Ta‐Yuan Chang

Niemann-Pick type C (NP-C) disease, a fatal neurovisceral disorder, is characterized by lysosomal accumulation of low density lipoprotein (LDL)–derived cholesterol. By positional cloning methods, a gene ( NPC1) with insertion, deletion, and missense mutations has been identified in NP-C patients. Transfection of NP-C fibroblasts with wild-type NPC1 cDNA resulted in correction of their excessive lysosomal storage of LDL cholesterol, thereby defining the critical role of NPC1 in regulation of intracellular cholesterol trafficking. The 1278–amino acid NPC1 protein has sequence similarity to the morphogen receptor PATCHED and the putative sterol-sensing regions of SREBP cleavage-activating protein (SCAP) and 3-hydroxy-3-methyl-glutaryl coenzyme A (HMG-CoA) reductase.

Mammalian cells acquire cholesterol from low-density lipoprotein (LDL) and from endogenous biosynthesis. The roles of the Niemann-Pick type C1 protein in mediating the endosomal transport of LDL-derived cholesterol and endogenously synthesized cholesterol are discussed. Excess cellular cholesterol is converted to cholesteryl esters by the enzyme acyl-coenzyme A:cholesterol acyltransferase (ACAT) 1 or is removed from a cell by cellular cholesterol efflux at the plasma membrane. A close relationship between the ACAT substrate pool and the cholesterol efflux pool is proposed. Sterol-sensing domains (SSDs) are present in several membrane proteins, including NPC1, HMG-CoA reductase, and the SREBP cleavage-activating protein. The functions of SSDs are described. ACAT1 is an endoplasmic reticulum cholesterol sensor and contains a signature motif characteristic of the membrane-bound acyltransferase family. The nonvesicular cholesterol translocation processes involve the START domain proteins and the oxysterol binding protein-related proteins (ORPs). The properties of these proteins are summarized.

Due to its presumed role in regulating cellular cholesterol homeostasis, and in various pathophysiological conditions, acyl-coenzyme A:cholesterol acyltransferase (ACAT) has attracted much attention. Cloning the ACAT gene provides the necessary tool to advance molecular studies of this enzyme. The topics reviewed in this chapter include the pathophysiological roles of ACAT, the biochemistry and molecular biology of the ACAT protein and the ACAT gene, and the mode of regulation by sterol or nonsterol agents in mammalian cells. In addition, we present a working model linking the presumed allosteric property of ACAT with cholesterol trafficking into and out of the endoplasmic reticulum.

The enzymes acyl-coenzyme A (CoA):cholesterol acyltransferases (ACATs) are membrane-bound proteins that utilize long-chain fatty acyl-CoA and cholesterol as substrates to form cholesteryl esters. In mammals, two isoenzymes, ACAT1 and ACAT2, encoded by two different genes, exist. ACATs play important roles in cellular cholesterol homeostasis in various tissues. This chapter summarizes the current knowledge on ACAT-related research in two areas: 1) ACAT genes and proteins and 2) ACAT enzymes as drug targets for atherosclerosis and for Alzheimer's disease.

Accumulation of cholesterol esters as cytoplasmic lipid droplets within macrophages and smooth muscle cells is a characteristic feature of early lesions of atherosclerotic plaque. Intracellularly, an essential element in forming cholesterol ester from cholesterol is the enzyme acyl-coenzyme A:cholesterol acyltransferase (ACAT). ACAT is a membrane protein located in the endoplasmic reticulum. The ACAT protein has never been purified to homogeneity, and no antibodies directed against ACAT have been reported. The gene(s) encoding this enzyme had not been isolated. This laboratory had previously reported the isolation of Chinese hamster ovary cells expressing human ACAT activity. From DNAs of these cells, we have cloned a 1.2-kb exonic human genomic DNA. This led to the eventual cloning of a 4-kb cDNA clone (K1) from a human macrophage cDNA library. Transfection of K1 in ACAT-deficient mutant Chinese hamster ovary cells complemented the mutant defect and resulted in the expression of human ACAT activity. K1 contained an open reading frame of 1650 bp encoding an integral membrane protein of 550 amino acids. Protein homology analysis showed that the predicted K1 protein shared homologous peptide sequences with other enzymes involved in the catalysis of acyl adenylate formation followed by acyl thioester formation and acyl transfer. These results indicate that K1 encodes a structural gene for ACAT. The cDNA reported here should facilitate future molecular studies on ACAT.

Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is an intracellular enzyme that produces cholesteryl esters in various tissues. In mammals, two ACAT genes (ACAT1 and ACAT2) have been identified. Together, these two enzymes are involved in storing cholesteryl esters as lipid droplets, in macrophage foam-cell formation, in absorbing dietary cholesterol, and in supplying cholesteryl esters as part of the core lipid for lipoprotein synthesis and assembly. The key difference in tissue distribution of ACAT1 and ACAT2 between humans, mice and monkeys is that, in adult human liver (including hepatocytes and bile duct cells), the major enzyme is ACAT1, rather than ACAT2. There is compelling evidence implicating a role for ACAT1 in macrophage foam-cell formation, and for ACAT2 in intestinal cholesterol absorption. However, further studies at the biochemical and cell biological levels are needed in order to clarify the functional roles of ACAT1 and ACAT2 in the VLDL or chylomicron synthesis/assembly process.

Niemann–Pick type C (NPC) 1 protein plays important roles in moving cholesterol and other lipids out of late endosomes by means of vesicular trafficking, but it is not known whether NPC1 directly interacts with cholesterol. We performed photoaffinity labeling of intact cells expressing fluorescent protein (FP)-tagged NPC1 by using [ 3 H]7,7-azocholestanol ([ 3 H]AC). After immunoprecipitation, 3 H-labled NPC1-GFP appeared as a single band. Including excess unlabeled sterol to the labeling reaction significantly diminished the labeling. Altering the NPC1 sterol-sensing domain (SSD) with loss-of-function mutations (P692S and Y635C) severely reduced the extent of labeling. To further demonstrate the specificity of labeling, we show that NPC2, a late endosomal/lysosomal protein that binds to cholesterol with high affinity, is labeled, whereas mutant NPC2 proteins inactive in binding cholesterol are not. Vamp7, an abundant late endosomal membrane protein without an SSD but with one transmembrane domain, cannot be labeled. Binding between [ 3 H]AC and NPC1 does not require NPC2. Treating cells with either U-18666A, a compound that creates an NPC-like phenotype, or with bafilomycin A1, a compound that raises late endosomal pH, has no effect on labeling of NPC1-YFP, suggesting that both drugs affect processes other than NPC1 binding to cholesterol. We also developed a procedure to label the NPC1-YFP by [ 3 H]AC in vitro and showed that cholesterol is more effective in protection against labeling than its analogs epicholesterol or 5-α-cholestan. Overall, the results demonstrate that there is direct binding between NPC1 and azocholestanol; the binding does not require NPC2 but requires a functional SSD within NPC1.

Niemann-Pick type C (NPC) is a disease that affects intracellular cholesterol-trafficking pathways. By cloning the hamster ortholog of NPC1, we identified the molecular lesions in two independently isolated Chinese hamster ovary cell mutants, CT60 and CT43. Both mutants lead to premature translational terminations of the NPC1 protein. Transfecting hamster NPC1cDNA complemented the defects of the mutants. Investigation of the CT mutants, their parental cells, and an NPC1-stable transfectant allow us to present evidence that NPC1 is involved in a post-plasma membrane cholesterol-trafficking pathway. We found that the initial movement of low density lipoprotein (LDL)-derived cholesterol to the plasma membrane (PM) did not require NPC1. After reaching the PM and subsequent internalization, however, cholesterol trafficking back to the PM did involve NPC1. Both LDL-derived cholesterol and cholesterol originating from the PM accumulated in a dense, intracellular compartment in the CT mutants. Cholesterol movement from this compartment to the PM or endoplasmic reticulum was defective in the CT mutants. Our results functionally distinguish the dense, intracellular compartment from the early endocytic hydrolytic organelle and imply that NPC1 is involved in sorting cholesterol from the intracellular compartment back to the PM or to the endoplasmic reticulum. Niemann-Pick type C (NPC) is a disease that affects intracellular cholesterol-trafficking pathways. By cloning the hamster ortholog of NPC1, we identified the molecular lesions in two independently isolated Chinese hamster ovary cell mutants, CT60 and CT43. Both mutants lead to premature translational terminations of the NPC1 protein. Transfecting hamster NPC1cDNA complemented the defects of the mutants. Investigation of the CT mutants, their parental cells, and an NPC1-stable transfectant allow us to present evidence that NPC1 is involved in a post-plasma membrane cholesterol-trafficking pathway. We found that the initial movement of low density lipoprotein (LDL)-derived cholesterol to the plasma membrane (PM) did not require NPC1. After reaching the PM and subsequent internalization, however, cholesterol trafficking back to the PM did involve NPC1. Both LDL-derived cholesterol and cholesterol originating from the PM accumulated in a dense, intracellular compartment in the CT mutants. Cholesterol movement from this compartment to the PM or endoplasmic reticulum was defective in the CT mutants. Our results functionally distinguish the dense, intracellular compartment from the early endocytic hydrolytic organelle and imply that NPC1 is involved in sorting cholesterol from the intracellular compartment back to the PM or to the endoplasmic reticulum. Niemann Pick Type C low density lipoprotein plasma membrane Chinese hamster ovary endoplasmic reticulum SREBP cleavage-activating protein acyl-coenzyme A:cholesterol transferase wild-type reverse transcriptase rapid amplification of cDNA ends [3H]cholesteryl linoleate-labeled LDL [3H]cholesterol/phospholipid green fluorescent protein phosphate-buffered saline base pair polymerase chain reaction kilobase cyclodextrin hamster NPC1 Niemann-Pick type C (NPC)1 is an autosomal recessive, neurovisceral disease. The hallmark of the NPC syndrome is the intracellular accumulation of unesterified cholesterol and other lipids in various tissues and organs (1.Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill Inc., New York1995: 2625-2639Google Scholar). In NPC fibroblasts, delayed homeostatic responses toward the regulatory effects of low density lipoprotein (LDL)-derived cholesterol have been demonstrated (2.Pentchev P.G. Comly M.E. Kruth H.S. Tokoro J. Butler J. Sokol M. Filling-Katz M. Quirk J.M. Marshall D.C. Patel S. Vanier M.T. Brady R.O. FASEB J. 1987; 1: 40-45Crossref PubMed Scopus (149) Google Scholar, 3.Liscum L. Faust J.R. J. Biol. Chem. 1987; 262: 17002-17008Abstract Full Text PDF PubMed Google Scholar). In these cells, the movement of LDL-derived cholesterol from the cell interior to the plasma membrane (PM) is defective (4.Liscum L. Ruggiero R.M. Faust J.R. J. Cell Biol. 1989; 108: 1625-1636Crossref PubMed Scopus (242) Google Scholar, 5.Neufeld E.B. Cooney A.M. Pitha J. Dawidowicz E.A. Dwyer N.K. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1996; 271: 21604-21613Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar). Pentchev and colleagues (1.Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill Inc., New York1995: 2625-2639Google Scholar, 2.Pentchev P.G. Comly M.E. Kruth H.S. Tokoro J. Butler J. Sokol M. Filling-Katz M. Quirk J.M. Marshall D.C. Patel S. Vanier M.T. Brady R.O. FASEB J. 1987; 1: 40-45Crossref PubMed Scopus (149) Google Scholar) undertook the positional cloning strategy and discovered the human NPC1 gene, thus providing a major breakthrough toward understanding the NPC disease at the molecular and cellular level (6.Carstea E.D. Morris J.A. Coleman K.G. Loftus S.K. Zhang D. Cummings C. Gu J. Rosenfeld M.A. Pavan W.J. Krizman D.B. Nagle J. Polymeropoulos M.H. Sturley S.L. Ioannou Y.A. Higgins M.E. Comly M. Cooney A. Brown A. Kaneski C.R. Blanchette-Mackie E.J. Dwyer N.K. Neufeld E.B. Chang T.Y. Liscum L. Strauss III, J.F. Ohno K. Zeigler M. Carmi R. Sokol J. Markie D. O'Neill R.R. Van Diggelen O.P. Elleder M. Patterson M.C. Brady R.O. Vanier M.T. Pentchev P.G. Tagle D.A. Science. 1997; 277: 228-231Crossref PubMed Scopus (1230) Google Scholar). The final cloning work involved the identification of a 300-kb human genomic DNA containing the candidate NPC1gene (7.Gu J.Z. Carstea E.D. Cummings C. Morris J.A. Loftus S.K. Zhang D. Coleman K.G. Cooney A.M. Comly M.E. Fandino L. Roff C. Tagle D.A. Pavan W.J. Pentchev P.G. Rosenfeld M.A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7378-7383Crossref PubMed Scopus (24) Google Scholar). This unique DNA was identified by its ability to complement the defect of a previously isolated Chinese hamster ovary (CHO) cholesterol-trafficking cell mutant, CT60 (8.Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). The humanNPC1 gene encodes an integral membrane protein with 1278 amino acids and contains the “sterol-sensing domain” (9.Watari H. Blanchette-Mackie E.J. Dwyer N.K. Watari M. Neufeld E.B. Patel S. Pentchev P.G. Strauss III, J.F. J. Biol. Chem. 1999; 274: 21861-21866Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar), identified in several other integral membrane proteins that respond to endoplasmic reticulum (ER) cholesterol (10.Kumagai H. Chun K.T. Simoni R.D. J. Biol. Chem. 1995; 270: 19107-19113Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar, 11.Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Cell. 1996; 87: 415-426Abstract Full Text Full Text PDF PubMed Scopus (427) Google Scholar). In mammalian cells, LDL binds to its receptor and internalizes and enters the endosomes/lysosomes for hydrolysis of the lipid cargo cholesteryl esters (12.Brown M.S. Goldstein J.L. Science. 1986; 232: 34-47Crossref PubMed Scopus (4383) Google Scholar). It is currently believed that the movement of LDL-derived cholesterol from the hydrolytic organelle to the PM is defective in NPC cells, ultimately leading to cholesterol accumulation in the lysosomes (4.Liscum L. Ruggiero R.M. Faust J.R. J. Cell Biol. 1989; 108: 1625-1636Crossref PubMed Scopus (242) Google Scholar, 5.Neufeld E.B. Cooney A.M. Pitha J. Dawidowicz E.A. Dwyer N.K. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1996; 271: 21604-21613Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar). More recent evidence at the microscopic level, however, illustrates that in NPC cells, cholesterol instead accumulates in the late endosomes (13.Neufeld E.B. Wastney M. Patel S. Suresh S. Cooney A.M. Dwyer N.K. Roff C.F. Ohno K. Morris J.A. Carstea E.D. Incardona J.P. Strauss III, J.F. Vanier M.T. Patterson M.C. Brady R.O. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1999; 274: 9627-9635Abstract Full Text Full Text PDF PubMed Scopus (334) Google Scholar, 14.Kobayashi T. Beuchat M.H. Lindsay M. Frias S. Palmiter R.D. Sakuraba H. Parton R.G. Gruenberg J. Nat. Cell Biol. 1999; 1: 113-118Crossref PubMed Scopus (251) Google Scholar). Another study showed that in NPC-like cells, the movement of LDL-derived cholesterol from the lysosomes to the PM is not defective (15.Lange Y. Ye J. Steck T.L. J. Biol. Chem. 1998; 273: 18915-18922Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). This study also demonstrates a slow equilibrium between the PM and the abnormal, buoyant lysosomes present in the NPC-like cells when cells are overloaded with cholesterol. However, this study did not clearly identify at what step the cholesterol-trafficking defect may be in these NPC-like cells. The NPC1 protein may be also involved in translocating cholesterol from the PM to the ER for esterification (16.Pentchev P.G. Comley M.E. Kruth H.S. Vanier M.T. Wenger D.A. Patel S. Brady R.O. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 8247-8251Crossref PubMed Scopus (327) Google Scholar, 17.Spillane D.M. Reagan Jr., J.W. Kennedy N.J. Schneider D.L. Chang T.Y. Biochim. Biophys. Acta. 1995; 1254: 283-294Crossref PubMed Scopus (20) Google Scholar). How NPC1 mediates this step is not clear. Thus, based on current literature, it is not obvious what actual step(s) in the LDL cholesterol-trafficking pathway cause cholesterol accumulation in NPC cells. In this work, we used two independently isolated cholesterol-trafficking mutants defective in NPC1, an NPC1 stable transfectant and their parental cells as tools to examine the role of NPC1 in intracellular cholesterol trafficking. We then provide evidence that NPC1 is involved in post-PM cholesterol trafficking, that is NPC1 cycles cholesterol from an intracellular compartment to the PM or to the ER after, but not prior to, newly hydrolyzed LDL-derived cholesterol appears in the PM. Our results allow us to explain the discrepancies that currently exist among various laboratories. The parental cell 25RA is a CHO cell line resistant to the cytotoxicity of 25-hydroxycholesterol (18.Chang T.Y. Limanek J.S. J. Biol. Chem. 1980; 255: 7787-7795Abstract Full Text PDF PubMed Google Scholar) and contains a gain of function mutation in the SREBP cleavage-activating protein (SCAP) (11.Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Cell. 1996; 87: 415-426Abstract Full Text Full Text PDF PubMed Scopus (427) Google Scholar). Mutant CT43 was isolated along with CT60 (8.Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar) but was uncharacterized until this study. Cell hybridization studies revealed that CT60 and CT43 belong to the same complementation group (data not shown). Cells were grown in medium A (Ham's F-12, 10% fetal bovine serum) as monolayers at 37 °C with 5% CO2 unless stated otherwise. When used at 37 °C, medium D refers to Ham's F-12 with 5% delipidated fetal bovine serum (19.Chin J. Chang T.Y. J. Biol. Chem. 1981; 256: 6304-6310Abstract Full Text PDF PubMed Google Scholar), 35 μm oleic acid, 1.5 mm CaCl2; when used at 17–19 °C or at 4 °C, medium D refers to the same medium without sodium bicarbonate and with 15 mm HEPES, pH 7. [1,2-3H]Cholesterol (50 Ci/mmol) was from American Radiolabeled Chemicals; [1,2,6,7-3H]cholesteryl linoleate (30–60 Ci/mmol) was from Amersham Pharmacia Biotech; 2-hydroxypropyl-β-cyclodextrin (used for the cholesterol efflux studies) was from Sigma; methyl β-cyclodextrin (used for the [3H]cholesterol labeling studies) was a gift from Cerestar (Hammond, IN); the acyl-coenzyme A:cholesterol transferase (ACAT) inhibitor CI976 (20.Sliskovic D.R. White A.D. Trends Pharmacol. Sci. 1991; 12: 194-199Abstract Full Text PDF PubMed Scopus (237) Google Scholar) was a gift of Parke-Davis. All media contained 10 μg/ml gentamicin. Total RNA was prepared from wild-type (WT) CHO cells by using Trizol reagent (Life Technologies, Inc.); the first strand cDNA was synthesized using SuperScript II reverse transcriptase (RT) and oligo(dT)12–18 (Life Technologies, Inc.). Based on the human and mouse NPC1 nucleotide sequence (6.Carstea E.D. Morris J.A. Coleman K.G. Loftus S.K. Zhang D. Cummings C. Gu J. Rosenfeld M.A. Pavan W.J. Krizman D.B. Nagle J. Polymeropoulos M.H. Sturley S.L. Ioannou Y.A. Higgins M.E. Comly M. Cooney A. Brown A. Kaneski C.R. Blanchette-Mackie E.J. Dwyer N.K. Neufeld E.B. Chang T.Y. Liscum L. Strauss III, J.F. Ohno K. Zeigler M. Carmi R. Sokol J. Markie D. O'Neill R.R. Van Diggelen O.P. Elleder M. Patterson M.C. Brady R.O. Vanier M.T. Pentchev P.G. Tagle D.A. Science. 1997; 277: 228-231Crossref PubMed Scopus (1230) Google Scholar, 21.Loftus S.K. Morris J.A. Carstea E.D. Gu J.Z. Cummings C. Brown A. Ellison J. Ohno K. Rosenfeld M.A. Tagle D.A. Pentchev P.G. Pavan W.J. Science. 1997; 277: 232-235Crossref PubMed Scopus (705) Google Scholar), primers were designed to amplify the internal hamster NPC1 cDNA by PCR. By using the primer set (forward primer, CTGTGTTTGGTATGGAGAGTGTGGAATTGC; reverse primer, GCAGCATGTCCCCCTTTGCCGCACTTGGGG), a 2.9-kb product was subcloned intopGEM-T vector (Promega) and sequenced using at least three independent clones. Rapid amplification of the 5′- and 3′-cDNA ends (5′-RACE and 3′-RACE) was performed using Marathon cDNA Amplification system (CLONTECH). Poly(A)+ RNA was isolated from WT CHO cells using the kit from Invitrogen. Double-stranded cDNA was synthesized and ligated to adaptor cDNA to serve as a template. The gene-specific 5′ end primer (GCCGAAGAAGAATCCTGGGCAGAGTTCC) and 3′ end primer (CTCTACAACGCCACTCACCAGTTTTGC) were employed to generate the 5′- and 3′-RACE products, respectively. The amplified products were sequenced using three independent clones. The full-length hamsterhmNPC1 cDNA sequence has been submitted to GenBankTM. For transfection studies, the full-lengthhmNPC1 cDNA was released from the pGEM vector with EagI and SpeI. This cDNA fragment was then inserted into the expression vector pcDNA3(Invitrogen) linearized with NotI and XbaI. The expression construct was named phmNPC1. cDNA covering the coding region ofhmNPC1 was divided into five overlapping regions (size averaging 1.0 kb) and was amplified by PCR. The primer sets used were as follows (forward and reverse, respectively): set 1, GGTGGACGGCAAGCAGAACCGCGGTCGGTA/TAAACATGCGTCTCAGACAGTCAT; set 2, CTGCCAGGACTGCTCCATTGTCTG/TATAGTAATTATCGACAGGGAAGG; set 3, CAAGAACTGCACCATTATAAGTGT/AGCTCTCAGAGGCCTGGATGCCT; set 4, CCCCTACAATGTTCCTTTCTTCCT/CTGGCTATTAGCCGAGCTTTCTTC; and set 5, TTTTGCAATGCTTCTGTGATTGAC/TTTCCATAATACTGCTTCACAAGTCACAGG. In addition, T7 or SP6 promoter sequences were introduced into forward or reverse primers, respectively. Non-isotopic RNase cleavage assays were performed with the Mismatch Detect II Kit according to the instruction manual supplied by Ambion. Total RNA was isolated from WT, CT60, and CT43 CHO cells, and cDNAs were synthesized to serve as templates. Each amplified region using the primer sets described above was transcribed in vitro by T7 or SP6 polymerase to generate sense or antisense RNA. The resulting RNA from the same region was cross-hybridized. Hybridized RNA containing the mutation was subject to cleavage by RNase and was identifiable by electrophoresis on 1.2% agarose gel. Region 1 of NPC1 RNA from CT60 cells and region 4 of NPC1 RNA from CT43 cells showed susceptibility to RNase cleavage; mutations within these regions were identified by sequencing PCR products corresponding to these regions. Cells in 6-well dishes at 50–60% confluency were transfected using LipofectAMINE (Life Technologies, Inc.). Cells were transiently co-transfected with 2 μg of DNA/well of phmNPC1 or empty vectorpcDNA3, along with 0.2 μg of pEGFP-N3(CLONTECH). Candidate-stable transfectants expressing phmNPC1 were selected from the G418-resistant colonies based on the presence of cytoplasmic cholesteryl ester lipid droplets visible under a light microscope (8.Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). CT43 cells do not possess such a phenotype because cholesterol is unable to reach the ER to be esterified by ACAT. Each candidate transfectant clone was subjected to four rounds of recloning. One clone, CT43NPC1, exhibited a stable phenotype and was characterized as reported here. Filipin staining was performed as described (8.Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). LDL and [3H]cholesteryl linoleate-labeled LDL ([3H]CL-LDL), specific radioactivity ranging between 5 and 15 μCi/mg protein, were prepared as described (8.Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). After labeling, labeled cellular lipids were analyzed by TLC; the percent hydrolysis and the percent reesterification were calculated as described (8.Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). For cholesterol efflux experiments, cells were incubated with 2% cyclodextrin in medium D at 37 °C for the indicated times. The media were centrifuged to remove cellular debris; labeled lipids were extracted and analyzed as described (8.Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). The percent cholesterol efflux was calculated as the amount of [3H]cholesterol in medium divided by the sum of [3H]cholesterol and [3H]cholesteryl oleate in cell extract and [3H]cholesterol in medium. Protein determinations were as described (22.Peterson G.L. Anal. Biochem. 1977; 83: 346-356Crossref PubMed Scopus (7142) Google Scholar). The PMs were labeled with [3H]cholesterol by using one of three methods (15.Lange Y. Ye J. Steck T.L. J. Biol. Chem. 1998; 273: 18915-18922Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 17.Spillane D.M. Reagan Jr., J.W. Kennedy N.J. Schneider D.L. Chang T.Y. Biochim. Biophys. Acta. 1995; 1254: 283-294Crossref PubMed Scopus (20) Google Scholar, 23.Christian A.E. Haynes M.P. Phillips M.C. Rothblat G.H. J. Lipid Res. 1997; 38: 2264-2272Abstract Full Text PDF PubMed Google Scholar) as follows: (a) [3H]cholesterol/phospholipid ([3H]CH/PC) liposomes (2 μCi, 40 pmol of cholesterol in 2 ml of medium D at 37 °C for 3–4 h); (b) 5 mm methyl β-cyclodextrin:[3H]cholesterol at molar ratio 8:1 (1.2 μCi, 620 pmol of cholesterol in 1 ml of medium D at 4 °C for 90 min); and (c) [3H]cholesterol in 0.025% Triton WR1339 in PBS (1 μCi, 20 pmol of cholesterol in 1 ml of PBS at 4 °C for 120 min). Before labeling at 4 °C, cells were pre-chilled for 30 min. Labeled cellular lipids were analyzed as described (17.Spillane D.M. Reagan Jr., J.W. Kennedy N.J. Schneider D.L. Chang T.Y. Biochim. Biophys. Acta. 1995; 1254: 283-294Crossref PubMed Scopus (20) Google Scholar). These were based upon previously described methods with modifications (4.Liscum L. Ruggiero R.M. Faust J.R. J. Cell Biol. 1989; 108: 1625-1636Crossref PubMed Scopus (242) Google Scholar,17.Spillane D.M. Reagan Jr., J.W. Kennedy N.J. Schneider D.L. Chang T.Y. Biochim. Biophys. Acta. 1995; 1254: 283-294Crossref PubMed Scopus (20) Google Scholar). Cells grown in 150-mm dishes were washed 3 times with cold PBS, scraped, and centrifuged. The cell pellets were resuspended in 500 μl of buffer A (250 mm sucrose, 20 mm HEPES, and 1 mm EDTA, pH 7.3) and homogenized on ice with tight-fitting, 1-ml Dounce homogenizers (Kontes); 50–100 strokes were needed to ensure extensive cell breakage. Postnuclear supernatants (800 μl) were layered onto 9 ml of 11% (v/v) Percoll in buffer A and centrifuged (20,000 × g, 40 min, 4 °C) using a Beckman model 50Ti rotor. Ten fractions were collected from the top. As determined by immunoblot analysis, more than 80% of the PM marker (Na+/K+-ATPase α-1) was concentrated in fractions 1 and 2, whereas more than 80% of the late endosomal/lysosomal marker (LAMP-1) and the lysosomal marker (LAMP-2) were concentrated in fractions 9 and 10. Anti-Na+/K+-ATPase α-1 was from Upstate Biotechnology, Inc.; anti-LAMP-1 and anti-LAMP-2 were from Santa Cruz Biotechnology. This was according to procedures described in the booklet by CLONTECH Laboratories on quantitative RT-PCR, using total RNA from 25RA, CT43, and CT43NPC1 cells. The PCR primer set, CGGGTCCACCCTGTGTACTTCGTTGTGG(f)/AGGTTAAAGATGGTGTCATCAATG(r) flanks the region deleted from CT43 NPC1 mRNA such that a shorter product (524 bp) is produced from mutant mRNA, whereas a longer product (640 bp) is produced from WT mRNA. To serve as an internal standard, a region (371 bp) of α-tubulin RNA was amplified with the primer set AGTGCACAGGTCTTCAGGGCTTCTT (f)/GGTCAACATTCAGGGCTCCATCAAA(r). To begin to characterize the CT60 and CT43 mutants at the molecular level, we determined the hmNPC1 cDNA sequence from WT CHO cells by performing RT-PCR and 5′- and 3′-RACE. hmNPC1 cDNA encodes a protein of 1277 amino acids, sharing high homology with the human and mouse NPC1 proteins (6.Carstea E.D. Morris J.A. Coleman K.G. Loftus S.K. Zhang D. Cummings C. Gu J. Rosenfeld M.A. Pavan W.J. Krizman D.B. Nagle J. Polymeropoulos M.H. Sturley S.L. Ioannou Y.A. Higgins M.E. Comly M. Cooney A. Brown A. Kaneski C.R. Blanchette-Mackie E.J. Dwyer N.K. Neufeld E.B. Chang T.Y. Liscum L. Strauss III, J.F. Ohno K. Zeigler M. Carmi R. Sokol J. Markie D. O'Neill R.R. Van Diggelen O.P. Elleder M. Patterson M.C. Brady R.O. Vanier M.T. Pentchev P.G. Tagle D.A. Science. 1997; 277: 228-231Crossref PubMed Scopus (1230) Google Scholar, 21.Loftus S.K. Morris J.A. Carstea E.D. Gu J.Z. Cummings C. Brown A. Ellison J. Ohno K. Rosenfeld M.A. Tagle D.A. Pentchev P.G. Pavan W.J. Science. 1997; 277: 232-235Crossref PubMed Scopus (705) Google Scholar) with 87/94% and 92/96% identity/similarity, respectively. The hmNPC1 mutations in CT60 and CT43 cells were located by RNase cleavage assays followed by sequencing (see “Experimental Procedures”). The CT60 mutant contains a Cys to Thr mutation at nucleotide 355, causing premature translational termination after only 118 amino acids (Fig.1 A). Previous studies indicate that the NPC1 protein cannot be detected in CT60 cells by immunoblot analysis (24.Watari H. Blanchette-Mackie E.J. Dwyer N.K. Glick J.M. Patel S. Neufeld E.B. Brady R.O. Pentchev P.G. Strauss III, J.F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 805-810Crossref PubMed Scopus (127) Google Scholar, 25.Patel S.C. Suresh S. Kumar U. Hu C.Y. Cooney A. Blanchette-Mackie E.J. Neufeld E.B. Patel R. Brady R.O. Patel Y.C. Pentchev P.G. Ong W.Y. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 1657-1662Crossref PubMed Scopus (146) Google Scholar). The CT43 mutant contains a mutation that causes a 116-bp deletion from nucleotides 2796 to 2911 in exon 19 (26.Morris J.A. Zhang D. Coleman K.G. Nagel J. Pentchev P.G. Carstea E.D. Biochem. Biophys. Res. Commun. 1999; 261: 493-498Crossref PubMed Scopus (59) Google Scholar), creating a frameshift that leads to premature translational termination after 933 amino acids (Fig. 1 B). Based on recent functional analysis on human NPC1 (9.Watari H. Blanchette-Mackie E.J. Dwyer N.K. Watari M. Neufeld E.B. Patel S. Pentchev P.G. Strauss III, J.F. J. Biol. Chem. 1999; 274: 21861-21866Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar, 24.Watari H. Blanchette-Mackie E.J. Dwyer N.K. Glick J.M. Patel S. Neufeld E.B. Brady R.O. Pentchev P.G. Strauss III, J.F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 805-810Crossref PubMed Scopus (127) Google Scholar), both CT mutants produce a non-functional hmNPC1 protein. The mutation analyses along with the RT-PCR result (Fig. 6 A) indicate that both CT60 and CT43 mutants contain only one NPC1 allele at the RNA level. Additional results show that the parental cell line (25RA) from which the CT mutants were derived contain a normal NPC1 allele (data not shown).Figure 6Stable expression of hmNPC1 at low levels partially restores the intracellular cholesterol-trafficking defects in the CT43 mutant. A,RT-PCR amplification involved 15–40 cycles as indicated. The WThmNPC1 band (640 bp) and the mutant hmNPC1 band (524 bp) are marked. B–E, 25RA, CT43neo+, and CT43NPC1 were grown as described in Fig. 2. Cells were treated with protocol A for B and C, incubated immediately with 2% CD for 30 min to determine percentage of cholesterol efflux (B), or chased in medium D at 37 °C for 8 h then incubated with 2% CD for 30 min to determine percentage of cholesterol efflux (C). Results are representative of two experiments. For D, cells were treated with protocol B, chased for 6–8 h at 37 °C, and then analyzed for percent reesterification. Values are the combined results of three independent experiments. For E, cells were labeled with [3H]CH/PC liposome, incubated in medium D at 37 °C for 14–18 h, and then analyzed for percent esterification. Values are the combined results of four experiments. Error bars indicate sizes of 1 S.E.View Large Image Figure ViewerDownload Hi-res image Download (PPT) One distinguishing feature of the NPC phenotype is the inability to deliver properly LDL-derived cholesterol to various organelles within the cell, thereby leading to accumulation of free cholesterol in an acidic cellular compartment that can be stained by filipin. Filipin is a fluorescent compound that specifically binds free cholesterol. When CT60 and CT43 cells were incubated with LDL for 24 h and then stained with filipin, they exhibited a strong fluorescent intracellular staining pattern relative to their parental 25RA cells or when incubated without LDL (Fig.1 C). To quantitate NPC1 cDNA expression, we used a method previously described (24.Watari H. Blanchette-Mackie E.J. Dwyer N.K. Glick J.M. Patel S. Neufeld E.B. Brady R.O. Pentchev P.G. Strauss III, J.F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 805-810Crossref PubMed Scopus (127) Google Scholar): co-transfecting CT43 cells with the constructs phmNPC1, which expresses WT NPC1, andpEGFP-N3, which expresses the green fluorescent protein (GFP), resulted in the disappearance of filipin staining in a significant portion of GFP-expressing cells. Co-transfecting the empty vector pcDNA3 and pEGFP-N3 failed to produce the same effect (Fig. 1, D and E). These results demonstrate that the cloned hmNPC1 cDNA is biologically active. The parental 25RA cells and CT mutants contain a gain of function mutation in the protein SCAP, rendering these cells resistant to sterol-dependent transcriptional regulation. This phenotype should not affect the general applicability of our results because we use these cells to study intracellular cholesterol trafficking, not sterol-dependent transcriptional control. To study the role of a single gene mutation (i.e. NPC1), we chose to compare directly the cholesterol trafficking activities of 25RA cells, rather than WT CHO cells, to the CT mutants. When cells are incubated with LDL at 19 °C, lipid transport from the sorting endosome to the lysosome is blocked (27.Chen C.S. Bach G. Pagano R.E. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 6373-6378Crossref PubMed Scopus (167) Google Scholar). Upon warming to 37 °C, the majority of the LDL is rapidly hydrolyzed in the lysosome within 10–20 min; the free cholesterol is then available for efflux at the PM, using high density lipoprotein as an acceptor, 40–50 min later (28.Brasaemle D.L. Attie A.D. J. Lipid Res. 1990; 31: 103-112Abstract Full Text PDF PubMed Google Scholar, 29.Johnson W.J. Chacko G.K. Phillips M.C. Rothblat G.H. J. Biol. Chem. 1990; 265: 5546-5553Abstract Full Text PDF PubMed Google Scholar). Cyclodextrins are compounds that can be used to monitor the flux of cholesterol through the PM of living cells. When cells are treated with cyclodextrin, PM cholesterol cannot be reinternalized into the cell interior (5.Neufeld E.B. Cooney A.M. Pitha J. Dawidowicz E.A. Dwyer N.K. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1996; 271: 21604-21613Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar). Taking advantage of these properties of cyclodextrin and considering the short time needed for cholesterol transport from the lysosome to the PM, we designed an assay in intact cells to monitor the arrival of newly hydrolyzed LDL-derived cholesterol at the PM. We used two different protocols to radiolabel cells prior to measuring cholesterol efflux with cyclodextrin at 37 °C as follows: protocol A, pulse cells with [3H]CL-LDL for 1 h at 37 °C; protocol B, pulse cells with [3H]CL-LDL for 4–5 h at 17–19 °C, allowing [3H]CL-LDL to accumulate in a pre-lysosomal compartment. To avoid continuously loading the cells with cholesterol, which may cause secondary consequences, we used cells grown in cholesterol-free media for 48 h as the starting culture and used cholesterol-free media throughout the experiments. After labeling, the cells were washed several times and immediately treated with 2% cyclodextrin at 37 °C to monitor cholesterol movement to the PM. When protocol A was used to label the cells, we found that the initial cholesterol efflux rates to the PM for 25RA and CT60 cells were essentially identical (Fig.2 A). Control experiments showed that the presence of cyclodextrin was necessary to cause significant cholesterol efflux (Fig. 2 A). We next performed similar experiments, using 25RA and CT43 cells, but inspected earlier time points after the short pulse period. Again, w

Chinese hamster ovary; De-S, delipidated fetal calf serum; MeiSO, dimethyl sulfoxide; HDL, high density lipoprotein; 25-OH cholesterol, 25-hydroxycholestero1; HMG-CoA, 3-hydroxy-3-methyglutaryl coenzyme A; LP(-), lipoprotein-deficient serum; GLC, gas-liquid chromatography; TLC, thin layer chromatography.'I Determined according to published procedure (12) using lactate Determined according to published procedure (12) using citrate n.d., not determined.dehydrogenase as cytoplasmic enzyme marker.synthase as mitochondrial enzyme marker.

Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is an intracellular enzyme that catalyzes the conjugation of long chain fatty acid and cholesterol to form cholesteryl esters.It is an integral membrane protein located in the endoplasmic reticulum.Experiments performed in intact mammalian cells have shown that the rate of cholesteryl ester synthesis in intact cells, as well as the ACAT activity from cell extracts, are greatly activated by the addition oflow density lipoprotein (LDL) or oxygenated sterols such as 25-hydroxycholesterol to the growth medium.However, the molecular mechanism(s) by which sterol(s) stimulate the ACAT activity remains to be elucidated.Recently, our laboratory reported the expression cloning of human ACAT cDNA (Chang, C. C.

Niemann-Pick type C (NPC)1 disease is a rare neurovisceral disorder characterized by progressive hepatosplenomegaly and central nervous system neurodegeneration (reviewed in Ref. 1). The estimated prevalence is 1:150,000 individuals. The disease involves the accumulation of unesterified cholesterol, sphingolipids, and other lipids within cells of the endosomal/lysosomal system, various tissues, and the brain. The disease is autosomal recessive and is caused by mutations in one of two genetic loci, npc1 and npc2.

Cholesterol is essential to the growth and viability of cells. The metabolites of cholesterol include: steroids, oxysterols, and bile acids, all of which play important physiological functions. Cholesterol and its metabolites have been implicated in the pathogenesis of multiple human diseases, including: atherosclerosis, cancer, neurodegenerative diseases, and diabetes. Thus, understanding how cells maintain the homeostasis of cholesterol and its metabolites is an important area of study. Acyl-coenzyme A:cholesterol acyltransferases (ACATs, also abbreviated as SOATs) converts cholesterol to cholesteryl esters and play key roles in the regulation of cellular cholesterol homeostasis. ACATs are most unusual enzymes because (i) they metabolize diverse substrates including both sterols and certain steroids; (ii) they contain two different binding sites for steroidal molecules. In mammals, there are two ACAT genes that encode two different enzymes, ACAT1 and ACAT2. Both are allosteric enzymes that can be activated by a variety of sterols. In addition to cholesterol, other sterols that possess the 3-beta OH at C-3, including PREG, oxysterols (such as 24(S)-hydroxycholesterol and 27-hydroxycholesterol, etc.), and various plant sterols, could all be ACAT substrates. All sterols that possess the iso-octyl side chain including cholesterol, oxysterols, various plant sterols could all be activators of ACAT. PREG can only be an ACAT substrate because it lacks the iso-octyl side chain required to be an ACAT activator. The unnatural cholesterol analogs epi-cholesterol (with 3-alpha OH in steroid ring B) and ent-cholesterol (the mirror image of cholesterol) contain the iso-octyl side chain but do not have the 3-beta OH at C-3. Thus, they can only serve as activators and cannot serve as substrates. Thus, within the ACAT holoenzyme, there are site(s) that bind sterol as substrate and site(s) that bind sterol as activator; these sites are distinct from each other. These features form the basis to further pursue ACAT structure–function analysis, and can be explored to develop novel allosteric ACAT inhibitors for therapeutic purposes. This article is part of a Special Issue entitled ‘Steroid/Sterol signaling’.

Ubiquitin linkage to cysteine is an unconventional modification targeting protein for degradation. However, the physiological regulation of cysteine ubiquitylation is still mysterious. Here we found that ACAT2, a cellular enzyme converting cholesterol and fatty acid to cholesteryl esters, was ubiquitylated on Cys277 for degradation when the lipid level was low. gp78-Insigs catalysed Lys48-linked polyubiquitylation on this Cys277. A high concentration of cholesterol and fatty acid, however, induced cellular reactive oxygen species (ROS) that oxidized Cys277, resulting in ACAT2 stabilization and subsequently elevated cholesteryl esters. Furthermore, ACAT2 knockout mice were more susceptible to high-fat diet-associated insulin resistance. By contrast, expression of a constitutively stable form of ACAT2 (C277A) resulted in higher insulin sensitivity. Together, these data indicate that lipid-induced stabilization of ACAT2 ameliorates lipotoxicity from excessive cholesterol and fatty acid. This unconventional cysteine ubiquitylation of ACAT2 constitutes an important mechanism for sensing lipid-overload-induced ROS and fine-tuning lipid homeostasis.

Acyl-CoA:cholesterol acyltransferase 1 (ACAT1) is a resident endoplasmic reticulum enzyme that prevents the buildup of cholesterol in membranes by converting it to cholesterol esters. Blocking ACAT1 pharmacologically or by Acat1 gene knock-out (KO) decreases amyloidopathy in mouse models for Alzheimer's disease. However, the beneficial actions of ACAT1 blockage to treat Alzheimer's disease remained not well understood. Microglia play essential roles in the proteolytic clearance of amyloid β (Aβ) peptides. Here we show that Acat1 gene KO in mouse increases phagocytic uptake of oligomeric Aβ1-42 and stimulates lysosomal Aβ1-42 degradation in cultured microglia and in vivo. Additional results show that Acat1 gene KO or a specific ACAT1 inhibitor K604 stimulates autophagosome formation and transcription factor EB-mediated lysosomal proteolysis. Surprisingly, the effect of ACAT1 blockage does not alter mTOR signaling or endoplasmic reticulum stress response but can be modulated by agents that disrupt cholesterol biosynthesis. To our knowledge, our current study provides the first example that a small molecule (K604) can promote autophagy in an mTOR-independent manner to activate the coordinated lysosomal expression and regulation network. Autophagy is needed to degrade misfolded proteins/peptides. Our results implicate that blocking ACAT1 may provide a new way to benefit multiple neurodegenerative diseases.

Alzheimer's disease (AD) is the most common cause of dementia with no cure at present. Cholesterol metabolism is closely associated with AD at several stages. ACAT1 converts free cholesterol to cholesteryl esters, and plays important roles in cellular cholesterol homeostasis. Recent studies show that in a mouse model, blocking ACAT1 provides multiple beneficial effects on AD. Here we review the current evidence that implicates ACAT1 as a therapeutic target for AD. We also discuss the potential usage of various ACAT inhibitors currently available to treat AD.

Abstract Sterol O -acyltransferase 1 (SOAT1) is an endoplasmic reticulum (ER) resident, multi-transmembrane enzyme that belongs to the membrane-bound O -acyltransferase (MBOAT) family. It catalyzes the esterification of cholesterol to generate cholesteryl esters for cholesterol storage. SOAT1 is a target to treat several human diseases. However, its structure and mechanism remain elusive since its discovery. Here, we report the structure of human SOAT1 (hSOAT1) determined by cryo-EM. hSOAT1 is a tetramer consisted of a dimer of dimer. The structure of hSOAT1 dimer at 3.5 Å resolution reveals that a small molecule inhibitor CI-976 binds inside the catalytic chamber and blocks the accessibility of the active site residues H460, N421 and W420. Our results pave the way for future mechanistic study and rational drug design targeting hSOAT1 and other mammalian MBOAT family members.

Acyl-coenzyme A:cholesterol acyltransferase (ACAT) catalyzes the formation of intracellular cholesterol esters in various tissues. We recently reported the cloning and expression of human macrophage ACAT cDNA. In the current study, we report the production of specific polyclonal antibodies against ACAT by immunizing rabbits with the recombinant fusion protein composed of glutathione S-transferase and the first 131 amino acids of ACAT protein. Immunoblot analysis showed that the antibodies cross-reacted with a 50-kDa protein band from a variety of human cell lines. These antibodies immunodepleted more than 90% of detergent-solubilized ACAT activities from six different human cell types, demonstrating that the 50-kDa protein is the major ACAT catalytic component in these cells. In multiple human tissues examined, the antibodies recognized protein bands with various molecular weights. These antibodies also cross-reacted with the ACAT protein in Chinese hamster ovary cells. Immunoblot analysis showed that the ACAT protein contents in human fibroblast cells, HepG2 cells, or Chinese hamster ovary cells were not affected by sterol in the medium, demonstrating that the main mechanism for sterol-dependent regulation of ACAT activity in these cells is not change in ACAT protein content. As revealed by indirect immunofluorescent microscopy, the ACAT protein in tissue culture cells was located in the endoplasmic reticulum. This finding, along with earlier studies, suggests that cholesterol concentration in the endoplasmic reticulum may be the major determinant for regulating ACAT activity in the intact cells. Acyl-coenzyme A:cholesterol acyltransferase (ACAT) catalyzes the formation of intracellular cholesterol esters in various tissues. We recently reported the cloning and expression of human macrophage ACAT cDNA. In the current study, we report the production of specific polyclonal antibodies against ACAT by immunizing rabbits with the recombinant fusion protein composed of glutathione S-transferase and the first 131 amino acids of ACAT protein. Immunoblot analysis showed that the antibodies cross-reacted with a 50-kDa protein band from a variety of human cell lines. These antibodies immunodepleted more than 90% of detergent-solubilized ACAT activities from six different human cell types, demonstrating that the 50-kDa protein is the major ACAT catalytic component in these cells. In multiple human tissues examined, the antibodies recognized protein bands with various molecular weights. These antibodies also cross-reacted with the ACAT protein in Chinese hamster ovary cells. Immunoblot analysis showed that the ACAT protein contents in human fibroblast cells, HepG2 cells, or Chinese hamster ovary cells were not affected by sterol in the medium, demonstrating that the main mechanism for sterol-dependent regulation of ACAT activity in these cells is not change in ACAT protein content. As revealed by indirect immunofluorescent microscopy, the ACAT protein in tissue culture cells was located in the endoplasmic reticulum. This finding, along with earlier studies, suggests that cholesterol concentration in the endoplasmic reticulum may be the major determinant for regulating ACAT activity in the intact cells.

There is growing evidence suggesting that cholesterol metabolism is linked to susceptibility to Alzheimer's disease by influencing amyloid β-protein (Aβ) metabolism. However, the precise cellular linkage sites between cholesterol and Aβ have not yet been clarified. To address this issue, we investigated Niemann-Pick type C (NPC) model cells and NPC mutant cells, which showed aberrant cholesterol trafficking. We observed a remarkable Aβ accumulation in late endosomes of both NPC model cells and mutant cells where cholesterol accumulates and a significant accumulation in the NPC mouse brain. This Aβ accumulation was independent of its constitutive secretion and production through an endocytic pathway. In addition, it is characterized by a marked predominance of Aβ42 and insolubility in SDS, suggesting the presence of aggregated Aβ in late endosomes. Most importantly, Aβ accumulation is coupled with the cholesterol levels in late endosomes. Thus, late endosomes of NPC cells are a novel pool of aggregated Aβ42 as well as cholesterol, suggesting a direct interaction between aggregated Aβ and cholesterol.

The acyl coenzyme A:cholesterol acyltransferase (ACAT) gene was first cloned in 1993 (Chang et al, J Biol Chem. 1993;268:20747-20755; designated ACAT-1). Using affinity-purified antibodies raised against the N-terminal portion of human ACAT-1 protein, we performed immunohistochemical localization studies and showed that the ACAT-1 protein was highly expressed in atherosclerotic lesions of the human aorta. We also performed cell-specific localization studies using double immunostaining and showed that ACAT-1 was predominantly expressed in macrophages but not in smooth muscle cells. We then used a cell culture system in vitro to monitor the ACAT-1 expression in differentiating monocytes-macrophages. The ACAT-1 protein content increased by up to 10-fold when monocytes spontaneously differentiated into macrophages. This increase occurred within the first 2 days of culturing the monocytes and reached a plateau level within 4 days of culturing, indicating that the increase in ACAT-1 protein content is an early event during the monocyte differentiation process. The ACAT-1 protein expressed in the differentiating monocytes-macrophages was shown to be active by enzyme assay in vitro. The high levels of ACAT-1 present in macrophages maintained in culture can explain the high ACAT-1 contents found in atherosclerotic lesions. Our results thus support the idea that ACAT-1 plays an important role in differentiating monocytes and in forming macrophage foam cells during the development of human atherosclerosis.

Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is an integral membrane protein located in the endoplasmic reticulum. It catalyzes the formation of cholesteryl esters from cholesterol and long-chain fatty acyl coenzyme A. The first gene encoding the enzyme, designated as <i>ACAT-1</i>, was identified in 1993 through an expression cloning approach. We isolated a Chinese hamster ovary cell line that stably expresses the recombinant human ACAT-1 protein bearing an N-terminal hexahistidine tag. We purified this enzyme approximately 7000-fold from crude cell extracts by first solubilizing the cell membranes with the zwitterionic detergent 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate, then proceeding with an ACAT-1 monoclonal antibody affinity column and an immobilized metal affinity column. The final preparation is enzymologically active and migrates as a single band at 54 kDa on SDS-polyacrylamide gel electrophoresis. Pure ACAT-1 dispersed in mixed micelles containing sodium taurocholate, phosphatidylcholine, and cholesterol remains catalytically active. The cholesterol substrate saturation curves of the enzyme assayed either in mixed micelles or in reconstituted vesicles are both highly sigmoidal. The oleoyl-coenzyme A substrate saturation curves of the enzyme assayed under the same conditions are both hyperbolic. These results support the hypothesis that ACAT is an allosteric enzyme regulated by cholesterol.

To investigate the distribution of acyl-coenzyme A:cholesterol acyltransferase-1 (ACAT-1) in various human tissues, we examined tissues of autopsy cases immunohistochemically. ACAT-1 was demonstrated in macrophages, antigen-presenting cells, steroid hormone-producing cells, neurons, cardiomyocytes, smooth muscle cells, mesothelial cells, epithelial cells of the urinary tracts, thyroid follicles, renal tubules, pituitary, prostatic, and bronchial glands, alveolar and intestinal epithelial cells, pancreatic acinar cells, and hepatocytes. These findings showed that ACAT-1 is present in a variety of human tissues examined. The immunoreactivities are particularly prominent in the macrophages, steroid hormone-producing cells, followed by hepatocytes, and intestinal epithelia. In cultured human macrophages, immunoelectron microscopy revealed that ACAT-1 was located mainly in the tubular rough endoplasmic reticulum; immunoblot analysis showed that the ACAT-1 protein content did not change with or without cholesterol loading; however, on cholesterol loading, about 30 to 40% of the total immunoreactivity appeared in small-sized vesicles. These vesicles were also enriched in 78-kd glucose-regulated protein (GRP 78), a specific marker for the endoplasmic reticulum. Immunofluorescent microscopy demonstrated extensive colocalization of ACAT-1 and GRP 78 signals in both the tubular and vesicular endoplasmic reticulum before and after cholesterol loading. These results raise the possibility that foam cell formation may activate an endoplasmic reticulum vesiculation process, producing vesicles enriched in the ACAT-1 protein. To investigate the distribution of acyl-coenzyme A:cholesterol acyltransferase-1 (ACAT-1) in various human tissues, we examined tissues of autopsy cases immunohistochemically. ACAT-1 was demonstrated in macrophages, antigen-presenting cells, steroid hormone-producing cells, neurons, cardiomyocytes, smooth muscle cells, mesothelial cells, epithelial cells of the urinary tracts, thyroid follicles, renal tubules, pituitary, prostatic, and bronchial glands, alveolar and intestinal epithelial cells, pancreatic acinar cells, and hepatocytes. These findings showed that ACAT-1 is present in a variety of human tissues examined. The immunoreactivities are particularly prominent in the macrophages, steroid hormone-producing cells, followed by hepatocytes, and intestinal epithelia. In cultured human macrophages, immunoelectron microscopy revealed that ACAT-1 was located mainly in the tubular rough endoplasmic reticulum; immunoblot analysis showed that the ACAT-1 protein content did not change with or without cholesterol loading; however, on cholesterol loading, about 30 to 40% of the total immunoreactivity appeared in small-sized vesicles. These vesicles were also enriched in 78-kd glucose-regulated protein (GRP 78), a specific marker for the endoplasmic reticulum. Immunofluorescent microscopy demonstrated extensive colocalization of ACAT-1 and GRP 78 signals in both the tubular and vesicular endoplasmic reticulum before and after cholesterol loading. These results raise the possibility that foam cell formation may activate an endoplasmic reticulum vesiculation process, producing vesicles enriched in the ACAT-1 protein. Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is a key enzyme involved in cellular cholesterol metabolism. It catalyzes the formation of cholesteryl esters from cholesterol and long-chain fatty acyl-coenzyme A.1Chang TY Chang CCY Cheng D Acyl-coenzyme A: cholesterol acyltransferase.Annu Rev Biochem. 1997; 66: 613-638Crossref PubMed Scopus (444) Google Scholar ACAT activities are present in various tissues such as liver, intestines, adrenal glands, and aorta and are involved in intracellular cholesterol storage, lipoprotein assembly, steroid hormone production, and dietary cholesterol absorption.2Suckling KE Stange EF Role of acyl-CoA: cholesterol acyltransferase in cellular cholesterol metabolism.J Lipid Res. 1985; 26: 647-671Abstract Full Text PDF PubMed Google Scholar Previous studies showed that ACAT is a membrane-bound enzyme; its activity is found only in the membrane fractions of intracellular organelles, especially in the rough endoplasmic reticulum.3Balasubramaniam S Venkatesan S Mitropoulos KA Peters TJ The submicrosomal localization of acyl-coenzyme A-cholesterol acyltransferase and its substrate, and of cholesteryl esters in rat liver.Biochem J. 1978; 174: 863-872Crossref PubMed Scopus (50) Google Scholar, 4Hashimoto S Fogelman AM Smooth microsomes: a trap for cholesteryl ester formed in hepatic microsomes.J Biol Chem. 1980; 255: 8678-8684Abstract Full Text PDF PubMed Google Scholar More recently, molecular probes of ACAT have become available. In 1993, the first cDNA of ACAT, designated as ACAT-1, was cloned from a human THP-1 cell cDNA library by using a somatic cell and molecular genetic approach.5Chang CCY Huh HY Cadigan KM Chang TY Molecular cloning and functional expression of human acyl-coenzyme A: cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells.J Biol Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar The sequence of human ACAT-1 cDNA led to the clonings of its homologues from various other species, including mice.6Uelmen PJ Oka K Sullivan M Chang CCY Chang TY Chan L Tissue-specific expression and cholesterol regulation of acylcoenzyme A: cholesterol acyltransferase (ACAT) in mice: molecular cloning of mouse ACAT cDNA, chromosomal localization, and regulation of ACAT in vitro and in vivo.J Biol Chem. 1995; 270: 26192-26201Crossref PubMed Scopus (117) Google Scholar ACAT-1 gene knockout mice were produced.7Meiner VL Cases S Myers HM Sande ER Bellosta S Schambelan M Pitas RE McGuire J Herz J Farese Jr, RV Disruption of the acyl-CoA: cholesterol acyltransferase gene in mice: evidence suggesting multiple cholesterol esterification enzymes in mammals.Proc Natl Acad Sci USA. 1996; 93: 14041-14046Crossref PubMed Scopus (245) Google Scholar, 8Meiner V Tam C Gunn MD Dong L-M Weisgraber KH Novak S Myers HM Erickson SK Farese Jr, RV Tissue expression studies on the mouse acyl-CoA: cholesterol acyltransferase gene (Acact): findings supporting the existence of multiple cholesterol esterification enzymes in mice.J Lipid Res. 1997; 38: 1928-1933Abstract Full Text PDF PubMed Google Scholar Analyses of these mice showed that ACAT activities were significantly decreased in selected tissues examined but not in the livers, strongly suggesting that one or more additional ACAT genes, distinct from the ACAT-1 gene, probably exist in mice. More recently, a different ACAT cDNA, designated ACAT-2, was cloned.9Oelkers P Behari A Cromley D Billheimer JT Sturley SL Characterization of two human genes encoding acyl coenzyme A: cholesterol acyltransferase-related enzymes.J Biol Chem. 1998; 273: 26765-26771Crossref PubMed Scopus (339) Google Scholar, 10Cases S Novak S Zheng YW Myers HM Lear SR Sande E Welch CB Lusis AJ Spencer TA Krause BR Erickson SK Farese Jr, RV ACAT-2, a second mammalian acyl-CoA: cholesterol acyltransferase: its cloning, expression, and characterization.J Biol Chem. 1998; 273: 26755-26764Crossref PubMed Scopus (340) Google Scholar, 11Anderson RA Joyce C Davis M Reagan JW Clark M Shelness GS Rudel LL Identification of a form of acyl-CoA: cholesterol acyltransferase specific to liver and intestine in nonhuman primate.J Biol Chem. 1998; 273: 26747-26754Crossref PubMed Scopus (265) Google Scholar The sequence of ACAT-2 is homologous but different from that of ACAT-1. Earlier, two different ACAT-like genes were found in the simple eukaryote Sachromycetes saravesea.12Yang H Bard M Bruner DA Gleeson A Deckelbaum RJ Aljinovic G Pohl TM Rothstein R Sturley SL Sterol esterification in yeast: a two-gene process.Science. 1996; 272: 1353-1356Crossref PubMed Scopus (231) Google Scholar, 13Yu C Kennedy NJ Chang CCY Rothblatt JA Molecular cloning and characterization of two isoforms of Saccharomyces cerevisiae acyl-CoA: sterol acyltransferase.J Biol Chem. 1996; 271: 24157-24163Crossref PubMed Scopus (115) Google Scholar The exact roles of ACAT-1 and ACAT-2 in different species remain unknown. Their physiological functions are currently under intensive investigation in several laboratories. Recently, specific polyclonal antibodies against the ACAT-1 protein from humans or mice have been produced.14Chang CCY Chen J Thomas MA Cheng D Priore VAD Newton RS Pape ME Chang TY Regulation and immunolocalization of acyl-coenzyme A: cholesterol acyltransferase in mammalian cells as studied with specific antibodies.J Biol Chem. 1995; 270: 29532-29540Crossref PubMed Scopus (140) Google Scholar, 15Meiner V Tam C Gunn MD Dong LM Weisgraber KH Novak S Myers HM Erickson SK Farese Jr, RV Tissue expression studies on the mouse acyl-CoA: cholesterol acyltransferase gene (Acact): findings supporting the existence of multiple cholesterol esterification enzymes in mice.J Lipid Res. 1997; 38: 1928-1933Abstract Full Text PDF PubMed Google Scholar, 16Khelef N Buton X Beatini N Wang H Meiner V Chang TY Farese Jr, RV Maxfield FR Tabas I Immunolocalization of acyl-coenzyme A: cholesterol O-acyltransferase in macrophages.J Biol Chem. 1998; 273: 11218-11224Crossref PubMed Scopus (49) Google Scholar In human cells and tissues, these antibodies recognize the ACAT-1 protein as a single 50-kd protein in sodium dodecyl sulfate-polyacrylamide gel electrophoresis.14Chang CCY Chen J Thomas MA Cheng D Priore VAD Newton RS Pape ME Chang TY Regulation and immunolocalization of acyl-coenzyme A: cholesterol acyltransferase in mammalian cells as studied with specific antibodies.J Biol Chem. 1995; 270: 29532-29540Crossref PubMed Scopus (140) Google Scholar Using an antibody against the human ACAT-1 protein, DM10, we performed immunoblot analysis and ACAT enzyme activity assay and found that human monocyte-derived macrophages expressed high levels of ACAT-1 protein and high ACAT enzyme activity during the early stage of monocyte/macrophage differentiation.17Miyazaki A Sakashita N Lee O Takahashi K Horiuchi S Hakamata H Morganelli PM Chang CCY Chang TY Expression of ACAT-1 protein in human atherosclerotic lesions and cultured human monocytes/macrophages.Arterioscler Thromb Vasc Biol. 1998; 18: 1568-1574Crossref PubMed Scopus (131) Google Scholar We also demonstrated that the ACAT-1 protein was amply present in macrophages, but not in smooth muscle cells, within the atherosclerotic lesions of human aorta.17Miyazaki A Sakashita N Lee O Takahashi K Horiuchi S Hakamata H Morganelli PM Chang CCY Chang TY Expression of ACAT-1 protein in human atherosclerotic lesions and cultured human monocytes/macrophages.Arterioscler Thromb Vasc Biol. 1998; 18: 1568-1574Crossref PubMed Scopus (131) Google Scholar Other than the atherosclerotic lesions, little is known about the distribution of ACAT-1 protein in normal human organs at the cellular level, particularly in those that play important roles in cholesterol homeostasis. At the single cell level, using the specific anti-ACAT-1 antibody (DM10) for immunofluorescent microscopy, Chang et al reported in human melanoma cells that ACAT-1 is mainly located in endoplasmic reticulum.14Chang CCY Chen J Thomas MA Cheng D Priore VAD Newton RS Pape ME Chang TY Regulation and immunolocalization of acyl-coenzyme A: cholesterol acyltransferase in mammalian cells as studied with specific antibodies.J Biol Chem. 1995; 270: 29532-29540Crossref PubMed Scopus (140) Google Scholar Using a similar method, Khelef et al reported in murine macrophages that a minor portion of ACAT-1 protein resides in membranes other than the endoplasmic reticulum16Khelef N Buton X Beatini N Wang H Meiner V Chang TY Farese Jr, RV Maxfield FR Tabas I Immunolocalization of acyl-coenzyme A: cholesterol O-acyltransferase in macrophages.J Biol Chem. 1998; 273: 11218-11224Crossref PubMed Scopus (49) Google Scholar; the non-rough endoplasmic reticulum localization of ACAT-1 may be the trans-Golgi network.18Tabas I A portion of acyl-CoA:cholesterol acyltransferase (ACAT) colocalizes with the trans-Golgi network (TGN) in macrophages (Mϕs).Circulation. 1998; 97 (abstr): 311Google Scholar The distribution of ACAT-1 at the ultrastructural level in any cell type has not been reported yet. In the present study, we examined by immunohistochemistry the distribution and localization of ACAT-1 in various normal human tissues. In addition, to investigate the intracellular localization of ACAT-1 at both the protein and cellular levels, we performed immunoblot analysis, immunoelectron microscopy, and immunofluorescent microscopy of cultured human macrophages before and after cholesterol loading by treating cells with acetylated low density lipoprotein (AcLDL). For immunohistochemistry, tissue specimens were obtained from various organs and tissues of 8 autopsy cases (6 males and 2 females, 41 to 75 years old) within 4 hours postmortem. These specimens were fixed in an ice-cold 2% periodate-lysine-paraformaldehyde fixative for 6 hours and washed with phosphate-buffered saline, pH 7.2, containing a graded series of sucrose (10, 15, and 20%). To prevent ice crystal formation, the specimens were immersed in 0.01 mol/L phosphate-buffered saline containing 20% sucrose and 10% glycerol for 30 minutes and embedded in OCT compound (Miles, Elkhart, IN). These embedded materials were frozen and cut sequentially into 5-μm-thick sections with a cryostat (HM 500 M; MICROM, Waldorf, Germany). Low density lipoprotein (LDL, d = 1.091 to 1.063) was isolated by sequential ultracentrifugation from normolipidemic human plasma, dialyzed in 0.15 mol/L NaCl and 1 mmol/L ethylenediamine tetraacetic dihydrate, pH 7.4 (Nacalai Tesque, Kyoto, Japan), and treated with acetic anhydride to prepare AcLDL as described previously.19Horiuchi S Takata K Maeda H Morino Y Scavenger function of sinusoidal liver cells: acetylated low density lipoprotein is endocytosed via a route distinct from formaldehyde-treated serum albumin.J Biol Chem. 1985; 260: 53-56Abstract Full Text PDF PubMed Google Scholar Monocytes were collected from peripheral blood of healthy volunteers according to the method described elsewhere, with a minor modification.20Sakai M Miyazaki A Hakamata H Sato Y Matsumura T Kobori S Shichiri M Horiuchi S Lysophosphatidylcholine potentiates the mitogenic activity of modified LDL for human monocyte-derived macrophages.Arterioscler Thromb Vasc Biol. 1996; 16: 600-605Crossref PubMed Scopus (73) Google Scholar Briefly, mononuclear leukocytes were segregated from peripheral blood using the Ficoll/Hypaque gradient centrifugation method, resuspended in RPMI1640 (Nissui Pharmaceutical Co., Tokyo, Japan) containing 10% autologous serum or 10% fetal calf serum, and plated in culture chambers (Lab-Tek Chamber Slide, Nalge Nunc International, Naperville, IL) for 2 hours. After nonadherent cells were removed by gently washing with culture medium, adherent monocytes were cultured for 7 days to induce differentiation and maturation into macrophages. Cultured macrophages were further incubated for 3 more days with a culture medium containing 100 μg/ml of AcLDL. After AcLDL treatment, foam cell transformation was confirmed by observing the accumulation of lipid droplets under phase-contrast microscopy. Specific polyclonal rabbit antibody for human ACAT-1, DM10, was generated and affinity-purified as described elsewhere.14Chang CCY Chen J Thomas MA Cheng D Priore VAD Newton RS Pape ME Chang TY Regulation and immunolocalization of acyl-coenzyme A: cholesterol acyltransferase in mammalian cells as studied with specific antibodies.J Biol Chem. 1995; 270: 29532-29540Crossref PubMed Scopus (140) Google Scholar The antibody recognizes the first 131 amino acids residues in N-terminal region of the human ACAT-1. To confirm the formation of mature macrophages derived from cultured peripheral monocytes, we used a mouse anti-human macrophage monoclonal antibody, AM-3K,21Zeng L Takeya M Takahashi K AM-3K, a novel monoclonal antibody specific for tissue macrophages and its application to pathological investigation.J Pathol. 1996; 178: 207-214Crossref PubMed Scopus (37) Google Scholar generated in our laboratory. To detect rough endoplasmic reticulum by immunofluorescent and immunoelectron microscopy, we used a goat polyclonal antibody N-20 raised against a human 78-kd glucose-regulated protein, GRP 78 (Santa Cruz Biotechnology, Santa Cruz, CA). To detect the expression of ACAT-1 in the normal human tissues, we performed the indirect immunoperoxidase method with a minor modification as described previously.17Miyazaki A Sakashita N Lee O Takahashi K Horiuchi S Hakamata H Morganelli PM Chang CCY Chang TY Expression of ACAT-1 protein in human atherosclerotic lesions and cultured human monocytes/macrophages.Arterioscler Thromb Vasc Biol. 1998; 18: 1568-1574Crossref PubMed Scopus (131) Google Scholar Briefly, after inhibition of endogenous peroxidase activity according to the method of Li et al,22Li C-Y Ziesmer SC Lazcano-Villareal O Use of azide and hydrogen peroxide as an inhibitor for endogenous peroxidase in the immunoperoxidase method.J Histochem Cytochem. 1987; 35: 1457-1460Crossref PubMed Scopus (146) Google Scholar the frozen sections were incubated with 5. normal donkey serum for 20 minutes and sequentially reacted with DM10 diluted 1:200 as primary antibody at room temperature for 1 hour. The sections were rinsed 5 times with ice-cold 0.01 mol/L phosphate-buffered saline, pH 7.2, and incubated with peroxidase-labeled anti-rabbit immunoglobulin F(ab′)2 (Amersham, Little Chalfont, UK) diluted 1:100 as second antibody. After washing, the peroxidase activity was visualized as black color with a solution containing Ni, Co, and 3,3′-diaminobenzidine (Dojin Chemical Co., Kumamoto, Japan),23Adams JC Heavy metal intensification of DAB-based HRP reaction product.J Histochem Cytochem. 1981; 29: 775Crossref PubMed Scopus (1664) Google Scholar and the sections were stained with Methylgreen and mounted with Malinol (Mutoh Chemical Co., Tokyo, Japan). To assure the immunoreactive specificity of DM10 in each tissue, control stainings were done in the same manner, omitting the primary antibody. In each case, the control stainings provided only a very weak positivity on background. Immunoblot analysis for cultured macrophages with or without AcLDL treatment was performed as described elsewhere.17Miyazaki A Sakashita N Lee O Takahashi K Horiuchi S Hakamata H Morganelli PM Chang CCY Chang TY Expression of ACAT-1 protein in human atherosclerotic lesions and cultured human monocytes/macrophages.Arterioscler Thromb Vasc Biol. 1998; 18: 1568-1574Crossref PubMed Scopus (131) Google Scholar Briefly, the 1 × 107 cells seeded in 10-cm dishes were washed several times with phosphate-buffered saline, stored at −80°C, and dried in monolayers for up to 7 days. The frozen cell monolayers were thawed and extracted with 0.1 ml of 10% sodium dodecyl sulfate per dish. Cells were scraped and sheared, using syringes with 25-gauge needles. Protein concentrations of cellular extracts were determined by the method of Lowry et al.24Lowry OH Rosenbrough NJ Farr AL Randall RJ Protein measurement with the Folin phenol reagents.J Biol Chem. 1951; 193: 265-270Abstract Full Text PDF PubMed Google Scholar Samples were run on 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and subjected to immunoblotting. The primary antibody (DM10) was used at a final concentration of 0.5 μg/ml. Immunoelectron microscopy was performed according to the same method as described previously.21Zeng L Takeya M Takahashi K AM-3K, a novel monoclonal antibody specific for tissue macrophages and its application to pathological investigation.J Pathol. 1996; 178: 207-214Crossref PubMed Scopus (37) Google Scholar Briefly, cultured macrophages with or without AcLDL treatment were fixed with 4. periodate-lysine-paraformaldehyde and 0.1% glutaraldehyde (Nacalai Tesque, Kyoto, Japan) in phosphate-buffered saline, pH 7.2, at 4°C for 20 minutes. After washing with phosphate-buffered saline and treating with 0.005% saponin containing phosphate-buffered saline for 10 minutes, the cells were stained by the immunoperoxidase method, using DM10 or N-20 as primary antibody. After visualization with 3,3′-diaminobenzidine for 5 minutes, the cells were postfixed with 1. osmium tetroxide at 4°C for 30 minutes. After rinsing, the cells were dehydrated with a graded series of ethanol and embedded in Epok 812. Ultrathin sections were made by an ultramicrotome MT7000 ULTRA (RMC Inc., Tucson, AZ) and observed under an electron microscope H-7500 (Hitachi, Tokyo, Japan). Immunofluorescent double staining with DM10 and N-20 was used to confirm the localization of ACAT-1 in rough endoplasmic reticulum. Briefly, cultured human macrophages with or without AcLDL treatment were fixed in 2% periodate-lysine-paraformaldehyde solution at 4°C for 20 minutes and rinsed with phosphate-buffered saline containing 0.005% saponin. The cells were incubated with 5% normal donkey serum and 0.1% Triton X-100 for 20 minutes and reacted to primary antibodies containing 200-fold-diluted DM10 with 20-fold-diluted N-20 for 1 hour at room temperature. After rinse, the cells were incubated with secondary antibody sequentially, FluoroLink Cy3-labeled donkey anti-goat IgG(H+L) (Amersham, Little Chalfont, UK) diluted 1:1000 was reacted to the cells, and FluoroLink Cy2-labeled goat anti-rabbit IgG(H+L) (Amersham) were further applied to the cells for 1 hour at room temperature after washing out the former fluorescent labeled antibody. The specimens were mounted using Dako fluorescent mounting medium (Dako, Carpinteria, CA) after washing out nonreacted secondary antibody and observed by a confocal laser scanning microscope (FLUOVIEW, Olympus, Tokyo, Japan). Table 1 summarizes the distribution of ACAT-1 in various organs and tissues of autopsy cases as revealed by immunohistochemistry, using the specific anti-ACAT-1 antibodies DM10. Immunoreactivity was demonstrated in various cells and tissues. The specificity of immunoreactivity using DM10 was demonstrated previously by immunoblot analysis: Lee et al reported that a single specific signal at 50 kd was detected in human liver, adrenal glands, and kidneys as well as in macrophages.25Lee O Chang CCY Lee W Chang TY Immunodepletion experiments suggest that acyl-coenzyme A: cholesterol acyltransferase-1 (ACAT-1) protein plays a major catalytic role in adult human liver, adrenal gland, macrophages, and kidney, but not intestines.J Lipid Res. 1998; 39: 1722-1727Abstract Full Text Full Text PDF PubMed Google Scholar In the digestive tract, immunoreactivity was expressed in the epithelia of the small intestines and gastric fundic glands, mesothelial cells, and smooth muscle cells. In the small intestine, absorptive epithelia expressed ACAT-1, whereas the goblet cells and Paneth cells showed a very weak immunoreactivity (Figure 1, A and B). Negative control staining (without incubation with the first antibodies) in specimens obtained from small intestine, liver, adrenal glands, and neurons confirmed that the immunosignals were specific for ACAT-1 (Figure 1C). Myenteric ganglion cells also showed a weak reactivity (data not shown). A very weak immunoreactivity was found in the squamous epithelium of esophagus and in the absorptive epithelial cells of the large intestine (Figure 1D), though these regions are not involved in cholesterol absorption. Kupffer cells in the liver expressed a marked immunoreactivity for ACAT-1; hepatocytes also stained positive with DM10, whereas the epithelial cells of bile ducts showed a much weaker immunoreactivity (Figure 1, E and F). No immunoreactivity was found in endothelial cells of the hepatic sinusoids (Figure 1F). Marked immunoreactivity for ACAT-1 was found in steroid hormone-producing cells including the adrenal cortical cells, Leydig cells in the testis, and granulosa cells in the ovary (Figure 2, A and B). In contrast, other types of endocrine cells that are not involved in steroid hormone production showed only an extremely weak immunoreactivity.Table 1Distribution of ACAT-1 in Normal Human TissuesTissues and cellsImmunoreactivityLiverHepatocytes++Kupffer cells+++Sinusoidal endothelia−Intrahepatic bile duct+Adrenal glandsAdrenal cortex+++Adrenal medulla−GonadsLeidig/granulosa cells++Stromal cells−Digestive tractEsophagusSquamous epithelia−Esophageal glands++StomachFoveolar epithelium−Fundic glands++Small intestineMucosal epithelial cells++Large intestineMucosal epithelial cells−Respiratory systemAlveolar epithelia++Bronchial epithelia++Alveolar macrophages+++Cardiovascular systemCardiomyocytes+Endothelial cells−Smooth muscle cells+Endocrine systemPituitary gland+Thyroid glandFollicular epithelial cells++Nervous systemNeurons++Glial cells−Myentric ganglia++KidneyEpithelial cells of proximal and distal tubules++Glomeruli−PancreasExocrine glands++Langerhans islet cells−Duct epithelia+Urinary tractTransitional epithelial cells++Immune systemLymphocytes (lymph nodes, spleen, Peyer's patches)−Macrophages (liver, lungs, kidneys)++++++, strongly positive; ++, positive; +, slightly positive; −, not detected. Open table in a new tab Figure 2Immunohistochemical demonstration of ACAT-1 in normal human tissues. A: Strong ACAT-1 signals are found in the parenchymal cells of adrenal cortex. B: Arrowheads indicate the presence of ACAT-1 in interstitial Leydig cells of the testis. C: Alveolar macrophages express an intense signal for ACAT-1, whereas alveolar epithelial cells (arrowheads. express a much weaker signal. D: Numerous macrophages in lymphatic sinuses of a lymph node show marked immunoreactivity for ACAT-1, whereas sinusal endothelial cells and dendritic cells (arrowheads. are only weakly positive for ACAT-1. E: Arrowheads indicate a positive ACAT-1 signal in epidermal Langerhans cells. F: Prominent immunosignals are shown in sebaceous glands in the skin, whereas other skin appendages such as hair follicles and eccrine sweat glands (arrowheads. stained negative. G: Neurons in cerebral cortex express ACAT-1, whereas no immunoreactivity was observed in glia (arrowheads). H: Purkinje cells (arrowheads. and their dendrites in cerebellar cortex also stained positive for ACAT-1. Original magnifications: A, ×120; B and C, ×150: D, ×230; E, ×190; F, ×40; G and H, ×300.View Large Image Figure ViewerDownload Hi-res image Download (PPT) +++, strongly positive; ++, positive; +, slightly positive; −, not detected. Macrophages in the alveolar spaces of lungs (Figure 2C), in the lymphatic sinuses of the lymph nodes, and in the red pulp of spleen, expressed an intense immunoreactivity to the ACAT-1 antibodies. Dendritic cells and endothelial cells of lymphatic sinuses in lymph nodes indicated immunoreactivity to DM10 (Figure 2D) and epidermal Langerhans cells were also positively stained by the antibodies (Figure 2E). Control experiments showed that macrophages in these tissues were positively stained with the anti-macrophage antibody AM-3K, while dendritic cells were not stained by AM-3K (data not shown). In the skin, the most prominent signals were observed in the sebaceous glands, while the eccrine sweat glands did not show immunoreactivity (Figure 2F). Neurons and their dendrites express ACAT-1 in the cerebral cortex, basal ganglia, cerebellar cortex, pontine nucleus, and spinal cord (Figure 2, G and H), but neural glia showed no immunoreactivities. In data not shown, DM10-positive immunoreactivities were also found in the tubular epithelial cells of kidneys, transitional epithelia of urinary tracts, cardiomyocytes, alveolar or bronchial epithelium, and bronchial glands in the respiratory tract, epithelial cells of the prostate and thyroid follicles, and pancreatic acinar and ductal epithelial cells. Monocytes collected from peripheral blood of normal healthy human volunteers were incubated in culture for 7 days. Immunostaining using the macrophage-specific antibody AM-3K confirmed that at this stage, all of the cells were differentiated into mature macrophages (data not shown). Modified LDL, such as AcLDL, are known to induce cholesteryl ester accumulation in macrophages and cause subsequent foam cell formation.20Sakai M Miyazaki A Hakamata H Sato Y Matsumura T Kobori S Shichiri M Horiuchi S Lysophosphatidylcholine potentiates the mitogenic activity of modified LDL for human monocyte-derived macrophages.Arterioscler Thromb Vasc Biol. 1996; 16: 600-605Crossref PubMed Scopus (73) Google Scholar To investigate whether AcLDL induces any changes in the ACAT protein content in human macrophages, we used DM10 as the primary antibody to perform immunoblot analysis. The results showed that a single 50-kd protein, corresponding to the human ACAT-1 protein,25Lee O Chang CCY Lee W Chang TY Immunodepletion experiments suggest that acyl-coenzyme A: cholesterol acyltransferase-1 (ACAT-1) protein plays a major catalytic role in adult human liver, adrenal gland, macrophages, and kidney, but not intestines.J Lipid Res. 1998; 39: 1722-1727Abstract Full Text Full Text PDF PubMed Google Scholar was detected in sodium dodecyl sulfate-polyacrylamide gel electrophoresis; the intensity of the 50-kd protein signal remained the same in cells with or without AcLDL for 3 days (Figure 3). Immunoelectron microscopy was used to study the subcellular localization of ACAT-1 in macrophages. Without cholesterol loading, immunoreactivities against DM10 were found in the membranes of intracellular organelles, especially in rough endoplasmic reticulum and the nuclear membrane (Figure 4A). however, no immunoreactivity was detectable in the Golgi complexes (Figure 4B). After AcLDL treatment, immunoreactivity could be found in small vesicles with diameter of 80 to 150 nm, in addition to the tubular endoplasmic reticulum structure (Figure 4, C and D). Based on the results of examining 50 or more individual electron micrographs, we estimated that approximately 30 to 40% of the total immunoreactivity appeared in these small vesicles after the transformation of cultured macrophages into foam cells. Under this condition, despite careful examinations, we have still failed to detect any immunoreactivity in the Golgi complexes (data not shown). In cultured human macrophages, immunofluorescent staining for ACAT-1 revealed that the enzyme was distributed in a dense reticular network throughout the cytoplasm (Figure 5A), a result consistent with the earlier findings implying that ACAT-1 is mainly distributed in the endoplasmic reticulum.16Khelef N Buton X Beatini N Wang H Meiner V Chang TY Farese Jr, RV Maxfield FR Tabas I Immunolocalization of acyl-coenzyme A: cholesterol O-acyltransferase in macrophages.J Biol Chem. 1998; 273: 11218-11224Crossref PubMed Scopus (49) Google Scholar When anti-GRP 78 antibody, a specific marker for endoplasmic reticulum, was used, similar patterns were demonstrated (Figure 5B).26Martin J Horwich AL Hartl FU Prevention of protein denaturation under heat stress by the chaperonin Hsp60.Science. 1992; 258: 995-998Crossref PubMed Scopus (236) Google Scholar, 27Csermely P Miyata Y Schnaider T Yahara I Autophosphorylation of grp94 (endoplasmin).J Biol Chem. 1995; 270: 6381-6388Crossref PubMed Scopus (74) Google Scholar By double immunofluorescent staining, the extensive colocalization of ACAT-1 and GRP 78 was demonstrated (Figure 5C). After cholesterol loading, the extent of colocalization of ACAT-1 and GRP 78 remained extensive and essentially unaltered (Figure 5, D-F). To further investigate the possibility that AcLDL treatment may cause extensive vesicular transformation of the endoplasmic reticulum, which is mainly tubular in structure, we performed additional immunoelectron microscopy using a specific antibody for GRP 78. In macrophages without AcLDL treatment, electron-dense, immunopositive deposits were observed at the tubular endoplasmic reticula (Figure 6A). After cholesterol loading, numerous immunoreactive small vesicles appeared throughout the cytoplasm of the cells (Figure 6B). In mammals, two ACAT cDNAs with homologous but distinct nucleotide sequences, designated ACAT-15Chang CCY Huh HY Cadigan KM Chang TY Molecular cloning and functional expression of human acyl-coenzyme A: cholesterol acyltransferase cDNA in mutant Chinese hamster ovary cells.J Biol Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar, 25Lee O Chang CCY Lee W Chang TY Immunodepletion experiments suggest that acyl-coenzyme A: cholesterol acyltransferase-1 (ACAT-1) protein plays a major catalytic role in adult human liver, adrenal gland, macrophages, and kidney, but not intestines.J Lipid Res. 1998; 39: 1722-1727Abstract Full Text Full Text PDF PubMed Google Scholar and ACAT-2,9Oelkers P Behari A Cromley D Billheimer JT Sturley SL Characterization of two human genes encoding acyl coenzyme A: cholesterol acyltransferase-related enzymes.J Biol Chem. 1998; 273: 26765-26771Crossref PubMed Scopus (339) Google Scholar, 10Cases S Novak S Zheng YW Myers HM Lear SR Sande E Welch CB Lusis AJ Spencer TA Krause BR Erickson SK Farese Jr, RV ACAT-2, a second mammalian acyl-CoA: cholesterol acyltransferase: its cloning, expression, and characterization.J Biol Chem. 1998; 273: 26755-26764Crossref PubMed Scopus (340) Google Scholar, 11Anderson RA Joyce C Davis M Reagan JW Clark M Shelness GS Rudel LL Identification of a form of acyl-CoA: cholesterol acyltransferase specific to liver and intestine in nonhuman primate.J Biol Chem. 1998; 273: 26747-26754Crossref PubMed Scopus (265) Google Scholar have been reported in the literature. The physiological functions of these two proteins are under investigation in several laboratories. Studies show that, in mice deficient in the ACAT-1 gene, a significant decrease in cellular cholesteryl ester formation was observed in selected tissues or cells that include the adrenal glands, skin, and macrophages, but not in the liver.7Meiner VL Cases S Myers HM Sande ER Bellosta S Schambelan M Pitas RE McGuire J Herz J Farese Jr, RV Disruption of the acyl-CoA: cholesterol acyltransferase gene in mice: evidence suggesting multiple cholesterol esterification enzymes in mammals.Proc Natl Acad Sci USA. 1996; 93: 14041-14046Crossref PubMed Scopus (245) Google Scholar, 8Meiner V Tam C Gunn MD Dong L-M Weisgraber KH Novak S Myers HM Erickson SK Farese Jr, RV Tissue expression studies on the mouse acyl-CoA: cholesterol acyltransferase gene (Acact): findings supporting the existence of multiple cholesterol esterification enzymes in mice.J Lipid Res. 1997; 38: 1928-1933Abstract Full Text PDF PubMed Google Scholar This result raised the possibility that the ACAT-1 gene product may play a functional role only in certain selected tissues, but not in the liver. In human tissues, using a biochemical approach, immunodepletion experiments suggested that the ACAT-1 protein constitutes a majority of the ACAT enzyme activities displayed in extracts prepared from various human tissues or cells, including livers (hepatocytes), adrenal glands, kidneys, and macrophages; human ACAT-1 is also present in the small intestines, but it may not be the major cholesterol esterifying enzyme in that tissue.25Lee O Chang CCY Lee W Chang TY Immunodepletion experiments suggest that acyl-coenzyme A: cholesterol acyltransferase-1 (ACAT-1) protein plays a major catalytic role in adult human liver, adrenal gland, macrophages, and kidney, but not intestines.J Lipid Res. 1998; 39: 1722-1727Abstract Full Text Full Text PDF PubMed Google Scholar Using the immunohistochemical staining in various human tissues, our current results show that the ACAT-1-expressing cells in normal human tissues can be classified into three major groups: 1) cells involved in cholesterol absorption and lipoprotein assembly, ie, the epithelia in the digestive tract and the hepatocytes in the liver; 2) steroid hormone-producing cells, such as parenchymal cells of the adrenal cortex, Leydig cells in the testis, and granulosa cells in the ovary. and 3) tissue macrophages and their related cells, such as dendritic cells. Our additional studies show that various other cell types, such as neuronal cells in central nervous system and myenteric plexus, cardiomyocytes, smooth muscle cells, or epithelial cells, also express ACAT-1. In these ACAT-1-positive tissues/cells, prominent immunoreactivities are observed in macrophages and its related cells, steroid hormone-producing cells, and sebaceous glands. Other types of cells such as intestinal enterocytes, hepatocytes, and neurons also express ACAT-1, but at a relatively weaker level. We thus conclude that the ACAT-1 protein is present in a wide variety of human tissues. In macrophages, our current result indicated that there is no change in the ACAT-1 protein content when the cells are transformed into foam cells (by loading cells with cholesterol via AcLDL treatment). This result is consistent with previous studies in various cells and tissues supporting the notion that the main mechanism for increase in ACAT enzyme activity by cholesterol influx is probably due to the allosteric property of the ACAT-1 enzyme in combination with an increase in intracellular cholesterol trafficking toward the endoplasmic reticulum.1Chang TY Chang CCY Cheng D Acyl-coenzyme A: cholesterol acyltransferase.Annu Rev Biochem. 1997; 66: 613-638Crossref PubMed Scopus (444) Google Scholar, 28Okwu AK Xu XX Shiratori Y Tabas I Regulation of the threshold for lipoprotein-induced acyl-CoA cholesterol O-acyltransferase stimulation in macrophages by cellular sphingomyelin content.J Lipid Res. 1994; 35: 644-655Abstract Full Text PDF PubMed Google Scholar, 29Chang CCY Lee CYG Chang ET Cruz JC Levesque M Chang TY Recombinant acyl-CoA: cholesterol acyltransferase-1(ACAT-1) purified to essential homogeneity utilizes cholesterol in mixed micelles or vesicles in a highly cooperative manner.J Biol Chem. 1998; 273: 35132-35141Crossref PubMed Scopus (110) Google Scholar The electron microscopic studies in macrophages described in this study report ACAT-1 localization at the ultrastructural level for the first time, demonstrating that the ACAT-1 protein is located mainly in the rough endoplasmic reticulum. This result is consistent with previous biochemical studies using other cell types, suggesting that ACAT-1 is an integral membrane protein that functions in the rough endoplasmic reticulum.1Chang TY Chang CCY Cheng D Acyl-coenzyme A: cholesterol acyltransferase.Annu Rev Biochem. 1997; 66: 613-638Crossref PubMed Scopus (444) Google Scholar, 30Reinhart MP Billheimer JT Faust JR Gaylor JL Subcellular localization of the enzymes of cholesterol biosynthesis and metabolism in rat liver.J Biol Chem. 1987; 262: 9649-9655Abstract Full Text PDF PubMed Google Scholar, 31Doolittle GM Chang TY Solubilization, partial purification, and reconstitution in phosphatidylcholine-cholesterol liposomes of acyl-CoA: cholesterol acyltransferase.Biochemistry. 1982; 21: 674-679Crossref PubMed Scopus (38) Google Scholar, 32Lange Y Strebel F Steck TL Role of the plasma membrane in cholesterol esterification in rat hepatoma cells.J Biol Chem. 1993; 268: 13838-13843Abstract Full Text PDF PubMed Google Scholar In an earlier study using immunofluorescence microscopy, Khelef et al demonstrated that a minor portion of ACAT-1 in mouse macrophages is distributed in Golgi complexes in addition to its main location in the endoplasmic reticulum.16Khelef N Buton X Beatini N Wang H Meiner V Chang TY Farese Jr, RV Maxfield FR Tabas I Immunolocalization of acyl-coenzyme A: cholesterol O-acyltransferase in macrophages.J Biol Chem. 1998; 273: 11218-11224Crossref PubMed Scopus (49) Google Scholar In human macrophages, however, we have examined numerous electron micrographs (more than 50) but have failed to detect any positive signals in the Golgi complexes. This discrepancy may result from species difference used in our current study and the studies by Khelef et al.16Khelef N Buton X Beatini N Wang H Meiner V Chang TY Farese Jr, RV Maxfield FR Tabas I Immunolocalization of acyl-coenzyme A: cholesterol O-acyltransferase in macrophages.J Biol Chem. 1998; 273: 11218-11224Crossref PubMed Scopus (49) Google Scholar When human macrophages were loaded with cholesterol by treating with AcLDL, we still could not detect any ACAT-1-positive immunoreactivity in the Golgi complexes. Instead, we found that the ACAT-1 signals were present in tubular endoplasmic reticulum as well as in the small-sized vesicles, 80 to 150 nm in diameter; these small vesicles also stained positive for GRP 78, known as a specific marker for endoplasmic reticulum. In addition, our double immunofluorescent staining revealed that the ACAT-1 signals colocalized extensively with the GRP 78 signals; the extent of colocalization between ACAT-1 and GRP 78 did not change before and after cholesterol loading. Overall, our findings raise the possibility that, at least in human macrophages, cholesterol loading may induce an accelerated endoplasmic reticulum vesiculation process to produce certain novel small vesicles enriched in the ACAT-1 protein from rough endoplasmic reticulum. The vesiculation process, if it exists, may increase the accessibility of ACAT-1 protein to intracellular free cholesterol. We thank Ms. Makiko Tanaka and Mr. Osamu Nakamura, Second Department of Pathology, Kumamoto University School of Medicine, for skillful technical assistance.

This paper reports the isolation and characterization of Chinese hamster ovary cell mutants defective in low density lipoprotein (LDL)-cholesterol trafficking. The parental cell line was 25-RA, which possesses LDL receptors and various cholesterogenic enzyme activities that are partially resistant to down regulation by exogenous sterols (Chang, T. Y., and J. S. Limanek. 1980. J. Biol. Chem. 255:7787-7795). Because these cells accumulate a large amount of intracellular cholesteryl ester when grown in medium containing 10% fetal calf serum, mutagenized populations of 25-RA cells were grown in the presence of a specific inhibitor of acyl-coenzyme A: cholesterol acyltransferase (ACAT), which depleted their cholesteryl ester stores. Without this cholesterol ester storage, 99% of 25-RA cells die after 5-d growth in cholesterol starvation medium, while the mutant cells, which accumulate free cholesterol intracellularly, survived. In two mutant clones chosen for characterization, activation of cholesteryl ester synthesis by LDL was markedly reduced in the mutant cells compared with 25-RA cells. This lack of activation of cholesterol ester synthesis in the mutant cells could not be explained by defective uptake and/or processing of LDL or by a decreased amount of ACAT, as determined by in vitro enzyme activity. Mutant cells grown in the presence of LDL contain numerous cytosolic particles that stain intensely with the fluorescent compound acridine orange, suggesting that they are acidic. The particles are also stained with filipin, a cholesterol-specific fluorescent dye. Indirect immunofluorescence with a monoclonal antibody specific for a lysosomal/endosomal fraction revealed a staining pattern that colocalized with the filipin signal. The mutant phenotype was recessive. The available evidence indicates that the mutant cells can take up and process LDL normally, but the hydrolyzed cholesterol accumulates in an acidic compartment, probably the lysosomes, where it can not be transported to its normal intracellular destinations.

Both genetic inactivation and pharmacological inhibition of the cholesteryl ester synthetic enzyme acyl-CoA:cholesterol acyltransferase 1 (ACAT1) have shown benefit in mouse models of Alzheimer's disease (AD). In this study, we aimed to test the potential therapeutic applications of adeno-associated virus (AAV)-mediated Acat1 gene knockdown in AD mice. We constructed recombinant AAVs expressing artificial microRNA (miRNA) sequences, which targeted Acat1 for knockdown. We demonstrated that our AAVs could infect cultured mouse neurons and glia and effectively knockdown ACAT activity in vitro. We next delivered the AAVs to mouse brains neurosurgically, and demonstrated that Acat1-targeting AAVs could express viral proteins and effectively diminish ACAT activity in vivo, without inducing appreciable inflammation. We delivered the AAVs to the brains of 10-month-old AD mice and analyzed the effects on the AD phenotype at 12 months of age. Acat1-targeting AAV delivered to the brains of AD mice decreased the levels of brain amyloid-β and full-length human amyloid precursor protein (hAPP), to levels similar to complete genetic ablation of Acat1. This study provides support for the potential therapeutic use of Acat1 knockdown gene therapy in AD.

Patients with Alzheimer's disease (AD) display amyloidopathy and tauopathy. In mouse models of AD, pharmacological inhibition using small molecule enzyme inhibitors or genetic inactivation of acyl-coenzyme A (Acyl-CoA):cholesterol acyltransferase 1 (ACAT1) diminished amyloidopathy and restored cognitive deficits. In microglia, ACAT1 blockage increases autophagosome formation and stimulates amyloid β peptide1-42 degradation. Here, we hypothesize that in neurons ACAT1 blockage augments autophagy and increases autophagy-mediated degradation of P301L-tau protein. We tested this possibility in murine neuroblastoma cells ectopically expressing human tau and in primary neurons isolated from triple transgenic AD mice that express mutant forms of amyloid precursor protein, presenilin-1, and human tau. The results show that ACAT1 blockage increases autophagosome formation and decreases P301L-tau protein content without affecting endogenous mouse tau protein content. In vivo, lacking Acat1 decreases P301L-tau protein content in the brains of young triple transgenic AD mice but not in those of old mice, where extensive hyperphosphorylations and aggregation of P301L-tau take place. These results suggest that, in addition to ameliorating amyloidopathy in both young and old AD mice, ACAT1 blockage may benefit AD by reducing tauopathy at early stage.

Cellular cholesterol homeostasis involves sterol sensing at the endoplasmic reticulum (ER) and sterol export from the plasma membrane (PM). Sterol sensing at the ER requires efficient sterol delivery from the PM; however, the macromolecules that facilitate retrograde sterol transport at the PM have not been identified. ATP-binding cassette transporter A1 (ABCA1) mediates cholesterol and phospholipid export to apolipoprotein A-I for the assembly of high density lipoprotein (HDL). Mutations in <i>ABCA1</i> cause Tangier disease, a familial HDL deficiency. Several lines of clinical and experimental evidence suggest a second function of ABCA1 in cellular cholesterol homeostasis in addition to mediating cholesterol efflux. Here, we report the unexpected finding that ABCA1 also plays a key role in facilitating retrograde sterol transport from the PM to the ER for sterol sensing. Deficiency in ABCA1 delays sterol esterification at the ER and activates the SREBP-2 cleavage pathway. The intrinsic ATPase activity in ABCA1 is required to facilitate retrograde sterol transport. ABCA1 deficiency causes alternation of PM composition and hampers a clathrin-independent endocytic activity that is required for ER sterol sensing. Our finding identifies ABCA1 as a key macromolecule facilitating bidirectional sterol movement at the PM and shows that ABCA1 controls retrograde sterol transport by modulating a certain clathrin-independent endocytic process.

Vascular contributions to cognitive impairment and dementia (VCID) are a common cause of cognitive decline, yet limited therapies exist. This cerebrovascular disease results in neurodegeneration via acute, chronic, local, and systemic mechanisms. The etiology of VCID is complex, with a significant impact from atherosclerosis. Risk factors including hypercholesterolemia and hypertension promote intracranial atherosclerotic disease and carotid artery stenosis (CAS), which disrupt cerebral blood flow and trigger ischemic strokes and VCID. Apolipoprotein E (APOE) is a cholesterol and phospholipid carrier present in plasma and various tissues. APOE is implicated in dyslipidemia and Alzheimer disease (AD); however, its connection with VCID is less understood. Few experimental models for VCID exist, so much of the present information has been drawn from clinical studies. Here, we review the literature with a focus on the clinical aspects of atherosclerotic cerebrovascular disease and build a working model for the pathogenesis of VCID. We describe potential intermediate steps in this model, linking cholesterol, atherosclerosis, and APOE with VCID. APOE4 is a minor isoform of APOE that promotes lipid dyshomeostasis in astrocytes and microglia, leading to chronic neuroinflammation. APOE4 disturbs lipid homeostasis in macrophages and smooth muscle cells, thus exacerbating systemic inflammation and promoting atherosclerotic plaque formation. Additionally, APOE4 may contribute to stromal activation of endothelial cells and pericytes that disturb the blood-brain barrier (BBB). These and other risk factors together lead to chronic inflammation, atherosclerosis, VCID, and neurodegeneration. Finally, we discuss potential cholesterol metabolism based approaches for future VCID treatment.

Multiple membrane organelles require cholesterol for proper function within cells. The Niemann-Pick type C (NPC) proteins export cholesterol from endosomes to other membrane compartments, including the endoplasmic reticulum (ER), plasma membrane (PM), trans-Golgi network (TGN), and mitochondria, to meet their cholesterol requirements. Defects in NPC cause malfunctions in multiple membrane organelles and lead to an incurable neurological disorder. Acyl-coenzyme A:cholesterol acyltransferase 1 (ACAT1), a resident enzyme in the ER, converts cholesterol to cholesteryl esters for storage. In mutant NPC cells, cholesterol storage still occurs in an NPC-independent manner. Here we report the interesting finding that in a mutant Npc1 mouse (Npc1nmf), Acat1 gene (Soat1) knockout delayed the onset of weight loss, motor impairment, and Purkinje neuron death. It also improved hepatosplenic pathology and prolonged lifespan by 34%. In mutant NPC1 fibroblasts, ACAT1 blockade (A1B) increased cholesterol content associated with TGN-rich membranes and mitochondria, while decreased cholesterol content associated with late endosomes. A1B also restored proper localization of syntaxin 6 and golgin 97 (key proteins in membrane trafficking at TGN) and improved the levels of cathepsin D (a key protease in lysosome and requires Golgi/endosome transport for maturation) and ABCA1 (a key protein controlling cholesterol release at PM). This work supports the hypothesis that diverting cholesterol from storage can benefit multiple diseases that involve cholesterol deficiencies in cell membranes.

Acyl-CoA:cholesterol acyltransferase (ACAT) plays important roles in cellular cholesterol homeostasis. Four human ACAT-1 mRNAs (7.0, 4.3, 3.6, and 2.8 kilobases (kb)) share the same short 5′-untranslated region (exon 1) and coding sequence (exons 2–15). The 4.3-kb mRNA contains an additional 5′-untranslated region (1289 nucleotides in length; exons Xa and Xb) immediately upstream from the exon 1 sequence. One ACAT-1 genomic DNA insert covers exons 1–16 and a promoter (the P1 promoter). A separate insert covers exon Xa (1277 base pairs) and a different promoter (the P7 promoter). Gene mapping shows that exons 1–16 and the P1 promoter sequences are located in chromosome 1, while exon Xa and the P7 promoter sequence are located in chromosome 7. RNase protection assays demonstrate three different protected fragments, corresponding to the 4.3-kb mRNA and the two other mRNAs transcribed from the two promoters. These results are consistent with the interpretation that the 4.3-kb mRNA is produced from two different chromosomes, by a novel RNA recombination mechanism involving trans-splicing of two discontinuous precursor RNAs.

Niemann-Pick type C (NPC) is a neurodegenerative disorder characterized by progressive accumulation of cholesterol, gangliosides, and other lipids in the central nervous system and visceral organs. In the NPC1 mouse model, neurodegeneration and neuronal cell loss occur before postnatal day 21. Whether neuronal cholesterol accumulation occurs in vivo before the first signs of neuronal cell loss has not been demonstrated. In this report, we used the NPC1 mouse model and employed a novel cholesterol binding reagent, BCθ, that enabled us to visualize cellular cholesterol accumulation at a level previously unattainable.The results demonstrate the superiority of BCθ staining over conventional filipin staining in confocal microscopy and highlight several new findings. We show that at postnatal day 9, although only mild signs of neurodegeneration are detectable, significant neuronal cholesterol accumulation has already occurred throughout the NPC1 brain. In addition, although NPC1 Purkinje neurons exhibit a normal morphology at day 9, significant cholesterol accumulation within their extensive dendritic trees has occurred. We also show that in the thalamus and cortex of NPC1 mice, activated glial cells first appear at postnatal day 9 and heavily populate by day 22, suggesting that in NPC1 mice, neuronal cholesterol accumulation precedes neuronal injury and neuronal cell loss. Niemann-Pick type C (NPC) is a neurodegenerative disorder characterized by progressive accumulation of cholesterol, gangliosides, and other lipids in the central nervous system and visceral organs. In the NPC1 mouse model, neurodegeneration and neuronal cell loss occur before postnatal day 21. Whether neuronal cholesterol accumulation occurs in vivo before the first signs of neuronal cell loss has not been demonstrated. In this report, we used the NPC1 mouse model and employed a novel cholesterol binding reagent, BCθ, that enabled us to visualize cellular cholesterol accumulation at a level previously unattainable. The results demonstrate the superiority of BCθ staining over conventional filipin staining in confocal microscopy and highlight several new findings. We show that at postnatal day 9, although only mild signs of neurodegeneration are detectable, significant neuronal cholesterol accumulation has already occurred throughout the NPC1 brain. In addition, although NPC1 Purkinje neurons exhibit a normal morphology at day 9, significant cholesterol accumulation within their extensive dendritic trees has occurred. We also show that in the thalamus and cortex of NPC1 mice, activated glial cells first appear at postnatal day 9 and heavily populate by day 22, suggesting that in NPC1 mice, neuronal cholesterol accumulation precedes neuronal injury and neuronal cell loss. Niemann-Pick type C (NPC) disease is a fatal autosomal recessive neurovisceral disorder in humans and in animals, characterized by progressive neurodegeneration in the central nervous system (CNS) and hepatosplenomegaly. The disease can be caused by mutations in one of two genes, NPC1 and NPC2 [as reviewed in ref. (1Patterson M.C. Vanier M.T. Suzuki K. Morris J.A. Carstea E. Neufeld E.B. Blanchette-Mackie J.E. Pentchev P.G. Niemann-Pick disease type C: a lipid trafficking disorder.in: Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York2001: 3611-3633Google Scholar)]. Mutations in Npc1 account for 95% of all NPC disease cases, whereas mutations in Npc2 account for the remaining 5% (1Patterson M.C. Vanier M.T. Suzuki K. Morris J.A. Carstea E. Neufeld E.B. Blanchette-Mackie J.E. Pentchev P.G. Niemann-Pick disease type C: a lipid trafficking disorder.in: Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York2001: 3611-3633Google Scholar). At the cellular level, NPC disease is characterized by the accumulation of unesterified cholesterol, sphingomyelin, glycosphingolipids, and other lipids within the endosomal/lysosomal system in various tissues. The Npc1 gene encodes a multi-pass transmembrane protein with a putative sterol-sensing domain (2Carstea E.D. Morris J.A. Coleman K.G. Loftus S.K. Zhang D. Cummings C. Gu J. Rosenfeld M.A. Pavan W.J. Krizman D.B. Nagle J. Polymeropoulos M.H. Sturley S.L. Ioannou Y.A. Higgins M.E. Comly M. Cooney A. Brown A. Kaneski C.R. Blanchette-Mackie E.J. Dwyer N.K. Neufeld E.B. Chang T.Y. Liscum L. Strauss III, J.F. Ohno K. Zeigler M. Carmi R. Sokol J. Markie D. O'Neill R.R. van Diggelen O.P. Elleder M. Patterson M.C. Brady R.O. Vanier M.T. Pentchev P.G. Tagle D.A. Niemann-Pick C1 disease gene: homology to mediators of cholesterol homeostasis.Science. 1997; 277: 228-231Crossref PubMed Scopus (1212) Google Scholar). It resides within the tubulovesicles associated with the late endosome/lysosome (3Ko D.C. Gordon M.D. Jin J.Y. Scott M.P. Dynamic movements of organelles containing Niemann-Pick C1 protein: NPC1 involvement in late endocytic events.Mol. Biol. Cell. 2002; 12: 601-614Crossref Scopus (211) Google Scholar, 4Zhang M. Dwyer N.K. Love D.C. Cooney A. Comly M. Neufeld E.B. Pentchev P.G. Blanchette-Mackie E.J. Hanover J.A. Cessation of rapid late endosomal tubulovesicular trafficking in Niemann-Pick type C1 disease.Proc. Natl. Acad. Sci. USA. 2001; 98: 4466-4471Crossref PubMed Scopus (119) Google Scholar). In NPC1 mutant cells, the transport of both LDL-derived and endogenously synthesized cholesterol through the endosome/lysosome is partially defective in a cell type-dependent manner (5Wojtanik K.M. Liscum L. The transport of LDL-derived cholesterol to the plasma membrane is defective in NPC1 cells.J. Biol. Chem. 2003; 278: 14850-14856Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar, 6Sugii S. Reid P.C. Ohgami N. Du H. Chang T.Y. Distinct endosomal compartments in early trafficking of low density lipoprotein-derived cholesterol.J. Biol. Chem. 2003; 278: 27180-27189Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 7Lange Y. Ye J. Steck T.L. Circulation of cholesterol between lysosomes and the plasma membrane.J. Biol. Chem. 1998; 273: 18915-18922Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar, 8Cruz J.C. Chang T.Y. Fate of endogenously synthesized cholesterol in Niemann-Pick type C1 cells.J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 9Karten B. Vance D.E. Campenot R.B. Vance J.E. Trafficking of cholesterol from cell bodies to distal axons in Niemann-Pick C1-deficient neurons.J. Biol. Chem. 2003; 278: 4168-4175Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 10Reid P.C. Sugii S. Chang T.Y. Trafficking defects in endogenously synthesized cholesterol in fibroblasts, macrophages, hepatocytes, and glial cells from Niemann-Pick type C1 mice.J. Lipid Res. 2003; 44: 1010-1019Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar). NPC1 may be required for vesicular shuttling of both membrane lipids and fluid phase constituents from the late endosome to various destinations (11Neufeld E.B. Wastney M. Patel S. Suresh S. Cooney A.M. Dwyer N.K. Roff C.F. Ohno K. Morris J.A. Carstea E.D. Incardona J.P. Strauss III, J.F. Vanier M.T. Patterson M.C. Brady R.O. Pentchev P.G. Blanchette-Mackie E.J. The Niemann-Pick C1 protein resides in a vesicular compartment linked to retrograde transport of multiple lysosomal cargo.J. Biol. Chem. 1999; 274: 9627-9635Abstract Full Text Full Text PDF PubMed Scopus (332) Google Scholar, 12Liscum L. Niemann-Pick type C mutations cause lipid traffic jam.Traffic. 2000; 1: 218-225Crossref PubMed Scopus (132) Google Scholar). In vitro, the NPC1 protein exhibits a transmembrane molecular pump activity for fatty acids but not for cholesterol (13Davies J.P. Chen F.W. Ioannou Y.A. Transmembrane molecular pump activity of Niemann-Pick C1 protein.Science. 2000; 290: 2295-2298Crossref PubMed Scopus (254) Google Scholar). The Npc2 gene encodes the soluble protein HE1, a lysosomal protein that can be secreted into the growth medium (14Naureckiene S. Sleat D.E. Lackland H. Fensom A. Vanier M.T. Wattiaux R. Jadot M. Lobel P. Identification of HE1 as the second gene of Niemann-Pick C disease.Science. 2000; 290: 2298-2301Crossref PubMed Scopus (698) Google Scholar). NPC2 binds cholesterol with very high affinity and binds fatty acids with lower affinity (15Ko D.C. Binkley J. Sidow A. Scott M.P. The integrity of a cholesterol-binding pocket in Niemann-Pick C2 protein is necessary to control lysosome cholesterol levels.Proc. Natl. Acad. Sci. USA. 2003; 100: 2518-2525Crossref PubMed Scopus (161) Google Scholar). Despite evidence at the in vitro level favoring the view that NPC1 and NPC2 are involved in intracellular cholesterol transport, the direct connection between cholesterol accumulation and neurodegeneration in NPC brains remains under debate. Earlier studies [as reviewed in ref. (1Patterson M.C. Vanier M.T. Suzuki K. Morris J.A. Carstea E. Neufeld E.B. Blanchette-Mackie J.E. Pentchev P.G. Niemann-Pick disease type C: a lipid trafficking disorder.in: Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York2001: 3611-3633Google Scholar)] reported that glycolipids are elevated in the NPC1 brain, the primary target of this disease, whereas there is no overt increase in cholesterol in the brain in human NPC1 or its animal models (16Xie C. Turley S.D. Pentchev P.G. Dietschy J.M. Cholesterol balance and metabolism in mice with loss of function Niemann-Pick C protein.Am. J. Physiol. 1999; 276: E336-E344PubMed Google Scholar). The neuropathological abnormalities of NPC1 disease resemble those in primary gangliosidoses (i.e., diseases caused by enzyme deficiencies in the glycolipid degradation pathway). The connection between glycolipids and NPC1 is further supported by the work of Vanier (17Vanier M.T. Lipid changes in Niemann-Pick disease type C brain: personal experience and review of the literature.Neurochem. Res. 1999; 24: 481-489Crossref PubMed Scopus (167) Google Scholar), who reported that the total GM2 and GM3 contents in the cerebral cortex of a three-month-old patient were highly elevated as compared with those of age-matched infants. In addition, Zervas, Dobrenis, and Walkley (18Zervas M. Dobrenis K. Walkley S.U. Neurons in Niemann-Pick disease type C accumulate gangliosides as well as unesterified cholesterol and undergo dendritic and axonal alterations.J. Neuropathol. Exp. Neurol. 2001; 60: 49-64Crossref PubMed Scopus (220) Google Scholar) used a monoclonal antibody against GM2 to perform immunostaining and showed that the GM2 immunoreactivity increased in the cortical pyramidal neurons in animals and humans with NPC1 in a manner similar to that found in primary GM2 gangliosidosis. The same group of investigators then showed that treating NPC1 animals with the drug N-butyldeoxynojirimycin, an inhibitor of the enzyme glucosylceramide synthase, a key enzyme in the early glycosphingolipid biosynthesis pathway, decreased the ganglioside accumulation and the accompanying neuropathological changes in their brains (19Zervas M. Somers K.L. Thrall M.A. Walkley S.U. Critical role of glycosphingolipids in Niemann-Pick disease type C.Curr. Biol. 2001; 11: 1283-1287Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar). These and other studies suggested that NPC1 might be considered a glycolipid storage disease rather than a cholesterol storage disease. However, recent evidence for cholesterol accumulation in the NPC1 brain has been described. In NPC1 mice, Zervas, Dobrenis, and Walkley (18Zervas M. Dobrenis K. Walkley S.U. Neurons in Niemann-Pick disease type C accumulate gangliosides as well as unesterified cholesterol and undergo dendritic and axonal alterations.J. Neuropathol. Exp. Neurol. 2001; 60: 49-64Crossref PubMed Scopus (220) Google Scholar) reported cholesterol accumulation in various neurons, in addition to GM2 accumulation. The mice examined by these investigators were at 9.5 weeks of age, and were near the end of their life span (which averages between 10 to 11 weeks) (1Patterson M.C. Vanier M.T. Suzuki K. Morris J.A. Carstea E. Neufeld E.B. Blanchette-Mackie J.E. Pentchev P.G. Niemann-Pick disease type C: a lipid trafficking disorder.in: Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York2001: 3611-3633Google Scholar). In a separate study, Treiber-Held et al. (20Treiber-Held S. Distl R. Meske V. Albert F. Ohm T.G. Spatial and temporal distribution of intracellular free cholesterol in brains of a Niemann-pick type C mouse model showing hyperphosphorylated tau protein. Implications for Alzherimer's disease.J. Pathol. 2003; 200: 95-103Crossref PubMed Scopus (47) Google Scholar) examined cholesterol accumulation in NPC1 mice between 3 and 10 weeks of age. They reported significant cholesterol accumulation in neurons of the cortex, the CA1 region of the hippocampus, and the cerebellar cortex as early as 3 weeks of age (20Treiber-Held S. Distl R. Meske V. Albert F. Ohm T.G. Spatial and temporal distribution of intracellular free cholesterol in brains of a Niemann-pick type C mouse model showing hyperphosphorylated tau protein. Implications for Alzherimer's disease.J. Pathol. 2003; 200: 95-103Crossref PubMed Scopus (47) Google Scholar). In addition, they observed only mild cholesterol accumulation in the CA3 region of the hippocampus, the dentate gyrus, and the thalamus. However, in the NPC1 mouse, neurodegeneration and low levels of neuronal cell loss have been reported to occur before postnatal day 21, with the earliest signs of neurodegeneration reported at postnatal day 9 (21Ong W-Y. Kumar U. Switzer R.C. Sidhu A. Suresh G. Hu C-Y. Patel S.C. Neurodegeneration in Niemann-Pick type C disease mice.Exp. Brain Res. 2001; 141: 218-231Crossref PubMed Scopus (97) Google Scholar, 22German D.C. Liang C-L. Song T. Yazdani U. Xie C. Dietschy J.M. Neurodegeneration in the Niemann-Pick C mouse: glial involvment.Neuroscience. 2002; 109: 437-450Crossref PubMed Scopus (154) Google Scholar). In addition, by day 21 there is already a 13% loss of Purkinje neurons from the cerebellum, a hallmark of NPC disease, which progresses to a 98% loss by the end of the life span (22German D.C. Liang C-L. Song T. Yazdani U. Xie C. Dietschy J.M. Neurodegeneration in the Niemann-Pick C mouse: glial involvment.Neuroscience. 2002; 109: 437-450Crossref PubMed Scopus (154) Google Scholar). Whether significant cholesterol accumulation occurs in vivo before the first signs of neuronal cell loss (pre-postnatal day 21) and neurodegeneration has not been demonstrated. To visualize cholesterol accumulation in cells, various investigators invariably use filipin staining as the standard method [as reviewed in ref. (1Patterson M.C. Vanier M.T. Suzuki K. Morris J.A. Carstea E. Neufeld E.B. Blanchette-Mackie J.E. Pentchev P.G. Niemann-Pick disease type C: a lipid trafficking disorder.in: Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York2001: 3611-3633Google Scholar)]. Filipin binds to cholesterol with high affinity; however, it exhibits rapid photobleaching and only modest natural fluorescence under UV excitation, making its detection under confocal microscopy difficult. Recently, a novel method for detecting cholesterol-rich domains utilizing the cholesterol binding agent BCθ was developed. BCθ originates from a protein toxin called theta-toxin produced by Clostridium perfringens. For detection purposes, the toxin has been modified by proteolysis and then biotinylated. By employing avidin-conjugated fluorescent dyes, BCθ bound to cellular cholesterol can be visualized under fluorescence microscopy (23Iwamoto M. Morita I. Fukuda M. Murota S. Ando S. Ohno-Iwashita Y. A biotinylated perfringolysin O derivative: a new probe for detection of cell surface cholesterol.Biochim. Biophys. Acta. 1997; 1327: 222-230Crossref PubMed Scopus (62) Google Scholar). In unfixed cells or cells fixed with 1% or 2% paraformaldehyde, BCθ cannot enter the cell interior and binds mainly to cholesterol-rich domain(s) at the cell surface (24Waheed A.A. Shimada Y. Heijnen H.F. Nakamura M. Inomata M. Hayashi M. Iwashita S. Slot J.W. Ohno-Iwashita Y. Selective binding of perfringolysin O derivative to cholesterol-rich membrane microdomains (rafts).Proc. Natl. Acad. Sci. USA. 2001; 98: 4926-4931Crossref PubMed Scopus (200) Google Scholar, 25Sugii S. Reid P.C. Ohgami N. Shimada Y. Maue R.A. Ninomiya H. Ohno-Iwashita Y. Chang T.Y. Biotinylated theta toxin derivative as a probe to examine intracellular cholesterol domains in normal and Niemann-Pick type C1 cells.J. Lipid Res. 2003; 44: 1033-1041Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). In contrast, when cells are fixed with 4% paraformaldehyde, a significant portion of the cholesterol binding sites at the plasma membrane (PM) are inactivated, presumably because of extensive cross-linking of membrane proteins (26Mobius W. Ohno-Iwashita Y. van Donselaar E.G. Oorschot V.M. Shimada Y. Fujimoto T. Heijnen H.F. Geuze H.J. Slot J.W. Immunoelectron microscopic localization of cholesterol using biotinylated and non-cytolytic perfringolysin O.J. Histochem. Cytochem. 2002; 50: 43-55Crossref PubMed Scopus (226) Google Scholar). Concurrently, the cells become leaky to various macromolecules, allowing BCθ to enter the cell interior. At the cell interior, BCθ was shown to stain mainly cholesterol-rich domains; the complexes formed can be visualized under fluorescence microscopy in a manner far superior to that of filipin (25Sugii S. Reid P.C. Ohgami N. Shimada Y. Maue R.A. Ninomiya H. Ohno-Iwashita Y. Chang T.Y. Biotinylated theta toxin derivative as a probe to examine intracellular cholesterol domains in normal and Niemann-Pick type C1 cells.J. Lipid Res. 2003; 44: 1033-1041Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). In the current study, we employ this new method to monitor cholesterol accumulation in the brains of NPC1 mice from the first signs of neurodegeneration at postnatal day 9 to a stage of low levels of neuronal cell loss at postnatal day 22. The animal studies were prereviewed and approved by the Institutional Animal Use and Care Committee at Dartmouth College, Hanover, New Hampshire: Protocol #11601. The BALB/c NPC1NIH mice were kindly donated by Peter G. Pentchev at the National Institutes of Health. Mice were bred as NPC+/− heterozygotes. Litters were genotyped via tail snip DNA by a previously described PCR method (27Loftus S.K. Morris J.A. Carstea E.D. Gu J.Z. Cummings C. Brown A. Ellison J. Ohno K. Rosenfeld M.A. Tagle D.A. Pentchev P.G. Pavan W.J. Murine model of Niemann-Pick C disease: mutation in a cholesterol homeostasis gene.Science. 1997; 277: 232-235Crossref PubMed Scopus (697) Google Scholar). Preliminary studies revealed no detectable abnormal phenotypes in the heterozygous animals (NPC+/−), consistent with previous reports. Homozygous NPC (NPC−/−) mice and their age-matched normal siblings (NPC+/+) were examined at 9, 11, 15, and 22 days of age, with n = 4 animals (2 NPC−/− and 2 NPC+/+) per age point. At each time period, mice were anesthetized with ether and perfused through their hearts with Dulbecco's phosphate buffered saline without calcium and magnesium followed by 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4). The brains were excised, and large coronal sections were taken with a razor blade through the cerebellum and the underlying brain stem, and through the cortex and the underlying basal structures. The large tissue sections were fixed in 4% paraformaldehyde for 30 min, washed multiple times in 0.2 M phosphate buffer, and cryoprotected in 30% sucrose at 4°C overnight. For each animal, coronal brain sections from the cerebellum/brainstem and the cortex/basal structures were embedded side by side; 5 μm thin sections were cut on a cryostat and placed on precleaned glass slides. Section slides were blocked with 1% fetal bovine serum (FBS) in 0.5 M Tris (pH 7.6), or with PBS containing 1% BSA and the nonspecific mouse IgM antibodies (for GM1 and GM2 slides only), then stained for histochemical analysis as described below. Section slides described above were incubated overnight at 4°C on humidified trays with various primary staining reagents diluted in 0.5 M Tris containing 1% FBS, or in PBS containing 1% BSA (for GM1 and GM2 staining). BCθ was prepared as previously described (24Waheed A.A. Shimada Y. Heijnen H.F. Nakamura M. Inomata M. Hayashi M. Iwashita S. Slot J.W. Ohno-Iwashita Y. Selective binding of perfringolysin O derivative to cholesterol-rich membrane microdomains (rafts).Proc. Natl. Acad. Sci. USA. 2001; 98: 4926-4931Crossref PubMed Scopus (200) Google Scholar) and used at 15 μg/ml. Anti-GM1 biotin-conjugated mouse monoclonal class IgM was from Seikagaku Co., Japan, and was used at 1:100 (v/v). Anti-GM2 mouse monoclonal class IgM, described by Taniguchi et al. (28Taniguchi M. Shinoda Y. Ninomiya H. Vanier M.T. Ohno K. Sites and temporal changes of gangliosides GM1/GM2 storage in the Niemann-Pick disease type C mouse brain.Brain Dev. 2001; 23: 414-421Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar), was generously provided by Dr. T. Tai of the Tokyo Metropolitan Institute of Gerontology. For GM1 and GM2 staining, sections were permeabilized with 0.5% Triton X-100 as described previously (28Taniguchi M. Shinoda Y. Ninomiya H. Vanier M.T. Ohno K. Sites and temporal changes of gangliosides GM1/GM2 storage in the Niemann-Pick disease type C mouse brain.Brain Dev. 2001; 23: 414-421Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar). Filipin (125 μg/ml) staining was performed under light-protected conditions for 2 h at room temperature, as previously described (25Sugii S. Reid P.C. Ohgami N. Shimada Y. Maue R.A. Ninomiya H. Ohno-Iwashita Y. Chang T.Y. Biotinylated theta toxin derivative as a probe to examine intracellular cholesterol domains in normal and Niemann-Pick type C1 cells.J. Lipid Res. 2003; 44: 1033-1041Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). After incubation with primary reagents, slides were washed with 0.5 M Tris containing no FBS and counterstained with NeurotraceTM fluorescent Nissl Stain (N-21480) 500/525 green (Molecular Probes, Eugene, OR) according to the manufacturer's literature. Anti-Calbindin-D-28K (EG-20) rabbit polyclonal antibodies (Sigma) were used to stain Purkinje neurons and their dendritic architecture. Anti-glial acidic fibrillary protein (GFAP) rabbit polyclonal antibodies (Sigma) were used to stain reactive astrocytes. Anti-F4/80 rat monoclonal antibodies (Accurate Chemical and Scientific Corp.) were used to stain macrophages. Bound BCθ, GM1, GM2, GFAP, or Calbindin antibodies were detected with the following secondary reagents: streptavidin-Alexa 488 or -Alexa 568 (at 1:1,000, v/v), goat anti-mouse IgM-Alexa 647 (at 1:150, v/v), horse/goat anti-rabbit-Alexa 488 (at 1:150, v/v), -Alexa 568 (at 1:150, v/v), or Cy 5 (at 1:150, v/v), and donkey anti-rat-Alexa 568 (at 1:150, v/v). All secondary reagents were from Molecular Probes. Slides were treated with Prolong anti-fade from Molecular Probes. Images were collected with a confocal microscope (Bio-Rad MRC-1024) and constructed with LaserSharp software. Images of filipin-stained sections were collected on a Leica TCS-SP confocal microscope equipped with an argon laser for UV excitations, and constructed with Leica Confocal Software. Multiple coronal brain sections from postnatal day 9, 11, 15, and 22 NPC and wild-type (WT) mice were stained with BCθ and Neurotrace. Sections representing cortex, thalamus, hypothalamus, hippocampus, dentate gyrus, and cerebellum were examined under a 10× objective using a Bio-Rad MRC1024 confocal microscope. For each section, six image scans, encompassing all regions of the brain, were taken, and the total image BCθ fluorescent intensity was determined by LaserSharp software. The Alexa dye conjugates used are very photo-stable under confocal microscopy, and no reduction in signal was observed during analysis. Sections from WT mice exhibited low levels of BCθ-positive signals, representing background staining of synaptosomal membranes and myelin-associated cholesterol. Therefore, to serve as a baseline, we adjusted the IRIS and GAIN features of the MRC1024 confocal microscope so that WT day 9 brain sections exhibited mean fluorescent intensities of 1,000 arbitrary units. Once these parameters were set, sections from WT day 11, 15, and 22 and NPC day 9, 11, 15, and 22 mice were scanned and the intensity values measured. To ensure that the measured intensity values were proportional to the signal intensity, instrument settings were chosen such that the signals recorded from the brightest samples prepared from the NPC1 mice did not go beyond the full-scale value. To confirm these findings, in a second experiment, a second set of brains from NPC and WT day 9, 11, 15, and 22 mice was examined in the same manner. Neurotrace staining was used to aid in the identification of regions and as an internal standard to determine differences in staining intensities in NPC and WT sections. Measurements of neurotrace fluorescent intensities showed <15% difference in values, indicating that the differences were specific to BCθ staining. Attempts to perform a similar analysis with filipin proved impossible because of the high background associated with filipin staining at these ages and its rapid bleaching time in confocal microscopy. To compare the ability of BCθ and filipin to detect cholesterol accumulation in vivo, normal (WT) and NPC1 (NPC) mouse brains, taken from postnatal day 9, 15, and 22 genotype-confirmed animals were processed for histochemistry and stained with BCθ and with filipin in parallel. A fluorescent Nissl stain, Neurotrace™ (Molecular Probes), which stains the extensive rough endoplasmic reticulum in neurons, was used as an identifying marker for neurons. As early as postnatal day 9, positive BCθ staining (Fig. 1, arrows), indicative of cholesterol accumulation, was observed in neurons of all regions of the NPC brain, including the cerebellum, cortex, thalamus, granule layer of the dentate gyrus, and the large pyramidal neurons of Ammon's horn in the hippocampus (regions CA1–CA3). This staining was variable from region to region, but in general, the extent of cholesterol accumulation progressed from day 9 to day 22. In WT mouse brains, cholesterol accumulation was undetectable in these regions. In comparison, weak sporadic filipin staining (Fig. 2)in neurons was present in postnatal day 9 NPC brains, with increased signals observed in NPC brains at postnatal day 22, although both NPC and WT brains exhibited high background (Fig. 2).Fig. 2Detection of neuronal cholesterol accumulation by filipin staining. Coronal brain sections (5 μm) taken from sibling WT (NPC1+/+) and NPC (NPC1−/−) mice perfuse-fixed with 4% paraformaldehyde were stained with filipin (blue) and neurotrace (green) and examined by confocal microscopy. Filipin (blue) stains intracellular cholesterol-rich domain(s), indicated by arrows; neurotrace (green), a fluorescent Nissl stain, stains neuronal perikarya, indicated by asterisks. Images shown are high-magnification images obtained from WT and NPC brains at postnatal days 9 and 22, and are representative of a large number of photographs obtained by confocal microscopy from multiple day 9, 11, 15, and 22 WT and NPC mice brains. Abbreviations used: CBL, cerebellum; CTX, cortex; TH, thalamus; HC, hippocampus CA3 region; DG, dentate gyrus. Scale bar is 10 μm.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In NPC cerebellum, BCθ staining detected low levels of cholesterol accumulation within Purkinje cells (Fig. 1, arrows; CBL indicated by the asterisk) and small granule neurons (Fig. 1; CBL, indicated by the plus sign) of the granule layer as early as postnatal day 9. Cholesterol accumulation in both Purkinje and granule neurons increased from day 9 to day 22 (Fig. 1, CBL). In WT mouse brain, BCθ did not detect any cholesterol accumulation between day 9 and day 22 within the cerebellum (Fig. 1, CBL). In contrast, cholesterol accumulation could not be detected by filipin in postnatal day 9 NPC cerebellum (Fig. 2, CBL). By day 22, filipin staining could detect cholesterol accumulation within Purkinje neurons (Fig. 2, arrows; CBL, asterisk), but not in granule neurons. At day 9, based on morphological appearance, NPC Purkinje cells exhibited no obvious abnormalities, but by day 22, multiple alterations in cell morphology, such as dendritic alterations and axonal swelling, became visually apparent. In addition, there was evidence of missing Purkinje cells when NPC cerebellar sections were stained with Calbindin, a Purkinje cell marker protein, suggesting initial Purkinje cell loss. At this stage, neuronal cell loss in the granular layer was not obvious. In NPC cortex (Fig. 1, CTX), at day 9, significant cholesterol accumulation was observed in neurons of all layers. Accumulation occurred predominantly in the neuronal perikarya (asterisk) as well as the axon hillock region (arrow). Cholesterol accumulations were barely detectable by filipin staining at postnatal day 9, and were difficult to discern from background staining (Fig. 2, CTX). Filipin staining at day 22 showed cholesterol accumulations in the axon hillock region of most neurons (Fig. 2, CTX, indicated by arrows), similar to BCθ staining

The first acyl-coenzyme A:cholesterol acyltransferase (ACAT) cDNA cloned and expressed in 1993 is designated as ACAT-1. In various human tissue homogenates, ACAT-1 protein is effectively solubilized with retention of enzymatic activity by the detergent CHAPS along with high salt. After using anti-ACAT-1 antibodies to quantitatively remove ACAT-1 protein from the solubilized enzyme, measuring the residual ACAT activity remaining in the immunodepleted supernatants allows us to assess the functional significance of ACAT-1 protein in various human tissues. The results showed that ACAT activity was immunodepleted 90% in liver (83% in hepatocytes), 98% in adrenal gland, 91% in macrophages, 80% in kidney, and 19% in intestines, suggesting that ACAT-1 protein plays a major catalytic role in all of the human tissue/cell homogenates examined except intestines. Intestinal ACAT activity is largely resistant to immunodepletion and is much more sensitive to inhibition by the ACAT inhibitor Dup 128 than liver ACAT activity.—Lee, O., C. C. Y. Chang, W. Lee, and T-Y. Chang. Immunodepletion experiments suggest that acyl-coenzyme A:cholesterol acyltransferase-1 (ACAT-1) protein plays a major catalytic role in adult human liver, adrenal gland, macrophages, and kidney, but not in intestines.

A protocol has been developed for isolating cholesterol ester-deficient cells from the Chinese hamster ovary cell clone 25-RA. This cell line previously was shown to be partially resistant to suppression of cholesterogenic enzyme activities by 25-hydroxycholesterol and to accumulate a large amount of intracellular cholesterol ester when grown in medium containing 10% fetal calf serum (Chang, T. Y., and Limanek, J. S. (1980) J. Biol. Chem. 255, 7787-7795). The higher cholesterol ester content of 25-RA is due to an increase in the rate of cholesterol biosynthesis and low density lipoprotein receptor activity compared to wild-type Chinese hamster ovary cells, and not due to an abnormal acyl-CoA:cholesterol acyltransferase enzyme. The procedure to isolate cholesterol ester-deficient mutants utilizes amphotericin B, a polyene antibiotic known to bind to cholesterol and to form pore complexes in membranes. After incubation in cholesterol-free medium plus an inhibitor of endogenous cholesterol biosynthesis, 25-RA cells were found to be 50-500 times more sensitive to amphotericin B killing than were mutant cells containing reduced amounts of cholesterol ester. Twelve amphotericin B-resistant mutants were isolated which retained the 25-hydroxycholesterol-resistant phenotype. These mutants did not exhibit the perinuclear lipid droplets characteristic of 25-RA cells, and lipid analysis revealed a large (up to 40-fold) reduction in cellular cholesterol ester. The acyl-CoA:cholesterol acyltransferase activities of these cholesterol ester-deficient mutants were markedly lower than 25-RA when assayed in intact cells or in an in vitro reconstitution assay. The tightest mutant characterized, AC29, was found to have less than 1% of the parental acyl-CoA:cholesterol acyltransferase activity. These mutants all have reduced rates of sterol synthesis and lower low density lipoprotein receptor activity compared to 25-RA, probably as a consequence of their reduced enzyme activities. Cell fusion experiments revealed that the phenotypes of all the mutants examined are not dominant and that the mutants all belong to the same complementation group. We conclude that these mutants contain a lesion in the gene encoding acyl-CoA:cholesterol acyltransferase or in a gene encoding a factor needed for enzyme production.

ACAT1 (acyl-CoA:cholesterol acyltransferase 1) is thought to have two distinct sterol-binding sites: a substrate-binding site and an allosteric-activator site. In the present work, we investigated the structural features of various sterols as substrates and/or activators in vitro. The results show that without cholesterol, the plant sterol sitosterol is a poor substrate for ACAT. In the presence of cholesterol, ACAT1-mediated esterification of sitosterol is highly activated while ACAT2-mediated esterification of sitosterol is only moderately activated. For ACAT1, we show that the stereochemistry of the 3-hydroxy group at steroid ring A is a critical structural feature for a sterol to serve as a substrate, but less critical for activation. Additionally, enantiomeric cholesterol, which has the same biophysical properties as cholesterol in membranes, fails to activate ACAT1. Thus ACAT1 activation by cholesterol is the result of stereo-specific interactions between cholesterol and ACAT1, and is not related to the biophysical properties of phospholipid membranes. To demonstrate the relevance of the ACAT1 allosteric model in intact cells, we showed that sitosterol esterification in human macrophages is activated upon cholesterol loading. We further show that the activation is not due to an increase in ACAT1 protein content, but is partly due to an increase in the cholesterol content in the endoplasmic reticulum where ACAT1 resides. Together, our results support the existence of a distinct sterol-activator site in addition to the sterol-substrate site of ACAT1 and demonstrate the applicability of the ACAT1 allosteric model in intact cells.

We previously studied the early trafficking of low density lipoprotein (LDL)-derived cholesterol in mutant Chinese hamster ovary cells defective in Niemann-Pick type C1 (NPC1) using cyclodextrin (CD) to monitor the arrival of cholesterol from the cell interior to the plasma membrane (PM) (Cruz, J. C., Sugii, S., Yu, C., and Chang, T.-Y. (2000) J. Biol. Chem. 275, 4013–4021). We found that newly hydrolyzed cholesterol derived from LDL first appears in certain CD-accessible pool(s), which we assumed to be the PM, before accumulating in the late endosome/lysosome, where NPC1 resides. To determine the identity of the early CD-accessible pool(s), in this study, we performed additional experiments, including the use of revised CD incubation protocols. We found that prolonged incubation with CD (>30 min) caused cholesterol in internal membrane compartment(s) to redistribute to the PM, where it became accessible to CD. In contrast, a short incubation with CD (5–10 min) did not cause such an effect. We also show that one of the early compartments contains acid lipase (AL), the enzyme required for liberating cholesterol from cholesteryl ester in LDL. Biochemical and microscopic evidence indicates that most of the AL is present in endocytic compartment(s) distinct from the late endosome/lysosome. Our results suggest that cholesterol is liberated from LDL cholesteryl ester in the hydrolytic compartment containing AL and then moves to the NPC1-containing late endosome/lysosome before reaching the PM or the endoplasmic reticulum. We previously studied the early trafficking of low density lipoprotein (LDL)-derived cholesterol in mutant Chinese hamster ovary cells defective in Niemann-Pick type C1 (NPC1) using cyclodextrin (CD) to monitor the arrival of cholesterol from the cell interior to the plasma membrane (PM) (Cruz, J. C., Sugii, S., Yu, C., and Chang, T.-Y. (2000) J. Biol. Chem. 275, 4013–4021). We found that newly hydrolyzed cholesterol derived from LDL first appears in certain CD-accessible pool(s), which we assumed to be the PM, before accumulating in the late endosome/lysosome, where NPC1 resides. To determine the identity of the early CD-accessible pool(s), in this study, we performed additional experiments, including the use of revised CD incubation protocols. We found that prolonged incubation with CD (>30 min) caused cholesterol in internal membrane compartment(s) to redistribute to the PM, where it became accessible to CD. In contrast, a short incubation with CD (5–10 min) did not cause such an effect. We also show that one of the early compartments contains acid lipase (AL), the enzyme required for liberating cholesterol from cholesteryl ester in LDL. Biochemical and microscopic evidence indicates that most of the AL is present in endocytic compartment(s) distinct from the late endosome/lysosome. Our results suggest that cholesterol is liberated from LDL cholesteryl ester in the hydrolytic compartment containing AL and then moves to the NPC1-containing late endosome/lysosome before reaching the PM or the endoplasmic reticulum. In mammalian cells, low density lipoprotein (LDL) 1The abbreviations used are: LDL, low density lipoprotein; AL, acid lipase; PM, plasma membrane; NPC1, Niemann-Pick type C1; CL, cholesteryl linoleate; [3H]CL-LDL, [3H]cholesteryl linoleate-labeled low density lipoprotein; CHO, Chinese hamster ovary; CD, cyclodextrin; FBS, fetal bovine serum; DNP, dinitrophenyl; DAMP, 3-(2,4-dinitroanilino)-3′-amino-N-methyldipropylamine; V-ATPase, vacuolar ATPase; MPR, mannose 6-phosphate receptor; CI-MPR, cation-independent mannose 6-phosphate receptor; HDL, high density lipoprotein; Hf, human fibroblast; PBS, phosphate-buffered saline; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; GFP, green fluorescent protein; TGN, trans-Golgi network.1The abbreviations used are: LDL, low density lipoprotein; AL, acid lipase; PM, plasma membrane; NPC1, Niemann-Pick type C1; CL, cholesteryl linoleate; [3H]CL-LDL, [3H]cholesteryl linoleate-labeled low density lipoprotein; CHO, Chinese hamster ovary; CD, cyclodextrin; FBS, fetal bovine serum; DNP, dinitrophenyl; DAMP, 3-(2,4-dinitroanilino)-3′-amino-N-methyldipropylamine; V-ATPase, vacuolar ATPase; MPR, mannose 6-phosphate receptor; CI-MPR, cation-independent mannose 6-phosphate receptor; HDL, high density lipoprotein; Hf, human fibroblast; PBS, phosphate-buffered saline; Tricine, N-[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]glycine; GFP, green fluorescent protein; TGN, trans-Golgi network. binds to its receptor at the cell surface and is recruited into clathrin-coated endocytotic vesicles. After endocytosis, LDL enters the endosomal/lysosomal system, where cholesteryl ester, a major lipid found in LDL, is hydrolyzed by the enzyme acid lipase (AL) (1Brown M.S. Goldstein J.L. Science. 1986; 232: 34-47Crossref PubMed Scopus (4350) Google Scholar). Mutations in AL cause cholesteryl ester to eventually accumulate in the lysosome (2Brown M.S. Sobhani M.K. Brunschede G.Y. Goldstein J.L. J. Biol. Chem. 1976; 251: 3277-3286Abstract Full Text PDF PubMed Google Scholar, 3Anderson R.A. Byrum R.S. Coates P.M. Sando G.N. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2718-2722Crossref PubMed Scopus (106) Google Scholar). After the hydrolytic action by AL, the transport of LDL-derived cholesterol from the endosome/lysosome to the plasma membrane (PM) or to the endoplasmic reticulum for re-esterification requires the protein named Niemann-Pick type C1 (NPC1). Mutations in NPC1 cause unesterified cholesterol and other lipids to accumulate in the late endosome and lysosome. Despite significant advances, the events that led to eventual accumulation of cholesterol in the late endosome/lysosome remain unclear. To delineate the early trafficking events of LDL-derived cholesterol, we previously performed pulse-chase experiments using [3H]cholesteryl linoleate-labeled LDL ([3H]CL-LDL) in Chinese hamster ovary (CHO) mutant cells defective in the npc1 locus, CT43, along with their parental cells, 25RA (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). To monitor the arrival of [3H]cholesterol at the PM, we utilized a cyclodextrin (CD)-based intact cell assay. CD is a water-soluble molecule that has a high affinity for cholesterol and has been widely used to monitor the arrival of cholesterol at the PM from the cell interior (5Rothblat G.H. de la Llera-Moya M. Atger V. Kellner-Weibel G. Williams D.L. Phillips M.C. J. Lipid Res. 1999; 40: 781-796Abstract Full Text Full Text PDF PubMed Google Scholar, 6Neufeld E.B. Cooney A.M. Pitha J. Dawidowicz E.A. Dwyer N.K. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1996; 271: 21604-21613Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar, 7Lange Y. Ye J. Rigney M. Steck T. J. Biol. Chem. 2000; 275: 17468-17475Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar, 8Frolov A. Srivastava K. Daphna-Iken D. Traub L.M. Schaffer J.E. Ory D.S. J. Biol. Chem. 2001; 276: 46414-46421Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). Our results show that [3H]cholesterol, newly released from the hydrolysis of [3H]CL-LDL, emerges in the early pool(s) in a manner unaffected by the npc1 mutation. Subsequently (within 2 h), in the parental cells, [3H]cholesterol is distributed to the PM and the endoplasmic reticulum. In CT43 cells, [3H]cholesterol accumulates in the characteristic aberrant endosome/lysosome. [3H]Cholesterol that is present in the early pool(s) is extractable by CD, whereas [3H]cholesterol that accumulates in the aberrant endosome/lysosome is resistant to extraction by CD. Based on this CD sensitivity test, the early pool(s) was assumed to be the PM (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). These results led us to hypothesize that, in NPC1 cells, cholesterol liberated from cholesteryl ester in LDL first moves to the PM independent of NPC1 and then moves back to the cell interior and accumulates in the aberrant late endosome/lysosome. Using a similar CD-based assay, other investigators independently reached the same conclusion (7Lange Y. Ye J. Rigney M. Steck T. J. Biol. Chem. 2000; 275: 17468-17475Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). The original CD-based assay used by us and by others involved continuous incubation of cells with CD for 30 min or longer. Thus, it is possible that prolonged incubation of cells with CD may cause redistribution of cellular cholesterol, so cholesterol originally residing in internal membranes moves to the PM and becomes extractable by CD. Recently, Haynes et al. (9Haynes M.P. Phillips M.C. Rothblat G.H. Biochemistry. 2000; 39: 4508-4517Crossref PubMed Scopus (113) Google Scholar) showed that, in CHO cells, depending on the incubation time used (ranging from 30 s to 20 min), CD is capable of extracting cellular cholesterol from two or three kinetically distinct pools; rearrangement of cholesterol between these pools could occur under various treatments. In this work, we further investigated the early trafficking events of LDL-derived cholesterol. To follow the fate of newly hydrolyzed cholesterol more precisely, we redesigned the procedures for the pulse-chase experiment and the CD treatment. We also performed biochemical and immunofluorescence experiments to define the hydrolytic compartment(s) involved in producing LDL-derived cholesterol. A model, revised from the one previously proposed by this laboratory (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar), describing the early itinerary of LDL-derived cholesterol in the context of the endocytic pathway is presented. Materials—Fetal bovine serum (FBS), protease inhibitor mixture, Nonidet P-40, 2-hydroxypropyl-β-cyclodextrin, monoclonal antibody against dinitrophenyl (DNP), paraformaldehyde, and human apoA-I were purchased from Sigma. The acyl-CoA:cholesterol O-acyltransferase inhibitor F12511 was a gift of Pierre Fabre Research (Castres, Cedex, France). Percoll and [1,2,6,7-3H]CL were from Amersham Biosciences. Optiprep (Nycomed) was from Axis-Shield. FuGENE 6 transfection reagent was from Roche Applied Science. The ProLong antifade kit, Alexa 488- or Alexa 568-conjugated goat anti-rabbit or anti-mouse IgG, LysoTracker Red (DND-99), 3-(2,4-dinitroanilino)-3′-amino-N-methyldipropylamine (DAMP), and Zenon rabbit IgG labeling kits were from Molecular Probes, Inc.. Monoclonal antibodies against EEA1, caveolin-1, and syntaxin-6 were from BD Biosciences. Monoclonal antibody against Na+/K+-ATPase was from Upstate Biotechnology, Inc. Monoclonal antibody against hamster LAMP2 (lysosomal-associated membrane protein-2) was from the Developmental Studies Hybridoma Bank maintained by the University of Iowa. Rabbit polyclonal antibodies against AL were produced as described (10Du H. Witte D.P. Grabowski G.A. J. Lipid Res. 1996; 37: 937-949Abstract Full Text PDF PubMed Google Scholar). Monoclonal antibody against vacuolar ATPase (V-ATPase) was a generous gift from Professor Satoshi Sato (Kyoto University, Kyoto, Japan); this antibody (OSW2) is directed against the 100–116-kDa subunit of the V0 domain of V-ATPase and has been shown to specifically recognize the vacuolar type proton pump (11Sato S.B. Toyama S. J. Cell Biol. 1994; 127: 39-53Crossref PubMed Scopus (24) Google Scholar). Rabbit polyclonal antibodies against the cation-independent mannose 6-phosphate receptor (CI-MPR) and against Rab9 were generous gifts from Professor Suzanne Pfeffer (Stanford University) (12Dintzis S.M. Velculescu V.E. Pfeffer S.R. J. Biol. Chem. 1994; 269: 12159-12166Abstract Full Text PDF PubMed Google Scholar). Delipidated FBS was prepared as described (13Chin J. Chang T.-Y. J. Biol. Chem. 1981; 256: 6304-6310Abstract Full Text PDF PubMed Google Scholar). LDL (density of 1.019–1.063 g/ml) was prepared from fresh human plasma by sequential flotation as previously described (14Cadigan K.M. Heider J.G. Chang T.-Y. J. Biol. Chem. 1988; 263: 274-282Abstract Full Text PDF PubMed Google Scholar). High density lipoprotein (HDL; density of 1.063–1.21 g/ml) was prepared by the same flotation method and purified by heparin affinity chromatography. Cell Lines and Cell Culture—25RA is a CHO cell line that is resistant to the cytotoxicity of 25-hydroxycholesterol (15Chang T.-Y. Limanek J.S. J. Biol. Chem. 1980; 255: 7787-7795Abstract Full Text PDF PubMed Google Scholar) and that contains a gain-of-function mutation in SCAP (SREBP cleavage-activating protein) (16Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Cell. 1996; 87: 415-426Abstract Full Text Full Text PDF PubMed Scopus (427) Google Scholar). The CT43 mutant cell line was isolated as one of the cholesterol trafficking mutants from mutagenized 25RA cells (17Cadigan K.M. Spillane D.M. Chang T.-Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). It contains the same gain-of-function mutation in SCAP. In addition, it contains a premature translational termination mutation near the 3′-end of the npc1 coding sequence, producing a nonfunctional truncated NPC1 protein (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). CHO cells were maintained in medium A (Ham's F-12 medium plus 10% FBS and 10 μg/ml gentamycin) as monolayers at 37 °C with 5% CO2. When medium B (Ham's F-12 medium supplemented with 5% delipidated FBS plus 35 μm oleic acid and 10 μg/ml gentamycin) was used at lower temperatures (18 °C or lower), Ham's F-12 medium (titrated to pH 7.4 without sodium bicarbonate) was used, and cells were placed in a water bath without CO2. A human fibroblast (Hf) cell line derived from an NPC patient (No. 93.22) was the generous gift of Dr. Peter Pentchev (National Institutes of Health). Hf cell lines isolated from patients with Wolman's disease (GM00863A and GM01606A) and with mucolipidosis II (I-cell disease) (GM02013D) were from the NIGMS Human Genetic Cell Repository (Camden, NJ). Hepatocyte-like HepG2 and monocytic THP-1 cells were obtained from American Type Culture Collection (Manassas, VA). Hf and HepG2 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% FBS and 100 units/ml penicillin/streptomycin at 37 °C with 10% CO2. THP-1 cells were maintained under the same conditions, except that RPMI 1640 medium was used instead. Prior to the experiment, THP-1 was treated with 100 nm phorbol 12-myristate 13-acetate and 100 nm 1α,25-dihydroxyvitamin D3 (both from Sigma) for at least 72 h to induce differentiation (18Maung K. Miyazaki A. Nomiyama H. Chang C.C. Chang T.-Y. Horiuchi S. J. Lipid Res. 2001; 42: 181-187Abstract Full Text Full Text PDF PubMed Google Scholar). LDL-derived Cholesterol Trafficking Assays—[3H]CL-LDL with specific radioactivity of ∼5 × 104 cpm/μg of protein was prepared as previously described (19Faust J.R. Goldstein J.L. Brown M.S. J. Biol. Chem. 1977; 252: 4861-4871Abstract Full Text PDF PubMed Google Scholar). Cells were plated in 6- or 12-well dishes as previously described (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 20Cruz J.C. Chang T.-Y. J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). Prior to each experiment, the cells were cultured for 2 days in medium B (to deplete stored cholesterol within the cell). Cells were chilled on ice, labeled with 30 μg/ml [3H]CL-LDL in medium B for 5 h at 18 °C, and washed once with 1% bovine serum albumin-containing cold phosphate-buffered saline (PBS) at 4 °C and three more times with cold PBS. Cells were then fed cold medium B and placed in a water bath for the indicated chase times at 37 °C. During the chase period, rapid metabolism of [3H]CL-LDL occurs in a time-dependent manner. To obtain reproducible results, we found that it was essential to use healthy cells grown at late log phase for plating and to control the temperature and pH of the growth media in a precise manner. To control the temperature, we incubated tissue culture plates or dishes on platforms covered with water in a constant temperature water bath. To control the pH in a precise manner, we used media devoid of sodium bicarbonate and titrated to pH 7.4 within 1 week before usage. An acyl-CoA:cholesterol O-acyltransferase inhibitor (2 μm F12511) was included whenever cells were incubated at 37 °C. F12511 was previously shown to inhibit acyl-CoA:cholesterol O-acyltransferase activity at the submicromolar level (21Chang C.C. Sakashita N. Ornvold K. Lee O. Chang E.T. Dong R. Lin S. Lee C.Y. Strom S.C. Kashyap R. Fung J.J. Farese Jr., R.V. Patoiseau J.F. Delhon A. Chang T.-Y. J. Biol. Chem. 2000; 275: 28083-28092Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). Labeled cellular lipids were extracted and analyzed by TLC as described (17Cadigan K.M. Spillane D.M. Chang T.-Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar); the percent hydrolysis was calculated as [3H]cholesterol counts divided by the sum of [3H]CL and [3H]cholesterol counts. For cholesterol efflux experiments, cells were incubated with 4% 2-hydroxypropyl-β-cyclodextrin (CD) in medium B in the presence of the acyl-CoA:cholesterol O-acyltransferase inhibitor at 37 °C for the indicated times. The labeled lipids were extracted and analyzed as described (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 17Cadigan K.M. Spillane D.M. Chang T.-Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). The percent cholesterol efflux was calculated as [3H]cholesterol counts in the medium divided by the sum of [3H]CL counts in the cell and [3H]cholesterol counts in the cell and in the medium. Isolation of the PM—To isolate the PM from the cells, we employed the 30% Percoll gradient procedure essentially as described (20Cruz J.C. Chang T.-Y. J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). All procedures were performed at 4 °C. Briefly, after the pulse-chase experiment, cells in two 150-mm dishes were collected. The cells were scraped in buffer containing 0.25 m sucrose, 1 mm EDTA, and 20 mm Tricine (pH 7.8) and broken with 15 strokes using a stainless steel tissue grinder (Dura-Grind, Wheaton). The post-nuclear supernatant was loaded onto a 30% Percoll gradient. After centrifugation at 84,000 × g for 30 min, 25 fractions were collected from the top. The PM fractions usually corresponded to fractions 9 and 10, as evidenced by a visible white membrane band; this band showed high enrichment in Na+/K+-ATPase and caveolin-1 protein (20Cruz J.C. Chang T.-Y. J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). In addition, we performed biotinylation of PM proteins in intact cells at 4 °C for 10 min using sulfosuccinimidyl-6-(biotinamido)hexanoate (Pierce), which showed that only fractions 9 and 10 were highly enriched in the biotinylated proteins (data not shown). The 3H-labeled lipids were extracted using chloroform/methanol and analyzed by TLC as previously described (20Cruz J.C. Chang T.-Y. J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). 11% Percoll Gradient Analyses—All procedures were performed at 4 °C. The fractionation method was performed as described previously (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 22Spillane D.M. Reagan Jr., J.W. Kennedy N.J. Schneider D.L. Chang T.-Y. Biochim. Biophys. Acta. 1995; 1254: 283-294Crossref PubMed Scopus (20) Google Scholar). Briefly, after the pulse-chase experiment, cells from one 150-mm dish were scraped into homogenization buffer (0.25 m sucrose, 1 mm EDTA, and 20 mm Tris (pH 7.4)) and homogenized with 15 strokes using the same stainless steel tissue grinder described above. To minimize breakage of membrane vesicles, 250 mm sucrose was included in the buffer. To increase recovery, the pellet was resuspended in buffer and homogenized a second time. The combined post-nuclear supernatant from cells was loaded onto 11% Percoll and centrifuged at 20,000 × g for 40 min using a Beckman Model Ti-70.1 rotor. 10 fractions were collected from the top. >80% of the PM marker (Na+/K+-ATPase) was concentrated in fractions 1 and 2, whereas >80% of the late endosomal/lysosomal markers (LAMP1/LAMP2) were concentrated in fractions 9 and 10 as previously described (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). The 3H-labeled lipids were extracted using chloroform/methanol and analyzed by TLC as previously described (20Cruz J.C. Chang T.-Y. J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). Optiprep Gradient Analyses—The procedure was based on a previously described method (23Sheff D.R. Daro E.A. Hull M. Mellman I. J. Cell Biol. 1999; 145: 123-139Crossref PubMed Scopus (382) Google Scholar) with modifications. Cells grown in one 150-mm dish were homogenized at 4 °C as described above. The post-nuclear supernatant (1 ml) was placed onto 9 ml of a linear 5–20% Optiprep gradient prepared in homogenization buffer at 4 °C. Gradients were centrifuged at 27,000 rpm for 20 h at 4 °C using a Beckman SW 41 rotor. 20 fractions (0.5 ml each) were carefully collected from the top. Immunoblot analyses were performed using antibodies against individual organelle markers as indicated. The 3H-labeled lipids were extracted using chloroform/methanol and analyzed by TLC as previously described (20Cruz J.C. Chang T.-Y. J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar). Immunoblot and Spectrofluorometric Analyses of Percoll Fractions— For immunoblot analysis, each Percoll fraction was ultracentrifuged either at 100,000 × g for 90 min or at 150,000 × g for 30 min to remove the Percoll particles. Afterward, the samples (located on top of the Percoll particles) were carefully collected using Pasteur pipettes. Proteins present in these fractions were concentrated by chloroform/methanol precipitation (24Chang C.C. Lee C.Y. Chang E.T. Cruz J.C. Levesque M.C. Chang T.-Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). The precipitated proteins were dissolved in lysis buffer (100 mm Tris (pH 8.0), 0.2 m NaCl, 1% Nonidet P-40, 1 mm EDTA, and 1× protease inhibitor mixture), separated on SDS-polyacrylamide gel, and immunoblotted with polyclonal anti-AL antibodies (1:1000). To quantitate the LysoTracker signal (a late endosomal/lysosomal marker), we used a highly sensitive fluorometer to measure the fluorescence intensities present in various Percoll fractions. The method is briefly described as follows. Cells were incubated with 100 nm LysoTracker Red for 2 h at 37 °C and then fractionated on a Percoll gradient at 4 °C. The Percoll fractions were ultracentrifuged at 150,000 × g for 30 min to remove the Percoll particles. Each fraction was then quantitated for its fluorescence at Ex577 nm/Em590 nm using a PC1 photon counting spectrofluorometer from ISS Inc. (Champaign, IL). For detection of the green fluorescent protein (GFP) signal in GFP-transfected or NPC1-GFP-transfected cells, a modified method was needed (because Percoll particles exhibited autofluorescent signals that strongly interfered with the GFP signal). Each Percoll fraction was solubilized with the non-fluorescent detergent Thesit (Roche Applied Science) at 0.2%, and the solubilized material was ultracentrifuged at 150,000 × g for 6 h. The fluorescent signal present in the supernatant was quantitated in the fluorometer at Ex488 nm/Em507 nm. Construction and Transfection of GFP-tagged NPC1—The construct encoding mouse NPC1 protein fused with GFP was created and sub-cloned into the pREX-IRES vector by a procedure described elsewhere (25Sugii, S., Reid, P. C., Ohgami, N., Shimada, Y., Maue, R. A., Ninomiya, H., Ohno-Iwashita, Y., and Chang, T.-Y. (2003) J. Lipid Res., in pressGoogle Scholar). CT43 cells were transfected with the npc1-gfp cDNA using FuGENE 6 according to the manufacturer's instructions. Control experiments showed that expression of NPC1-GFP, but not GFP alone, completely rescued the cholesterol accumulation defect in CT43 cells, indicating that the NPC1-GFP fusion protein is functional (25Sugii, S., Reid, P. C., Ohgami, N., Shimada, Y., Maue, R. A., Ninomiya, H., Ohno-Iwashita, Y., and Chang, T.-Y. (2003) J. Lipid Res., in pressGoogle Scholar). Transfected cells were used within 2–3 days of transfection for imaging analysis and within 4 days for Percoll gradient analysis. Fluorescence Microscopy—Cells were grown on glass coverslips in 6-well plates or in 60-mm dishes and processed for fluorescence studies. For LysoTracker labeling, cells were preincubated with 200 nm LysoTracker Red in the medium at 37 °C for 2 h prior to the experiment. For DAMP staining, intact cells were incubated with 50 μm DAMP for 30 min at 37 °C (26Anderson R.G. Falck J.R. Goldstein J.L. Brown M.S. Proc. Natl. Acad. Sci. U. S. A. 1984; 81: 4838-4842Crossref PubMed Scopus (182) Google Scholar, 27Anderson R.G. Pathak R.K. Cell. 1985; 40: 635-643Abstract Full Text PDF PubMed Scopus (219) Google Scholar); its signal was detected with monoclonal antibody against DNP, followed by Alexa 568-conjugated secondary antibody. For immunostaining, cells were washed three times with PBS, fixed with 4% paraformaldehyde for 10 min at room temperature, washed three times again, and permeabilized either with methanol (chilled at -20 °C) for 1 min or with 1% Triton X-100 in PBS at room temperature for 10 min. After three more washes, the cells were blocked with 10% goat serum in PBS for 30 min at room temperature and incubated with predetermined concentrations of various primary antibodies in the blocking medium for 1 h. When anti-V-ATPase antibody was used as the primary antibody, the incubation time was for 20 min only. Antibody dilutions used in immunofluorescence were as follows: LAMP2 (1:200), AL (1:500 to 1:1000), EEA1 (1:50), syntaxin-6 (1:50), caveolin-1 (1:100), V-ATPase (1:1000), CI-MPR (1:500), and DNP (1:100). For double labeling studies using rabbit anti-AL and rabbit anti-CI-MPR antibodies, Zenon rabbit IgG labeling kits (Alexa 488 and Alexa 568, respectively) were employed according to the manufacturer's protocol. For other labeling studies, cells were washed with PBS three times, treated with various Alexa-conjugated secondary IgGs, and then washed three times. The coverslips were mounted with a drop of ProLong antifade medium onto the glass slides before image processing. Samples were viewed and photographed using a Zeiss Axiophot microscope with a ×63 objective equipped with a CCD camera (DEI-750, Optronics Engineering, Goleta, CA). Fluorescein isothiocyanate and rhodamine filters were used to visualize GFP/Alexa 488 and LysoTracker Red/Alexa 568, respectively. The images were processed using MetaView Version 4.5 software (Universal Imaging Corp., Downing-town, PA). In selective experiments as indicated, the samples were also viewed under a Bio-Rad MRC-1024 krypton/argon laser scanning confocal microscope. The images were constructed using LaserSharp software and further processed using Adobe Photoshop Version 5.02. Early Trafficking of LDL-derived Cholesterol Probed with a Long Versus Short Incubation with CD—We grew CT43 and 25RA cells in cholesterol-free medium for 2 days and pulse-labeled them with [3H]CL-LDL for 5 h at 18 °C. At this temperature, LDL was internalized, but accumulated in pre-lysosomal compartments without significant hydrolysis of CL. When the temperature was increased to 37 °C, CL in LDL was rapidly hydrolyzed to free cholesterol and transported to designated locations (4Cruz J.C. Sugii S. Yu C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). In numerous experiments, we found that the half-time of hydrolysis averaged 25 ± 5 min in both cell types; a typical result is shown in Fig. 1F. During the warm-up period (i.e. immediately after the labeling), if cells were continuously incubated with CD for various time periods as indicated (0–120 min), 25RA and CT43 cells showed the same degree of cholesterol efflux toward CD; the efflux significantly increased from 30 min on (Fig. 1A). When cells were chased at 37 °C for 30 min before adding CD for up to 120 min, a slight defect in cholesterol efflux (starting at 15 min after adding CD) occurred in CT43 cells (Fig. 1B). In a separate experiment, a slight efflux defect in CT43 cells was also found in cells chased for 15 min before CD treatment (data not shown). In contrast, a severe efflux defect in CT43 cells occurred when cells were chased at 37 °C for 60 min (Fig. 1C) or for 120 min (Fig. 1D) before adding CD. In a separate experiment, a severe efflux defect in CT43 cells was also shown in cells chased for 45 min before CD treatment (data not shown). We next compared cholesterol effluxes in 25RA and CT43 cells using a procedure that involves a short incubation with CD (28Yancey P.G. Rodrigueza W.V. Kilsdonk E.P. Stoudt G.W. Johnson W.J. Phillips M.C. Rothblat G.H. J. Biol. Chem. 1996; 271: 16026-16034Abstract Full Text Full Text PDF PubMed Scopus (387) Google Scholar). In a control experiment

Acyl-CoA:cholesterol acyltransferase (ACAT) is a membrane-bound enzyme that produces cholesteryl esters intracellularly. Two ACAT genes (ACAT1 and ACAT2) have been identified. The expression of ACAT1 is ubiquitous, whereas that of ACAT2 is tissue restricted. Previous research indicates that ACAT1 may contain seven transmembrane domains (TMDs). To study ACAT2 topology, we inserted two different antigenic tags (hemagglutinin, monoclonal antibody Mab1) at various hydrophilic regions flanking each of its predicted TMDs, and expressed the recombinant proteins in mutant Chinese hamster ovary cells lacking endogenous ACAT. Each tagged ACAT2 was expressed in the endoplasmic reticulum as a single undegraded protein band and was at least partially active enzymatically. We then used cytoimmunofluorescence and protease protection assays to monitor the sidedness of the hemagglutinin and Mab1 tags along the ER membranes. The results indicated that ACAT2 contains only two detectable TMDs, located near the N terminal region. We also show that a conserved serine (S245), a candidate active site residue, is not essential for ACAT catalysis. Instead, a conserved histidine (H434) present within a hydrophobic peptide segment, may be essential for ACAT catalysis. H434 may be located at the cytoplasmic side of the membrane.

Human acyl-coenzyme A:cholesterol acyltransferase 1 (hACAT1) esterifies cholesterol at the endoplasmic reticulum (ER). We had previously reported that hACAT1 contains seven transmembrane domains (TMD) (Lin, S., Cheng, D., Liu, M. S., Chen, J., and Chang, T. Y. (1999) <i>J. Biol. Chem.</i> 274, 23276-23285) and nine cysteines. The Cys near the N-terminal is located at the cytoplasm; the two cysteines near the C-terminal form a disulfide bond and are located in the ER lumen. The other six free cysteines are located in buried region(s) of the enzyme (Guo, Z.-Y., Chang, C. C. Y., Lu, X., Chen, J., Li, B.-L., and Chang, T.-Y. (2005) <i>Biochemistry</i> 44, 6537-6548). In the current study, we show that the conserved His-460 is a key active site residue for hACAT1. We next performed Cys-scanning mutagenesis within the region of amino acids 354-493, expressed these mutants in Chinese hamster ovary cells lacking ACAT1, and prepared microsomes from transfected cells. The microsomes are either left intact or permeabilized with detergent. The accessibility of the engineered cysteines of microsomal hACAT1 to various maleimide derivatives, including mPEG₅₀₀₀-maleimide (large, hydrophilic, and membrane-impermeant), <i>N</i>-ethylmaleimide, 4-acetamido-4′-maleimidylstilbene-2,2′-disulfonic acid (small, hydrophilic, and ER membrane-permeant), and <i>N</i>-phenylmaleimide (small, hydrophobic, and ER membrane-permeant), were monitored by Western blot analysis. The results led us to construct a revised, nine-TMD model, with the active site His-460 located within a hitherto undisclosed transmembrane domain, between Arg-443 and Tyr-462.

The half-life (t 1/2) of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase of Chinese hamster ovary cells grown in fetal calf serum medium is approximately 2 h. When cells are switched to grow in delipidated serum medium (DeL-M) for more than 24 h, the t 1/2 of the enzyme is found to be drastically altered to approximately 13 h. Exposure of low density lipoprotein (LDL) (100 micrograms of protein/ml) or 25-hydroxycholesterol (1 microgram/ml) to cells grown in DeL-M suppresses reductase activity more rapidly than would be expected solely if reductase synthesis were suppressed, showing that inactivation of reductase activity by sterols, previously demonstrated using only analogs of cholesterol, is a normal mechanism for regulation of HMG-CoA reductase activity by the physiologically important sterol source (LDL). This inactivation effect by LDL or by 25-hydroxycholesterol is shown to be at least in part due to acceleration of reductase degradation rate. Furthermore, the inactivation effect by sterols is shown to be largely abolished if cycloheximide (250 micrograms/ml) is added simultaneously to the growth medium, indicating that continuous synthesis of a class of mediator protein(s) is necessary in mediating the effect of LDL or 25-hydroxycholesterol. Two different protein synthesis inhibitors (emetine and puromycin) were used and gave essentially identical results. Preincubation of cell culture with cycloheximide for 2 h essentially completely abolishes the effect of 25-hydroxycholesterol, indicating that the mediator protein(s) turns over rapidly, with t 1/2 less than 3 or 4 h.

The liver plays a central role in cholesterol homeostasis. It exclusively receives and metabolizes oxysterols, which are important metabolites of cholesterol and are more cytotoxic than free cholesterol, from all extrahepatic tissues. Hepatocellular carcinomas (HCCs) impair certain liver functions and cause pathological alterations in many processes including cholesterol metabolism. However, the link between an altered cholesterol metabolism and HCC development is unclear. Human ACAT2 is abundantly expressed in intestine and fetal liver. Our previous studies have shown that ACAT2 is induced in certain HCC tissues. Here, by investigating tissue samples from HCC patients and HCC cell lines, we report that a specific cholesterol metabolic pathway, involving induction of ACAT2 and esterification of excess oxysterols for secretion to avoid cytotoxicity, is established in a subset of HCCs for tumor growth. Inhibiting ACAT2 leads to the intracellular accumulation of unesterified oxysterols and suppresses the growth of both HCC cell lines and their xenograft tumors. Further mechanistic studies reveal that HCC-linked promoter hypomethylation is essential for the induction of ACAT2 gene expression. We postulate that specifically blocking this HCC-established cholesterol metabolic pathway may have potential therapeutic applications for HCC patients.

Mammalian cells obtain cholesterol via two pathways: endogenous synthesis in the endoplasmic reticulum and exogenous sources mainly through the low density lipoprotein (LDL) receptor pathway. We performed pulse-chase experiments to monitor the fate of endogenously synthesized cholesterol and showed that, after reaching the plasma membrane from the endoplasmic reticulum, the newly synthesized cholesterol eventually accumulates in an internal compartment in Niemann-Pick type C1 (NPC1) cells. Thus, the ultimate fate of endogenously synthesized cholesterol in NPC1 cells is the same as LDL-derived cholesterol. However, the time required for endogenous cholesterol to accumulate internally is much slower than LDL-derived cholesterol. Different pathways thus govern the post-plasma membrane trafficking of endogenous cholesterol and LDL-derived cholesterol to the internal compartment. Results using the inhibitorN-butyldeoxynojirimycin, which depletes cellular complex glycosphingolipids, demonstrates that the cholesterol trafficking defect in NPC1 cells is not caused by ganglioside accumulation. The ultimate cause of death in NPC disease is progressive neurological deterioration in the central nervous system, where the major source of cholesterol is derived from endogenous synthesis. Our current study provides a plausible link between defects in intracellular trafficking of endogenous cholesterol and the etiology of Niemann-Pick type C disease. Mammalian cells obtain cholesterol via two pathways: endogenous synthesis in the endoplasmic reticulum and exogenous sources mainly through the low density lipoprotein (LDL) receptor pathway. We performed pulse-chase experiments to monitor the fate of endogenously synthesized cholesterol and showed that, after reaching the plasma membrane from the endoplasmic reticulum, the newly synthesized cholesterol eventually accumulates in an internal compartment in Niemann-Pick type C1 (NPC1) cells. Thus, the ultimate fate of endogenously synthesized cholesterol in NPC1 cells is the same as LDL-derived cholesterol. However, the time required for endogenous cholesterol to accumulate internally is much slower than LDL-derived cholesterol. Different pathways thus govern the post-plasma membrane trafficking of endogenous cholesterol and LDL-derived cholesterol to the internal compartment. Results using the inhibitorN-butyldeoxynojirimycin, which depletes cellular complex glycosphingolipids, demonstrates that the cholesterol trafficking defect in NPC1 cells is not caused by ganglioside accumulation. The ultimate cause of death in NPC disease is progressive neurological deterioration in the central nervous system, where the major source of cholesterol is derived from endogenous synthesis. Our current study provides a plausible link between defects in intracellular trafficking of endogenous cholesterol and the etiology of Niemann-Pick type C disease. low-density lipoprotein acyl-coenzyme A:cholesterol transferase cyclodextrin bovine serum albumin Chinese hamster ovary [3H]cholesteryl-linoleate-labeled LDL endoplasmic reticulum human fibroblast internal membrane N-butyldeoxynojirimycin Niemann-Pick type C disease Niemann-Pick type C1 plasma membrane phosphate-buffered saline sterol regulatory element binding protein (SREBP) cleavage-activating protein thin layer chromatography Genetic disorders have served as important model systems to identify the factors and mechanisms involved in intracellular lipid metabolism and trafficking. One example has been elegantly demonstrated by the elucidation of the low density lipoprotein (LDL)1 receptor pathway for regulation of intracellular cholesterol metabolism, using human fibroblast (Hf) cells from patients homozygous in familial hypercholesterolemia (1Brown M.S. Goldstein J.L. Science. 1986; 232: 34-47Crossref PubMed Scopus (4287) Google Scholar). Another disease that has provided important insights into cholesterol metabolism is the Niemann-Pick type C (NPC) disease (2Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill, NY1995Google Scholar). NPC disease is an autosomal recessive, neurovisceral disorder that presently has no therapeutic cure. It affects children who carry homozygous forms of the mutant NPC1 gene (3Carstea E.D. Morris J.A. Coleman K.G. Loftus S.K. Zhang D. Cummings C. Gu J. Rosenfeld M.A. Pavan W.J. Krizman D.B. Nagle J. Polymeropoulos M.H. Sturley S.L. Ioannou Y.A. Higgins M.E. Comly M. Cooney A. Brown A. Kaneski C.R. Blanchette-Mackie E.J. Dwyer N.K. Neufeld E.B. Chang T.Y. Liscum L. Strauss III, J.F. Ohno K. Zeigler M. Carmi R. Sokol J. Markie D. O'Neill R.R. van Diggelen O.P. Elleder M. Patterson M.C. Brady R.O. Vanier M.T. Pentchev P.G. Tagle D.A. Science. 1997; 277: 228-231Crossref PubMed Scopus (1188) Google Scholar) and causes death before adulthood. Hf cells from NPC patients have been found to accumulate LDL-derived cholesterol as unesterified cholesterol in an intracellular compartment (4Pentchev P.G. Comley M.E. Kruth H.S. Vanier M.T. Wenger D.A. Patel S. Brady R.O. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 8247-8251Crossref PubMed Scopus (319) Google Scholar, 5Pentchev P.G. Comly M.E. Kruth H.S. Tokoro J. Butler J. Sokol M. Filling-Katz M. Quirk J.M. Marshall D.C. Patel S. Vanier M.T. Brady R.O. FASEB J. 1987; 1: 40-45Crossref PubMed Scopus (149) Google Scholar, 6Liscum L. Ruggiero R.M. Faust J.R. J. Cell Biol. 1989; 108: 1625-1636Crossref PubMed Scopus (241) Google Scholar). Other lipids, particularly glycosphingolipids, have also been found to accumulate in NPC cells (7Yano T. Taniguchi M. Akaboshi S. Vanier M.T. Tai T. Sakuraba H. Ohno K. Proc. Jpn. Acad. 1996; 72B: 214-219Crossref Scopus (26) Google Scholar). We have previously isolated Chinese hamster ovary (CHO) cell mutants defective at the NPC1 locus (8Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar, 9Gu J.Z. Carstea E.D. Cummings C. Morris J.A. Loftus S.K. Zhang D. Coleman K.G. Cooney A.M. Comly M.E. Fandino L. Roff C. Tagle D.A. Pavan W.J. Pentchev P.G. Rosenfield M.A. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 7378-7383Crossref PubMed Scopus (24) Google Scholar). By performing pulse-chase experiments in these cells, we found that LDL-derived cholesterol initially moves from the hydrolytic compartment/lysosome to the plasma membrane (PM) independent of NPC1. After reaching the PM, cholesterol is internalized into an intracellular compartment. We propose that NPC1 is involved in sorting post-PM cholesterol from the intracellular compartment back to the PM or to the ER for re-esterification (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). In humans and mice, mutations in NPC1 cause neurodegeneration in the central nervous system. Cells in the brain acquire cholesterol mostly by endogenous synthesis (11Lutjohann H.C. Karthigasan J. Borenshteyn N.I. Flax J.D. Kirschner D.A. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 9799-9804Crossref PubMed Scopus (556) Google Scholar, 12Turley S.D. Burns D.K. Dietschy J.M. Am. J. Physiol. 1998; 274: E1099-E1105Crossref PubMed Google Scholar). Thus to fully understand the etiology of the NPC disease, it is important to elucidate the intracellular trafficking of endogenous cholesterol from its site of synthesis in the ER and its movement to the PM. The majority of the newly synthesized cholesterol is rapidly transported from the ER to cholesterol-rich microdomains of the PM, termed caveolae (or lipid rafts) by an energy-dependent process (13DeGrella R.F. Simoni R.D. J. Biol. Chem. 1982; 257: 14256-14262Abstract Full Text PDF PubMed Google Scholar, 14Urbani L. Simoni R.D. J. Biol. Chem. 1990; 265: 1919-1923Abstract Full Text PDF PubMed Google Scholar, 15Lange Y. J. Biol. Chem. 1994; 269: 3411-3414Abstract Full Text PDF PubMed Google Scholar, 16Smart E.J. Ying Y.S. Donzell W.C. Anderson R.G.W. J. Biol. Chem. 1996; 271: 29427-29435Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar, 17Uittengogaard A. Ying Y. Smart E.J. J. Biol. Chem. 1998; 273: 6525-6532Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar, 18Heino S. Lusa S. Somerharju P. Ehnholm C. Olkkonen V.M. Ikonen E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8375-8380Crossref PubMed Scopus (206) Google Scholar), and the Golgi may play a partial role in the overall trafficking process (18Heino S. Lusa S. Somerharju P. Ehnholm C. Olkkonen V.M. Ikonen E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8375-8380Crossref PubMed Scopus (206) Google Scholar). The initial movement of the newly synthesized cholesterol to the PM is independent of NPC1 (6Liscum L. Ruggiero R.M. Faust J.R. J. Cell Biol. 1989; 108: 1625-1636Crossref PubMed Scopus (241) Google Scholar, 19Neufeld E.B. Cooney A.M. Pitha J. Dawidowicz E.A. Dwyer N.K. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1996; 271: 21604-21613Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar). However, the post-PM trafficking of endogenously synthesized cholesterol remains to be investigated. In this report, we examine the role of NPC1 in the intracellular trafficking of endogenously synthesized cholesterol in both CHO and Hf cells defective in NPC1, testing the hypothesis that NPC1 is involved in the post-PM trafficking of both endogenously synthesized cholesterol and LDL-derived cholesterol. Our results reveal that the ultimate fate of both cholesterol sources with regards to NPC1 is similar: trafficking of both endogenously synthesized cholesterol and LDL-derived cholesterol between the PM and the ER involves NPC1. We also show that, after arriving at the PM, the initial fate of the two sources of cholesterol before entering the NPC1-associated compartment is different. Finally, we demonstrate that the trafficking defect of endogenously synthesized cholesterol in NPC1 cells is not caused by cellular ganglioside accumulation. [3H]Acetate (20 Ci/mmol), [1-14C]acetate (56.7 mCi/mmol), [4-14C]cholesterol (50–60 mCi/mmol) were purchased from American Radiolabeled Chemicals; [1,2,6,7-3H]cholesteryl linoleate (30–60 Ci/mmol) was from Amersham Pharmacia Biotech; 2-hydroxypropyl-β-cyclodextrin (CD),N-butyldeoxynojirimycin (NB-DNJ), and various glycosphingolipids as thin layer chromatography (TLC) standards were from Sigma; [3H]cholesteryl linoleate-labeled LDL ([3H]CL-LDL), specific radioactivity ranging between 5 and 15 μCi/mg of protein, was prepared as described previously (8Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). 25RA cells are a CHO cell line resistant to the cytotoxicity of 25-hydroxycholesterol (20Chang T.Y. Limanek J.S. J. Biol. Chem. 1980; 255: 7787-7795Abstract Full Text PDF PubMed Google Scholar) containing a gain of function mutation in the SREBP cleavage-activating protein (SCAP) (21Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Cell. 1996; 87: 415-426Abstract Full Text Full Text PDF PubMed Scopus (425) Google Scholar). CT43 cells are derived from 25RA cells and are defective in NPC1 (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). CT43NPC1-1 is a previously characterized cell line derived from CT43 cells that stably expresses hamster NPC1 (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). CT43NPC1-2 and CT43NPC1-3 are two additional independently isolated hamster NPC1 stable transfectants derived from CT43 cells. Estimation of the mRNA levels by semiquantitative reverse transcriptase-polymerase chain reaction in CT43NPC1-1 cells had been previously reported (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). The level of hamster NPC1 mRNA expressed in these transfectants is relatively low (approximately 5% of the level present in 25RA cells); similar experiments using the CT43NPC1-2and CT43NPC1-3 cells yielded the same result. It should be noted that it had been very difficult for our and other laboratories to obtain stable transfectants expressing normal levels of NPC1 using conventional transfection procedures. However, very recently, a study (22Millard E.E. Srivastava K. Traub L.M. Schaffer J.E. Ory D.S. J. Biol. Chem. 2000; 275: 38445-38451Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar) using a more efficient method for gene delivery (retroviral infection) reported the isolation of CHO cells expressing normal and very high levels of NPC1. Hf NPC cells (93.11 and 94.71) were a generous gift of Peter Pentchev (National Institute of Health). CHO cells were seeded in medium A (Ham's F-12, 10% fetal bovine serum, and 10 μg/ml gentamicin) as monolayers at 37 °C with 5% CO2 on day 1. On day 2, cells were incubated with medium D at 37 °C. When used at 37 °C, medium D refers to Ham's F-12 with 5% delipidated fetal bovine serum (23Chin J. Chang T.Y. J. Biol. Chem. 1981; 256: 6304-6310Abstract Full Text PDF PubMed Google Scholar), 35 μm oleic acid, 1.5 mm CaCl2, and 10 μg/ml gentamicin; when used at 14 °C, medium D refers to the same medium without sodium bicarbonate and supplemented with 20 mm HEPES, pH 7. All experiments were conducted on day 4, when the cells were 80–90% confluent. Similar culture conditions were performed with Hf cell lines, except that Dulbecco's modified Eagle's medium and Pen-Strep (100 units/ml) were used instead of Ham's F-12 and gentamicin, respectively. CHO and Hf cells were grown and cultured in six-well dishes as described under “Cell Culture.” On day 4, CHO cells were prechilled in medium D for 30 min at 4 °C and then pulse-labeled for 2–3 h at 14 °C with 10 μCi of [3H]acetate/well for single-labeling experiments or with 1 μCi of [3H]CL-LDL and 0.5 μCi of [14C]acetate/well for double-labeling experiments, unless otherwise indicated. On day 4, Hf cells were subjected to pulse-chase conditions as described in the figure legends, using 25 μCi of [3H]acetate or 0.5 μCi of [14C]cholesterol/well. After the pulses, the cells were washed once with phosphate buffered saline (PBS) plus 5 mg/ml bovine serum albumin (BSA) and twice with PBS without BSA. For cholesterol efflux experiments in CHO cells: to measure pre-PM cholesterol trafficking, cells were immediately incubated with 2% cyclodextrin in medium D at 37 °C for the indicated times; to measure post-PM cholesterol trafficking, cells were chased in medium D at 37 °C for the indicated times and then incubated with 2% cyclodextrin in medium D for 30 min at 37 °C (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). To measure cholesterol esterification, after the pulse-labeling, cells were chased in medium D without cyclodextrin at 37 °C for the indicated times. The radiolabeled lipids were extracted and separated via TLC; the respective14C or 3H label counts were measured in a liquid scintillation counter using a dual-labeling program. In [14C]- or [3H]acetate labeling experiments, both cholesterol and fatty acids were labeled. To analyze the label distribution of cholesteryl esters in cholesterol and fatty acids, the labeled cholesteryl esters scraped off the TLC underwent saponification and re-extraction; the separated cholesterol and fatty acid components were then quantified by TLC according to procedures previously employed (24Limanek J.S. Chin J. Chang T.Y. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 5452-5456Crossref PubMed Scopus (39) Google Scholar, 25Chang C.C.Y. Doolittle G.M. Chang T.Y. Biochemistry. 1986; 25: 1693-1699Crossref PubMed Scopus (55) Google Scholar). The result showed that over 95% of the recovered label was cholesterol. Other methods, including the percentage of cholesterol efflux, percentage of (re)esterification, and percentage of hydrolysis were determined as described previously (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). Cells were grown and cultured in 2 × 150-mm dishes as described under “Cell Culture,” except that cells were incubated with medium D on day 3. On day 4, cells were prechilled in medium D for 30 min at 4 °C and then pulse-labeled for 3 h at 14 °C with 10 μCi of [3H]CL-LDL and 5 μCi of [14C]acetate/dish. The cells were washed once with PBS plus 5 mg/ml BSA, washed twice with PBS without BSA, and chased in medium D for 2 or 24 h at 37 °C. The method to isolate the PM and internal membrane (IM) fractions, adapted from a previously described procedure (16Smart E.J. Ying Y.S. Donzell W.C. Anderson R.G.W. J. Biol. Chem. 1996; 271: 29427-29435Abstract Full Text Full Text PDF PubMed Scopus (455) Google Scholar), is described as follows. After the pulse-chase, all of the subsequent steps were conducted at 4 °C. Cells were washed two times with buffer A (0.25 m sucrose, 1 mm EDTA, 20 mm Tris, pH 7.8), scraped, and collected by centrifugation (1400 × g, 5 min). The cell pellet was homogenized in 1 ml of buffer A, using 10 strokes of a 2-ml “Dura-Grind” stainless steel homogenizer (Wheaton). The homogenate was centrifuged (1000 × g, 10 min), the post-nuclear supernatant was collected, and the pellet was homogenized and centrifuged again. The post-nuclear supernatants were combined and loaded onto a Percoll gradient (30% in buffer A, 23.5 ml) and centrifuged (84,000 × g, 30 min), and 25 fractions (1 ml) were collected from the top. The PM usually localized to fractions 9 and 10, as evidenced by a visible white membrane band and the enrichment of Na+/K+ ATPase enzyme activity (26Spillane D.M. Reagan Jr., J.W. Kennedy N.J. Schneider D.L. Chang T.Y. Biochim. Biophys. Acta. 1995; 1254: 283-294Crossref PubMed Scopus (20) Google Scholar) and anti-caveolin-1 expression as determined by immunoblot analysis with rabbit polyclonal caveolin-1 IgG (Santa Cruz Biotechnologies). Protein determinations were as described (27Peterson G.L. Anal. Biochem. 1977; 83: 346-356Crossref PubMed Scopus (7065) Google Scholar). On day 1, cells were cultured in medium A. On day 2, the medium was changed to medium D supplemented withNB-DNJ as described in the figure legend. On day 5, cells were harvested by cell scraping, pelleted by centrifugation, and washed three times with PBS. For glycolipid analysis, a method previously described was employed (28Platt F.M. Reinkensmeier G. Dwek R.A. Butters T.D. J. Biol. Chem. 1997; 272: 19365-19372Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). The lipids were extracted from the pellet three times by adding 1 ml of chloroform:methanol (2:1) with vortexing, first overnight at 4 °C and then for 3 h at room temperature, pooled, and dried under nitrogen. The lipid fraction was analyzed by TLC, using a solvent system of chloroform:methanol:water (65:25:4, v/v). The TLC plate was air-dried, and the glycolipids were identified by spraying with α-napthol (1% (w/v), in methanol) followed by 50% (v/v) sulfuric acid and heat-treated (80 °C for 10 min). We pulse-labeled mutant CT43 cells and their parental 25RA cells with [3H]acetate at 14 °C then chased the cells at 37 °C. Acetate is the principal metabolite from which cholesterol is biosynthesized. Early work has shown that, when cells are pulsed with radiolabeled acetate at 14 °C, most of the newly synthesized cholesterol remains in the ER as free, unesterified cholesterol; upon warming the cells at 37 °C, the labeled cholesterol moves to the PM within minutes (29Kaplan M.R. Simoni R.D. J. Cell Biol. 1985; 101: 446-453Crossref PubMed Scopus (168) Google Scholar). To monitor the arrival of cholesterol at the PM, we chased cells with cyclodextrin to measure cyclodextrin-mediated cholesterol efflux (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar, 18Heino S. Lusa S. Somerharju P. Ehnholm C. Olkkonen V.M. Ikonen E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8375-8380Crossref PubMed Scopus (206) Google Scholar, 19Neufeld E.B. Cooney A.M. Pitha J. Dawidowicz E.A. Dwyer N.K. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1996; 271: 21604-21613Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar, 30Kilsdonk E.P. Yancey P.G. Stoudt G.W. Bangerter F.W. Johnson W.J. Phillips M.C. Rothblat G.H. J. Biol. Chem. 1995; 270: 17250-17256Abstract Full Text Full Text PDF PubMed Scopus (694) Google Scholar). We found significant amounts of endogenous cholesterol rapidly appeared at the PM in both cell types within 10–20 min (Fig. 1 A). In agreement with earlier studies (6Liscum L. Ruggiero R.M. Faust J.R. J. Cell Biol. 1989; 108: 1625-1636Crossref PubMed Scopus (241) Google Scholar, 19Neufeld E.B. Cooney A.M. Pitha J. Dawidowicz E.A. Dwyer N.K. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1996; 271: 21604-21613Abstract Full Text Full Text PDF PubMed Scopus (319) Google Scholar), this result indicates that the movement of endogenous cholesterol from the ER to the PM does not involve NPC1. To monitor the post-PM fate of endogenous cholesterol, we used the same protocol for the pulse period, but chased the cells without cyclodextrin, then determined the amount of labeled cholesterol esterified by acyl-coenzyme A:cholesterol acyltransferase-1 (ACAT-1), a resident ER protein (31Chang T.Y. Chang C.C.Y. Cheng D. Ann. Rev. Biochem. 1997; 66: 613-638Crossref PubMed Scopus (435) Google Scholar). The results revealed that CT43 cells are severely defective in esterifying endogenous cholesterol throughout the chase period (up to 21 h) (Fig. 1 B). The inability of CT43 cells to esterify endogenous cholesterol was not due to defects in the ACAT-1 enzyme, for ACAT-1 activity was normal in CT43 cells. By using a reconstituted ACAT enzyme assay (32Chang C.C.Y. Lee C-Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar), we found that the ACAT specific activity in 25RA and CT43 cells was 119.4 ± 12.3 and 99.2 ± 14.1 pmol/min/mg, respectively. To ascertain that the observed defect in endogenous cholesterol esterification is due to mutation within the NPC1 gene in CT43 cells, we compared the percentage of endogenous cholesterol esterifications in 25RA, CT43, and three NPC1 stable transfectant cell lines independently isolated from CT43 cells. We found that the percentage of endogenous cholesterol esterification values in NPC1 stable transfectant cells were significantly higher (by up to 2.7-fold) than the value in CT43 cells, although not as high as the value in 25RA cells (Fig. 1 C). The partial restoration in ability to esterify endogenous cholesterol may be explained by the low expression level of the transfected hamster NPC1 seen in the stable transfectant clones (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). These cumulative findings imply that NPC1 is functionally involved in the post-PM trafficking of endogenous cholesterol from the PM to the ER. Both mutant CT43 cells and their parental 25RA cells contain a gain of function mutation in the protein SCAP (20Chang T.Y. Limanek J.S. J. Biol. Chem. 1980; 255: 7787-7795Abstract Full Text PDF PubMed Google Scholar, 21Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Cell. 1996; 87: 415-426Abstract Full Text Full Text PDF PubMed Scopus (425) Google Scholar), rendering these cells resistant to sterol-dependent transcriptional regulation. It may be argued that the phenotype demonstrated in CT43 cells may not be seen in NPC cells without the SCAP mutation. To address this concern, we examined two independent Hf NPC cells, NPC 93.22 and NPC 94.71. Both NPC 93.22 and NPC 94.71 cells stained positively with filipin, indicative of an accumulation of free intracellular cholesterol (Fig. 2 A). We then examined the ability of these cells to esterify cholesterol delivered via different routes and found that both NPC 93.22 and NPC 94.71 cells were defective in re-esterifying LDL-derived cholesterol (Fig. 2 B), with NPC 94.71 cells exhibiting a more serious defect. When esterification of endogenously synthesized cholesterol (Fig. 2 C) or cholesterol delivered from the growth medium (Fig. 2 D) was examined, we discovered that only NPC 94.71 cells but not NPC 93.22 cells exhibited a defect relative to control cells. These results indicate that the various cholesterol esterification defects observed in CT43 cells can be seen in some but not all of Hf NPC cells. Once arriving at the PM, endogenous cholesterol may be internalized and recycle between an internal compartment and the PM in a similar manner as demonstrated for LDL-derived cholesterol (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). To test this possibility, we used the same protocol for the pulse period as described earlier but chased the cells in medium without cyclodextrin for various periods of time at 37 °C, thus allowing cholesterol arriving at the PM to be internalized. Afterward, cells were incubated with cyclodextrin for 30 min to monitor the movement of internalized cholesterol back to the PM. We found that CT43 cells exhibited no defect after an 8-h chase but displayed a partial defect after a 24-h chase (Fig. 3 A). To directly compare the kinetics of this post-PM trafficking step between endogenous cholesterol and LDL-derived cholesterol, we simultaneously pulse-labeled 25RA and CT43 cells with [14C]acetate and [3H]CL-LDL at 14 °C, then subjected the cells to the same chase conditions described above. The result revealed that CT43 cells exhibited a defect in endogenous cholesterol efflux only after a 24-h chase but not after a 2-, 4-, or 8-h chase (Fig. 3 B). In contrast, a defect in LDL-derived cholesterol efflux in the same cells was found as early as after a 2-h chase 2As the chase period increased, the defect in LDL-derived cholesterol in these cells gradually decreased. This result may be due to the existence of a default pathway that occurs in NPC1 cells, when the cholesterol sorting compartment fuses with the lysosome, permitting cholesterol to be released from the lysosome to the PM (10Cruz J.C. Sugii S., Yu, C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (150) Google Scholar). (Fig. 3 B). These findings are consistent with the interpretation that both endogenous cholesterol and LDL-derived cholesterol enter an internal cholesterol pool that requires NPC1 for further cholesterol trafficking and sorting. However, the pathways by which each cholesterol source enters the internal cholesterol pool are different. To further compare the involvement of NPC1 in endogenous cholesterol and LDL-derived cholesterol trafficking pathways, we examined the initial arrival at the PM of both endogenous and LDL-derived cholesterol in 25RA and CT43 cells. We pulse-labeled cells with [14C]acetate and [3H]CL-LDL at 14 °C then chased the cells with cyclodextrin at 37 °C for the indicated times. We found that, in both cell types, the trafficking of endogenous cholesterol to the PM was much more rapid than that of LDL-derived cholesterol 3Additional experiments showed that, with longer incubation time (>90 min), the LDL-derived cholesterol eventually became readily accessible to cyclodextrin (data not shown). (Fig. 4 A). The slower appearance of LDL-derived cholesterol at the PM can only be partially accounted for by the limited cholesteryl ester hydrolysis of LDL at the earlier time points (before or at 30 min; Fig. 4 B). To compare the post-PM movements of endogenous cholesterol and LDL-derived cholesterol to the ER, we chased the cells without cyclodextrin for the various indicated times to monitor the esterification rates of the two cholesterol sources. In 25RA cells, we found that endogenous cholesterol was esterified at a slower rate than that of LDL-derived cholesterol (Fig. 4 C). As replotted in Fig. 4 D, after a 180-min chase, the relative increase in esterification of endogenous cholesterol was calculated to be approximately one-third that of LDL-derived cholesterol. The control experiment showed that each cholesterol source was esterified to a much less extent in CT43 cells than in 25RA cells. 4We noted that, at the zero time point, the percentage of esterification was higher for endogenous cholesterolversus LDL-derived cholesterol in both cell types (Fig. 4 C), suggesting that a small portion of newly synthesized cholesterol in the ER is available as a substrate for ACAT-1 without first traversing the PM. Thus, in 25RA cells, although endogenous cholesterol arrives at the PM faster than LDL-derived cholesterol (Fig. 4A), the subsequent post-PM movement of endogenous cholesterol to the ER for esterification is slower than that of LDL-derived cholesterol (Fig. 4 D). These findings provide further evidence to support the notion that both endogenous cholesterol and LDL-derived cholesterol enter an internal cholesterol pool for NPC1-dependent cholesterol trafficking and esterification, but the pathways by which each cholesterol source enters this pool are different. To biochemically compare the initial and ultimate fates of endogenous cholesterol and LDL-derived cholesterol, we used the double-labeling procedure described earlier to perform pulse-chase experiments in 25RA and CT43 cells then analyzed the cell homogenates using a 30% Percoll gradient (16Smart E.J. Ying Y.S. Donzell W.C. Anderson R.G.W. J. Biol. Ch

Acyl-CoA:cholesterol acyltransferase (ACAT) plays important roles in cellular cholesterol homeostasis and is involved in atherosclerosis. ACAT-1 protein is located mainly in the ER. The hydropathy plot suggests that ACAT-1 protein contains multiple transmembrane segments. We inserted either the hemagglutinin tag or the HisT7 tag at various hydrophilic regions within the human ACAT-1 protein and used immunofluorescence microscopy to determine the topography of the tagged proteins expressed in mutant Chinese hamster ovary cells lacking endogenous ACAT. All of the tagged proteins are located mainly in the ER and retain full or partial enzyme activities. None of the tagged proteins produces detectable intracellular degradation intermediates. Treating cells with digitonin at 5 μg/ml permeabilizes the plasma membranes while leaving the ER membranes sealed; in contrast, treating cells with 0.25% Triton X-100 or with cold methanol permeabilizes both the plasma membranes and the ER membranes. After appropriate permeabilization, double immunostaining using antibodies against the N-terminal region and against the inserted tag were used to visualize various regions of the tagged protein. The results show that human ACAT-1 in the ER contains seven transmembrane domains.

Niemann-Pick type C (NP-C) disease is a progressive and fatal neuropathological disorder previously characterized by abnormal cholesterol metabolism in peripheral tissues. Although a defective gene has been identified in both humans and thenpc nih mouse model of NP-C disease, how this leads to abnormal neuronal function is unclear. Here we show that whereas embryonic striatal neurons from npc nih mice can take up low density lipoprotein-derived cholesterol, its subsequent hydrolysis and esterification are significantly reduced. Given the importance of cholesterol to a variety of signal transduction mechanisms, we assessed the effect of this abnormality on the ability of these neurons to respond to brain-derived neurotrophic factor (BDNF). In contrast to its effects on wild type neurons, BDNF failed to induce autophosphorylation of the TrkB receptor and to increase neurite outgrowth in npc nih neurons, despite expression of TrkB on the cell surface. The results suggest that abnormal cholesterol metabolism occurs in neurons in the brain during NP-C disease, even at embryonic stages of development prior to the onset of phenotypic symptoms. Moreover, this defect is associated with a lack of TrkB function and BDNF responsiveness, which may contribute to the loss of neuronal function observed in NP-C disease. Niemann-Pick type C (NP-C) disease is a progressive and fatal neuropathological disorder previously characterized by abnormal cholesterol metabolism in peripheral tissues. Although a defective gene has been identified in both humans and thenpc nih mouse model of NP-C disease, how this leads to abnormal neuronal function is unclear. Here we show that whereas embryonic striatal neurons from npc nih mice can take up low density lipoprotein-derived cholesterol, its subsequent hydrolysis and esterification are significantly reduced. Given the importance of cholesterol to a variety of signal transduction mechanisms, we assessed the effect of this abnormality on the ability of these neurons to respond to brain-derived neurotrophic factor (BDNF). In contrast to its effects on wild type neurons, BDNF failed to induce autophosphorylation of the TrkB receptor and to increase neurite outgrowth in npc nih neurons, despite expression of TrkB on the cell surface. The results suggest that abnormal cholesterol metabolism occurs in neurons in the brain during NP-C disease, even at embryonic stages of development prior to the onset of phenotypic symptoms. Moreover, this defect is associated with a lack of TrkB function and BDNF responsiveness, which may contribute to the loss of neuronal function observed in NP-C disease. Niemann-Pick type C brain-derived neurotrophic factor low density lipoprotein polymerase chain reaction phosphate-buffered saline glutamic acid decarboxylase Niemann-Pick type C (NP-C)1 disease is a fatal, autosomal recessive disorder resulting in progressive central nervous system deterioration and premature death. Analysis of this disorder has benefited from feline and murine (npc nih mutant mice) models that recapitulate much of the human pathology (for review see Refs. 1.Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Scriver C.R. Stanbury J.B. Wyngaarden J.B. Frederickson D.S. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill Inc., New York1995: 2625-2639Google Scholar and 2.Liscum L. Klansek J.J. Curr. Opin. Lipidol. 1998; 9: 131-136Crossref PubMed Scopus (96) Google Scholar). For example, both NP-C patients andnpc nih mutant mice are characteristically asymptomatic at birth. Tremor and ataxia occur later, and innpc nih mutant mice these symptoms appear after approximately 1 month (3.Morris M.D. Bhuvaneswaran C. Shio H. Fowler S. Am. J. Pathol. 1982; 108: 140-149PubMed Google Scholar). Recently, a gene mutated in NP-C disease (NPC1) was cloned from humans (4.Carstea E.D. Morris J.A. Coleman K.G. Loftus S.K. Zhang D. Cummings C. Gu J. Rosenfeld M.A. Pavan W.J. Krizman D.B. Nagle J. Polymeropoulos M.H. Sturley S.L. Ioannou Y.A. Higgins M.E. Comly M. Cooney A. Brown A. Kaneski C.R. Blanchette-Mackie E.J. Dwyer N.K. Neufeld E.B. Chang T.-Y. Liscum L. Strauss III, J.F. Ohno K. Zeigler M. Carmi R. Sokol J. Markie D. O'Neill R.R. van Diggelen O.P. Elleder M. Patterson M.C. Brady R.O. Vanier M.T. Pentchev P.G. Tagle D.A. Science. 1997; 277: 228-231Crossref PubMed Scopus (1199) Google Scholar) and mice (5.Loftus S.K. Morris J.A. Carstea E.D. Gu J.Z. Cummings C. Brown A. Ellison J. Ohno K. Rosenfeld M.A. Tagle D.A. Pentchev P.G. Pavan W.J. Science. 1997; 277: 232-235Crossref PubMed Scopus (692) Google Scholar). The NPC1 protein is thought to be important for cholesterol trafficking and metabolism (2.Liscum L. Klansek J.J. Curr. Opin. Lipidol. 1998; 9: 131-136Crossref PubMed Scopus (96) Google Scholar, 6.Neufeld E.B. Wastney M. Patel S. Suresh S. Cooney A.M. Dwyer N.K. Roff C.F. Ohno K. Morris J.A. Carstea E.D. Incardona J.P. Strauss III, J.F. Vanier M.T. Patterson M.C. Brady R.O. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1999; 274: 9627-9635Abstract Full Text Full Text PDF PubMed Scopus (330) Google Scholar, 7.Cruz J.C. Sugii S., Yu, C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar), and a diagnostic hallmark of NP-C disease is lysosomal storage of lipids (primarily unesterified cholesterol) in peripheral tissues. Despite the fact that progressive neurological deterioration is ultimately the cause of premature death, neither the levels of cholesterol nor of phospholipids are grossly elevated innpc nih mutant mouse brain (1 and 2) leaving the basis for this deterioration unknown.Postmortem studies have characterized widespread anatomical abnormalities in brains of both humans and animals with NP-C disease (1.Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Scriver C.R. Stanbury J.B. Wyngaarden J.B. Frederickson D.S. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill Inc., New York1995: 2625-2639Google Scholar). The severest pathology is often in regions involved with extrapyramidal motor control, including cerebellum, basal ganglia, red nucleus, and spinal cord (3.Morris M.D. Bhuvaneswaran C. Shio H. Fowler S. Am. J. Pathol. 1982; 108: 140-149PubMed Google Scholar, 8.Shio H. Fowler S. Bhuvaneswaran C. Morris M.D. Am. J. Pathol. 1982; 108: 150-159PubMed Google Scholar, 9.Weintraub H. Abramovici A. Sandbank U. Pentchev P.G. Brady R.O. Sekine M. Suzuki A. Sela B. J. Neurochem. 1985; 45: 665-672Crossref PubMed Scopus (36) Google Scholar, 10.Fink J.K. Filling-Katz M.R. Sokol J. Cogan D.G. Pikus A. Sonies B. Soong B. Pentchev P.G. Comly M.E. Brady R.O. Barton N.W. Neurology. 1989; 39: 1040-1049Crossref PubMed Google Scholar, 11.March P.A. Thrall P.A. Brown D.E. Mitchell T.W. Lowenthal A.C. Walkley S.U. Acta Neuropathol. 1997; 94: 164-172Crossref PubMed Scopus (82) Google Scholar). For example, in the basal ganglia, distended neuronal cell somata with displaced nuclei, neurofibrillary tangles, and process degeneration are prevalent (12.Love S. Bridges L.R. Case P. Brain. 1995; 118: 119-129Crossref PubMed Scopus (182) Google Scholar, 13.Suzuki K. Parker C.C. Pentchev P.G. Katz D. Ghetti B. D'Agostino A.N. Carstea E.D. Acta Neuropathol. 1995; 89: 227-238Crossref PubMed Scopus (171) Google Scholar). Despite the relative plethora of data describing morphological abnormalities, little is known about how neuronal function is compromised, when the biochemical and physiological abnormalities arise during development, or whether the defects originate in glia and/or neurons in NP-C disease.Previous studies have demonstrated that cultures from embryonic striata are advantageous for assessing neuronal differentiation and the actions of neurotrophic factors. These cells can be maintained in vitro in a defined, serum-free medium (14.Ventimiglia R. Mather P. Jones B.E. Lindsay R.M. Eur. J. Neurosci. 1995; 7: 213-222Crossref PubMed Scopus (240) Google Scholar, 15.Ikeda Y. Nishiyama N. Saito H. Katsuki H. Dev. Brain Res. 1997; 98: 253-258Crossref PubMed Scopus (55) Google Scholar), and similar to intact striatum (for review see Refs. 16.Gerfen C.R. Annu. Rev. Neurosci. 1992; 15: 285-320Crossref PubMed Scopus (871) Google Scholar and 17.Kawaguchi Y. Wilson C.J. Augood S.J. Emson P.C. Trends Neurosci. 1995; 18: 527-535Abstract Full Text PDF PubMed Scopus (980) Google Scholar), more than 90% of the cultured cells are neurons that synthesize γ-aminobutyric acid (14.Ventimiglia R. Mather P. Jones B.E. Lindsay R.M. Eur. J. Neurosci. 1995; 7: 213-222Crossref PubMed Scopus (240) Google Scholar,18.Mizuno K. Carnahan J. Nawa H. Dev. Biol. 1994; 165: 243-256Crossref PubMed Scopus (225) Google Scholar). Brain-derived neurotrophic factor (BDNF) promotes the differentiation of striatal neurons in vitro as it doesin vivo (14.Ventimiglia R. Mather P. Jones B.E. Lindsay R.M. Eur. J. Neurosci. 1995; 7: 213-222Crossref PubMed Scopus (240) Google Scholar, 18.Mizuno K. Carnahan J. Nawa H. Dev. Biol. 1994; 165: 243-256Crossref PubMed Scopus (225) Google Scholar), consistent with expression of TrkB receptors in these neurons (19.Merlio J.P. Ernfors P. Jaber M. Persson H. Neuroscience. 1992; 51: 513-532Crossref PubMed Scopus (537) Google Scholar). These neurons also respond to neurotrophin-3, but not to nerve growth factor (14.Ventimiglia R. Mather P. Jones B.E. Lindsay R.M. Eur. J. Neurosci. 1995; 7: 213-222Crossref PubMed Scopus (240) Google Scholar, 18.Mizuno K. Carnahan J. Nawa H. Dev. Biol. 1994; 165: 243-256Crossref PubMed Scopus (225) Google Scholar), consistent with the expression of TrkC, but not TrkA, in embryonic rat brain (20.Ernfors P. Merlio J.-P. Persson H. Eur. J. Neurosci. 1992; 4: 1140-1158Crossref PubMed Scopus (449) Google Scholar,21.Ernfors P. Rosario C.M. Merlio J.P. Grant G. Aldskogius H. Persson H. Mol. Brain Res. 1993; 17: 217-226Crossref PubMed Scopus (143) Google Scholar).Recent evidence indicates that localization of sphingolipids and cholesterol in membrane domains, or “lipid rafts,” is essential for assembly and activity of specific transmembrane signaling complexes (for review see Refs. 22.Simons K. Ikonen E. Nature. 1997; 397: 569-572Crossref Scopus (8019) Google Scholar and 23.Hooper N.M. Mol. Membr. Biol. 1999; 16: 145-156Crossref PubMed Scopus (357) Google Scholar) and implies that defects in cholesterol metabolism could interfere with neurotrophin signaling and neuronal differentiation. Here, we demonstrate that abnormalities in the metabolism of exogenously supplied LDL-derived cholesterol are evident in embryonic striatal neurons from npc nih mutant mice and that these deficits are accompanied by loss of BDNF-mediated neurite outgrowth and TrkB receptor activation. Consistent with this, TrkB activation also fails to occur in wild type striatal neurons depleted of cholesterol. The results are important for understanding neurotrophin-mediated signal transduction as well as the mechanisms underlying NP-C disease.DISCUSSIONNiemann-Pick type C disease is a progressive and fatal neuropathological disorder. Although this disease is associated with abnormal cholesterol metabolism in peripheral tissues, the basis for the progressive neurodegeneration and abnormal brain function is unclear. Here we show that although embryonic neurons from the brain of −/− npc nih mice can survive in vitroand are not grossly abnormal in appearance, they exhibit significant deficits in cholesterol metabolism, neurite outgrowth, and neurotrophin responsiveness, all of which may contribute to the progression of NP-C disease.Accumulation of unesterified cholesterol in peripheral fibroblasts is the diagnostic hallmark of NP-C disease, yet elevated cholesterol has not been reported in previous analyses of the brains of NP-C patients or npc nih mutant mice (1.Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Scriver C.R. Stanbury J.B. Wyngaarden J.B. Frederickson D.S. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill Inc., New York1995: 2625-2639Google Scholar, 2.Liscum L. Klansek J.J. Curr. Opin. Lipidol. 1998; 9: 131-136Crossref PubMed Scopus (96) Google Scholar). Similarly, we did not detect an abnormal accumulation of cholesterol in striatal neurons isolated from −/− npc nih mice at an embryonic stage of development. Studies in vivo suggest that minimal amounts of LDL-derived cholesterol are taken up by the brain, especially during embryonic and early postnatal development (39.Xie C. Turley S.D. Dietschy J.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11992-11997Crossref PubMed Scopus (85) Google Scholar, 52.Turley S.D. Dietschy J.M. Nutr. Metab. Cardiovasc. Dis. 1997; 7: 195-201Google Scholar). However, although it appears that neurons rely heavily on de novo synthesis of cholesterol during initial development (52.Turley S.D. Dietschy J.M. Nutr. Metab. Cardiovasc. Dis. 1997; 7: 195-201Google Scholar, 53.Turley S.D. Burns D.K. Rosenfeld C.R. Dietschy J.M. J. Lipid Res. 1996; 37: 1953-1961Abstract Full Text PDF PubMed Google Scholar, 54.Jurevics H.A. Kidwai F.Z. Morell P. J. Lipid Res. 1997; 38: 723-733Abstract Full Text PDF PubMed Google Scholar), it has been suggested that exogenous uptake, as part of cholesterol recycling in the brain, may be important for subsequent neuronal remodeling (Refs. 55.Pitas R.E. Boyles J.K. Lee S.H. Foss D. Mahley R.W. Biochim. Biophys. Acta. 1987; 917: 148-161Crossref PubMed Scopus (567) Google Scholar and 56.Weisgraber K.H. Roses A.D. Strittmatter W.J. Curr. Opin. Lipidol. 1994; 5: 110-116Crossref PubMed Scopus (134) Google Scholar and for discussion see Ref. 39.Xie C. Turley S.D. Dietschy J.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11992-11997Crossref PubMed Scopus (85) Google Scholar). Consistent with this idea, we show that embryonic striatal neurons take up exogenously supplied cholesterol linoleate. More important, we find that subsequent to its uptake, the neurons from −/−npc nih mice exhibit significant deficits in their ability to hydrolyze and esterify this cholesterol. These results extend the findings of a previous study showing an impaired cholesterol metabolism in mixed cultures of glia and neurons from newborn −/−npc nih mice (36.Patel S.C. Suresh S. Weintraub H. Brady R.O. Pentchev P.G. Biophys. Res. Commun. 1987; 143: 233-240Crossref PubMed Scopus (9) Google Scholar) by providing direct evidence this abnormality occurs in neurons. Taken together, the findings suggest that in NP-C disease errors in neuronal cholesterol metabolism occur early in brain development and may have an accumulating influence as the remodeling of neuronal connections continues in the brain.Previous studies suggest that cholesterol is important for neurite outgrowth. In particular, inhibition of cholesterol synthesis impairs the neurite outgrowth from sympathetic neurons (41.de Chaves E.I. Rusinol A.E. Vance D.E. Campenot R.B. Vance J.E. J. Biol. Chem. 1997; 272: 30766-30773Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar), whereas exogenous cholesterol enhances neurite outgrowth from dorsal root ganglion neurons (40.Handelmann G.E. Boyles J.K. Weisgraber K.H. Mahley R.W. Pitas R.E. J. Lipid Res. 1992; 33: 1677-1688Abstract Full Text PDF PubMed Google Scholar). Furthermore, interfering with LDL receptor-independent means by which cholesterol uptake may occur results in simplified dendritic arborizations from neurons of the central nervous system, including decreases in the number and average length of neurites (57.Narita M. Bu G. Holtzman D.M. Schwartz A.L. J. Neurochem. 1997; 68: 587-595Crossref PubMed Scopus (94) Google Scholar,58.Trommsdorff M. Gotthardt M. Hiesberger T. Shelton J. Stockinger W. Nimpf J. Hammer R.E. Richardson J.A. Herz J. Cell. 1999; 97: 689-701Abstract Full Text Full Text PDF PubMed Scopus (1077) Google Scholar). Here we show that abnormal metabolism of cholesterol in neurons from −/− mice is accompanied by deficits in neurite outgrowth that mirror those reported in these previous studies, including a reduced number of primary neurites, fewer branch points, and diminished neurite length. Thus, the abnormal cholesterol metabolism associated with mutation of the NPC1 gene may ultimately compromise both the complexity and the maintenance of neuronal arbors and lead to eventual loss of neuronal function in NP-C disease.In addition to the observed deficiencies in cholesterol metabolism and neurite outgrowth, we show for the first time that striatal neurons from −/− npc nih mice do not respond to BDNF with an increase in neurite outgrowth. Errors in cholesterol metabolism in NP-C disease could potentially interfere with BDNF signaling in a variety of ways, as cholesterol and other lipid metabolites have important roles in multiple aspects of neuronal signal transduction. For example, sphingomyelin plays an important role in the signaling from the p75 neurotrophin receptor (59.Chao M.V. Mol. Cell. Neurosci. 1995; 6: 91-96Crossref PubMed Scopus (48) Google Scholar). In addition, cholesterol is necessary for the covalent modification and function of molecules such as ras that are involved in neurotrophin signaling pathways (60.Hancock J.F. Magee A.I. Childs J.E. Marshall C.J. Cell. 1989; 57: 1167-1177Abstract Full Text PDF PubMed Scopus (1448) Google Scholar, 61.Roy S. Luetterforst R. Harding A. Apolloni A. Etheridge M. Stang E. Rolls B. Hancock J.F. Parton R.G. Nat. Cell Biol. 1999; 1: 98-105Crossref PubMed Scopus (124) Google Scholar). Finally, gangliosides, which are elevated in NP-C disease (1.Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Scriver C.R. Stanbury J.B. Wyngaarden J.B. Frederickson D.S. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill Inc., New York1995: 2625-2639Google Scholar,2.Liscum L. Klansek J.J. Curr. Opin. Lipidol. 1998; 9: 131-136Crossref PubMed Scopus (96) Google Scholar), have been shown to alter receptor tyrosine kinase signaling (62.Weis F.M.B. Davis R.J. J. Biol. Chem. 1990; 265: 12059-12066Abstract Full Text PDF PubMed Google Scholar, 63.Mutoh T. Tkuda A. Miyadai T. Hamaguchi M. Fujiki N. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 5087-5091Crossref PubMed Scopus (393) Google Scholar, 64.Rabin S.J. Mocchetti I. J. Neurochem. 1995; 65: 347-354Crossref PubMed Scopus (118) Google Scholar, 65.Yates A.J. Saqr H.E. Van Brocklyn J. J. Neuro-oncol. 1995; 24: 65-73Crossref PubMed Scopus (54) Google Scholar). However, because these aspects of signaling may be affected in NP-C disease, perhaps most consistent with our data from both wild type and mutant mice is the idea that the errors in cholesterol homeostasis that arise as a result of the NPC1 mutation interfere with TrkB signaling by altering lipid rafts. Specifically, recent studies have demonstrated that localization of sphingolipids and cholesterol in lipid rafts is essential for the assembly and activity of transmembrane signaling complexes in these specialized membrane domains (22.Simons K. Ikonen E. Nature. 1997; 397: 569-572Crossref Scopus (8019) Google Scholar, 23.Hooper N.M. Mol. Membr. Biol. 1999; 16: 145-156Crossref PubMed Scopus (357) Google Scholar, 42.Masserini M. Palestrini P. Pitto M. J. Neurochem. 1999; 73: 1-11Crossref PubMed Scopus (102) Google Scholar). Relevant to these studies, a previous report suggests that mutation of the NPC1 gene is associated with alterations in the cholesterol composition of the rafts isolated from peripheral tissues (66.Garver W.S. Erickson R.P. Wilson J.M. Colton T.L. Hossain G.S. Kozloski M.A. Heidenreich R.A. Biochim. Biophys. Acta. 1997; 1361: 272-280Crossref PubMed Scopus (51) Google Scholar). Chemical depletion of cholesterol from the cell surface disassembles raft-enriched membrane invaginations referred to as caveolae and interferes with the function of receptor tyrosine kinases (67.Liu P. Oh P. Horner T. Rogers R.A. Schnitzer J.E. J. Biol. Chem. 1997; 272: 7211-7222Abstract Full Text Full Text PDF PubMed Scopus (244) Google Scholar, 68.Furuchi T. Anderson R.G.W. J. Biol. Chem. 1998; 273: 21099-21104Abstract Full Text Full Text PDF PubMed Scopus (331) Google Scholar). TrkA activation is also disrupted upon altered expression of caveolin-1 (46.Bilderback T.R. Valeswara-Rao G. Lisanti M.P. Dobrowsky R.T. J. Biol. Chem. 1999; 274: 257-263Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar), a cholesterol-binding protein that plays a key role in controlling the level of cholesterol in the plasma membrane (69.Murata M. Peranen J. Schreiner R. Wieland F. Kurzchalia T.V. Simons K. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 10339-10343Crossref PubMed Scopus (761) Google Scholar, 70.Fielding C.J. Fielding P.E. J. Lipid Res. 1997; 38: 1503-1521Abstract Full Text PDF PubMed Google Scholar). We find that although the levels of TrkB protein are comparable in striatal neurons from wild type and mutant mice, the BDNF-induced autophosphorylation of TrkB was essentially eliminated in neurons from the −/− npc nih mice. Furthermore, TrkB activation was also abolished in wild type striatal neurons acutely depleted of cholesterol, consistent with the fact that the TrkB receptor tyrosine kinase is found in lipid rafts (43.Wu C. Butz S. Ying Y. Anderson R.G.W. J. Biol. Chem. 1997; 272: 3554-3559Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar). When taken together, the results support the assertion that the abnormal cholesterol metabolism associated with the NPC1 mutation interferes with BDNF responsiveness by altering lipid rafts and interfering with TrkB activation.Evidence suggests that BDNF and the activation of TrkB play prominent roles in the maintenance and modulation of neuronal function. For example, BDNF modulates axonal and dendritic arborization, the expression of peptides and calcium-binding proteins, and synaptic transmission (71.Gao W.-Q. Zheng J.L. Karihaloo M. J. Neurosci. 1995; 15: 2656-2667Crossref PubMed Google Scholar, 72.Patterson S.L. Abel T. Deuel T.A. Martin K.C. Rose J.C. Kandel E.R. Neuron. 1996; 16: 1137-1145Abstract Full Text Full Text PDF PubMed Scopus (1024) Google Scholar, 73.Snider W.D. Cell. 1994; 77: 627-638Abstract Full Text PDF PubMed Scopus (1302) Google Scholar, 74.McAllister K.A. Katz L.C. Lo D.C. Annu. Rev. Neurosci. 1999; 22: 295-318Crossref PubMed Scopus (1147) Google Scholar). TrkB signaling has also been shown to be important in the mature nervous system, as indicated by recent experiments in which expression of this receptor was conditionally knocked out in forebrain neurons of postnatal mice. Although the knockout did not result in gross abnormalities in brain structure, these animals exhibited selective deficits in both synaptic and cognitive functions (75.Minichiello L. Korte M. Wolfer D. Kühn R. Unsicker K. Cestari V. Rossi-Arnaud C. Lipp H.-P. Bonhoeffer T. Klein R. Neuron. 1999; 24: 401-414Abstract Full Text Full Text PDF PubMed Scopus (648) Google Scholar). Thus, our finding that neurons from −/−npc nih mice exhibit deficits in BDNF-mediated TrkB signaling may not only provide a basis for understanding the aberrant neuronal morphology described in these animals but may also provide insight into the cognitive deficits that characterize the postnatal progression of NP-C disease. Finally, by identifying specific cellular and molecular deficits in neuronal function in NP-C disease, our results provide insight not only into the neuropathology of this disorder but also into neurotrophin signaling and the functional significance of cholesterol in the brain. Niemann-Pick type C (NP-C)1 disease is a fatal, autosomal recessive disorder resulting in progressive central nervous system deterioration and premature death. Analysis of this disorder has benefited from feline and murine (npc nih mutant mice) models that recapitulate much of the human pathology (for review see Refs. 1.Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Scriver C.R. Stanbury J.B. Wyngaarden J.B. Frederickson D.S. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill Inc., New York1995: 2625-2639Google Scholar and 2.Liscum L. Klansek J.J. Curr. Opin. Lipidol. 1998; 9: 131-136Crossref PubMed Scopus (96) Google Scholar). For example, both NP-C patients andnpc nih mutant mice are characteristically asymptomatic at birth. Tremor and ataxia occur later, and innpc nih mutant mice these symptoms appear after approximately 1 month (3.Morris M.D. Bhuvaneswaran C. Shio H. Fowler S. Am. J. Pathol. 1982; 108: 140-149PubMed Google Scholar). Recently, a gene mutated in NP-C disease (NPC1) was cloned from humans (4.Carstea E.D. Morris J.A. Coleman K.G. Loftus S.K. Zhang D. Cummings C. Gu J. Rosenfeld M.A. Pavan W.J. Krizman D.B. Nagle J. Polymeropoulos M.H. Sturley S.L. Ioannou Y.A. Higgins M.E. Comly M. Cooney A. Brown A. Kaneski C.R. Blanchette-Mackie E.J. Dwyer N.K. Neufeld E.B. Chang T.-Y. Liscum L. Strauss III, J.F. Ohno K. Zeigler M. Carmi R. Sokol J. Markie D. O'Neill R.R. van Diggelen O.P. Elleder M. Patterson M.C. Brady R.O. Vanier M.T. Pentchev P.G. Tagle D.A. Science. 1997; 277: 228-231Crossref PubMed Scopus (1199) Google Scholar) and mice (5.Loftus S.K. Morris J.A. Carstea E.D. Gu J.Z. Cummings C. Brown A. Ellison J. Ohno K. Rosenfeld M.A. Tagle D.A. Pentchev P.G. Pavan W.J. Science. 1997; 277: 232-235Crossref PubMed Scopus (692) Google Scholar). The NPC1 protein is thought to be important for cholesterol trafficking and metabolism (2.Liscum L. Klansek J.J. Curr. Opin. Lipidol. 1998; 9: 131-136Crossref PubMed Scopus (96) Google Scholar, 6.Neufeld E.B. Wastney M. Patel S. Suresh S. Cooney A.M. Dwyer N.K. Roff C.F. Ohno K. Morris J.A. Carstea E.D. Incardona J.P. Strauss III, J.F. Vanier M.T. Patterson M.C. Brady R.O. Pentchev P.G. Blanchette-Mackie E.J. J. Biol. Chem. 1999; 274: 9627-9635Abstract Full Text Full Text PDF PubMed Scopus (330) Google Scholar, 7.Cruz J.C. Sugii S., Yu, C. Chang T.-Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar), and a diagnostic hallmark of NP-C disease is lysosomal storage of lipids (primarily unesterified cholesterol) in peripheral tissues. Despite the fact that progressive neurological deterioration is ultimately the cause of premature death, neither the levels of cholesterol nor of phospholipids are grossly elevated innpc nih mutant mouse brain (1 and 2) leaving the basis for this deterioration unknown. Postmortem studies have characterized widespread anatomical abnormalities in brains of both humans and animals with NP-C disease (1.Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Scriver C.R. Stanbury J.B. Wyngaarden J.B. Frederickson D.S. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill Inc., New York1995: 2625-2639Google Scholar). The severest pathology is often in regions involved with extrapyramidal motor control, including cerebellum, basal ganglia, red nucleus, and spinal cord (3.Morris M.D. Bhuvaneswaran C. Shio H. Fowler S. Am. J. Pathol. 1982; 108: 140-149PubMed Google Scholar, 8.Shio H. Fowler S. Bhuvaneswaran C. Morris M.D. Am. J. Pathol. 1982; 108: 150-159PubMed Google Scholar, 9.Weintraub H. Abramovici A. Sandbank U. Pentchev P.G. Brady R.O. Sekine M. Suzuki A. Sela B. J. Neurochem. 1985; 45: 665-672Crossref PubMed Scopus (36) Google Scholar, 10.Fink J.K. Filling-Katz M.R. Sokol J. Cogan D.G. Pikus A. Sonies B. Soong B. Pentchev P.G. Comly M.E. Brady R.O. Barton N.W. Neurology. 1989; 39: 1040-1049Crossref PubMed Google Scholar, 11.March P.A. Thrall P.A. Brown D.E. Mitchell T.W. Lowenthal A.C. Walkley S.U. Acta Neuropathol. 1997; 94: 164-172Crossref PubMed Scopus (82) Google Scholar). For example, in the basal ganglia, distended neuronal cell somata with displaced nuclei, neurofibrillary tangles, and process degeneration are prevalent (12.Love S. Bridges L.R. Case P. Brain. 1995; 118: 119-129Crossref PubMed Scopus (182) Google Scholar, 13.Suzuki K. Parker C.C. Pentchev P.G. Katz D. Ghetti B. D'Agostino A.N. Carstea E.D. Acta Neuropathol. 1995; 89: 227-238Crossref PubMed Scopus (171) Google Scholar). Despite the relative plethora of data describing morphological abnormalities, little is known about how neuronal function is compromised, when the biochemical and physiological abnormalities arise during development, or whether the defects originate in glia and/or neurons in NP-C disease. Previous studies have demonstrated that cultures from embryonic striata are advantageous for assessing neuronal differentiation and the actions of neurotrophic factors. These cells can be maintained in vitro in a defined, serum-free medium (14.Ventimiglia R. Mather P. Jones B.E. Lindsay R.M. Eur. J. Neurosci. 1995; 7: 213-222Crossref PubMed Scopus (240) Google Scholar, 15.Ikeda Y. Nishiyama N. Saito H. Katsuki H. Dev. Brain Res. 1997; 98: 253-258Crossref PubMed Scopus (55) Google Scholar), and similar to intact striatum (for review see Refs. 16.Gerfen C.R. Annu. Rev. Neurosci. 1992; 15: 285-320Crossref PubMed Scopus (871) Google Scholar and 17.Kawaguchi Y. Wilson C.J. Augood S.J. Emson P.C. Trends Neurosci. 1995; 18: 527-535Abstract Full Text PDF PubMed Scopus (980) Google Scholar), more than 90% of the cultured cells are neurons that synthesize γ-aminobutyric acid (14.Ventimiglia R. Mather P. Jones B.E. Lindsay R.M. Eur. J. Neurosci. 1995; 7: 213-222Crossref PubMed Scopus (240) Google Scholar,18.Mizuno K. Carnahan J. Nawa H. Dev. Biol. 1994; 165: 243-256Crossref PubMed Scopus (225) Google Scholar). Brain-derived neurotrophic factor (BDNF) promotes the differentiation of striatal neurons in vitro as it doesin vivo (14.Ventimiglia R. Mather P. Jones B.E. Lindsay R.M. Eur. J. Neurosci. 1995; 7: 213-222Crossref PubMed Scopus (240) Google Scholar, 18.Mizuno K. Carnahan J. Nawa H. Dev. Biol. 1994; 165: 243-256Crossref PubMed Scopus (225) Google Scholar), consistent with expression of TrkB receptors in these neurons (19.Merlio J.P. Ernfors

Acyl-CoA:cholesterol acyltransferase (ACAT) is a key enzyme in cellular cholesterol homeostasis and in atherosclerosis. ACAT-1 may function as an allosteric enzyme. We took a multifaceted approach to investigate the subunit composition of ACAT-1. When ACAT-1 with two different tags were co-expressed in the same Chinese hamster ovary cells, antibody specific to one tag caused co-immunoprecipitation of both types of ACAT-1 proteins. Radioimmunoprecipitations of cells expressing the untagged ACAT-1 or the 6-histidine-tagged ACAT-1 yielded a single radiolabeled band of predicted size on SDS-polyacrylamide gel electrophoresis. These results show that ACAT-1 exists as homo-oligomers in intact Chinese hamster ovary cells. We solubilized HisACAT-1 with the detergent deoxycholate or CHAPS (3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonic acid), performed gel filtration chromatography and sucrose density gradient centrifugations in H₂O and D₂O, and determined the Stokes radii and sedimentation coefficients of the HisACAT1-detergent complexes. The estimated molecular mass of HisACAT-1 is 263 kDa, which is 4 times that of the HisACAT-1 monomer (69 kDa). Finally, cross-linking experiments in intact cells and <i>in vitro</i> show that the increase in cross-linker concentrations causes an increase in size of the HisACAT-1-positive signals, forming material(s) 4 times the size of the monomer, supporting the conclusion that ACAT-1 is a homotetrameric enzyme.

Differential regulation has been suggested for cellular cholesterol and phospholipid release mediated by apolipoprotein A-I (apoA-I)/ABCA1. We investigated various factors involved in cholesterol mobilization related to this pathway. ApoA-I induced a rapid decrease of the cellular cholesterol compartment that is in equilibrium with the ACAT-accessible pool in cells that generate cholesterol-rich HDL. Pharmacological and genetic inactivation of ACAT enhanced the apoA-I-mediated cholesterol release through upregulation of ABCA1 and through cholesterol enrichment in the HDL generated. Pharmacological activation of protein kinase C (PKC) also decreased the ACAT-accessible cholesterol pool, not only in the cells that produce cholesterol-rich HDL by apoA-I (i.e., human fibroblast WI-38 cells) but also in the cells that generate cholesterol-poor HDL (mouse fibroblast L929 cells). In L929 cells, the PKC activation caused an increase in apoA-I-mediated cholesterol release without detectable change in phospholipid release and in ABCA1 expression. These results indicate that apoA-I mobilizes intracellular cholesterol for the ABCA1-mediated release from the compartment that is under the control of ACAT. The cholesterol mobilization process is presumably related to PKC activation by apoA-I.

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTCycloheximide sensitivity in regulation of acyl coenzyme A:cholesterol acyltransferase activity in Chinese hamster ovary cells. 1. Effect of exogenous sterolsCatherine C. Y. Chang, Gary M. Doolittle, and T. Y. ChangCite this: Biochemistry 1986, 25, 7, 1693–1699Publication Date (Print):April 8, 1986Publication History Published online1 May 2002Published inissue 8 April 1986https://doi.org/10.1021/bi00355a038RIGHTS & PERMISSIONSArticle Views124Altmetric-Citations59LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (839 KB) Get e-Alerts Get e-Alerts

We compared the abilities of cholesterolversus various oxysterols as substrate and/or as activator for the enzyme acyl-coenzyme A:cholesterol acyltransferase (ACAT), by monitoring the activity of purified human ACAT1 in response to sterols solubilized in mixed micelles or in reconstituted vesicles. The results showed that 5α,6α-epoxycholesterol and 7α-hydroxycholesterol are comparable with cholesterol as the favored substrates, whereas 7-ketocholesterol, 7β-hydroxycholesterol, 5β,6β-epoxycholesterol, and 24(S),25-epoxycholesterol are very poor substrates for the enzyme. We then tested the ability of 7-ketocholesterol as an activator when cholesterol was measured as the substrate, andvice versa. When cholesterol was measured as the substrate, the addition of 7-ketocholesterol could not activate the enzyme. In contrast, when 7-ketocholesterol was measured as the substrate, the addition of cholesterol significantly activated the enzyme and changed the shape of the substrate saturation curve from sigmoidal to essentially hyperbolic. Additional results show that, as an activator, cholesterol is much better than all the oxysterols tested. These results suggest that ACAT1 contains two types of sterol binding sites; the structural requirement for the ACAT activator site is more stringent than it is for the ACAT substrate site. Upon activation by cholesterol, ACAT1 becomes promiscuous toward various sterols as its substrate. We compared the abilities of cholesterolversus various oxysterols as substrate and/or as activator for the enzyme acyl-coenzyme A:cholesterol acyltransferase (ACAT), by monitoring the activity of purified human ACAT1 in response to sterols solubilized in mixed micelles or in reconstituted vesicles. The results showed that 5α,6α-epoxycholesterol and 7α-hydroxycholesterol are comparable with cholesterol as the favored substrates, whereas 7-ketocholesterol, 7β-hydroxycholesterol, 5β,6β-epoxycholesterol, and 24(S),25-epoxycholesterol are very poor substrates for the enzyme. We then tested the ability of 7-ketocholesterol as an activator when cholesterol was measured as the substrate, andvice versa. When cholesterol was measured as the substrate, the addition of 7-ketocholesterol could not activate the enzyme. In contrast, when 7-ketocholesterol was measured as the substrate, the addition of cholesterol significantly activated the enzyme and changed the shape of the substrate saturation curve from sigmoidal to essentially hyperbolic. Additional results show that, as an activator, cholesterol is much better than all the oxysterols tested. These results suggest that ACAT1 contains two types of sterol binding sites; the structural requirement for the ACAT activator site is more stringent than it is for the ACAT substrate site. Upon activation by cholesterol, ACAT1 becomes promiscuous toward various sterols as its substrate. acyl-coenzyme A:cholesterol acyltransferase 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonic acid endoplasmic reticulum phosphatidylcholine Acyl-coenzyme A:cholesterol acyltransferase (ACAT)1 is a membrane-bound enzyme located in the endoplasmic reticulum (ER). It is present in a variety of cell types and tissues and utilizes two lipophilic substrates, cholesterol and long-chain fatty acyl-coenzyme A, to catalyze the formation of neutral lipid cholesteryl esters. In mammals, two ACAT isoforms exist (ACAT1 and ACAT2) (reviewed in Ref. 1Chang T.Y. Chang C.C.Y. Lin S. Yu C. Li B.L. Miyazaki A. Curr. Opin. Lipidol. 2001; 12: 289-296Google Scholar). The tissue distribution of ACAT1 is essentially ubiquitous, whereas that of ACAT2 is more restricted. The physiological roles of these isoforms in various tissues are under active investigation. At the single cell level, ACAT participates in controlling the cellular membrane cholesterol level. Unlike many other enzymes involved in cholesterol metabolism, regulation of ACAT by sterol occurs at the post-translational level. In mixed micelles or in reconstituted vesicles, both ACAT1 and ACAT2 display a sigmoidal response to cholesterol as their substrates (2Chang C.C.Y. Sakashita N. Ornvold K. Lee O. Chang E. Dong R. Lin S. Lee C.Y.G. Strom S. Kashyap R. Fung J. Farese Jr., R. Patoiseau J.F. Delhon A. Chang T.Y. J. Biol. Chem. 2000; 275: 28083-28092Google Scholar). These results are consistent with the concept that the ACAT activity is allosterically regulated by membrane cholesterol content in the ER (reviewed in Ref. 3Chang T.Y. Chang C.C.Y. Cheng D. Annu. Rev. Biochem. 1997; 66: 613-638Google Scholar). Oxysterols are sterols containing a second oxygen atom, present as a carbonyl, hydroxyl, or epoxide group in rings A or B or in the side chain, in addition to the C3 hydroxyl group. A large number of oxysterols are found in various locations, including food products, plasma, or inside the cells (reviewed in Refs. 4Schroepfer Jr., G.J. Physiol. Rev. 2000; 80: 361-554Google Scholar and 5Brown A.J. Jessup W. Atherosclerosis. 1999; 142: 1-28Google Scholar). They are produced by various enzymes in vivo, and/or by chemical oxidation in vitro. 24-Hydroxycholesterol, 25-hydroxycholesterol, 27-hydroxycholesterol, and 7α-hydroxycholesterol are the four main oxysterols enzymatically derived (5Brown A.J. Jessup W. Atherosclerosis. 1999; 142: 1-28Google Scholar, 6Russell D.W. Biochim. Biophys. Acta. 2000; 1529: 126-135Google Scholar) and can be found in the plasma and inside certain cell types. 7-Ketocholesterol, 7α-hydroxycholesterol, 7β-hydroxycholesterol, and 27-hydroxycholesterol are the four major oxysterols found in human atherosclerotic lesions (5Brown A.J. Jessup W. Atherosclerosis. 1999; 142: 1-28Google Scholar, 7Brown A.J. Mander E.L. Gelissen I.C. Kritharides L. Dean R.T. Jessup W. J. Lipid Res. 2000; 41: 226-236Google Scholar). In addition, 7-ketocholesterol, 7α-hydroxycholesterol, 7β-hydroxycholesterol, 5α,6α-epoxycholesterol, and 5β,6β-epoxycholesterol are the major oxysterols present in oxidized low density lipoprotein preparations in vitro (8Dzeletovic S. Babiker A. Lund E. Diczfalusy U. Chem. Phys. Lipids. 1995; 78: 119-128Google Scholar, 9Patel R.P. Diczfalusy U. Dzeletovic S. Wilson M.T. Darley-Usmar V. J. Lipid Res. 1996; 37: 2361-2371Google Scholar). Oxysterols possess a wide range of biological properties and may play regulatory roles in cholesterol metabolism. For example, when added to the culture medium of intact cells, most oxysterols, including 7α-hydroxycholesterol, 7-ketocholesterol, and 25-hydroxycholesterol, greatly suppressed the cholesterol biosynthesis rate (10Kandutsch A.A. Chen H.W. J. Biol. Chem. 1973; 248: 8408-8417Google Scholar, 11Brown M.S. Goldstein J.L. J. Biol. Chem. 1974; 249: 7306-7314Google Scholar). Several oxysterols are high affinity ligands for the nuclear receptor LXRα1 (13Janowski B.A. Willy P.J. Devi T.R. Falck J.R. Mangelsdorf D.J. Nature. 1996; 383: 728-731Google Scholar, 14Lehmann J.M. Kliewer S.A. Moore L.B. Smith-Oliver T.A. Oliver B.B. Su J.-L. Sundseth S.S. Winegar D.A. Blanchard D.E. Spencer T.A. Willson T.M. J. Biol. Chem. 1997; 272: 3137-3140Google Scholar), and one of them, 24(S),25-epoxycholesterol, has been proposed as a participant in cholesterol regulation in the liver (12Spencer T.A. Li D. Russel J.S. Collins J.L. Bledsoe R.K. Consler T.G. Moore L.B. Galardi C.M. McKee D.D. Moore J.T. Watson M.A. Parks D.J. Lambert M.H. Willson T.M. J. Med. Chem. 2001; 44: 886-897Google Scholar). On the other hand, the roles of oxysterols in controlling cholesterol homeostasis in vivo are still under debate, partly because in various mammalian systems examined, various oxysterols are present in very low concentrations, with much shorter half-lives relative to cholesterol (15Bjorkhem I. J. Clin. Invest. 2002; 110: 725-730Google Scholar). Oxysterols have also been shown to have effects on ACAT activity. For example, when added to medium of tissue culture cells, oxysterols such as 7-ketocholesterol or 25-hydroxycholesterol, in addition to their suppressive effect on cholesterol biosynthesis rate, stimulated cholesterol esterification rate and increased ACAT activity (16Brown M.S. Dana S.E. Goldstein J.L. J. Biol. Chem. 1975; 250: 4925-4927Google Scholar). When cholesterol was added in the same manner, it failed to provide the same response. Despite numerous studies, the mechanism of oxysterol-mediated activation of cholesteryl ester biosynthesis had not been clarified. It could be due to the presence of a putative oxysterol binding site present in ACAT1 or could be due to the ability of oxysterol to mobilize cellular cholesterol to the ER; other mechanism(s) could not be ruled out. We and other investigators used various crude cell extract systems and had demonstrated the apparent activation of ACAT by 25-hydroxycholesterol in vitro (17Erickson S.K. Shrewsbury M.A. Brooks C. Myer D.J. J. Lipid Res. 1980; 21: 930-941Google Scholar, 18Lichtenstein A.H. Brecher P. J. Biol. Chem. 1980; 255: 9098-9104Google Scholar, 19Cheng D. Chang C.C. Qu X. Chang T.Y. J. Biol. Chem. 1995; 270: 685-695Google Scholar). However, in these studies, the enzyme ACAT and the sterols (cholesterol and 25-hydroxycholesterol) serving as substrate and/or activator were present in different membranes. Thus, one could not rule out the possibility that the apparent activation by 25-hydroxycholesterol was due to its ability to translocate cholesterol from a cholesterol-rich membrane to a cholesterol-poor membrane where ACAT is located (discussed in Ref. 19Cheng D. Chang C.C. Qu X. Chang T.Y. J. Biol. Chem. 1995; 270: 685-695Google Scholar). Studies were also performed attempting to determine the sterol substrate specificity of ACAT. When individual sterols were delivered in vesicle form to the enzyme, Cases et al. (20Cases S. Novak S. Zheng Y.W. Myers H. Lear S.R. Sande E. Welch C.B. Lusis A.J. Spencer T.A. Krause B.R. Erickson S.K. Farese Jr., R.V. J. Biol. Chem. 1998; 273: 26755-26764Google Scholar) have shown that ACAT seemed to utilize various oxysterols much more efficiently than cholesterol. Again, these studies involved the use of crude enzyme extracts, with ACAT and sterols present in different membranes. Among various sterols, the ability to move from the donor membrane to the ACAT-containing membrane differs greatly (21Theunissen J.J.H. Jackson R.L. Kempen H.J.M. Demel R.A. Biochim. Biophys. Acta. 1986; 860: 66-74Google Scholar). The transfer rates for oxysterols were much faster (more than 10 times) than those for cholesterol; these differences could greatly mask the true sterol specificity for the enzyme. Thus, the intrinsic substrate specificity of ACAT could not be determined from these studies. In oxidized low density lipoprotein-loaded macrophages, large amounts of esterified oxysterols and esterified cholesterol are present in the cytosolic fraction of the cells; these cytosolic steryl esters are the products of ACAT reaction (7Brown A.J. Mander E.L. Gelissen I.C. Kritharides L. Dean R.T. Jessup W. J. Lipid Res. 2000; 41: 226-236Google Scholar). How ACAT can utilize oxysterols in the presence of large amounts of cellular cholesterol is not clear, partly because the relative specificity of ACAT toward oxysterols and cholesterol as substrate or as activator has not been clarified. In the current work, we compared the abilities of several selected oxysterols versus cholesterol as ACAT substrates or as ACAT activators. The oxysterols evaluated included, as representatives of ring A or B oxysterols, 7α-, and 7β-hydroxycholesterol, 7-ketocholesterol, and 5α,6α- and 5β,6β-epoxycholesterol and, as a representative of side-chain oxysterols, 24(S),25-epoxycholesterol. We first placed sterols and the enzyme in mixed micelles (22Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Google Scholar), using human ACAT1 purified to homogeneity as the enzyme source and analyzed the enzyme activity in response to varying sterol concentrations. In mixed micelles, the sterol is in direct contact with the enzyme in solution form (23Carman G.M. Deems R.A. Dennis E.A. J. Biol. Chem. 1995; 270: 18711-18714Google Scholar). This assay system also avoids the formation of sterol microdomain(s). On the other hand, the environment provided by the mixed micelles is not close to that of ACAT1 under physiological conditions, because ACAT1 is an integral membrane protein residing in the ER. We therefore tested the validity of information learned from using the mixed micelles system by using the reconstituted vesicle system (24Doolittle G.M. Chang T.Y. Biochim. Biophys. Acta. 1982; 713: 529-537Google Scholar, 25Cadigan K.M. Chang T.Y. J. Lipid Res. 1988; 29: 1683-1692Google Scholar). The latter system provides an environment close to that of ACAT1 under physiological conditions. In addition, the sterol and the enzyme ACAT1 reside in the same vesicles, thus eliminating the sterol transfer step between two different vesicles prior to enzyme catalysis. Our results show that ACAT1 can accommodate cholesterol, 5α,6α-epoxycholesterol, and 7α-hydroxycholesterol as its three preferred substrates. In contrast, for activation of ACAT1, cholesterol is superior to all of the oxysterols tested, including 7-ketocholesterol, 7α-hydroxycholesterol, 7β-hydroxycholesterol, 5α,6α-epoxycholesterol, 5β,6β-epoxycholesterol, or 7β-hydroxycholesterol. Thus, the structural requirement for sterol as an ACAT activator is more stringent than it is for sterol as an ACAT substrate. Cholesterol, 7β-hydroxycholesterol, 5α,6α-epoxycholesterol, 5β,6β-epoxycholesterol, 7-ketocholesterol, β-sitosterol, CHAPS, taurocholate, oleoyl-coenzyme A, egg phosphatidylcholine (PC), cholesteryl oleate, fatty acid-free bovine serum albumin, 4-dimethylaminopyridine, imidazole, oleic anhydride, triethylamine, and primulin dye were all from Sigma. 7α-Hydroxycholesterol, 25-hydroxycholesterol, and 27-hydroxycholesterol were from Steraloids. 24(S),25-epoxycholesterol was synthesized as previously described (26Tomkinson N.C.O. Willson T.M. Russel J.S. Spencer T.A. J. Org. Chem. 1998; 63: 9919-9923Google Scholar, 27Spencer T.A. Li D. Russel J.S. Tomkinson N.C. Willson T.M. J. Org. Chem. 2000; 65: 1919-1923Google Scholar). All of the sterols showed single spots in TLC analysis and were used without further purification. 2,6-Di-tert-butyl-p-cresol was from Eastman Kodak Co. The Centrisart ultrafiltration device (cut-off molecular mass, 300 kDa) was from Sartorius. Organic solvents used were reagent grade and were from Fisher. Grace's insect cell medium was from Invitrogen. The software program Prism (GraphPad Software, Inc.) was from Sigma. The source of enzyme was recombinant human ACAT1 expressed in insect Hi5 cells and purified to electrophoretic homogeneity. The purification procedure was as described previously (22Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Google Scholar, 28Lu X. Lin S. Chang C.C.Y. Chang T.Y. J. Biol. Chem. 2002; 276: 711-718Google Scholar), using nickel column chromatography and ACAT1 monoclonal column chromatography. For some of the experiments reported in this work (see Fig. 4), the enzyme source used was HisACAT1Δ1–65 (29Yu C. Zhang Y. Lu X. Chang C.C.Y. Chang T.Y. Biochemistry. 2002; 41: 3762-3769Google Scholar). The ACAT1 monoclonal antibody only recognizes the N terminus of the enzyme. The HisACAT1Δ1–65 enzyme lacked the N-terminal and thus could only be partially purified, using nickel column chromatography (29Yu C. Zhang Y. Lu X. Chang C.C.Y. Chang T.Y. Biochemistry. 2002; 41: 3762-3769Google Scholar). The enzyme was assayed in sterol/PC/taurocholate mixed micelles or in reconstituted vesicles conducted as described previously (22Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Google Scholar), using the radioactive substrate [3H]oleoyl coenzyme A at 4 × 104dpm/nmol. The mixed micelles were prepared as described previously (22Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Google Scholar), containing varying sterol concentrations, reported as mol % sterol/sterol + PC as indicated in various figures, in 11.2 mm PC and 18.6 mm taurocholate. For assays that contained two different sterols, each sterol/PC/taurocholate mixed micelles sample was made separately and then mixed together and used within 6 h. The reconstituted vesicles were prepared essentially as described previously (30Ventimiglia J.B. Levesque M.C. Chang T.Y. Anal. Biochem. 1986; 157: 323-330Google Scholar, 31Shi S.P. Chang C.C.Y. Gould G.W. Chang T.Y. Biochim. Biophys. Acta. 1989; 982: 187-195Google Scholar). In the current work, we used taurocholate instead of cholate as the detergent to prepare the bile salt/PC/sterol micelles, with taurocholate at 18.6 mm and the PC at 11.2 mm. We then used cholestyramine to remove bile salt from mixed micelles, which rapidly led to vesicle formation. Control experiments using radioactive taurocholate showed that after two treatments of cholestyramine, more than 99% of the taurocholate was removed from the resultant vesicles. The sterol solubility in micellar solutions was monitored by subjecting the solutions to ultracentrifugation (at 50,0000 × g for 40 min) followed by ultrafiltration through a Sartorius Centrisart ultrafiltration device that contains a membrane with a molecular mass cut-off of 300 kDa as described (32Moschetta A. Eckhardt E.R.M. De Smet M.B.M. Renooij W. Van Berge-Henegouwen G.P. Van Erpecum K.J. Biochim. Biophys. Acta. 2001; 1532: 15-27Google Scholar). After the ultracentrifugation and the ultrafiltration steps, the sterols were quantitated according to the method described previously (33White T. Bursten S. Federighi D. Lewis R.A. Nudelman E. Anal. Biochem. 1998; 258: 109-117Google Scholar). Briefly, the lipids present in the untreated samples or in the supernatants after treatment were extracted with chloroform/methanol (2:1), spotted onto the TLC plate, and separated using the solvent system hexane/acetone/acetic acid = 80:20:1 (v/v/v). The plate was sprayed with a 0.05% solution of primulin dye and then scanned by using the STORM 860 imaging system to detect the laser-excited fluorescent signals. Spots of a given sterol were quantitated by integration of variable pixel intensities using the ImageQuant software. Standard curves were produced by quantitating increasing amounts (10–200 μg) of a given sterol sample spotted in parallel lanes. Various nonradioactive sterol oleate esters were used as internal markers and visualized by iodine staining after TLC analysis. Other than cholesteryl oleate and 25-hydroxycholesterol (from Steraloids), the sterol esters described in the current work were not commercially available. They were chemically synthesized based on the general instruction provided by Molecular Probes, Inc. (Eugene, OR). Typically, 5 μmol of a given sterol was weighed in an amber vial, and 0.166 ml of methylene chloride was added and swirled briefly. 0.075 ml of triethylamine, 3 mg of oleic anhydride, and 0.042 mg of 4-dimethylaminopyridine as catalyst and 2 μl of 0.1% 2,6-di-tert-butyl-p-cresol in methylene chloride as antioxidant were then added. The vial was sealed under nitrogen and stirred with a magnetic stir bar overnight in the dark. 12 h later, the same amounts of oleic anhydride, 4-dimethylaminopyridine, and 2,6-di-tert-butyl-p-cresol described before were added, and the reaction was continued for an additional 10 h. The sterol oleates synthesized were used as the internal markers for TLC without purification. When TLC plates were run in a petroleum ether/ether/acetic acid (90:10:1) solvent system, theR f values for oleates of the following sterols were as follows: cholesterol, 0.87; 5α,6α-epoxycholesterol, 0.51; 5β,6β-epoxycholesterol, 0.58; 7-ketocholesterol, 0.36; 7α-hydroxycholesterol, 0.21; 7β-hydroxycholesterol, 0.28; β-sitosterol, 0.89; 25-hydroxycholesterol, 0.30; 24(S),25-epoxycholesterol, 0.46. In order to quantitatively compare the abilities of various sterols that serve as ACAT substrate and/or activator, a single phase system composed of the enzyme, phospholipid, and sterol is needed. We had previously developed a mixed micelles system for measuring ACAT activity. This system consisted of mixing egg PC, taurocholate, and cholesterol at appropriate ratios, followed by bath-sonication at cold temperature until optical clearance. The enzyme ACAT solubilized in low concentration of the detergent CHAPS was then added to the mixed micelles before the reaction began. It is possible that the micelles prepared by sonication may still contain a minor portion of sterol in the form of supersaturated microcrystals and/or multilamellar or unilamellar vesicles. To remove microcrystals and/or vesicles from the micelles, Moschetta et al. (32Moschetta A. Eckhardt E.R.M. De Smet M.B.M. Renooij W. Van Berge-Henegouwen G.P. Van Erpecum K.J. Biochim. Biophys. Acta. 2001; 1532: 15-27Google Scholar) developed a simple and effective procedure that involved ultracentrifugation and ultrafiltration. We used this procedure to monitor the quality of the mixed micelles that contained either cholesterol, or 7-ketocholesterol, or 5α,6α-epoxycholestanol. The results showed that essentially 100% of these three sterols existed in the micellar phase at concentrations from 0.25 to 2 mm (which is equivalent to 0.022–0.15 mol % sterol/sterol + PC) (data not shown). Other sterols, including 5β,6β-epoxycholesterol, β-sitosterol, 7α-hydroxycholesterol, and 7β-hydroxycholesterol, behaved in the same manner (results not shown). In contrast, oxysterols that contain the hydroxy groups at the side chain, including 24-hydroxycholesterol, 25-hydroxycholesterol, and 27-hydroxycholesterol, could only produce clear micellar solutions at no more than 0.5 mm (0.043 mol % sterol/sterol + PC). Therefore, in our current study, we have focused our effort on comparing various sterols that readily form mixed micelles. We compared the ability of seven sterols to serve as substrates of ACAT by varying their concentrations from 0.047 to 2.0 mm, which amount to 0.004–0.15 mol % sterol/sterol + PC. In some experiments, the highest concentrations were extended to 2.3 mm (0.17 mol % sterol/sterol + PC). The solubility of 24(S),25-epoxycholesterol was higher than that of oxysterols with hydroxy groups at the side chain; this property allowed us to study 24(S),25-epoxycholesterol at concentrations between 0.0047 and 0.1 mol % sterol/sterol + PC. The results (Fig.1) show that 5α,6α-epoxycholestanol, cholesterol, and 7α-hydroxycholesterol are the three best substrates. All three sterols exhibit sigmoidal substrate saturation curves; theK 0.5 values (the concentration at which half-maximal velocity is achieved) for these three sterols were similar, varying between 0.7 and 0.9 mol % sterol/sterol + PC. At sterol concentrations above K 0.5, 5α,6α-epoxycholestanol is a slightly better substrate than cholesterol, whereas 7α-hydroxycholesterol is ∼70% as efficient as cholesterol as the substrate (results of three independent experiments). The other three sterols tested, 7-ketocholesterol, 7β-hydroxycholesterol, and β-sitosterol (a major plant sterol) were all vastly inferior to cholesterol as the substrate. In addition, 24(S),25-epoxycholesterol tested at concentrations up to 0.1 mol % sterol/sterol + PC is also a poor substrate. Theinset showed the same data using a smaller scale to report the ACAT activity. It demonstrates that ACAT1 can definitely use any of the latter four sterols as substrates although in a far less efficient manner. We next tested the effect of cholesterol when 7-ketocholesterol serves as the substrate, and vice versa. The results (Fig.2 A) show that cholesterol added at low concentrations (from 0.01 to 0.1 mol % sterol/sterol + PC) significantly activated the enzyme when 7-ketocholesterol was measured as the substrate. It also changed the substrate saturation curve from being sigmoidal to essentially hyperbolic. Calculations (using the software program Prism) showed that the Hill coefficient decreased from 3.0 without cholesterol to 1.1 with cholesterol added at 0.1 mol % sterol/sterol + PC. The K 0.5 value decreased from 0.13 mol % sterol/sterol + PC without cholesterol to 0.04 mol % sterol/sterol + PC with cholesterol. TheV max value increased from 150 nmol/min without cholesterol to 200 nmol/min with cholesterol. The activation effect by cholesterol shown in Fig. 2 A could not be explained, because cholesterol is a better substrate and binds to the catalytic site more efficiently. If this were the case, cholesterol should have caused severe inhibition when 7-ketocholesterol was measured as the substrate. When cholesterol was measured as the substrate, 7-ketocholesterol added at low concentrations (from 0.005 to 0.025 mol % sterol/sterol + PC) caused slight inhibition of the enzyme (Fig. 2 B). The inhibition was more prominent at higher cholesterol concentrations. Thus, the inhibitory effect of 7-ketocholesterol is presumably through substrate competition. 7-Ketocholesterol did not alter the sigmoidicity of the cholesterol substrate saturation curve. Calculations showed that the K 0.5 value for cholesterol stayed at 0.07 mol % sterol/sterol + PC, and the Hill coefficient stayed around 2.2, with or without 7-ketocholesterol added.Figure 2Sterol substrate saturation curves of HisACAT1 with both cholesterol and 7-ketocholesterol present in mixed micelles. The final concentrations of cholesterol or 7-ketocholesterol were as indicated. A, 7-ketocholesterol substrate saturation curve in the presence of the indicated concentrations of cholesterol. B, cholesterol substrate saturation curve in the presence of the indicated concentrations of 7-ketocholesterol. The assays were done in duplicate. The results shown are representative of two separate experiments.View Large Image Figure ViewerDownload (PPT) Human ACAT1 is a homotetrameric enzyme (34Yu C. Chen J. Lin S. Liu J. Chang C.C.Y. Chang T.Y. J. Biol. Chem. 1999; 274: 36139-36145Google Scholar). We had previously shown that by deleting the first 65 amino acid residues from the N-terminal, the enzyme could be converted to a dimeric form. This form was designated as hACAT1Δ1–65. The dimeric enzyme is 5–10 times more active than the native ACAT1 in terms of catalytic efficiency (29Yu C. Zhang Y. Lu X. Chang C.C.Y. Chang T.Y. Biochemistry. 2002; 41: 3762-3769Google Scholar). We compared the effect of cholesterol and 7-ketocholesterol using hACAT1Δ1–65 as the enzyme source. The results show (Fig.3 A) that cholesterol significantly activated the enzyme activity when 7-ketocholesterol was measured as the substrate, whereas 7-ketocholesterol added had minimal effect on the enzyme activity when cholesterol was measured as the substrate (Fig. 3 B). Thus, the ability of cholesterol to activate the enzyme does not require the enzyme to exist at the tetrameric form. We next tested the effect of cholesterol when 5α,6α-epoxycholestanol was measured as the substrate, andvice versa. The results showed that cholesterol added at low concentrations significantly activated the enzyme when 5α,6α-epoxycholesterol was used as the substrate, whereas 5α,6α-epoxycholesterol added inhibited the enzyme when cholesterol was measured as the substrate (data not shown). This result suggested that cholesterol may be a better activator than 5α,6α-epoxycholesterol, although the latter sterol is a slightly better substrate than cholesterol (Fig. 1). To test this interpretation, we next used 7-ketocholesterol as the substrate at two different concentrations (at 0.08 or 0.12 mol % sterol/sterol + PC) and compared cholesterol versus various other sterols as indicated, including 5α,6α-epoxycholesterol, for their abilities to activate the enzyme. The results (Fig. 4) showed that among all the sterols tested, cholesterol is the only sterol that caused significant activation of the enzyme. In intact cells, ACAT resides mainly in the ER and uses sterol present in the ER as the enzymatic substrate (3Chang T.Y. Chang C.C.Y. Cheng D. Annu. Rev. Biochem. 1997; 66: 613-638Google Scholar). To measure ACAT activity in a system that is similar to the ER, we next tested the effects of various sterols present in vesicle form. To avoid the step of sterol transfer between donor vesicles to the vesicles where ACAT resides, we had previously developed a reconstituted vesicle system by diluting the ACAT solubilized in detergent into a large excess of preformed vesicles with defined sterol and PC composition (24Doolittle G.M. Chang T.Y. Biochim. Biophys. Acta. 1982; 713: 529-537Google Scholar). We now used the reconstituted vesicle system to compare the abilities of cholesterol, 5α,6α-epoxycholesterol, and 7-ketocholesterol to serve as ACAT substrates. The results show (Fig. 5) that 5α,6α-epoxycholesterol and cholesterol are much better substrates than 7-ketocholesterol. For each of the sterols tested, the enzyme responded to the sterol content present in the vesicles in a sigmoidal-like manner. We next tested the effect of cholesterol on ACAT activity when 7-ketocholesterol was measured as the substrate, andvice versa. The results show that cholesterol added at low concentrations significantly activated the enzyme when 7-ketocholesterol (Fig. 6 A) was measured as the substrate, whereas 7-ketocholesterol (Fig.6 B) added inhibited the enzyme, presumably through substrate competition, when cholesterol was measured as the substrate. In data not shown, we also tested the effect of cholesterol on ACAT activity when 5α,6α-epoxycholestanol was measured as the substrate, andvice versa, and have obtained essentially the same results as described in Fig. 6, A and B. To further test this finding using the reconstituted vesicle system, we used 7-ketocholesterol as the variable substrate and compared cholesterol and 5α,6α-epoxycholesterol, added at 0.4 mol % sterol/sterol + PC, for their ability to activate the enzyme. The results (Fig.7) show that cholesterol is superior to 5α,6α-epoxycholesterol as the activator. Thus, the results using the reconstituted vesicles system fully corroborated the results using the mixed micelles system.Figure 6Sterol substrate saturation curves of HisACAT1 with both cholesterol and 7-ketocholesterol present in reconstituted vesicles. The cholesterol/PC/taurocholate and 7-ketocholesterol/PC/taurocholate mixed micelles were made separately and then mixed and treated with cholestyramine to produce the reconstituted vesicles. A, 7-ketocholesterol substrate saturation curves with cholesterol at the indicated concentration (0 or 0.04 mol %). B, cholesterol substrate saturation curves with 7-ketocholesterol at the indicated concentration (0 or 0.04 mol %).View Large Image Figure ViewerDownload (PPT)Figure 77-Ketocholesterol substrate saturation curves of HisACAT1 with cholesterol or 5α,6α-epoxycholesterol present in reconstituted vesicles. The final concentration of cholesterol or 5α,6α-epoxycholesterol added was at 0.04 mol %. The assays were done in duplicate.View Large Image Figure ViewerDownload (PPT) In the current work, we employed the mixed micelles assay system to compare the abilities of various sterols to serve as a substrate for ACAT1. The results show that cholesterol and 5α,6α-epoxycholesterol are the two best substrates tested. 7α-Hydroxycholesterol is the third best substrate, being 70% as efficient, whereas other sterols such as 7-ketocholesterol were 10% or less as efficient. Modification of cholesterol by including the 7α-hydroxy moiety in steroid ring B is moderately tolerated as the enzymatic substrate. We then developed a method to compare the abilities of various sterols serving as ACAT activators. The results show that cholesterol is far superior as an activator to all other sterols tested, including 5α,6α-epoxycholesterol or 7α-hydroxycholesterol. Thus, the structural specificity of the activator site is much more stringent than its sterol substrate site. The results obtained by using the mixed micelles have essentially been confirmed by using the reconstituted vesicles system. In bile salt-based mixed micelles, a sterol-specific microdomain(s) has not been reported. In PC-based vesicles, the physical properties of cholesterol, 5α,6α-epoxycholestanol, 7α-hydroxycholesterol, 7β-hydroxycholesterol, and 7-ketocholesterol have previously been shown to be similar to those of cholesterol (19Cheng D. Chang C.C. Qu X. Chang T.Y. J. Biol. Chem. 1995; 270: 685-695Google Scholar, 35Li Q.-T. Das N.P. Arch. Biochem. Biophys. 1994; 315: 473-478Google Scholar, 36Verhagen J.C.D. ter Braake P. Teunissen J. van Ginkel G. Sevanian A. J. Lipid Res. 1996; 37: 1488-1502Google Scholar). Therefore, we believe that the sterol specificity demonstrated in our current work is mainly due to the intrinsic specificity of the enzyme, not due to subtle difference in biophysical properties of sterols in micelles or in vesicles. We also show that the ability of cholesterol to serve as an activator is preserved when the oligomeric structure of ACAT changes from the tetrameric form to a dimeric form. To explain these results, we propose the following model: ACAT1 contains a sterol substrate site and an allosteric sterol activator site. The activator site is restricted to cholesterol only, whereas the substrate site is more promiscuous. When 7-ketocholesterol is the substrate, activation by cholesterol at low concentration decreases theK 0.5 value as well as increasing theV max value toward 7-ketocholesterol. When 5α,6α-epoxycholesterol is the substrate, activation by cholesterol at low concentration decreases the K 0.5 value without affecting the V max value of the enzyme toward 5α,6α-epoxycholesterol. In the future, using various biochemical approaches that include photoaffinity labeling and site-specific mutagenesis, studies can test the validity of this model. In oxidized low density lipoprotein-loaded macrophages, a large amount of esterified oxysterols including 7-ketocholesterol are found; those present in the cytosol were derived from ACAT reaction (7Brown A.J. Mander E.L. Gelissen I.C. Kritharides L. Dean R.T. Jessup W. J. Lipid Res. 2000; 41: 226-236Google Scholar). These observations could be explained based on our model; ACAT1 present in macrophages is activated by cholesterol in the cholesterol-rich environment and becomes more efficient in using 7-ketocholesterol as an alternative substrate, thus causing an ample amount of 7-ketocholesterol to be esterified. In addition, as shown in our current work, β-sitosterol (a major plant sterol) is a poor ACAT1 substrate and a poor activator. Our model predicts that β-sitosterol may become a much better substrate of ACAT1 when the enzyme is under high cholesterol conditions. In the future, this prediction could be tested under various physiological conditions. Related to our current work, Brown et al. (37Brown A.J. Sun L. Feramisco J.D. Brown M.S. Goldstein J.L. Mol. Cell. 2002; 10: 237-245Google Scholar) have recently shown that when added as cyclodextrin complex, cholesterol, 7-ketocholesterol, 7α-hydroxycholesterol, or other structurally related sterols added to the ER membranes in vitro causes conformational change of the sterol-sensing protein SCAP. Oxysterols with hydroxy groups at the side chain, such as 25-hydroxycholesterol or 27-hydroxycholesterol, fail to initiate this change. SCAP is a key factor involved in sterol-specific transcriptional regulation of cholesterol biosynthesis. The sterol specificity demonstrated in their system strongly suggests that it is cholesterol itself that acts on the sterol regulatory machinery. The authors did not test the abilities of the sterols to cause conformational change of SCAP in a dose-dependent manner. Our results reported here show that cholesterol is superior to either 7-ketocholesterol or 7α-cholesterol as an ACAT activator in vitro. Both ACAT1 and SCAP are integral membrane proteins that mainly reside in the ER. Our results thus reinforce the results of Brown et al. (37Brown A.J. Sun L. Feramisco J.D. Brown M.S. Goldstein J.L. Mol. Cell. 2002; 10: 237-245Google Scholar), supporting the concept that the content of cholesterol rather than the content of an oxysterol such as 7-ketocholesterol or 7α-hydroxycholesterol located in the ER plays a pivotal role in the regulation of intracellular cholesterol metabolism. The fact that 7-ketocholesterol added in intact cells caused significant stimulation in esterification of cholesterol (16Brown M.S. Dana S.E. Goldstein J.L. J. Biol. Chem. 1975; 250: 4925-4927Google Scholar) could be explained by its ability to cause translocation of cholesterol from the plasma membrane to the ER, where ACAT resides (3Chang T.Y. Chang C.C.Y. Cheng D. Annu. Rev. Biochem. 1997; 66: 613-638Google Scholar, 38Lange Y. Steck T.L. J. Biol. Chem. 1997; 272: 13103-13108Google Scholar). Due to their limited solubility in mixed micelles, we could not perform extensive testing on various oxysterols with hydroxymoiety at the side chain. We did, however, find that 25-hydroxycholesterol at concentrations up to 0.05 mol % was also a poor substrate for ACAT1. When cholesterol was measured as a substrate, 25-hydroxycholesterol added at low concentration failed to increase ACAT activity, whereas cholesterol added at low concentration greatly increased the ACAT activity in utilizing 25-hydroxycholesterol as the substrate (results not shown). In lipid membranes, the oxysterols with hydroxy groups at the side chain are very different from cholesterol in terms of their biophysical properties (21Theunissen J.J.H. Jackson R.L. Kempen H.J.M. Demel R.A. Biochim. Biophys. Acta. 1986; 860: 66-74Google Scholar, 35Li Q.-T. Das N.P. Arch. Biochem. Biophys. 1994; 315: 473-478Google Scholar, 36Verhagen J.C.D. ter Braake P. Teunissen J. van Ginkel G. Sevanian A. J. Lipid Res. 1996; 37: 1488-1502Google Scholar). Kauffman et al. (39Kauffman J. Westerman P.W. Carey M.C. J. Lipid Res. 2000; 41: 991-1003Google Scholar) proposed that 25-hydroxycholesterol and 27-hydroxycholesterol might prefer to interact with PC in “reverse orientation” (i.e. with its hydrophilic side chain lining up with the polar moiety of the PC molecules in membranes). Based on earlier studies and the current results, if oxysterols serve as important regulators for ACAT activity in intact cells, they may act through certain novel mechanism(s) rather than by incorporating into the ER membranes and being recognized by ACAT as a preferred activating molecule. We thank Drs. Keith Suckling and Brian Jackson of GlaxoSmithKline Pharmaceuticals and members of our laboratory for stimulating discussions, and we thank Helina Morgan for careful editing of the manuscript.

Acyl-CoA:cholesterol acyltransferase from Chinese hamster ovary (CHO) cells was solubilized by deoxycholate, and then reconstituted in phosphatidylcholine/cholesterol liposomes. This reconstituted activity was totally dependent upon the cholesterol content of the mixture and showed saturation for cholesterol. Analysis of the reconstituted enzyme on linear Ficoll gradients shows that the enzyme has been incorporated into phospholipid/cholesterol liposomes. The CHO cell enzyme activity as measured by conventional assay (using cellular cholesterol as the substrate) was activated approximately 20-fold by low density lipoprotein. This activation process was independent of protein synthesis. When the above cell homogenates were assayed after optimal reconstitution, the activation produced by low density lipoprotein was essentially completely abolished. There was also no change in enzyme activity measured after reconstitution when cells were switched from sterol-containing medium to sterol-free medium, in contrast to a more than 7-fold drop in enzyme activity when assayed without reconstitution. These results suggest that the enzyme activity in intact cells is controlled by the content and composition of cellular lipids associated with the enzyme molecule. Since the intracellular messenger of low density lipoprotein is known to be cholesterol, it is likely that this enzyme activity in intact cells is primarily controlled by the cholesterol content in the vicinity of the enzyme molecule.

High levels of the inflammatory cytokine tumor necrosis factor-alpha (TNF-alpha) are present in atherosclerotic lesions. TNF-alpha regulates expression of multiple genes involved in various stages of atherosclerosis, and it exhibits proatherosclerotic and antiatherosclerotic properties. ACAT catalyzes the formation of cholesteryl esters (CE) in monocytes/macrophages, and it promotes the foam cell formation at the early stage of atherosclerosis. We hypothesize that TNF-alpha may be involved in regulating the ACAT gene expression in monocytes/macrophages. In this article, we show that in cultured, differentiating human monocytes, TNF-alpha enhances the expression of the ACAT1 but not ACAT2 gene, increases the cholesteryl ester accumulation, and promotes the lipid-laden cell formation. Several other proinflammatory cytokines tested do not affect the ACAT1 gene expression. The stimulation effect is consistent with a receptor-dependent process, and is blocked by using nuclear factor-kappa B (NF-kappa B) inhibitors. A functional and unique NF-kappa B element located within the human ACAT1 gene proximal promoter is required to mediate the action of TNF-alpha. Our data demonstrate that TNF-alpha, through the NF-kappa B pathway, specifically enhances the expression of human ACAT1 gene to promote the CE-laden cell formation from the differentiating monocytes, and our data support the hypothesis that TNF-alpha is proatherosclerotic during early phase of lesion development.

A sterol-requiring mutant has been isolated from mutagenized Chinese hamster ovary cells. This mutant grows normally only when cholesterol is present in the medium. Cell lysis occurs within 3 days in the absence of cholesterol. The frequency of reversion of this mutant to prototrophic growth is low (less than or equal to 10(-6). Whole cell pulse experiments with [14C]acetate or [3H]mevalonate indicate that the rate of synthesis of digitonin-precipitable material is greatly diminished in the mutant cells as compared to that in normal Chinese hamster ovary cells. Enzyme assays in vitro with crude cell extracts show that the biosynthetic conversion of mevalonate to squalene and the conversion of squalene to lanosterol are not impaired in the mutant cells. Gas-liquid chromatographic analyses of radioactive sterol composition after whole cell pulse experiments with [3H]squalene and with [3H]anosterol suggest that the fundamental enzymatic defect of the mutant is at the stage of lanosterol demethylation. When cells were grown in serum-free medium, lanosterol and dihydrolanosterol accumulated intracellularly in the mutant cells before cell lysis occurred; neither of these two intermediary sterols was detected in the wild-type cells grown under the same condition.

The MBOAT enzyme family, identified in 2000, comprises 11 genes in the human genome that participate in a variety of biological processes. MBOAT enzymes contain multiple transmembrane domains and share two active site residues, histidine and asparagine. Several MBOAT members are drug targets for major human diseases, including atherosclerosis, obesity, Alzheimer disease, and viral infections. Here we review the historical aspects of MBOAT enzymes, classify them biochemically into 3 subgroups, and describe the essential features of each member.

Recent evidence indicates that microRNAs might participate in prostate cancer initiation, progression and treatment response. Germline variations in microRNAs might alter target gene expression and modify the efficacy of prostate cancer therapy. To determine whether genetic variants in microRNAs and microRNA target sites are associated with the risk of biochemical recurrence (BCR) after radical prostatectomy (RP). We retrospectively studied two independent cohorts composed of 320 Asian and 526 Caucasian men with pathologically organ-confined prostate cancer who had a median follow-up of 54.7 and 88.8 months after RP, respectively. Patients were systematically genotyped for 64 single-nucleotide polymorphisms (SNPs) in microRNAs and microRNA target sites, and their prognostic significance on BCR was assessed by Kaplan-Meier analysis and Cox regression model. After adjusting for known clinicopathologic risk factors, two SNPs (MIR605 rs2043556 and CDON rs3737336) remained associated with BCR. The numbers of risk alleles showed a cumulative effect on BCR [perallele hazard ratio (HR) 1.60, 95% confidence interval (CI) 1.16-2.21, p for trend = 0.005] in Asian cohort, and the risk was replicated in Caucasian cohort (HR 1.55, 95% CI 1.15-2.08, p for trend = 0.004) and in combined analysis (HR 1.57, 95% CI 1.26-1.96, p for trend <0.001). Results warrant replication in larger cohorts. This is the first study demonstrating that SNPs in microRNAs and microRNA target sites can be predictive biomarkers for BCR after RP.

MicroRNAs (miRNAs) post-transcriptionally regulate gene expression by targeting mRNAs and control a wide range of biological functions. Recent studies have indicated that miRNAs can regulate lipid and cholesterol metabolism in mammals. Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is a key enzyme in cellular cholesterol metabolism. The accumulated cholesteryl esters are mainly synthesized by ACAT1 during the formation of foam cell, a hallmark of early atherosclerotic lesions. Here, we revealed that miR-9 could target the 3'-untranslated region of human ACAT1 mRNA, specifically reduce human ACAT1 or reporter firefly luciferase (Fluc) proteins but not their mRNAs in different human cell lines, and functionally decrease the formation of foam cells from THP-1-derived macrophages. Our findings suggest that miR-9 might be an important regulator in cellular cholesterol homeostasis and decrease the formation of foam cells in vivo by reducing ACAT1 proteins.

DNA methylation and histone acetylation inhibitors are widely used to study the role of epigenetic marks in the regulation of gene expression. In addition, several of these molecules are being tested in clinical trials or already in use in the clinic. Antimetabolites, such as the DNA-hypomethylating agent 5-azacytidine (5-AzaC), have been shown to lower malignant progression to acute myeloid leukemia and to prolong survival in patients with myelodysplastic syndromes. Here we examined the effects of DNA methylation inhibitors on the expression of lipid biosynthetic and uptake genes. Our data demonstrate that, independently of DNA methylation, 5-AzaC selectively and very potently reduces expression of key genes involved in cholesterol and lipid metabolism (e.g. PCSK9, HMGCR, and FASN) in all tested cell lines and in vivo in mouse liver. Treatment with 5-AzaC disturbed subcellular cholesterol homeostasis, thereby impeding activation of sterol regulatory element-binding proteins (key regulators of lipid metabolism). Through inhibition of UMP synthase, 5-AzaC also strongly induced expression of 1-acylglycerol-3-phosphate O-acyltransferase 9 (AGPAT9) and promoted triacylglycerol synthesis and cytosolic lipid droplet formation. Remarkably, complete reversal was obtained by the co-addition of either UMP or cytidine. Therefore, this study provides the first evidence that inhibition of the de novo pyrimidine synthesis by 5-AzaC disturbs cholesterol and lipid homeostasis, probably through the glycerolipid biosynthesis pathway, which may contribute mechanistically to its beneficial cytostatic properties. DNA methylation and histone acetylation inhibitors are widely used to study the role of epigenetic marks in the regulation of gene expression. In addition, several of these molecules are being tested in clinical trials or already in use in the clinic. Antimetabolites, such as the DNA-hypomethylating agent 5-azacytidine (5-AzaC), have been shown to lower malignant progression to acute myeloid leukemia and to prolong survival in patients with myelodysplastic syndromes. Here we examined the effects of DNA methylation inhibitors on the expression of lipid biosynthetic and uptake genes. Our data demonstrate that, independently of DNA methylation, 5-AzaC selectively and very potently reduces expression of key genes involved in cholesterol and lipid metabolism (e.g. PCSK9, HMGCR, and FASN) in all tested cell lines and in vivo in mouse liver. Treatment with 5-AzaC disturbed subcellular cholesterol homeostasis, thereby impeding activation of sterol regulatory element-binding proteins (key regulators of lipid metabolism). Through inhibition of UMP synthase, 5-AzaC also strongly induced expression of 1-acylglycerol-3-phosphate O-acyltransferase 9 (AGPAT9) and promoted triacylglycerol synthesis and cytosolic lipid droplet formation. Remarkably, complete reversal was obtained by the co-addition of either UMP or cytidine. Therefore, this study provides the first evidence that inhibition of the de novo pyrimidine synthesis by 5-AzaC disturbs cholesterol and lipid homeostasis, probably through the glycerolipid biosynthesis pathway, which may contribute mechanistically to its beneficial cytostatic properties.

Humans express two ACAT (acyl-CoA:cholesterol acyltransferase) genes, ACAT1 and ACAT2. ACAT1 is ubiquitously expressed, whereas ACAT2 is primarily expressed in intestinal mucosa and plays an important role in intestinal cholesterol absorption. To investigate the molecular mechanism(s) responsible for the tissue-specific expression of ACAT2, we identified five cis-elements within the human ACAT2 promoter, four for the intestinal-specific transcription factor CDX2 (caudal type homeobox transcription factor 2), and one for the transcription factor HNF1α (hepatocyte nuclear factor 1α). Results of luciferase reporter and electrophoretic mobility shift assays show that CDX2 and HNF1α exert a synergistic effect, enhancing the ACAT2 promoter activity through binding to these cis-elements. In undifferentiated Caco-2 cells, the ACAT2 expression is increased when exogenous CDX2 and/or HNF1α are expressed by co-transfection. In differentiated Caco-2 cells, the ACAT2 expression significantly decreases when the endogenous CDX2 or HNF1α expression is suppressed by using RNAi (RNA interference) technology. The expression levels of CDX2, HNF1α, and ACAT2 are all greatly increased when the Caco-2 cells differentiate to become intestinal-like cells. These results provide a molecular mechanism for the tissue-specific expression of ACAT2 in intestine. In normal adult human liver, CDX2 expression is not detectable and the ACAT2 expression is very low. In the hepatoma cell line HepG2 the CDX2 expression is elevated, accounting for its elevated ACAT2 expression. A high percentage (seven of fourteen) of liver samples from patients affected with hepatocellular carcinoma exhibited elevated ACAT2 expression. Thus, the elevated ACAT2 expression may serve as a new biomarker for certain form(s) of hepatocellular carcinoma.

Niemann-Pick C1-like 1 (NPC1L1) is a target for ezetimibe, a drug that blocks intestinal cholesterol absorption. A new study by Ge et al. (2008) in this issue of Cell Metabolism shows that non-lipoprotein-bound cholesterol induces endocytosis of NPC1L1 and that ezetimibe blocks the internalization of the NPC1L1/cholesterol complex. The in vivo significance of these findings is discussed.

has been further characterized with respect to its dependence on cholesterol.Upon removal of serum lipids from the growth medium, the activity of the important cholesterogenic enzyme 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase and the low density lipoprotein (LDL) binding activity both increase significantly in the normal cell.Both these increases were much less in the mutant cell.Studies in vitro with NaF indicate that the differences in reductase activities between normal and mutant cells are not due to differences in activation by a dephosphorylation mechanism.Heat inactivation profiles and K, for HMG-CoA of both cell reductases were found to be identical, thus reducing the possibility that the mutant cell contains a mutation in the polypeptide chain of reductase.The fact that in lipid-deficient medium both reductase and LDL binding activities are low in the mutant strongly suggests that the expression of these activities is controlled in a coordinate manner.This conclusion is supported by parallel studies on a spontaneous revertant of the mutant in which the expression of reductase and LDL binding activities have both reverted to normal.These results indicate that the phenotypic abnormalities seen in the mutant are probably caused by a single mutation.A common factor is postulated to mediate this coordinate expression, and the function of such a factor is altered in the mutant cell.Cell mutants are useful biological tools for unraveling important metabolic events.A recent example is the work by Goldstein and Brown (for reviews, see Refs. 1 and 2) using cultured human fibroblasts from normal subjects and patients with familial hypercholesterolemia to elucidate the low density lipoprotein receptor pathway.Normal cultured cells take up LDL' from the serum in the medium and, thus, keep the

Mammalian cells synthesize various sterol molecules, including the C30 sterol, lanosterol, as cholesterol precursors in the endoplasmic reticulum. The build-up of precursor sterols, including lanosterol, displays cellular toxicity. Precursor sterols are found in plasma HDL. How these structurally different sterols are released from cells is poorly understood. Here, we show that newly synthesized precursor sterols arriving at the plasma membrane (PM) are removed by extracellular apoA-I in a manner dependent on ABCA1, a key macromolecule for HDL biogenesis. Analysis of sterol molecules by GC-MS and tracing the fate of radiolabeled acetate-derived sterols in normal and mutant Niemann-Pick type C cells reveal that ABCA1 prefers newly synthesized sterols, especially lanosterol, as the substrates before they are internalized from the PM. We also show that ABCA1 resides in a cholesterol-rich membrane domain resistant to the mild detergent, Brij 98. Blocking ACAT activity increases the cholesterol contents of this domain. Newly synthesized C29/C30 sterols are transiently enriched within this domain, but rapidly disappear from this domain with a half-life of less than 1 h. Our work shows that substantial amounts of precursor sterols are transported to a certain PM domain and are removed by the ABCA1-dependent pathway.

Macrophages in atherosclerotic lesions accumulate large amounts of cholesteryl-fatty acyl esters ("foam cell" formation) through the intracellular esterification of cholesterol by acyl-coenzyme A:cholesterol<i>O</i>-acyltransferase (ACAT). In this study, we sought to determine the subcellular localization of ACAT in macrophages. Using mouse peritoneal macrophages and immunofluorescence microscopy, we found that a major portion of ACAT was in a dense reticular cytoplasmic network and in the nuclear membrane that colocalized with the luminal endoplasmic reticulum marker protein-disulfide isomerase (PDI) and that was in a similar distribution as the membrane-bound endoplasmic reticulum marker ribophorin. Remarkably, another portion of the macrophage ACAT pattern did not overlap with PDI or ribophorin, but was found in as yet unidentified cytoplasmic structures that were juxtaposed to the nucleus. Compartments containing labeled β-very low density lipoprotein, an atherogenic lipoprotein, did not overlap with the ACAT label, but rather were embedded in the dense reticular network of ACAT. Furthermore, cell-surface biotinylation experiments revealed that freshly harvested, non-attached macrophages, but not those attached to tissue culture dishes, contained ∼10–15% of ACAT on the cell surface. In summary, ACAT was found in several sites in macrophages: a cytoplasmic reticular/nuclear membrane site that overlaps with PDI and ribophorin and has the characteristics of the endoplasmic reticulum, a perinuclear cytoplasmic site that does not overlap with PDI or ribophorin and may be another cytoplasmic structure or possibly a unique subcompartment of the endoplasmic reticulum, and a cell-surface site in non-attached macrophages. Understanding possible physiological differences of ACAT in these locations may reveal an important component of ACAT regulation and macrophage foam cell formation.

Niemann-Pick type C1 disease (NPC1) is an inherited neurovisceral lipid storage disorder, hallmarked by the intracellular accumulation of unesterified cholesterol and glycolipids in endocytic organelles. Cells acquire cholesterol through exogenous uptake and endogenous biosynthesis. NPC1 participation in the trafficking of LDL-derived cholesterol has been well studied; however, its role in the trafficking of endogenously synthesized cholesterol (endoCHOL) has received much less attention. Previously, using mutant Chinese hamster ovary cells, we showed that endoCHOL moves from the endoplasmic reticulum (ER) to the plasma membrane (PM) independent of NPC1. After arriving at the PM, it moves between the PM and internal compartments. The movement of endoCHOL from internal membranes back to the PM and the ER for esterification was shown to be defective in NPC1 cells. To test the generality of these findings, we have examined the trafficking of endoCHOL in four different physiologically relevant cell types isolated from wild-type, heterozygous, and homozygous BALB/c NPC1^NIH mice. The results show that all NPC1 homozygous cell types (embryonic fibroblasts, peritoneal macrophages, hepatocytes, and cerebellar glial cells) exhibit partial trafficking defects, with macrophages and glial cells most prominently affected. Our findings suggest that endoCHOL may contribute significantly to the overall cholesterol accumulation observed in selective tissues affected by Niemann-Pick type C disease.

To visualize the intracellular transport of plasma membrane-derived cholesterol under physiological and pathophysiological conditions, a novel fluorescent cholesterol analog, 6-dansyl cholestanol (DChol), has been synthesized. We present several lines of evidence that DChol mimics cholesterol. The cholesterol probe could be efficiently incorporated into the plasma membrane via cyclodextrin-donor complexes. The itinerary of DChol from the plasma membrane to the cell was studied to determine its dependence on the function of Niemann-Pick C1 (NPC) protein. In all cells, DChol moved from the plasma membrane to the endoplasmic reticulum. Its further transport to the Golgi complex was observed but with marked differences among various cell lines. DChol was finally transported to small (approximately 0.5 microm diameter) lipid droplets, a process that required functional acyl-CoA:cholesterol acyltransferase. In human NPC fibroblasts, NPC-like cells, or in cells mimicking the NPC phenotype, DChol was found in enlarged (>1 microm diameter) droplets. When the NPC-phenotype was corrected by transfection with NPC1, DChol was again found in small-sized droplets. Our data show that NPC1 has an essential role in the distribution of plasma membrane-derived cholesterol by maintaining the small size of cholesterol-containing lipid droplets in the cell.

Acyl-CoA:cholesterol acyltransferase (ACAT) catalyzes the formation of cholesteryl esters from cholesterol and long-chain fatty-acyl-coenzyme A. At the single-cell level, ACAT serves as a regulator of intracellular cholesterol homeostasis. In addition, ACAT supplies cholesteryl esters for lipoprotein assembly in the liver and small intestine. Under pathological conditions, the accumulation of cholesteryl esters produced by ACAT in macrophages contributes to foam cell formation, a hallmark of the early stage of atherosclerosis. Several reviews addressing various aspects of ACAT and ACAT inhibitors are available. This review briefly outlines the current knowledge on the biochemical properties of human ACATs, and then focuses on discussing the merit of ACAT as a drug target for pharmaceutical interventions against atherosclerosis.

Cell swelling takes place rapidly when animal cells in monolayer culture are treated with hypotonic buffer in situ; scraping of the swollen cells causes virtually 100% cell lysis. Because this procedure avoids the use of scraping and centrifugation to collect the cells and the use of Dounce homogenizers for cell disruption, recovery of the cell extract is very high. 3-Hydroxy-3-methylglutaryl coenzyme A reductase activities of cell extracts prepared by this method are virtually identical to those prepared by the conventional procedure involving Dounce homogenization.

Macrophages are phagocytes that play important roles in health and diseases. Acyl-CoA:cholesterol acyltransferase 1 (ACAT1) converts cellular cholesterol to cholesteryl esters and is expressed in many cell types. Unlike global Acat1 knockout (KO), myeloid-specific Acat1 KO ( Acat1-) does not cause overt abnormalities in mice. Here, we performed analyses in age- and sex-matched Acat1-M/-M and wild-type mice on chow or Western diet and discovered that Acat1-M/-M mice exhibit resistance to Western diet-induced obesity. On both chow and Western diets, Acat1-M/-M mice display decreased adipocyte size and increased insulin sensitivity. When fed with Western diet, Acat1-M/-M mice contain fewer infiltrating macrophages in white adipose tissue (WAT), with significantly diminished inflammatory phenotype. Without Acat1, the Ly6Chi monocytes express reduced levels of integrin-β1, which plays a key role in the interaction between monocytes and the inflamed endothelium. Adoptive transfer experiment showed that the appearance of leukocytes from Acat1-M/-M mice to the inflamed WAT of wild-type mice is significantly diminished. Under Western diet, Acat1-M/-M causes suppression of multiple proinflammatory genes in WAT. Cell culture experiments show that in RAW 264.7 macrophages, inhibiting ACAT1 with a small-molecule ACAT1-specific inhibitor reduces inflammatory responses to lipopolysaccharide. We conclude that under Western diet, blocking ACAT1 in macrophages attenuates inflammation in WAT. Other results show that Acat1-M/-M does not compromise antiviral immune response. Our work reveals that blocking ACAT1 suppresses diet-induced obesity in part by slowing down monocyte infiltration to WAT as well as by reducing the inflammatory responses of adipose tissue macrophages.

Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is an intracellular enzyme involved in cellular cholesterol homeostasis and in atherosclerotic foam cell formation. HumanACAT-1 gene contains two promoters (P1 and P7), each located in a different chromosome (1 and 7) (Li, B. L., Li, X. L., Duan, Z. J., Lee, O., Lin, S., Ma, Z. M., Chang, C. C., Yang, X. Y., Park, J. P., Mohandas, T. K., Noll, W., Chan, L., and Chang, T. Y. (1999) J. Biol Chem. 274, 11060–11071). Interferon-γ (IFN-γ), a cytokine that exerts many pro-atherosclerotic effects in vivo, causes up-regulation of ACAT-1 mRNA in human blood monocyte-derived macrophages and macrophage-like cells but not in other cell types. To examine the molecular nature of this observation, we identified within the ACAT-1 P1 promoter a 159-base pair core region. This region contains 4 Sp1 elements and an IFN-γ activated sequence (GAS) that overlaps with the second Sp1 element. In the monocytic cell line THP-1 cell, the combination of IFN-γ and all-trans-retinoic acid (a known differentiation agent) enhances the ACAT-1 P1 promoter but not the P7 promoter. Additional experiments showed that all-trans-retinoic acid causes large induction of the transcription factor STAT1, while IFN-γ causes activation of STAT1 such that it binds to the GAS/Sp1 site in the ACAT-1 P1 promoter. Our work provides a molecular mechanism to account for the effect of IFN-γ in causing transcriptional activation ofACAT-1 in macrophage-like cells. Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is an intracellular enzyme involved in cellular cholesterol homeostasis and in atherosclerotic foam cell formation. HumanACAT-1 gene contains two promoters (P1 and P7), each located in a different chromosome (1 and 7) (Li, B. L., Li, X. L., Duan, Z. J., Lee, O., Lin, S., Ma, Z. M., Chang, C. C., Yang, X. Y., Park, J. P., Mohandas, T. K., Noll, W., Chan, L., and Chang, T. Y. (1999) J. Biol Chem. 274, 11060–11071). Interferon-γ (IFN-γ), a cytokine that exerts many pro-atherosclerotic effects in vivo, causes up-regulation of ACAT-1 mRNA in human blood monocyte-derived macrophages and macrophage-like cells but not in other cell types. To examine the molecular nature of this observation, we identified within the ACAT-1 P1 promoter a 159-base pair core region. This region contains 4 Sp1 elements and an IFN-γ activated sequence (GAS) that overlaps with the second Sp1 element. In the monocytic cell line THP-1 cell, the combination of IFN-γ and all-trans-retinoic acid (a known differentiation agent) enhances the ACAT-1 P1 promoter but not the P7 promoter. Additional experiments showed that all-trans-retinoic acid causes large induction of the transcription factor STAT1, while IFN-γ causes activation of STAT1 such that it binds to the GAS/Sp1 site in the ACAT-1 P1 promoter. Our work provides a molecular mechanism to account for the effect of IFN-γ in causing transcriptional activation ofACAT-1 in macrophage-like cells. acyl-coenzyme A:cholesterol acyltransferase base pair(s) IFN-γ activated sequence interferon-gamma all-trans-retinoic acid 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate fetal bovine serum phosphate-buffered saline electrophoretic mobility shift assays reverse transcriptase-polymerase chain reaction glyceraldehyde-3-phosphate dehydrogenase kelonucleotides ACAT1 is an intracellular enzyme responsible for catalyzing the intracellular formation of cholesteryl esters from cholesterol and long-chain fatty acyl-coenzyme A (1Chang T.Y. Chang C.C.Y. Cheng D. Annu. Rev. Biochem. 1997; 66: 613-638Crossref PubMed Scopus (450) Google Scholar). In mammals, two ACAT genes have been identified (2Chang C.C.Y. Huh H.Y. Cadigan K.M. Chang T.Y. J. Biol. Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar, 3Anderson R.A. Joyce C. Davis M. Reagan J.W. Clark M. Shelness G.S. Rudel L.L. J. Biol. Chem. 1998; 273: 26747-26754Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar, 4Cases S. Novak S. Zheng Y.W. Myers H.M. Lear S.R. Sande E. Welch C.B. Lusis A.J. Spencer T.A. Krause B.R. Erickson S.K. Farese Jr., R.V. J. Biol. Chem. 1998; 273: 26755-26764Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 5Oelkers P. Behari A. Cromley D. Billheimer J.T. Sturley S.L. J. Biol. Chem. 1998; 273: 26765-26771Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar). In adult human tissues, ACAT-1 is the major enzyme present in various tissues, including macrophages, liver (hepatocytes and Kupffer cells), and adrenal gland (6Lee O. Chang C.C. Lee W. Chang T.Y. J. Lipid Res. 1998; 39: 1722-1727Abstract Full Text Full Text PDF PubMed Google Scholar, 7Chang C.C. Sakashita N. Ornvold K. Lee O. Chang E.T. Dong R. Lin S. Lee C.Y. Strom S.C. Kashyap R. Fung J.J. Farese Jr., R.V. Patoiseau J.F. Delhon A. Chang T.Y. J. Biol. Chem. 2000; 275: 28083-28092Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar). ACAT-1 is also present in the intestine; however, the major enzyme involved in the intestinal cholesterol absorption may be ACAT-2, which is mainly located in the apical region of the intestinal villi (7Chang C.C. Sakashita N. Ornvold K. Lee O. Chang E.T. Dong R. Lin S. Lee C.Y. Strom S.C. Kashyap R. Fung J.J. Farese Jr., R.V. Patoiseau J.F. Delhon A. Chang T.Y. J. Biol. Chem. 2000; 275: 28083-28092Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar). The relative tissue distributions of ACAT-1 and ACAT-2 in mice and monkeys are not entirely consistent with those found in humans (8Buhman K.K. Accad M. Novak S. Choi R.S. Wong J.S. Hamilton R.L. Turley S. Farese Jr., R.V. Nat. Med. 2000; 6: 1341-1347Crossref PubMed Scopus (300) Google Scholar, 9Lee R.G. Willingham M.C. Davis M.A. Skinner K.A. Rudel L.L. J. Lipid Res. 2000; 41: 1991-2001Abstract Full Text Full Text PDF PubMed Google Scholar) raising the possibility that the distribution of the two ACATs in various tissues may be species dependent. In macrophages and other cell types, a dynamic cholesterol-cholesteryl ester cycle exist; the formation of intracellular cholesteryl esters is catalyzed by ACAT-1, while the hydrolysis of cholesteryl esters is catalyzed by the enzyme neutral cholesteryl ester hydrolase (10Brown M.S. Goldstein J.L. Annu. Rev. Biochem. 1983; 52: 223-261Crossref PubMed Google Scholar, 11Fielding C.J. FASEB J. 1992; 6: 3162-3168Crossref PubMed Scopus (56) Google Scholar). The net accumulation of intracellular cholesteryl esters is affected at the substrate level, as well as at the levels of the enzymes ACAT and neutral cholesteryl ester hydrolase (12Panousis C.G. Zuckerman S.H. J. Lipid Res. 2000; 41: 75-83Abstract Full Text Full Text PDF PubMed Google Scholar, 13Ross R. Nature. 1993; 362: 801-809Crossref PubMed Scopus (10064) Google Scholar, 14Brown M.S. Ho Y.K. Goldstein J.L. J. Biol. Chem. 1980; 255: 9344-9352Abstract Full Text PDF PubMed Google Scholar). The main mode of sterol-specific regulation of ACAT-1 has been identified at the post-translational level, involving allosteric regulation by its substrate cholesterol (1Chang T.Y. Chang C.C.Y. Cheng D. Annu. Rev. Biochem. 1997; 66: 613-638Crossref PubMed Scopus (450) Google Scholar, 15Chang C.C. Lee C.Y. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). On the other hand, the cellular and molecular nature of non-sterol-mediated ACAT-1 regulation remains largely unknown. Recently, using mouse macrophage-derived foam cells, Panousis and Zuckerman (12Panousis C.G. Zuckerman S.H. J. Lipid Res. 2000; 41: 75-83Abstract Full Text Full Text PDF PubMed Google Scholar) reported that IFN-γ increased the cellular cholesteryl ester content and reduced high density lipoprotein-mediated cholesterol efflux; its cellular effects were attributed to its ability to increaseACAT-1 message (12Panousis C.G. Zuckerman S.H. J. Lipid Res. 2000; 41: 75-83Abstract Full Text Full Text PDF PubMed Google Scholar) and to induce down-regulation of the Tangier Disease gene (the ABC1 transporter) (16Panousis C.G. Zuckerman S.H. Arterioscler. Thromb. Vasc. Biol. 2000; 20: 1565-1571Crossref PubMed Scopus (113) Google Scholar). In the current work, we showed that IFN-γ increased ACAT-1 message and protein content in human monocyte-derived macrophages. To examine the molecular mechanism of IFN-γ action on ACAT-1 gene regulation in macrophages, we identified the important cis-acting elements in the human ACAT-1 P1 promoter. In order to perform transient transfection experiments, we used THP-1 cell, a monocytic human cell line as the cell model. Upon treatment with retinoids, including all-trans-retinoic acid (ATRA), THP-1 cells differentiate into macrophage-like cells (17Banka C.L. Black A.S. Dyer C.A. Curtiss L.K. J. Lipid Res. 1991; 32: 35-43Abstract Full Text PDF PubMed Google Scholar, 18Alessio M. Monte L.De. Scirea A. Gruarin P. Tandon N.N. Sitia R. J. Biol. Chem. 1996; 271: 1770-1775Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 19Tontonoz P.L. Nagy J.G. Alvalez A. Thomazy V.A. Evans R.M. Cell. 1998; 93: 241-252Abstract Full Text Full Text PDF PubMed Scopus (1632) Google Scholar, 20Shiffman D. Mikita T. Tai J.T. Wade D.P. Porter J.G. Seilhamer J.J. Somogyi R. Liang S. Lawn R.M. J. Biol. Chem. 2000; 275: 37324-37332Abstract Full Text Full Text PDF PubMed Scopus (114) Google Scholar). Our results show that ATRA and IFN-γ synergistically caused up-regulation of ACAT-1 gene expression. Additional experiments revealed that ATRA causes increased gene expression of the transcription factor STAT1, while IFN-γ is essential to cause STAT1 to undergo phosphorylation dependent dimerization and to bind to the GAS site present in theACAT-1 P1 promoter. Human monocytes were isolated according to a published procedure (21Cheng W. Kvilekval K.V. Abumrad N.A. Am. J. Physiol. 1995; 269: E642-648Crossref PubMed Google Scholar) with slight modification: human leukocyte packs were obtained from Shanghai Blood Service Center and used within 1 day. The cells were diluted (2:1, v/v) with cold phosphate-buffered saline (PBS), layered on an equal volume of Ficoll-Paque (Amersham Pharmacia Biotech), and centrifuged for 20 min at 2,500 rpm at room temperature. Mononuclear cells were collected and washed three times at 4 °C (to remove platelets) by adding 100 ml of PBS followed by centrifugation at 1,000 rpm for 10 min. The remaining red blood cells in the pellet were lysed by treatment with 10 ml of 0.2% NaCl for 45 s, followed by sequential additions of 10 ml of 1.6% NaCl and 30 ml of cold PBS. The pelleted cells were suspended in cold RPMI 1640 with 7% human type AB serum to a density of 5 × 106/ml, plated onto 60-mm tissue culture dishes that were precoated with 2 ml/dish of FBS, and incubated for 90 min at 37 °C. Next, the dishes were washed three times with warm RPMI 1640 (37 °C) to remove unadhered cells. The adhered cells were judged to be more than 95% monocytes by α-naphthylacetate esterase staining. The cells were cultured for up to 16 days in RPMI 1640 medium supplemented with 7% human type AB serum, with a medium change every other day. Other cell lines were from ATCC. Cells were incubated 60-mm dishes in a 37 °C incubator with 5% atmospheric CO2. All media were supplemented with 100 μg/ml kanamycin, 50 units/ml streptomycin, 2 g/liters sodium bicarbonate, plus 10% fetal bovine serum (FBS). THP-1 and U937 cells were grown in RPMI 1640 medium. HepG2 and Caco-2 cells were grown in Dulbecco's modified Eagle's medium. HEK293 cells were grown in minimal essential medium medium. Chinese hamster ovary cell lines AC29 and 25RA (22Cadigan K.M. Chang T.Y. J. Lipid Res. 1988; 29: 1683-1692Abstract Full Text PDF PubMed Google Scholar, 23Chang T.Y. Limanek J.S. J. Biol. Chem. 1980; 255: 7787-7795Abstract Full Text PDF PubMed Google Scholar) were grown in F12 medium. Human type AB serum was from Sigma. Fetal bovine serum was obtained from Life Technologies, Inc. (Life Technologies, Grand Island, NY). Purified recombinant human IFN-γ (1 × 107 units/mg of protein) was a generous gift from Professor Xin-yuan Liu (24Jiang C.L. Lu C.L. Chen Y.Z. Liu X.Y. Peptides. 1999; 20: 1385-1388Crossref PubMed Scopus (3) Google Scholar) at the Shanghai Institute of Biochemistry and Cell Biology. ATRA was from Sigma. Rabbit anti-Sp1 (PEP2, catalog number sc-59-G, 200 μg/ml) and anti-STAT1 (C-111, catalog number sc-417, 200 μg/ml) polyclonal antibodies were from Santa Cruz Biotechnology. [α-32P]- and [γ-32P]dATP (6000 Ci/mmol) were from Amersham Pharmacia Biotech. CHAPS, taurocholate, oleoyl-coenzyme A, egg phosphatidycholine, cholesteryl oleate, cholesterol, and fatty acid-free bovine serum albumin were all from Sigma. Reagent-grade solvents were from Fisher. [3H]Oleoyl-coenzyme A was chemically synthesized as described (25Bishop J.E. Hajra A.K. Anal. Biochem. 1980; 106: 344-350Crossref PubMed Scopus (80) Google Scholar). Radioactive reagents were from Amersham Pharmacia Biotech. The 632-bp DNA fragment containing the human ACAT-1 P1 promoter (−598/+34) (26Li B.L. Li X.L. Duan Z.J. Lee O. Lin S. Ma Z.M. Chang C.C. Yang X.Y. Park J.P. Mohandas T.K. Noll W. Chan L. Chang T.Y. J. Biol. Chem. 1999; 274: 11060-11071Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar) was inserted into the multiple cloning sites of the luciferase reporter gene vector pGL2-E (Promega). This fragment was stepwise deleted from both ends by various suitable restriction endonucleases to create plasmids that contained the −324/+34, −188/+34, −125/+34, −598/−126, and the −598/−189 fragments, respectively. Deletions were achieved by PCR-mediated mutagenesis using the corresponding set of mutant primers that included a 6-bp KpnI or NheI linker flanking the primer sequences on the vector. The primer sequences on the vector are: GLP1, 5′-TGTATCTTATGGTACTGTAACTG-3′; GLP2, 5′-CTTTATGTTTTTGGCGTCTTCCA-3′. The primers used to make 5′- and 3′-deletion mutations (to generate the −110/+34, −100/+34, −100/−7, −100/−17, and the −100/−27 fragments) were 5′-aaaggtaccGGTGGGCGGAAC-3′, 5′-aaaggtaccACTGGCAACCTG-3′, 5′-aaagctagCCGGCCCCTACGC-3′, 5′-aaagctagCGCCCCCTGCCTC-3′, and 5′-aaagctagCTCCGAGCACCGC-3′, respectively. The PCR products were then digested with KpnI and NheI and subcloned into an empty pGL2-E vector. The fidelity of all these constructs was verified by sequencing. Site-directed mutagenesis was undertaken using a modification of the procedure described by Ho et al. (27Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene ( Amst .). 1989; 77: 51-59Crossref PubMed Scopus (6963) Google Scholar). Briefly, two overlapping fragments of the promoter subcloned into the pGL2-E vector were amplified separately. The first reaction used a flanking primer that hybridized with the vector at the 5′-end of the inserted sequence, and an internal primer that hybridized at the site of the desired mutation and contained the mismatched base. The second reaction included one flanking primer that hybridized with the vector at the 3′-end of the inserted sequence, and an internal primer that overlapped with the site of the desired mutation and also contained the mismatched base. The two overlapping fragments generated by PCR are “fused” by denaturing and annealing in a subsequent primer extension reaction. Finally the “fusion” product was amplified by PCR using the primers GLP1 and GLP2. The product of the final PCR was digested with KpnI and NheI and subcloned into the pGL2-E vector. To guard against PCR-associated nucleotide incorporation errors, the integrity of all the constructs generated was sequenced using an automated ABI Prism 377 DNA sequencer (Perkin-Elmer Applied Biosystems, Canada Inc., Mississaug, ON). To generate the fragments Sp1–1m, Sp1–2m, Sp1–3m, Sp1–4m, and GASm, respectively, the following sets of primer pairs were used: 5′-CCTCCCCGTTCCGGTACCTCCCC-3′/5′-GGGGAGGTACCGGAACGGGGAGG-3′, 5′-CAGTTCCGTTCACCTCCCCGCC-3′/5′-GGCGGGGAGGTGAACGGAACTG-3′, 5′-GAGGCAGGAAGCGTAGGGGCCG-3′/5′-CGGCCCCTACGCTTCCTGCCTC-3′, 5′-GGGCGTAGAAGCCGGGCTGTCC-3′/5′-GGACAGCCCGGCTTCTACGCCC-3′, 5′-GTTGCCAGCCCCGCCCACCTCC-3′/5′-GGAGGTGGGCGGGGCTGGCAAC-3′. For additional mutagenesis work, we used Sp1–1m as the template and 5′-CAGTTCCGTTCACCTCCCCGTT-3′/5′-AACGGGGAGGTGAACGGAACTG-3′ as the primer pair to generate Sp1–12m, used Sp1–12m as the template and 5′-GAGGCAGGAAGCGTAGGGGCCG-3′/5′-CGGCCCCTACGCTTCCTGCCTC-3′ as the primer pair to generate Sp1–123m, used Sp1–123m as the template and 5′-AAGCGTAGAAGCCGGGCTGTCC-3′/5′-GGACAGCCCGGCTTCTACGCTT-3′ as the primer pair to generate Sp1–1234m. The humanSTAT1 cDNA (encoding the 750 amino acids of STAT1 protein) in pRC/CMV (pRC/CMV-STAT1) was a gift from Dr. Darnell (Rockefeller University). The mutant STAT1 expression plasmid was created using the site-directed mutagenesis procedure of Hoet al. (27Ho S.N. Hunt H.D. Horton R.M. Pullen J.K. Pease L.R. Gene ( Amst .). 1989; 77: 51-59Crossref PubMed Scopus (6963) Google Scholar). Two sets of primers 5′-GGAGAGAAGCTTCTTGGT-3′/5′-CTGAAGTCTAGAAGGGTG-3′ and 5′-AAGGAACTGGATTTATCAAGACTGA-3′/5′-TCAGTCTTGATAAATCCAGTTCCTT-3′ were used to mutate STAT1 at amino acid 701 (the Jak1/2 phosphorylation site) from tyrosine to phenylalanine (28Vinkemeier U. Cohen S.L. Moarefi I. Chait B.T. Kuriyan J. Darnell Jr., J.E. EMBO J. 1996; 15: 5616-5626Crossref PubMed Scopus (254) Google Scholar). The expression plasmid pRC/CMV-STAT1-Y701Fm was constructed by inserting the mutant PCR product digested with HindIII/XbaI into the same sites of pRC/CMV. A series ofACAT-1 P1 promoter/luciferase reporter (Luc) constructs were transfected into THP-1 or U937 cells using the DEAE-dextran method (29Powell J.T. Klaasse Bos J.M. van Mourik J.A. FEBS Lett. 1992; 303: 173-177Crossref PubMed Scopus (10) Google Scholar,30Mack K.D. Wei R. Elbagarri A. Abbey N. McGrath M.S. J. Immunol. Methods. 1998; 211: 79-86Crossref PubMed Scopus (53) Google Scholar). After washing twice with PBS, 1 × 106cells were transfected with 1.5 μg of ACAT-1 promoter/Luc plasmid and 0.75 μg pCH110 as internal control in 1 ml of STBE (25 mm Tris-HCl, pH 7.4, 5 mm KCl, 0.7 mm CaCl2, 137 mm NaCl, 0.6 mm Na2HPO4, 0.5 mmMgCl2) containing 150 μg of DEAE-dextran. The cells were incubated for 20 min at 37 °C, washed once with RPMI 1640 without FBS, then resuspended in 5 ml of fresh RPMI 1640 with 10% FBS, and plated at 2 × 105 cells/ml/well in a 24-well plate for 40 h. HepG2, CACO-2, and HEK293 cells were transfected by the methods of calcium phosphate co-precipitation essentially as described by Liu et al. (31Liu J. Streiff R. Zhang Y.L. Vestal R.E. Spence M.J. Briggs M.R. J. Lipid Res. 1997; 38: 2035-2048Abstract Full Text PDF PubMed Google Scholar). Briefly, cells were plated at 1 × 105 cells/well in 1 ml of medium in 24-well tissue culture plates 1 day before transfection. One h before transfection, cells were replaced with fresh medium. Calcium phosphate precipitates containing (per well) 0.3 μg of ACAT-1 promoter/Luc and 0.15 μg of pCH110 were prepared. The DNA/calcium phosphate precipitates were incubated with the cells at 37 °C for 8 h, after which time the cells were washed once with PBS, and replaced with Dulbecco's modified Eagle's medium or minimal essential medium containing 10% FBS. After incubation for 7 h, cells were treated with or without IFN-γ (100 units/ml), or ATRA (10−6m), or IFN-γ (100 units/ml) plus ATRA (10−6m). 40 h later, the cells were harvested and the cell pellets were lysed in 200 μl of lysis buffer (Reporter lysis buffer, Promega, catalog number E397A), vortexed for 5 s, and spun at 2000 × gfor 5 min at room temperature. 60 μl of the cell lysate was mixed with 60 μl of luciferase assay buffer (Promega) for luciferase activity measurement (Promega Instruction Bulletin Part number TB101) in an Auto Lumat BG-P luminometer (MGM Instrument Inc.). For β-galactosidase activity assay, the luminescent β-galactosidase detection Kit II was used (CLONTECH User Manual PT2106-1). The total RNA (4 μg) prepared according to the single step acid guanidinium thiocyanate phenol chloroform method (Trizol Regent, Life Technologies, Inc.) was annealed with 1 μg of oligo(dT) (12–18 in length) in a total volume of 20 μl and reverse transcribed with 5 units of avian myeloblastosis virus reverse transcriptase (Life Technologies, Inc.) at 42 °C for 50 min, and then diluted to a volume of 80 μl as the ss-cDNA product. The 4 μl of diluted ss-cDNA product was added to a reaction mixture in a final volume of 20 μl containing 10 mm Tris-HCl (pH 8.3), 50 mm KCl, 1.5 mm MgCl2, 0.5 mm dNTP, 0.5 mm each pair of primers, and 1 unit of Taq DNA polymerase (Life Technologies, Inc.). To serve as controls, GAPDH gene expression was assessed to ascertain that equal amounts of cDNA were added to each PCR. The PCR products (10 μl), taken at several different cycles (from 26 to 32), were separated in agarose gel and quantified by using the UVP Labwork Software (UVP Inc.). The sets of primers used are 5′-AAAGGAGTCCCTAGAG-3′/5′-GGATGAGAACTCTTGC-3′ for ACAT-1 P1 product (hACAT-1 cDNA K1 1486–2043, amplifying a 558-bp fragment), 5′-ACCCACCATTATCTAA-3′/5′-ACCCACCATTATCTAA-3′ for humanACAT-1 P7 product (hACAT-1 cDNA K1 982–1670, amplifying a 689-bp fragment) (2Chang C.C.Y. Huh H.Y. Cadigan K.M. Chang T.Y. J. Biol. Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar, 26Li B.L. Li X.L. Duan Z.J. Lee O. Lin S. Ma Z.M. Chang C.C. Yang X.Y. Park J.P. Mohandas T.K. Noll W. Chan L. Chang T.Y. J. Biol. Chem. 1999; 274: 11060-11071Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar), 5′-GCCCGACCCTATTACAAAAA-3′/5′-CTGCCAACTCAACACCTCTG-3′ for STAT1 coding sequence (amplifying a 646-bp fragment) (32Sakamoto S. Nie J. Taniguchi T. J. Immunol. 1999; 162: 4381-4384PubMed Google Scholar) and 5′-GAGTCAACGGATTTGGTCG-3′/5′-GAAGTGGTGGTACCTCTTCC-3′ for GAPDH (amplifying a 291-bp fragment) (32Sakamoto S. Nie J. Taniguchi T. J. Immunol. 1999; 162: 4381-4384PubMed Google Scholar). Nuclear extract was prepared as described (33Andrews N.C. Faller D.V. Nucleic Acids Res. 1991; 19: 2499Crossref PubMed Scopus (2229) Google Scholar). THP-1 cells were harvested and washed twice with cold PBS at 4 °C, and resuspended gently in 400 μl of buffer A (10 mm HEPES, pH 7.9, 10 mmKCl, 1.5 mm MgCl2, 0.5 mmdithiothreitol, 0.2 mm phenylmethylsulfonyl fluoride), and stored on ice for 10 min, then vortexed for 10 s. Nuclei were pelleted (10,000 × g, 10 s), resuspended with ice-cold buffer C (20 mm HEPES, pH 7.9, 25% glycerol, 420 mm NaCl, 1.5 mm MgCl2, 1 mm EDTA, 0.5 mm dithiothreitol, 0.2 mm phenylmethylsulfonyl fluoride), and incubated on ice for 20 min. The mixture was subjected to centrifugation (10,000 ×g) for 2 min at 4 °C, and the supernatant as nuclear extract was stored in aliquots at −80 °C. For EMSA, 10 μg of protein of nuclear extract was incubated for 10 min on ice in 10 μl of binding buffer (10 mm Tris-HCl, pH 7.5, 1 mmMgCl2, 4% glycerol, 50 mm NaCl, 0.5 mm dithiothreitol, 0.5 mm EDTA, and 3 μg of poly(dI)-(dC) from Amersham Pharmacia Biotech Inc.). DNA probes were labeled using T4 polynucleotide kinase (Promega) and [γ-32P]dATP. 1 ng of labeled probe (∼1 × 104 dpm) was added to the binding reaction mixture and incubated at 25 °C for 30 min. For “supershift” analyses, 1 μl of each antibody as indicated was added and incubated 30 min at 25 °C before adding the probe. Binding reactions were size fractionated on a nondenaturing 4.5% acrylamide gel (29:1, mass:mass, acrylamide:N,N′-methylenebisacrylamide), ran at 200 V for 3 h in 0.5 × TBE buffer. The gel was dried and autoradiographed with PhosphorImager scanning system. THP-1 cells were cultured at 2 × 105/ml in 60-mm dishes. Human blood monocytes were cultured at 1.5 × 106/60-mm dishes. Cells were treated with IFN-γ as indicated for 40 h before harvest. The preparation of total RNA was according to the single step acid guanidinium thiocyanate phenol chloroform method (Trizol Regent, Life Technologies, Inc.). Total RNA, 20 μg/sample, were electrophoresed in a 1% agarose gel containing 2.2 m formaldehyde and transferred to a Nytran membrane (Schleicher and Schuell, Dassel, Germany) with 3.0m sodium chloride, 0.3 m sodium citrate (20 × SSC) as the transfer buffer. The membrane was cross-linked by UV irradiation and incubated for 10 min at 65 °C in 0.5m sodium phosphate buffer (pH 7.2), 7% SDS, 1 mm EDTA (prehybridization buffer). The polymerase chain reaction products of human ACAT-1 cDNA (1486–2686, 1.2-kilobases) and human GAPDH cDNA (291-bp) were used as templates for labeling probes. Labeled probes were made with [α-32P]dATP by the random primer method using a Random-labeling Kit (Promega). Blots were prehybridized and hybridized with labeled probes and washed under high stringency conditions. Hybridization was carried out at 65 °C in the same solution as prehybridization, except for the addition of labeled probe. The membrane was washed with 40 mm sodium phosphate buffer (pH 7.2), 0.1% SDS at room temperature for 5 min three times, and at 65 °C for 20 min. After washing, the membrane was exposed and the intensity of the bands was quantified by densitometric analysis using the UVP Labwork software (UVP Inc.). To serve as control, rehybridization of the same blot with the human GAPDH probe was carried out. The sample mRNA expression levels were normalized by the intensity of the human GAPDH mRNA bands. Cells were harvested with 10% SDS in 50 mm Tris, 1 mm EDTA (pH 7.5) with 25 mm dithiothreitol, and incubated at 37 °C for 20 min, then sheared with a syringe fitted with an 18-gauge needle. Protein concentration of the cell extract was determined by a modified Lowry method (34Oosta G.M. Mathewson N.S. Catravas G.N. Anal. Biochem. 1978; 89: 31-34Crossref PubMed Scopus (34) Google Scholar). The affinity purified anti-ACAT-1 IgGs (designated as DM10) was used as the primary antibodies against ACAT-1 (35Chang C.C. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). Western blots, using freshly prepared cell extracts in SDS, were conducted according to a previously described procedure (35Chang C.C. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). The assay was performed essentially as described previously (15Chang C.C. Lee C.Y. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 35Chang C.C. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). AC29, 25RA, and THP-1 cells were cultured at 2 × 105/ml in 60-mm dishes and then treated in various manners for 40 h as indicated. The ACAT-1-deficient mutant cell line AC29, and its parental cell 25RA derived from Chinese hamster ovary cells (2Chang C.C.Y. Huh H.Y. Cadigan K.M. Chang T.Y. J. Biol. Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar, 15Chang C.C. Lee C.Y. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 35Chang C.C. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar) were used to ensure that the ACAT activity assayed in vitro work properly. For THP-1 cells, the suspended and adherent cells were collected by direct centrifugation and scrapping, respectively, at room temperature. The two groups of cells collected from the same dish were pooled together, washed with PBS once, and centrifuged to collect the cell pellets. Cold 1 mm Tris, 1 mm EDTA (pH 7.8), at 100 μl/sample, was added to cell pellet chilled on ice. The mixtures were left on ice for 5 min. Brief but vigorous vortexing (30 s to 1 min) was used to cause extensive cell lysis. The protein concentration of the cell homogenates was kept at 2–4 mg/ml in buffer A (50 mm Tris, 1 mm EDTA at pH 7.8 with protease inhibitors). The enzyme was solubilized and assayed in mixed micelle condition as previously described (35Chang C.C. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). Human ACAT-1 gene is located in two different chromosomes (1 and 7), each chromosome containing a separate ACAT-1 promoter (P1 and P7). Northern analyses have revealed the presence of four ACAT-1 mRNAs (7.0, 4.3, 3.6, and 2.8-knt) in all the human tissues and cell lines examined (3Anderson R.A. Joyce C. Davis M. Reagan J.W. Clark M. Shelness G.S. Rudel L.L. J. Biol. Chem. 1998; 273: 26747-26754Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar). The 2.8 and 3.6-knt messages are produced from the P1 promoter, while the 4.3-knt mRNA is produced from two different chromosomes by a novel RNA recombination event that presumably involves trans-splicing (26Li B.L. Li X.L. Duan Z.J. Lee O. Lin S. Ma Z.M. Chang C.C. Yang X.Y. Park J.P. Mohandas T.K. Noll W. Chan L. Chang T.Y. J. Biol. Chem. 1999; 274: 11060-11071Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). The P1 promoter is contiguous with the coding sequence and spans from −598 to +65 of the ACAT-1 genomic DNA (26Li B.L. Li X.L. Duan Z.J. Lee O. Lin S. Ma Z.M. Chang C.C. Yang X.Y. Park J.P. Mohandas T.K. Noll W. Chan L. Chang T.Y. J. Biol. Chem. 1999; 274: 11060-11071Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). To determine the minimal region of the

Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is an enzyme involved in cellular cholesterol homeostasis and atherosclerosis. ACAT1 is an allosteric enzyme responding to its substrate cholesterol in a sigmoidal manner. It is a homotetrameric protein that spans the membrane multiple times, with its N-terminal 131 hydrophilic amino acids residing at the cytoplasmic side of the endoplasmic reticulum. This region contains two closely linked putative alpha-helices. Our current studies show that this region contains a dimer-forming motif. Adding this motif to the bacterial glutathione S-transferase (GST) converted the homodimeric GST to a tetrameric fusion protein. Conversely, deleting this motif from the full-length ACAT1 converted the enzyme from a homotetramer to a homodimer. The dimeric ACAT1 remains enzymatically active. Its biochemical characteristics, including the sigmoidal response to cholesterol, the IC(50) value toward a specific ACAT inhibitor, and sensitivity toward heat inactivation, are essentially unaltered. On the other hand, the dimeric ACAT1 exhibits a 5-10-fold increase in the V(max) of the overall reaction and a 2.2-fold increase in the K(m) for oleoyl-coenzyme. Thus, deleting the dimer-forming motif near the N-terminus changes ACAT1 from its tetrameric form to a dimeric form and increases its catalytic efficiency.

BCθ is a proteolytically nicked and biotinylated derivative of a cholesterol binding protein perfringolysin O (θ-toxin), and has been used to detect cholesterol-rich domains at the plasma membrane (PM). Here we show that by modifying the cell fixation condition, BCθ can also be used to detect cholesterol-rich domains intracellularly. When cells were processed for PM cholesterol staining, the difference in BCθ signals between the CT43 (CT) cell, a mutant Chinese hamster ovary cell line lacking the Niemann-Pick type C1 (NPC1) protein, and its parental cell 25RA (RA) was minimal. However, when cells were fixed with 4% paraformaldehyde, they became permeable to BCθ. Under this condition, BCθ mainly stained cholesterol-rich domains inside the cells, with the signal being much stronger in CT cells than in RA cells. The sensitivity of BCθ staining was superior to that of filipin staining. The staining of cholesterol-rich domain(s) inside RA cells was sensitive to β-cyclodextrin treatment, while most of the staining inside CT cells was relatively resistant to cyclodextrin treatment. Clear differences in intracellular BCθ staining were also seen between the normal and mutant NPC1 fibroblasts of human or mouse origin.Thus, BCθ is a powerful tool for visually monitoring cholesterol-rich domains inside normal and NPC cells. BCθ is a proteolytically nicked and biotinylated derivative of a cholesterol binding protein perfringolysin O (θ-toxin), and has been used to detect cholesterol-rich domains at the plasma membrane (PM). Here we show that by modifying the cell fixation condition, BCθ can also be used to detect cholesterol-rich domains intracellularly. When cells were processed for PM cholesterol staining, the difference in BCθ signals between the CT43 (CT) cell, a mutant Chinese hamster ovary cell line lacking the Niemann-Pick type C1 (NPC1) protein, and its parental cell 25RA (RA) was minimal. However, when cells were fixed with 4% paraformaldehyde, they became permeable to BCθ. Under this condition, BCθ mainly stained cholesterol-rich domains inside the cells, with the signal being much stronger in CT cells than in RA cells. The sensitivity of BCθ staining was superior to that of filipin staining. The staining of cholesterol-rich domain(s) inside RA cells was sensitive to β-cyclodextrin treatment, while most of the staining inside CT cells was relatively resistant to cyclodextrin treatment. Clear differences in intracellular BCθ staining were also seen between the normal and mutant NPC1 fibroblasts of human or mouse origin. Thus, BCθ is a powerful tool for visually monitoring cholesterol-rich domains inside normal and NPC cells. Microdomains called lipid rafts exist in all mammalian cell membranes. They are rich in cholesterol and sphingolipids, and play important roles in various cellular processes, including signal transduction, cell surface polarity, and endocytosis (1Simons K. Ikonen E. How cells handle cholesterol.Science. 2000; 290: 1721-1726Google Scholar). In addition, it has been shown that cholesterol modulates intracellular transport of proteins from early endosomes to the plasma membranes (PMs), or from endosomes to the Golgi (2Mayor S. Sabharanjak S. Maxfield F.R. Cholesterol-dependent retention of GPI-anchored proteins in endosomes.EMBO J. 1998; 17: 4626-4638Google Scholar, 3Grimmer S. Iversen T.G. van Deurs B. Sandvig K. Endosome to Golgi transport of ricin is regulated by cholesterol.Mol. Biol. Cell. 2000; 11: 4205-4216Google Scholar, 4Miwako I. Yamamoto A. Kitamura T. Nagayama K. Ohashi M. Cholesterol requirement for cation-independent mannose 6-phosphate receptor exit from multivesicular late endosomes to the Golgi.J. Cell Sci. 2001; 114: 1765-1776Google Scholar); it also modulates the trafficking pathway of other lipids such as sphingolipids (5Puri V. Watanabe R. Dominguez M. Sun X. Wheatley C.L. Marks D.L. Pagano R.E. Cholesterol modulates membrane traffic along the endocytic pathway in sphingolipid-storage diseases.Nat. Cell Biol. 1999; 1: 386-388Google Scholar, 6Puri V. Watanabe R. Singh R.D. Dominguez M. Brown J.C. Wheatley C.L. Marks D.L. Pagano R.E. Clathrin-dependent and -independent internalization of plasma membrane sphingolipids initiates two Golgi targeting pathways.J. Cell Biol. 2001; 154: 535-547Google Scholar). At present, cellular factors that determine the concentration and the localization of cholesterol inside the cell remain largely unknown. One of the key molecules involved in the correct distribution of intracellular cholesterol is Niemann-Pick type C1 (NPC1) protein [mutation in NPC1 causes NPC syndrome, a fatal pediatric neurodegenerative disease (7Patterson M.C. Vanier M.T. Suzuki K. Morris J.A. Carstea E. Neufeld E.B. Blanchette-Mackie J.E. Pentchev P.G. Niemann-Pick disease type C: A lipid trafficking disorder.in: Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, New York2001: 3611-3633Google Scholar)]. Although the precise mechanism is still not clear, NPC1 was shown to mediate the transport of LDL-derived cholesterol from endosome/lysosome to the PM and to the endoplasmic reticulum (ER) (reviewed in ref. 8Ioannou Y.A. Multidrug permeases and subcellular cholesterol transport.Nat. Rev. Mol. Cell Biol. 2001; 2: 657-668Google Scholar). Chinese hamster ovary (CHO) mutants that are defective in the NPC1 protein have been isolated and characterized (9Cadigan K.M. Spillane D.M. Chang T.Y. Isolation and characterization of Chinese hamster ovary cell mutants defective in intracellular low density lipoprotein-cholesterol trafficking.J. Cell Biol. 1990; 110: 295-308Google Scholar, 10Gu J.Z. Carstea E.D. Cummings C. Morris J.A. Loftus S.K. Zhang D. Coleman K.G. Cooney A.M. Comly M.E. Fandino L. Roff C. Tagle D.A. Pavan W.J. Pentchev P.G. Rosenfeld M.A. Substantial narrowing of the Niemann-Pick C candidate interval by yeast artificial chromosome complementation.Proc. Natl. Acad. Sci. USA. 1997; 94: 7378-7383Google Scholar, 11Dahl N.K. Reed K.L. Daunais M.A. Faust J.R. Liscum L. Isolation and characterization of Chinese hamster ovary cells defective in the intracellular metabolism of low density lipoprotein-derived cholesterol.J. Biol. Chem. 1992; 267: 4889-4896Google Scholar). We compared the cholesterol trafficking activities between the NPC1 mutants [CT43 (CT) and CT60] and their parental cell line 25RA (RA) (12Chang T.Y. Limanek J.S. Regulation of cytosolic acetoacetyl coenzyme A thiolase, 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase, and mevalonate kinase by low density lipoprotein and by 25-hydroxycholesterol in Chinese hamster ovary cells.J. Biol. Chem. 1980; 255: 7787-7795Google Scholar, 13Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Sterol resistance in CHO cells traced to point mutation in SREBP cleavage-activating protein.Cell. 1996; 87: 415-426Google Scholar), and showed that NPC1 also participates in the transport of PM-derived cholesterol to the ER. Cholesterol newly synthesized in the ER quickly moves to the PM. After arrival at the PM, its retrograde transport back to the ER for esterification has been shown to require NPC1 (14Cruz J.C. Chang T.Y. Fate of endogenously synthesized cholesterol in Niemann-Pick type C1 cells.J. Biol. Chem. 2000; 275: 41309-41316Google Scholar, 15Cruz J.C. Sugii S. Yu C. Chang T.Y. Role of Niemann-Pick type C1 protein in intracellular trafficking of low density lipoprotein-derived cholesterol.J. Biol. Chem. 2000; 275: 4013-4021Google Scholar). Similar findings have been reported by other investigators (16Pentchev P.G. Comly M.E. Kruth H.S. Vanier M.T. Wenger D.A. Patel S. Brady R.O. A defect in cholesterol esterification in Niemann-Pick disease (type C) patients.Proc. Natl. Acad. Sci. USA. 1985; 82: 8247-8251Google Scholar, 17Byers D.M. Morgan M.W. Cook H.W. Palmer F.B. Spence M.W. Niemann-Pick type II fibroblasts exhibit impaired cholesterol esterification in response to sphingomyelin hydrolysis.Biochim. Biophys. Acta. 1992; 1138: 20-26Google Scholar, 18Lange Y. Ye J. Rigney M. Steck T. Cholesterol movement in Niemann-Pick type C cells and in cells treated with amphiphiles.J. Biol. Chem. 2000; 275: 17468-17475Google Scholar). These studies suggest that, irrespective of the origin of cholesterol, the lack of a functional NPC1 protein invariably leads to cholesterol accumulation in the late endosome/lysosome. For studying intracellular cholesterol transport, the biochemical approach is often problematic, partly because of the difficulty in isolating distinct subcellular organelles in their pure state. In recent years, the microscopic approach has provided invaluable information. One of the most frequently used methods for specifically viewing cholesterol-rich domains in intact cells is to label cholesterol by filipin, a naturally fluorescent polyene antibiotic that has a high affinity toward cholesterol (19Norman A.W. Demel R.A. de Kruyff B. van Deenen L.L. Studies on the biological properties of polyene antibiotics. Evidence for the direct interaction of filipin with cholesterol.J. Biol. Chem. 1972; 247: 1918-1929Google Scholar). Several problems associated with the use of filipin for highlighting cholesterol in various tissues and cells have been noted in the literature (20Miller R.G. The use and abuse of filipin to localize cholesterol in membranes.Cell Biol. Int. Rep. 1984; 8: 519-535Google Scholar, 21Robinson J.M. Karnovsky M.J. Evaluation of the polyene antibiotic filipin as a cytochemical probe for membrane cholesterol.J. Histochem. Cytochem. 1980; 28: 161-168Google Scholar, 22Severs N.J. Simons H.L. Failure of filipin to detect cholesterol-rich domains in smooth muscle plasma membrane.Nature. 1983; 303: 637-638Google Scholar, 23Behnke O. Tranum-Jensen J. van Deurs B. Filipin as a cholesterol probe. II. Filipin-cholesterol interaction in red blood cell membranes.Eur. J. Cell Biol. 1984; 35: 200-215Google Scholar, 24Pelletier R.M. Vitale M.L. Filipin vs enzymatic localization of cholesterol in guinea pig, mink, and mallard duck testicular cells.J. Histochem. Cytochem. 1994; 42: 1539-1554Google Scholar), and are summarized as follows: i) the absorption spectrum of filipin is within the UV range (most of the confocal microscopes commercially available are not equipped with the laser beam that excites in the UV range); ii) the fluorescence signal of filipin bleaches in a short time; iii) in unfixed or fixed cells, filipin deforms the cellular membrane by forming complexes with cholesterol, and causes perturbation of membrane lipid organization; and iv) filipin has been reported to give false-negative results. Two fluorescent analogs of cholesterol, NBD cholesterol, and dehydroergosterol (DHE) have been used by various investigators to track the fate of unesterified sterol in the cell (25Frolov A. Petrescu A. Atshaves B.P. So P.T. Gratton E. Serrero G. Schroeder F. High density lipoprotein-mediated cholesterol uptake and targeting to lipid droplets in intact L-cell fibroblasts. A single- and multiphoton fluorescence approach.J. Biol. Chem. 2000; 275: 12769-12780Google Scholar, 26Mukherjee S. Zha X. Tabas I. Maxfield F.R. Cholesterol distribution in living cells: fluorescence imaging using dehydroergosterol as a fluorescent cholesterol analog.Biophys. J. 1998; 75: 1915-1925Google Scholar). NBD cholesterol exhibits a strong initial fluorescence signal at desirable wavelengths, but bleaches quickly under light exposure. Moreover, NBD cholesterol may not faithfully mimic the behavior of cholesterol inside the cells (25Frolov A. Petrescu A. Atshaves B.P. So P.T. Gratton E. Serrero G. Schroeder F. High density lipoprotein-mediated cholesterol uptake and targeting to lipid droplets in intact L-cell fibroblasts. A single- and multiphoton fluorescence approach.J. Biol. Chem. 2000; 275: 12769-12780Google Scholar). DHE was reported to behave in a manner similar to cholesterol in many ways (26Mukherjee S. Zha X. Tabas I. Maxfield F.R. Cholesterol distribution in living cells: fluorescence imaging using dehydroergosterol as a fluorescent cholesterol analog.Biophys. J. 1998; 75: 1915-1925Google Scholar), but its fluorescence intensity is weak (it absorbs and emits in the UV region, therefore special equipment is required in order to visualize it by fluorescence microscopy). For these reasons, there is a need to develop a reliable and versatile cholesterol-specific probe for microscopic studies. Recently, a novel probe (BCθ) was developed as an effective tool for detecting cholesterol-rich domains (27Waheed A.A. Shimada Y. Heijnen H.F. Nakamura M. Inomata M. Hayashi M. Iwashita S. Slot J.W. Ohno-Iwashita Y. Selective binding of perfringolysin O derivative to cholesterol-rich membrane microdomains (rafts).Proc. Natl. Acad. Sci. USA. 2001; 98: 4926-4931Google Scholar, 28Iwamoto M. Morita I. Fukuda M. Murota S. Ando S. Ohno-Iwashita Y. A biotinylated perfringolysin O derivative: a new probe for detection of cell surface cholesterol.Biochim. Biophys. Acta. 1997; 1327: 222-230Google Scholar). The probe is derived from a pore-forming cytolysin produced by the pathogenic bacterium Clostridium perfringens (28Iwamoto M. Morita I. Fukuda M. Murota S. Ando S. Ohno-Iwashita Y. A biotinylated perfringolysin O derivative: a new probe for detection of cell surface cholesterol.Biochim. Biophys. Acta. 1997; 1327: 222-230Google Scholar). This thiol-activated cytolysin, called perfringolysin O (θ-toxin), specifically binds to free (unesterified) cholesterol (29Ohno-Iwashita Y. Iwamoto M. Ando S. Mitsui K. Iwashita S. A modified theta-toxin produced by limited proteolysis and methylation: a probe for the functional study of membrane cholesterol.Biochim. Biophys. Acta. 1990; 1023: 441-448Google Scholar, 30Ohno-Iwashita Y. Iwamoto M. Mitsui K. Ando S. Iwashita S. A cytolysin, theta-toxin, preferentially binds to membrane cholesterol surrounded by phospholipids with 18-carbon hydrocarbon chains in cholesterol-rich region.J. Biochem. (Tokyo). 1991; 110: 369-375Google Scholar, 31Ohno-Iwashita Y. Iwamoto M. Ando S. Iwashita S. Effect of lipidic factors on membrane cholesterol topology–mode of binding of theta-toxin to cholesterol in liposomes.Biochim. Biophys. Acta. 1992; 1109: 81-90Google Scholar, 32Nakamura M. Sekino N. Iwamoto M. Ohno-Iwashita Y. Interaction of theta-toxin (perfringolysin O), a cholesterol-binding cytolysin, with liposomal membranes: change in the aromatic side chains upon binding and insertion.Biochemistry. 1995; 34: 6513-6520Google Scholar) and forms oligomeric pores in the membranes (33Rossjohn J. Feil S.C. McKinstry W.J. Tweten R.K. Parker M.W. Structure of a cholesterol-binding, thiol-activated cytolysin and a model of its membrane form.Cell. 1997; 89: 685-692Google Scholar). The probe BCθ was prepared by a two-step procedure. First, θ-toxin is proteolytically digested with subtilisin Carlsberg. This step generates a complex of 38 and 15 kDa fragments called Cθs (34Ohno-Iwashita Y. Iwamoto M. Mitsui K. Kawasaki H. Ando S. Cold-labile hemolysin produced by limited proteolysis of theta-toxin from Clostridium perfringens.Biochemistry. 1986; 25: 6048-6053Google Scholar). Next, the complex Cθ is biotinylated and purified, resulting in what is called BCθ (28Iwamoto M. Morita I. Fukuda M. Murota S. Ando S. Ohno-Iwashita Y. A biotinylated perfringolysin O derivative: a new probe for detection of cell surface cholesterol.Biochim. Biophys. Acta. 1997; 1327: 222-230Google Scholar). The biotinylation allows Cθ to be identified through binding to avidin. When used in fluorescence microscopy, the labeling efficiency of BCθ depends on the qualities of fluorescent avidin or streptavidin. Various kinds of avidin/streptavidin products with different fluophores, having stable fluorescent properties, are available, making this reagent suitable for double staining purposes. BCθ binds to cholesterol in synthetic liposomes and in intact cells with identical affinity to that of the wild-type (WT) θ-toxin, but because it does not oligomerize, it bears no hemolytic activity (28Iwamoto M. Morita I. Fukuda M. Murota S. Ando S. Ohno-Iwashita Y. A biotinylated perfringolysin O derivative: a new probe for detection of cell surface cholesterol.Biochim. Biophys. Acta. 1997; 1327: 222-230Google Scholar, 30Ohno-Iwashita Y. Iwamoto M. Mitsui K. Ando S. Iwashita S. A cytolysin, theta-toxin, preferentially binds to membrane cholesterol surrounded by phospholipids with 18-carbon hydrocarbon chains in cholesterol-rich region.J. Biochem. (Tokyo). 1991; 110: 369-375Google Scholar, 31Ohno-Iwashita Y. Iwamoto M. Ando S. Iwashita S. Effect of lipidic factors on membrane cholesterol topology–mode of binding of theta-toxin to cholesterol in liposomes.Biochim. Biophys. Acta. 1992; 1109: 81-90Google Scholar). Recently, it was demonstrated that BCθ binds to cholesterol-rich microdomains in the PM of intact cells with or without fixation (27Waheed A.A. Shimada Y. Heijnen H.F. Nakamura M. Inomata M. Hayashi M. Iwashita S. Slot J.W. Ohno-Iwashita Y. Selective binding of perfringolysin O derivative to cholesterol-rich membrane microdomains (rafts).Proc. Natl. Acad. Sci. USA. 2001; 98: 4926-4931Google Scholar, 35Hagiwara H. Kogure S.Y. Nakamura M. Shimada Y. Ohno-Iwashita Y. Fujimoto T. Cross-linking of plasmalemmal cholesterol in lymphocytes induces capping, membrane shedding, and endocytosis through coated pits.Biochem. Biophys. Res. Commun. 1999; 260: 516-521Google Scholar, 36Mobius W. Ohno-Iwashita Y. van Donselaar E.G. Oorschot V.M. Shimada Y. Fujimoto T. Heijnen H.F. Geuze H.J. Slot J.W. Immunoelectron microscopic localization of cholesterol using biotinylated and non-cytolytic perfringolysin O.J. Histochem. Cytochem. 2002; 50: 43-55Google Scholar). BCθ is relatively high in molecular weight (∼57 kDa) and has not been considered to be an effective agent for staining cholesterol inside the cells. In the current work, we show that increasing the concentration of paraformaldehyde (PFA) from 1% to 4% during the cell fixation step allows the entry of BCθ to stain cholesterol-rich domains inside mammalian cells. The signal elicited with BCθ staining is superior to that of filipin staining. This methodology was proven to be useful in studying cholesterol distribution in the NPC1-dependent manner. Filipin and 2-hydroxypropyl-β-cyclodextrin (hpCD) were purchased from Sigma. PFA was obtained from Sigma and from Electron Microscopy Sciences (Ft. Washington, PA) and gave the same results as described in this work. U18666A was from Biomol. FuGENE 6 Transfection Reagent was from Roche. ProLong Antifade Kit and Oregon Green 488-, Alexa 568-, or Texas Red-X-conjugated streptavidin were from Molecular Probes. LDL was prepared from fresh human plasma by sequential flotation as previously described (37Cadigan K.M. Heider J.G. Chang T.Y. Isolation and characterization of Chinese hamster ovary cell mutants deficient in acyl-coenzyme A: cholesterol acyltransferase activity.J. Biol. Chem. 1988; 263: 274-282Google Scholar). BCθ was prepared as previously described (27Waheed A.A. Shimada Y. Heijnen H.F. Nakamura M. Inomata M. Hayashi M. Iwashita S. Slot J.W. Ohno-Iwashita Y. Selective binding of perfringolysin O derivative to cholesterol-rich membrane microdomains (rafts).Proc. Natl. Acad. Sci. USA. 2001; 98: 4926-4931Google Scholar). Briefly, θ-toxin was overexpressed in Escherichia coli strains, and purified by a series of chromatographies (38Shimada Y. Nakamura M. Naito Y. Nomura K. Ohno-Iwashita Y. C-terminal amino acid residues are required for the folding and cholesterol binding property of perfringolysin O, a pore-forming cytolysin.J. Biol. Chem. 1999; 274: 18536-18542Google Scholar). It was digested with subtilisin Carlsberg to produce a nicked θ-toxin (Cθ) (34Ohno-Iwashita Y. Iwamoto M. Mitsui K. Kawasaki H. Ando S. Cold-labile hemolysin produced by limited proteolysis of theta-toxin from Clostridium perfringens.Biochemistry. 1986; 25: 6048-6053Google Scholar). BCθ was then obtained by biotinylating Cθ as described (28Iwamoto M. Morita I. Fukuda M. Murota S. Ando S. Ohno-Iwashita Y. A biotinylated perfringolysin O derivative: a new probe for detection of cell surface cholesterol.Biochim. Biophys. Acta. 1997; 1327: 222-230Google Scholar). RA is a CHO cell line resistant to the cytotoxicity of 25-hydroxycholesterol (12Chang T.Y. Limanek J.S. Regulation of cytosolic acetoacetyl coenzyme A thiolase, 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase, and mevalonate kinase by low density lipoprotein and by 25-hydroxycholesterol in Chinese hamster ovary cells.J. Biol. Chem. 1980; 255: 7787-7795Google Scholar) and contains a gain-of-function mutation in the sterol regulatory element binding protein-1 cleavage-activating protein (SCAP) (13Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Sterol resistance in CHO cells traced to point mutation in SREBP cleavage-activating protein.Cell. 1996; 87: 415-426Google Scholar). The CT mutant cell line is isolated as one of the cholesterol-trafficking mutants from mutagenized RA cells (9Cadigan K.M. Spillane D.M. Chang T.Y. Isolation and characterization of Chinese hamster ovary cell mutants defective in intracellular low density lipoprotein-cholesterol trafficking.J. Cell Biol. 1990; 110: 295-308Google Scholar). It contains the same gain-of-function mutation in SCAP. In addition, it contains a premature translational termination mutation near the 3′ end of the NPC1 coding sequence, producing a nonfunctional, truncated NPC1 protein (15Cruz J.C. Sugii S. Yu C. Chang T.Y. Role of Niemann-Pick type C1 protein in intracellular trafficking of low density lipoprotein-derived cholesterol.J. Biol. Chem. 2000; 275: 4013-4021Google Scholar). The human fibroblast cell line derived from an NPC patient (93. 22) was the generous gift of Dr. Peter Pentchev. Isolation of mouse embryonic fibroblasts (MEFs) was performed as described (39Willnow T.E. Herz J. Genetic deficiency in low density lipoprotein receptor-related protein confers cellular resistance to Pseudomonas exotoxin A. Evidence that this protein is required for uptake and degradation of multiple ligands.J. Cell Sci. 1994; 107: 719-726Google Scholar). Briefly, at embryonic day 17, mouse embryos were taken out of the uteri of pregnant females from confirmed npc1 heterozygous breeding pairs by caesarean section. For each embryo, the tail and a portion of a limb were removed and prepared for DNA extraction and genotyping according to the procedure described (40Henderson L.P. Lin L. Prasad A. Paul C.A. Chang T.Y. Maue R.A. Embryonic striatal neurons from Niemann-Pick type C mice exhibit defects in cholesterol metabolism and neurotrophin responsiveness.J. Biol. Chem. 2000; 275: 20179-20187Google Scholar). After dissection and incubation in 0.05% trypsin solution, the softened tissue was disrupted by repeated pipetting. Cell debris was separated and the supernatant plated in T25 cm2 flasks. Fibroblasts at early passages (fourth to tenth) were used in the current work. All experimental protocols were approved by the Institutional Animal Care and Research Advisory Committee at Dartmouth Medical School and conducted in accordance with the US Public Health Service guide for the care and use of laboratory animals. CHO cells were maintained in medium A [Ham’s F-12, plus 10% fetal bovine serum (FBS) and 10 μg/ml gentamycin] as monolayers at 37°C with 5% CO2. Medium D refers to Ham’s F-12 with 5% delipidated FBS (41Chin J. Chang T.Y. Evidence for coordinate expression of 3-hydroxy-3-methylglutaryl coenzyme A. Reductase and low density lipoprotein binding activity.J. Biol. Chem. 1981; 256: 6304-6310Google Scholar), plus 35 μM oleic acid and 10 μg/ml gentamycin. When medium D was used at lower temperatures (below 18°C), sodium bicarbonate was depleted from Ham’s F-12 and cells were placed in the incubator without CO2. Human fibroblasts and MEFs were grown in the same conditions as the CHO cells, except that Dulbecco’s modified Eagle’s medium and Pen-Strep (100 U/ml) were used. A PCR fragment was generated using green fluorescent protein (GFP) cDNA as the template and a 5′ primer whose sequence corresponds to the C-terminal sequence of the mouse NPC1 from the unique Eco47III restriction site to the end of the reading frame (except the stop codon) followed by the sequence corresponding to six alanines (the spacer), which is in turn followed by a sequence corresponding to the N-terminal sequence of GFP (5′-TATATAAGCGCTACAGAGGGACAGAGAGAGAACGGCTCCTCAATTTTGCAGCAGCAGCAGCAGCAATGGTGAG-CAAGGGCGAGGA-3′). The 3′ primer consists of sequences corresponding to the C-terminal sequence of GFP and to HindIII and XhoII restriction sites (5′-CGTCTGAAGCTTAGATCTTTACTTGTACAGCTCGTCCA-3′). The resulting PCR product was digested with HindIII and Eco47III and ligated into an NPC1-containing Bluescript plasmid that had been digested with Eco47III and HindIII and gel purified. The resulting cDNA encoding the NPC1-(ala)6-GFP fusion protein was sequenced on both strands to confirm that it was correct. The GFP-tagged NPC1 protein (NPC1-GFP) was removed from the plasmid with SpeI and HindIII and subcloned into the pREX-IRES vector (42Liu X. Constantinescu S.N. Sun Y. Bogan J.S. Hirsch D. Weinberg R.A. Lodish H.F. Generation of mammalian cells stably expressing multiple genes at predetermined levels.Anal. Biochem. 2000; 280: 20-28Google Scholar). CT cells were transfected with the NPC1-GFP cDNA using FuGENE 6 according to manufacturer’s instructions. Transfected cells were imaged within 2–3 days of transfection. Cells were grown on glass coverslips in 6-well plates and processed for fluorescence studies. In some experiments, to minimize the possible effect of residual serum adhering to the coverslips, we incubated the cells in a serum-free medium for 2 h before the experiments and noticed no difference in results obtained with or without the preincubation step. For BCθ staining of fixed cells, the cells were washed three times and fixed with 4% or 1% PFA in PBS for 10 min or longer at room temperature. After extensive washes with PBS, the cells were preincubated in PBS containing 1% BSA, then 10 μg/ml BCθ in 1% BSA-PBS was added and incubated with the cells for 30 min at room temperature. After washing three times, the cells were incubated with either Oregon Green 488- or with Texas Red X-conjugated streptavidin (1 μg/ml) in PBS with 1% BSA at room temperature. After three washes, the coverslips were mounted with a drop of ProLong Anti-Fade media onto the glass plates for image processing. In the case of filipin staining, the protocol was essentially the same except that cells were preincubated with 1.5 mg/ml glycine in PBS for 30 min, then incubated with filipin (125 μg/ml) in PBS for 1 h at room temperature before image processing. For live-cell staining, cells were chilled and kept on ice, washed three times, preincubated in ice-cold phenol red-free Hank’s balanced salt solution (HBSS) containing 1% BSA, then incubated with 10 μg/ml BCθ in the same solution for 30 min at 4°C. After washing three times with HBSS, the cells were incubated with fluorescent streptavidin in HBSS with 1% BSA at 4°C, and processed for image analysis. Samples were viewed and photographed using a Zeiss Axiophot microscope with a 63× objective equipped with CCD camera DEI-750 from Optronics Engineering (Goleta, CA). DAPI filter, FITC filter, and Texas Red filter were used to visualize filipin, GFP-Oregon Green 488, and Texas Red X, respectively. Using the MetaView 4.5 software from Universal Imaging Corp. (Downingtown, PA), we processed the images. To establish the validity of the localization studies, the BCθ-treated samples were labeled with Alexa 568-conjugated streptavidin and viewed with a Bio-Rad (Hercules, CA) MRC-1024 Krypton-Argon laser confocal microscope with 0.2 μm per optical section. The images were constructed by LaserSharp software, and further processed by Adobe Photoshop 5.02. Cells were processed for BCθ staining with Oregon Green 488-streptavidin essentially as described above except that the cells were grown without coverslips in 6-well dishes. After the staining, the cells were scraped by rubber policemen into microtubes, pelleted with a brief centrifugation, and resuspended in 1 ml of 1% BSA in either HBSS (for live-cell staining) or PBS (for fixed-cell staining). The cells were analyzed at excitation wavelength of 488 nm and emission wavelength of 515–530 nm using FACScan cytometer with CellQuest software (Becton Dickinson, San Jose, CA). Sorted for each sample were 104 cells. Due to its lack of hemolytic activity and its relatively large molecular weight, previous studies have focused on using BCθ for labeling cholesterol-rich microdomains at the PM of intact cells (27Waheed A.A. Shimada Y. Heijnen H.F. Nakamura M. Inomata M. Hayashi M. Iwashita S. Slot J.W. Ohno-Iwashita Y. Selective binding of perfringolysin O derivative to cholesterol-rich membrane microdomains (rafts).Proc. Natl. Acad. Sci. USA. 2001; 98: 4926-4931Google Scholar, 43Fujimoto T. Hayashi M. Iwamoto M. Ohno-Iwashita Y. Crosslinked plasmalemmal cholesterol is sequestered to caveolae: analysis with a new cytochemical probe.J. Histochem. Cytochem. 1997; 45: 1197-1205Google Scholar). We used the RA cells and CT cells unfixed or fixed with low concentrations of PFA (1%), incubated them with BCθ followed by secondary staining using a fluorescent streptavidin, then viewed cells under a fluorescent microscope with confocal and differential interference contract (DIC) imaging capabilities. To demonstrate localization of the fluorescent signals in the cells, the pictures with the DIC images were superimposed onto the pictures with the BCθ staining images. As expected, treating unfixed or 1% PFA-fixed cells with BCθ resulted in strong staining mainly in the vicinity of the cell surf

To investigate the association of RUNX1 rs2253319 with clinicopathological characteristics of prostate cancer (PCa) and disease recurrence after radical prostatectomy (RP).Taking advantage of the systematic stage and grade for each tumor in a cohort of 314 patients with localized PCa receiving RP, we evaluated the associations of RUNX1 rs2253319 with age at diagnosis, preoperative prostate-specific antigen (PSA) level, Gleason score, surgical margin, pathologic stage, status of lymph node metastasis, and PSA recurrence after RP.The minor allele, T, and the minor homozygote TT genotype of RUNX1 rs2253319 were significantly associated with a 1.49- to 2.76-fold higher risk for advanced pathologic stage and a 3.35- to 9.52-fold higher risk for lymph node metastasis. RUNX1 rs2253319 TT genotype was also associated with poorer PSA-free survival compared with the major homozygote CC genotype in Kaplan-Meier analysis (log-rank test, P= 0.038) and multivariate Cox proportional hazards model adjusting for age and PSA concentration (P= 0.045).RUNX1 rs2253319 is associated with adverse clinicopathological features and might be a prognostic factor for the recurrence of PSA in patients with PCa receiving RP.

Independent exposure to noise or organic solvents is reported to be associated with cardiovascular effects, but the effect of joint exposure is unclear. The present study aimed to investigate effects of noise, a mixture of organic solvents (N,N-dimethylformamide (DMF) and toluene) and their interaction on hypertension.We recruited 59 volunteers working in a synthetic leather manufacturing company during 2005-2006. Both personal noise exposure and airborne co-exposure to DMF and toluene at work were measured and used to calculate the mixed hazard index (HI). Multivariate logistic regressions were conducted to estimate between-group differences of hypertension by controlling for potential confounders.We found that 18 co-exposure workers (82.22 +/- 2.70 dBA and a mixed HI of 0.53 +/- 0.20) had the highest prevalence of hypertension (55.6%) compared to 15 solvent-exposure workers (a mixed HI of 0.32 +/- 0.18; 46.7%), 9 noise-exposure workers (84.13 +/- 2.30 dBA; 44.4%) and 17 low-exposure workers (11.8%). The adjusted odds ratio (OR) of hypertension compared to low-exposure workers increased from 7.9 times (95% confidence interval (CI)=0.9-66.3; p=0.06) in solvent-exposure workers and 9.1 times (OR=9.1, 95% CI=1.0-81.1; p<0.05) in noise-exposure workers to 13.5 times (95% CI=1.5-117.8; p<0.05) in co-exposure workers.Our findings suggest that co-exposure to noise, DMF and toluene is associated with hypertension in synthetic leather workers. Simultaneous exposure to noise and a mixture of organic solvents may have a sub-additive effect on the risk of hypertension.

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTAspartate transcarbamylase from Streptococcus faecalis. Purification, properties, and nature of an allosteric activator siteTa-Yuan Chang and Mary E. JonesCite this: Biochemistry 1974, 13, 4, 629–638Publication Date (Print):February 1, 1974Publication History Published online1 May 2002Published inissue 1 February 1974https://doi.org/10.1021/bi00701a001Request reuse permissionsArticle Views33Altmetric-Citations24LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (2 MB) Get e-AlertscloseSupporting Info (1)»Supporting Information Supporting Information Get e-Alerts

Pregnenolone (PREG) can be converted to PREG esters (PE) by the plasma enzyme lecithin: cholesterol acyltransferase (LCAT), and by other enzyme(s) with unknown identity. Acyl-CoA:cholesterol acyltransferase 1 and 2 (ACAT1 and ACAT2) convert various sterols to steryl esters; their activities are activated by cholesterol. PREG is a sterol-like molecule, with 3-β-hydroxy moiety at steroid ring A, but with much shorter side chain at steroid ring D. Here we show that without cholesterol, PREG is a poor ACAT substrate; with cholesterol, the Vmax for PREG esterification increases by 100-fold. The binding affinity of ACAT1 for PREG is 30–50-fold stronger than that for cholesterol; however, PREG is only a substrate but not an activator, while cholesterol is both a substrate and an activator. These results indicate that the sterol substrate site in ACAT1 does not involve significant sterol-phospholipid interaction, while the sterol activator site does. Studies utilizing small molecule ACAT inhibitors show that ACAT plays a key role in PREG esterification in various cell types examined. Mice lacking ACAT1 or ACAT2 do not have decreased PREG ester contents in adrenals, nor do they have altered levels of the three major secreted adrenal steroids in serum. Mice lacking LCAT have decreased levels of PREG esters in the adrenals. These results suggest LCAT along with ACAT1/ACAT2 contribute to control pregnenolone ester content in different cell types and tissues. Pregnenolone (PREG) can be converted to PREG esters (PE) by the plasma enzyme lecithin: cholesterol acyltransferase (LCAT), and by other enzyme(s) with unknown identity. Acyl-CoA:cholesterol acyltransferase 1 and 2 (ACAT1 and ACAT2) convert various sterols to steryl esters; their activities are activated by cholesterol. PREG is a sterol-like molecule, with 3-β-hydroxy moiety at steroid ring A, but with much shorter side chain at steroid ring D. Here we show that without cholesterol, PREG is a poor ACAT substrate; with cholesterol, the Vmax for PREG esterification increases by 100-fold. The binding affinity of ACAT1 for PREG is 30–50-fold stronger than that for cholesterol; however, PREG is only a substrate but not an activator, while cholesterol is both a substrate and an activator. These results indicate that the sterol substrate site in ACAT1 does not involve significant sterol-phospholipid interaction, while the sterol activator site does. Studies utilizing small molecule ACAT inhibitors show that ACAT plays a key role in PREG esterification in various cell types examined. Mice lacking ACAT1 or ACAT2 do not have decreased PREG ester contents in adrenals, nor do they have altered levels of the three major secreted adrenal steroids in serum. Mice lacking LCAT have decreased levels of PREG esters in the adrenals. These results suggest LCAT along with ACAT1/ACAT2 contribute to control pregnenolone ester content in different cell types and tissues.

Many studies have shown that sterols can stimulate acyl-coenzyme A:cholesterol acyltransferase (ACAT) activity in cells. To elucidate this mechanism, effects of sterol-mediated induction on both the enzyme activity of ACAT and its mRNA levels were studied in human hepatoblastoma cell line, HepG2 cells. When HepG2 cells were loaded with cholesterol and 25-hydroxycholesterol, both the whole-cell ACAT activity and the microsomal ACAT activity were increased by 85.1% and 41.3%. In contrast, cholesterol depletion of HepG2 cells with compactin, a 3-hydroxy-3-methylglutaryl coenzyme A reductase inhibitor, resulted in a decrease in both the whole-cell and the microsomal ACAT activity by 46.4% and 58.3%. Under identical conditions, RT-PCR and Northern blotting analyses revealed that neither cholesterol loading nor cholesterol depletion of HepG2 cells altered the amounts of ACAT mRNA. Moreover, these treatments had no effect on the enzymatic ACAT activity determined by the reconstituted assay in which HepG2 cell homogenate had been supplemented in vitro with a saturating level of exogenous cholesterol. These results indicate that cholesterol-induced up-regulation of ACAT activity in HepG2 cells does not occur at the level of transcription, but rather at a posttranscriptional level.

A new method for reconstituting acyl coenzyme A: cholesterol acyltransferase (ACAT) activity from either Chinese hamster ovary (CHO) or human fibroblast cell extracts into cholesterol-phosphatidylcholine liposomes is described. The method is rapid (less than 60 min) and easy to perform. The procedure involves solubilizing the cell extracts with deoxycholate followed by dilution into preformed liposomes. Ficoll gradient analysis demonstrated that, after reconstitution, almost all of the detectable ACAT activity co-migrated with the liposomes. Exogenous cholesterol in the liposomes was absolutely necessary for providing ACAT activity, but not for incorporation of the ACAT enzyme into the vesicle bilayer. Human fibroblast cell extracts prepared from cells grown in medium containing 10% fetal calf serum were found to contain a 10-fold higher microsomal ACAT activity compared to extracts from cells grown in 10% delipidated fetal calf serum. In contrast, when the ACAT activity from these extracts was measured using the reconstitution assay, there was no difference in the specific activities. These results support our previous work (Doolittle, G. M., and T. Y. Chang. 1982. Biochim. Biophys. Acta. 713: 529-537; and Chang, C. C. Y., et al. 1986. Biochemistry. 25: 1693-1699), and suggest that cholesterol regulates ACAT activity in CHO cells and human fibroblasts by mechanism(s) other than modulation of the amount of enzyme.

Niemann-Pick type C (NPC) disease is a cholesterol-storage disease accompanied by neurodegeneration with the formation of neurofibrillary tangles, the major component of which is the hyperphosphorylated tau. Here, we examined the mechanism underlying hyperphosphorylation of tau using mutant Chinese hamster ovary (CHO) cell line defective in NPC1 (CT43) as a tool. Immunoblot analysis revealed that tau was hyperphosphorylated at multiple sites in CT43 cells, but not in their parental cells (25RA) or the wild-type CHO cells. In CT43 cells, mitogen-activated protein (MAP) kinase Erk1/2 was activated and the specific MAPK inhibitor, PD98059, attenuated the hyperphosphorylation of tau. The amount of protein phosphatase 2A not bound to microtubules was decreased in CT43 cells. CT43 cells but not 25RA cells were amphotericin B-resistant, indicating that cholesterol level in the plasma membrane of CT43 is decreased. In addition, the level of cholesterol in the detergent-insoluble, low-density membrane (LDM) fraction of CT43 cells was markedly reduced compared with the other two types of CHO cells. As LDM domain plays critical role in signaling pathways, these results suggest that the reduced cholesterol level in LDM domain due to the lack of NPC1 may activate MAPK, which subsequently promotes tau phosphorylation in NPC1-deficient cells.

This chapter focuses on Acyl coenzyme A: cholesterol O-acyltransferase (ACAT), which utilizes long-chain fatty acyl coenzyme A and cholesterol as substrates to catalyze the formation of cholesterol esters. This enzyme is responsible for the cellular synthesis of cholesterol esters in various cell types. The presence of cholesterol-esterifying activity in rat liver preparations has been known for over 40 years. ACAT activity has been reported to occur in various cell types including human fibroblasts, rat hepatoma cells, rat hepatocytes, mouse peritoneal microphages, Ehrlich ascites cells, and Chinese hamster ovary (CHO) cells. It is also found in various tissues from different species—including rat, guinea pig, and human intestine; guinea pig, pig, human, and monkey liver; rabbit, monkey, and pigeon arteries; and rat ovary. This chapter reviews the fundamental biochemical characteristics of the enzyme—including the enzyme assay conditions, enzyme properties, procedures for solubilization, reconstitution into liposome, and partial purification. Studies on substrate specificity as well as inhibitors are presented and various aspects of the regulation of ACAT by sterols are reviewed.

Acyl-coenzyme A:cholesterol acyltransferase 1 (ACAT1) is a membrane-bound enzyme utilizing long-chain fatty acyl-coenzyme A and cholesterol to form cholesteryl esters and coenzyme A. Previously, we had expressed tagged human ACAT1 (hACAT1) in CHO cells and purified it to homogeneity; however, only a sparse amount of purified protein could be obtained. Here we report that the hACAT1 expression level in H293 cells is 18-fold higher than that in CHO cells. We have developed a milder purification procedure to purify the enzyme to homogeneity. The abundance of the purified protein enabled us to conduct difference intrinsic fluorescence spectroscopy to study the binding between the enzyme and its substrates in CHAPS/phospholipid mixed micelles. The results show that oleoyl-CoA binds to ACAT1 with Kd = 1.9 μM and elicits significant structural changes of the protein as manifested by the significantly positive changes in its fluorescence spectrum; stearoyl-CoA elicits a similar spectrum change but much lower in magnitude. Previously, kinetic studies had shown that cholesterol is an efficient substrate and an allosteric activator of ACAT1, while its diastereomer epicholesterol is neither a substrate nor an activator. Here we show that both cholesterol and epicholesterol induce positive changes in the ACAT1 fluorescence spectrum; however, the magnitude of spectrum changes induced by cholesterol is much larger than epicholesterol. These results show that stereospecificity, governed by the 3β-OH moiety in steroid ring A, plays an important role in the binding of cholesterol to ACAT1.

Abstract Androgen‐deprivation therapy (ADT) is the most common therapy for advanced prostate cancer, but the prognosis significantly differs among individuals. In this study, we evaluated recently identified 19 prostate cancer susceptibility variants as prognostic predictors for the survival after ADT. A total of 601 prostate cancer patients treated with ADT were enrolled in this study cohort. The prognostic significance of the prostate cancer risk variants on disease progression, prostate cancer‐specific mortality (PCSM) and all‐cause mortality (ACM) after ADT were assessed by Kaplan–Meier analysis and Cox regression model. Two polymorphisms, rs16901979 and rs7931342, were significantly associated with PCSM ( p = 0.005 for rs16901979 and p = 0.038 for rs7931342), and rs16901979 was also associated with ACM ( p = 0.003) following ADT. Although the effect of rs7931342 was attenuated after controlling for other known clinical prognostic factors, rs16901979 remained a significant predictor for PCSM and ACM after ADT ( p = 0.002). Moreover, the addition of the rs16901979 status in current clinical staging system further enhanced the risk prediction on PCSM and ACM particularly for the high‐risk patients with distant metastasis ( p &lt; 0.017). In conclusion, this is the first study showing that prostate cancer risk variants, such as rs16901979, might improve outcome prediction following ADT, thus allowing identification of high‐risk patients who might benefit from appropriate adjuvant therapy.

A rare form of human ACAT1 mRNA, containing the optional long 5′-untranslated region, is produced as a 4.3-kelonucleotide chimeric mRNA through a novel interchromosomal trans-splicing of two discontinuous RNAs transcribed from chromosomes 1 and 7 (Li, B. L., Li, X. L., Duan, Z. J., Lee, O., Lin, S., Ma, Z. M., Chang, C. C., Yang, X. Y., Park, J. P., Mohandas, T. K., Noll, W., Chan, L., and Chang, T. Y. (1999) J. Biol. Chem. 274, 11060–11071). To investigate its function, we express the chimeric ACAT1 mRNA in Chinese hamster ovary cells and show that it can produce a larger ACAT1 protein, with an apparent molecular mass of 56 kDa on SDS-PAGE, in addition to the normal, 50-kDa ACAT1 protein, which is produced from the ACAT1 mRNAs without the optional long 5′-untranslated repeat. To produce the 56-kDa ACAT1, acat1 sequences located at both chromosomes 7 and 1 are required. The 56-kDa ACAT1 can be recognized by specific antibodies prepared against the predicted additional amino acid sequence located upstream of the N-terminal of the ACAT1ORF. The translation initiation codon for the 56-kDa protein is GGC, which encodes for glycine, as deduced by mutation analysis and mass spectrometry. Similar to the 50-kDa protein, when expressed alone, the 56-kDa ACAT1 is located in the endoplasmic reticulum and is enzymatically active. The 56-kDa ACAT1 is present in native human cells, including human monocyte-derived macrophages. Our current results show that the function of the chimeric ACAT1 mRNA is to increase the ACAT enzyme diversity by producing a novel isoenzyme. To our knowledge, our result provides the first mammalian example that a trans-spliced mRNA produces a functional protein.

Acyl-coenzyme A:cholesterol acyltransferase (ACAT) is a membrane protein located in the endoplasmic reticulum (ER). It plays important roles in cellular cholesterol homeostasis. Human ACAT1 (hACAT1) contains nine cysteines (C). To quantify and map its disulfide linkage, we performed thiol-specific modifications by mPEG5000-maleimide (PEG-mal) and iodoacetamide (IA) under denatured condition, using extracts that contain wild-type or various single C to A mutant hACAT1s. With the wild-type enzyme, seven Cs could be modified before dithiothreitol (DTT) treatment; nine Cs could be modified after DTT treatment. With the C528A or the C546A enzyme, all eight Cs could be modified before or after DTT treatment. With all other remaining single C to A mutant enzymes, six Cs could be modified before DTT treatment, and eight Cs could be modified after DTT treatment. We next performed Lys-C protease digestion on hACAT1 with a hemagglutinin (HA) tag at the C-terminus. The digests were treated with or without DTT and analyzed by SDS−PAGE and Western blotting. The two predicted C-terminal fragments (K496−K531 and N532−F550−HA tag) were trapped as a single peptide band, but only when the digests were treated without DTT. Thus, C528 and C546 near the enzyme's C-terminus form a disulfide. PEG-mal is impermeable to ER membranes. We used PEG-mal to map the localizations of the seven free sulfhydryls and the disulfide bond of hACAT1 present in microsomal vesicles. The results show that C92 is located on the cytoplasmic side of the ER membrane and the disulfide is located in the ER lumen, while all other free Cs are located within the hydrophobic region(s) of the enzyme.

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTCycloheximide sensitivity in regulation of acyl coenzyme A:cholesterol acyltransferase activity in Chinese hamster ovary cells. 2. Effect of sterol endogenously synthesizedCatherine C. Y. Chang and T. Y. ChangCite this: Biochemistry 1986, 25, 7, 1700–1706Publication Date (Print):April 8, 1986Publication History Published online1 May 2002Published inissue 8 April 1986https://doi.org/10.1021/bi00355a039RIGHTS & PERMISSIONSArticle Views93Altmetric-Citations24LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (769 KB) Get e-Alertsclose Get e-Alerts

ACAT1 is normally a resident enzyme in the endoplasmic reticulum (ER). We previously showed that treating macrophages with denatured LDL causes a large increase in ER-derived, ACAT1-positive vesicles. Here, we isolated ER membranes and ER-derived vesicles to examine their ACAT enzyme activity in vitro. The results showed that when macrophages are grown under normal conditions, ACAT1 is located in high density ER membrane; its enzymatic activity is relatively low. Loading macrophages with cholesterol did not increase the total cellular ACAT1 protein content significantly but caused more ACAT1 to appear in ER-derived vesicles. These vesicles exhibit lower density and are associated with markers of both ER and the trans-Golgi network. When normalized with equal ACAT1 protein mass, the enzymatic activities of ACAT1 in ER-derived vesicles were 3-fold higher than those present in ER membrane. Results using reconstituted ACAT enzyme assay showed that the increase in enzyme activity in ER-derived vesicles is not due to an increase in the cholesterol content associated with these vesicles. Overall, our results show that macrophages cope with cholesterol loading by using a novel mechanism: they produce more ER-derived vesicles with elevated ACAT1 enzyme activity without having to produce more ACAT1 protein. ACAT1 is normally a resident enzyme in the endoplasmic reticulum (ER). We previously showed that treating macrophages with denatured LDL causes a large increase in ER-derived, ACAT1-positive vesicles. Here, we isolated ER membranes and ER-derived vesicles to examine their ACAT enzyme activity in vitro. The results showed that when macrophages are grown under normal conditions, ACAT1 is located in high density ER membrane; its enzymatic activity is relatively low. Loading macrophages with cholesterol did not increase the total cellular ACAT1 protein content significantly but caused more ACAT1 to appear in ER-derived vesicles. These vesicles exhibit lower density and are associated with markers of both ER and the trans-Golgi network. When normalized with equal ACAT1 protein mass, the enzymatic activities of ACAT1 in ER-derived vesicles were 3-fold higher than those present in ER membrane. Results using reconstituted ACAT enzyme assay showed that the increase in enzyme activity in ER-derived vesicles is not due to an increase in the cholesterol content associated with these vesicles. Overall, our results show that macrophages cope with cholesterol loading by using a novel mechanism: they produce more ER-derived vesicles with elevated ACAT1 enzyme activity without having to produce more ACAT1 protein. endoplasmic reticulum trans-Golgi network 2-methyl-β-cyclodextrin In mammalian cells, the cholesterol content in various membranes varies from the highest in the plasma membrane to the lowest in the endoplasmic reticulum (ER) membrane. Excess cellular cholesterol is converted to cholesteryl esters or is removed from cells by cellular cholesterol efflux (1Maxfield F.R. Tabas I. Role of cholesterol and lipid organization in disease.Nature. 2005; 438: 612-621Crossref PubMed Scopus (969) Google Scholar, 2Ikonen E. Cellular cholesterol trafficking and compartmentalization.Nat. Rev. Mol. Cell Biol. 2008; 9: 125-138Crossref PubMed Scopus (996) Google Scholar). The conversion of free cholesterol to cholesteryl ester is catalyzed by the enzyme ACAT. Two ACAT isoforms exist in mammals: ACAT1 and ACAT2 (3Buhman K.F. Accada M. Farese Jr, R.V. Mammalian acyl-CoA:cholesterol acyltransferases.Biochim. Biophys. Acta. 2000; 1529: 142-154Crossref PubMed Scopus (174) Google Scholar, 4Rudel L.L. Lee R. Cockman T. Structure, function, and regulation of ACAT.Curr. Opin. Lipidol. 2001; 12: 121-127Crossref PubMed Scopus (208) Google Scholar, 5Chang T.Y. Li B.L. Chang C.C. Urano Y. Acyl-coenzyme A:cholesterol acyltransferases.Am. J. Physiol. Endocrinol. Metab. 2009; 297: E1-E9Crossref PubMed Scopus (318) Google Scholar). ACAT1 is ubiquitously expressed in various tissues, while ACAT2 is mainly expressed in intestinal enterocytes and in hepatocytes (5Chang T.Y. Li B.L. Chang C.C. Urano Y. Acyl-coenzyme A:cholesterol acyltransferases.Am. J. Physiol. Endocrinol. Metab. 2009; 297: E1-E9Crossref PubMed Scopus (318) Google Scholar, 6Parini P. Davis M. Lada A.T. Erickson S.K. Wright T.L. Gustafsson U. Sahlin S. Einarsson C. Eriksson M. Angelin B. et al.ACAT2 is localized to hepatocytes and is the major cholesterol-esterifying enzyme in human liver.Circulation. 2004; 110: 2017-2023Crossref PubMed Scopus (168) Google Scholar, 7Song B.L. Wang C.H. Yao X.M. Yang L. Zhang W.J. Wang Z.Z. Zhao X.N. Yang J.B. Qi W. Yang X.Y. et al.Human acyl-CoA:cholesterol acyltransferase 2 gene expression in intestinal Caco-2 cells and in hepatocellular carcinoma.Biochem. J. 2006; 394: 617-626Crossref PubMed Scopus (39) Google Scholar). Macrophages play key roles in atherosclerosis. Under hyperlipidemic conditions, macrophages continuously internalize denatured/modified LDL. Cholesterol derived from internalized lipoproteins is converted to cholesteryl esters by ACAT1, the major ACAT isozyme in macrophages (8Miyazaki A. Sakashita N. Lee O. Takahashi K. Horiuchi S. Hakamata H. Morganelli P.M. Chang C.C. Chang T.Y. Expression of ACAT1 protein in human atherosclerotic lesions and cultured human monocytes-macrophages.Arterioscler. Thromb. Vasc. Biol. 1998; 18: 1568-1574Crossref PubMed Scopus (130) Google Scholar). Chronic exposure to denatured/modified LDL causes macrophages to become foamy in appearance; foamy macrophages are hallmarks of early atherosclerotic lesions. In advanced lesions, in addition to cholesteryl esters, free (unesterified) cholesterol also accumulates in macrophages. The excessive buildup of free cholesterol in membranes can cause cellular toxicity, especially in macrophages (9Warner G.J. Stoudt G. Bamberger M. Johnson W.J. Rothblat G.H. Cell toxicity induced by inhibition of acyl coenzyme A:cholessterol acyltransferase and accumulation of unesterified cholesterol.J. Biol. Chem. 1995; 270: 5772-5778Abstract Full Text Full Text PDF PubMed Scopus (225) Google Scholar, 10Tabas I. Consequences of cellular cholesterol accumulation: basic concepts and physiological implications.J. Clin. Invest. 2002; 110: 905-911Crossref PubMed Scopus (525) Google Scholar). In various cell types examined, ACAT1 is mainly located in the tubular ER (11Chang T.Y. Chang C.C.Y. Cheng D. Acyl-coenzyme A:cholesterol acyltransferase.Annu. Rev. Biochem. 1997; 66: 613-638Crossref PubMed Scopus (440) Google Scholar); in mouse macrophages and other cell types examined, 5–15% of the total immunoreactive ACAT1 signal is also present in ER-derived, perinuclear structure(s) near the trans-Golgi network (TGN) and the endocytic recycling compartment (12Khelef N. Soe T.T. Quehenberger O. Beatini N. Tabas I. Maxfield F.R. Enrichment of acyl coenzyme A:cholesterol O-acyltransferase near trans-golgi network and endocytic recycling compartment.Arterioscler. Thromb. Vasc. Biol. 2000; 20: 1769-1776Crossref PubMed Google Scholar). In human macrophages, when maintained in normal medium, the ACAT1 signal is mainly with the tubular ER; however, adding modified LDL to the growth medium of these cells caused up to 30–40% of the total ACAT1 immunoreactive signals to become associated with small, ER-derived vesicles 80–100 nm in diameter (13Sakashita N. Miyazaki A. Takeya M. Horiuchi S. Chang C.C.Y. Chang T.Y. Takahashi K. Localization of human acyl-coenzyme A:cholesterol acyltransferase-1 in macrophages and in various tissues.Am. J. Pathol. 2000; 156: 227-236Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). These studies suggest that in macrophages, ACAT1 can be associated with ER-derived vesicles, especially when cells are grown in cholesterol-rich conditions. These ACAT1-positive, ER-derived structures had not previously been isolated in vitro. In the current work, we used OptiPrep gradient ultracentrifugation to isolate various ACAT1-positive membrane fractions and evaluated the ACAT enzyme activities in these fractions. FBS, RPMI1640 medium, protease inhibitor cocktail, SDS, 2-methyl-β-cyclodextrin (mβCD), paraformaldehyde, BSA, saponin, primulin, and PMA were from Sigma. Penicillin-streptomycin solution was from Invitrogen. DTT and SuperSignal Chemiluminescent substrate were from Pierce. ProLong Antifade kit, anti-rabbit IgG Alexa Fluor 488, and anti-mouse IgG Alexa Fluor 568 were from Molecular Probes. The rabbit anti-human ACAT1 antibodies (DM10 and DM102) and the mouse anti-human ACAT1 monoclonal antibody were as previously described (14Chang C.C.Y. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. Regulation and immunolocalization of acyl-coenzyme A: cholesterol acyltransferase in mammalian cells as studied with specific antibodies.J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 15Chang C.C. Lee C.Y. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. Recombinant acyl-CoA:cholesterol acyltransferase-1 (ACAT-1) purified to essential homogeneity utilizes cholesterol in mixed micelles or in vesicles in a highly cooperative manner.J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). Monoclonal antibodies against syntaxin 6, calnexin, BiP, and GM130 were from BD Biosciences. Monoclonal antibody against sodium/potassium ATPase (Na/K ATPase) was from Upstate USA Inc. Iodixanol solution (OptiPrep) used to prepare density gradient was from Axis-Shield. Pansorbin beads for the immunoadsorption experiment were from Calbiochem. [3H]oleyl-CoA was prepared as described previously (15Chang C.C. Lee C.Y. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. Recombinant acyl-CoA:cholesterol acyltransferase-1 (ACAT-1) purified to essential homogeneity utilizes cholesterol in mixed micelles or in vesicles in a highly cooperative manner.J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar). The ACAT1 specific ACAT inhibitor K-604 was a generous gift from Kowa Co. Ltd. (Tokyo, Japan) (16Ikenoya M. Yoshinaka Y. Kobayashi H. Kawamine K. Shibuya K. Sato F. Sawanobori K. Watanabe T. Miyazaki A. A selective ACAT-1 inhibitor, K-604, suppresses fatty streak lesions in fat-fed hamsters without affecting plasma cholesterol levels.Atherosclerosis. 2007; 191: 290-297Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). LDL (density of 1.019–1.063 g/ml) and acetylated LDL were prepared from fresh human plasma as previously described (8Miyazaki A. Sakashita N. Lee O. Takahashi K. Horiuchi S. Hakamata H. Morganelli P.M. Chang C.C. Chang T.Y. Expression of ACAT1 protein in human atherosclerotic lesions and cultured human monocytes-macrophages.Arterioscler. Thromb. Vasc. Biol. 1998; 18: 1568-1574Crossref PubMed Scopus (130) Google Scholar). Aggregated LDL was prepared by vortex mixing LDL at maximal speed for 2 min as described previously (17Huang W. Ishii I. Zhang W-Y. Sonobe M. Kruth H.S. PMA activation of macrophages alters macrophage metabolism of aggregated LDL.J. Lipid Res. 2002; 43: 1275-1282Abstract Full Text Full Text PDF PubMed Google Scholar). Human monocytic cell line THP-1 was from ATCC. THP-1 cells were maintained in 150 mm dishes in medium A (RPMI1640 medium plus 10% FBS, 100 units/ml penicillin G, and 0.1 mg/ml streptomycin sulfate). THP-1 cells treated with 100 nM PMA in medium A for 7 days were used for experiments described here. Human monocytes were isolated from blood of healthy volunteers. Informed written consent was obtained from all volunteers in accordance with protocols approved by the Kumamoto University Hospital Review Board. Monocyte-derived macrophages, grown in medium A in 150 mm dishes for 9 days, were used. Cholesterol-rich macrophages were prepared by incubating macrophages with medium A containing 100 µg/ml of aggregated LDL, 100 µg/ml of acetylated LDL, or 250 µM of mβCD containing 16 µM cholesterol (mβCD/cholesterol complex) for 48 h. SDS (at 10% final) and DTT (at 0.1 M final) were added to OptiPrep fractions, immunoadsorbed samples, or whole cell lysates. After incubation at 37°C for 30 min, the solubilized proteins were analyzed by10% SDS-PAGE and subjected to immunoblotting as described previously (14Chang C.C.Y. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. Regulation and immunolocalization of acyl-coenzyme A: cholesterol acyltransferase in mammalian cells as studied with specific antibodies.J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). THP-1 and human macrophages grown in 6-well tissue culture plate with medium A with or without various additional cholesterol sources for 48 h were rinsed with PBS three times and dried at room temperature, then treated with 2 ml/well of hexane:2-propanol (3:2). The total cholesterol and free cholesterol contents present in the lipid extracts were determined by using the cholesterol determination kit following the manufacturer's instruction (Wako Chemical, Tokyo, Japan). The cholesteryl ester values were calculated by subtracting the free cholesterol values from the total cholesterol values. Cellular protein dissolved in 0.1 N sodium hydroxide was determined by using a BCA Protein Assay kit (Pierce) with BSA as a standard. Immunoadsorption was employed to isolate ACAT1-positive membranes using the procedure briefly described below: 30 µL of precleaned pansorbin beads were incubated with 6 µg of rabbit polyclonal ACAT1 antibodies DM102 or nonimmunized rabbit IgG in buffer for 2 h at 4°C. After washing, the beads were incubated with ACAT1-rich OptiPrep fraction in buffer containing 100 mM sodium chloride for 15 h at 4°C. After brief centrifugation in a microfuge, the pellet was isolated and washed thoroughly. Cells cultured in a 6-well tissue culture plate with sterile coverslips were washed with Buffer A [PBS (pH 7.2) containing 0.5% BSA and 0.01% saponins] and were fixed with 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) on ice for 30 min. After washing, the samples were pretreated with 5% goat serum and incubated with primary antibodies for 60 min, then incubated with anti-rabbit Alexa Fluor 488 and anti-mouse Alexa Fluor 568 for 60 min and scanned and recorded as digital images using Carl Zeiss LSM510 Meta or Olympus FV300 at a resolution of 1,024 × 1,024 pixels/frame using an objective lens with numerical aperture 1.40 and estimated optical thickness < 500 nm. For quantitative analysis of confocal images, at least 30 images were scanned at random; the colocalization coefficient between ACAT1 signal and various organelle markers as indicated were calculated by using the WinROOF image analysis software, version 5.7. Statistical analysis was carried out by performing Mann-Whitney U-test; P-values < 0.05 were considered statistically significant. Experiments were performed at 4°C. Cells grown in a 150 mm plate were scraped off into 1 ml homogenization buffer containing 0.25 M sucrose, 20 mM Tris buffer (pH 7.8), and protease inhibitor cocktail and were homogenized using a stainless steel tissue grinder (Dura-Grind, Wheaton). The postnuclear supernatant was loaded onto the top of a 9 ml, continuous 7.5–19.5% OptiPrep gradient in homogenization buffer and was fractionated by sedimentation velocity ultracentrifugation in a SW41 rotor at 200,000 g for 2 h; 19 equal fractions were collected from top to bottom. To perform the two-step sequential fractionation method, after the first step centrifugation, OptiPrep was added to the low-density, ACAT1-rich fraction (fraction 4) to reach 20% final concentration in 1 ml. The sample was placed at the bottom of a continuous 7.5–19.5% OptiPrep gradient and centrifuged at 200,000 g for 2 h. Afterwards, 19 equal fractions were collected from top to bottom. Each OptiPrep membrane fraction was used directly for ACAT enzyme activity determination using the nonreconstituted assay; in this assay, the cellular cholesterol associated with the membrane served as the enzyme substrate (15Chang C.C. Lee C.Y. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. Recombinant acyl-CoA:cholesterol acyltransferase-1 (ACAT-1) purified to essential homogeneity utilizes cholesterol in mixed micelles or in vesicles in a highly cooperative manner.J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 18Cadigan K.M. Chang T.Y. A simple method for reconstitution of CHO cell and human fibroblast ACAT activity into liposomes.J. Lipid Res. 1988; 29: 1683-1692Abstract Full Text PDF PubMed Google Scholar). In addition, in Fig. 2E, each membrane fraction was subjected to ACAT activity determination using both the nonreconstituted assay and the reconstituted vesicle assay. In the latter assay, the cholesterol present in the reconstituted vesicles serves as the enzyme substrate (15Chang C.C. Lee C.Y. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. Recombinant acyl-CoA:cholesterol acyltransferase-1 (ACAT-1) purified to essential homogeneity utilizes cholesterol in mixed micelles or in vesicles in a highly cooperative manner.J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (106) Google Scholar, 18Cadigan K.M. Chang T.Y. A simple method for reconstitution of CHO cell and human fibroblast ACAT activity into liposomes.J. Lipid Res. 1988; 29: 1683-1692Abstract Full Text PDF PubMed Google Scholar). To briefly describe the latter assay, each membrane fraction was first treated with the detergent 2% CHAPS and 1 M potassium chloride; ACAT solubilized in detergent was reconstituted into vesicles by diluting the detergent treated extract into a large excess of preformed phospholipid vesicles with defined cholesterol/phosphatidylcholine molar ratio (at 0.2). For each assay employed, the assay was initiated by adding 20 µL of solution containing 10 nmol of [3H]oleoyl-CoA and 10 nmol of fatty acid-free BSA, and the reaction mixture was incubated at 37°C for up to 30 min. The enzyme activity was linear with time within 30 min. The ACAT1-specific ACAT inhibitor K-604 was employed at final concentration of 1 µM (16Ikenoya M. Yoshinaka Y. Kobayashi H. Kawamine K. Shibuya K. Sato F. Sawanobori K. Watanabe T. Miyazaki A. A selective ACAT-1 inhibitor, K-604, suppresses fatty streak lesions in fat-fed hamsters without affecting plasma cholesterol levels.Atherosclerosis. 2007; 191: 290-297Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). We treated macrophages with aggregated LDL or with other cholesterol donors to promote foam cell formation in vitro. When PMA-activated THP-1 cells were treated with various cholesterol donors for 48 h, cellular free cholesterol content increased from 10.3 to 23.0 (acetylated LDL), 23.4 (aggregated LDL), or 19.9 (mβCD/cholesterol complex) µg/mg cellular protein; cellular cholesteryl ester content increased from 8.0 to 79.6 (acetylated LDL), or 120 (aggregated LDL), or 121 (mβCD/cholesterol complex) µg/mg protein (Fig. 1A, left panels). Likewise, when primary human macrophages grown in medium A were treated with aggregated LDL, cellular cholesterol content increased from 10.4 to 34.1 µg/mg protein; cholesteryl ester content increased from 5.1 to 148 µg/mg protein (Fig. 1A, right panels). After 48 h of aggregated LDL treatment, the protein content of ACAT1 was modestly increased in the THP-1 macrophages but not in the primary human macrophages (Fig. 1B). We next employed subcellular fractionation to isolate the ACAT1-containing membranes in THP-1 macrophages. The results showed that in basal “medium A” conditions, most of the ACAT1 signal appeared in the medium-density fractions (fractions 8–11) where the ER marker protein calnexin and the TGN marker protein syntaxin 6 were found (Fig. 2A). In contrast, after incubating cells with aggregated LDL, most of the ACAT1 signal and the calnexin signal shifted to lower-density fractions (fractions 4–7); interestingly, a significant portion of the syntaxin 6 signal also moved to the lighter-density fractions (Fig. 2B). Similar changes in the densities of the ACAT1-containing membranes were observed when the THP-1 macrophages were treated for 2 days with 100 µg/ml of acetylated LDL (Fig. 2C) or with mβCD/cholesterol complex (Fig. 2D). We next examined the ACAT enzymatic activities in each of the OptiPrep membrane fractions shown in Fig. 2A–D by using the nonreconstituted assay (described in Methods). This assay uses cholesterol associated with each membrane fraction as the enzyme substrate. The results (Figs. 2A–D; lower panels) showed that in cells grown in basal conditions, the ACAT activities in various membrane fractions were very low (Fig. 2A); in cells treated with various cholesterol donors, the lighter-density membranes contained higher ACAT activity than the medium-density membranes (Figs. 2BndashD). We also found that incubating the THP-1 macrophages with aggregated LDL for only 8 h is sufficient to produce the lower-density membranes with elevated ACAT activity (Fig. 2F). To test if the increase in ACAT activity in the less-dense membranes might be due to increases in cholesterol content in these membranes, we repeated the experiment shown in Fig. 2B and examined the ACAT activity in each fraction by using both the nonreconstituted assay and the reconstituted vesicle assay; the latter assay (described in Methods) uses cholesterol present in the reconstituted lipid vesicles as the enzyme substrate. The results (Fig. 2E) showed that the ACAT activities in the lower-density membranes remained elevated when exogenous cholesterol was used as the enzymatic substrate, demonstrating that the elevation in ACAT activity in these membranes is not caused by an increase in cholesterol content in these membranes. To evaluate the ACAT1 enzyme activity based on ACAT1 protein content, we repeated the experiment shown in Fig. 2B, loaded samples from OptiPrep fractions 4–6 and 9–11 that provided equal amount of ACAT activity in vitro, and compared their relative ACAT1 protein content by immunoblotting. The results (Fig. 2G) showed that at equal ACAT1 protein mass, the lower-density membrane fractions contained significantly higher ACAT enzymatic activity than the medium-density membrane fractions (by approximately 3-fold). We also found that treating cell homogenates of macrophages grown in medium A with mβCD/cholesterol complex produced high ACAT enzyme activity in vitro but failed to produce the ACAT1-containing membranes that exhibited lesser density (results not shown). Also, treating THP-1 macrophages with aggregated LDL and with a specific chemical ACAT inhibitor still produced the same lighter-density ER-derived fraction, while the ACAT activities in these fractions were effectively inhibited (results not shown). Together, these data indicate that it is the increase in cellular cholesterol, not cellular cholesteryl ester, that produces the lighter-density membranes with elevated ACAT activity and that the action of cholesterol requires cellular integrity. We next employed confocal microscopy to monitor changes in ACAT1 localization in THP-1 (Fig. 3A, B, left panels) and primary human macrophages (Fig. 3A, B, right panels). The results show that in cells grown in medium A, ACAT1 signal was mainly located in the ER area; however, in cells treated with aggregated LDL, a significant amount of ACAT1 signal appeared in the juxtanuclear position (Fig. 3A, green). We next performed double immunofluorescence staining using ACAT1 antibodies or antibodies against syntaxin 6 (a protein mainly localized in the tubulovesicular element of TGN) (19Bock J.B. Klumperman J. Davanger S. Scheller R.H. Syntaxin 6 functions in trans-Golgi network vesicle trafficking.Mol. Biol. Cell. 1997; 8: 1261-1271Crossref PubMed Scopus (248) Google Scholar). The results showed that in cells grown in medium A, only 6% apparent colocalization occurred between the ACAT1 signal and the Golgi marker (Fig. 3B, blue bars). In the cholesterol-rich macrophages, approximately 25% of the ACAT1 signal coincided with the Golgi marker (Fig. 3B, yellow bars). The colocalization coefficients between ACAT1 and syntaxin 6 are summarized in Fig. 3B. In cholesterol-rich cells, part of the ER protein marker BiP was also shifted to the juxtanuclear Golgi area and exhibited significant colocalization with the syntaxin 6 signal (results not shown). Additional experiments showed that in THP-1 macrophages grown in medium A with or without aggregated LDL, the ACAT1 signals extensively colocalized with the ER marker BiP signal (results not shown). To test if the findings made in THP-1 macrophages may also occur in human macrophages, we incubated human monocyte-derived macrophages in medium A or in medium A plus aggregated LDL for 2 days, then examined the ACAT1 localization by confocal microscopy. The results (Fig. 3A, B; right panels) showed that in medium A, the ACAT1 signal did not colocalize significantly with the syntaxin 6 signal, whereas in medium with aggregated LDL present, significant partial colocalization between these two signals occurred. The calculated colocalization coefficients between ACAT1 and syntaxin 6 are given in Fig. 3B, right panel. After cholesterol loading, the degree of apparent colocalization between the ER marker BiP and the TGN marker syntaxin 6 also increased (results not shown). Together, these observations suggest that in cholesterol-rich THP-1 macrophages or primary human macrophages, a significant amount of ACAT1 may be located near TGN. To provide more evidence for a tight association of ACAT1 with a specific fraction of Golgi-related membrane(s), we first purified the ACAT1-positive, lower-density membranes in cholesterol-loaded THP-1 macrophages by OptiPrep gradient centrifugation; we then subjected the purified fractions to a second OptiPrep gradient centrifugation (described in Methods). After the second centrifugation step, the ACAT1-positive fractions remained in the lower-density fractions. The same fractions also contained the TGN marker syntaxin 6, the ER marker BiP, and the plasma membrane marker Na/K ATPase, but they lacked the cis-Golgi matrix marker GM130 (present in the higher-density fractions after the second centrifugation step) (Fig. 4A, upper panel). These ACAT1-positve fractions still retained high ACAT enzymatic activity in vitro (Fig. 4A, lower panel). After the second centrifugation, we analyzed the lipid contents present in various OptiPrep fractions. The lower-density fractions rich in ACAT enzyme activities were also rich in cholesterol and in cholesteryl esters (Fig. 4A, upper panel). Next, we further purified these ACAT1-positive vesicles after two-step subcellular fractionation by performing immunoadsorption using Pansorbin beads containing ACAT1 specific antibodies. After immunoadsorption, the samples were analyzed by Western blotting. The results show (Fig. 4B) that when ACAT1 antibodies were employed, the pelleted membrane fraction contained ACAT1, the ER marker proteins (calnexin and BiP), and syntaxin 6, but it did not contain Na/K ATPase. When the nonimmunized rabbit IgG was employed as a negative control, none of the organelle markers were present in the pellet fraction. These results suggest that the highly purified ACAT1-positive membrane fraction is tightly associated with the ER marker proteins as well as the TGN marker protein syntaxin 6. To test the validity of findings made in THP-1macrophages, we grew human monocyte-derived macrophages in normal conditions (medium A) or in cholesterol-rich conditions (by incubating with 100 µg/ml of aggregated LDL for 48 h) and used these cells to perform similar experiments as described earlier. The results showed that when cells were grown in medium A, a small amount of ACAT1 as well as the ER marker calnexin and the TGN marker syntaxin 6 were already detectable in lighter density fractions 4–6 (Fig. 5A). In cholesterol-rich conditions, more ACAT1 protein and more ER marker protein calnexin appeared in the lower-density fractions, and the ACAT1 protein present in these fractions exhibited higher enzyme activity in vitro (Fig. 5B). Lipid-laden human and mouse macrophages also express ACAT2 (20Sakashita N. Miyazaki A. Chang C.C.Y. Morganelli P. Chang T.Y. Nakamura O. Kiyota E. Hakamata H. Satoh M. Tamagawa H. et al.The presence of ACAT2 in human and mouse macrophages: in vivo and in vitro studies.Lab. Invest. 2003; 83: 1569-1581Crossref PubMed Scopus (44) Google Scholar). We performed immunoblotting analysis and found that the lower-density membranes only contained the ACAT1 signal but not the ACAT2 signal (results not shown). To validate this finding, we employed an ACAT1-specific inhibitor called K-604. Compound K-604 preferentially inhibits ACAT1 over ACAT2 by more than 200-fold; at 1 µM, it inhibits 80% of the ACAT1 activity without inhibiting the ACAT2 activity. The results showed that K-604 used at 1 µM inhibited approximately 90% of the ACAT activity associated with the lower-density membranes (Fig. 5C). These results demonstrate that the ACAT enzyme activity displayed in these lighter-density membranes mainly came from ACAT1, not ACAT2. We next performed immunoadsorption experiments, using the postnuclear supernatants as the starting material. The results (Fig. 5D) showed that the ACAT1-positive membranes from cells in cholesterol-rich conditions were associated with the TGN marker syntaxin 6 (Fig. 5D, lower panels), while similar membranes from cells grown in medium A contained a negligible amount of syntaxin 6 (Fig. 5D, upper panels). These results confirm our previous results obtained in cholesterol-loaded THP-1 macrophages. ACAT1 is located in the ER and ER-derived vesicles (12Khelef N. Soe T.T. Quehenberger O. Beatini N. Tabas I. Maxfield F.R. Enrichment of acyl coenzyme A:cholesterol O-acyltransferase near trans-golgi network and endocytic recycling compartment.Arterioscler. Thromb. Vasc. Biol. 2000; 20: 1769-1776Crossref PubMed Google Scholar, 13Sakashita N. Miyazaki A. Takeya M. Horiuchi S. Chang C.C.Y. Chang T.Y. Takahashi K. Localization of human acyl-coenzyme A:cholesterol acyltransferase-1 in macrophages and in various tissues.Am. J. Pathol. 2000; 156: 227-236Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). We had previously shown that upon loading macrophages with denatured LDL, there is an increase in the ER-derived, ACAT1-positive vesicles (13Sakashita N. Miyazaki A. Takeya M. Horiuchi S. Chang C.C.Y. Chang T.Y. Takahashi K. Localization of human acyl-coenzyme A:cholesterol acyltransferase-1 in macrophages and in various tissues.Am. J. Pathol. 2000; 156: 227-236Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). To begin to pursue the biological significance of this finding, in the current manuscript, we first demonstrated that in macrophages, cholesterol itself (delivered as a soluble complex in cyclodextrin) could trigger the formation of the ER-derived vesicles. We next isolated these ER-derived vesicles in vitro and showed that the catalytic activity of ACAT1 present in these vesicles is increased; the increase in activity is not due to an increase in cholesterol content associated in these membranes. These results show that macrophages cope with cholesterol loading by using a novel mechanism: they produce more ER-derived vesicles that express elevated ACAT1 enzyme activity without having to produce more ACAT1 protein. Currently, we do not know the mechanism(s) responsible for the cholesterol-dependent production of these ER-derived vesicles. We propose the following scenario as a starting point for future investigations: recent evidence suggests that ER membranes may be composed of various microdomains with distinct protein and lipid composition (21Baumann O. Walz B. Endoplasmic reticulum of animal cells and its organization into structural and functional domains.Int. Rev. Cytol. 2001; 205: 149-214Crossref PubMed Scopus (336) Google Scholar, 22Shibata Y. Voeltz G.K. Rapoport T.A. Rough sheets and smooth tubules.Cell. 2006; 126: 435-439Abstract Full Text Full Text PDF PubMed Scopus (313) Google Scholar). In various cell types, tubular ER and juxtanuclear ER-derived structures may coexist, with the tubular ER being the dominant form. Overloading of cholesterol in cells, especially in the macrophages, may somehow induce the formation of small, ER-derived vesicles, perhaps by an unknown ER fragmentation process. This process may allow the cholesterol-rich component of the ER to segregate from the rest of the ER, thus protecting the nonfragmented ER from being overloaded with cholesterol. ACAT1 present in the small, ER-derived vesicles may esterify cholesterol efficiently, preventing the accumulation of excess free cholesterol in cholesterol-rich subcellular organelles, including the TGN. This scenario is consistent with the hypothesis by Khelef et al. (12Khelef N. Soe T.T. Quehenberger O. Beatini N. Tabas I. Maxfield F.R. Enrichment of acyl coenzyme A:cholesterol O-acyltransferase near trans-golgi network and endocytic recycling compartment.Arterioscler. Thromb. Vasc. Biol. 2000; 20: 1769-1776Crossref PubMed Google Scholar), who suggested that the proximity of the ACAT1-positive, ER-derived structure(s) with the cholesterol-rich organelles (TGN and endocytic recycling compartment) may provide a mechanism for localized control of cholesterol content of the ERC/TGN membranes. What causes the ACAT1 in the lower-density membranes to be more active than the ACAT1 in the higher-density ER membranes also remains unknown. It is possible that the higher-density ER membrane may contain an endogenous ACAT1 inhibitor and/or that the lower-density membranes may contain an endogenous ACAT1 activator. We are currently pursuing these possibilities. We thank members of the T-Y.C. laboratory for discussion during the course of this work. We are also grateful to Helina H. Josephson and Stephanie Murphy for expert editing of this manuscript.

Niemann-Pick type C (NPC) disease is a fatal neurodegenerative disorder characterized by over-accumulation of low-density lipoprotein-derived cholesterol and glycosphingolipids in late endosomes/lysosomes (LE/L) throughout the body. Human mutations in either NPC1 or NPC2 genes have been directly associated with impaired cholesterol efflux from LE/L. Independent from its role in cholesterol homeostasis and its NPC2 partner, NPC1 was unexpectedly identified as a critical player controlling intracellular entry of filoviruses such as Ebola. In this study, a yeast three-hybrid system revealed that the NPC1 cytoplasmic tail directly interacts with the clathrin adaptor protein AP-1 via its acidic/di-leucine motif. Consequently, a nonfunctional AP-1A cytosolic complex resulted in a typical NPC-like phenotype mainly due to a direct impairment of NPC1 trafficking to LE/L and a partial secretion of NPC2. Furthermore, the mislocalization of NPC1 was not due to cholesterol accumulation in LE/L, as it was not rescued upon treatment with Mβ-cyclodextrin, which almost completely eliminated intracellular free cholesterol. Our cumulative data demonstrate that the cytosolic clathrin adaptor AP-1A is essential for the lysosomal targeting and function of NPC1 and NPC2.

Objective— To investigate the role of acyl-CoA:cholesterol acyltransferase 1 (ACAT1) in hematopoiesis. Approach and Results— ACAT1 converts cellular cholesterol to cholesteryl esters for storage in multiple cell types and is a potential drug target for human diseases. In mouse models for atherosclerosis, global Acat1 knockout causes increased lesion size; bone marrow transplantation experiments suggest that the increased lesion size might be caused by ACAT1 deficiency in macrophages. However, bone marrow contains hematopoietic stem cells that give rise to cells in myeloid and lymphoid lineages; these cell types affect atherosclerosis at various stages. Here, we test the hypothesis that global Acat1 −/− may affect hematopoiesis, rather than affecting macrophage function only, and show that Acat1 −/− mice contain significantly higher numbers of myeloid cells and other cells than wild-type mice. Detailed analysis of bone marrow cells demonstrated that Acat1 −/− causes a higher proportion of the stem cell–enriched Lin − Sca-1 + c-Kit + population to proliferate, resulting in higher numbers of myeloid progenitor cells. In addition, we show that Acat1 −/− causes higher monocytosis in Apoe −/− mouse during atherosclerosis development. Conclusions— ACAT1 plays important roles in hematopoiesis in normal mouse and in Apoe −/− mouse during atherosclerosis development.

Abstract Single nucleotide polymorphisms ( SNP s) within the regulatory elements of a gene can alter gene expression, making these SNP s of prime importance for candidate gene association studies. We aimed to determine whether such regulatory variants are associated with clinical outcomes in three cohorts of patients with prostate cancer. We used Regulome DB to identify potential regulatory variants based on in silico predictions and reviewed genome‐wide experimental findings. Overall, 131 putative regulatory SNP s with the highest confidence score on predicted functionality were investigated in two independent localized prostate cancer cohorts totalling 458 patients who underwent radical prostatectomy. The statistically significant SNP s identified in these two cohorts were then tested in an additional cohort of 504 patients with advanced prostate cancer. We identified one regulatory SNP s, rs1646724, that are consistently associated with increased risk of recurrence in localized disease ( P = .003) and mortality in patients with advanced prostate cancer ( P = .032) after adjusting for known clinicopathological factors. Further investigation revealed that rs1646724 may affect expression of SLC 35B4 , which encodes a glycosyltransferase, and that down‐regulation of SLC 35B4 by transfecting short hairpin RNA in DU 145 human prostate cancer cell suppressed proliferation, migration and invasion. Furthermore, we found increased SLC 35B4 expression correlated with more aggressive forms of prostate cancer and poor patient prognosis. Our study provides robust evidence that regulatory genetic variants can affect clinical outcomes.

We have previously shown that acyl-coenzyme A: cholesterol acyltransferase-1 (ACAT-1) protein content increases significantly during the human monocyte-macrophage differentiation process. To gain further insight, we used undifferentiated human monocytic THP-1 cells as a model system with which to examine whether ACAT-1 mRNA and protein content can be increased by treating cells with 1,25-dihydroxyvitamin D3 [1,25-(OH)2D3] or with 9-cis-retinoic acid (9-cis-RA), two agents known to upregulate the expression of various genes during the monocyte-macrophage differentiation process. Immunoblot analysis with anti-human ACAT-1 antibodies revealed that ACAT-1 protein was increased by 2.6-fold, using 1,25-(OH)2D3 at a physiological concentration (100 pM). ACAT-1 protein was also increased when using 9-cis-RA, but only at relatively high concentrations (0.1–1 μM). Northern blot analysis revealed that among the four ACAT-1 mRNA transcripts (2.8, 3.6, 4.2, and 7.0 kb) examined, only the 2.8- and 3.6-kb transcripts were selectively increased. On the basis of enzyme assays in vitro, ACAT activity was increased 3.0-fold by using 100 nM 1,25-(OH)2D3, and 1.8-fold by using 1 μM 9-cis-RA. Together, our results suggest that 1,25-(OH)3 participates in ACAT-1 gene expression during the monocyte-macrophage differentiation process. —Maung, K. K., A. Miyazaki, H. Nomiyama, C. C. Y. Chang, T-Y. Chang, and S. Horiuchi. Induction of acyl-coenzyme A:cholesterol acyltransferase-1 by 1,25-dihydroxyvitamin D3 or 9-cis-retinoic acid in undifferentiated THP-1 cells.

We report the chemical synthesis of a new photoactivatable cholesterol analog 7,7-azocholestanol (AC) and its linoleate ester (ACL). We also examined the biochemical properties of the sterol and its ester by employing several different mutant Chinese hamster ovary (CHO) cell lines with defined abnormalities in cholesterol metabolism as tools. AC mimics cholesterol in supporting the growth of a mutant cell line (M19) that requires cholesterol for growth. In normal cells, tritiated ACL present in low-density lipoprotein (LDL) was hydrolyzed and reesterified in a manner similar to tritiated cholesteryl linoleate (CL) in LDL. Also, in the mutant cell line (AC29) lacking the enzyme acyl-coenzyme A:cholesterol acyltransferase or in the mutant cell line (CT60) defective in the Niemann-Pick type C1 protein, the hydrolysis of ACL in LDL was normal, but the reesterification of the liberated AC was defective. Therefore, the metabolism of ACL in LDL is very similar to that of CL in LDL. Tritium-labeled AC delivered to intact CHO cells as a cyclodextrin complex was shown to photoaffinity label several discrete polypeptides, including caveolin-1.These results demonstrate AC as an effective reagent for studying cholesterol-protein interactions involved in intracellular cholesterol trafficking. We report the chemical synthesis of a new photoactivatable cholesterol analog 7,7-azocholestanol (AC) and its linoleate ester (ACL). We also examined the biochemical properties of the sterol and its ester by employing several different mutant Chinese hamster ovary (CHO) cell lines with defined abnormalities in cholesterol metabolism as tools. AC mimics cholesterol in supporting the growth of a mutant cell line (M19) that requires cholesterol for growth. In normal cells, tritiated ACL present in low-density lipoprotein (LDL) was hydrolyzed and reesterified in a manner similar to tritiated cholesteryl linoleate (CL) in LDL. Also, in the mutant cell line (AC29) lacking the enzyme acyl-coenzyme A:cholesterol acyltransferase or in the mutant cell line (CT60) defective in the Niemann-Pick type C1 protein, the hydrolysis of ACL in LDL was normal, but the reesterification of the liberated AC was defective. Therefore, the metabolism of ACL in LDL is very similar to that of CL in LDL. Tritium-labeled AC delivered to intact CHO cells as a cyclodextrin complex was shown to photoaffinity label several discrete polypeptides, including caveolin-1. These results demonstrate AC as an effective reagent for studying cholesterol-protein interactions involved in intracellular cholesterol trafficking. Biological membranes consist of lipids and proteins. To study lipid-protein interactions, an effective approach has been to affinity-label specific lipid binding proteins by employing UV cross-linkings using various radiolabeled, photoactivatable lipid molecules (1Brunner J. Use of photocrosslinkers in cell biology.Trends Cell Biol. 1996; 6: 154-157Abstract Full Text PDF PubMed Scopus (51) Google Scholar). For photolabile-steroid analogs, the preparation and properties of many steroid diaziridines and diazirines (which produce the carbene intermediates upon photolysis) were reported in the 1960s (2Church R.F.R. Weiss M.J. Synthesis and properties of small functionalized diazirine molecules. Some observations on the reaction of a diaziridine with the iodine-iodide ion system.J. Org. Chem. 1970; 35: 2465-2471Crossref Scopus (102) Google Scholar). Using the same synthetic procedures, Kramer and Kurz (3Kramer W. Kurz G. Photolabile derivatives of bile salts. Synthesis and suitability for photoaffinity labeling.J. Lipid Res. 1983; 24: 910-923Abstract Full Text PDF PubMed Google Scholar) reported the chemical synthesis of several photolabile analogs of bile salts suitable for photoaffinity labeling. Taylor et al. (4Taylor F.R. Kandutsch A.A. Anzalone L. Phirwa S. Spencer T.A. Photoaffinity labeling of the oxysterol receptor.J. Biol. Chem. 1988; 263: 2264-2269Abstract Full Text PDF PubMed Google Scholar) reported the synthesis of labeled oxysterol 7,7-azo-cholestane-3β, 25-diol, and achieved successful labeling and identification of the oxysterol receptor in mouse L-cell extracts. Very recently, Thiele et al. (5Thiele C. Hannah M.J. Fahrenholz F. Huttner W.B. Cholesterol binds to synaptophysin and is required for biogenesis of synaptic vesicles.Nat. Cell Biol. 2000; 2: 42-49Crossref PubMed Scopus (456) Google Scholar) reported the chemical synthesis of a photolabile cholesterol analog 6,6-azocholestanol (also called photocholesterol), and its use in the identification of specific cholesterol binding proteins in neuronal cells (5Thiele C. Hannah M.J. Fahrenholz F. Huttner W.B. Cholesterol binds to synaptophysin and is required for biogenesis of synaptic vesicles.Nat. Cell Biol. 2000; 2: 42-49Crossref PubMed Scopus (456) Google Scholar). Photocholesterol has also been used to identify specific sterol binding proteins in Caenorhabditis elegans (6Matyash V. Geier C. Henske A. Mukherjee S. Hirsh D. Thiele G.B. Maxfield F.R. Kurzchalia T.V. Distribution and transport of cholesterol in C. elegans.Mol. Biol. Cell. 2001; 12: 1725-1736Crossref PubMed Scopus (138) Google Scholar). The biophysical behavior of photocholesterol in model membranes has been shown to be very similar to that of cholesterol (7Mintzer E.A. Waarts B.L. Wilschut J. Bittman R. Behavior of a photoactivatable analog of cholesterol, 6-photocholesterol, in model membranes.FEBS Lett. 2002; 510: 181-184Crossref PubMed Scopus (31) Google Scholar). In mammalian cells, the major exogenous cholesterol source comes in the form of LDL. Normally, LDL contains cholesteryl linoleate (CL) as its major lipid cargo. LDL binds to the LDL receptor in the plasma membrane (PM); the complex then internalizes and enters the hydrolytic/lysosomal compartment where CL is hydrolyzed. The free cholesterol liberated from hydrolysis eventually enters an intracellular compartment that contains the Niemann-Pick type C1 protein (NPC1). From this compartment, cholesterol recycles back to the PM, or moves to the endoplasmic reticulum (ER) for reesterification by the enzyme ACAT (8Pentchev P.G. Vanier M.T. Suzuki K. Patterson M.C. Niemann-Pick disease type C: a cellular cholesterol lipidosis.in: Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. McGraw-Hill, Inc, New York1995: 2625-2639Google Scholar, 9Liscum L. Klansek J.J. Niemann-Pick disease type C.Curr. Opin. Lipidol. 1998; 9: 131-135Crossref PubMed Scopus (96) Google Scholar, 10Cruz J.C. Sugii S. Yu C. Chang T.Y. Role of Niemann-Pick type C1 protein in intracellular trafficking of low density lipoprotein derived cholesterol.J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 11Cruz J.C. Chang T.Y. Fate of endogenously synthesized cholesterol in Niemann-Pick type C1 cells.J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 12Lange Y. Ye J. Rigney M. Steck T. Cholesterol movement in Niemann-Pick type C cells and in cells treated with amphiphiles.J. Biol. Chem. 2000; 275: 17468-17475Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar); (reviewed in 13Ioannou Y.A. Multiple drug permeases and subcellular cholesterol transport.Nat. Rev. Mol. Cell Biol. 2001; 2: 657-668Crossref PubMed Scopus (81) Google Scholar). Whether photocholesterol could be incorporated into LDL, and if so, whether the fate of LDL-derived photocholesterol in mammalian cells is similar to that of LDL-derived cholesterol has not been examined. In this manuscript, we report the chemical synthesis of a new photoactivatable cholesterol analog 7,7-azocholestanol (AC) and its linoleate ester (ACL), as well as a method to label AC with 3H at high-specific radioactivity. We also examined the biochemical properties of the sterol and its ester by employing several different mutant Chinese hamster ovary (CHO) cell lines with defined abnormalities in cholesterol metabolism as tools. The results show that the fate of LDL-bound ACL in CHO cells is very similar to that of LDL-bound CL. An additional result showed that labeled AC delivered to intact CHO cells as a cyclodextrin complex was able to cross-link several discrete polypeptides after UV-irradiation. Infrared Spectra were determined on a Perkin-Elmer spectrophotometer. 1H-NMR spectra were determined on a 300 MHz Varian spectrometer, with deuteriochloroform as the solvent. UV spectroscopy was performed with a Gilford spectrometer with ethanol as the solvent. Composition analysis was performed at Atlantic Microlab, Norcross, GA. Organic solvents are from Aldrich, in HPLC grade whenever available. Unless stated otherwise, all chemical reagents used for synthesis were from Aldrich. The synthesis starting from 5-cholestan-3β-ol-7-one (I) to 7,7-azo-5α-cholestan-3α-[3H]3β-ol (VI) ([3H]AC) is outlined as follows. Unless stated otherwise, the purity of all the compounds synthesized was analyzed by TLC, and was found to be at least 90% pure. 5α-Cholestan-3β-ol-7-one (I) in the amount of 384.5 mg (0.96 mmol) was dissolved in 100 ml of anhydrous 2-propanol and slowly added to a vessel containing 86.5 mg of 10% palladium on carbon (from Eastman Kodak). The mixture was hydrogenated at room temperature for 110 min. The catalyst was removed by filtration through celite. Rotary evaporation removed the solvent, leaving flaky white crystals in nearly 100% yield. Following the procedure of Church and Weiss (2Church R.F.R. Weiss M.J. Synthesis and properties of small functionalized diazirine molecules. Some observations on the reaction of a diaziridine with the iodine-iodide ion system.J. Org. Chem. 1970; 35: 2465-2471Crossref Scopus (102) Google Scholar), a solution of 266 mg (0.66 mol) ketone (II) was dissolved in 30 ml anhydrous methanol under nitrogen and cooled to 0°C. Dry ammonia was bubbled through for 2 h. From here on all the reactions were carried out in the dark. The mixture was stirred, and a solution of 350 mg (3.1 mol) hydroxylamine-O-sulfonic acid in 5 ml anhydrous methanol was slowly added over 20 min. The resulting cloudy mixture was stirred at 0°C for 1 h, then at room temperature for 5–12 h. The white precipitate formed was removed by filtration through a glass wool-plugged funnel and the filtrate was evaporated to give the diaziridine intermediate 5α-cholestan-7,7-hydrazi-3β-ol (III) as a white residue. The intermediate compound (III) was quickly dissolved in a mixture of 25 ml dry methanol and 1 ml triethylamine. While vigorously stirring, the mixture was treated with 400 mg iodine in 5 ml dry methanol so the slightly brown iodine color persisted. Sodium dithionite was slowly added to reduce the excess iodine. The reaction mixture was washed with saturated sodium chloride solution, then with water, dried over magnesium sulfate, then evaporated to dryness to yield a yellowish-white residue. TLC analysis indicated that the residue was a mixture of three or four organic components. Flash chromatography of the mixture in a 20 mm × 15 cm column of silica gel 60 using the solvent system hexane-ethyl acetate (1:2, v/v) yielded pure compound IV with approximately 60% yield. Following the procedure from Corey and Suggs (14Corey E.J. Suggs J.W. Pyridinium chlorochromate. An efficient reagent for oxidation of primary and secondary alcohols to carbonyl compounds.Tetrahedron Letters. 1975; : 2647-2650Crossref Scopus (2697) Google Scholar), 90 mg (0.42 mmol) pyridinium chlorochromate (PCC) was suspended in 0.67 ml anhydrous dichloromethane. A solution of 115.2 mg 7,7-azo-5α-cholestan-3β-ol (IV) in 0.5 ml dichloromethane was added to the PCC mixture. The reaction mixture stood with stirring at room temperature for 1–2 h, then was diluted with 5 vol of anhydrous ethyl ether. The solvent was decanted and the residue washed twice with anhydrous ethyl ether. The organic phases were combined and filtered through Florisil. The filtrate was rotary evaporated and white crystals of compound (V) were obtained in nearly quantitative yield. Based on the procedure by Kramer and Kurz (3Kramer W. Kurz G. Photolabile derivatives of bile salts. Synthesis and suitability for photoaffinity labeling.J. Lipid Res. 1983; 24: 910-923Abstract Full Text PDF PubMed Google Scholar), a 1 M stock solution of 100 mCi NaB[3H]4 in H2O (0.3783 mg, 10 μmol, specific activity: 5.2 Ci/mmol, from Amersham) was prepared; 10 μl was pipetted into the reaction vial and lyophilized. Next, 4.2 mg (10 μmol) of the 7,7-azo ketone (V) was dissolved in 400 μl ethanol and 30 μl H2O. The ketone solution was added to the vial containing the solid NaB-[3H]4. The mixture was stirred for several minutes, then allowed to occur at room temperature for 2.5 h. The products consisted of the 3α-ol and the 3β-ol (VI) isomers. The 3α-ol isomer (as a byproduct of the reaction) migrated slightly faster than the 3β-ol isomer (VI) on TLC with hexane-ethyl acetate (1:2, v/v), with an Rf differential of approximately 0.1. The 3β-alcohol isomer (VI) was isolated in the pure form by extraction from the silica gel after TLC separation on a 20 × 20 cm preadsorbent 250 μm silica gel plate (from J. T. Baker). After extraction with 4 vol of methanol followed by 4 vol of dichloromethane, the solvent was rotary evaporated to yield [3H]AC in ∼60% yield. The purified compound was stored in methanol at −80°C. TLC analysis revealed that no detectable autoradiololysis of [3H]AC (VI) occurred for at least 2 years. The non-radiochemical compound (VI) was synthesized in the same manner using nonradiochemical NaBH4. Based on the procedure of Lentz et al. (15Lentz B.R. Barenholz Y. Thompson T.E. A simple method for the synthesis of cholesterol esters in high yield.Chem. Phys. Lipids. 1975; 15: 216-221Crossref PubMed Scopus (32) Google Scholar), the solvent (methanol) from an amber vial containing the purified [3H]AC (1 mg, 2.4 μmol) was evaporated under nitrogen and resuspended in 88 μl benzene. An 80 μl of 100 mM linoleic anhydride in benzene (4.3 mg, 8.0 μmol) was added to the [3H]AC solution. Two microliters of 0.1% 2,6-di-tert-butyl-p-cresol (BHT) in benzene (final concentration 0.001% BHT), and 30 μl of 1 mg/ml dimethyl amino pyridine in benzene (30 μg, 250 nmol) was added to the amber vial. The solution was briefly flushed with nitrogen, capped tight, and stirred overnight. The resultant crude product contained 7,7-azo-5α-cholestan-3β-[3H]3α-ol linoleate ([3H]ACL). The crude product was purified by preparative TLC using a preparative TLC Si1000 plate (J. T. Baker), developed in hexane-benzene (1:1; v/v). Non-radiochemical azoCL was synthesized by the same method using non-radiochemical AC and linoleic anhydride. To recover [3H]ACL after TLC, non-radiochemical ACL was used as a standard in a parallel lane, and was visualized with 0.05% dichlorofluorescein (in ethanol). The appropriate band that contained [3H]ACL was scraped off the plate and extracted with 150 ml 10% methanol in diethyl ether and filtered through a sintered glass funnel. The solvent was rotary evaporated to yield the purified azocholesteryl ester. The radiochemical purity determined by TLC analysis was consistently above 80% with a yield of approximately 60–70%. The slightly lower radiochemical purity of [3H]ACL (less than 90%) is presumably due to the intrinsic instability of linoleate moiety present in ACL. For this reason, we routinely incorporate freshly synthesized [3H]ACL into LDL (see below). The [3H]ACL-LDL was used for various experiments within one week of its preparation. The same procedure for synthesizing ACL described above was used to synthesize 7,7-azo-5α-cholestan-3β-ol oleate (ACO; compound IX), using non-radiochemical AC and oleic anhydride. The yield was approximately 60–70%. Wild-type (WT) CHO cells were from ATCC, and maintained in this laboratory for many years. The 25RA cells are CHO cells resistant to the cytotoxicity of 25-hydroxycholesterol (16Chang T.Y. Limanek J.S. Regulation of cytosolic acetoacetyl coenzyme A thiolase, 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase, and mevalonate kinase by low density lipoprotein and by 25-hydroxycholesteral in Chinese hamster ovary cells.J. Biol. Chem. 1980; 255: 7787-7795Abstract Full Text PDF PubMed Google Scholar) and contain a gain of function mutation in the SREBP cleavage activating protein SCAP (17Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Sterol resistance in CHO cells traced to point mutation in SREBP cleavage-activating protein.Cell. 1996; 87: 415-426Abstract Full Text Full Text PDF PubMed Scopus (427) Google Scholar). CT60 and CT43 cells are derived from 25RA cells (18Cadigan K.M. Spillane D.M. Chang T.Y. Isolation and characterization of Chinese hamster ovary cell mutants defective in intracellular low density lipoprotein-cholesterol trafficking.J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar), and lack the NPC1 protein (10Cruz J.C. Sugii S. Yu C. Chang T.Y. Role of Niemann-Pick type C1 protein in intracellular trafficking of low density lipoprotein derived cholesterol.J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). AC29 cells are derived from 25RA cells and lack acyl-coenzyme A: cholesterol acyltransferase 1 (ACAT1) (19Cadigan K.M. Heider J.G. Chang T.Y. Isolation and characterization of Chinese hamster ovary cell mutants deficient in acyl-coenzyme A: cholesterol acyltransferase activity.J. Biol. Chem. 1988; 263: 274-282Abstract Full Text PDF PubMed Google Scholar, 20Chang C.C.Y. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. Regulation and immunolocalization of acyl-coenzyme A: cholesterol acyltransferase in mammalian cells as studied with specific antibodies.J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). M19 cells are derived from WT cells (21Hasan M.T. Chang C.C.Y. Chang T.Y. Somatic cell genetic and biochemical characterization of cell lines resulting from human genomic DNA transfection of Chinese hamster ovary cell mutants defective in sterol-dependent activation of sterol synthesis and LDL receptor expression.Somatic Cell & Mol. Genetics. 1994; 20: 183-194Crossref PubMed Scopus (52) Google Scholar) and are defective in S2P, a gene encoding a specific protease required for intramembrane cleavages of SREBPs (22Rawson R.B. Zelenski N.G. Nijhawan D. Ye J. Sakai J. Hasan M.T. Chang T.Y. Brown M.S. Goldstein J.L. Complementation cloning of S2P, a gene encoding a putative metalloprotease required for intramembrane cleavage of SREBPs.Mol. Cell. 1997; 1: 47-57Abstract Full Text Full Text PDF PubMed Scopus (393) Google Scholar). Cells were grown and cultured as described in the figure legends. LDL, [3H]cholesteryl-linoleate labeled-LDL ([3H]CL-LDL), [3H]azocholesteryl-linoleate labeled-LDL ([3H]ACL-LDL), delipidated serum, and methyl β-cyclodextrin (MβCD) complexes were prepared based on procedures previously described (10Cruz J.C. Sugii S. Yu C. Chang T.Y. Role of Niemann-Pick type C1 protein in intracellular trafficking of low density lipoprotein derived cholesterol.J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). The chemical synthesis of AC and ACL were described in Materials and Methods. The characteristics of various intermediates/derivative-formed (compounds II, IV, V, and IX), including their Rf values in TLC analyses and their various spectrometric measures, are tabulated in Table 1.TABLE 1.Characteristics of various compounds in synthetic pathwayTLCUVCompoundRfSolventε@ 350 nmε@ 367 nmIR (cm−1) Characteristic Absorption1H-NMR (ppm) Characteristic MaximaII 5α-cholestan-3β-ol-7-one0.285Hexane/EtOAc (3:7)n/an/a1719 (C = O) (sa) 3370 (O – H) (s)3.65 (m, 1, C-3); 0.65 (s, 3, C-18); 0.89/0.91 (d, 6, C-26/C-22); 0.93 (s, 3, C-21); 1.107 (s, 3, C-19); 2.33 (dt, 2, C-6); 2.19 (dq, 1, C-8)IV 7,7-azo-5α-cholestan-3β-ol0.4910.303Hexane/EtOAc (1:2) Hexane/EtOAc (2:1)91.2101.71572 (N = N) (m) 3462 (O – H) (s)3.65 (m, 1, C-3); 0.025 (dd, 1, C-6); 0.3 (dq, 1, C-8); 0.93 (s, 3, C-19)V 7,7-azo-5α-cholestan-3-one0.740Hexane/EtOAc (1:2)n/an/a1570 (N = N) (m) 1719 (C = O) (s)0.025 (dd, 1, C-6); 0.125 (dq, 1, C-8); 1.18 (s, 3, C-19) [Note disappearance of alcohol at 3.65 ppm; also appearance of bands at 2.0–2.5 ppm which are α and β to carbonyl at C-3]IX 7,7-azo-5α-cholestan-3β-ol oleate0.790Hexane/Benzene (2:3)n/an/a1574 (N = N) (m) 1652 (C = C) (w) 1733 (C = O) (s) 1000 (C – O) (m)4.75 (m, 1, C-3); 5.38 (m, 2, C = C); 2.28 (t, 2, alpha to COO); 0.025 (dd, 1, C-6); 0.125 (dq, 1, C-8); 1.30 (d, 3, C-19 and CH2 in alkane of oleate)a s, strong; m, medium; w, weak. Open table in a new tab a s, strong; m, medium; w, weak. The structures of AC (compound VI) and its predicted carbene intermediate (compound VII) upon UV irradiation are shown in Fig. 1. Two structural differences exist between cholesterol and AC:cholesterol and contain a Δ5 double bond not present in AC; the hydrogen located at C-7 in cholesterol is replaced with a photoactivatable diazirine ring in AC. The diazirine ring in AC is located at C-7, instead of at C-6 as in photocholesterol (5Thiele C. Hannah M.J. Fahrenholz F. Huttner W.B. Cholesterol binds to synaptophysin and is required for biogenesis of synaptic vesicles.Nat. Cell Biol. 2000; 2: 42-49Crossref PubMed Scopus (456) Google Scholar). We employed various assays to test if AC retains similar biological activities to cholesterol. WT CHO cells are able to grow indefinitely when grown in cholesterol-free medium. M19 cells are cholesterol auxotrophs that depend on the presence of exogenous cholesterol for growth (21Hasan M.T. Chang C.C.Y. Chang T.Y. Somatic cell genetic and biochemical characterization of cell lines resulting from human genomic DNA transfection of Chinese hamster ovary cell mutants defective in sterol-dependent activation of sterol synthesis and LDL receptor expression.Somatic Cell & Mol. Genetics. 1994; 20: 183-194Crossref PubMed Scopus (52) Google Scholar). To determine if AC can serve as a sterol supplement for M19 cells, WT and M19 cells were incubated in cholesterol-free medium supplemented with cholesterol, or with AC, or with no sterol. The growth of the cells was monitored for 4 days. We found that WT cells grew in all medium conditions tested (Fig. 2A), whereas M19 cells grew in medium supplemented with cholesterol or with AC, but died in medium not supplemented with sterol (Fig. 2B). Only small differences in growth were observed when M19 cells were incubated with medium supplemented with either cholesterol or AC. These results indicate that AC can serve as a sterol source for growth in place of cholesterol in M19 cells. In order to determine if AC can be metabolized in intact cells, we utilized [3H]ACL-LDL to examine the fate of the cholesterol analog in the LDL receptor pathway, taking advantage of additional CHO cell mutants. CT60 and CT43 cells, derived from 25RA cells (16Chang T.Y. Limanek J.S. Regulation of cytosolic acetoacetyl coenzyme A thiolase, 3-hydroxy-3-methylglutaryl coenzyme A synthase, 3-hydroxy-3-methylglutaryl coenzyme A reductase, and mevalonate kinase by low density lipoprotein and by 25-hydroxycholesteral in Chinese hamster ovary cells.J. Biol. Chem. 1980; 255: 7787-7795Abstract Full Text PDF PubMed Google Scholar), are NPC1 mutants defective in trafficking LDL-derived cholesterol to the ER for reesterification (10Cruz J.C. Sugii S. Yu C. Chang T.Y. Role of Niemann-Pick type C1 protein in intracellular trafficking of low density lipoprotein derived cholesterol.J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar) by a resident ER protein, ACAT1 (23Chang T.Y. Chang C.C.Y. Cheng D. Acyl-coenzyme A:cholesterol acyltransferase.Annu. Rev. Biochem. 1997; 66: 613-638Crossref PubMed Scopus (440) Google Scholar). AC29 cells, also isolated from 25RA cells, are mutants lacking ACAT1 (24Cadigan K.M. Chang C.C.Y. Chang T.Y. Isolation of Chinese hamster ovary cell lines expressing human acyl-coenzyme A:cholesterol acyltransferase activity.J. Cell Biol. 1989; 108: 2201-2210Crossref PubMed Scopus (21) Google Scholar). When we labeled 25RA, CT60, and AC29 cells with [3H]ACL-LDL, we found that the [3H]ACL-LDL was hydrolyzed to [3H]AC in all cells (Fig. 3A). The hydrolyzed [3H]AC was reesterified into [3H]ACO in 25RA cells but no significant radiolabeled ester product was formed in CT60 or in AC29 cells (Fig. 3B). When directly comparing the metabolism of [3H]ACL-LDL to [3H]CL-LDL in 25RA cells, we found that [3H]ACL-LDL is hydrolyzed similarly to [3H]CL-LDL (Fig. 3C). Although [3H]ACL-LDL can be reesterified in 25RA cells (Fig. 3B), the amount of [3H]ACO formed is less than the [3H]cholesteryl oleate formed (Fig. 3D). We believe the reason for this lies in the substrate specificity of ACAT1. This is supported by the finding that although AC can serve as a sterol substrate for ACAT as determined by a reconstituted in vitro ACAT assay, cholesterol is still a better substrate than AC for ACAT1 (results not shown). One approach to deliver AC to intact cells is via cyclodextrins, which are water soluble, cyclic oligomers of glucose that have the capacity to bind cholesterol within its hydrophobic core (25Christian A.E. Haynes P. Phillips M.C. Rothblat G.H. Use of cyclodextrins for manipulating cellular cholesterol content.J. Lipid Res. 1997; 38: 2264-2272Abstract Full Text PDF PubMed Google Scholar). We prepared MβCD complexes composed of either [3H]cholesterol or [3H]AC. We then incubated the WT CHO cells with [3H]sterol alone, or with [3H]sterol as MβCD complex at 37°C, then determined the total amount of incorporation of [3H]sterol into the cells. We found that the cellular incorporations of [3H]cholesterol or [3H]AC were similar; the incorporations were much greater when delivered as a complex with MβCD than without MβCD (Fig. 4). To test if [3H]AC can cross-link proteins after UV photoactivation, we treated intact 25RA and CT43 cells with [3H]AC/cyclodextrin complex for a brief period (1 h at room temperature) followed by UV exposure, and found that several discrete protein bands could be identified by SDS-PAGE-radioluminography (Fig. 5A). A total of eight discrete bands (indicated by arrows a–h, Fig. 5A), could be identified by this method. The estimated molecular weights (in kDa) of these bands are: a, 88; b, 68; c, 51; d, 38; e, 33; f, 21; g, 18; h, 11.7. The labeling patterns in the 25RA cells and the CT43 cells were very similar (comparing lanes 1 and 3 of Fig. 5). The limitation in sensitivity and resolution of the current method did not allow us to conclude whether or not the NPC1 protein, a membrane glycoprotein with apparent molecular weight of 150–180 kDa (13Ioannou Y.A. Multiple drug permeases and subcellular cholesterol transport.Nat. Rev. Mol. Cell Biol. 2001; 2: 657-668Crossref PubMed Scopus (81) Google Scholar), or the ACAT1 protein, a membrane protein with apparent molecular weight of 45 kDa (20Chang C.C.Y. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. Regulation and immunolocalization of acyl-coenzyme A: cholesterol acyltransferase in mammalian cells as studied with specific antibodies.J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar), was photolabeled. When an excess amount of unlabeled cholesterol was included during the labeling period, the labeling intensity for each of these bands significantly decreased (i.e., comparing results in lanes 1 and 3 vs. those in lanes 2 and 4 of Fig. 5). These results suggest that most or all of the labeled proteins recognize cholesterol in a specific manner. Based on Western blotting results (Fig. 5B), one of the labeled bands, the 20–21 kDa band, is probably caveolin-1. To positively reveal the identity of this band, after photolabeling the 25RA cell lysates were solubilized in detergent, and were immunoprecipitated either with mouse monoclonal antibody against caveolin-1 or with control mouse IgG; the immunoprecipates and the immunodepleted supernatants were analyzed by SDS-PAGE-radioluminography. The result (Fig. 6)showed that the major labeled band (band f) is caveolin-1, a known cholesterol binding protein. Each of these bands shown in Figs. 5 and 6 could be composed of a single polypeptide, or multiple polypeptides with overlapping molecular weights. In the future, the immunoprecipitation strategy described here coupled with extensive purification of individually labeled bands may help to reveal the identity of these labeled proteins other than caveolin-1.Fig. 6.Immunoprecipitation of photolabeled caveolin-1 in 25RA cells. A: 25RA cells grown in medium D for 48 h [2 × 106 cells, suspended in 0.2 ml of Hanks' buffer (pH 7.4)] were photolabeled by incubating with [3H]AC/cyclodextrin complex (0.32 μg, 8.8 μCi) for 1 h at 37°C, followed by photolysis for 15 min on ice. Unless stated otherwise, the photolabelings were carried out in the absence of excess unlabeled cholesterol. The [3H]AC labeled cells were centrifuged to remove unbound [3H]AC. The cell-pellets were lysed using lysis buffer (50 mM Tris (pH 7.4), 100 mM NaCl, 1% Triton X-100, 0.5% Nonidet P-40, 1 mM EDTA, 1 mM EGTA, and 500-fold diluted protease inhibitors cocktail (Sigma). The supernatant was collected by centrifugation at 10,000 g for 15 min at 4°C. The lysates were subjected to immunoprecipitations using mouse monoclonal anti-caveolin-1 or control mouse IgG according to procedure described (28Chen D. Zang A.L. Zhao Q. Markley J.L. Zheng J. Bird I.M. Magness R.R. Ovine caveolin-1: cDNA cloning, E. coli expression, and association with endothelial nitric oxide synthase.Mol. Cell. Endocrinol. 2001; 175: 41-56Crossref PubMed Scopus (14) Google Scholar, 29Caselli A. Taddei M.L. Manao G. Camici G. Ramponi G. Tyrosine-phosphorylated caveolin is a physiological substrate of the low M(r) protein-tyrosine phosphatase.J. Biol. Chem. 2001; 276: 18849-18854Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar). The immunoprecipitates and the immunodepleted supernatants were subjected to 10% SDS-PAGE, followed by radioluminography (exposure time: 5 days). Lane 1: [3H]AC-labeled lysate before immunoprecipitation; lane 2: same as lane 1 except photolabeling was carried out in the presence of 100-fold excess of unlabeled cholesterol; lane 3: immunoprecipitate of [3H]AC-labeled lysate, using mouse monoclonal anti-caveolin-1 (Transduction Laboratories, clone No. 2234); lane 4: immunoprecipitate of [3H]AC-labeled lysate, using control mouse IgG; lane 5: immunodepleted supernatant of [3H]AC-labeled lysate, after immunoprecipitation using anti-caveolin-1; lane 6: immunodepleted supernatant of [3H]AC-labeled lysate, after immunoprecipitation using control mouse IgG. B: In parallel with radioluminography, after SDS-PAGE, the parallel set of samples was immunoblotted with rabbit polyclonal anti-caveolin-1 antibodies (Santa Cruz: N-20).View Large Image Figure ViewerDownload (PPT) In this manuscript, we reported the chemical synthesis of a new photoactivatable cholesterol analog AC labeled with 3H at high-specific radioactivity, and described methods to synthesize its oleate or linoleate ester. The procedures described can be carried out in standard biochemical laboratories. We then took a cell biological approach to examine the biochemical properties of AC and its ester by employing several different mutant CHO cell lines as tools. The results showed that AC can substitute for cholesterol as a sterol source in a cholesterol auxotroph. When delivered to intact cells as [3H]ACL-LDL, [3H]ACL is hydrolyzed into free [3H]AC in the hydrolytic/lysosomal compartment, transported to the ER via an NPC1-mediated pathway, and reesterified into [3H]azocholesteryl oleate by ACAT1. Thus, AC faithfully mimics cholesterol in terms of the LDL receptor mediated metabolic pathway in intact cells. As described in Fig. 5, labeling intact 25RA cells with [3H]AC/cyclodextrin complex followed by UV irradiation enabled us to identify several candidate cholesterol-binding proteins. Based on Western analysis and immunoprecipitation analyses, one of these proteins is caveolin-1. We are currently pursuing the identification of these other candidate cholesterol-binding proteins. We also showed that LDL-bound [3H]ACL is metabolized in a similar manner to LDL-bound [3H]CL. Thus, in the future, AC and its ester may also serve to identify novel cholesterol binding proteins involved in the LDL receptor mediated pathway in mammalian cells. Regarding the relative reactivity between AC and the 6,6-azocholestanol (photocholesterol) (5Thiele C. Hannah M.J. Fahrenholz F. Huttner W.B. Cholesterol binds to synaptophysin and is required for biogenesis of synaptic vesicles.Nat. Cell Biol. 2000; 2: 42-49Crossref PubMed Scopus (456) Google Scholar): based on the well-known conformation of cholestanol (26Fieser L.F. Fieser M. Steroids. Reinhold Publishing Corporation, New York1959Google Scholar), the insertion of the carbene at C-6 of steroid into any given protein may create axial-axial interaction between the angular methyl group at C-8 of the steroid, and the axial carbon-carbon bond formed between the steroid and the protein. Such an interaction does not occur if the carbene is located at C-7. Therefore, AC may be a more efficient photoaffinity-labeling reagent than 6,6-azocholestanol. This possibility can be tested by future experimentation. The authors thank Drs. Robert Simoni and Len Fang Lee for helpful discussions during the course of this work. We also thank Helina Morgan for careful editing of the manuscript. This work has been supported by National Institutes of Health Grants HL 60306 and HL 36709 to T-Y.C. 7,7-azocholestanol 7,7-azocholestanol linoleate 7,7-azo-5α-cholestan-3β-ol oleate 2,6-di-tert-butyl-p-cresol Chinese hamster ovary cholesteryl linoleate endoplasmic reticulum methyl β-cyclodextrin Niemann-Pick Type C1 pyridinium chlorochromate

The effect(s) of endogenously synthesized cholesterol (endo-CHOL) on the endosomal system in mammalian cells has not been examined. Here we treated Chinese hamster ovary cell lines with lovastatin (a hydroxymethylglutaryl-CoA reductase inhibitor) and mevalonate (a precursor for isoprenoids) to block endo-CHOL synthesis and then examined its effects on the fate of cholesterol liberated from low density lipoprotein (LDL-CHOL). The results showed that blocking endo-CHOL synthesis for 2 h or longer does not impair the hydrolysis of cholesteryl esters but partially impairs the transport of LDL-CHOL to the plasma membrane. Blocking endo-CHOL synthesis for 2 h or longer also alters the localization patterns of the late endosomes/lysosomes and retards their motility, as monitored by time-lapse microscopy. LDL-CHOL overcomes the effect of blocking endo-CHOL synthesis on endosomal localization patterns and on endosomal motility. Overexpressing Rab9, a key late endosomal small GTPase, relieves the endosomal cholesterol accumulation in Niemann-Pick type C1 cells but does not revert the reduced endosomal motility caused by blocking endo-CHOL synthesis. Our results suggested that endo-CHOL contributes to the cholesterol content of late endosomes and controls its motility, in a manner independent of NPC1. These results also supported the concept that endosomal motility plays an important role in controlling cholesterol trafficking activities. The effect(s) of endogenously synthesized cholesterol (endo-CHOL) on the endosomal system in mammalian cells has not been examined. Here we treated Chinese hamster ovary cell lines with lovastatin (a hydroxymethylglutaryl-CoA reductase inhibitor) and mevalonate (a precursor for isoprenoids) to block endo-CHOL synthesis and then examined its effects on the fate of cholesterol liberated from low density lipoprotein (LDL-CHOL). The results showed that blocking endo-CHOL synthesis for 2 h or longer does not impair the hydrolysis of cholesteryl esters but partially impairs the transport of LDL-CHOL to the plasma membrane. Blocking endo-CHOL synthesis for 2 h or longer also alters the localization patterns of the late endosomes/lysosomes and retards their motility, as monitored by time-lapse microscopy. LDL-CHOL overcomes the effect of blocking endo-CHOL synthesis on endosomal localization patterns and on endosomal motility. Overexpressing Rab9, a key late endosomal small GTPase, relieves the endosomal cholesterol accumulation in Niemann-Pick type C1 cells but does not revert the reduced endosomal motility caused by blocking endo-CHOL synthesis. Our results suggested that endo-CHOL contributes to the cholesterol content of late endosomes and controls its motility, in a manner independent of NPC1. These results also supported the concept that endosomal motility plays an important role in controlling cholesterol trafficking activities. Cholesterol is an important lipid molecule present ubiquitously in mammalian cells. It plays important structural and functional roles in cell membranes (1Bloch K. Steroids. 1992; 57: 378-383Crossref PubMed Scopus (199) Google Scholar). In specialized cells such as steroidogenic cells or hepatocytes, cholesterol serves as an obligatory precursor for steroid hormones and bile acids. Almost all mammalian cells receive exogenous cholesterol, mainly via the classic low density lipoprotein (LDL) 5The abbreviations used are: LDL, low density lipoprotein; ACAT, acyl-coenzyme A:cholesterol transferase; CD, cyclodextrin; CHO, Chinese hamster ovary; CL, cholesteryl linoleate; [3H]CL-LDL, [3H]cholesteryl linoleate-labeled LDL; endo-CHOL, endogenously synthesized cholesterol; ER, endoplasmic reticulum; GFP, green fluorescent protein; LDL-CHOL, cholesterol liberated from LDL; MVB, multivesicular body; NPC1, Niemann-Pick type C1; NSDHL, NADPH sterol dehydrogenase-like protein; PBS, phosphate-buffered saline; PM, plasma membrane; SCAP, SREBP cleavage-activating protein; SREBP, sterol regulatory element-binding protein; TGN, transGolgi network; YFP, yellow fluorescent protein; HMG, hydroxymethylglutaryl; WT, wild type; PBS, phosphate-buffered saline; DiI, DiIC18(3Sugii S. Reid P.C. Ohgami N. Du H. Chang T.Y. J. Biol. Chem. 2003; 278: 27180-27189Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar); DIC, differential interference contrast.5The abbreviations used are: LDL, low density lipoprotein; ACAT, acyl-coenzyme A:cholesterol transferase; CD, cyclodextrin; CHO, Chinese hamster ovary; CL, cholesteryl linoleate; [3H]CL-LDL, [3H]cholesteryl linoleate-labeled LDL; endo-CHOL, endogenously synthesized cholesterol; ER, endoplasmic reticulum; GFP, green fluorescent protein; LDL-CHOL, cholesterol liberated from LDL; MVB, multivesicular body; NPC1, Niemann-Pick type C1; NSDHL, NADPH sterol dehydrogenase-like protein; PBS, phosphate-buffered saline; PM, plasma membrane; SCAP, SREBP cleavage-activating protein; SREBP, sterol regulatory element-binding protein; TGN, transGolgi network; YFP, yellow fluorescent protein; HMG, hydroxymethylglutaryl; WT, wild type; PBS, phosphate-buffered saline; DiI, DiIC18(3Sugii S. Reid P.C. Ohgami N. Du H. Chang T.Y. J. Biol. Chem. 2003; 278: 27180-27189Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar); DIC, differential interference contrast. receptor pathway; LDL binds to the LDL receptor and enters the cell interior by receptor-mediated endocytosis (2Brown M.S. Goldstein J.L. Science. 1986; 232: 34-47Crossref PubMed Scopus (4343) Google Scholar). Although present in the earlier endosomal compartment(s), most of the cholesteryl esters in LDL are hydrolyzed by the enzyme acid lipase (3Sugii S. Reid P.C. Ohgami N. Du H. Chang T.Y. J. Biol. Chem. 2003; 278: 27180-27189Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar); the free (unesterified) cholesterol liberated from cholesteryl ester then emerges in the late endosomes (3Sugii S. Reid P.C. Ohgami N. Du H. Chang T.Y. J. Biol. Chem. 2003; 278: 27180-27189Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 4Wojtanik K.M. Liscum L. J. Biol. Chem. 2003; 278: 14850-14856Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). The egress of cholesterol from the late endosomes requires the concerted actions of several proteins, including the Niemann-Pick type C1 (NPC1) and NPC2 proteins (reviewed in Ref. 5Patterson M.C. Vanier M.T. Suzuki K. Morris J.A. Carstea E. Neufeld E.B. Blanchette-Mackie J.E. Pentchev P.G. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. 8th Ed. III. McGraw-Hill Inc., New York2001: 3611-3633Google Scholar); both NPC1 and NPC2 proteins directly bind cholesterol (Refs. 6Ko D.C. Binkley J. Sidow A. Scott M.P. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2518-2525Crossref PubMed Scopus (161) Google Scholar and 7Ohgami N. Ko D.C. Thomas M. Scott M.P. Chang C.C. Chang T.Y. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 12473-12478Crossref PubMed Scopus (169) Google Scholar and reviewed in Ref. 8Chang T.Y. Reid P.C. Sugii S. Ohgami N. Cruz J.C. Chang C.C.Y. J. Biol. Chem. 2005; 280: 20917-20920Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). Mutations in either NPC1 or NPC2 cause cholesterol (and other lipids) to be entrapped in the aberrant endosomes/lysosomes and prevent it from being delivered to various destinations, including the plasma membranes (PM), trans-Golgi network (TGN), and the endoplasmic reticulum (ER), where cholesterol would normally be reesterified by the ER resident enzyme acyl-coenzyme A:cholesterol acyltransferase 1 (ACAT1) (reviewed in Refs. 5Patterson M.C. Vanier M.T. Suzuki K. Morris J.A. Carstea E. Neufeld E.B. Blanchette-Mackie J.E. Pentchev P.G. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Bases of Inherited Disease. 8th Ed. III. McGraw-Hill Inc., New York2001: 3611-3633Google Scholar and 9Liscum L. Traffic. 2000; 1: 218-225Crossref PubMed Scopus (131) Google Scholar). In addition to the cells that contain NPC1 or NPC2 mutations, cells treated with U18666A (a hydrophobic amine (10Liscum L. Faust J.R. J. Biol. Chem. 1989; 264: 11796-11806Abstract Full Text PDF PubMed Google Scholar)) or cells that contain various other mutations (11Frolov A. Srivastava K. Daphna-Iken D. Traub L.M. Schaffer J.E. Ory D.S. J. Biol. Chem. 2001; 276: 46414-46421Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar, 12Eskelinen E.L. Schmidt C.K. Neu S. Willenborg M. Fuertes G. Salvador N. Tanaka Y. Lullmann-Rauch R. Hartmann D. Heeren J. von Figura K. Knecht E. Saftig P. Mol. Biol. Cell. 2004; 15: 3132-3145Crossref PubMed Scopus (205) Google Scholar) can also accumulate cholesterol abnormally and exhibit NPC-like phenotypes (reviewed in Ref. 8Chang T.Y. Reid P.C. Sugii S. Ohgami N. Cruz J.C. Chang C.C.Y. J. Biol. Chem. 2005; 280: 20917-20920Abstract Full Text Full Text PDF PubMed Scopus (133) Google Scholar). Late endosomes exhibit long distance, bidirectional motility between the peripheral region and the perinuclear region of the cells (13Lebrand C. Corti M. Goodson H. Cosson P. Cavalli V. Mayran N. Faure J. Gruenberg J. EMBO J. 2002; 21: 1289-1300Crossref PubMed Scopus (275) Google Scholar). In general, the motility of endosomal organelles depends on microtubules, various motor proteins, and Rab proteins (reviewed in Ref. 14Seabra M.C. Coudrier E. Traffic. 2004; 5: 393-396Crossref PubMed Scopus (160) Google Scholar). Rab proteins are a family of small GTPases present in various endosomal organelles and play important roles in membrane trafficking events (reviewed in Ref. 15Pfeffer S.R. Trends Cell Biol. 2001; 11: 487-491Abstract Full Text Full Text PDF PubMed Scopus (437) Google Scholar). Recently, it was shown that in cells that display NPC-like phenotypes, cholesterol derived from LDL accumulates and blocks the dissociation of Rab7, a Rab protein mainly located in the late endosomes, from its regulator protein guanine nucleotide dissociation inhibitor, causing the Rab7 protein to be locked in an inactive state and significantly diminishing the motility of the late endosomes (13Lebrand C. Corti M. Goodson H. Cosson P. Cavalli V. Mayran N. Faure J. Gruenberg J. EMBO J. 2002; 21: 1289-1300Crossref PubMed Scopus (275) Google Scholar). This study links late endosomal motility with intracellular cholesterol trafficking activities. The accumulation of cholesterol in NPC cells also inhibits the function of Rab4, a different GTPase that is mainly located in the earlier endosomes (16Choudhury A. Sharma D.K. Marks D.L. Pagano R.E. Mol. Biol. Cell. 2004; 15: 4500-4511Crossref PubMed Scopus (120) Google Scholar). In addition to receiving cholesterol via LDL, essentially all mammalian cells also synthesize cholesterol endogenously (endo-CHOL). The de novo biosynthesis of endo-CHOL uses acetyl coenzyme A as the simple precursor and involves many enzymatic reactions. The terminal stage of endo-CHOL synthesis is at the ER (reviewed in Ref. 17Gibbons G.F. Mitropoulos K.A. Myant N.B. Biochemistry of Cholesterol. Elsevier/North-Holland Biomedical Press, Amsterdam1982Google Scholar). Once synthesized, the nascent endo-CHOL is rapidly transported in an energydependent manner to the caveolae/lipid raft microdomain of the PM within 10-20 min (18Urbani L. Simoni R.D. J. Biol. Chem. 1990; 265: 1919-1923Abstract Full Text PDF PubMed Google Scholar, 19Smart E.J. Ying Y. Donzell W.C. Anderson R.G.W. J. Biol. Chem. 1996; 271: 29427-29435Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar, 20Uittenbogaard A. Ying Y. Smart E.J. J. Biol. Chem. 1998; 273: 6525-6532Abstract Full Text Full Text PDF PubMed Scopus (272) Google Scholar, 21Heino S. Lusa S. Somerharju P. Ehnholm C. Olkkonen V.M. Ikonen E. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8375-8380Crossref PubMed Scopus (208) Google Scholar). These processes do not require NPC1 (22Liscum L. Ruggiero R.M. Faust J.R. J. Cell Biol. 1989; 108: 1625-1636Crossref PubMed Scopus (241) Google Scholar). At the PM, endo-CHOL may recycle rapidly (within minutes) between the PM and the recycling endosomes (23Hao M. Lin S.X. Karylowski O.J. Wustner D. McGraw T.E. Maxfield F.R. J. Biol. Chem. 2002; 277: 609-617Abstract Full Text Full Text PDF PubMed Scopus (246) Google Scholar). Other fate(s) of the endo-CHOL remains largely unclear. However, it is known that in mutant NPC1 cells, 8 h or longer after its initial synthesis, a certain portion of endo-CHOL is significantly trapped within the late endosomes; the entrapment partially disables the recycling of endo-CHOL from the late endosomes to the PM and its movement to the ER for esterification by ACAT1 (24Cruz J.C. Chang T.Y. J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar, 25Lange Y. Ye J. Rigney M. Steck T. J. Biol. Chem. 2000; 275: 17468-17475Abstract Full Text Full Text PDF PubMed Scopus (156) Google Scholar). Thus, similar to the LDL-CHOL, the post-PM intracellular trafficking of endo-CHOL partially depends on NPC1. These results suggest that endo-CHOL that traverses through the endocytic compartment may play important role(s) in controlling the function/properties of the late endosome(s). In the this study, we used wild-type (WT) and various well characterized mutant Chinese hamster ovary (CHO) cells as tools and investigated the role of endo-CHOL in the endocytic pathway. We blocked endo-CHOL synthesis by treating cells with lovastatin (also called mevinolin) and mevalonate. Lovastatin is the drug that blocks endo-CHOL synthesis by inhibiting the key enzyme HMG-CoA reductase in the earlier part of the sterol biosynthesis pathway (26Alberts A.W. Chen J. Kuron G. Hunt V. Huff J. Hoffman C. Rothrock J. Lopez M. Joshua H. Harris E. Patchett A. Monaghan R. Currie S. Stapley E. Alberts-Schonberg G. Hensens O. Hirshfield J. Hoogsteen K. Liesch J. Springer J. Proc. Natl. Acad. Sci. U. S. A. 1980; 77: 3957-3961Crossref PubMed Scopus (1455) Google Scholar). Mevalonate is the reaction product of HMG-CoA reductase. It is an obligatory intermediate for all isoprenoids, including cholesterol, ubiquinone, dolichol, etc., that are all needed for cell growth and survival (reviewed in Ref. 27Goldstein J.L. Brown M.S. Nature. 1990; 343: 425-430Crossref PubMed Scopus (4534) Google Scholar). When added to the culture medium, only a small amount of mevalonate can enter the cell interior; it cannot satisfy the needs of the lovastatin-treated cells for sterol, but it enables them to synthesize various other mevalonate-derived nonsterol metabolites necessary for cell growth. We examined the endocytic activities of the cells by monitoring the fate of cholesterol liberated from the low density lipoprotein LDL (LDL-CHOL). Our results indicate that endo-CHOL plays a significant role in maintaining the functions of the late endosomes. Materials—Fetal bovine serum (FBS), 2-hydroxypropyl-β-cyclodextrin (CD), paraformaldehyde, and mevalonic acid (mevalonate) were from Sigma. The lipid-free FBS was prepared as described (28Chin J. Chang T.Y. J. Biol. Chem. 1981; 256: 6304-6310Abstract Full Text PDF PubMed Google Scholar). Mevinolin, also called lovastatin, was a gift from Alfred Alberts (Merck). The acyl-coenzyme A:cholesterol transferase (ACAT) inhibitor F12511 (29Chang C.C.Y. Sakashita N. Ornvold K. Lee O. Chang E.T. Dong R. Lin S. Lee C.Y. Strom S.C. Kashyap R. Fung J.J. Farese Jr., R.V. Patoiseau J.F. Delhon A. Chang T.Y. J. Biol. Chem. 2000; 275: 28083-28092Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar) was a gift of Pierre Fabre Research (Castres, France). Percoll and [1,2,6,7-3H]cholesteryl linoleate (30-60 Ci/mmol) were from Amersham Biosciences. [3H]Acetate (20 Ci/mmol) and [1-14C]acetate (56.7 mCi/mmol) were from American Radiolabeled Chemicals. The FuGENE 6 transfection reagent was from Roche Applied Science. ProLong antifade kit, Alexa Fluor 488 or 568 goat anti-rabbit or anti-mouse IgG, LysoTracker Red (DND-99), and DiI (DiIC18(3Sugii S. Reid P.C. Ohgami N. Du H. Chang T.Y. J. Biol. Chem. 2003; 278: 27180-27189Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar)) were from Molecular Probes. The rabbit anti-NPC2 polyclonal antiserum was a generous gift from Dr. Peter Lobel (Robert Wood Johnson Medical School). The monoclonal antibody against hamster Lamp2 was from Developmental Studies Hybridoma Bank maintained by the University of Iowa. The mouse anti-β-actin antibody (clone AC-74) was from Sigma. LDL (density of 1.019-1.063 g/ml) was prepared from fresh human plasma by sequential flotation as described previously (30Cadigan K.M. Heider J.G. Chang T.Y. J. Biol. Chem. 1988; 263: 274-282Abstract Full Text PDF PubMed Google Scholar). [3H]Cholesteryl linoleate-labeled LDL ([3H]CL-LDL) with specific radioactivity of ∼5 × 104 cpm/mg protein was prepared according to published procedure (31Faust J.R. Goldstein J.L. Brown M.S. J. Biol. Chem. 1977; 252: 4861-4871Abstract Full Text PDF PubMed Google Scholar). DiI-LDL was prepared as described previously (32Lougheed M. Moore E.D.W. Scriven D.R.L. Steinbrecher U.P. Arterioscler. Thromb. Vasc. Biol. 1999; 19: 1881-1890Crossref PubMed Scopus (61) Google Scholar). The NPC1-GFP expression plasmid was as described previously (33Sugii S. Reid P.C. Ohgami N. Shimada Y. Maue R.A. Ninomiya H. Ohno-Iwashita Y. Chang T.Y. J. Lipid Res. 2003; 44: 1033-1041Abstract Full Text Full Text PDF PubMed Scopus (41) Google Scholar). The Rab9-YFP expression plasmid was a gift of Dr. Yiannis Ioannou (Mount Sinai School of Medicine) (34Walter M. Davies J.P. Ioannou Y.A. J. Lipid Res. 2003; 44: 243-253Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Production of Antibodies against Hamster NPC1 (DM105)—The N-terminal portion of the hamster NPC1 protein (amino acid residues 35-172, ∼34 kDa) was expressed as a fusion protein adduct with the bacterial protein GST. To produce the fusion protein, the primer sets used for PCR are as follows: forward primer, CGCGGATCCTTTGGAGATAAGAAGTACAAC (corresponding to BamHI restriction site and to the nucleotide sequence 103-123 of hamster NPC1 (38Cruz J.C. Sugii S. Yu C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar)); reverse primer, CCGGAATTCGGCCTTCTCATTACTTGCAGG (corresponding to EcoRI restriction site and to the nucleotide sequence 498-516 of hamster NPC1). The resulting PCR product was digested with BamHI and EcoRI and ligated into the pGEX-4T1 vector (Amersham Biosciences) that had been digested with BamHI and EcoRI, followed by gel purification. The fusion protein was expressed in Escherichia coli and purified by SDS-PAGE, based on the procedure employed previously (29Chang C.C.Y. Sakashita N. Ornvold K. Lee O. Chang E.T. Dong R. Lin S. Lee C.Y. Strom S.C. Kashyap R. Fung J.J. Farese Jr., R.V. Patoiseau J.F. Delhon A. Chang T.Y. J. Biol. Chem. 2000; 275: 28083-28092Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar). The purified protein in 0.2% SDS solution was sent to Cocalico Co. (Philadelphia, PA) to generate antisera in rabbits. The antisera were purified via GST-NPC1 fusion protein affinity column chromatography and stored at 4 °C in 0.1 m Trisglycine buffer, pH 7.0, under sterile conditions. Immunoblotting Analysis—Western blotting with anti-NPC1 polyclonal antibodies (DM105) was performed as follows. WT CHO cells were solubilized in lysis buffer (50 mm Tris-HCl, pH 7.4, 150 mm NaCl, 1% Nonidet P-40, and protease inhibitors mixture (Sigma)) on ice for 30 min, followed by centrifugation at 13,000 rpm for 20 min at 4 °C. After adding (4×) SDS-loading buffer with 0.1 m dithiothreitol to the solubilized cell lysate, the samples were kept on ice until the SDS-PAGE analysis. Treating the samples in SDS at 37 or 60 °C caused a large loss in NPC1 signal in Western blotting (result not shown). The primary antibodies used were the affinity-purified IgG against the GST-NPC1 protein, at 0.8 μg/ml, in TBS, 0.3% Tween 20 buffer containing 1% skim milk. Western blotting with anti-NPC2 polyclonal antisera was performed essentially as described previously (7Ohgami N. Ko D.C. Thomas M. Scott M.P. Chang C.C. Chang T.Y. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 12473-12478Crossref PubMed Scopus (169) Google Scholar). Results of Western blots were quantified by using the NIH image (version 1.63). To normalize the values, the mean pixel intensities obtained with anti-NPC1 or with anti-NPC2 were divided by those obtained with anti-β-actin. Cell Lines and Procedures for Cell Culture Work—WT CHO cells were originally from the ATCC. 25RA cells were derived from the WT CHO cells; they are resistant to the cytotoxicity of 25-hydroxycholesterol (35Chang T.Y. Limanek J.S. J. Biol. Chem. 1980; 255: 7787-7795Abstract Full Text PDF PubMed Google Scholar) and contain a gain of function mutation in the sterol regulatory element-binding protein (SREBP) cleavage-activating protein (SCAP) (36Hua X. Nohturfft A. Goldstein J.L. Brown M.S. Cell. 1996; 87: 415-426Abstract Full Text Full Text PDF PubMed Scopus (427) Google Scholar). CT43 mutant cells were isolated as one of the cholesterol-trafficking mutants from mutagenized 25RA cells (37Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar), containing a premature translational termination mutation near the 3′-end of the NPC1 coding sequence and producing a nonfunctional, truncated NPC1 protein (38Cruz J.C. Sugii S. Yu C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). M19 cells were isolated from mutagenized WT CHO cells; these cells fail to respond to sterol-dependent regulation of HMG-CoA reductase and LDL receptors (39Hasan M.T. Chang C.C.Y. Chang T.Y. Somatic Cell Mol. Genet. 1994; 20: 183-194Crossref PubMed Scopus (52) Google Scholar) because these cells contain a deletion mutation in site 2 protease that is required to cleave the SREBP into an active form (40Rawson R.B. Zelenski N.G. Nijhawan D. Ye J. Sakai J. Hasan M.T. Chang T.Y. Brown M.S. Goldstein J.L. Mol. Cell. 1997; 1: 47-57Abstract Full Text Full Text PDF PubMed Scopus (393) Google Scholar). LEX1 cells are mutant CHO cells isolated from WT cells. LEX1 cells exhibit defects in fusion between the late endosomes and the lysosomes and are defective in the disintegration of LDL particles labeled with fluorescent phospholipids (41Ohashi M. Miwako I. Nakamura K. Yamamoto A. Murata M. Ohnishi S. Nagayama K. J. Cell Sci. 1999; 112: 1125-1138Crossref PubMed Google Scholar). The molecular lesion of the LEX1 cells is unknown. The LEX2 mutant cells were also isolated from WT CHO cells; they exhibit an arrested multivesicular body (MVB) and show defects in the transport of the cation-independent mannose 6-phosphate receptor from the MVB back to the trans-Golgi network (TGN). In addition, these mutant cells contain another defect in the transport of lysosomal proteins and apoB100 in LDL to the late endosomes (42Ohashi M. Miwako I. Yamamoto A. Nagayama K. J. Cell Sci. 2000; 113: 2187-2205Crossref PubMed Google Scholar). LEX2 cells contain a molecular lesion in the gene encoding NAD(P)H-dependent sterol dehydrogenase-like protein (NSDHL), an enzyme in the late stage of the cholesterol biosynthesis pathway. A stable transfectant of LEX2 cells that expresses an active NSDHL, called the LEX2LIB3 cell, has been reported (43Miwako I. Yamamoto A. Kitamura T. Nagayama K. Ohashi M. J. Cell Sci. 2001; 114: 1765-1776Crossref PubMed Google Scholar). The expression of this enzyme resulted in the correction of the cholesterol biosynthesis defect in the LEX2 cells. In LEX2LIB3 cells, the transport of cation-independent mannose 6-phosphate receptor from the MVB to the TGN is normal, and the arrested MVB disappears. However, the defective processing of endocytosed LDL to the degradative compartment remains uncorrected, suggesting that in the LEX2LIB3 cells, there remains a defect in the late stage of the endocytic pathway (43Miwako I. Yamamoto A. Kitamura T. Nagayama K. Ohashi M. J. Cell Sci. 2001; 114: 1765-1776Crossref PubMed Google Scholar). The LEX1 and LEX2 cells belong to different complementation groups. All of the CHO cells were maintained in Medium A (Ham's F-12 plus 10% FBS and 10 mg/ml gentamycin) as monolayers at 37 °C with 5% CO2. Medium A contains bovine LDL, which provides LDL-CHOL. Medium D refers to Ham's F-12 supplemented with 5% lipid-free FBS plus 35 mm oleic acid and 10 mg/ml gentamycin. Medium D lacks LDL-CHOL. Medium S refers to Medium D plus 50 μm lovastatin and 230 μm mevalonate. In cells grown in Medium S, the endo-CHOL synthesis rate is 99% inhibited (37Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). When Medium D or Medium S was used at lower temperatures (18 °C or lower), Ham's F-12 without sodium bicarbonate was used, and cells were placed in a water bath without CO2. Assays to Monitor the Fate of [3H]Cholesteryl Linoleate in LDL—Cells were plated in Medium A in 6- or 12-well dishes, as described previously (38Cruz J.C. Sugii S. Yu C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 24Cruz J.C. Chang T.Y. J. Biol. Chem. 2000; 275: 41309-41316Abstract Full Text Full Text PDF PubMed Scopus (79) Google Scholar), and were cultured for 36 h in Medium D to deplete stored cholesterol within the cell. Prior to labeling, cells were pre-chilled on ice, then labeled with 30 μg/ml [3H]CL-LDL in Medium D for 5 h at 18°C, washed once with cold PBS that contained 1% bovine serum albumin, and washed three more times with cold PBS. Cells were then fed with cold Medium D and placed in a water bath for the indicated chase time at 37 °C. At 18 °C, LDL was internalized and accumulated in pre-lysosomal compartments without significant hydrolysis of CL. When the temperature was increased to 37 °C, CL in LDL was rapidly hydrolyzed to become free cholesterol and transported to designated locations in a time-dependent manner (3Sugii S. Reid P.C. Ohgami N. Du H. Chang T.Y. J. Biol. Chem. 2003; 278: 27180-27189Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar). After the chase, the labeled cellular lipids were extracted and analyzed by TLC as described (37Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar); the percent hydrolysis was calculated as [3H]cholesterol and [3H]cholesteryl oleate counts divided by the sum of [3H]cholesteryl linoleate, [3H]cholesterol, and [3H]cholesteryl oleate counts; the percent reesterification was calculated as [3H]cholesteryl oleate counts divided by the sum of [3H]cholesteryl linoleate, [3H]cholesterol, and [3H]cholesteryl oleate counts. Total uptake of LDL was calculated as the sum of [3H]cholesteryl linoleate, [3H]cholesterol, and [3H]cholesteryl oleate counts divided by the cellular protein amount. The protein amount was determined by the Bradford method using the assay reagent from Bio-Rad. For cholesterol efflux experiments, cells were incubated with 4% CD (as sterol acceptor) in Medium D in the presence of the ACAT inhibitor (2 μm F12511) (29Chang C.C.Y. Sakashita N. Ornvold K. Lee O. Chang E.T. Dong R. Lin S. Lee C.Y. Strom S.C. Kashyap R. Fung J.J. Farese Jr., R.V. Patoiseau J.F. Delhon A. Chang T.Y. J. Biol. Chem. 2000; 275: 28083-28092Abstract Full Text Full Text PDF PubMed Scopus (186) Google Scholar) at 37 °C for 10 min. The labeled lipids were extracted and analyzed as described (37Cadigan K.M. Spillane D.M. Chang T.Y. J. Cell Biol. 1990; 110: 295-308Crossref PubMed Scopus (91) Google Scholar). The percent cholesterol efflux was calculated as [3H]cholesterol counts in the medium divided by the sum of [3H]cholesteryl linoleate counts in the cell and [3H]cholesterol counts in the cell and in the medium. In a control experiment, to test the efficacy of CD in removing PM-CHOL, we labeled the PM of intact cells with [3H]cholesterol at 4 °C (by using the [3H]cholesterol/liposome method (45Spillane D.M. Reagan J.W.J. Kennedy N.J. Schneider D.L. Chang T.Y. Biochim. Biophys. Acta. 1995; 1254: 283-294Crossref PubMed Scopus (20) Google Scholar)) and then treated the labeled cells with CD for 10 min at 37 °C. We found that CD removed 80-90% of the total cellular label (results not shown). Assays to Monitor the Fate of PM-labeled Cholesterol—Prior to the experiment, cells were plated in 6- or 12-well dishes and were cultured for 36 h in Medium D to deplete stored cholesterol within the cell. The PM of intact cells was labeled with [3H]cholesterol by adding ethanolic stock solution of [3H]cholesterol (at 1 μCi/ml) to cells grown in Medium D at 37 °C; the final concentration of ethanol in the growth medium was 0.1%. After labeling for 12 h, the cells were washed and chased at 37 °C for 8 h. Afterward, the radiolabeled lipids were extracted and separated by TLC as described previously (38Cruz J.C. Sugii S. Yu C. Chang T.Y. J. Biol. Chem. 2000; 275: 4013-4021Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). The percent esterification was calculated as [3H]cholesteryl oleate counts divided by the sum of [3H]cholesterol and [3H]cholesteryl oleate counts. For cholesterol efflux experiments, after cells were labeled with [3H]cholesterol for 12 h as described above, and they were washed and chased in Medium D with ACAT inhibitor added (2 μm F12511) at 37 °C for 6 h and then incubated with 4% CD in Medium D with ACAT inhibitor added at 37 °C for 10 min. The percent cholesterol efflux was calculated as [3H]cholesterol counts in the medium divided by the sum of [3H]cholesterol counts in the cell and in the medium. Percoll Gradient Analysis—The fractionation met

Trans-splicing, a process involving the cleavage and joining of two separate transcripts, can expand the transcriptome and proteome in eukaryotes. Chimeric RNAs generated by trans-splicing are increasingly described in literatures. The widespread presence of antibiotic resistance genes in natural environments and human intestines is becoming an important challenge for public health. Certain antibiotic resistance genes, such as ampicillin resistance gene (Amp(r)), are frequently used in recombinant plasmids. Until now, trans-splicing involving recombinant plasmid-derived exogenous transcripts and endogenous cellular RNAs has not been reported. Acyl-CoA:cholesterol acyltransferase 1 (ACAT1) is a key enzyme involved in cellular cholesterol homeostasis. The 4.3-kb human ACAT1 chimeric mRNA can produce 50-kDa and 56-kDa isoforms with different enzymatic activities. Here, we show that human ACAT1 56-kDa isoform is produced from an mRNA species generated through the trans-splicing of an exogenous transcript encoded by the antisense strand of Amp(r) (asAmp) present in common Amp(r)-plasmids and the 4.3-kb endogenous ACAT1 chimeric mRNA, which is presumably processed through a prior event of interchromosomal trans-splicing. Strikingly, DNA fragments containing the asAmp with an upstream recombined cryptic promoter and the corresponding exogenous asAmp transcripts have been detected in human cells. Our findings shed lights on the mechanism of human ACAT1 56-kDa isoform production, reveal an exogenous-endogenous trans-splicing system, in which recombinant plasmid-derived exogenous transcripts are linked with endogenous cellular RNAs in human cells, and suggest that exogenous DNA might affect human gene expression at both DNA and RNA levels.

Acyl coenzyme A-cholesterol acyltransferase (ACAT) catalyzes the formation of intracellular cholesterol esters. It is present in a variety of tissues and is believed to play significant roles in cholesterol homeostasis. Under pathologic conditions, accumulation of the ACAT reaction product as cytoplasmic cholesterol ester lipid droplets within macrophages and smooth muscle cells is a characteristic feature of early lesions of human atherosclerotic plaques. ACAT is a membrane protein located in the endoplasmic reticulum. Its activity is susceptible to inactivation by detergents, and it has never been purified to homogeneity; no antibodies directed against it have been reported. Through a somatic cell and molecular genetic approach, we have recently succeeded in molecular cloning and functional expression of a human macrophage ACAT cDNA. This cDNA contains an open reading frame of 1650 base pairs encoding an integral membrane protein of 550 amino acids. Protein homology analysis shows that the predicted protein sequence shares short regions of homology with other enzymes involved in the catalysis of acyl adenylate formation with subsequent acyl thioester formation and acyl transfer. The ACAT cDNA will enable the investigation of ACAT biochemistry and molecular biology. It will speed up the design of specific ACAT inhibitors as drugs that may provide more effective therapeutic treatment or prevention of atherosclerosis. In addition, studies on the physiologic roles of ACAT in various tissues can now be undertaken through transgenic animal research.

Acyl-coenzyme A:cholesterol acyltransferase (ACAT) plays important roles in cellular cholesterol homeostasis and in the early stages of atherosclerosis. ACAT1 is an integral membrane protein with multiple transmembrane domains. Human ACAT1 contains nine cysteine residues; its activity is severely inhibited by various thiol-specific modification reagents including p-chloromercuribenzene sulfonic acid, suggesting that certain cysteine residue(s) might be near or at the active site. We constructed various ACAT1 mutants that contained either single cysteine to alanine substitution at various positions, contained a reduced number of cysteines, or contained no cysteine at all. Each of these mutants retained 20% or more of the wild-type ACAT activity. Therefore, cysteine is not essential for ACAT catalysis. For the cysteine-free enzyme, its basic kinetic properties and intracellular localization in Chinese hamster ovary cells were shown to be very similar to those of the wild-type enzyme. The availability of the cysteine-free ACAT1 will facilitate future ACAT structure function studies. Additional studies show that Cys467 is one of the major target sites that leads top-chloromercuribenzene sulfonic acid-mediated ACAT1 inactivation, suggesting that Cys467 may be near the ACAT active site(s). Acyl-coenzyme A:cholesterol acyltransferase (ACAT) plays important roles in cellular cholesterol homeostasis and in the early stages of atherosclerosis. ACAT1 is an integral membrane protein with multiple transmembrane domains. Human ACAT1 contains nine cysteine residues; its activity is severely inhibited by various thiol-specific modification reagents including p-chloromercuribenzene sulfonic acid, suggesting that certain cysteine residue(s) might be near or at the active site. We constructed various ACAT1 mutants that contained either single cysteine to alanine substitution at various positions, contained a reduced number of cysteines, or contained no cysteine at all. Each of these mutants retained 20% or more of the wild-type ACAT activity. Therefore, cysteine is not essential for ACAT catalysis. For the cysteine-free enzyme, its basic kinetic properties and intracellular localization in Chinese hamster ovary cells were shown to be very similar to those of the wild-type enzyme. The availability of the cysteine-free ACAT1 will facilitate future ACAT structure function studies. Additional studies show that Cys467 is one of the major target sites that leads top-chloromercuribenzene sulfonic acid-mediated ACAT1 inactivation, suggesting that Cys467 may be near the ACAT active site(s). acyl-coenzyme A:cholesterol acyltransferase acyl carrier protein 3-[(3-cholamidopropyl)-dimethylammonio]-1-propanesulfonate Chinese hamster ovary 5,5′-dithiobis-2-nitrobenzoate endoplasmic reticulum N-ethylmaleimide phosphatidylcholine para-chloromercuribenzene sulfonic acid wild-type Acyl-coenzyme A:cholesterol acyltransferase (ACAT)1 catalyzes the formation of cholesteryl esters using fatty acyl-coenzyme A and cholesterol as substrates. It plays important roles in cellular cholesterol homeostasis and in the early stages of atherosclerosis (reviewed in Ref. 1Chang T.Y. Chang C.C.Y. Cheng D. Annu. Rev. Biochem. 1997; 66: 613-638Crossref PubMed Scopus (441) Google Scholar). For these reasons, this enzyme has been a pharmaceutical target for drug therapy of hyperlipidemia and atherosclerosis (reviewed in Ref. 2Krause B.R. Bocan T.M.A. Ruffolo Jr., R.R. Holliinger M.A. Inflammation: Mediators and Pathways. CRC Press, Inc., Boca Raton, FL1995: 173-198Google Scholar). In mammals, two ACAT genes (designated as ACAT1and ACAT2) have been identified (reviewed in Refs. 3Buhman K.F. Accada M. Farese Jr., R.V. Biochim. Biophys. Acta. 2000; 1529: 142-154Crossref PubMed Scopus (174) Google Scholar, 4Rudel L. Lee R. Cockman T. Curr. Opin. Lipidol. 2001; 12: 121-127Crossref PubMed Scopus (209) Google Scholar, 5Chang T.Y. Chang C.C.Y. Lin S. Yu C. Li B.L. Miyazaki A. Curr. Opin. Lipidol. 2001; 12: 289-296Crossref PubMed Scopus (211) Google Scholar). In addition, a related gene called DGAT1(diacylglycerolacyltransferase 1) has been identified based on its protein sequence homology near the C-terminal of ACAT1 (6Cases S. Smith S.J. Zheng Y.W. Myers H.M. Lear S.R. Sande E. Novak S. Collins C. Welch C.B. Lusis A.J. Erickson S.K. Farese Jr., R.V. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13018-13023Crossref PubMed Scopus (886) Google Scholar). In adult humans, ACAT1 is ubiquitously expressed in various tissues including hepatocytes, macrophages, adrenals, intestines, and neurons (7Chang C.C.Y. Huh H.Y. Cadigan K.M. Chang T.Y. J. Biol. Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar, 8Lee O. Chang C.C.Y. Lee W. Chang T.Y. J. Lipid Res. 1998; 39: 1722-1727Abstract Full Text Full Text PDF PubMed Google Scholar, 9Sakashita N. Miyazaki A. Takeya M. Horiuchi S. Chang C.C.Y. Chang T.Y. Takahashi K. Am. J. Pathol. 2000; 156: 227-236Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 10Chang C.C.Y. Sakashita N. Ornvold K. Lee O. Chang E. Dong R. Lin S. Lee C.Y.G. Strom S. Kashyap R. Fung J. Farese Jr., R. Patoiseau J.F. Delhon A. Chang T.Y. J. Biol. Chem. 2000; 275: 28083-28092Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar), whereas ACAT2 is mainly located at the apical region of the small intestines (10Chang C.C.Y. Sakashita N. Ornvold K. Lee O. Chang E. Dong R. Lin S. Lee C.Y.G. Strom S. Kashyap R. Fung J. Farese Jr., R. Patoiseau J.F. Delhon A. Chang T.Y. J. Biol. Chem. 2000; 275: 28083-28092Abstract Full Text Full Text PDF PubMed Scopus (187) Google Scholar). The physiological functions of ACAT1 and ACAT2 in various tissues are under active investigation in several laboratories. ACAT1 is an integral membrane protein with four identical subunits (11Yu C. Chen J. Lin S. Liu J. Chang C.C.Y. Chang T.Y. J. Biol. Chem. 1999; 274: 36139-36145Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). It is mainly located in the endoplasmic reticulum (12Lin S. Cheng D. Liu M.S. Chen J. Chang T.Y. J. Biol. Chem. 1999; 274: 23276-23285Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Depending on the methods of analysis employed, it may span the ER membrane seven times (12Lin S. Cheng D. Liu M.S. Chen J. Chang T.Y. J. Biol. Chem. 1999; 274: 23276-23285Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar) or five times (13Joyce C.W. Shelness G.S. Davis M.A. Lee R.G. Skinner K. Anderson R.A. Rudel L.L. Mol. Biol. Cell. 2000; 11: 3675-3687Crossref PubMed Scopus (101) Google Scholar). The recombinant human ACAT1 overexpressed in Chinese hamster ovary (CHO) cells has been solubilized in the zwitterionic detergent CHAPS and has been purified to homogeneity with retention of catalytic activity (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). When placed either in vesicles or in mixed micelles, the purified enzyme responds to its substrate cholesterol in a sigmoidal manner but responds to the other substrate oleoyl-coenzyme A in a hyperbolic manner. These results imply that the enzyme is allosterically regulated by cholesterol but not by oleoyl-coenzyme A (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). The molecular basis of ACAT allosterism is unknown. With regard to the nature of the ACAT active site, little information is available at present. For hamster ACAT1, a serine to leucine mutation (corresponding to Ser269 in human ACAT1) caused the mutant ACAT1 to lose enzyme activity when expressed in CHO cells (15Cao G. Goldstein J.L. Brown M.S. J. Biol. Chem. 1996; 271: 14642-14648Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar) or in yeast cells (16Guo Z. Cromley D. Billheimer J.T. Sturley S.L. J. Lipid Res. 2001; 42: 1282-1291Abstract Full Text Full Text PDF PubMed Google Scholar). This serine is conserved in ACAT2 and in DGAT1. Joyce and colleagues (13Joyce C.W. Shelness G.S. Davis M.A. Lee R.G. Skinner K. Anderson R.A. Rudel L.L. Mol. Biol. Cell. 2000; 11: 3675-3687Crossref PubMed Scopus (101) Google Scholar) showed that the same mutation caused loss of enzyme activity in ACAT2 when the mutant enzyme was assayed in extracts of transfected cells. These results support the hypothesis that Ser269 may constitute part of the ACAT active site. On the other hand, the S269L mutation also caused the resultant ACAT1 protein to be expressed at a much lower level than that of the wild-type (WT) enzyme in transfected cells (15Cao G. Goldstein J.L. Brown M.S. J. Biol. Chem. 1996; 271: 14642-14648Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 16Guo Z. Cromley D. Billheimer J.T. Sturley S.L. J. Lipid Res. 2001; 42: 1282-1291Abstract Full Text Full Text PDF PubMed Google Scholar). Therefore, it is possible that Ser269 is not part of the active site; instead, the S269L mutation may cause gross structural alteration of the enzyme that leads to rapid degradation of the enzyme. Guo et al. (16Guo Z. Cromley D. Billheimer J.T. Sturley S.L. J. Lipid Res. 2001; 42: 1282-1291Abstract Full Text Full Text PDF PubMed Google Scholar) recently proposed that several residues might constitute part of the ACAT substrate-binding site(s). A family of more than 20 membrane-boundO-acyltransferases from different species has been identified (17Hofmann K. Trends Biochem. Sci. 2000; 25: 111-112Abstract Full Text Full Text PDF PubMed Scopus (391) Google Scholar). This gene family encodes membrane proteins that transfer organic acids onto hydroxyl groups of membrane-embedded targets. A histidine (460 in human ACAT1) within a long hydrophobic region is invariant within this family, suggesting that it might be part of the active site. In the 1980s, before molecular probes of ACAT were available, Kinnunenet al. (18Kinnunen P.M. DeMichele A. Lange L.G. Biochemistry. 1988; 27: 7344-7350Crossref PubMed Scopus (44) Google Scholar, 19Kinnunen P.M. Spilburg C.A. Lange L.G. Biochemistry. 1988; 27: 7351-7356Crossref PubMed Scopus (16) Google Scholar) used isolated microsomes from rabbit tissue homogenates, performed chemical modification studies, and concluded that certain cysteine residue(s) and certain histidine residue(s) may be near or at the ACAT active site. In the current study, we first purified the histidine-tagged recombinant human ACAT1 (HisACAT1) (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar) expressed in infected insect High Five (H5) cells to homogeneity. We next showed that the purified ACAT1 is sensitive to various thiol modification reagents including p-chloromercuribenzene sulfonic acid (pCMBS). Human ACAT1 contains 9 cysteine residues. We utilized site-directed mutagenesis to replace each cysteine with an alanine and found that each of the single Cys to Ala mutants retained a significant amount of ACAT activity. We then constructed various ACAT1 mutants with reducing numbers of cysteines, as well as an ACAT1 mutant that completely lacks cysteine. We found that each of these additional mutants retained at least 20% of the activity found in the WT ACAT1; their Km values for oleoyl-CoA and the sigmoidal responses to cholesterol concentration were all similar to those of the WT enzyme. These results indicate that none of the cysteines is essential for ACAT1 catalysis. We also showed that Cys467is one of the major pCMBS target sites that leads to ACAT1 inactivation. Together, our results suggest that pCMBS inhibits ACAT activity by covalently attaching a bulky group to Cys467near the ACAT active site(s). CHAPS, taurocholate, fetal bovine serum, oleoyl-coenzyme A, egg phosphatidylcholine (PC), cholesteryl oleate, cholesterol, fatty acid-free bovine serum albumin, pCMBS,N-ethylmaleimide (NEM), 5,5′-dithiobis-2-nitrobenzoate (DTNB), and iodoacetamide were purchased from Sigma. Dithiothreitol and disuccinimidyl suberate were purchased from Pierce. Reagent grade organic solvents were obtained from Fisher. [9,10-3H(N)]Oleic acid was from American Radiolabeled Chemicals (30 Ci/mmol). [3H]Oleoyl-coenzyme A was synthesized as described (20Bishop J.E. Hajra A.K. Anal. Biochem. 1980; 106: 344-350Crossref PubMed Scopus (77) Google Scholar). Cobalt metal affinity resin was fromCLONTECH Laboratories. The monoclonal antibody against human ACAT1 was from Vancouver Biotech. Fugene 6 transfection reagent was from Roche Molecular Biochemicals. Mutagenesis primers were synthesized by Invitrogen. BaculoGold virus DNA and pVL1393 transfer vector were from PharMingen. The F-12 medium was from Cellgro; Grace's medium and Opti-MEM medium were from Invitrogen. His6-tagged human ACAT1cDNA (HisACAT1) (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar) was cloned in pGEM-7Z(−) vector (Promega). Using this construct as a template, various ACAT1 mutants containing single Cys to Ala substitutions were generated by high fidelity PCR-based mutagenesis, using Stratagene's QuikChange site-directed mutagenesis kit. Table Ilists the pairs of primers used in the PCR mutagenesis experiments. The mutated ACAT1 cDNAs were released from pGEM-7Z(−) vector by EcoRI and NsiI double digestion and then inserted into EcoRI- and PstI-treated transfer vector pVL1393. The ACAT1-positive transfer vectors were co-transfected into insect SF9 cells with linearized BaculoGold DNA. Five days after transfection, recombinant viruses produced from transfected cells were harvested from the medium and then amplified using SF9 cells. To construct various additional cysteine-deficient mutants, including the one devoid of cysteines, multiple rounds of PCR mutagenesis and subcloning were performed. The construction procedures are briefly described as follows: 1) using the mutant ACAT1C333A construct as the template and appropriate primers, Cys345 and Cys365 were mutated to alanines to produce the construct ACAT1 C6, with 6 cysteines remaining (at positions 92, 387, 467, 516, 528, and 546). 2) Using the mutantACAT1 C467A as the template and appropriate primers, Cys516 and Cys546 were mutated to alanines; the resultant construct was then cut by NdeI andHindIII. The released fragment that contained the region from residues 240 to the C terminus was directionally cloned into the truncated mutant ACAT1 construct C92A produced by cutting the construct by the same enzymes. This procedure produced the mutant construct ACAT1 C5, with 5 cysteines remaining (at positions 333, 345, 365, 387, and 528). 3) The C6 construct was sequentially digested with NcoI and StyI; the released region containing residues 223–464 was swapped with the corresponding region present in the C5 construct by restriction digestion and directional cloning. The resultant construct only retained Cys387 and Cys528 and is designated as C2 (387/528). 4) Using construct C2 (387/528) as the template and appropriate primers, a similar strategy was used to produce construct C1 (528), which has only one cysteine remaining (at position 528), and to produce construct C0, which has no cysteine remaining. 5) The construct C2 (528/546) was produced by reverting the Ala in position 546 back to Cys through mutagenesis, using construct C1 (528) as the template. The C1 (467) mutant and C1 (345) mutant were generated in a similar manner. After PCR mutagenesis, the authenticity of all of the mutations present in mutant cDNAs and in mutant viruses were verified by automatic DNA sequencing at regions flanking the mutations. Viral DNAs were isolated using a published procedure (21O'Reilly D.R. Miller L.K. Luckow V.A. Baculovirus Expression Vectors: A Laboratory Manual. W. H. Freeman and Company, New York1992: 141-142Google Scholar). The results verified that all of the mutant cDNAs and all of the mutant viruses contained the correct mutations as predicted.Table ISites of cysteine to alanine mutagenesis in HisACAT1MutationsSense strand primerAnti-sense strand primerC92AGATAATGGTGGGgccGCTCTCACAACCGGTTGTGAGAGCggcCCCACCATTATCC333AGCACAGGTCTTTGGTgccTTTTTCTATGTGCACATAGAAAAAggcACCAAAGACCTGTGCC345ACTTTGAAAGGCTTgctGCCCCCTTGTTTCGGCCGAAACAAGGGGGCageAAGCCTTTCAAAGC365ACGTGTTCTGGTCCTAgctCTATTTAACTCCGGAGTTAAATACageTAGGACCAGAACACGC387AGCCTTTTTGCACgcgTGGCTCAATGCGGCATTGAGCCAcgcGTGCAAAAAGGCC467AGCCTTGGCTGTTgccTTGAGCTTTTTCGAAAAAGCTCAAAggcAACAGCCAAGGCC516AGCAATGGAGTCTTACTCgccTTTTATTCTCAAGCTTGAGAATAAAAggcGAGTAAGACTCCATTGCC528AGGTATGCACGTCGGCACgctCCTCTGAAAAATCGATTTTTCAGAGGagcGTGCCGACGTGCATACCC546ACCACGTTCCTGGACTgctCGTTACGTGTTTTAGCTAAAACACGTAACGagcAGTCCAGGAACGTGGHisACAT1 cDNA was subjected to site-directed mutagenesis, creating nine individual C to A mutations as indicated. The mismatched codons are shown with lowercase letters. The numbering of residues is according to amino acid numbering of human ACAT1 (7Chang C.C.Y. Huh H.Y. Cadigan K.M. Chang T.Y. J. Biol. Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar). Open table in a new tab HisACAT1 cDNA was subjected to site-directed mutagenesis, creating nine individual C to A mutations as indicated. The mismatched codons are shown with lowercase letters. The numbering of residues is according to amino acid numbering of human ACAT1 (7Chang C.C.Y. Huh H.Y. Cadigan K.M. Chang T.Y. J. Biol. Chem. 1993; 268: 20747-20755Abstract Full Text PDF PubMed Google Scholar). The purification procedure was adopted with modifications from the one published earlier using CHO cells as the enzyme source (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). In brief, insect H5 cells were cultured in 20–30 150 mm-size tissue culture plates with Grace's medium plus 5% fetal bovine serum. Each plate was infected by a high titer recombinant ACAT1 baculovirus; all of the recombinant ACAT1s contain a His6 tag at their N termini. The cells were harvested by hypotonic shock and scraping after 48 h of infection. The protein concentration of the cell homogenates was kept at 2–4 mg/ml in 50 mm Tris at pH 7.8, with 0.5 μg/ml leupeptin, 2.5 μg/ml antipain, 0.1 μg/ml chymostatin, and 2 μg/ml aprotinin. The cell extracts were solubilized in 2% CHAPS and 1 mKCl. After centrifugation at 100,000 × g at 4 °C for 45 min, the supernatants were loaded onto a 10-ml (1.6 × 5 cm) cobalt affinity column pre-equilibrated with buffer that consists of 50 mm Tris-HCl, pH 7.8, 0.5% CHAPS, and 1 mKCl. The column was extensively washed with the column equilibration buffer and then eluted with a buffer of similar composition but containing 10 mm imidazole. Next, the ACAT1-containing fractions were eluted out by using buffer with higher imidazole concentration (50 mm). The active fractions were pooled and further purified by using a 5-ml ACAT1 monoclonal antibody affinity column according to the procedure described previously (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). The assays were carried out in bile salt/cholesterol/PC mixed micelles as described before (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). For each reaction, 20 μl of purified WT ACAT1 or various partially purified mutant ACAT1s in 50 mm Tris-HCl, pH 7.8, 0.5% CHAPS, and 1m KCl were incubated with 1 μl of a specific thiol modification reagent, prepared individually as stock solutions in Me2SO, at 4 °C for 30 min. Next, the mixtures were diluted 5-fold by adding 80 μl of taurocholate/PC/cholesterol mixed micelles, and the ACAT activity was measured at 37 °C for 5 min after adding 20 μl of labeled oleoyl-CoA/bovine serum albumin mixture (5 nmol). The activities of the enzyme treated with 1 μl of Me2SO only were used as the 100% values. The protein contents of purified ACAT1 were determined by using Coomassie Blue staining after SDS-PAGE, using bovine serum albumin as the standard for quantitation purposes. All other protein determinations were made using Peterson's modification of the Lowry method (22Peterson G.L. Anal. Biochem. 1977; 83: 346-356Crossref PubMed Scopus (7141) Google Scholar). Salt and detergent present in each sample were removed using the chloroform/methanol extraction procedure (23Wessel D. Flugge U.I. Anal. Biochem. 1984; 138: 141-143Crossref PubMed Scopus (3184) Google Scholar). All samples were then resuspended in loading buffer containing 50 mm Tris, pH 6.8, 9% SDS, 50 mm dithiothreitol, 10% glycerol, and 0.05% bromphenol blue, incubated at 37 °C for 15 min, and then analyzed by SDS-PAGE. DM10, the affinity-purified polyclonal rabbit IgGs against ACAT1 amino acid residues 1–131, were used as the primary antibodies for immunoblotting (24Chang C.C.Y. Chen J. Thomas M.A. Cheng D. Del Priore V.A. Newton R.S. Pape M.E. Chang T.Y. J. Biol. Chem. 1995; 270: 29532-29540Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). Densitometric analysis of immunoblot signals was performed using National Institutes of Health imaging software. Previously, we had purified the recombinant HisACAT1 to homogeneity from a stable transfectant of CHO cells that overexpress hACAT1 (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). The amount of purified ACAT1 protein from this source is very limited. To seek a better source as starting material for enzyme purification, we attempted to express HisACAT1 through a recombinant virus infection in insect H5 cells, using a procedure similar to the one previously developed in this laboratory (25Cheng D. Chang C.C.Y. Qu X. Chang T.Y. J. Biol. Chem. 1995; 270: 685-695Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar). We found that the specific activity of ACAT1 present in homogenates of infected H5 cells was 5–10 times higher than that of the same enzyme stably expressed in CHO cells. We thus used this source as the starting material and developed a purification scheme as summarized in Fig.1A. Using this scheme, we purified HisACAT1 protein to electrophoretic homogeneity, as shown in Fig.1B (lanes 6 and 7). We can routinely obtain 5–10 μg of purified ACAT1 protein from 20 150-mm tissue culture plates of infected insect cells. The specific activity of the final preparation is 3,500–4,000 nmol/min/mg, which is comparable with the specific activity of the final preparation obtained by using the CHO cells as the enzyme source (14Chang C.C.Y. Lee C.Y.G. Chang E.T. Cruz J.C. Levesque M.C. Chang T.Y. J. Biol. Chem. 1998; 273: 35132-35141Abstract Full Text Full Text PDF PubMed Scopus (108) Google Scholar). Using purified HisACAT1 as the source, we tested its susceptibility to inactivation by various thiol modification reagents. Four different −SH modifying reagents were employed: pCMBS, DTNB, NEM, and iodoacetamide. We found that either pCMBS or DTNB, each containing a bulky group, inactivated ACAT1 at relatively low concentration (with IC50 at about 10 μm), whereas NEM, a reagent smaller in size, inactivated the enzyme at much higher concentrations. The IC50 for NEM-mediated inhibition is about 50-fold higher than that of pCMBS-mediated or DTNB-mediated inhibition. We also found that iodoacetamide, which is smaller than NEM, did not inactivate ACAT activity even at 1 mm concentration (Fig.2). Therefore, the inhibitory efficiency of these modification reagents seems to correlate well with their sizes. The above result supported the hypothesis that certain Cys residue(s) may be near or at the ACAT active site. We undertook the site-specific mutagenesis approach to further investigate this issue. Human ACAT1 contains 9 cysteines, with their locations indicated in Fig.3A. Among them, Cys92, Cys365, Cys467, and Cys516 are conserved in ACAT1s from various species; Cys333, Cys345, Cys387, Cys528, and Cys546 are conserved in both ACAT1s and ACAT2s. On the other hand, none of these cysteines is conserved in DGAT1, an ACAT homolog that also uses long chain fatty acyl-CoA as a substrate. We converted each of these 9 cysteines to an alanine, then incorporated each mutant into the recombinant baculovirus genome, and expressed it in H5 cells. The ACAT protein expression levels were monitored by performing Western blotting using anti-ACAT1 IgGs (DM10) and by measuring ACAT activity in the crude cell extracts. The results showed that, similar to the WT ACAT1, each mutant ACAT1 was expressed as a single, undegraded 50-kDa band (Fig. 3B, bandsnear the top). The ACAT enzyme specific activity determinations showed that each mutant ACAT1 was at least partially active when compared with the activity of the WT ACAT1 (Fig.3B, bars near the bottom). The expression levels of individual ACAT1 mutants varied to some extent, as judged by the intensities of bands in Western blot analysis (Fig.3B). When the activities of the WT and mutant ACATs present in the cell extracts were normalized by the ACAT protein content, the results showed that all of the Cys to Ala mutants contained 50% or more of the WT ACAT activity (Fig. 3C). The variations in activity in some of the ACAT1s with single Cys to Ala substitutions might be caused by subtle structural alteration(s) induced by the individual mutations. The above result suggested that cysteines might not be required for ACAT1 catalysis. We asked whether mutant ACAT1s with reducing numbers of cysteines still retain enzyme activity. To test this possibility, we produced the following mutant ACAT1 viruses: C6 (retaining cysteines at positions 92, 387, 467, 516, 528, and 546); C5 (retaining cysteines at positions 333, 345, 365, 387, and 528); C2 (387/528) (retaining cysteines at positions 387 and 528); C2 (528/546) (retaining cysteines at positions 528 and 546); C1 (528) (retaining cysteine at position 528); and C0 (retaining no cysteines). The enzyme activities of these mutant proteins expressed in infected cells were then analyzed. The results showed that all of the Cys-deficient ACAT1s examined retained at least partial enzyme activity (based on specific activity measurement (Fig. 4A)). To compare the relative ACAT activity in a more precise manner, we loaded the same amount of ACAT activity found in each cell extract and then monitored their relative ACAT protein contents by Western analysis. When analyzed in this manner, one expects that those cell extracts containing higher intrinsic enzyme activity will give less intense ACAT1 protein signals. The results (Fig. 4B) showed that mutant ACAT1 C6 contained essentially the same activity as the WT ACAT1; other mutant ACAT1s (C5, C2 (387/528), and C1 (528)) contained ∼33–59% of the activity of WT ACAT1. The one completely devoid of cysteines (C0) still contained ∼40% of the activity of WT ACAT1. We next expressed several Cys-deficient mutant ACAT1s (the C2 (528/546), C1 (528), and the C0) in ACAT-deficient CHO cells (AC29) by transient transfections. The relative enzyme activities of these mutants were evaluated by performing [3H]oleate incorporation in intact cells (Fig.5A) and by immunoblot (Fig.5B). The normalized ACAT activities were calculated by dividing the values in Fig. 5A by the values in Fig.5B. The result showed that the C1 (528) mutant and the C0 mutant still contained a significant amount of residual enzyme activity, supporting the conclusion derived from insect cell expression studies. The expression levels of the C1 and C0 mutant ACAT1s in CHO cells were much lower than that of the WT ACAT1 (Fig. 5B), and it is difficult to precisely evaluate their relative contents within the same blot. Therefore, for ACAT-specific activity determinations, the results obtained in Fig. 5C may not be as precise as those obtained in Fig. 4B. To examine the intracellular location of the C0 mutant in CHO cells, we performed double immunofluorescence experiments using laser scanning confocal microscopy with differential interference contrast optics. We found that the mutant ACAT1 C0 extensively colocalized with the ER marker Bip (Fig. 5D). Its localization pattern is essentially the same as what we had previously reported for the WT ACAT1 expressed in CHO cells (12Lin S. Cheng D. Liu M.S. Chen J. Chang T.Y. J. Biol. Chem. 1999; 274: 23276-23285Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). The same localization patterns were also found for ACAT1 mutant C2 (528/546) and for mutant C1 (528) (results not shown). We had previously used chemical cross-linking in intact cells as one of three methods to estimate the oligomeric state of WT ACAT1 (11Yu C. Chen J. Lin S. Liu J. Chang C.C.Y. Chang T.Y. J. Biol. Chem. 1999; 274: 36139-36145Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). We found that the amine-specific homo-bifunctional chemical cross-linking agent disuccinimidyl suberate caused the formation of material two to four times the size of the monomeric enzyme when added to intact insect cells expressing either WT ACAT1 or mutant ACAT1 C0 (Fig. 6). This result suggested that mutant ACAT1 C0, similar to WT ACAT1, is also a homotetrameric enzyme.Figure 5Cys-deficient HisACAT1s expressed in CHOcells are catalytically active, and are localized mainly in theER. Cys-deficient ACAT1 mutants (C2 (528/546), C1 (528), and C0) i

Acyl-CoA:cholesterol acyltransferase (ACAT) plays important roles in cellular cholesterol homeostasis. Two ACAT genes exist in mammals. We report here the genomic organization of human ACAT-2 gene and analysis of its promoter activity in various cell lines. The human ACAT-2 gene spans over 18 kb and contains 15 exons. Three transcription start sites and one poly(A) site are identified by the 5′/3′-RACE. In addition, the human ACAT-2 gene is linked to the insulin-like growth factor binding protein 6 (IGFBP-6) gene in a head-to-tail manner with a small intergenic region of about 1.2 kb. The 5′-flanking region of human ACAT-2 gene contains many potential cis-acting elements for multiple transcriptional regulatory factors but lacks TATA and CCAAT boxes. Using promoter-luciferase reporter assays, we demonstrate the transcriptional activity of ACAT-2 gene promoter is high in Caco-2 cells, especially after these cells become postconfluent and behave as intestinal enterocytes.

Acyl-coenzyme A:cholesterol acyltransferase 1 (ACAT1) is a resident enzyme in the endoplasmic reticulum. ACAT1 is a homotetrameric protein and contains nine transmembrane domains (TMDs). His460 is a key active residue and is located within TMD7. Human ACAT1 has seven free Cys, but the recombinant ACAT1 devoid of free Cys retains full enzyme activity. To further probe the functionality of TMD7 (amino acids 446−460) and TMD8 (amino acids 466−481), we used a parental ACAT1 devoid of free Cys as the template to perform Cys-scanning mutagenesis within these regions. Each of the single Cys mutants was expressed in Chinese hamster ovary (CHO) cell line AC29 lacking endogenous ACAT1. We measured the effect of single Cys substitution on enzyme activity and used the Cu(1,10-phenanthroline)2SO4-mediated disulfide cross-linking method to probe possible interactions of engineered Cys between the two identical subunits. The results show that several residues in one subunit closely interact with the same residues in the other subunit; mutating these residues to Cys does not lead to large loss in enzyme activity. Helical wheel analysis suggests that these residues are located at one side of the coil. In contrast, mutating residues F453, A457, or H460 to Cys causes large loss in enzyme activity; the latter residues are located at the opposite side of the coil. A similar arrangement is found for residues in TMD8. Thus, helical coils in TMD7 and TMD8 have two distinct functional sides: one side is involved in substrate-binding/catalysis, while the other side is involved in subunit interaction.

Cholesterol has been implicated in various neurodegenerative diseases. Here we review the connection between cholesterol and Alzheimer's disease (AD), focusing on a recent study that links neuronal cholesterol esterification with biosynthesis of 24(S)-hydroxycholesterol and the fate of human amyloid precursor protein in a mouse model of AD. We also briefly evaluate the potential of ACAT1 as a drug target for AD.

Acyl-CoA:cholesterol acyltransferase (ACAT) inhibitors have been considered as potential therapeutic agents to treat several diseases, including Alzheimer’s disease, atherosclerosis, and cancer. While many ACAT inhibitors are readily available, methods to encapsulate them as nanoparticles have not been reported. We report a simple method to encapsulate ACAT inhibitors, using the potent hydrophobic ACAT inhibitor F12511 as an example. By mixing DSPE-PEG2000, egg phosphatidylcholine (PC), and F12511 in ethanol, followed by drying, resuspension and sonication in buffer, we show that F12511 can be encapsulated as stealth liposomes at high concentration. We successfully incorporated F12511 into nanoparticles and found that increasing PC in the nanoparticles markedly increased the amount of F12511 incorporated in stealth liposomes. The nanoparticles containing F12511 (Nanoparticle F) exhibit average size of approximately 200 nm and are stable at 4 ºC for at least 6 months. Nanoparticle F is very effective at inhibiting ACAT in human and mouse neuronal and microglial cell lines. Toxicity tests using mouse primary neuronal cells show that F12511 alone or Nanoparticle F added at concentrations from 2 to 10 µM for 24-, 48-, and 72-hours produces minimal, if any, toxicity. Unlike existing methods, the current method is simple, cost effective, and can be expanded to produce tagged liposomes to increase specificity of delivery. This also offers opportunity to embrace water soluble agent(s) within the aqueous compartment of the nanoparticles for potential combinatorial therapy. This method shows promise for delivery of hydrophobic ACAT inhibitors at high concentration in vivo.

Using a stable cell line 25-RA derived from wild-type Chinese hamster ovary (CHO) cells as the parental cell, this laboratory previously reported the isolation and characterization of CHO cell mutants (cholesterol-trafficking or CT) defective in transporting LDL-derived cholesterol out of the acidic compartment(s) (lysosomes/endosomes) to the endoplasmic reticulum (ER) for esterification. In this report, we show that the CT mutation can be complemented by fusion with human cells; however, attempts to complement the CT defect through DNA transfection have resulted in a collection of stable cell lines designated as ST cells. Under cholesterol starvation condition, the ST cells exhibit an elevated rate of cholesterol ester biosynthesis (by 3- to 5-fold) compared to both the parental CHO cells and the CT cells. The phenotypes of the ST cells are stable. ST cells are thus new cell lines arisen from the CT cells. When the plasma membranes of the parental, CT, and ST cells are labelled with [3H]cholesterol, ST cells show rates of [3H]cholesterol esterification much higher than that observed in CT cells but lower than that observed in the parental CHO cells. This result shows that translocation of plasma membrane cholesterol to the ER for esterification is defective in the CT cells. This result also suggests that ST cells acquire increased cholesterol trafficking activity between the lysosome and the ER without mixing with the plasma membrane cholesterol pool. The characteristics of CT cells and ST cells reported here suggest that translocation of both lysosomal LDL-derived cholesterol and plasma membrane cholesterol to the ER for esterification may require common cellular factors involved in cholesterol egress from the acidic compartment(s) (lysosomes/endosomes).

We have previously reported that the human ACAT1 gene produces a chimeric mRNA through the interchromosomal processing of two discontinuous RNAs transcribed from chromosomes 1 and 7. The chimeric mRNA uses AUG(1397-1399) and GGC(1274-1276) as translation initiation codons to produce normal 50-kDa ACAT1 and a novel enzymatically active 56-kDa isoform, respectively, with the latter being authentically present in human cells, including human monocyte-derived macrophages. In this work, we report that RNA secondary structures located in the vicinity of the GGC(1274-1276) codon are required for production of the 56-kDa isoform. The effects of the three predicted stem-loops (nt 1255-1268, 1286-1342 and 1355-1384) were tested individually by transfecting expression plasmids into cells that contained the wild-type, deleted or mutant stem-loop sequences linked to a partial ACAT1 AUG open reading frame (ORF) or to the ORFs of other genes. The expression patterns were monitored by western blot analyses. We found that the upstream stem-loop(1255-1268) from chromosome 7 and downstream stem-loop(1286-1342) from chromosome 1 were needed for production of the 56-kDa isoform, whereas the last stem-loop(1355-1384) from Chromosome 1 was dispensable. The results of experiments using both monocistronic and bicistronic vectors with a stable hairpin showed that translation initiation from the GGC(1274-1276) codon was mediated by an internal ribosome entry site (IRES). Further experiments revealed that translation initiation from the GGC(1274-1276) codon requires the upstream AU-constituted RNA secondary structure and the downstream GC-rich structure. This mechanistic work provides further support for the biological significance of the chimeric nature of the human ACAT1 transcript.

Acyl-CoA:cholesterol acyltransferase 1 (ACAT1) is a key enzyme exclusively using free cholesterols as the substrates in cell and is involved in the cellular cholesterol homeostasis. In this study, we used human neuroblastoma cell line SK-N-SH as a model and first observed that inhibiting ACAT1 can decrease the amyloid precursor protein (APP)-α-processing. Meanwhile, the transfection experiments using the small interfering RNA and expression plasmid of ACAT1 indicated that ACAT1 can dependently affect the APP-α-processing. Furthermore, inhibiting ACAT1 was found to increase the free cholesterols in plasma membrane (PM-FC), and the increased PM-FC caused by inhibiting ACAT1 can lead to the decrease of the APP-α-processing, indicating that ACAT1 regulates the dynamics of PM-FC, which leads to the alteration of the APP-α-processing. More importantly, further results showed that under the ACAT1 inhibition, the alterations of the PM-FC and the subsequent APP-α-processing are not dependent on the cellular total cholesterol level, confirming that ACAT1 regulates the dynamics of PM-FC. Finally, we revealed that even when the Niemann-Pick-Type C-dependent pathway is blocked, the ACAT1 inhibition still obviously results in the PM-FC increase, suggesting that the ACAT1-dependent pathway is responsible for the shuttling of PM-FC to the intracellular pool. Our data provide a novel insight that ACAT1 which enzymatically regulates the dynamics of PM-FC may play important roles in the human neuronal cells.

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTAspartate transcarbamylase from Streptococcus faecalis. Reverse reaction and binding studiesTa-Yuan Chang and Mary E. JonesCite this: Biochemistry 1974, 13, 4, 646–653Publication Date (Print):February 1, 1974Publication History Published online1 May 2002Published inissue 1 February 1974https://doi.org/10.1021/bi00701a003RIGHTS & PERMISSIONSArticle Views23Altmetric-Citations13LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (992 KB) Get e-AlertsSupporting Info (1)»Supporting Information Supporting Information Get e-Alerts

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTAspartate transcarbamylase from Streptococcus faecalis. Steady-state kinetic analysisTa-Yuan Chang and Mary E. JonesCite this: Biochemistry 1974, 13, 4, 638–645Publication Date (Print):February 1, 1974Publication History Published online1 May 2002Published inissue 1 February 1974https://doi.org/10.1021/bi00701a002RIGHTS & PERMISSIONSArticle Views41Altmetric-Citations12LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (896 KB) Get e-AlertsSupporting Info (1)»Supporting Information Supporting Information Get e-Alerts

In the spring of 2016, a former Associate Editor of the Journal of Lipid Research, Steve Young, asked us to propose a thematic review series centering on ApoE, lipid metabolism, and Alzheimer disease (AD). With input from Steve, we put together a proposal. The proposal received full endorsement from the Editors-in-Chief, Ed Dennis and Bill Smith. We sent invitations to our list of potential contributors and received prompt and positive responses from most of the invitees. The pathological hallmarks of AD involve amyloidopathy, taupathy, and chronic neuroinflammation. AD can be classified as early onset (EOAD) and late onset (LOAD), with 99% of the cases being LOAD. EOAD occurs in young adults and is usually caused by rare mutations of genes directly involved in processing of the amyloid precursor protein. In contrast, LOAD involves numerous environmental and genetic risk factors, with aging being the best-known risk factor. After age 65, the risk of developing the disease doubles every 5 years. Besides aging, the Apoe4 allele is the most significant risk factor. ApoE is the major apolipoprotein in the brain. Human Apoe has three major alleles, e2, e3, and e4, with e4 being the less common one. There is strong evidence that ApoE affects AD pathology through multiple mechanisms. There is also evidence that the ApoE-containing lipoproteins participate in lipid homeostasis in the brain. On the other hand, how ApoE acts to affect all these events, in an isoform specific manner, remains largely unknown. In the brain, ApoE binds to several closely related receptors present in various cells; what role(s) these receptors play in mediating the actions of ApoE and amyloid β peptides and in contributing to brain functions in health and disease also needs much investigation. We organized this thematic review series to address these issues. Each review is contributed by a leading scientist. We asked the expert scientists to describe the current status of the field and to offer their views on what needs to be done to advance the field. We also asked the expert scientists to recommend potential therapeutic strategies to ameliorate AD. The series will begin with a review by Holtzman and colleagues. The names of the corresponding authors, their affiliations, and the titles of all the reviews are listed below. Articles in the series will begin in summer 2017, with one review scheduled to appear in each subsequent issue. We thank all the contributors for spending their precious time to write the manuscripts and submit them on time. We also thank the Associate Editor of the Journal of Lipid Research, Nick Davidson, for efficiently overseeing the peer reviews of the manuscripts, and Mary Chang and Jeanne Gladfelter for their management and assistance. AD is the most prevalent form of dementia in the adults. Currently, there is no cure. We consider AD to be a special lipid disease and encourage scientists in the lipid research community to join the AD research field. Research into the causes, prevention, and treatment of AD provides an excellent opportunity to utilize knowledge in lipids to help elderly folks, including us. 1. David Holtzman (Washington University School of Medicine) Apolipoprotein E and Alzheimer's disease: the influence of apoE on amyloid-ε and other amyloidogenic proteins2. Joachim Herz (University of Texas Southwestern Medical Center) The ApoE receptors Vldlr and Apoer2 in central nervous system function and disease3. Mitsuru Shinohara (Mayo Clinic, Jacksonville, Florida) Role of LRP1 in the pathogenesis of Alzheimer's disease: evidence from clinical and preclinical studies4. William Rebeck (Georgetown University) The role of APOE on lipid homeostasis and inflammation in normal brains5. Mary Jo Ladu (University of Illinois at Chicago) EFAD transgenic mice as a human APOE relevant preclinical model of Alzheimer's disease6. Gary Landreth (Indiana University School of Medicine) Therapeutic potential of nuclear receptor agonists in Alzheimer's disease7. Tobias Hartmann (Universität des Saarlandes, Saarlandes, Germany) Omega-3 fatty acids, lipids, and apoE lipidation in Alzheimer's disease: a rationale for multi-nutrient dementia prevention8. TY Chang and Catherine Chang (Geisel School of Medicine at Dartmouth) Cellular cholesterol homeostasis and Alzheimer's disease

Abstract Background Cholesterol is essential for growth and maintenance of mammalian cells. It is stored as cholesteryl esters by the enzymes acyl-CoA:cholesterol acyltransferases 1 &amp; 2 (ACAT 1 &amp; 2) (Sterol O-acyltransferase 1 &amp; 2; SOATs in GenBank). ACAT1 blockade (A1B) in macrophages ameliorates various pro-inflammatory responses elicited by lipopolysaccharides (LPS) or by cholesterol loading. In mouse and human brains, Acat1 expression dominates over Acat2 and Acat1 is elevated in many neurodegenerative diseases and in acute neuroinflammation. However, the possible effects of ACAT1 blockade in neuroinflammation, regulated by mediators such as Toll-Like Receptor 4 (TLR4), has not been studied. Methods We conducted LPS-induced acute neuroinflammation experiments in control vs myeloid specific or neuron specific Acat1 knockout ( KO) mice. Furthermore, we evaluated LPS-induced neuroinflammation in the microglial cell line N9 with or without pre-treatment of the small molecule ACAT1-specific inhibitor K-604. Biochemical and microscopy assays were used to monitor inflammatory responses and the fate of TLR4. Results In vivo studies revealed that Acat1 inactivation in myeloid cell lineage, but not in neurons, markedly attenuated LPS-induced activation of various pro-inflammatory response genes in hippocampus and cortex. Studies in cell culture showed that pre-incubating cells with K-604 significantly ameliorated the pro-inflammatory responses induced by LPS. In cells acutely treated with LPS (for 30 min), pre-incubation with K-604 significantly increased the endocytosis of TLR4, the major transmembrane signaling receptor that mediates LPS-dependent acute neuroinflammation. In cells chronically treated with LPS (for 24-48 hrs), pre-incubation with K-604 significantly decreased the total TLR4 protein content, presumably due to enhanced trafficking of TLR4 to the lysosomes for degradation. For ex vivo evidence, we isolated microglia from adult mice, and found that in mice without LPS stimulation, myeloid Acat1 inactivation altered cellular distribution of TLR4; in mice with LPS stimulation, myeloid Acat1 inactivation decreased the cellular content of TLR4. Conclusion Blocking ACAT1 in mouse microglia alters the fate of TLR4 and suppresses its ability to participate in pro-inflammatory signaling cascade in response to LPS.