDNA was significantly associated with prognosis (P<0.001) regardless of recurrence. Furthermore, in 39 patients who did not undergo surgery, detection of KRAS ctDNA was a predictive factor for prognosis (P = 0.005). Multivariate analysis revealed that detection of KRAS ctDNA was the only independent prognostic factor regardless of tumor resection (hazard ratios = 54.5 for patients who underwent surgery and 10.1 for patients who did not undergo surgery; P<0.001 for both). Patients without emergence of KRAS ctDNA within 1 year after surgery showed significantly better prognosis irrespective of recurrence (P<0.001). No detection or disappearance of KRAS ctDNA within 6 months of treatment was significantly correlated with therapeutic responses to first-line chemotherapy (P<0.001). Changes in KRAS status provided critical information for the prediction of therapeutic responses. Conclusions Our study showed for the first time that detection of KRAS ctDNA levels within a short period enables the prediction of prognosis and therapeutic responses in patients with pancreatic cancer.

Objective To clarify the significance of immunometabolism in systemic lupus erythematosus (SLE), and to determine the effect of calcium/calmodulin‐dependent protein kinase 4 (CaMK4) on T cell metabolism. Methods Metabolomic profiling was performed using capillary electrophoresis mass spectrometry in naive T cells from MRL/ lpr mice treated with anti‐CD3/CD28 antibodies in the absence or presence of a CaMK4 inhibitor (KN‐93). The expression of GLUT1 and CaMK4 in CD4+ T cells from healthy controls (n = 16), patients with inactive SLE (n = 13), and patients with active SLE (n = 14) was examined by flow cytometry and quantitative polymerase chain reaction. In vitro experiments were performed to determine the effect of KN‐93 on the expression of GLUT1 during Th17 cell differentiation in T cells from patients with SLE. Results CaMK4 inhibition significantly decreased the levels of glycolytic intermediates such as glucose‐6‐phosphate, fructose‐6‐phosphate, fructose‐1,6‐diphosphate, pyruvate, and lactate ( P &lt; 0.05), whereas it did not affect the levels of the pentose phosphate pathway intermediates such as 6‐phospho‐ d ‐gluconate, ribulose‐5‐phosphate, ribose‐5‐phosphate, and phosphoribosyl pyrophosphate. The expression levels of GLUT1 and CaMK4 in effector memory CD4+ T cells were significantly higher in patients with active SLE compared to healthy controls ( P &lt; 0.01 and P &lt; 0.05, respectively) and patients with inactive SLE ( P &lt; 0.05 and P &lt; 0.01, respectively). A functional analysis revealed that CaMK4 inhibition decreased the expression of GLUT1 during Th17 cell differentiation ( P &lt; 0.01), followed by a reduction of interleukin‐17 (IL‐17) production ( P &lt; 0.05). Conclusion The results of the study indicate that the activity of CaMK4 could be responsible for glycolysis, which contributes to the production of IL‐17, and CaMK4 may contribute to aberrant expression of GLUT1 in T cells from patients with active SLE.

Bound-systems of $\Xi^-$--$^{14}_{}{\rm N}$ are studied via $\Xi^-$ capture at rest followed by emission of a twin single-$\Lambda$ hypernucleus in the emulsion detectors. Two events forming extremely deep $\Xi^-$ bound states were obtained by analysis of a hybrid method in the E07 experiment at J-PARC and reanalysis of the E373 experiment at KEK-PS. The decay mode of one event was assigned as $\Xi^-+^{14}_{}{\rm N}\to^{5}_{\Lambda}{\rm He}$+$^{5}_{\Lambda}{\rm He}$+$^{4}_{}{\rm He}$+n. Since there are no excited states for daughter particles, the binding energy of the $\Xi^-$ hyperon, $B_{\Xi^-}$, in $^{14}_{}{\rm N}$ nucleus was uniquely determined to be 6.27 $\pm$ 0.27 MeV. Another $\Xi^-$--$^{14}_{}{\rm N}$ system via the decay $^{9}_{\Lambda}{\rm Be}$ + $^{5}_{\Lambda}{\rm He}$ + n brings a $B_{\Xi^-}$ value, 8.00 $\pm$ 0.77 MeV or 4.96 $\pm$ 0.77 MeV, where the two possible values of $B_{\Xi^-}$ correspond to the ground and the excited states of the daughter $^{9}_{\Lambda}{\rm Be}$ nucleus, respectively. Because the $B_{\Xi^-}$ values are larger than those of the previously reported events (KISO and IBUKI), which are both interpreted as the nuclear $1p$ state of the $\Xi^-$--$^{14}_{}{\rm N}$ system, these new events give the first indication of the nuclear $1s$ state of the $\Xi$ hypernucleus, $^{15}_{\Xi}{\rm C}$.

Most of the diseases for which apheresis therapy is indicated are intractable and rare, and each patient has a different background and treatment course prior to apheresis therapy initiation. Therefore, it is difficult to conduct large-scale randomized controlled trials to secure high-quality evidence. Under such circumstances, the American Society for Apheresis (ASFA) issued its guidelines in 2007, which were repeatedly revised until the latest edition in 2019. The ASFA guidelines are comprehensive. However, in the United States, a centrifugal separation method is mainly used for apheresis, whereas the mainstream procedure in Japan is the membrane separation method. The target diseases and their backgrounds are different from those in Japan. Due to these differences, the direct adoption of the ASFA guidelines in Japanese practice creates various problems. One of the features of apheresis in Japan is the development of treatment methods using hollow-fiber devices such as double filtration plasmapheresis (DFPP) and selective plasma exchange and adsorption-type devices such as polymyxin B-immobilized endotoxin adsorption columns. Specialists in emergency medicine, hematology, collagen diseases/rheumatology, respiratory medicine, cardiovascular medicine, gastroenterology, neurology, nephrology, and dermatology who are familiar with apheresis therapy gathered for this guideline, which covers 86 diseases. In addition, since apheresis therapy involves not only physicians but also clinical engineers, nurses, dieticians, and many other medical professionals, this guideline was prepared in the form of a worksheet so that it can be easily understood at the bedside. Moreover, to the clinical purposes, this guideline is designed to summarize apheresis therapy in Japan and to disseminate and further develop Japanese apheresis technology to the world. As diagnostic and therapeutic techniques are constantly advancing, the guidelines need to be revised every few years. In order to ensure the high quality of apheresis therapy in Japan, both the Japanese Society for Apheresis Registry and the guidelines will be inseparable.

Although routinely observed among North Americans, self-enhancing biases have been elusive in studies conducted with Japanese. The authors conducted two studies of relationship-serving biases (RSBs) with Japanese, Asian Canadian, and European Canadian participants. In both studies, members of all three cultural groups viewed their own relationships (with their best friend, their closest family member, and their romantic partner) as more positive than those of their peers, and to roughly the same extent. Of importance, however, (a) RSBs were largely uncorrelated with both self-esteem and self-serving biases and (b) Japanese (but not the other two cultural groups’) RSBs were paralleled by tendencies to view their relationship partners more positively than themselves. The authors suggest that relationship enhancement serves a different function than self-enhancement, aiding the individual’s quest for connection and belongingness with others.

Vascular endothelial growth factor C (VEGF-C) is the only factor known to cause lymphangiogenesis. We studied the correlation between VEGF-C and vascular endothelial growth factor receptor-3 (VEGFR-3) expression of 85 primary gastric cancers by reverse transcriptase-polymerase chain reaction (RT-PCR) and immunohistochemistry, and the results were correlated with the number of lymphatic vessels, stained with anti-VEGFR-3 antibody. RT-PCR and immunohistology demonstrated that VEGF-C was mainly produced from cancer cells, but not from stromal elements. Morphologically, VEGFR-3 expression was detected in the endothelial cells of the stromal lymphatic vessels. There was a statistically positive correlation between the incidence of VEGF-C and VEGFR-3 mRNA expression in the primary tumours (P=0.0002). The number of VEGFR-3-positive lymphatic vessels in VEGF-C mRNA positive tumours was significantly larger than that in VEGF-C-negative tumours. The number of VEGFR-3-positive vessels in the tumour stroma was closely related to the grade of lymphatic invasion of gastric cancer. These results strongly indicate that VEGF-C may induce the proliferation of lymphatic vessels in the stroma of primary gastric cancer via activation of VEGFR-3, expressed on the endothelial cells of lymphatic vessels. In these circumstances, cancer cells can easily invade the lymphatic vessel, because of the increase of the contact points of cancer cells with the lymphatic vessels.

Hepatocyte growth factor receptor (c-met), autocrine motility factor receptor (AMFR), and urokinase-type plasminogen activator receptor (uPAR) are known to play important roles in tumor cell migration, invasion, and metastasis. The authors studied the relation between the expression patterns of these genes and the growth patterns of human gastric carcinoma.The relation between the expression of c-met, AMFR, and uPAR and clinicopathologic parameters was studied using immunohistochemical preparations from 102 paraffin embedded primary gastric carcinomas.Of 102 cases, 43 (42%) had overexpression of c-met, and AMFR and uPAR immunoreactivity was observed in 41 cases (40%) and 38 cases (37%), respectively. Macroscopic examination revealed that all three genes were expressed in 1 (3%) of 32 early stage gastric carcinomas, 0 (0%) of 29 localized carcinomas (Borrmann types 1 and 2), and 16 (39%) of 41 infiltrating carcinomas (Borrmann types 3 and 4). In particular, the incidence (68%, 13 of 19 cases) of simultaneous expression of the three genes was significantly higher in Borrmann type 4 gastric carcinoma than in the other macroscopic types (P < 0.01). The overexpression of these genes was also closely associated with lymph node metastasis and peritoneal dissemination. In addition, the simultaneous overexpression of the three genes was associated with positive lymphatic vessel invasion and infiltrating type. Patients with tumors that simultaneously expressed all three genes had significantly poorer prognoses than those with tumors expressing only one or two of the genes. Furthermore, the number of genes expressed was closely related to the prognosis, and the Cox proportional hazards model identified this as one of the independent prognostic factors.These results suggest that the expression patterns of c-met, AMFR, and uPAR may be closely associated with the progression and invasion of gastric carcinoma as well as the prognoses of the patients. Borrmann type 4 gastric carcinoma is characterized by the diverse and simultaneous expression of these three genes.

A prospective clinical study was performed to evaluate a new method of treatment of endotoxin shock, a column containing polystyrene fibers with covalently bound immobile polymyxin B. Direct hemoperfusion using the column removes circulating endotoxin by adsorption. All of the patients studied, 37 in the treatment group and 33 in the control group, had endotoxemia and failure of 1 or more organs. The perfusion was performed 1-7 times per patient, 2 h/session. The survival rate was significantly higher in the treatment group (54%) than in the controls (36.4%). The mean plasma endotoxin concentration was significantly lowered by the treatment from 83.7 pg/ml before perfusion to 56.4 pg/ml immediately after and 28.5 pg/ml the day after the treatment, and the posttreatment level was much lower in those who survived (mean, 18.8 pg/ml) compared to those who died (mean, 88 pg/ml). Various parameters of cardiac function also improved after the treatment.

The complement system, composed of more than 30 serum and cell surface components, is collaborating in recognition and elimination of pathogens as a part of both the innate and acquired immune systems. The two collagenous lectins, mannose-binding lectin (MBL) and ficolins, are one of the pattern recognition molecules acting in innate immunity and upon recognition of the pathogens, they trigger the activation of the lectin complement pathway through attached serine proteases (MASPs). A similar lectin-base complement system, consisting of the lectin-protease complex and C3, is present in ascidians, our closest invertebrate relatives and functions in an opsonic manner. On the other hand, ongoing genome projects in both vertebrates and invertebrates revealed that most domains used by mammalian complement components are found in both protostomes and deuterostomes. However, the unique combinations of them as found in mammalian complement components are present only in deuterostomes, indicating the deuterostome origin of the complement system. Unexpectedly, the complement system of an invertebrate deuterostome, ascidian, shows a similar level of complexity as that of mammals, suggesting that expansion of complement genes by gene duplications occurred independently both in the ascidian and vertebrate lineages. Although most characteristic domain structures of the mammalian complement components are found in ascidians, detailed evolutionary analysis casts doubt on their mutual reactivity in several points. Thus, another integrative step seems to have been required to establish the modern complement system of higher vertebrates.

We have cloned and characterized LATS2, a novel mammalian homologue of the Drosophila tumor suppressor gene lats/warts. Northern blot analysis showed ubiquitous expression of mouse LATS2 (MmLATS2) mRNA, whereas expression of human LATS2 (HsLATS2) mRNA was enhanced in skeletal muscle and heart. Immunoblotting analysis of fractionated cell lysates showed HsLats2 to be a nuclear protein. We mapped the MmLATS2 gene to mouse chromosome 14 by interspecific backcross analysis. We also mapped the HsLATS2 gene (by fluorescence in situ hybridization) to the 13q11-q12 region, in which a loss of heterozygosity has been frequently observed in many primary cancers and to which the tumor suppressor genes RB and BRCA2 have also been mapped.

Neural crest is formed at the boundary of epidermal and neural ectoderm. To understand the molecular mechanism of neural crest formation, we focused on the transcriptional regulation of the Slug gene. In the upstream sequence of the chicken Slug gene, we have identified potential binding sites for transcription factors, such as Lef/Tcf and Smad1. Transgenic mouse embryos carrying the chicken Slug promoter‐reporter gene showed a crest‐specific activation of the reporter, suggesting the isolated sequence included the cis ‐regulatory elements to receive Slug ‐inducing signals in the mouse neural crest. While these potential cis ‐regulatory elements could be recognized and activated by corresponding transcription factors, such as Lef1 and Smad1, Wnt‐Lef‐β‐catenin signal failed to induce endogenous Slug expression in quail neural plate tissue prepared from forebrain and midbrain levels. In contrast, Slug expression and subsequent epithelial‐mesenchymal transition were effectively induced by BMP4. Consistently, while we could detect phosphorylation of Smad1 in the ectoderm including the neural plate and the neural fold region, the activation of a reporter gene for a detection of canonical Wnt signal activation was below the level of detection at the forebrain and midbrain levels. These observations indicated that in the anterior ectoderm BMP signal has a predominant role for Slug expression.

Abstract Mannose-binding lectin-associated serine proteases (MASPs) are involved in complement activation through the lectin pathway. To elucidate the phylogenetic origin of MASP and a primordial complement system, we cloned two MASP cDNAs from amphioxus (Branchiostoma belcheri) of the cephalochordates, considered to be the closest relative of vertebrates. The two sequences, orthologues of mammalian MASP-1 and MASP-3, were produced by alternative processing of RNA from a single gene consisting of a common H chain-encoding region and two L chain-encoding regions, a structure which is similar to that of the human MASP1/3 gene. We also isolated two MASP genes from the ascidian Halocynthia roretzi (urochordates) and found that each of them consists simply of an H chain-encoding region and a single L chain-encoding region. The difference in structure between the ascidian MASP genes and the amphioxus/mammalian MASP genes suggests that a prototype gene was converted to the MASP1/3-type gene possessing two L chain-encoding regions at an early stage of evolution before the divergence of amphioxus. This conclusion is supported by the presence of MASP-1 and MASP-3 homologues in almost all vertebrates, as demonstrated by the cloning of novel cDNA sequences representing lamprey (cyclostomes) MASP-1 and Xenopus MASP-3. The ancient origin of MASP-1 and MASP-3 suggests that they have crucial functions common to all species which emerged after cephalochordates.

We isolated a novel gene, termed MLZE, from a B16-BL6 cDNA library after subtraction of B16-F10 mRNA. Expression levels of mouse MLZE (mMLZE) increased in accordance with metastatic ability of B16 melanoma sublines. Human homolog of mMlze (hMlze) contained one leucine zipper structure and two potential nuclear localizing signals. Northern blot analysis of multiple human tissues showed that hMLZE was expressed primarily in trachea and spleen. We mapped the hMLZE gene (by fluorescence in situ hybridization) to 8q24.1 - 2, which contains the c-myc gene and is often amplified in malignant melanoma. Immunohistochemistry revealed that the number of hMlze-positive cases was significantly larger in Clark levels III, IV and V melanomas (6 / 11 = 55%) than in Clark levels I and II melanomas (2 / 15 = 13%). In two cases of hMlze-positive melanomas, the strength of hMlze staining increased substantially in the deep component of the tumor. Considering that melanomas above Clark level II are more metastatic than those below Clark level III, these findings suggested that MLZE is one of the genes whose expression is upregulated during the course of acquisition of metastatic potential in melanoma cells.

The expression of mRNAs for vascular endothelial growth factor (VEGF) was examined in 42 cases of primary lung cancer tissues (18 adenocarcinomas, 18 squamous cell carcinomas, 2 large cell carcinomas, 3 small cell carcinomas, and 1 adenoid cystic carcinoma) and 4 human lung cancer cell lines. As seen by reverse transcription-PCR analysis, VEGF mRNAs were expressed predominantly as transcripts for the secretory forms of VEGF (VEGF121 and VEGF165), both in resected lung cancer tissues and in human lung cancer cell lines. The positive ratios of VEGF mRNA according to pathological type were 66.7% (12 of 18) in adenocarcinoma, 72.2% (13 of 18) in squamous cell carcinoma, 100% (2 of 2) in large cell carcinoma, and 67% (2 of 3) in small cell carcinoma. The relative antigen levels of VEGF detected by immunohistochemical examination almost coincided with the relative VEGF mRNA expression levels. Also, we examined the expression of basic fibroblast growth factor mRNA in the same tumor specimens. However, no significant correlation was found between the VEGF and basic fibroblast growth factor mRNA expression levels. We assessed the relationship between the VEGF121 mRNA expression level and the survival period in patients (n = 17) who underwent a curative operation at stage I of the disease. The median survival of the VEGF high-expression group was 8 months, and that of the VEGF low-expression group was 151 months. The 3- and 5-year survival rates of the high-expression group (n = 6) were 50.0% and 16.7%, respectively. On the other hand, those of the low expression group (n = 11) were 90.9% and 77.9%, respectively. The difference in survival between the two groups was significant (P < 0.05). Among eight cases of long-term survival beyond 5 years, seven cases had low or no VEGF121 mRNA expression. In contrast, among 18 cases with VEGF121 mRNA overexpression, 17 cases died due to recurrence. As a marker of tumor angiogenesis, the VEGF121 mRNA expression level may be a significant prognostic indicator of lung cancers in early stages.

Abstract Mannose-binding lectin (MBL) and ficolins are pattern recognition proteins acting in innate immunity, and they trigger the activation of the lectin complement pathway through MBL-associated serine proteases (MASPs). Upon activation of the lectin pathway, MASP-2 cleaves C4 and C2. A truncated form of MASP-2, named small MBL-associated protein (sMAP), is also associated with MBL/ficolin-MASP complexes. To clarify the role of sMAP, we have generated sMAP-deficient (sMAP−/−) mice by targeted disruption of the sMAP-specific exon. Because of the gene disruption, the expression level of MASP-2 was also decreased in sMAP−/− mice. When recombinant sMAP (rsMAP) and recombinant MASP-2 (rMASP-2) reconstituted the MBL-MASP-sMAP complex in deficient serum, the binding of these recombinant proteins to MBL was competitive, and the C4 cleavage activity of the MBL-MASP-sMAP complex was restored by the addition of rMASP-2, whereas the addition of rsMAP attenuated the activity. Therefore, MASP-2 is essential for the activation of C4 and sMAP plays a regulatory role in the activation of the lectin pathway.

Ficolin is a collagenous lectin which plays a crucial role in innate immunity. Three and two ficolins have been identified in human and mice, respectively. To identify the mouse homologue of human H-ficolin and to elucidate the orthology between mouse ficolins A/B and human L-/M-ficolins, the gene structures were explored. The mouse homologue of the H-ficolin gene was identified as a pseudogene on chromosome 4. The mouse ficolin A gene was located far from the ficolin B gene on chromosome 2, whereas the human L-ficolin and M-ficolin genes were close in the region homologous to the ficolin B locus. Together with the exon-intron structures and the phylogenetic tree, these results suggest that ficolin B is the mouse orthologue of M-ficolin and that the genes encoding serum-type ficolins, ficolin A and L-ficolin, were generated independently from the ficolin B/M-ficolin lineage each in mice and primates.

Ficolin and mannose-binding lectin (MBL) are animal lectins that are involved in innate immunity by initiating the lectin complement pathway. Here, we report that interactions between these lectins and fibrinogen/fibrin augment the lectin pathway. An ELISA revealed that recombinant mouse ficolin A (rFcnA), rMBL-A and rMBL-C bind to fibrinogen in a dose-dependent manner. Affinity Western blotting showed that these lectins bind to the A alpha- and B beta-chains of fibrinogen and the alpha- and beta-chains of fibrin, but not to the gamma-chain, and that rMBL-A and rMBL-C preferentially bind to the alpha- and beta-chains. The C4 deposition activity on Fbg-coated plates was observed by using mouse serum, and the deposition on GlcNAc-coated plates was enhanced by fibrinogen supplementation and further enhanced by the addition of thrombin. Similar effects of fibrinogen and fibrin were observed in the bindings of these lectins to a Gram-positive pathogen, Staphylococcus aureus, and in the subsequent C3 deposition on the bacteria. In particular, the lectin pathway, through MBLs, seemed to synchronize with blood coagulation. Therefore, it is suggested that the lectin pathway collaborates with the coagulation system in the first-line host defense against pathogens under conditions such as injury and inflammation.

The morbidity rate of hepatic resection for hepatocellular carcinoma (HCC) remains high. To clarify predictors and the prognostic significance of operative complications in patients with HCC, we conducted a comparative retrospective analysis of 291 patients with HCC who underwent hepatic resection.Operative complications included hyperbilirubinemia, ascites, hemorrhage, respiratory and cardiovascular diseases, bile leakage and abscess formation, renal failure, wound infection, and pleural effusion. Predictors of operative complications and their prognostic value for long-term survival were studied by univariate and multivariate analyses.Mortality and morbidity rates were 7.2% and 42.6%. The main operative complications were ascites (n = 30), intraabdominal abscess (n = 25), hyperbilirubinemia (n = 19), wound infection (n = 16), pleural effusion (n = 10) and intraabdominal hemorrhage (n=9). By a multivariate logistic regression model, Child-Pugh class B and increased operative blood loss (> or = 1200ml) were independent predictors of postoperative complications. Among 243 patients without operative death, the 5-year overall survival rate was significantly lower in patients with operative complications (34.3%) than in those without these complications (48.7%). By the multivariate Cox proportional hazards model, the presence of operative complications was an independent predictor of poor overall survival as well as presence of portal invasion.Child-Pugh class B and operative blood loss > or = 1200ml were independent predictors of complications after hepatic resection for HCC. Long-term survival is poorer in patients with postoperative complications. Decreasing operative blood loss may result in fewer postoperative complications and better long-term survival of HCC patients.

The toxicity and carcinogenicity of arsenic depend on its species. Individuals living in Japan consume much seafood that contains high levels of organoarsenics. Speciation analysis of urinary arsenic is required to clarify the health risks of arsenic intake. There has been no report of urinary arsenic analysis in Japan using high performance liquid chromatography with inductively coupled plasma mass spectrometry (HPLC-ICP-MS). We performed speciation analysis of urinary arsenic for 210 Japanese male subjects without occupational exposure using HPLC-ICP-MS. The median values of urinary arsenics were as follows: sodium arsenite (AsIII), 3.5; sodium arsenate (AsV), 0.1; monomethylarsonic acid (MMA), 3.1; dimethylarsinic acid (DMA), 42.6; arsenobetaine (AsBe), 61.3; arsenocholine, trimethylarsine oxide, and unidentified arsenics (others), 5.2; and total arsenic (total As), 141.3 microgAs/l. The median creatinine-adjusted values were as follows: AsIII, 3.0; AsV, 0.1; MMA, 2.6; DMA, 35.9; AsBe, 52.1; others 3.5; and total As, 114.9 microgAs/g creatinine. Our findings indicate that DMA and AsBe levels in Japan are much higher than those found in Italian and American studies. It appears that the high levels of DMA and AsBe observed in Japan may be due in part to seafood intake. ACGIH and DFG set the BEI and BAT values for occupational arsenic exposure as 35 microgAs/l and 50 microgAs/l, respectively, using the sum of inorganic arsenic (iAs), MMA, and DMA. In the general Japanese population, the sums of these were above 50 microgAs/l in 115 (55%) samples. We therefore recommend excluding DMA concentration in monitoring of iAs exposure.

The suggested model for pro-matrix metalloproteinase-2 (proMMP-2) activation by membrane type 1 MMP (MT1-MMP) implicates the complex between MT1-MMP and tissue inhibitor of MMP-2 (TIMP-2) as a receptor for proMMP-2. To dissect this model and assess the pathologic significance of MMP-2 activation, an artificial receptor for proMMP-2 was created by replacing the signal sequence of TIMP-2 with cytoplasmic/transmembrane domain of type II transmembrane mosaic serine protease (MSP-T2). Unlike TIMP-2, MSP-T2 served as a receptor for proMMP-2 without inhibiting MT1-MMP, and generated TIMP-2-free active MMP-2 even at a low level of MT1-MMP. Thus, MSP-T2 did not affect direct cleavage of the substrate testican-1 by MT1-MMP, whereas TIMP-2 inhibited it even at the level that stimulates proMMP-2 processing. Expression of MSP-T2 in HT1080 cells enhanced MMP-2 activation by endogenous MT1-MMP and caused intensive hydrolysis of collagen gel. Expression of MSP-T2 in U87 glioma cells, which express a trace level of endogenous MT1-MMP, induced MMP-2 activation and enhanced cell-associated protease activity, activation of extracellular signal-regulated kinase, and metastatic ability into chick embryonic liver and lung. MT1-MMP can exert both maximum MMP-2 activation and direct cleavage of substrates with MSP-T2, which cannot be achieved with TIMP-2. These results suggest that MMP-2 activation by MT1-MMP potentially amplifies protease activity, and combination with direct cleavage of substrate causes effective tissue degradation and enhances tumor invasion and metastasis, which highlights the complex role of TIMP-2. MSP-T2 is a unique tool to analyze physiologic and pathologic roles of MMP-2 and MT1-MMP in comparison with TIMP-2.

Adiponectin, a key substance in metabolic syndrome, is known to have anti-inflammatory properties. The relationship between adiponectin and sepsis in vivo is unclear. In this study, the possible involvement of adiponectin in polymicrobial sepsis was investigated using adiponectin-knockout (APN-KO) mice that underwent cecal ligation and puncture (CLP) and received the peroxisome proliferator-activated receptor gamma (PPAR-gamma) that increases the plasma adiponectin concentration.APN-KO and wild-type (WT) mice underwent either CLP or a sham operation. The plasma adiponectin, endotoxin, tumor necrosis factor-alpha (TNF-alpha), and interleukin-6 (IL-6) levels were determined before and at 2, 4, 6, 8, 12, 16, and 24 hours after the procedures, and the survival rates were compared. Mice were injected with rosiglitazone, a selective PPAR-gamma agonist, and compared survival rates after CLP with those without rosiglitazone.After CLP, APN-KO mice had a significantly higher mortality than WT mice. The plasma endotoxin, TNF-alpha, and IL-6 levels in APN-KO mice were significantly higher than those in WT mice 24 hours after CLP. Within 4 hours after CLP, the plasma adiponectin level in WT mice decreased to half of the initial levels. Pre-CLP treatment with PPAR-gamma was shown to increase the plasma adiponectin level and to improve significantly mortality of WT mice during sepsis; mortality among APN-KO mice did not improve.These results suggest that adiponectin deficiency may cause the high mortality and the high inflammatory cytokine levels in mice with polymicrobial sepsis.

Mannose-binding lectin (MBL) and ficolin are complexed with MBL-associated serine proteases, key enzymes of complement activation via the lectin pathway, and act as soluble pattern recognition molecules in the innate immune system. Although numerous reports have revealed the importance of MBL in infectious diseases and autoimmune disorders, the role of ficolin is still unclear. To define the specific role of ficolin in vivo, we generated model mice deficient in ficolins. The ficolin A (FcnA)-deficient (Fcna(-/-)) and FcnA/ficolin B double-deficient (Fcna(-/-)b(-/-)) mice lacked FcnA-mediated complement activation in the sera, because of the absence of complexes comprising FcnA and MBL-associated serine proteases. When the host defense was evaluated by transnasal infection with a Streptococcus pneumoniae strain, which was recognized by ficolins, but not by MBLs, the survival rate was significantly reduced in all three ficolin-deficient (Fcna(-/-), Fcnb(-/-), and Fcna(-/-)b(-/-)) mice compared with wild-type mice. Reconstitution of the FcnA-mediated lectin pathway in vivo improved survival rate in Fcna(-/-) but not in Fcna(-/-)b(-/-) mice, suggesting that both FcnA and ficolin B are essential in defense against S. pneumoniae. These results suggest that ficolins play a crucial role in innate immunity against pneumococcal infection through the lectin complement pathway.

Background: Cadmium, a ubiquitous environmental pollutant, is classified as a carcinogenic substance. Several laboratory and epidemiologic studies of workers and subjects in polluted areas have suggested a positive association between cadmium exposure and risk of several cancers. However, data from general populations are sparse. We prospectively examined the association between cadmium exposure and incidence of cancer in a Japanese population with a relatively high dietary intake of cadmium. Methods: We conducted a population-based prospective study in 90,383 Japanese men and women 45–74 years of age. Participants responded to a validated questionnaire that included 138 food items. We estimated dietary cadmium intake from 6 food groups, based on the questionnaire data. During 9 years of follow-up, 5849 cancer cases were identified. Hazard ratios (HRs) and 95% confidence intervals (CIs) for cancer were calculated by Cox proportional hazards modeling. Results: There was no evidence of an association of cadmium consumption and total cancer, with HRs in the highest versus lowest cadmium intake group of 0.94 (95% CI = 0.82 to 1.08; test for trend, P = 0.46) for men and 0.96 (0.81 to 1.15; 0.60) for women. No site-specific cancers were associated with cadmium intake in men or women. Conclusion: We found no associations of cancer with cadmium, at least at the exposure levels observed in a general population in Japan.

Ado-trastuzumab emtansine (T-DM1) is an antibody-drug conjugate (ADC) approved for the treatment of HER2-positive metastatic breast cancer. It consists of trastuzumab, a humanized mAb directed against HER2, and a microtubule inhibitor, DM1, conjugated to trastuzumab via a thioether linker. Hepatotoxicity is one of the serious adverse events associated with T-DM1 therapy. Mechanisms underlying T-DM1-induced hepatotoxicity remain elusive. Here, we use hepatocytes and mouse models to investigate the mechanisms of T-DM1-induced hepatotoxicity. We show that T-DM1 is internalized upon binding to cell surface HER2 and is colocalized with LAMP1, resulting in DM1-associated cytotoxicity, including disorganized microtubules, nuclear fragmentation/multiple nuclei, and cell growth inhibition. We further demonstrate that T-DM1 treatment significantly increases the serum levels of aspartate aminotransferase, alanine aminotransferase, and lactate dehydrogenase in mice and induces inflammation and necrosis in liver tissues, and that T-DM1-induced hepatotoxicity is dose dependent. Moreover, the gene expression of TNFα in liver tissues is significantly increased in mice treated with T-DM1 as compared with those treated with trastuzumab or vehicle. We propose that T-DM1-induced upregulation of TNFα enhances the liver injury that may be initially caused by DM1-mediated intracellular damage. Our proposal is underscored by the fact that T-DM1 induces the outer mitochondrial membrane rupture, a typical morphologic change in the mitochondrial-dependent apoptosis, and mitochondrial membrane potential dysfunction. Our work provides mechanistic insights into T-DM1-induced hepatotoxicity, which may yield novel strategies to manage liver injury induced by T-DM1 or other ADCs.

A double-$\Lambda$ hypernucleus, ${}_{\Lambda\Lambda}\mathrm{Be}$, was observed by the J-PARC E07 collaboration in nuclear emulsions tagged by the $(K^{-},K^{+})$ reaction. This event was interpreted as a production and decay of $ {}_{\Lambda\Lambda}^{\;10}\mathrm{Be}$, ${}_{\Lambda\Lambda}^{\;11}\mathrm{Be}$, or ${}_{\Lambda\Lambda}^{\;12}\mathrm{Be}^{*}$ via $\Xi^{-}$ capture in ${}^{16}\mathrm{O}$. By assuming the capture in the atomic 3D state, the binding energy of two $\Lambda$ hyperons$\,$($B_{\Lambda\Lambda}$) of these double-$\Lambda$ hypernuclei are obtained to be $15.05 \pm 0.11\,\mathrm{MeV}$, $19.07 \pm 0.11\,\mathrm{MeV}$, and $13.68 \pm 0.11\,\mathrm{MeV}$, respectively. Based on the kinematic fitting, ${}_{\Lambda\Lambda}^{\;11}\mathrm{Be}$ is the most likely explanation for the observed event.

Immune check point inhibitors targeting programmed cell death protein-1 (PD-1) and its ligand (PD-L1) have shown clinical success in treatment of human malignancies. Triple negative breast cancer (TNBC), which is primarily characterized by high heterogeneity and presence of tumor infiltrating lymphocytes, remains therapeutic challenge due to unavailability of approved targeted therapy. Therapeutic potential of immune check point inhibitors for TNBC patients is under active clinical investigation. In this study, we show that FDA-approved anti-PD-L1 antibody, atezolizumab (ATE), potentiates T cell-mediated cytotoxicity and apoptosis of TNBC cells that express higher levels of PD-L1, but does not have significant effect on TNBC cells expressing low levels of PD-L1. PD-L1 knockdown further confirmed that ability of ATE to promote T cell-induced cytotoxicity is PD-L1 expression dependent. Combination of ATE with PD-L1 upregulating agents, such as HDAC, proteasomal, and lysosomal inhibitors, further augmented cytotoxic activity of T cells toward TNBC cells. Based on analysis of breast cancer tissue samples deposited in The Cancer Genome Atlas (TCGA), we found a positive correlation between PD-L1 and focal adhesion kinase (FAK) mRNA expression in PD-L1-positive (PD-L1+) TNBC, suggesting a functional association of FAK and immune checkpoints. We further demonstrate that ATE dramatically downregulates phosphorylation status of FAK, an important regulator of cell invasion and migration, and significantly enhances FAK inhibitor mediated inhibition of cell motility and invasion of PD-L1+ TNBC cells independent of T cells. Taken together, our data suggest that ATE shows promising anti-tumor activity in PD-L1+ TNBC via both T cell-dependent and -independent mechanisms.

Abstract Background Polymyositis/dermatomyositis (PM/DM) is an autoimmune disease that is sometimes complicated with rapidly progressive interstitial lung disease (RPILD). However, serum and lung biomarkers that can predict RPILD development remain unclear. Objectives To determine potential serum and lung biomarkers that can predict RPILD development in patients with PM/DM‐ILD. Methods In total, 49 patients with PM/DM‐ILD were enrolled. We measured the serum levels of 41 cytokines/chemokines, ferritin and anti‐MDA5 antibody, compared them between the RPILD ( n = 23) and non‐RPILD ( n = 26) groups, and ranked them by their importance through random forest analysis. To distinguish the two groups, we determined biomarker combinations by logistic regression analysis. We also measured the bronchoalveolar lavage fluid (BALF) levels of 41 cytokines/chemokines. Using immunohistochemistry, we examined IL‐15 expression in lung tissues. The IL‐15 production was also investigated using A549 and BEAS‐2B cells. Results The RPILD group had significantly higher IL‐15, IL‐1RA, IL‐6, CXCL10, VCAM‐1, anti‐MDA5 antibody and ferritin serum levels than the non‐RPILD group, but it had a significantly low CCL22 level. Meanwhile, anti‐MDA5 antibody, IL‐15, CXCL8, CCL22, IL‐1RA and ferritin were the best combination to distinguish the two groups. IL‐15 and CCL22 were also predictive marker for RPILD development in anti‐MDA5 antibody‐positive patients. Additionally, the RPILD group had significantly high IL‐15 levels in BALF. The lung tissues expressed IL‐15, which increased after cytokine stimulation in the A549 cells. Conclusion This study identified a combination of biomarkers predicting PM/DM‐RPILD progression, and IL‐15 is an important cytokine for predicting RPILD development and reflecting ILD severity.

Abstract Objective To compare the efficacy and safety of tofacitinib and baricitinib in patients with RA in a real-world setting. Methods A total of 242 patients with RA who were treated with tofacitinib ( n = 161) or baricitinib ( n = 81) were enrolled. We evaluated efficacy and safety between tofacitinib and baricitinib using multivariable analyses to avoid confounding. Their clinical disease activity and AEs were evaluated for 24 weeks. Results The mean (SD) DAS28-ESR change from baseline to 24 weeks was 1.57 (1.55) (tofacitinib) and 1.46 (1.36) (baricitinib). There was no significant difference in the clinical response between the two groups (adjusted mean difference, 0.04; 95% CI, −0.35 to 0.28). The efficacy was not significantly changed in the patients without concomitant MTX use in both groups, but the concomitant MTX use showed better clinical efficacy in the cases of baricitinib treatment. In both groups, the most common AE was herpes zoster infection, and the AE rates were similar between the two groups. However, the predictive factors contributing to clinical response as revealed by a multivariable logistic analysis differed. The concomitant oral steroid use was independently associated with the achievement of DAS-low disease activity in the tofacitinib group, whereas in the baricitinib group, the number of biological and/or targeted synthetic DMARDs previously used was associated. Conclusions Our findings indicate that tofacitinib and baricitinib had comparable continuing efficacies and safety profiles. However, there is a possibility that the influence of clinical characteristics on the treatment response differs. The comparison provides useful information to the optimal use of JAK inhibitors in real-world settings.

We have cloned the mouse CRTH2 (chemoattractant receptor-homologous molecule expressed on TH2 cells) gene encoding a putative leukocyte chemoattractant receptor, of which human homologue is expressed selectively in Th2 but not in Th1 clones among T cell clones. The deduced amino-acid sequence of mouse CRTH2 bears 77% identity with its human homologue. Phylogenetic analysis suggested that both mouse and human CRTH2 are closely related to the N-formyl peptide receptor and the C5a receptor among leukocyte chemoattractant receptors. The mouse CRTH2 gene was mapped on chromosome 19c with FISH, where no other genes for leukocyte chemoattractant receptors are mapped. RT-PCR analysis revealed that mouse CRTH2 mRNA is expressed in various cell lineages, including both hematopoietic and non-hematopoietic cell lines. Expression was also observed in liver, lung, kidney, brain, heart, thymus, and spleen. These results suggest that mouse CRTH2 functions in a variety of cells, making the effects of CRTH2 pleiotropic.

Mannose-binding lectin (MBL), a serum lectin specific for mannose or N-acetylglucosamine (GlcNAc), which contains both a collagen-like domain and a carbohydrate-recognition domain (CRD), plays a role in innate immunity by acting as an opsonin and activating complement in association with MBL-associated serine protease (MASP) via the lectin pathway. Another type of GlcNAc-binding lectins termed "ficolins" exist in serum. They are characterized by the presence of both a collagen-like domain and a fibrinogen-like domain. Investigations of two types of human serum ficolins, ficolin/P35 and Hakata antigen, revealed that they are associated with MASPs and sMAP, a truncated protein of MASP-2, and activate complement. These findings indicate that, like MBL, serum ficolins are collagenous lectins capable of activating the lectin pathway and thus have a role in innate immunity.

The binding of urokinase-type plasminogen activator (uPA) to its receptor (uPAR) has been implicated in cancer invasion and metastasis. This activity is known to be regulated by several inhibitors such as plasminogen activator inhibitors (PAIs). To elucidate the participation of the uPA system in the malignant behaviour of squamous cell carcinoma (SCC) in the oral cavity, uPA, uPAR, PAI-1 and -2 expression and localisation in 34 primary oral cancers were examined immunohistochemically. The results were then compared with clinicopathological findings. The positive rates of uPA, uPAR, PAI-1 and -2 expression were 23.5, 29.4, 29.4 and 11.8%, respectively. uPA expression correlated with mode of cancer invasion according to Yamamoto-Kohama's criteria (p < 0.01) and with secondary regional lymph node metastasis. uPAR expression also correlated with mode of invasion. In particular, the tumours of both uPA- and uPAR-positive [uPA(+)/uPAR(+)] cases were highly invasive. In the present study, neither PAI-1 nor PAI-2 expression correlated with clinicopathological parameters. However, PAI-2 negative cases of uPA(+)/uPAR(+) were significantly more invasive (p < 0.0001). Such uPA(+)/uPAR(+)/PAI-2(-) cases almost always showed secondary lymph node metastasis (p < 0.01). These results indicate that the uPA system plays a significant role in the invasive and metastatic processes of oral SCC, and that this system may be a powerful aid in evaluating the clinical course or prognosis of patients with oral cancer.

S100A4 has been implicated in the malignant phenotype of tumor cells, including cell motility, but the biological function is hardly known. A recent study suggests that S100A4-induced invasiveness in malignant tumor cells is partially caused by down-regulation of E-cadherin. To clarify the clinical significance of S100A4 and its association with E-cadherin-mediated cell-to-cell adhesion system, we examined their protein expressions in non-small cell lung cancer (NSCLC) specimens using immunohistochemical techniques. Expression of S100A4 was observed in 81 (60%) of 135 NSCLCs and correlated with progression of the pathological T factor (p<0.001), lymph node metastasis (p<0.005), and poor survival (p<0.05). Reduced expression of E-cadherin, alpha-catenin, and beta-catenin was observed in 64% (87 of 135), 50% (43 of 86), and 58% (50 of 86) of the specimens tested, respectively. The expression of E-cadherin closely correlated with differentiation and inversely with that of S100A4. Among these adhesion-associated molecules we found that alpha-catenin appeared to reflect most strikingly the presence of lymph node metastasis and the short survival periods of NSCLC patients. Furthermore, patients who showed S100A4-positive/alpha-catenin-negative expression had a significantly shorter survival than the patients with S100A4-negative/alpha-catenin-positive expression. These results indicate that S100A4, as well as alpha-catenin, plays a role in the progression and metastasis of NSCLCs and that simultaneous immunohistochemical detection of their expression may be useful to define a subpopulation of lung cancer patients with a possible poor prognosis.

The relationship between vascular endothelial growth factor (VEGF) and lymph node metastasis was studied in 90 cases of primary lung cancer without distant metastasis. As a result of quantitative reverse transcription polymerase chain reaction (RT-PCR) analysis, the VEGF121 mRNA expression levels in lung cancer tissues with nodal metastasis (n = 35) were higher than in those without nodal metastasis (n = 55). However, no significant difference could be found in VEGF121 mRNA expression levels as stratified by tumour size (T1N0M0 vs T2N0M0). Simultaneously, ten lymph nodes (four node positive and six node negative) together with the corresponding primary lung tumours and adjacent normal lung tissue, were studied for VEGF expression. The VEGF mRNA expression in metastatic lymph nodes was intense in three out of the four cases examined. Further, while VEGF expression levels in metastatic lymph nodes were conspicuously higher than those for the primary site, all its expression levels in non-metastatic nodes were inferior to those of the primary tumours. Except for macrophages, the VEGF antigen was identified mainly in the cytoplasm of metastatic cancer cells and the endothelial cells of blood or lymphatic vessels in lymph nodes. Although the detailed mechanisms and the significance of strong VEGF expressions in metastatic lymph nodes are still unknown, these data are consistent with a model whereby VEGF increases the opportunity for nodal metastasis through neoblood and lymphatic vessels.

Apolipoprotein E receptor 2 is a recently identified receptor that resembles low and very low density lipoprotein receptors. Isolation and characterization of genomic clones encoding human apolipoprotein E receptor 2 revealed that the gene spans ~60 kilobases and contains 19 exons. The positions of the exon/intron boundaries of the gene are almost identical to those of low and very low density lipoprotein receptors. Fluorescent in situ hybridization of human chromosomes revealed that the gene is located on chromosome 1p34. Isolation of a cDNA encoding a variant receptor and reverse transcription-polymerase chain reaction indicate the presence of multiple variants with different numbers of cysteine-rich repeats in the binding domain of the receptor. We also found a variant receptor lacking a 59-amino acid insertion in the cytoplasmic domain. The transcription start site was mapped to the position 236 base pairs upstream of the AUG translation initiator codon by primer extension analysis. Sequence inspection of the 5′-flanking region revealed potential DNA elements: AP-2, GC factor, PEA3, and Sp1. The minimal promoter region and a region required for nerve growth factor inducibility in PC12 cells were also determined. Apolipoprotein E receptor 2 is a recently identified receptor that resembles low and very low density lipoprotein receptors. Isolation and characterization of genomic clones encoding human apolipoprotein E receptor 2 revealed that the gene spans ~60 kilobases and contains 19 exons. The positions of the exon/intron boundaries of the gene are almost identical to those of low and very low density lipoprotein receptors. Fluorescent in situ hybridization of human chromosomes revealed that the gene is located on chromosome 1p34. Isolation of a cDNA encoding a variant receptor and reverse transcription-polymerase chain reaction indicate the presence of multiple variants with different numbers of cysteine-rich repeats in the binding domain of the receptor. We also found a variant receptor lacking a 59-amino acid insertion in the cytoplasmic domain. The transcription start site was mapped to the position 236 base pairs upstream of the AUG translation initiator codon by primer extension analysis. Sequence inspection of the 5′-flanking region revealed potential DNA elements: AP-2, GC factor, PEA3, and Sp1. The minimal promoter region and a region required for nerve growth factor inducibility in PC12 cells were also determined.

We molecularly cloned a cDNA coding for a novel phosphotyrosine molecule with a 70 kDa molecular mass, named STAM (signal transducing adaptor molecule), which is tyrosine-phosphorylated rapidly after stimulation with various cytokines such as IL-2, IL-3, IL-4, IL-7, GM-CSF, EGF and PDGF. STAM contains an SH3 (Src-homology 3) domain and the ITAM (immunoreceptor tyrosine-based activation motif), suggesting that STAM acts as an adaptor molecule involved in signal transducing pathways from the cytokine receptors.

Tertiary amine was covalently bonded to a polystyrene fiber and examined for antibacterial activity. The tertiary amine covalently bonded to a polystyrene fiber (TAF) showed a high antimicrobial activity against Escherichia coli. TAF exhibited a stronger antibacterial activity against gram-negative bacteria (E. coli, Pseudomonas aeruginosa, Klebsiella pneumoniae, Salmonella typhimurium, and Serratia marcescens) than against gram-positive bacteria (Staphylococcus aureus and Streptococcus faecalis) or Candida albicans. This activity against E. coli was accentuated by 0.1% deoxycholate or 10 mg of actinomycin D per ml, to which E. coli is normally not susceptible. This implies that TAF causes an increase of the bacterial outer membrane permeability. On the other hand, the antimicrobial activity was inhibited by adding Mg2+ or by lowering the pH. This suggest an electrostatic interaction between the bacterial cell wall and TAF. Scanning electron microscopy showed that E. coli cells were initially attached to TAF, with many projections on the cell surface, but then were apparently lysed after contact for 4 h. Taken together, these results imply that bacteria initially interact with TAF by an electrostatic force between the anionic bacterial outer membrane and the cationic tertiary amine residues of TAF and that longer contact with TAF damages the bacterial outer membrane structure and increases its permeability.

E-cadherin (ECD) is known to be an invasion suppressor gene, and urokinase-type plasminogen activator (uPA) plays a central role in infiltration of solid cancers.To elucidate the relationship between expression of these factors and metastasis in patients with gastric cancer, the authors examined immunohistochemically a combination analysis of uPA and E-cadherin expression in 98 primary tumors, and the results were correlated with several parameters related to metastasis.Among 125 tumors, 42 (34%) were evaluated as having E-cadherin expression (E-cadherin-positive), and the other 83 (66%) were defined as having reduced E-cadherin expression (E-cadherin-negative). uPA immunoreactivity was observed in 82 tumors (66%). There were four subtypes of patterns of uPA and E-cadherin expression: 22 uPA-negative/E-cadherin-positive, 17 uPA-negative/E-cadherin-negative, 21 uPA-positive/E-cadherin-positive, and 65 uPA-positive/E-cadherin-negative, uPA overexpression and reduced E-cadherin expression were associated with lymph node metastasis, vessel invasion, serosal involvement, and poor prognosis. In addition, uPA-positive/E-cadherin-negative tumors were associated significantly with large tumors, positive serosal invasion, lymph node involvement, and poor prognosis. Patients with uPA-positive/E-cadherin-negative expression had the poorest prognoses, compared with the three other groups of patients uPA-positive/E-cadherin-negative tumors had a fourfold relative risk of death when compared with uPA-negative/E-cadherin-positive tumors. A Cox proportional hazard model projected lymph node status as the strongest of the prognostic variables followed by DNA ploidy patterns and uPA/E-cadherin tissue status.These results indicate that immunohistochemical combination analysis of uPA and E-cadherin expression may be a powerful aid in evaluating metastatic potential or the prognosis of patients with gastric cancer.

Adiponectin is an anti-inflammatory cytokine that is specifically and abundantly produced by adipocytes as a secretory protein. A direct interaction between adiponectin and lipopolysaccharide (LPS) is not fully understood. To elucidate the effects of adiponectin on LPS, we first investigated interactions between recombinant adiponectin and LPS.Various concentrations of LPS (50, 500, and 5000 pg/ml) and recombinant adiponectin (1, 10, and 100 microg/ml) were incubated for 1 h. The limulus amoebocyte lysate (LAL) activities in the mixture were measured. Interactions between adiponectin (100 microg/ml) and LPS (100 and 300 microg/ml) were also analyzed in Western blotting. Next, we determined plasma adiponectin, tumor necrosis factor-alpha (TNF-alpha), and endotoxin levels at 1.5, 3, and 24 h after onsets of rodent polymicrobial sepsis induced by cecal ligation and puncture (CLP).The incubation with adiponectin significantly and dose-dependently suppressed LAL activity in the mixture compared to control. Western blotting revealed that adiponectin incubated with LPS shifted to a higher mass. In the animal model of sepsis, both plasma endotoxin and TNF-alpha levels after CLP gradually increased and were significantly higher at 3, 24 h compared to those after sham operation. On the contrary, plasma adiponectin levels after CLP gradually decreased and were significantly lower at 3, 24 h compared to those after sham operation. Plasma adiponectin levels were negatively correlated with plasma endotoxin levels (r = -0.77, P < 0.01).Our results indicate that adiponectin might neutralize LPS in vitro and diminish LPS activity in rats with polymicrobial sepsis. These findings suggest that the anti-inflammatory effects of adiponectin are in part likely because of neutralization of LPS activity.

Recent research has raised questions regarding the consistency of unrealistic optimism and related self-enhancing tendencies, both within cultures and across cultures. The current study tested whether the method used to assess unrealistic optimism influenced cross-cultural patterns in the United States and Japan. The results showed that the direct method (a single comparison judgment between self and peers) produced similar patterns across cultures because of cognitive biases (e.g., egocentrism); specifically, participants were unrealistically optimistic about experiencing infrequent/negative events but pessimistic about experiencing frequent/ negative events. However, the indirect method (separate self- and peer judgments) produced different patterns across cultures because culturally specific motivational biases emerged using this method; specifically, the U.S. sample was more unrealistically optimistic than the Japanese sample. The authors discuss how these results might influence the interpretation of previous findings on culture and self-enhancement.