Stephen H. Leppla

Anthrax lethal toxin, produced by the bacterium Bacillus anthracis, is the major cause of death in animals infected with anthrax. One component of this toxin, lethal factor (LF), is suspected to be a metalloprotease, but no physiological substrates have been identified. Here it is shown that LF is a protease that cleaves the amino terminus of mitogen-activated protein kinase kinases 1 and 2 (MAPKK1 and MAPKK2) and that this cleavage inactivates MAPKK1 and inhibits the MAPK signal transduction pathway. The identification of a cleavage site for LF may facilitate the development of LF inhibitors.

Anthrax toxin is composed of three proteins: protective antigen (PA), lethal factor (LF), and edema factor (EF). These proteins individually cause no known physiological effects in animals but in pairs produce two toxic actions. Injection of PA with LF causes death of rats in 60 min, whereas PA with EF causes edema in the skin of rabbits and guinea pigs. The mechanisms of action of these proteins have not been determined. It is shown here that EF is an adenylate cyclase [ATP pyrophosphate-lyase (cyclizing), EC 4.6.1.1] produced by Bacillus anthracis in an inactive form. Activation occurs upon contact with a heat-stable eukaryotic cell material. The specific activity of the resulting adenylate cyclase nearly equals that of the most active known cyclase. In Chinese hamster ovary cells exposed to PA and EF, cAMP concentrations increase without a lag to values about 200-fold above normal, remain high in the continued presence of toxin, and decrease rapidly after its removal. The increase in cAMP is completely blocked by excess LF. It is suggested that PA interacts with cells to form a receptor system by which EF and perhaps LF gain access to the cytoplasm.

The protective antigen (PA) of the anthrax toxin binds to a cell surface receptor and thereby allows lethal factor (LF) to be taken up and exert its toxic effect in the cytoplasm. Here, we report that clustering of the anthrax toxin receptor (ATR) with heptameric PA or with an antibody sandwich causes its association to specialized cholesterol and glycosphingolipid-rich microdomains of the plasma membrane (lipid rafts). We find that although endocytosis of ATR is slow, clustering it into rafts either via PA heptamerization or using an antibody sandwich is necessary and sufficient to trigger efficient internalization and allow delivery of LF to the cytoplasm. Importantly, altering raft integrity using drugs prevented LF delivery and cleavage of cytosolic MAPK kinases, suggesting that lipid rafts could be therapeutic targets for drugs against anthrax. Moreover, we show that internalization of PA is dynamin and Eps15 dependent, indicating that the clathrin-dependent pathway is the major route of anthrax toxin entry into the cell. The present work illustrates that although the physiological role of the ATR is unknown, its trafficking properties, i.e., slow endocytosis as a monomer and rapid clathrin-mediated uptake on clustering, make it an ideal anthrax toxin receptor.

Proteolytic cleavage of the protective antigen (PA) protein of anthrax toxin at residues 164-167 is necessary for toxic activity. Cleavage by a cellular protease at this sequence, Arg-Lys-Lys-Arg, normally follows binding of PA to a cell surface receptor. We attempted to identify this protease by determining its sequence specificity and catalytic properties. Semi-random cassette mutagenesis was used to generate mutants with replacements of residues 164-167 by Arg, Lys, Ser, or Asn. Analysis of 19 mutant proteins suggested that lethal factor-dependent toxicity required the sequence Arg-Xaa-Xaa-Arg. Based on these data, three additional mutants were constructed with the sequences Ala-Lys-Lys-Arg, Arg-Lys-Lys-Ala, and Arg-Ala-Ala-Arg. Of these mutant proteins, Arg-Ala-Ala-Arg was toxic, confirming that the cellular protease can recognize the sequence Arg-Xaa-Xaa-Arg. The mutant containing the sequence Ala-Lys-Lys-Arg was also toxic but required > 13 times more protein to produce equivalent toxicity. This sequence specificity is similar to that of the ubiquitous subtilisin-like protease furin, which is involved in processing of precursors of certain receptors and growth factors. Therefore we tested whether a recombinant soluble furin would cleave PA. This furin derivative efficiently cleaved native PA and the Arg-Ala-Ala-Arg mutant but not the nontoxic PA mutants. In addition, previously identified inhibitors of furin blocked cleavage of receptor-bound PA. These data imply that furin is the cellular protease that activates PA, and that nearly all cell types contain at least a small amount of furin exposed on their cell surface.

Induction of an eicosanoid storm is shown to be an unexpected consequence of inflammasome activation in peritoneal macrophages, leading to vascular leakage and rapid death in mice. Inflammasomes are multiprotein complexes that initiate early cellular responses to cellular pathogens. The mechanisms of inflammasome activation have been the focus of intense research, but relatively little is known about what pathways are activated downstream of inflammasomes. This study shows that systemic activation of the inflammasome in vivo results in the rapid induction of potent signalling lipids called eicosanoids, which cause a catastrophic loss of fluid from the blood, contributing to the death of the animal within 30 minutes. When restricted to the site of infection, eicosanoids may have a beneficial role in host defence, for example by increasing local vascular permeability, allowing an influx of immune cells. Detection of microbial products by host inflammasomes is an important mechanism of innate immune surveillance. Inflammasomes activate the caspase-1 (CASP1) protease, which processes the cytokines interleukin (IL)-1β and IL-18, and initiates a lytic host cell death called pyroptosis1. To identify novel CASP1 functions in vivo, we devised a strategy for cytosolic delivery of bacterial flagellin, a specific ligand for the NAIP5 (NLR family, apoptosis inhibitory protein 5)/NLRC4 (NLR family, CARD-domain-containing 4) inflammasome2,3,4. Here we show that systemic inflammasome activation by flagellin leads to a loss of vascular fluid into the intestine and peritoneal cavity, resulting in rapid (less than 30 min) death in mice. This unexpected response depends on the inflammasome components NAIP5, NLRC4 and CASP1, but is independent of the production of IL-1β or IL-18. Instead, inflammasome activation results, within minutes, in an ‘eicosanoid storm’—a pathological release of signalling lipids, including prostaglandins and leukotrienes, that rapidly initiate inflammation and vascular fluid loss. Mice deficient in cyclooxygenase-1, a critical enzyme in prostaglandin biosynthesis, are resistant to these rapid pathological effects of systemic inflammasome activation by either flagellin or anthrax lethal toxin. Inflammasome-dependent biosynthesis of eicosanoids is mediated by the activation of cytosolic phospholipase A2 in resident peritoneal macrophages, which are specifically primed for the production of eicosanoids by high expression of eicosanoid biosynthetic enzymes. Our results therefore identify eicosanoids as a previously unrecognized cell-type-specific signalling output of the inflammasome with marked physiological consequences in vivo.

Summary Comparison of the anthrax toxin lethal factor (LF) amino acid sequence with sequences in the Swiss protein database revealed short regions of similarity with the consensus zinc‐binding site, HEXXH, that is characteristic of metalloproteases. Several protease inhibitors, including bestatin and captopril, prevented intoxication of macrophages by lethal toxin. LF was fully inactivated by site‐directed mutagenesis that substituted Ala for either of the residues (H‐686 and H‐690) implicated in zinc binding. Similarly, LF was inactivated by substitution of Cys for E‐687, which is thought to be an essential part of the catalytic site. In contrast, replacement of E‐720 and E‐721 with Ala had no effect on LF activity. LF bound 65 Zn both in solution and on protein blots. The 65 Zn binding was reduced for several of the LF mutants. These data suggest that anthrax toxin LF is a zinc metallopeptidase, the catalytic function of which is responsible for the lethal activity observed in cultured cells and in animals.

NOD-like receptor (NLR) proteins (Nlrps) are cytosolic sensors responsible for detection of pathogen and danger-associated molecular patterns through unknown mechanisms. Their activation in response to a wide range of intracellular danger signals leads to formation of the inflammasome, caspase-1 activation, rapid programmed cell death (pyroptosis) and maturation of IL-1β and IL-18. Anthrax lethal toxin (LT) induces the caspase-1-dependent pyroptosis of mouse and rat macrophages isolated from certain inbred rodent strains through activation of the NOD-like receptor (NLR) Nlrp1 inflammasome. Here we show that LT cleaves rat Nlrp1 and this cleavage is required for toxin-induced inflammasome activation, IL-1 β release, and macrophage pyroptosis. These results identify both a previously unrecognized mechanism of activation of an NLR and a new, physiologically relevant protein substrate of LT.

Induction of immunity that limits Toxoplasma gondii infection in mice is critically dependent on the activation of the innate immune response. In this study, we investigated the role of cytoplasmic nucleotide-binding domain and leucine-rich repeat containing a pyrin domain (NLRP) inflammasome sensors during acute toxoplasmosis in mice. We show that in vitro Toxoplasma infection of murine bone marrow-derived macrophages activates the NLRP3 inflammasome, resulting in the rapid production and cleavage of interleukin-1β (IL-1β), with no measurable cleavage of IL-18 and no pyroptosis. Paradoxically, Toxoplasma-infected mice produced large quantities of IL-18 but had no measurable IL-1β in their serum. Infection of mice deficient in NLRP3, caspase-1/11, IL-1R, or the inflammasome adaptor protein ASC led to decreased levels of circulating IL-18, increased parasite replication, and death. Interestingly, mice deficient in NLRP1 also displayed increased parasite loads and acute mortality. Using mice deficient in IL-18 and IL-18R, we show that this cytokine plays an important role in limiting parasite replication to promote murine survival. Our findings reveal T. gondii as a novel activator of the NLRP1 and NLRP3 inflammasomes in vivo and establish a role for these sensors in host resistance to toxoplasmosis.Inflammasomes are multiprotein complexes that are a major component of the innate immune system. They contain "sensor" proteins that are responsible for detecting various microbial and environmental danger signals and function by activating caspase-1, an enzyme that mediates cleavage and release of the proinflammatory cytokines interleukin-1β (IL-1β) and IL-18. Toxoplasma gondii is a highly successful protozoan parasite capable of infecting a wide range of host species that have variable levels of resistance. We report here that T. gondii is a novel activator of the NLRP1 and NLRP3 inflammasomes in vivo and establish a role for these sensors in host resistance to toxoplasmosis. Using mice deficient in IL-18 and IL-18R, we show that the IL-18 cytokine plays a pivotal role by limiting parasite replication to promote murine survival.

Anthrax is caused by the spore-forming, gram-positive bacterium Bacillus anthracis. The bacterium's major virulence factors are (a) the anthrax toxins and (b) an antiphagocytic polyglutamic capsule. These are encoded by two large plasmids, the former by pXO1 and the latter by pXO2. The expression of both is controlled by the bicarbonate-responsive transcriptional regulator, AtxA. The anthrax toxins are three polypeptides-protective antigen (PA), lethal factor (LF), and edema factor (EF)-that come together in binary combinations to form lethal toxin and edema toxin. PA binds to cellular receptors to translocate LF (a protease) and EF (an adenylate cyclase) into cells. The toxins alter cell signaling pathways in the host to interfere with innate immune responses in early stages of infection and to induce vascular collapse at late stages. This review focuses on the role of anthrax toxins in pathogenesis. Other virulence determinants, as well as vaccines and therapeutics, are briefly discussed.

The pathophysiological effects resulting from many bacterial diseases are caused by exotoxins released by the bacteria. Bacillus anthracis, a spore-forming bacterium, is such a pathogen, causing anthrax through a combination of bacterial infection and toxemia. B. anthracis causes natural infection in humans and animals and has been a top bioterrorism concern since the 2001 anthrax attacks in the USA. The exotoxins secreted by B. anthracis use capillary morphogenesis protein 2 (CMG2) as the major toxin receptor and play essential roles in pathogenesis during the entire course of the disease. This review focuses on the activities of anthrax toxins and their roles in initial and late stages of anthrax infection.

Anthrax lethal toxin is a classical AB toxin comprised of two components: protective antigen (PA) and lethal factor (LF). Here, we show that following assembly and endocytosis, PA forms a channel that translocates LF, not only into the cytosol, but also into the lumen of endosomal intraluminal vesicles (ILVs). These ILVs can fuse and release LF into the cytosol, where LF can proteolyze and disable host targets. We find that LF can persist in ILVs for days, fully sheltered from proteolytic degradation, both in vitro and in vivo. During this time, ILV-localized LF can be transmitted to daughter cells upon cell division. In addition, LF-containing ILVs can be delivered to the extracellular medium as exosomes. These can deliver LF to the cytosol of naive cells in a manner that is independent of the typical anthrax toxin receptor-mediated trafficking pathway, while being sheltered from neutralizing extracellular factors of the immune system.

Bacillus anthracis lethal toxin (LT) is the major virulence factor of anthrax and reproduces most of the laboratory manifestations of the disease in animals. We studied LT toxicity in BALB/cJ and C57BL/6J mice. BALB/cJ mice became terminally ill earlier and with higher frequency than C57BL/6J mice. Timed histopathological analysis identified bone marrow, spleen, and liver as major affected organs in both mouse strains. LT induced extensive hypoxia. Crisis was due to extensive liver necrosis accompanied by pleural edema. There was no evidence of disseminated intravascular coagulation or renal dysfunction. Instead, analyses revealed hepatic dysfunction, hypoalbuminemia, and vascular/oxygenation insufficiency. Of 50 cytokines analyzed, BALB/cJ mice showed rapid but transitory increases in specific factors including KC, MCP-1/JE, IL-6, MIP-2, G-CSF, GM-CSF, eotaxin, FasL, and IL-1beta. No changes in TNF-alpha occurred. The C57BL/6J mice did not mount a similar cytokine response. These factors were not induced in vitro by LT treatment of toxin-sensitive macrophages. The evidence presented shows that LT kills mice through a TNF-alpha-independent, FasL-independent, noninflammatory mechanism that involves hypoxic tissue injury but does not require macrophage sensitivity to toxin.

Before intoxication can occur, anthrax toxin protective antigen (PA), Pseudomonas exotoxin A (PE), and diphtheria toxin (DT) must be activated by proteolytic cleavage at specific amino acid sequences. Previously, it was shown that PA and DT can be activated by furin. In Chinese hamster ovary (CHO) cells, wild-type (RKKR) and cleavage site mutants of PA, each administered with a modified form of anthrax toxin lethal factor (the N terminus of lethal factor fused to PE domain III), had the following potencies: RKKR (wild type) (concentration causing 50% cell death [EC50] = 12 ng/ml) > or = RAAR (EC50 = 18 ng/ml) > FTKR (EC50 = 24 ng/ml) > STRR (EC50 = 49 ng/ml). In vitro cleavage of PA and cleavage site mutants of PA by furin demonstrated that native PA (RKKR) and PA with the cleavage sequence RAAR are substrates for furin. To characterize eukaryotic proteases that play a role in activating bacterial toxins, furin-deficient CHO cells were selected after chemical mutagenesis. Furin-deficient cells were resistant to PE, whose cleavage site, RQPR, constitutes a furin recognition site and to all PA cleavage site mutants, but were sensitive to DT (EC50 = 2.9 ng/ml) and PA (EC50 = 23 ng/ml), whose respective cleavage sites, RKKR and RVRR, contain additional basic residues. Furin-deficient cells that were transfected with the furin gene regained sensitivity to PE and PA cleavage site mutants. These studies provide evidence that furin can activate the three toxins and that one or more additional proteases contribute to the activation of DT and PA.

Anthrax lethal toxin is a multi-functional virulence factor that has evolved to target multiple host functions to allow for optimal establishment of Bacillus anthracis infection. The toxin appears to play a role in all stages of infection, from germination to the induction of vascular collapse leading to host death. Early in infection, at sublethal doses, it acts to suppress immune cell and cytokine responses, thereby promoting bacterial outgrowth. Later in the disease, lethal levels of toxin induce the cytokine-independent shock-like death associated with anthrax. The understanding of the molecular events induced by anthrax toxin in different target cells at each stage of infection will aid in deciphering the pathogenesis of this bacterium and developing therapies.

Anthrax lethal toxin (LT) and edema toxin (ET) are the major virulence factors of anthrax and can replicate the lethality and symptoms associated with the disease. This review provides an overview of our current understanding of anthrax toxin effects in animal models and the cytotoxicity (necrosis and apoptosis) induced by LT in different cells. A brief reexamination of early historic findings on toxin in vivo effects in the context of our current knowledge is also presented.

The virulence of Bacillus anthracis has been attributed to a tripartite toxin composed of three proteins designated protective antigen, lethal factor, and edema factor. The effects of the toxin components on phagocytosis and chemiluminescence of human polymorphonuclear neutrophils were studied in vitro. Initially, it was determined that the avirulent Sterne strain of B. anthracis (radiation killed) required opsonization with either serum complement or antibodies against the Sterne cell wall to be phagocytized. Phagocytosis of the opsonized Sterne cells was not affected by the individual anthrax toxin components. However, a combination of protective antigen and edema factor inhibited Sterne cell phagocytosis and blocked both particulate and phorbol myristate acetate-induced polymorphonuclear neutrophil chemiluminescence. These polymorphonuclear neutrophil effects were reversible upon removal of the toxin components. The protective antigen-edema factor combination also increased intracellular cyclic AMP levels. These studies suggest that two of the protein components of anthrax toxin, edema factor and protective antigen, increase host susceptibility to infection by suppressing polymorphonuclear neutrophil function and impairing host resistance.

Bordetella pertussis and Bacillus anthracis produce extracytoplasmic adenylate cyclase toxins (AC toxins) with shared features including activation by calmodulin and the ability to enter target cells and catalyze intracellular cyclic AMP (cAMP) production from host ATP. The two AC toxins were evaluated for sensitivities to a series of inhibitors of known uptake mechanisms. Cytochalasin D, an inhibitor of microfilament function, abrogated the cAMP response to B. anthracis AC toxin (93%) but not the cAMP response elicited by B. pertussis AC toxin. B. anthracis-mediated intoxication of CHO cells was completely inhibited by ammonium chloride (30 mM) and chloroquine (0.1 mM), whereas the cAMP accumulation produced by B. pertussis AC toxin remained unchanged. The block of target cell intoxication by cytochalasin D could be bypassed when cells were first treated with anthrax AC toxin and then exposed to an acidic medium. These data indicate that despite enzymatic similarities, these two AC toxins intoxicate target cells by different mechanisms, with anthrax AC toxin entering by means of receptor-mediated endocytosis into acidic compartments and B. pertussis AC toxin using a separate, and as yet undefined, mechanism.

The protective antigen (PA) of anthrax toxin binds to a cell surface receptor, undergoes heptamerization, and binds the enzymatic subunits, the lethal factor (LF) and the edema factor (EF). The resulting complex is then endocytosed. Via mechanisms that depend on the vacuolar ATPase and require membrane insertion of PA, LF and EF are ultimately delivered to the cytoplasm where their targets reside. Here, we show that membrane insertion of PA already occurs in early endosomes, possibly only in the multivesicular regions, but that subsequent delivery of LF to the cytoplasm occurs preferentially later in the endocytic pathway and relies on the dynamics of internal vesicles of multivesicular late endosomes.

The currently available human vaccine for anthrax, derived from the culture supernatant of Bacillus anthracis, contains the protective antigen (PA) and traces of the lethal and edema factors, which may contribute to adverse side effects associated with this vaccine. Therefore, an effective expression system that can provide a clean, safe, and efficacious vaccine is required. In an effort to produce anthrax vaccine in large quantities and free of extraneous bacterial contaminants, PA was expressed in transgenic tobacco chloroplasts by inserting the pagA gene into the chloroplast genome. Chloroplast integration of the pagA gene was confirmed by PCR and Southern analysis. Mature leaves grown under continuous illumination contained PA as up to 14.2% of the total soluble protein. Cytotoxicity measurements in macrophage lysis assays showed that chloroplast-derived PA was equal in potency to PA produced in B. anthracis. Subcutaneous immunization of mice with partially purified chloroplast-derived or B. anthracis-derived PA with adjuvant yielded immunoglobulin G titers up to 1:320,000, and both groups of mice survived (100%) challenge with lethal doses of toxin. An average yield of about 150 mg of PA per plant should produce 360 million doses of a purified vaccine free of bacterial toxins edema factor and lethal factor from 1 acre of land. Such high expression levels without using fermenters and the immunoprotection offered by the chloroplast-derived PA should facilitate development of a cleaner and safer anthrax vaccine at a lower production cost. These results demonstrate the immunogenic and immunoprotective properties of plant-derived anthrax vaccine antigen.

The interaction of radiolabeled diphtheria toxin with highly sensitive mammalian cell lines was studied. Toxin bound to (or was taken up by) Vero cells at 4 and 37 degrees C in a highly specific manner. At both temperatures, excess unlabeled toxin competed for up to 90% of the cell-associated label. The association at 37 degrees C was biphasic, increasing to a peak at 1 to 2 h and falling thereafter. At 4 degrees C, association increased with time to a steady state. Both fragment B and CRM-197 competed for the association of labeled toxin with cells. The magnitude of association correlated with the cytotoxic sensitivity of several cell lines. Both pH and exogenous nucleotides affected the association in a manner consistent with effects on cytotoxicity. The label associated with cells at 4 degrees C was largely intact toxin, while that at 37 degrees C was degraded. At 4 degrees C, the association was saturable (K = 9 X 10(8) liters/mol), was reversible, and indicated about 1 to 2 X 10(5) binding sites/cell.

The anthrax toxin is composed of three independent polypeptide chains. Successful intoxication only occurs when heptamerization of the receptor-binding polypeptide, the protective antigen (PA), allows binding of the two enzymatic subunits before endocytosis. We show that this tailored behavior is caused by two counteracting posttranslational modifications in the cytoplasmic tail of PA receptors. The receptor is palmitoylated, and this unexpectedly prevents its association with lipid rafts and, thus, its premature ubiquitination. This second modification, which is mediated by the E3 ubiquitin ligase Cbl, only occurs in rafts and is required for rapid endocytosis of the receptor. As a consequence, cells expressing palmitoylation-defective mutant receptors are less sensitive to anthrax toxin because of a lower number of surface receptors as well as premature internalization of PA without a requirement for heptamerization.

<b>Bacillus anthracis</b> edema toxin (ET), an adenylyl cyclase, is an important virulence factor that contributes to anthrax disease. The role of ET in anthrax pathogenesis is, however, poorly understood. Previous studies using crude toxin preparations associated ET with subcutaneous edema, and ET-deficient strains of <b>B. anthracis</b> showed a reduction in virulence. We report the first comprehensive study of ET-induced pathology in an animal model. Highly purified ET caused death in BALB/cJ mice at lower doses and more rapidly than previously seen with the other major <b>B. anthracis</b> virulence factor, lethal toxin. Observations of gross pathology showed intestinal intralumenal fluid accumulation followed by focal hemorrhaging of the ileum and adrenal glands. Histopathological analyses of timed tissue harvests revealed lesions in several tissues including adrenal glands, lymphoid organs, bone, bone marrow, gastrointestinal mucosa, heart, and kidneys. Concomitant blood chemistry analyses supported the induction of tissue damage. Several cytokines increased after ET administration, including granulocyte colony-stimulating factor, eotaxin, keratinocyte-derived cytokine, MCP-1/JE, interleukin-6, interleukin-10, and interleukin-1β. Physiological measurements also revealed a concurrent hypotension and bradycardia. These studies detail the extensive pathological lesions caused by ET and suggest that it causes death due to multiorgan failure.

The Centers for Disease Control (CDC) lists Bacillus anthracis as a category A agent and estimates the cost of an anthrax attack to exceed US$ 26 billion per 100,000 exposed individuals. Concerns regarding anthrax vaccine purity, a requirement for multiple injections, and a limited supply of the protective antigen (PA), underscore the urgent need for an improved vaccine. Therefore, the 83 kDa immunogenic Bacillus anthracis protective antigen was expressed in transgenic tobacco chloroplasts. The PA gene (pag) was cloned into a chloroplast vector along with the psbA regulatory signals to enhance translation. Chloroplast integration of the transgenes was confirmed by PCR and Southern blot analyses. Crude plant extracts contained up to 2.5 mg full length PA/g of fresh leaf tissue and this showed exceptional stability for several months in stored leaves or crude extracts. Maximum levels of expression were observed in mature leaves under continuous illumination. Co-expression of the ORF2 chaperonin from Bacillus thuringiensis did not increase PA accumulation or induce folding into cuboidal crystals in transgenic chloroplasts. Trypsin, chymotrypsin and furin proteolytic cleavage sites present in PA were protected in transgenic chloroplasts because only full length PA 83 was observed without any degradation products. Both CHAPS and SDS detergents extracted PA with equal efficiency and PA was observed in the soluble fraction. Chloroplast-derived PA was functionally active in lysing mouse macrophages when combined with lethal factor (LF). Crude leaf extracts contained up to 25 microg functional PA/ml. With an average yield of 172 mg of PA per plant using an experimental transgenic cultivar grown in a greenhouse, 400 million doses of vaccine (free of contaminants) could be produced per acre, a yield that could be further enhanced 18-fold using a commercial cultivar in the field.

Anthrax lethal toxin is a complex of protective antigen (PA, 735 amino acids) and lethal factor (LF, 776 amino acids) that lyses certain eukaryotic cells. LF interacts with PA to gain access to the cytosol to assert its toxicity. The internalization of LF requires that PA bind to a specific membrane receptor and be cleaved by a cell-surface protease (probably furin), so as to expose a site on PA to which LF binds with high affinity. To localize LF functional domains, amino, carboxyl, and internal deletions of LF were made. Toxicity was eliminated by deletion of 40 and 47 residues from the amino and carboxyl termini, respectively. Similarly, deleting the first of the four imperfect repeats of 19 amino acids located at residues 308-383 made LF non-toxic, showing that this region is also essential for activity. To identify the minimum region of LF which is required for binding to PA, varying amino-terminal portions of LF were fused to the ADP-ribosylation domain of Pseudomonas exotoxin A. Fusion proteins containing residues 1-254 of LF were toxic when administered with PA, while those having only residues 1-198 of LF were inactive, showing that the PA-binding domain of LF lies within residues 1-254.

Thirty-six monoclonal antibodies to the protective antigen protein of Bacillus anthracis exotoxin have been characterized for affinity, antibody subtype, competitive binding to antigenic regions, and ability to neutralize lethal and edema toxin activities. At least 23 antigenic regions were detected on protective antigen by a blocking, enzyme-linked immunosorbent assay. Two clones, 3B6 and 14B7, competed for a single antigenic region and neutralized the activity of both the lethal toxin in vivo (Fisher 344 rat) and the edema toxin in vitro (CHO cells). These two antibodies blocked the binding of 125I-labeled protective antigen to FRL-103 cells. Our results support the proposal that binding of protective antigen to cell receptors is required for expression of toxicity.

This chapter describes the production and purification of anthrax toxin. Bacillus anthracis secretes three proteins that are collectively known as anthrax toxin. The protective antigen (PA, 85 kDa), lethal factor (LF, 83 kDa), and edema factor (EF, 89 kDa) proteins individually have no known toxic activities. Simultaneous injection of PA and LF causes death of rats, while PA and EF together produce edema in skin. Thus, “anthrax toxin” is actually two toxins, each of which is like staphylococcal leukocidin and botulinum C2 toxin in having receptor-binding and effecter domains on separate proteins. The PA protein appears to play a dual role as the B moiety for two different A proteins. Binding studies have shown that PA must be present in order for EF to bind to cells. Study of anthrax toxin is essential in improving for understanding of the virulence of B. anthracis and in design of improved vaccines. In addition, study of the anthrax toxins may show them to be useful tools in cell biology.

Anthrax toxin, a major virulence factor of Bacillus anthracis, gains entry into target cells by binding to either of 2 von Willebrand factor A domain-containing proteins, tumor endothelium marker-8 (TEM8) and capillary morphogenesis protein-2 (CMG2). The wide tissue expression of TEM8 and CMG2 suggest that both receptors could play a role in anthrax pathogenesis. To explore the roles of TEM8 and CMG2 in normal physiology, as well as in anthrax pathogenesis, we generated TEM8- and CMG2-null mice and TEM8/CMG2 double-null mice by deleting TEM8 and CMG2 transmembrane domains. TEM8 and CMG2 were found to be dispensable for mouse development and life, but both are essential in female reproduction in mice. We found that the lethality of anthrax toxin for mice is mostly mediated by CMG2 and that TEM8 plays only a minor role. This is likely because anthrax toxin has approximately 11-fold higher affinity for CMG2 than for TEM8. Finally, the CMG2-null mice are also shown to be highly resistant to B. anthracis spore infection, attesting to the importance of both anthrax toxin and CMG2 in anthrax infections.

The 184-kb Bacillus anthracis plasmid pXO1, which is required for virulence, contains three genes encoding the protein components of anthrax toxin, cya (edema factor gene), lef (lethal factor gene), and pag (protective antigen gene). Expression of the three proteins is induced by bicarbonate or serum. Using a pag-lacZ transcriptional construct to measure pag promoter activity, we cloned in Bacillus subtilis a gene (atxA) whose product acts in trans to stimulate anthrax toxin expression. Deletion analysis located atxA on a 2.0-kb fragment between cya and pag. DNA sequencing identified one open reading frame encoding 476 amino acids with a predicted M(r) of 55,673, in good agreement with the value of 53 kDa obtained by in vitro transcription-translation analysis. The cloned atxA gene complemented previously characterized Tn917 insertion mutants UM23 tp29 and UM23 tp32 (J. M. Hornung and C. B. Thorne, Abstr. 91st Gen. Meet. Am. Soc. Microbiol. 1991, abstr. D-121, p. 98), which are deficient in synthesis of all three toxin proteins. These results demonstrate that the atxA product activates not only transcription of pag but also that of cya and lef. beta-Galactosidase synthesis from the pag-lacZ transcriptional fusion construct introduced into an insertion mutant (UM23 tp62) which does not require bicarbonate for toxin synthesis indicated that additional regulatory genes other than atxA play a role in the induction of anthrax toxin gene expression by bicarbonate.

Anthrax toxin is the only protein secreted by Bacillus anthracis that contributes to the virulence of this bacterium. An obligatory step in the action of anthrax toxin on eukaryotic cells is cleavage of the receptor-bound protective antigen (PA) protein (83 kilodaltons) to produce a 63-kilodalton, receptor-bound COOH-terminal fragment. A similar fragment can be obtained by limited treatment with trypsin. This proteolytic processing event exposes a site with high affinity for the other two anthrax toxin proteins, lethal factor and edema factor. Terminal sequencing of the purified fragment showed that the activating cleavage occurred in the sequence Arg164-Lys165-Lys166-Arg167. The gene encoding PA was mutagenized to delete residues 163–168, and the deleted PA was purified from a Bacillus subtilis host. The deleted PA was not cleaved by either trypsin or the cell-surface protease, and was non-toxic when administered with lethal factor. Purified, deleted PA protected rats when administered 90 min before injection of 20 minimum lethal doses of toxin. This mutant PA may be useful as a replacement for the PA that is the major active ingredient in the current human anthrax vaccine, because deleted PA is expected to have normal immunogenicity, but would not combine with trace amounts of LF and EF to cause toxicity.

Anthrax lethal toxin, which consists of two proteins, protective antigen and lethal factor, is cytolytic for macrophages. Macrophages from different mouse strains were found to vary in their sensitivities to toxin. C3H mouse macrophages lysed by lethal factor concentrations of 0.001 micrograms/ml were 100,000 times more sensitive than those from resistant A/J mice. We analyzed various stages of the intoxication process to determine the basis for this resistance. Direct binding studies with radioiodinated protective antigen revealed that the affinity (Kd, approximately 0.5 nM) and number of receptors per cell (25,000 to 33,000) were the same in sensitive and resistant cells. Proteolytic activation of protective antigen by a cell surface protease and subsequent binding of lethal factor were also the same in both sensitive and resistant macrophages. Resistant A/J macrophages were not cross-resistant to other toxins and a virus which, like lethal toxin, require vesicular acidification for activity, implying that resistance is not due to a defect in vesicular acidification. When introduced into the cytosol by osmotic lysis of pinosomes, lethal factor in the absence of protective antigen was cytolytic for the sensitive macrophages while resistant cells were unaffected. Thus, lethal factor by itself possesses the toxic activity of lethal toxin. These results suggest that macrophage resistance is due to a defect at a stage occurring after toxin internalization. A/J macrophages may lack the putative lethal factor target in the cytosol or be defective in the further processing or activation of lethal factor in the cytosol or in endocytic vesicles.

The kinetics of Bacillus anthracis toxin production in culture and its lethal activity in rats, mice, and guinea pigs were investigated. Lethal toxin activity was produced in vitro throughout exponential growth at essentially identical rates in both encapsulated virulent and nonencapsulated avirulent strains. The two toxin proteins which produce lethality when in combination, lethal factor (LF) and protective antigen (PA), could be quantitated directly from culture fluids by rocket immunoelectrophoresis. Using purified preparations of these proteins, we determined that a combination of 8 micrograms of LF and 40 micrograms of PA was required for a maximal rate of killing (39 to 40 min) in Fischer 344 rats (250 to 300 g). Conversely, a minimum of 0.6 microgram of LF and 3 micrograms of PA was required for lethality. The 50% lethal dose for Hartley guinea pigs was 50 micrograms of LF and 250 micrograms of PA, and for Swiss mice it was 2.5 micrograms of LF and 12.5 micrograms of PA. Analyses classically reserved for enzyme kinetic studies were used to study the kinetics of lethal activity in the rat model after intravenous injection of LF-PA mixtures. The amounts of LF and PA which were required to give half the rate of killing (i.e., double the minimum time to death) were 1.2 and 5.8 micrograms, respectively. A theoretical minimum time to death was determined to be 38 min. A third anthrax toxin component, edema factor, was shown to inhibit lethal toxin activity. Edema factor could not be quantitated by rocket immunoelectrophoresis because the protein did not form distinct precipitin bands with available antisera.

The tripartite protein toxin of Bacillus anthracis consists of protective antigen (PA), edema factor (EF), and lethal factor (LF). As a first step in developing a more efficacious anthrax vaccine, recombinant plasmids containing the PA gene have been isolated. A library was constructed in the E. coli vector pBR322 from Bam HI-generated fragments of the anthrax plasmid, pBA1. Two clones producing PA were identified by screening lysates with ELISA (enzyme-linked immunosorbent assay). Western blots revealed a full-size PA protein in the recombinant E. coli, and a cell elongation assay demonstrated biological activity. Both positive clones had a 6 kb insert of DNA, which mapped in the Bam HI site of the vector. The two inserts are the same except that they lie in opposite orientations with respect to the vector. Thus PA is encoded by the plasmid pBA1.

Toxoplasma gondii is an intracellular parasite that infects a wide range of warm-blooded species. Rats vary in their susceptibility to this parasite. The Toxo1 locus conferring Toxoplasma resistance in rats was previously mapped to a region of chromosome 10 containing Nlrp1. This gene encodes an inflammasome sensor controlling macrophage sensitivity to anthrax lethal toxin (LT) induced rapid cell death (pyroptosis). We show here that rat strain differences in Toxoplasma infected macrophage sensitivity to pyroptosis, IL-1β/IL-18 processing, and inhibition of parasite proliferation are perfectly correlated with NLRP1 sequence, while inversely correlated with sensitivity to anthrax LT-induced cell death. Using recombinant inbred rats, SNP analyses and whole transcriptome gene expression studies, we narrowed the candidate genes for control of Toxoplasma-mediated rat macrophage pyroptosis to four genes, one of which was Nlrp1. Knockdown of Nlrp1 in pyroptosis-sensitive macrophages resulted in higher parasite replication and protection from cell death. Reciprocally, overexpression of the NLRP1 variant from Toxoplasma-sensitive macrophages in pyroptosis-resistant cells led to sensitization of these resistant macrophages. Our findings reveal Toxoplasma as a novel activator of the NLRP1 inflammasome in rat macrophages.

The exotoxin (PE) of Pseudomonas aeruginosa was purified from 50-liter cultures by a simple three-step procedure, yielding 135 mg of essentially homogeneous protein. In Ouchterlony gel diffusion, PE produces a single line which does not interact with a diphtheria toxin-antitoxin precipitin line. The protein has a molecular weight of 66,000, an isoelectric point of 5.1, N-terminal arginine, and four disulfide bridges. The amino acid composition shows no apparent similarity to that of diphtheria toxin. The median lethal dose of this PE preparation in mice weighing 20 g is 0.1 mug. The median lethal dose in 350-g rats is 20 mug. The cytotoxicity of PE for mouse L929 fibroblasts is completely neutralized by small amounts of specific pony antitoxin. The exotoxin possesses adenosine diphosphate-ribosylation activity. Both cytotoxic and adenosine diphosphate-ribosylation activities are shown to be properties of the intact 66,000-dalton protein.

Abstract The inflammasomes are intracellular complexes that have an important role in cytosolic innate immune sensing and pathogen defense. Inflammasome sensors detect a diversity of intracellular microbial ligands and endogenous danger signals and activate caspase-1, thus initiating maturation and release of the proinflammatory cytokines interleukin-1β and interleukin-18. These events, although crucial to the innate immune response, have also been linked to the pathology of several inflammatory and autoimmune disorders. The natural isothiocyanate sulforaphane, present in broccoli sprouts and available as a dietary supplement, has gained attention for its antioxidant, anti-inflammatory, and chemopreventive properties. We discovered that sulforaphane inhibits caspase-1 autoproteolytic activation and interleukin-1β maturation and secretion downstream of the nucleotide-binding oligomerization domain-like receptor leucine-rich repeat proteins NLRP1 and NLRP3, NLR family apoptosis inhibitory protein 5/NLR family caspase-1 recruitment domain-containing protein 4 (NAIP5/NLRC4), and absent in melanoma 2 (AIM2) inflammasome receptors. Sulforaphane does not inhibit the inflammasome by direct modification of active caspase-1 and its mechanism is not dependent on protein degradation by the proteasome or de novo protein synthesis. Furthermore, sulforaphane-mediated inhibition of the inflammasomes is independent of the transcription factor nuclear factor erythroid-derived 2-like factor 2 (Nrf2) and the antioxidant response-element pathway, to which many of the antioxidant and anti-inflammatory effects of sulforaphane have been attributed. Sulforaphane was also found to inhibit cell recruitment to the peritoneum and interleukin-1β secretion in an in vivo peritonitis model of acute gout and to reverse NLRP1-mediated murine resistance to Bacillus anthracis spore infection. These findings demonstrate that sulforaphane inhibits the inflammasomes through a novel mechanism and contributes to our understanding of the beneficial effects of sulforaphane.

The monoclonal antibody S9.6 binds DNA–RNA hybrids with high affinity, making it useful in research and diagnostic applications, such as in microarrays and in the detection of R‐loops. A single‐chain variable fragment (scFv) of S9.6 was produced, and its affinities for various synthetic nucleic acid hybrids were measured by surface plasmon resonance (SPR). S9.6 exhibits dissociation constants of approximately 0.6 nM for DNA–RNA and, surprisingly, 2.7 nM for RNA–RNA hybrids that are AU‐rich. The affinity of the S9.6 scFv did not appear to be strongly influenced by various buffer conditions or by ionic strength below 500 mM NaCl. The smallest epitope that was strongly bound by the S9.6 scFv contained six base pairs of DNA–RNA hybrid. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

Bacillus anthracis infects hosts as a spore, germinates, and disseminates in its vegetative form. Production of anthrax lethal and edema toxins following bacterial outgrowth results in host death. Macrophages of inbred mouse strains are either sensitive or resistant to lethal toxin depending on whether they express the lethal toxin responsive or non-responsive alleles of the inflammasome sensor Nlrp1b (Nlrp1bS/S or Nlrp1bR/R, respectively). In this study, Nlrp1b was shown to affect mouse susceptibility to infection. Inbred and congenic mice harboring macrophage-sensitizing Nlrp1bS/S alleles (which allow activation of caspase-1 and IL-1β release in response to anthrax lethal toxin challenge) effectively controlled bacterial growth and dissemination when compared to mice having Nlrp1bR/R alleles (which cannot activate caspase-1 in response to toxin). Nlrp1bS-mediated resistance to infection was not dependent on the route of infection and was observed when bacteria were introduced by either subcutaneous or intravenous routes. Resistance did not occur through alterations in spore germination, as vegetative bacteria were also killed in Nlrp1bS/S mice. Resistance to infection required the actions of both caspase-1 and IL-1β as Nlrp1bS/S mice deleted of caspase-1 or the IL-1 receptor, or treated with the Il-1 receptor antagonist anakinra, were sensitized to infection. Comparison of circulating neutrophil levels and IL-1β responses in Nlrp1bS/S,Nlrp1bR/R and IL-1 receptor knockout mice implicated Nlrp1b and IL-1 signaling in control of neutrophil responses to anthrax infection. Neutrophil depletion experiments verified the importance of this cell type in resistance to B. anthracis infection. These data confirm an inverse relationship between murine macrophage sensitivity to lethal toxin and mouse susceptibility to spore infection, and establish roles for Nlrp1bS, caspase-1, and IL-1β in countering anthrax infection.

Anthrax lethal factor (LF) is the protease component of anthrax lethal toxin (LT). LT induces pyroptosis in macrophages of certain inbred mouse and rat strains, while macrophages from other inbred strains are resistant to the toxin. In rats, the sensitivity of macrophages to toxin-induced cell death is determined by the presence of an LF cleavage sequence in the inflammasome sensor Nlrp1. LF cleaves rat Nlrp1 of toxin-sensitive macrophages, activating caspase-1 and inducing cell death. Toxin-resistant macrophages, however, express Nlrp1 proteins which do not harbor the LF cleavage site. We report here that mouse Nlrp1b proteins are also cleaved by LF. In contrast to the situation in rats, sensitivity and resistance of Balb/cJ and NOD/LtJ macrophages does not correlate to the susceptibility of their Nlrp1b proteins to cleavage by LF, as both proteins are cleaved. Two LF cleavage sites, at residues 38 and 44, were identified in mouse Nlrp1b. Our results suggest that the resistance of NOD/LtJ macrophages to LT, and the inability of the Nlrp1b protein expressed in these cells to be activated by the toxin are likely due to polymorphisms other than those at the LF cleavage sites.

Bacillus anthracis, the causative agent of anthrax disease, is lethal owing to the actions of two exotoxins: anthrax lethal toxin (LT) and oedema toxin (ET). The key tissue targets responsible for the lethal effects of these toxins are unknown. Here we generated cell-type-specific anthrax toxin receptor capillary morphogenesis protein-2 (CMG2)-null mice and cell-type-specific CMG2-expressing mice and challenged them with the toxins. Our results show that lethality induced by LT and ET occurs through damage to distinct cell types; whereas targeting cardiomyocytes and vascular smooth muscle cells is required for LT-induced mortality, ET-induced lethality occurs mainly through its action in hepatocytes. Notably, and in contradiction to what has been previously postulated, targeting of endothelial cells by either toxin does not seem to contribute significantly to lethality. Our findings demonstrate that B. anthracis has evolved to use LT and ET to induce host lethality by coordinately damaging two distinct vital systems.

The inflammasomes are intracellular protein complexes that play an important role in innate immune sensing. Activation of inflammasomes leads to activation of caspase-1 and maturation and secretion of the pro-inflammatory cytokines IL-1β and IL-18. In certain myeloid cells this activation can also lead to an inflammatory cell death (pyroptosis). Inflammasome sensor proteins have evolved to detect a range of microbial ligands and bacterial exotoxins either through direct interaction or by detection of host cell changes elicited by these effectors. Bacterial exotoxins activate the inflammasomes through diverse processes including direct sensor cleavage, modulation of ion fluxes through plasma membrane pore formation, and perturbation of various host cell functions. In this review, we summarize the findings on some of the bacterial exotoxins that activate the inflammasomes.

Host recognition of microbial components is essential in mediating an effective immune response. Cytosolic bacteria must secure entry into the host cytoplasm to facilitate replication and, in doing so, liberate microbial ligands that activate cytosolic innate immune sensors and the inflammasome. Here, we identified a multicomponent enterotoxin, haemolysin BL (HBL), that engages activation of the inflammasome. This toxin is highly conserved among the human pathogen Bacillus cereus. The three subunits of HBL bind to the cell membrane in a linear order, forming a lytic pore and inducing activation of the NLRP3 inflammasome, secretion of interleukin-1β and interleukin-18, and pyroptosis. Mechanistically, the HBL-induced pore results in the efflux of potassium and triggers the activation of the NLRP3 inflammasome. Furthermore, HBL-producing B. cereus induces rapid inflammasome-mediated mortality. Pharmacological inhibition of the NLRP3 inflammasome using MCC950 prevents B. cereus-induced lethality. Overall, our results reveal that cytosolic sensing of a toxin is central to the innate immune recognition of infection. Therapeutic modulation of this pathway enhances host protection against deadly bacterial infections. The Bacillus cereus enterotoxin haemolysin BL induces pore formation and activation of the NLRP3 inflammasome, leading to enhanced lethality during infection.

Abstract Inflammasomes are important for host defence against pathogens and homeostasis with commensal microbes. Here, we show non-haemolytic enterotoxin (NHE) from the neglected human foodborne pathogen Bacillus cereus is an activator of the NLRP3 inflammasome and pyroptosis. NHE is a non-redundant toxin to haemolysin BL (HBL) despite having a similar mechanism of action. Via a putative transmembrane region, subunit C of NHE initiates binding to the plasma membrane, leading to the recruitment of subunit B and subunit A, thus forming a tripartite lytic pore that is permissive to efflux of potassium. NHE mediates killing of cells from multiple lineages and hosts, highlighting a versatile functional repertoire in different host species. These data indicate that NHE and HBL operate synergistically to induce inflammation and show that multiple virulence factors from the same pathogen with conserved function and mechanism of action can be exploited for sensing by a single inflammasome.

R-loops are ubiquitous, dynamic nucleic-acid structures that play fundamental roles in DNA replication and repair, chromatin and transcription regulation, as well as telomere maintenance. The DNA-RNA hybrid-specific S9.6 monoclonal antibody is widely used to map R-loops. Here, we report crystal structures of a S9.6 antigen-binding fragment (Fab) free and bound to a 13-bp hybrid duplex. We demonstrate that S9.6 exhibits robust selectivity in binding hybrids over double-stranded (ds) RNA and in categorically rejecting dsDNA. S9.6 asymmetrically recognizes a compact epitope of two consecutive RNA nucleotides via their 2'-hydroxyl groups and six consecutive DNA nucleotides via their backbone phosphate and deoxyribose groups. Recognition is mediated principally by aromatic and basic residues of the S9.6 heavy chain, which closely track the curvature of the hybrid minor groove. These findings reveal the molecular basis for S9.6 recognition of R-loops, detail its binding specificity, identify a new hybrid-recognition strategy, and provide a framework for S9.6 protein engineering.

Urokinase plasminogen activator receptor (uPAR) binds pro-urokinase plasminogen activator (pro-uPA) and thereby localizes it near plasminogen, causing the generation of active uPA and plasmin on the cell surface. uPAR and uPA are overexpressed in a variety of human tumors and tumor cell lines, and expression of uPAR and uPA is highly correlated to tumor invasion and metastasis. To exploit these characteristics in the design of tumor cell-selective cytotoxins, we constructed mutated anthrax toxin-protective antigen (PrAg) proteins in which the furin cleavage site is replaced by sequences cleaved specifically by uPA. These uPA-targeted PrAg proteins were activated selectively on the surface of uPAR-expressing tumor cells in the presence of pro-uPA and plasminogen. The activated PrAg proteins caused internalization of a recombinant cytotoxin, FP59, consisting of anthrax toxin lethal factor residues 1–254 fused to the ADP-ribosylation domain of Pseudomonas exotoxin A, thereby killing the uPAR-expressing tumor cells. The activation and cytotoxicity of these uPA-targeted PrAg proteins were strictly dependent on the integrity of the tumor cell surface-associated plasminogen activation system. We also constructed a mutated PrAg protein that selectively killed tissue plasminogen activator-expressing cells. These mutated PrAg proteins may be useful as new therapeutic agents for cancer treatment. Urokinase plasminogen activator receptor (uPAR) binds pro-urokinase plasminogen activator (pro-uPA) and thereby localizes it near plasminogen, causing the generation of active uPA and plasmin on the cell surface. uPAR and uPA are overexpressed in a variety of human tumors and tumor cell lines, and expression of uPAR and uPA is highly correlated to tumor invasion and metastasis. To exploit these characteristics in the design of tumor cell-selective cytotoxins, we constructed mutated anthrax toxin-protective antigen (PrAg) proteins in which the furin cleavage site is replaced by sequences cleaved specifically by uPA. These uPA-targeted PrAg proteins were activated selectively on the surface of uPAR-expressing tumor cells in the presence of pro-uPA and plasminogen. The activated PrAg proteins caused internalization of a recombinant cytotoxin, FP59, consisting of anthrax toxin lethal factor residues 1–254 fused to the ADP-ribosylation domain of Pseudomonas exotoxin A, thereby killing the uPAR-expressing tumor cells. The activation and cytotoxicity of these uPA-targeted PrAg proteins were strictly dependent on the integrity of the tumor cell surface-associated plasminogen activation system. We also constructed a mutated PrAg protein that selectively killed tissue plasminogen activator-expressing cells. These mutated PrAg proteins may be useful as new therapeutic agents for cancer treatment. amino-terminal fragment of urokinase plasminogen activator Dulbecco's modified Eagle's medium edema factor fusion protein of LF amino acids 1–254 and Pseudomonas exotoxin A domain III human umbilical vein endothelial cells lethal factor matrix metalloproteinase 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide anthrax toxin-protective antigen amino-terminal 20-kDa fragment of PrAg carboxyl-terminal 63-kDa fragment of PrAg polyacrylamide gel electrophoresis plasminogen activator inhibitor-1 plasminogen activator inhibitor-2 tissue plasminogen activator urokinase plasminogen activator urokinase plasminogen activator receptor Dissolution of the extracellular matrix is a prerequisite for invasive growth and metastatic spread of tumors as well as for physiological tissue remodeling and tissue repair. Matrix dissolution is accomplished by the concerted effort of a number of extracellular proteolytic systems, including serine, metallo-, and cysteine proteases (1Dano K. Romer J. Nielsen B.S. Bjorn S. Pyke C. Rygaard J. Lund L.R. APMIS. 1999; 107: 120-127Crossref PubMed Scopus (293) Google Scholar, 2Andreasen P.A. Egelund R. Petersen H.H. Cell Mol. Life Sci. 2000; 57: 25-40Crossref PubMed Scopus (850) Google Scholar, 3Koblinski J.E. Ahram M. Sloane B.F. Clin. Chim. Acta. 2000; 291: 113-135Crossref PubMed Scopus (517) Google Scholar). A particularly well studied proteolytic system implicated in tumor progression is the plasminogen activation system, a complex system of serine proteases, protease inhibitors, and protease receptors, that governs the conversion of the abundant plasma protease zymogen, plasminogen, to the active protease, plasmin (1Dano K. Romer J. Nielsen B.S. Bjorn S. Pyke C. Rygaard J. Lund L.R. APMIS. 1999; 107: 120-127Crossref PubMed Scopus (293) Google Scholar, 2Andreasen P.A. Egelund R. Petersen H.H. Cell Mol. Life Sci. 2000; 57: 25-40Crossref PubMed Scopus (850) Google Scholar). Plasmin is formed by the proteolytic cleavage of plasminogen by either of two plasminogen activators, the urokinase plasminogen activator (uPA)1 and the tissue plasminogen activator (tPA). uPA is a 52-kDa serine protease that is secreted as an inactive single chain proenzyme (pro-uPA) that is efficiently converted to active two-chain uPA by plasmin (4Nielsen L.S. Hansen J.G. Skriver L. Wilson E.L. Kaltoft K. Zeuthen J. Dano K. Biochemistry. 1982; 21: 6410-6415Crossref PubMed Scopus (182) Google Scholar). Two-chain uPA, in turn, is a potent activator of plasminogen, leading to a powerful feedback loop that results in productive plasmin formation. However, both pro-uPA and plasminogen are catalytically inactive pro-enzymes, and the mechanism of initiation of uPA-mediated plasminogen activation is not fully understood. Pro-uPA binds with high affinity (Kd = 0.5 nm) to a specific glycosylphosphatidylinositol-linked cell surface receptor, the uPA receptor (uPAR), via an epidermal growth factor-like amino-terminal fragment (ATF; amino acids 1–135, 15 kDa) (5Ploug M. Ellis V. Dano K. Biochemistry. 1994; 33: 8991-8997Crossref PubMed Scopus (110) Google Scholar). uPAR is a 60-kDa, three-domain glycoprotein whose first and third domains constitute a composite high affinity binding site for the ATF of pro-uPA (5Ploug M. Ellis V. Dano K. Biochemistry. 1994; 33: 8991-8997Crossref PubMed Scopus (110) Google Scholar, 6Ploug M. Ronne E. Behrendt N. Jensen A.L. Blasi F. Dano K. J. Biol. Chem. 1991; 266: 1926-1933Abstract Full Text PDF PubMed Google Scholar, 7Behrendt N. Ploug M. Patthy L. Houen G. Blasi F. Dano K. J. Biol. Chem. 1991; 266: 7842-7847Abstract Full Text PDF PubMed Google Scholar, 8Ploug M. Ostergaard S. Hansen L.B. Holm A. Dano K. Biochemistry. 1998; 37: 3612-3622Crossref PubMed Scopus (81) Google Scholar). The concomitant binding of pro-uPA to uPAR, and of plasminogen to as yet uncharacterized cell surface receptors, strongly potentiates uPA-mediated plasminogen activation (9Ellis V. Scully M.F. Kakkar V.V. J. Biol. Chem. 1989; 264: 2185-2188Abstract Full Text PDF PubMed Google Scholar, 10Stephens R.W. Pollanen J. Tapiovaara H. Leung K.C. Sim P.S. Salonen E.M. Ronne E. Behrendt N. Dano K. Vaheri A. J. Cell Biol. 1989; 108: 1987-1995Crossref PubMed Scopus (303) Google Scholar, 11Ellis V. Behrendt N. Dano K. J. Biol. Chem. 1991; 266: 12752-12758Abstract Full Text PDF PubMed Google Scholar, 12Ronne E. Behrendt N. Ellis V. Ploug M. Dano K. Hoyer-Hansen G. FEBS Lett. 1991; 288: 233-236Crossref PubMed Scopus (184) Google Scholar), possibly due to the formation of ternary complexes, aligning the two proenzymes in a way that exploits their low intrinsic activity and thereby favors a mutual activation process (13Ellis V. Dano K. J. Biol. Chem. 1993; 268: 4806-4813Abstract Full Text PDF PubMed Google Scholar). The net result of this process is the efficient and localized generation of active uPA and plasmin on the cell surface. Although many studies have documented the central role of uPA-mediated cell-surface plasminogen activation requiring uPAR, recent studies in uPAR-deficient mice have demonstrated the existence of additional, uPAR-independent pathways of uPA-mediated plasminogen activation, in the context of both physiological cell migration and fibrin dissolution (14Bugge T.H. Flick M.J. Danton M.J. Daugherty C.C. Romer J. Dano K. Carmeliet P. Collen D. Degen J.L. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5899-5904Crossref PubMed Scopus (238) Google Scholar, 15Carmeliet P. Moons L. Dewerchin M. Rosenberg S. Herbert J.M. Lupu F. Collen D. J. Cell Biol. 1998; 140: 233-245Crossref PubMed Scopus (117) Google Scholar). uPAR and uPA are overexpressed with remarkable consistency in malignant human tumors, including monocytic and myelogenous leukemias (16Plesner T. Ralfkiaer E. Wittrup M. Johnsen H. Pyke C. Pedersen T.L. Hansen N.E. Dano K. Am. J. Clin. Pathol. 1994; 102: 835-841Crossref PubMed Scopus (107) Google Scholar, 17Lanza F. Castoldi G.L. Castagnari B. Todd III, R.F. Moretti S. Spisani S. Latorraca A. Focarile E. Roberti M.G. Traniello S. Br. J. Haematol. 1998; 103: 110-123Crossref PubMed Scopus (56) Google Scholar) and cancers of the colon (18Pyke C. Kristensen P. Ralfkiaer E. Grondahl-Hansen J. Eriksen J. Blasi F. Dano K. Am. J. Pathol. 1991; 138: 1059-1067PubMed Google Scholar), breast (19Carriero M.V. Del Vecchio S. Franco P. Potena M.I. Chiaradonna F. Botti G. Stoppelli M.P. Salvatore M. Clin. Cancer Res. 1997; 3: 1299-1308PubMed Google Scholar), bladder (20Hudson M.A. McReynolds L.M. J. Natl. Cancer Inst. 1997; 89: 709-717Crossref PubMed Scopus (50) Google Scholar), thyroid (21Ragno P. Montuori N. Covelli B. Hoyer-Hansen G. Rossi G. Cancer Res. 1998; 58: 1315-1319PubMed Google Scholar), liver (22De Petro G. Tavian D. Copeta A. Portolani N. Giulini S.M. Barlati S. Cancer Res. 1998; 58: 2234-2239PubMed Google Scholar), pleura (23Shetty S. Idell S. Arch. Biochem. Biophys. 1998; 356: 265-279Crossref PubMed Scopus (33) Google Scholar), lung (24Morita S. Sato A. Hayakawa H. Ihara H. Urano T. Takada Y. Takada A. Int. J. Cancer. 1998; 78: 286-292Crossref PubMed Scopus (63) Google Scholar), pancreas (25Taniguchi T. Kakkar A.K. Tuddenham E.G. Williamson R.C. Lemoine N.R. Cancer Res. 1998; 58: 4461-4467PubMed Google Scholar), ovaries (26Sier C.F. Stephens R. Bizik J. Mariani A. Bassan M. Pedersen N. Frigerio L. Ferrari A. Dano K. Brunner N. Blasi F. Cancer Res. 1998; 58: 1843-1849PubMed Google Scholar), and the head and neck (27Schmidt M. Hoppe F. Acta Otolaryngol. 1999; 119: 949-953Crossref PubMed Scopus (25) Google Scholar). Extensive in situ hybridization and immunohistochemical studies of various human tumor types have demonstrated that cancer cells typically express uPAR, whereas pro-uPA may be expressed by either the cancer cells or by adjacent stromal cells (18Pyke C. Kristensen P. Ralfkiaer E. Grondahl-Hansen J. Eriksen J. Blasi F. Dano K. Am. J. Pathol. 1991; 138: 1059-1067PubMed Google Scholar, 28Pyke C. Ralfkiaer E. Ronne E. Hoyer-Hansen G. Kirkeby L. Dano K. Histopathology. 1994; 24: 131-138Crossref PubMed Scopus (108) Google Scholar, 29Nielsen B.S. Sehested M. Timshel S. Pyke C. Dano K. Lab. Invest. 1996; 74: 168-177PubMed Google Scholar). Plasminogen activation by uPA is regulated by two physiological inhibitors, plasminogen activator inhibitors-1 and -2 (PAI-1 and PAI-2) (30Cubellis M.V. Andreasen P. Ragno P. Mayer M. Dano K. Blasi F. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4828-4832Crossref PubMed Scopus (173) Google Scholar, 31Ellis V. Wun T.C. Behrendt N. Ronne E. Dano K. J. Biol. Chem. 1990; 265: 9904-9908Abstract Full Text PDF PubMed Google Scholar, 32Baker M.S. Bleakley P. Woodrow G.C. Doe W.F. Cancer Res. 1990; 50: 4676-4684PubMed Google Scholar), each forming a 1:1 complex with uPA. Plasmin generated by the cell surface plasminogen activation system is relatively protected from its primary physiological inhibitor α2-antiplasmin (11Ellis V. Behrendt N. Dano K. J. Biol. Chem. 1991; 266: 12752-12758Abstract Full Text PDF PubMed Google Scholar,33Plow E.F. Freaney D.E. Plescia J. Miles L.A. J. Cell Biol. 1986; 103: 2411-2420Crossref PubMed Scopus (388) Google Scholar, 34Hall S.W. Humphries J.E. Gonias S.L. J. Biol. Chem. 1991; 266: 12329-12336Abstract Full Text PDF PubMed Google Scholar). Unlike uPA, plasmin is a relatively nonspecific protease, capable of degrading fibrin and several other glycoproteins and proteoglycans of the extracellular matrix (35Liotta L.A. Goldfarb R.H. Brundage R. Siegal G.P. Terranova V. Garbisa S. Cancer Res. 1981; 41: 4629-4636PubMed Google Scholar). Therefore, cell surface plasminogen activation facilitates invasion and metastasis of tumor cells by dissolution of restraining tissue barriers. In addition, cell surface plasminogen activation may facilitate matrix degradation through the activation of latent matrix metalloproteinases (MMP) (36Werb Z. Mainardi C.L. Vater C.A. Harris Jr., E.D. N. Engl. J. Med. 1977; 296: 1017-1023Crossref PubMed Scopus (554) Google Scholar). Plasmin can also activate growth factors, such as transforming growth factor-β, which may further modulate stromal interactions in the expression of enzymes and tumor neo-angiogenesis (37Mignatti P. Rifkin D.B. Enzyme Protein. 1996; 49: 117-137Crossref PubMed Scopus (294) Google Scholar). Another protein that requires cell surface proteolytic activation is anthrax toxin. This three-component toxin consists of protective antigen (PrAg, 83 kDa), lethal factor (LF, 90 kDa), and edema factor (EF, 90 kDa) (38Smith H. Stanley J.L. J. Gen. Microbiol. 1962; 29: 517-521Crossref PubMed Scopus (32) Google Scholar, 39Leppla S.H. Iglewski B.J. Vaughan M. Tu A. Bacterial Toxins and Virulence Factors in Disease. Handbook of Natural Toxins. 8. Marcel Dekker, Inc., New York1995: 543-572Google Scholar, 40Leppla S.H. Alouf J.E. Freer J.H. Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, London1999: 243-263Google Scholar). PrAg binds to an unidentified cell surface receptor and is cleaved at the sequence,164RKKR167, by a cell-surface, furin-like protease (41Molloy S.S. Bresnahan P.A. Leppla S.H. Klimpel K.R. Thomas G. J. Biol. Chem. 1992; 267: 16396-16402Abstract Full Text PDF PubMed Google Scholar, 42Klimpel K.R. Molloy S.S. Thomas G. Leppla S.H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10277-10281Crossref PubMed Scopus (409) Google Scholar). This cleavage is absolutely required for the subsequent steps in toxin action. The carboxyl-terminal 63-kDa fragment (PrAg63) remains bound to receptor, associates to form a heptamer, and binds and internalizes LF and EF (40Leppla S.H. Alouf J.E. Freer J.H. Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, London1999: 243-263Google Scholar, 43Milne J.C. Furlong D. Hanna P.C. Wall J.S. Collier R.J. J. Biol. Chem. 1994; 269: 20607-20612Abstract Full Text PDF PubMed Google Scholar, 44Leppla S.H. Friedlander A.M. Cora E. Fehrenbach F. Alouf J.E. Falmagne P. Goebel W. Jeljaszewicz J. Jurgen D. Rappouli R. Bacterial Protein Toxins. Gustav Fischer, New York1988: 111-112Google Scholar, 45Benson E.L. Huynh P.D. Finkelstein A. Collier R.J. Biochemistry. 1998; 37: 3941-3948Crossref PubMed Scopus (162) Google Scholar). LF kills animals (46Beall F.A. Taylor M.J. Thorne C.B. J. Bacteriol. 1962; 83: 1274-1280Crossref PubMed Google Scholar, 47Ezzell J.W. Ivins B.E. Leppla S.H. Infect. Immun. 1984; 45: 761-767Crossref PubMed Google Scholar) and lyses mouse macrophages (48Friedlander A.M. J. Biol. Chem. 1986; 261: 7123-7126Abstract Full Text PDF PubMed Google Scholar, 49Hanna P.C. Kochi S. Collier R.J. Mol. Biol. Cell. 1992; 3: 1269-1277Crossref PubMed Scopus (79) Google Scholar), probably due to the proteolytic cleavage of mitogen-activated protein kinase kinases (50Duesbery N.S. Webb C.P. Leppla S.H. Gordon V.M. Klimpel K.R. Copeland T.D. Ahn N.G. Oskarsson M.K. Fukasawa K. Paull K.D. Vande Woude G.F. Science. 1998; 280: 734-737Crossref PubMed Scopus (898) Google Scholar, 51Vitale G. Pellizzari R. Recchi C. Napolitani G. Mock M. Montecucco C. Biochem. Biophy. Res. Commun. 1998; 248: 706-711Crossref PubMed Scopus (363) Google Scholar). EF damages cells due to its intracellular adenylate cyclase activity (52Leppla S.H. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 3162-3166Crossref PubMed Scopus (773) Google Scholar). A potent PrAgdependent cytotoxin, FP59, created by fusing LF amino acids 1–254 to the ADP-ribosylation domain of Pseudomonas exotoxin A can kill any cell having receptors for PrAg and the ability to activate PrAg by cleavage at amino acids 164–167 (53Arora N. Klimpel K.R. Singh Y. Leppla S.H. J. Biol. Chem. 1992; 267: 15542-15548Abstract Full Text PDF PubMed Google Scholar, 54Arora N. Leppla S.H. J. Biol. Chem. 1993; 268: 3334-3341Abstract Full Text PDF PubMed Google Scholar). The unique requirement that PrAg be activated on the target cell surface provides an opportunity to re-engineer this protein to make its activation dependent on the tumor cell surface urokinase plasminogen activation system. Our previous work showed that PrAg can be made specific for MMP-expressing cells by replacing the164RKKR167 furin site with sequences preferentially cleaved by MMPs (55Liu S. Netzel-Arnett S. Birkedal-Hansen H. Leppla S.H. Cancer Res. 2000; 60: 6061-6067PubMed Google Scholar). In this report we extended this approach to exploit the localized activity of the uPA protease on tumor cells. uPA and tPA possess an extremely high degree of structural similarity (56Spraggon G. Phillips C. Nowak U.K. Ponting C.P. Saunders D. Dobson C.M. Stuart D.I. Jones E.Y. Structure. 1995; 3: 681-691Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar, 57Lamba D. Bauer M. Huber R. Fischer S. Rudolph R. Kohnert U. Bode W. J. Mol. Biol. 1996; 258: 117-135Crossref PubMed Scopus (123) Google Scholar), share the same primary physiological substrate (plasminogen) and inhibitors (PAI-1 and PAI-2) (58Collen D. Lijnen H.R. Blood. 1991; 78: 3114-3124Crossref PubMed Google Scholar), and exhibit restricted substrate specificity. Recent elegant genetic studies using substrate phage display and substrate subtraction phage display identified peptide substrates that are cleaved with high efficiency as well as high selectivity by either uPA or tPA (59Ke S.H. Coombs G.S. Tachias K. Corey D.R. Madison E.L. J. Biol. Chem. 1997; 272: 20456-20462Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar, 60Ke S.H. Coombs G.S. Tachias K. Navre M. Corey D.R. Madison E.L. J. Biol. Chem. 1997; 272: 16603-16609Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). We used the amino acid sequences defined in that work to replace the furin cleavage site in PrAg to produce several mutated PrAg proteins susceptible to cleavage by uPA and tPA. These uPA- and tPA-targeted PrAg proteins were activated selectively on the surface of tumor cells and caused their killing by the recombinant cytotoxin FP59, as described below. FP59 and a soluble form of furin were prepared as described previously (61Gordon V.M. Benz R. Fujii K. Leppla S.H. Tweten R.K. Infect. Immun. 1997; 65: 4130-4134Crossref PubMed Google Scholar). Rabbit anti-PrAg polyclonal antiserum (serum no. 5308) was made in our laboratory. Reagents obtained from American Diagnostica Inc. (Greenwich, CT) included pro-uPA (single-chain uPA, no. 107), uPA (no. 124), tPA (no. 116), human urokinase amino-terminal fragment (ATF, no. 146), human Glu-plasminogen (no. 410), human PAI-1 (no. 1094), α2-antiplasmin (no. 4030), monoclonal antibody against human uPA B-chain (no. 394), and goat polyclonal antibody against human t-PA (no. 387). tPA not containing protein stabilizer was purchased from Calbiochem (San Diego, CA). Aprotinin and tranexamic acid were purchased from Sigma Chemical Co. (St. Louis, MO). The uPAR monoclonal antibody R3 was a gift from Dr. Gunilla Høyer Hansen (Finsen Laboratory, Copenhagen, Denmark). A modified overlap PCR method was used to construct the mutated PrAg proteins in which the furin site is replaced by: 1) the plasminogen-derived sequence PCPGRVVGG in PrAg-U1; 2) the preferred uPA substrate sequences PGSGRSA and PGSGKSA in PrAg-U2 and PrAg-U3, respectively; and 3) the preferred tPA sequence PQRGRSA in PrAg-U4 (Table I). Plasmid pYS5 (62Singh Y. Chaudhary V.K. Leppla S.H. J. Biol. Chem. 1989; 264: 19103-19107Abstract Full Text PDF PubMed Google Scholar) was used as both PCR template and expression vector. The nativePfu DNA polymerase (Stratagene, La Jolla, CA) was used in the PCR reactions. We used 5′-primer F,AAAGGAGAACGTATATGA (Shine-Dalgarno and start codons are underlined), and the phosphorylated reverse primer R1, pTGGTGAGTTCGAAGATTTTTGTTTTAATTCTGG (the first three nucleotides encodes P, the others anneal to the sequence corresponding to P154 to S163), to amplify a fragment designated “N.” We used the mutagenic phosphorylated primer H1, pTGTCCAGGAAGAGTAGTTGGAGGAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding CPGRVVGG and S168 to P176, and reverse primer R2, ACGTTTATCTCTTATTAAAAT, annealing to the sequence encoding I589 to R595, to amplify a mutagenic fragment “M1.” We used a phosphorylated mutagenic primer H2, pGGAAGTGGAAGATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding GSGRSA and S168 to P176, and reverse primer R2, to amplify a mutagenic fragment “M2.” We used a phosphorylated mutagenic primer H3, pGGAAGTGGAAAATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding GSGKSA and S168 to P176, and reverse primer R2, to amplify a mutagenic fragment “M3.” We used a phosphorylated mutagenic primer H4, pCAGAGAGGAAGATCAGCAAGTACAAGTGCTGGACCTACGGTTCCAG, encoding QRGRSA and S168 to P176, and reverse primer R2, to amplify a mutagenic fragment “M4.” Primers F and R2 were used to amplify the ligated products of N + M1, N + M2, N + M3, and N + M4, respectively, resulting in the mutagenized fragments U1, U2, U3, and U4 in which the coding sequence for the furin site (164RKKR167) is replaced by uPA or tPA substrate sequence. The 670-bp HindIII/PstI fragments from the digests of U1, U2, U3, and U4 were cloned between the HindIII and PstI sites of pYS5. The resulting mutated PrAg proteins were accordingly named PrAg-U1, PrAg-U2, PrAg-U3, and PrAg-U4. We also constructed a mutated PrAg protein, PrAg-U7, in which 164RKKR167 is replaced by the sequence PGG. This protein is expected to be resistant to all cell surface proteases. DNA sequencing analyses confirmed the sequences of the mutated PrAg constructs.Table IPredicted and observed properties of mutated PA proteinsProteinSequence at the “furin loop”kcat/Kmfor sequenceaData from Ref. 59, which was obtained from the studies on the peptides underlined in column 2.uPA:tPA selectivityaData from Ref. 59, which was obtained from the studies on the peptides underlined in column 2.Protease expected to cleaveToxicity to cultured cells, EC50bAssays on HeLa, A2058, and 293 cells were done in the presence of 100 ng/ml pro-uPA and 1 μg/ml Glu-plasminogen. Assays on HUVEC and Bowes cells were done without these additions. Arrows indicate the cleavage sites.uPAtPAHeLaA2058293HUVECBowesng/mlPrAgNS RKKR↑ STSAGPTVFurin121015<13PrAg-U1NSPCPGR↑VVGGSTSAGPTV0.880.293uPA/tPA (weakly)>1000>1000>1000PrAg-U2NSPGSGR↑SA STSAGPTV12006020uPA1413>1000>1000600PrAg-U3NSPGSGK↑SA STSAGPTV1931.6121uPA3018>1000>1000>1000PrAg-U4NSPORGR↑SA STSAGPTV7.36700.005tPA20050>10002512PrAg-U7NSPGG STSAGPTVNonea Data from Ref. 59Ke S.H. Coombs G.S. Tachias K. Corey D.R. Madison E.L. J. Biol. Chem. 1997; 272: 20456-20462Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar, which was obtained from the studies on the peptides underlined in column 2.b Assays on HeLa, A2058, and 293 cells were done in the presence of 100 ng/ml pro-uPA and 1 μg/ml Glu-plasminogen. Assays on HUVEC and Bowes cells were done without these additions. Arrows indicate the cleavage sites. Open table in a new tab Plasmids encoding the constructs described above were transformed into the non-virulent strain Bacillus anthracisUM23C1-1, and transformants were grown in FA medium (62Singh Y. Chaudhary V.K. Leppla S.H. J. Biol. Chem. 1989; 264: 19103-19107Abstract Full Text PDF PubMed Google Scholar) with 20 μg/ml kanamycin for 16 h at 37 °C. The mutated PrAg proteins were concentrated from the culture supernatants and purified by chromatography on a MonoQ column (Amersham Pharmacia Biotech, Piscataway, NJ) by the methods described previously (63Varughese M. Chi A. Teixeira A.V. Nicholls P.J. Keith J.M. Leppla S.H. Mol. Med. 1998; 4: 87-95Crossref PubMed Google Scholar). Reaction mixtures of 50 μl containing 5 μg of the PrAg proteins were incubated at 37 °C with 5 μl of soluble furin or 0.5 μg of uPA or tPA. Furin cleavage was done as described previously (55Liu S. Netzel-Arnett S. Birkedal-Hansen H. Leppla S.H. Cancer Res. 2000; 60: 6061-6067PubMed Google Scholar). Cleavage with uPA or tPA was done in 150 mm NaCl, 10 mm Tris-HCl (pH 7.5). Aliquots withdrawn at intervals were analyzed by SDS-polyacrylamide gel electrophoresis (PAGE) using 4–20% gradient Tris-glycine gels (Novex, San Diego, CA), and proteins were either visualized by Coomassie Blue staining or were electroblotted to a nitrocellulose membrane (Novex). Membranes were blocked with 5% (w/v) non-fat milk, incubated sequentially with rabbit anti-PrAg polyclonal antibody (no. 5308) and horseradish peroxidase-conjugated goat anti-rabbit antibody (sc-2004, Santa Cruz Biotechnology, Inc., Santa Cruz, CA), and visualized by detection of horseradish peroxidase by SuperSignal West Pico chemiluminescent substrate (Pierce, Rockford, IL). To verify the cleavage sites, digestions of native PrAg by furin, PrAg-U2 and-U3 by uPA, and PrAg-U4 by tPA (Calbiochem) were performed for 3 h at 37 °C as described above. Then the resulting PrAg63s were separated by SDS-NuPAGE electrophoresis (Novex), and the proteins were transferred onto Immobilon-P polyvinylidene difluoride membranes (Millipore, Bedford, MA) and visualized by Coomassie Blue staining. The protein bands were cut out and sequenced by the Protein and Nucleic Acid Laboratory, Center for Biologics Evaluation and Research, FDA using an ABI model 494A protein sequencer. Human 293 kidney cells, human cervix adenocarcinoma HeLa cells, human melanoma A2058 cells, and human melanoma Bowes cells were obtained from American Type Culture Collection (Manassas, VA). Mouse Lewis lung carcinoma cell line LL3 was kindly provided by Dr. Michael S. O'Reilly (Boston, MA). These cells were grown in Dulbecco's modified Eagle's medium (DMEM) with 0.45% glucose, 10% fetal bovine serum (FCS), 2 mm glutamine, and 50 μg/ml gentamicin. Human umbilical vein endothelial cells (HUVEC) were obtained from Clonetics Corp. (Walkersville, MD) and were grown in RPMI 1640 containing 20% defined and supplemented bovine calf serum (HyClone Laboratories, Inc, Logan, UT), 5 units/ml heparin (Fisher Scientific, Pittsburgh, PA), 100 units/ml penicillin, and 0.2 mg/ml endothelial cell growth supplement (Collaborative Research), 100 μg/ml streptomycin, 50 μg/ml gentamicin, and 2.5 μg/ml amphotericin B (Life Technologies, Rockville, MD). Cells were maintained at 37 °C in a 5% CO2 environment. Cells were cultured in 96-well plates to ∼50% confluence and washed twice with serum-free DMEM to remove residual serum. Then the cells were preincubated for 30 min with serum-free DMEM containing 100 ng/ml pro-uPA and 1 μg/ml Glu-plasminogen with or without PAI-1, aprotinin, α2-antiplasmin, ATF, or the uPAR blocking antibody R3. PrAg proteins (0–1000 ng/ml) combined with FP59 (50 ng/ml) were added to the cells to give a total volume of 200 μl/well. Cells were incubated with the toxins for 6 h, after which the medium was replaced with fresh DMEM supplemented with 10% fetal calf serum. Cell viability was assayed by adding 50 μl of 2.5 mg/ml MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide) at 48 h. The cells were incubated with MTT for 45 min at 37 °C, the medium was removed, and the blue pigment produced by viable cells was dissolved in 100 μl/well of 0.5% (w/v) SDS, 25 mmHCl, in 90% (v/v) isopropanol. The plates were vortexed and the oxidized MTT was measured as A570 using a microplate reader. Cells were cultured in 24-well plates to confluence, washed, and incubated in serum-free DMEM with 1 μg/ml pro-uPA, 1 μg/ml PrAg-U2, and 1 μg/ml Glu-plasminogen, and 2 mg/ml bovine serum albumin (BSA) at 37 °C for various lengths of times. The cells were washed five times to remove unbound pro-uPA and PrAg-U2. When PAI-1 was tested, it was incubated with cells for 30 min prior to the addition of pro-uPA and PrAg-U2. When tranexamic acid was tested, cells were preincubated with serum-free DMEM containing 2 mg/ml BSA, 1 mm tranexamic acid, without plasminogen, for 30 min before the addition of pro-uPA and PrAg-U2. Cells were lysed in 100 μl/well of modified radioimmune precipitation lysis buffer (50 mmTris-HCl, pH 7.4, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mm NaCl, 1 mm EDTA, 1 mmphenylmethylsulfonyl fluoride, 1 μg/ml each of aprotinin, leupeptin, and pepstatin) on ice for 10 min. Equal amounts of protein from cell lysates and equal volumes of the conditioned media were separated by PAGE using 4–20% gradient Tris-glycine gels (Novex). Western blotting was performed as described above to detect pro-uPA and PrAg-U2 and their cleavage products by using the monoclonal antibody against human uPA B-chain (no. 394) and anti-PrAg polyclonal antibody (no. 5308). A co-culture model like that described previously (55Liu S. Netzel-Arnett S. Birkedal-Hansen H. Leppla S.H. Cancer Res. 2000; 60: 6061-6067PubMed Google Scholar) was employed to determine whether PrAg-U2 killed uPAR-overexpressing tumor cells without affecting bystander, uPAR non-expressing cells. Briefly, HeLa and 293 cells were co-cultured in separate compartments of eight-chamber slides. With the partitions removed, the culture slides were incubated for 6 h with native PrAg or PrAg-U2 (each 300 ng/ml) combined with FP59 (50 ng/ml) in serum-free DMEM containing 100 ng/ml pro-uPA and 1 μg/ml Glu-pla

The interaction of anthrax toxin protective antigen (PA) and target cells was assessed, and the importance of the cytosolic domain of tumor endothelium marker 8 (TEM8) in its function as a cellular receptor for PA was evaluated. PA binding and proteolytic processing on the Chinese hamster ovary cell surface occurred rapidly, with both processes nearly reaching steady state in 5 min. Remarkably, the resulting PA63 fragment was present on the cell surface only as an oligomer, and furthermore, the oligomer was the only PA species internalized, suggesting that oligomerization of PA63 triggers receptor-mediated endocytosis. Following internalization, the PA63 oligomer was rapidly and irreversibly transformed to an SDS/heat-resistant form, in a process requiring an acidic compartment. This conformational change was functionally correlated with membrane insertion, channel formation, and translocation of lethal factor into the cytosol. To explore the role of the TEM8 cytosolic tail, a series of truncated TEM8 mutants was transfected into a PA receptor-deficient Chinese hamster ovary cell line. Interestingly, all of the cytosolic tail truncated TEM8 mutants functioned as PA receptors, as determined by PA binding, processing, oligomer formation, and translocation of an lethal factor fusion toxin into the cytosol. Moreover, cells transfected with a TEM8 construct truncated before the predicted transmembrane domain failed to bind PA, demonstrating that residues 321–343 are needed for cell surface anchoring. Further evidence that the cytosolic domain plays no essential role in anthrax toxin action was obtained by showing that TEM8 anchored by a glycosylphosphatidylinositol tail also functioned as a PA receptor. The interaction of anthrax toxin protective antigen (PA) and target cells was assessed, and the importance of the cytosolic domain of tumor endothelium marker 8 (TEM8) in its function as a cellular receptor for PA was evaluated. PA binding and proteolytic processing on the Chinese hamster ovary cell surface occurred rapidly, with both processes nearly reaching steady state in 5 min. Remarkably, the resulting PA63 fragment was present on the cell surface only as an oligomer, and furthermore, the oligomer was the only PA species internalized, suggesting that oligomerization of PA63 triggers receptor-mediated endocytosis. Following internalization, the PA63 oligomer was rapidly and irreversibly transformed to an SDS/heat-resistant form, in a process requiring an acidic compartment. This conformational change was functionally correlated with membrane insertion, channel formation, and translocation of lethal factor into the cytosol. To explore the role of the TEM8 cytosolic tail, a series of truncated TEM8 mutants was transfected into a PA receptor-deficient Chinese hamster ovary cell line. Interestingly, all of the cytosolic tail truncated TEM8 mutants functioned as PA receptors, as determined by PA binding, processing, oligomer formation, and translocation of an lethal factor fusion toxin into the cytosol. Moreover, cells transfected with a TEM8 construct truncated before the predicted transmembrane domain failed to bind PA, demonstrating that residues 321–343 are needed for cell surface anchoring. Further evidence that the cytosolic domain plays no essential role in anthrax toxin action was obtained by showing that TEM8 anchored by a glycosylphosphatidylinositol tail also functioned as a PA receptor. Anthrax toxin, the major virulence factor of Bacillus anthracis, consists of three polypeptides: protective antigen (PA, 1The abbreviations used are: PA, protective antigen; TEM8, tumor endothelium marker 8; CHO, Chinese hamster ovary; LF, lethal factor; HA, hemagglutinin; aa, amino acid; MAPKK, several mitogen-activated protein kinase kinases; PI-PLC, phosphatidylinositol-specific phospholipase C; HBSS, Hanks' balanced salt solution; GPI, glycosylphosphatidylinositol; uPAR, urokinase plasminogen activator receptor; MTT, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide 83 kDa), lethal factor (LF, 90 kDa), and edema factor (EF, 89 kDa) (1Leppla S.H. Alouf J.E. Freer J.H. Comprehensive Sourcebook of Bacterial Protein Toxins. Academic Press, London1999: 243-263Google Scholar, 2Smith H. Stanley J.L. J. Gen. Microbiol. 1962; 29: 517-521Crossref PubMed Scopus (32) Google Scholar). These three proteins are individually non-toxic. To intoxicate mammalian cells, PA binds to a ubiquitously expressed, recently identified cellular receptor, tumor endothelium marker 8 (TEM8) variant 2 (3Bradley K.A. Mogridge J. Mourez M. Collier R.J. Young J.A. Nature. 2001; 414: 225-229Crossref PubMed Scopus (763) Google Scholar), and is cleaved at the sequence RKKR167 on the cell surface by furin or furin-like proteases (4Klimpel K.R. Molloy S.S. Thomas G. Leppla S.H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10277-10281Crossref PubMed Scopus (409) Google Scholar, 5Molloy S.S. Bresnahan P.A. Leppla S.H. Klimpel K.R. Thomas G. J. Biol. Chem. 1992; 267: 16396-16402Abstract Full Text PDF PubMed Google Scholar). Proteolysis yields the amino-terminal 20-kDa fragment (PA20), which is released into the medium, and the carboxyl-terminal 63-kDa fragment (PA63), which remains bound to the receptor and self-associates to form a ring-shaped heptamer (6Milne J.C. Furlong D. Hanna P.C. Wall J.S. Collier R.J. J. Biol. Chem. 1994; 269: 20607-20612Abstract Full Text PDF PubMed Google Scholar, 7Petosa C. Collier R.J. Klimpel K.R. Leppla S.H. Liddington R.C. Nature. 1997; 385: 833-838Crossref PubMed Scopus (687) Google Scholar). The heptamer binds up to 3 molecules of LF or EF (8Mogridge J. Cunningham K. Collier R.J. Biochemistry. 2002; 41: 1079-1082Crossref PubMed Scopus (184) Google Scholar,9Mogridge J. Cunningham K. Lacy D.B. Mourez M. Collier R.J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 7045-7048Crossref PubMed Scopus (165) Google Scholar). The resulting oligomeric complex is then internalized into endosomes, where the decreased pH causes the PA63 heptamer to insert into the endosomal membrane and produce a channel through which LF and EF translocate to the cytosol (10Wesche J. Elliott J.L. Falnes P.O. Olsnes S. Collier R.J. Biochemistry. 1998; 37: 15737-15746Crossref PubMed Scopus (175) Google Scholar). Therefore, PA is the central part of anthrax toxin, serving as the delivery vehicle for binding and translocation of LF and EF into the cytosol of the cells. The combination of PA plus LF kills animals (11Ezzell J.W. Ivins B.E. Leppla S.H. Infect. Immun. 1984; 45: 761-767Crossref PubMed Google Scholar, 12Beall F.A. Taylor M.J. Thorne C.B. J. Bacteriol. 1962; 83: 1274-1280Crossref PubMed Google Scholar) and certain cells, including mouse macrophages (13Friedlander A.M. J. Biol. Chem. 1986; 261: 7123-7126Abstract Full Text PDF PubMed Google Scholar, 14Hanna P.C. Kochi S. Collier R.J. Mol. Biol. Cell. 1992; 3: 1269-1277Crossref PubMed Scopus (79) Google Scholar). LF is a zinc-dependent metalloprotease that cleaves several mitogen-activated protein kinase kinases (MAPKK) in their amino-terminal regions (15Duesbery N.S. Webb C.P. Leppla S.H. Gordon V.M. Klimpel K.R. Copeland T.D. Ahn N.G. Oskarsson M.K. Fukasawa K. Paull K.D. Vande Woude G.F. Science. 1998; 280: 734-737Crossref PubMed Scopus (898) Google Scholar, 16Vitale G. Pellizzari R. Recchi C. Napolitani G. Mock M. Montecucco C. Biochem. Biophys. Res. Commun. 1998; 248: 706-711Crossref PubMed Scopus (363) Google Scholar). How this cleavage triggers the lethal effects of the toxin and whether there are additional cellular substrates remains unclear. EF is a calmodulin-dependent adenylate cyclase that elevates intracellular cAMP concentrations (17Leppla S.H. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 3162-3166Crossref PubMed Scopus (773) Google Scholar), thereby causing diverse effects in cells including the impairment of phagocytosis (18O'Brien J. Friedlander A. Dreier T. Ezzell J. Leppla S. Infect. Immun. 1985; 47: 306-310Crossref PubMed Google Scholar). Previous studies on the interaction of PA with host cells have often used cytotoxicity assays to infer internalization mechanisms, or have used radiolabeled or chemically labeled PA that may behave differently due to modification. In the present studies, we directly assessed PA binding, proteolytic processing, and internalization by target cells using a highly sensitive and specific rabbit antiserum to PA. We found that following binding and processing by cell surface furin, the cleaved PA immediately forms the PA63 oligomer and that this oligomer is the only species of PA that is internalized. In addition, following internalization, the oligomer is quickly transformed into an SDS/heat-resistant form, a process coincident with insertion and channel formation in endosomal membranes. In related studies we extended the understanding of toxin internalization obtained in the recent breakthrough that identified TEM8 variant 2 as a PA receptor (3Bradley K.A. Mogridge J. Mourez M. Collier R.J. Young J.A. Nature. 2001; 414: 225-229Crossref PubMed Scopus (763) Google Scholar). Currently, there are three reported cDNAs that result from splicing variations in TEM8 (GenBankTM accession number NM_032208, NM_053034, and NM_18153). The physiological functions of these have not been studied. Beyond the fact that TEM8 variant 2 functions as a PA receptor, the only information available is that implicit in the initial identification that TEM8 expression is up-regulated in tumor endothelium (19St Croix B. Rago C. Velculescu V. Traverso G. Romans K.E. Montgomery E. Lal A. Riggins G.J. Lengauer C. Vogelstein B. Kinzler K.W. Science. 2000; 289: 1197-1202Crossref PubMed Scopus (1668) Google Scholar, 20Carson-Walter E.B. Watkins D.N. Nanda A. Vogelstein B. Kinzler K.W. St Croix B. Cancer Res. 2001; 61: 6649-6655PubMed Google Scholar). Thus, it remains unknown whether other TEM8 variants can also function as PA receptors, and whether TEM8 has functions beyond binding PA in anthrax toxin action. To answer these questions, in the present work, we constructed a series of TEM8 truncated mutants, transfected them into a PA receptor-deficient Chinese hamster ovary (CHO) cell mutant, and found that all constructs having a membrane anchor functioned as PA receptors. Protein toxins produced as described previously included PA (21Leppla S.H. Methods Enzymol. 1988; 165: 103-116Crossref PubMed Scopus (128) Google Scholar), PA-Δ FF (PA with 313FF314deleted) (22Singh Y. Klimpel K.R. Arora N. Sharma M. Leppla S.H. J. Biol. Chem. 1994; 269: 29039-29046Abstract Full Text PDF PubMed Google Scholar), diphtheria toxin (23Carroll S.F. Barbieri J.T. Collier R.J. Methods Enzymol. 1988; 165: 68-76Crossref PubMed Scopus (45) Google Scholar), PA-U7 (a non-cleavable variant of PA with the furin site RKKR replaced by PAA) (24Liu S. Bugge T.H. Leppla S.H. J. Biol. Chem. 2001; 276: 17976-17984Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar), and FP59, a recombinant fusion toxin consisting of anthrax toxin LF amino acids 1–254 (LFn) fused to the ADP-ribosylation domain ofPseudomonas exotoxin A (25Arora N. Leppla S.H. Infect. Immun. 1994; 62: 4955-4961Crossref PubMed Google Scholar). Rabbit anti-PA polyclonal antiserum (number 5308) and LF polyclonal antiserum (number 5309) were made in our laboratory by immunization with recombinant PA and LF. Polyclonal antibody against the amino-terminal sequence of MAPKK1 (MEK1-NT) was purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Goat anti-rabbit IgG-HRP (sc2054) and goat anti-mouse IgG-HRP (sc2005) were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Bafilomycin A1, saponin, and phosphatidylinositol-specific phospholipase C (PI-PLC) were purchased from Sigma. CHO cell clone 6 (CHO CL6) is a line recloned in this laboratory from CHO 10001, a subclone of CHO-S (26Gottesman M.M. Methods Enzymol. 1987; 151: 3-8Crossref PubMed Google Scholar), which was obtained from Dr. Michael Gottesman (National Institutes of Health, Bethesda). CHO FD11, a furin-deficient derivative of CHO CL6, was developed in our laboratory by chemical mutagenesis (27Gordon V.M. Klimpel K.R. Arora N. Henderson M.A. Leppla S.H. Infect. Immun. 1995; 63: 82-87Crossref PubMed Google Scholar). CHO PR230 is a spontaneous PA receptor-deficient mutant derived from CHO WTP4, which is derived from the thioguanine- and ouabain-resistant cell WTB111 (28Robbins A.R. Oliver C. Bateman J.L. Krag S.S. Galloway C.J. Mellman I. J. Cell Biol. 1984; 99: 1296-1308Crossref PubMed Scopus (65) Google Scholar), which was derived from CHO-K1. All CHO cells were grown in α-minimal essential medium supplemented with 5% fetal calf serum, 2 mm glutamine, 50 μg/ml gentamycin, and 25 mm HEPES. PA binding was assessed at both 37 and 4 °C. Cells were grown in 24-well plates to confluence. Cells were incubated with 1 μg/ml PA for different lengths of time and then washed five times with Hanks' balanced salt solution (HBSS) (Biofluids, Rockville, MD). The cells were lysed in 100 μl of modified RIPA lysis buffer (50 mm Tris-HCl, pH 7.4, 1% Nonidet P-40, 0.25% sodium deoxycholate, 150 mm NaCl, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 1 μg/ml each of aprotinin, leupeptin, and pepstatin). In measurements of PA internalization, the cells were first treated with 0.5 ml of 0.5 mg/ml trypsin in HBSS per well at 37 °C for 5 min to remove proteolytically the cell surface-bound PA, then washed, and lysed. The cell lysates were subjected to SDS-PAGE or native-PAGE using 4–20% Tris-glycine gradient gels (NOVEX, San Diego). Prior to loading, the cell lysates were boiled for 10 min in 1× SDS sample buffer (50 mm Tris-HCl, pH 6.8, 2% SDS, 100 mmdithiothreitol, 0.01% bromphenol blue, 6% glycerol) for SDS-PAGE or were incubated for 10 min at room temperature in 1× native buffer (NOVEX) for native-PAGE. The proteins were then transferred to nitrocellulose membranes, followed by Western blotting as described (29Liu S. Netzel-Arnett S. Birkedal-Hansen H. Leppla S.H. Cancer Res. 2000; 60: 6061-6067PubMed Google Scholar). PA was visualized by chemiluminescence using the West Pico Kit (Pierce). For the two-dimensional analysis, cell lysate was first separated on native-PAGE, and the gel strip was then sequentially equilibrated for 15 min each in Buffer I (125 mm Tris-HCl, pH 6.8, 1% SDS, 8.7% glycerol, 5 mm dithiothreitol) and Buffer II (125 mm Tris-HCl, pH 6.8, 1% SDS, 8.7% glycerol, 2% iodoacetamide) and subjected to SDS-PAGE, followed by Western blotting as described above. In measurements of LF translocation, CHO CL6 cells grown in 24-well plates were incubated with 1 μg/ml LF along with 1 μg/ml PA or PA-Δ FF for 1 h at 37 °C, washed once with HBSS, and treated with 0.5 ml 0.5 mg/ml trypsin in HBSS per well at 37 °C for 5 min to remove proteolytically the cell surface-bound toxin. The cells were then washed and permeabilized by saponin to allow efflux of cytosol as described (30Moskaug J.O. Sandvig K. Olsnes S. J. Biol. Chem. 1988; 263: 2518-2525Abstract Full Text PDF PubMed Google Scholar). Briefly, the cells were resuspended and incubated in 100 μl of phosphate-buffered saline containing 50 μg/ml saponin, 1 mm EDTA, 1 mm phenylmethylsulfonyl fluoride, 1 μg/ml each of aprotinin, leupeptin, and pepstatin for 30 min at 4 °C. The soluble fraction was separated from the particulate fraction by centrifugation at 15,000 × g for 5 min at 4 °C. The pellet was washed in HBSS and solubilized in RIPA lysis buffer. The samples from the soluble and pellet fractions were analyzed by native-PAGE followed by Western blotting using LF antiserum (number 5309). In measurements of MAPKK1 cleavage by LF, CHO CL6 cells grown in 24-well plate were incubated with 1 μg/ml LF along with 1 μg/ml PA or PA-Δ FF for 1 h at 37 °C, washed, lysed, and analyzed by SDS-PAGE followed by Western blotting using an antibody against the amino-terminal sequence of MAPKK1 (MEK1-NT). To assess the effect of vacuolar pH elevation on de novo formation of SDS/heat-resistant PA63 oligomer, CHO CL6 cells were incubated at 4 °C with 1 μg/ml PA for 3 h and then washed five times with ice-cold HBSS. The cells were then incubated in fresh medium in the presence or absence of 0.2 μm bafilomycin A1 at 37 °C. Incubations at 37 °C varied from 5 to 180 min. To assess the effect of vacuolar pH elevation on the preformed SDS/heat-resistant PA63 oligomer, cells were incubated with 1 μg/ml PA at 37 °C for 1 h and washed five times. One set of cells was then further incubated in fresh medium containing 0.2 μm bafilomycin A1 and the other in medium without the drug. The incubations at 37 °C varied from 10 to 180 min. The cells were lysed, and the lysates were processed by SDS-PAGE and Western blotting as described above. Human TEM8 variant cDNA fragments were isolated by reverse transcriptase-PCR from human fetal brain mRNA (catalog number 11438-017) purchased from Invitrogen. First-strand cDNA was synthesized by using the SuperScript First-strand Synthesis System (catalog number 11904-018) purchased from Invitrogen. We used 5′ primer PR5 (AAGTGTACA ATGGCCACGGCGGAGCGGAGAGCCCTCGGCATCGGCT, the start codon ATG is underlined and the BsrGI site for cloning is in boldface) in combination with various 3′ primers to amplify different carboxyl-terminal truncated TEM8 variants, as diagramed in Fig. 5 A). Thus, primer 115 aa (CCCACAAGGCATCGAGTTTTCCCTT, stop codon provided by the expression vector) was used to obtain the TEM8 variant TEM8-115 aa, having a 115-residue cytosolic tail. Similarly, primer 26 aa (CGGGATCC TA AGCGTAATCTGGAACATCGTATGGGTAACCATCATCATCTTCTTCCTCACTCTCCTCGGCA, the antisense of stop codon is underlined, the BamHI site is in boldface, and the sequence encoding for an influenza virus hemagglutinin (HA) tag is in italic) was used to obtain TEM8–26 aa. Primer 16 aa (CGGGATCC TA AGCGTAATCTGGAACATCGTATGGGTAGGCAGGGGGTGGAGGGACCTCCTTGATAAT, underlining, etc., as above) was used to obtain TEM8–16 aa. Primer 0 aa (CGGGATCC TACCAGAACCACCAGAGGAGAGCCAGGGCTA, underlining, etc., as above, and having no HA tag) was used to obtain TEM8–0 aa. Primer ED (CGGGATC CTAACCGTCAGAACAGTGTGTGGTGGTGATGATGACA, underlining, etc., as above) was used to obtain TEM8-ed, the variant having only the extracellular domain, residues 1–320. Finally, primer v3 (CTATTCCATGCAAGCAGCTGTTGTGGGGCCTGATGCAATTTTGTGGAGGCTACAGTGTGTGGTGGTGATGATGACAGAACTGGA, the antisense of stop codon is underlined) was used to obtain TEM8 variant 3. We found it is difficult to amplify full-length cDNA for TEM8 variant 1 due to its exceptionally high GC content, and instead we synthesized the 3′ cDNA region of variant 1 chemically and ligated it into TEM8-115 aa, resulting in full-length TEM8 variant 1. The TEM8 variant cDNA fragments were digested by BsrGI alone orBsrGI and BamHI and then cloned between theBsrGI and EcoRV or BsrGI andBamHI sites of pIRESHgy2B (catalog number 6939-1, Clontech Laboratories, Inc., Palo Alto, CA). This bicistronic mammalian expression vector contains an attenuated version of the internal ribosome entry site of the encephalomyocarditis virus, which allows both the gene of interest and the hygromycin B selection marker to be translated from a single mRNA. We also constructed a glycosylphosphatidylinositol (GPI)-anchored TEM8 by fusion of the TEM8 extracellular region to the GPI anchoring sequence of urokinase plasminogen activator receptor (uPAR) (31Ploug M. Ronne E. Behrendt N. Jensen A.L. Blasi F. Dano K. J. Biol. Chem. 1991; 266: 1926-1933Abstract Full Text PDF PubMed Google Scholar). To do so, the GPI sequence of human uPAR was amplified by using primers U5 (TATCGTACGTTGTAACCACCCAGACCTGGATGTCCAGT, theBsiWI cloning site is in boldface) and U3 (AATTCCAGCACACTGG TTAGGTCCAGAGGAGAGTGCCT, the antisense of the stop codon is underlined, and the BstXI site is in boldface), with a template of uPAR plasmid phuPAR (kind gift from Dr. Thomas H. Bugge, National Institutes of Health, Bethesda). The PCR product was digested by BsiWI and BstXI and cloned between the BsiWI and BstXI sites of the plasmid encoding TEM8-ed, resulting in an expression plasmid encoding the TEM8 extracellular part (residues 1–317) and the GPI anchoring sequence of uPAR (residues 293–335) linked by short tripeptide IVR. All the expression plasmids were confirmed by DNA sequencing and were transfected into CHO PR230 cells using LipofectAMINE Plus Reagent (Invitrogen), and stably transfected cells were selected by growth in hygromycin B (500 μg/ml) for 2 weeks. Hygromycin-resistant colonies were either isolated individually or pooled for further analysis. Cells were grown in 96-well plates to ∼50% confluence. Serial dilutions of PA (0–1000 ng/ml) combined with FP59 (100 ng/ml) were added to the cells to give a total volume of 200 μl/well and were incubated for 48 h. Cell viability was then assayed by adding 50 μl of 2.5 mg/ml 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) in α-minimal essential medium. The cells were incubated with MTT for 45 min at 37 °C; the medium was removed, and the blue pigment produced by viable cells was solubilized with 100 μl/well of 0.5% (w/v) SDS, 25 mm HCl, in 90% (v/v) isopropyl alcohol. The plates were vortexed, and the oxidized MTT was measured asA 570 using a microplate reader. Total RNA was isolated from exponentially growing CHO cells by using TRIzol Reagent (Invitrogen), separated on 1.0% agarose, 6.66% formaldehyde gels and then transferred onto nylon membranes (Immobilon-N, Millipore). Membranes were hybridized with a 32P-labeled 1.0-kb CHO TEM8 cDNA fragment isolated by reverse transcriptase-PCR by using 5′ primer TTCTGCCAGGAGGAGACACTTACATGC, and 3′ primer CCCACAAGGCATCGAGTTTTCCCTT. DNA sequencing analysis showed that this fragment was 90 and 89% identical to the corresponding mouse and human TEM8 sequences, respectively. Hybridization was performed in QuikHyb hybridization solution (catalog number 201220, Stratagene, La Jolla, CA) containing denatured salmon sperm DNA (0.5 mg/ml) at 60 °C overnight. Membranes were then washed in 2× SSC (catalog number 750020, Research Genetics, Huntsville, AL), 0.1% SDS at room temperature for 5 min, and then twice with 0.1× SSC, 0.1% SDS at 60 °C for 25 min. We used a high titered polyclonal anti-PA serum (number 5308) to assess PA binding and its subsequent processing and internalization by CHO cells. Analysis of unmodified PA eliminated concerns that radiolabeled or chemically labeled PA might behave differently from native PA due to the modification. The results showed that PA bound to CHO CL6 cells and was rapidly cleaved to PA63. More than half the PA bound was cleaved to PA63 within 5 min (Fig. 1 A, CL6 lanes). Because furin is the major cell surface protease that cleaves PA (4Klimpel K.R. Molloy S.S. Thomas G. Leppla S.H. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 10277-10281Crossref PubMed Scopus (409) Google Scholar,5Molloy S.S. Bresnahan P.A. Leppla S.H. Klimpel K.R. Thomas G. J. Biol. Chem. 1992; 267: 16396-16402Abstract Full Text PDF PubMed Google Scholar), we compared processing of PA by CHO FD11, a derivative of CHO CL6 cells that lacks furin (27Gordon V.M. Klimpel K.R. Arora N. Henderson M.A. Leppla S.H. Infect. Immun. 1995; 63: 82-87Crossref PubMed Google Scholar). The FD11 cells bound PA efficiently, but cleavage to PA63 was very slow (Fig. 1 A, FD11 lanes). In addition to intact PA and PA63, another PA species revealed on SDS-PAGE was an SDS/heat-resistant PA63 oligomer that migrated very slowly (Fig. 1 A). Because the formation of the PA63 oligomer requires proteolysis, the PA63 oligomer was hardly detected in cell lysates from FD11 (Fig. 1 A). The cell lysates were further analyzed by native-PAGE. The FD11 cell lysates contained mainly the intact PA (Fig. 1 B, FD11 lanes), as expected, whereas the lysates from CHO CL6 cells contained intact PA as well as two higher order PA63 oligomers, but no monomeric PA63 (Fig. 1 B, CL6 lanes). When the binding assay was performed by using trypsin-nicked PA in which the furin site was pre-cleaved by limited trypsin digestion (22Singh Y. Klimpel K.R. Arora N. Sharma M. Leppla S.H. J. Biol. Chem. 1994; 269: 29039-29046Abstract Full Text PDF PubMed Google Scholar), as expected the major PA species detected were the oligomers, and just a negligible amount of monomer PA was shown (Fig. 1 C). The nature of these two distinct PA63 oligomers is unclear. The faster migrating species, termed oligomer A in this study (Fig. 1,B and C), is probably free PA63 heptamer, whereas the more slowly migrating species, termed oligomer B (Fig. 1,B and C), may be a complex of the PA63 heptamer with cellular components such as the PA receptor or detergent-resistant membrane structures. When these oligomeric species (in Fig. 1 C, lane 1h) were subjected to second dimension SDS-PAGE, interestingly, oligomer A dissociated to PA63 monomer, whereas oligomer B turned out to be the mixture of both SDS-sensitive and -resistant oligomers (Fig. 1 D). Together these results showed not only that bound PA is rapidly cleaved by furin but also that the resulting PA63 monomer very rapidly oligomerizes. Thus, the cell surface-associated PA63 mimics the behavior of PA63 produced in vitro, which forms the heptamer in neutral aqueous solutions (21Leppla S.H. Methods Enzymol. 1988; 165: 103-116Crossref PubMed Scopus (128) Google Scholar). These heptamers have been visualized previously by electron microscopy (6Milne J.C. Furlong D. Hanna P.C. Wall J.S. Collier R.J. J. Biol. Chem. 1994; 269: 20607-20612Abstract Full Text PDF PubMed Google Scholar), x-ray diffraction (7Petosa C. Collier R.J. Klimpel K.R. Leppla S.H. Liddington R.C. Nature. 1997; 385: 833-838Crossref PubMed Scopus (687) Google Scholar), and electrophoresis (22Singh Y. Klimpel K.R. Arora N. Sharma M. Leppla S.H. J. Biol. Chem. 1994; 269: 29039-29046Abstract Full Text PDF PubMed Google Scholar, 32Singh Y. Klimpel K.R. Goel S. Swain P.K. Leppla S.H. Infect. Immun. 1999; 67: 1853-1859Crossref PubMed Google Scholar). Absence of PA63 monomer further indicated that oligomerization of PA63 is effectively irreversible. PA63 detected by SDS-PAGE (Fig. 1 A) evidently resulted from the resolution of PA63 oligomer by boiling in SDS loading buffer. The data above indicated that cells exposed to PA contain intact PA and PA63 oligomers on their surface (Fig. 1 B). To explore whether these PA species are equally internalized, we performed a PA trypsin protection assay. After incubation with PA at 4 or 37 °C, cells were treated with trypsin to remove the cell surface-bound PA, allowing identification of those materials internalized by endocytosis. Remarkably, PA63 oligomer constituted the major protected PA species at 37 °C (Fig. 1, A and B, CL6 lanes), indicating that the PA63 oligomer was the only form of PA to be internalized. Also present were small amounts of a PA fragment, probably the carboxyl-terminal 47-kDa receptor-binding portion remaining bound to receptor after incomplete cleavage by trypsin (33Novak J.M. Stein M.P. Little S.F. Leppla S.H. Friedlander A.M. J. Biol. Chem. 1992; 267: 17186-17193Abstract Full Text PDF PubMed Google Scholar). Endocytosis is temperature-dependent (10Wesche J. Elliott J.L. Falnes P.O. Olsnes S. Collier R.J. Biochemistry. 1998; 37: 15737-15746Crossref PubMed Scopus (175) Google Scholar), and therefore all surface-bound PA should be removed by trypsin from cells incubated at 4 °C. Thus, in a control for the previous experiment, we showed that trypsin removed all the cell-associated PA (Fig. 1 E), with the exception of the 47-kDa fragment mentioned above. Further evidence that intact, monomeric PA is not internalized into cells was obtained using PA-U7, an uncleavable variant of PA that can bind but cannot be proteolytically activated by cellular furin (24Liu S. Bugge T.H. Leppla S.H. J. Biol. Chem. 2001; 276: 17976-17984Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar). This PA mutant was not internalized to a trypsin-resistant site even when incubated with cells at 37 °C for 4 h (Fig. 1 F). These results demonstrated that the proteolytic cleavage of receptor-bound PA is an absolute prerequisite not only for the biochemical property of self-assembly but also for its subsequent biological activity of undergoing endocytosis. Previous studies showed that in solution, purified PA63 can form two types of oligomers, an SDS-sensitive type, which forms at neutral pH and can be resolved into PA63 monomer by SDS, and the SDS-resistant type, which forms at acidic pH and persists in the presence of SDS (34Miller C.J. Elliott J.L. Collier R.J. Biochemistry. 1999; 38: 10432-10441Crossref PubMed Scopus (227) Google Scholar). This suggested that the SDS/heat-resistant oligomer shown above (Fig. 1 A) may be the counterpart of this SDS-resistant oligomer formed in acidic solution, and therefore may be produced following endocytosis and delivery to acidic compartments. In fact, when CHO CL6 cells were incubated with PA, the SDS/heat-resistant oligomer was formed at 37 °C (Fig. 1 A, CL6 lanes) but not at 4 °C, a temperature at which endocytosis does not occur (Fig. 1 E, 1h lane). Moreover, native-PAGE analysis revealed that the PA63 oligomer A formed at both 4 and 37 °C (Fig. 2 A). Based on these observations we hypothesized that the PA63 oligomer formed on the cell surface encounters a progressively more acidic environment along the endocytic pathway and undergoes conformational changes and membrane insertion at acidic pH that renders it resistant to SDS/heat. To verify this hypothesis, we incubated CHO CL6 cells with PA at 4 °C, washed, and then shifted to 37 °C for various lengths of time in the absence or presence of bafilomycin A1, a potent and specific inhibitor of the vacuolar (H+)-ATPase proton pumps that maintain the pH gradients of acidic compartments (35Beauregard K.E. Lee K.D. Collier R.J. Swanson J.A. J. Exp. Med. 1997; 186:

Diphthamide, a posttranslational modification of translation elongation factor 2 that is conserved in all eukaryotes and archaebacteria and is the target of diphtheria toxin, is formed in yeast by the actions of five proteins, Dph1 to -5, and a still unidentified amidating enzyme.Dph2 and Dph5 were previously identified.Here, we report the identification of the remaining three yeast proteins ( Dph1, -3, and-4) and show that all five Dph proteins have either functional ( Dph1, -2, -3, and-5) or sequence (Dph4) homologs in mammals.We propose a unified nomenclature for these proteins (e.g., HsDph1 to -5 for the human proteins) and their genes based on the yeast nomenclature.We show that Dph1 and Dph2 are homologous in sequence but functionally independent.The human tumor suppressor gene OVCA1, previously identified as homologous to yeast DPH2, is shown to actually be HsDPH1.We show that HsDPH3 is the previously described human diphtheria toxin and Pseudomonas exotoxin A sensitivity required gene 1 and that DPH4 encodes a CSL zinc finger-containing DnaJ-like protein.Other features of these genes are also discussed.The physiological function of diphthamide and the basis of its ubiquity remain a mystery, but evidence is presented that Dph1 to -3 function in vivo as a protein complex in multiple cellular processes.

The ability of genetic vaccination to protect against a lethal challenge of anthrax toxin was evaluated. BALB/c mice were immunized via gene gun inoculation with eucaryotic expression vector plasmids encoding either a fragment of the protective antigen (PA) or a fragment of lethal factor (LF). Plasmid pCLF4 contains the N-terminal region (amino acids [aa] 10 to 254) of Bacillus anthracis LF cloned into the pCI expression plasmid. Plasmid pCPA contains a biologically active portion (aa 175 to 764) of B. anthracis PA cloned into the pCI expression vector. One-micrometer-diameter gold particles were coated with plasmid pCLF4 or pCPA or a 1:1 mixture of both and injected into mice via gene gun (1 microg of plasmid DNA/injection) three times at 2-week intervals. Sera were collected and analyzed for antibody titer as well as antibody isotype. Significantly, titers of antibody to both PA and LF from mice immunized with the combination of pCPA and pCLF4 were four to five times greater than titers from mice immunized with either gene alone. Two weeks following the third and final plasmid DNA boost, all mice were challenged with 5 50% lethal doses of lethal toxin (PA plus LF) injected intravenously into the tail vein. All mice immunized with pCLF4, pCPA, or the combination of both survived the challenge, whereas all unimmunized mice did not survive. These results demonstrate that DNA-based immunization alone can provide protection against a lethal toxin challenge and that DNA immunization against the LF antigen alone provides complete protection.

A panel of variants with alanine substitutions in the small loop of anthrax toxin protective antigen domain 4 was created to determine individual amino acid residues critical for interactions with the cellular receptor and with a neutralizing monoclonal antibody, 14B7. Substituted protective antigen proteins were analyzed by cellular cytotoxicity assays, and their interactions with antibody were measured by plasmon surface resonance and analytical ultracentrifugation. Residue Asp⁶⁸³ was the most critical for cell binding and toxicity, causing an ∼1000-fold reduction in toxicity, but was not a large factor for interactions with 14B7. Substitutions in residues Tyr⁶⁸¹, Asn⁶⁸², and Pro⁶⁸⁶ also reduced toxicity significantly, by 10–100-fold. Of these, only Asn⁶⁸² and Pro⁶⁸⁶ were also critical for interactions with 14B7. However, residues Lys⁶⁸⁴, Leu⁶⁸⁵, Leu⁶⁸⁷, and Tyr⁶⁸⁸ were critical for 14B7 binding without greatly affecting toxicity. The K684A and L685A variants exhibited wild type levels of toxicity in cell culture assays; the L687A and Y688A variants were reduced only 1.5- and 5-fold, respectively.

The alpha toxin produced by <i>Clostridium septicum</i> is a channel-forming protein that is an important contributor to the virulence of the organism. Chinese hamster ovary (CHO) cells are sensitive to low concentrations of the toxin, indicating that they contain toxin receptors. Using retroviral mutagenesis, a mutant CHO line (BAG15) was generated that is resistant to alpha toxin. FACS analysis showed that the mutant cells have lost the ability to bind the toxin, indicating that they lack an alpha toxin receptor. The mutant cells are also resistant to aerolysin, a channel-forming protein secreted by <i>Aeromonas</i> spp., which is structurally and functionally related to alpha toxin and which is known to bind to glycosylphosphatidylinositol (GPI)-anchored proteins, such as Thy-1. We obtained evidence that the BAG15 cells lack <i>N</i>-acetylglucosaminyl-phosphatidylinositol deacetylase-L, needed for the second step in GPI anchor biosynthesis. Several lymphocyte cell lines lacking GPI-anchored proteins were also shown to be less sensitive to alpha toxin. On the other hand, the sensitivity of CHO cells to alpha toxin was increased when the cells were transfected with the GPI-anchored folate receptor. We conclude that alpha toxin, like aerolysin, binds to GPI-anchored protein receptors. Evidence is also presented that the two toxins bind to different subsets of GPI-anchored proteins.

Both the protective antigen (PA) and the poly(gamma-d-glutamic acid) capsule (gamma dPGA) are essential for the virulence of Bacillus anthracis. A critical level of vaccine-induced IgG anti-PA confers immunity to anthrax, but there is no information about the protective action of IgG anti-gamma dPGA. Because the number of spores presented by bioterrorists might be greater than encountered in nature, we sought to induce capsular antibodies to expand the immunity conferred by available anthrax vaccines. The nonimmunogenic gamma dPGA or corresponding synthetic peptides were bound to BSA, recombinant B. anthracis PA (rPA), or recombinant Pseudomonas aeruginosa exotoxin A (rEPA). To identify the optimal construct, conjugates of B. anthracis gamma dPGA, Bacillus pumilus gamma dLPGA, and peptides of varying lengths (5-, 10-, or 20-mers), of the d or l configuration with active groups at the N or C termini, were bound at 5-32 mol per protein. The conjugates were characterized by physico-chemical and immunological assays, including GLC-MS and matrix-assisted laser desorption ionization time-of-flight spectrometry, and immunogenicity in 5- to 6-week-old mice. IgG anti-gamma dPGA and antiprotein were measured by ELISA. The highest levels of IgG anti-gamma dPGA were elicited by decamers of gamma dPGA at 10 -20 mol per protein bound to the N- or C-terminal end. High IgG anti-gamma dPGA levels were elicited by two injections of 2.5 microg of gamma dPGA per mouse, whereas three injections were needed to achieve high levels of protein antibodies. rPA was the most effective carrier. Anti-gamma dPGA induced opsonophagocytic killing of B. anthracis tox-, cap+. gamma dPGA conjugates may enhance the protection conferred by PA alone. gamma dPGA-rPA conjugates induced both anti-PA and anti-gamma dPGA.

Mucosal, but not parenteral, immunization induces immune responses in both systemic and secretory immune compartments. Thus, despite the reports that Abs to the protective Ag of anthrax (PA) have both anti-toxin and anti-spore activities, a vaccine administered parenterally, such as the aluminum-adsorbed anthrax vaccine, will most likely not induce the needed mucosal immunity to efficiently protect the initial site of infection with inhaled anthrax spores. We therefore took a nasal anthrax vaccine approach to attempt to induce protective immunity both at mucosal surfaces and in the peripheral immune compartment. Mice nasally immunized with recombinant PA (rPA) and cholera toxin (CT) as mucosal adjuvant developed high plasma PA-specific IgG Ab responses. Plasma IgA Abs as well as secretory IgA anti-PA Abs in saliva, nasal washes, and fecal extracts were also induced when a higher dose of rPA was used. The anti-PA IgG subclass responses to nasal rPA plus CT consisted of IgG1 and IgG2b Abs. A more balanced profile of IgG subclasses with IgG1, IgG2a, and IgG2b Abs was seen when rPA was given with a CpG oligodeoxynucleotide as adjuvant, suggesting a role for the adjuvants in the nasal rPA-induced immunity. The PA-specific CD4(+) T cells from mice nasally immunized with rPA and CT as adjuvant secreted low levels of CD4(+) Th1-type cytokines in vitro, but exhibited elevated IL-4, IL-5, IL-6, and IL-10 responses. The functional significance of the anti-PA Ab responses was established in an in vitro macrophage toxicity assay in which both plasma and mucosal secretions neutralized the lethal effects of Bacillus anthracis toxin.

Toxins produced by Bacillus anthracis and other microbial pathogens require functions of host cell genes to yield toxic effects. Here we show that low density lipoprotein receptor-related protein 6 (LRP6), previously known to be a coreceptor for the Wnt signaling pathway, is required for anthrax toxin lethality in mammalian cells. Downregulation of LRP6 or coexpression of a truncated LRP6 dominant-negative peptide inhibited cellular uptake of complexes containing the protective antigen (PA) carrier of anthrax toxin moieties and protected targeted cells from death, as did antibodies against epitopes in the LRP6 extracellular domain. Fluorescence microscopy and biochemical analyses showed that LRP6 enables toxin internalization by interacting at the cell surface with PA receptors TEM8/ATR and/or CMG2 to form a multicomponent complex that enters cells upon PA binding. Our results, which reveal a previously unsuspected biological role for LRP6, identify LRP6 as a potential target for countermeasures against anthrax toxin lethality.

The lethal factor (LF) and edema factor (EF) components of anthrax toxin are toxic to animal cells only if internalized by interaction with the protective antigen (PA) component. PA binds to a cell surface receptor and is proteolytically cleaved to expose a binding site for LF and EF. To study how LF and EF are internalized and trafficked within cells, LF was fused to the translocation and ADP-ribosylation domains (domains II and III, respectively) of Pseudomonas exotoxin A. LF fusion proteins containing Pseudomonas exotoxin A domains II and III were less toxic than those containing only domain III. Fusion proteins with a functional endoplasmic reticulum retention sequence, REDLK, at the carboxyl terminus of domain III were less toxic than those with a nonfunctional sequence, LDER. The most potent fusion protein, FP33, had an EC50 = 2 pM on Chinese hamster ovary cells, exceeding that of native Pseudomonas exotoxin A (EC50 = 420 pM). Toxicity of all the fusion proteins required the presence of PA and was blocked by monensin. These data suggest that LF and LF fusion proteins are efficiently translocated from acidified endosomes directly to the cytosol without trafficking through other organelles, as is required for Pseudomonas exotoxin A. This system provides a potential vehicle for importing diverse proteins into the cytosol of mammalian cells.

Bacillus anthracis lethal factor (LF) is a 90-kDa zinc metalloprotease that plays an important role in the virulence of the organism. LF has previously been purified from Escherichia coli and Bacillus anthracis. The yields and purities of these preparations were inadequate for crystal structure determination. In this study, the genes encoding wild-type LF and a mutated, inactive LF (LF-E687C) were placed in an E. coli-Bacillus shuttle vector so that LF was produced with the protective antigen (PA) signal peptide at its N-terminus. The resulting vectors, pSJ115 and pSJ121, express wild-type and mutated LF fusion proteins, respectively. Expression of the LF genes is under the control of the PA promoter and, during secretion, the PA signal peptide is cleaved to release the 90-kDa LF proteins. The wild-type and mutated LF proteins were purified from the culture medium using three chromatographic steps (Phenyl-Sepharose, Q-Sepharose, and hydroxyapatite). The purified proteins were greater than 95% pure and yields (20-30 mg/L) were higher than those obtained in other expression systems (1-5 mg/L). These proteins have been crystallized and are being used to solve the crystal structure of LF. Their potential use in anthrax vaccines is also discussed.

Several strategies that target anthrax toxin are being developed as therapies for infection by Bacillus anthracis. Although the action of the tripartite anthrax toxin has been extensively studied in vitro, relatively little is known about the presence of toxins during an infection in vivo. We developed a series of sensitive sandwich enzyme-linked immunosorbent assays (ELISAs) for detection of both the protective antigen (PA) and lethal factor (LF) components of the anthrax exotoxin in serum. The assays utilize as capture agents an engineered high-affinity antibody to PA, a soluble form of the extracellular domain of the anthrax toxin receptor (ANTXR2/CMG2), or PA itself. Sandwich immunoassays were used to detect and quantify PA and LF in animals infected with the Ames or Vollum strains of anthrax spores. PA and LF were detected before and after signs of toxemia were observed, with increasing levels reported in the late stages of the infection. These results represent the detection of free PA and LF by ELISA in the systemic circulation of two animal models exposed to either of the two fully virulent strains of anthrax. Simple anthrax toxin detection ELISAs could prove useful in the evaluation of potential therapies and possibly as a clinical diagnostic to complement other strategies for the rapid identification of B. anthracis infection.

Although circulatory shock related to lethal toxin (LeTx) may play a primary role in lethality due to Bacillus anthracis infection, its mechanisms are unclear. We investigated whether LeTx-induced shock is associated with inflammatory cytokine and nitric oxide (NO) release. Sprague-Dawley rats with central venous and arterial catheters received 24-h infusions of LeTx (lethal factor 100 microg/kg; protective antigen 200 microg/kg) that produced death beginning at 9 h and a 7-day mortality rate of 53%. By 9 h, mean arterial blood pressure, heart rate, pH, and base excess were decreased and lactate and hemoglobin levels were increased in LeTx nonsurvivors compared with LeTx survivors and controls (diluent only) (P < or = 0.05 for each comparing the 3 groups). Despite these changes, arterial oxygen and circulating leukocytes and platelets were not decreased and TNF-alpha, IL-beta, IL-6, and IL-10 levels were not increased comparing either LeTx nonsurvivors or survivors to controls. Nitrate/nitrite levels and tissue histology also did not differ comparing LeTx animals and controls. In additional experiments, although 24-h infusions of LeTx and Escherichia coli LPS produced similar mortality rates (54 and 56%, respectively) and times to death (13.2 +/- 0.8 vs. 11.0 +/- 1.7 h, respectively) compared with controls, only LPS reduced circulating leukocytes, platelets, and IL-2 levels and increased TNF-alpha, IL-1 alpha and -1 beta, IL-6, IL-10, interferon-gamma, granulocyte macrophage-colony stimulating factor, RANTES, migratory inhibitory protein-1 alpha, -2, and -3, and monocyte chemotactic protein-1, as well as nitrate/nitrite levels (all P < or = 0.05 for the effects of LPS). Thus, in contrast to LPS, excessive inflammatory cytokine and NO release does not appear to contribute to the circulatory shock and lethality occurring with LeTx in this at model. Although therapies to modulate these host mediators may be applicable fo shock caused by LPS or other bacterial toxins, they may not with LeTx.

Lethal toxin from Bacillus anthracisis composed of protective antigen (PA) and lethal factor (LF). Anti-PA mAbs that neutralized lethal toxin activity, either in vivo or in vitro , identified three non-overlapping antigenic regions on PA. Two distinct antigenic regions were recognized by the four mAbs that neutralized lethal toxin activity by inhibiting the binding of 125 I-LF to cell-bound PA. Mapping showed that one mAb, 1G3 PA63 , recognized an epitope on a 17 IcDa fragment located between amino acid residues Ser-168 and Phe-314. The three other mAbs, 2D3 PA , 2D5 PA and 10D2 PA , recognized an epitope between amino acids Ile-581 and Asn-601. A single antigenic region was recognized by the three mAbs, 3B6 PA , 14B7 PA and 10E10 PA63 , that inhibited binding of 125 I-PA to cells. This region was located between amino acids Asp-671 and lle-721. These results confirm previously defined functional domains of PA and suggest that LF may interact with two different sites on PA to form lethal toxin.

Bacillus anthracis secretes three polypeptides: protective antigen (PA), lethal factor (LF), and edema factor (EF), which interact at the surface of mammalian cells to form toxic complexes. LF and EF are enzymes that target substrates within the cytosol; PA provides a heptameric pore to facilitate LF and EF transport into the cytosol. Other than administration of antibiotics shortly after exposure, there is currently no approved effective treatment for inhalational anthrax. Here we demonstrate an approach to disabling the toxin: high-affinity blockage of the PA pore by a rationally designed low-molecular weight compound that prevents LF and EF entry into cells. Guided by the sevenfold symmetry and predominantly negative charge of the PA pore, we synthesized small cyclic molecules of sevenfold symmetry, β-cyclodextrins chemically modified to add seven positive charges. By channel reconstitution and high-resolution conductance recording, we show that per-6-(3-aminopropylthio)-β-cyclodextrin interacts strongly with the PA pore lumen, blocking PA-induced transport at subnanomolar concentrations (in 0.1 M KCl). The compound protected RAW 264.7 mouse macrophages from cytotoxicity of anthrax lethal toxin (= PA + LF). More importantly, it completely protected the highly susceptible Fischer F344 rats from lethal toxin. We anticipate that this approach will serve as the basis for a structure-directed drug discovery program to find new and effective treatments for anthrax.

ABSTRACT The protective antigen (PA) protein of anthrax toxin binds to a cellular receptor and is cleaved by cell surface furin to produce a 63-kDa fragment (PA63). The receptor-bound PA63 oligomerizes to a heptamer and acts to translocate the catalytic moieties of the toxin, lethal factor (LF) and edema factor (EF), from endosomes to the cytosol. In this report, we used nondenaturing gel electrophoresis to show that each PA63 subunit in the heptamer can bind one LF molecule. Studies using PA immobilized on a plastic surface showed that monomeric PA63 is also able to bind LF. The internalization of PA and LF by cells was studied with radiolabeled and biotinylated proteins. Uptake was relatively slow, with a half-time of 30 min. The number of moles of LF internalized was nearly equal to the number of moles of PA subunit internalized. The essential role of PA oligomerization in LF translocation was shown with PA protein cleaved at residues 313-314. The oligomers formed by these proteins during uptake into cells were not as stable when subjected to heat and detergent as were those formed by native PA. The results show that the structure of the toxin proteins and the kinetics of proteolytic activation, LF binding, and internalization are balanced in a way that allows each PA63 subunit to internalize an LF molecule. This set of proteins has evolved to achieve highly efficient internalization and membrane translocation of the catalytic components, LF and EF.

The acquisition of cell-surface urokinase plasminogen activator activity is a hallmark of malignancy. We generated an engineered anthrax toxin that is activated by cell-surface urokinase in vivo and displays limited toxicity to normal tissue but broad and potent tumoricidal activity. Native anthrax toxin protective antigen, when administered with a chimeric anthrax toxin lethal factor, Pseudomonas exotoxin fusion protein, was extremely toxic to mice, causing rapid and fatal organ damage. Replacing the furin activation sequence in anthrax toxin protective antigen with an artificial peptide sequence efficiently activated by urokinase greatly attenuated toxicity to mice. In addition, the mutation conferred cell-surface urokinase-dependent toxin activation in vivo, as determined by using a panel of plasminogen, plasminogen activator, plasminogen activator receptor, and plasminogen activator inhibitor-deficient mice. Surprisingly, toxin activation critically depended on both urokinase plasminogen activator receptor and plasminogen in vivo, showing that both proteins are essential cofactors for the generation of cell-surface urokinase. The engineered toxin displayed potent tumor cell cytotoxicity to a spectrum of transplanted tumors of diverse origin and could eradicate established solid tumors. This tumoricidal activity depended strictly on tumor cell-surface plasminogen activation. The data show that a simple change of protease activation specificity converts anthrax toxin from a highly lethal to a potent tumoricidal agent.

Chloroquine was found to prevent the cytotoxic action of diphtheria toxin on cultured monkey kidney cells. Analysis of the cellular processing of 125I-labeled diphtheria toxin showed that chloroquine does not affect the rate or extent of toxin uptake but substantially blocks degradation. These studies provide strong evidence that diphtheria toxin enters monkey kidney cells primarily by adsorptive endocytosis and suggest that lysosomal processing is involved in intracellular activation of the proenzyme form of the toxin.

Adenylate cyclase (AC) toxins produced by Bacillus anthracis and Bordetella pertussis were compared for their ability to interact with and intoxicate Chinese hamster ovary cells. At 30 degrees C, anthrax AC toxin exhibited a lag of 10 min for measurable cAMP accumulation that was not seen with pertussis AC toxin. This finding is consistent with previous data showing inhibition of anthrax AC toxin but not pertussis AC toxin entry by inhibitors of receptor-mediated endocytosis (Gordon, V. M., Leppla, S. H., and Hewlett, E. L. (1988) Infect. Immun. 56, 1066-1069). Treatment of target Chinese hamster ovary cells with trypsin or cycloheximide reduced anthrax AC toxin-induced cAMP accumulation by greater than 90%, but was without effect on pertussis AC toxin. In contrast, incubation of the AC toxins with gangliosides prior to addition to target cells inhibited cAMP accumulation by pertussis AC toxin, but not anthrax AC toxin. To evaluate the role of lipids in the interaction of pertussis AC toxin with membranes, multicompartmental liposomes were loaded with a fluorescent marker and exposed to toxin. Pertussis AC toxin elicited marker release in a time- and concentration-dependent manner and required a minimal calcium concentration of 0.2 mM. These data demonstrate that the requirements for intoxication by the AC toxins from B. anthracis and B. pertussis are fundamentally different and provide a perspective for new approaches to study the entry processes.

Detection of RNAs on microarrays is rapidly becoming a standard approach for molecular biologists. However, current methods frequently discriminate against structured and/or small RNA species. Here we present an approach that bypasses these problems. Unmodified RNA is hybridized directly to DNA microarrays and detected with the high-affinity, nucleotide sequence-independent, DNA/RNA hybrid-specific mouse monoclonal antibody S9.6. Subsequent reactions with a fluorescently-labeled anti-mouse IgG antibody or biotin-labeled anti-mouse IgG together with fluorescently labeled streptavidin produces a signal that can be measured in a standard microarray scanner. The antibody-based method was able to detect low abundance small RNAs of Escherichia coli much more efficiently than the commonly-used cDNA-based method. A specific small RNA was detected in amounts of 0.25 fmol (i.e. concentration of 10 pM in a 25 microl reaction). The method is an efficient, robust and inexpensive technique that allows quantitative analysis of gene expression and does not discriminate against short or structured RNAs.

Bicarbonate is required for production of the major virulence factors, the toxins and capsule, of Bacillus anthracis. In this study we examined the basis for stimulation of production of protective antigen (PA), a central component of the two anthrax toxins encoded by plasmid pXO1. RNA prepared from B. anthracis grown in media with and without added bicarbonate was probed for PA mRNA. Data showed that bicarbonate was required for increased transcription of the PA gene (pag) in minimal medium. Transcription of pag was low in rich medium and could not be stimulated by the addition of bicarbonate. To characterize further the factors required for transcriptional regulation of pag, the promoter region of pag was fused to the chloramphenicol acetyltransferase gene (cat-86) of vector pPL703 and transformed by electroporation into pXO1+ (Tox+) and pXO1- (Tox-) strains of B. anthracis. Analysis of chloramphenicol acetyltransferase produced by the pag-cat-86 fusion in each of these backgrounds confirmed the results obtained by hybridization. Data obtained with this fusion also revealed that the large toxin plasmid, pXO1, found in virulent strains of B. anthracis, was required for stimulation of transcription of pag by bicarbonate. This result suggests the existence of a trans-acting factor that is involved in the activation of pag transcription.

ABSTRACT We developed a europium nanoparticle-based immunoassay (ENIA) for the sensitive detection of anthrax protective antigen (PA). The ENIA exhibited a linear dose-dependent pattern within the detection range of 0.01 to 100 ng/ml and was approximately 100-fold more sensitive than enzyme-linked immunosorbent assay (ELISA). False-positive results were not observed with serum samples from healthy adults, mouse plasma without PA, or plasma samples collected from mice injected with anthrax lethal factor or edema factor alone. For the detection of plasma samples spiked with PA, the detection sensitivities for ENIA and ELISA were 100% (11/11 samples) and 36.4% (4/11 samples), respectively. The assay exhibited a linear but qualitative correlation between the PA injected and the PA detected in murine blood ( r = 0.97731; P &lt; 0.0001). Anthrax PA was also detected in the circulation of mice infected with spores from a toxigenic Sterne-like strain of Bacillus anthracis , but only in the later stages of infection. These results indicate that the universal labeling technology based on europium nanoparticles and its application may provide a rapid and sensitive testing platform for clinical diagnosis and laboratory research.

We have cloned and expressed in Escherichia coli the lethal factor (LF) gene of Bacillus anthracis. At least two of the six LF recombinant plasmids produce full-length LF protein. Transcription of the LF gene in E. coli appears to be under the control of its own B. anthracis promoter. Recombinant LF protein produced in E. coli remains intracellular and is not secreted. However, this LF protein is biochemically active and displays the same lethal effects as LF secreted by B. anthracis in the mouse macrophage assay. The LF gene, like that of the protective antigen gene, is present on the large B. anthracis toxin plasmid pXO1.

Anthrax lethal toxin (LT) is a bipartite protease-containing toxin and a key virulence determinant of Bacillus anthracis. In mice, LT causes the rapid lysis of macrophages isolated from certain inbred strains, but the correlation between murine macrophage sensitivity and mouse strain susceptibility to toxin challenge is poor. In rats, LT induces a rapid death in as little as 37 minutes through unknown mechanisms. We used a recombinant inbred (RI) rat panel of 19 strains generated from LT-sensitive and LT-resistant progenitors to map LT sensitivity in rats to a locus on chromosome 10 that includes the inflammasome NOD-like receptor (NLR) sensor, Nlrp1. This gene is the closest rat homolog of mouse Nlrp1b, which was previously shown to control murine macrophage sensitivity to LT. An absolute correlation between in vitro macrophage sensitivity to LT-induced lysis and animal susceptibility to the toxin was found for the 19 RI strains and 12 additional rat strains. Sequencing Nlrp1 from these strains identified five polymorphic alleles. Polymorphisms within the N-terminal 100 amino acids of the Nlrp1 protein were perfectly correlated with LT sensitivity. These data suggest that toxin-mediated lethality in rats as well as macrophage sensitivity in this animal model are controlled by a single locus on chromosome 10 that is likely to be the inflammasome NLR sensor, Nlrp1.

Bacillus anthracis kills through a combination of bacterial infection and toxemia. Anthrax toxin working via the CMG2 receptor mediates lethality late in infection, but its roles early in infection remain unclear. We generated myeloid-lineage specific CMG2-deficient mice to examine the roles of macrophages, neutrophils, and other myeloid cells in anthrax pathogenesis. Macrophages and neutrophils isolated from these mice were resistant to anthrax toxin. However, the myeloid-specific CMG2-deficient mice remained fully sensitive to both anthrax lethal and edema toxins, demonstrating that targeting of myeloid cells is not responsible for anthrax toxin-induced lethality. Surprisingly, the myeloid-specific CMG2-deficient mice were completely resistant to B. anthracis infection. Neutrophil depletion experiments suggest that B. anthracis relies on anthrax toxin secretion to evade the scavenging functions of neutrophils to successfully establish infection. This work demonstrates that anthrax toxin uptake through CMG2 and the resulting impairment of myeloid cells are essential to anthrax infection.

The receptor-mediated internalization and degradation of radiolabeled diphtheria toxin by cultured monkey kidney cells was studied. The ability of a number of enzymes and chemicals to remove cell surface-bound toxin was tested; the combination of pronase and inositol hexaphosphate (PIHP) proved most effective. Using PIHP, the kinetics of toxin-cell association at 37 degrees C was resolved into two compounds: surface binding and internalization. The PIHP assay also allowed estimation of the half-time of toxin internalization (about 25 min). An assay involving precipitation of culture supernatants with trichloroacetic acid was developed and used to measure the rate of degradation and excretion of cell-associated toxin. Agents which markedly inhibited toxin internalization similarly prevented degradation, implying an intracellular location for the degradative process. The primary radioactive product excreted by Vero cells was monoiodotyrosine. The extent and rate of toxin degradation indicated lysosomal involvement. Finally, agents which blocked internalization or degradation, or both, (e.g. antibody and concanavalin A), protected cells from the cytotoxin action of diphtheria toxin, suggesting that these processes are necessary for expression of biological effect.

Blood coagulation often accompanies bacterial infections and sepsis and is generally accepted as a consequence of immune responses. Though many bacterial species can directly activate individual coagulation factors, they have not been shown to directly initiate the coagulation cascade that precedes clot formation. Here we demonstrated, using microfluidics and surface patterning, that the spatial localization of bacteria substantially affects coagulation of human and mouse blood and plasma. Bacillus cereus and Bacillus anthracis, the anthrax-causing pathogen, directly initiated coagulation of blood in minutes when bacterial cells were clustered. Coagulation of human blood by B. anthracis required secreted zinc metalloprotease InhA1, which activated prothrombin and factor X directly (not via factor XII or tissue factor pathways). We refer to this mechanism as 'quorum acting' to distinguish it from quorum sensing--it does not require a change in gene expression, it can be rapid and it can be independent of bacterium-to-bacterium communication.

To study the role of the diphthamide modification on eukaryotic elongation factor 2 (eEF2), we generated an eEF2 Gly(717)Arg mutant mouse, in which the first step of diphthamide biosynthesis is prevented. Interestingly, the Gly(717)-to-Arg mutation partially compensates the eEF2 functional loss resulting from diphthamide deficiency, possibly because the added +1 charge compensates for the loss of the +1 charge on diphthamide. Therefore, in contrast to mouse embryonic fibroblasts (MEFs) from OVCA1(-/-) mice, eEF2(G717R/G717R) MEFs retain full activity in polypeptide elongation and have normal growth rates. Furthermore, eEF2(G717R/G717R) mice showed milder phenotypes than OVCA1(-/-) mice (which are 100% embryonic lethal) and a small fraction survived to adulthood without obvious abnormalities. Moreover, eEF2(G717R/G717R)/OVCA1(-/-) double mutant mice displayed the milder phenotypes of the eEF2(G717R/G717R) mice, suggesting that the embryonic lethality of OVCA1(-/-) mice is due to diphthamide deficiency. We confirmed that the diphthamide modification is essential for eEF2 to prevent -1 frameshifting during translation and show that the Gly(717)-to-Arg mutation cannot rescue this defect.

Anthrax lethal toxin (LT) activates the NLRP1b (NALP1b) inflammasome and caspase-1 in macrophages from certain inbred mouse strains, but the mechanism by which this occurs is poorly understood. We report here that similar to several NLRP3 (NALP3, cryopyrin)-activating stimuli, LT activation of the NLRP1b inflammasome involves lysosomal membrane permeabilization (LMP) and subsequent cytoplasmic cathepsin B activity. CA-074Me, a potent cathepsin B inhibitor, protects LT-sensitive macrophages from cell death and prevents the activation of caspase-1. RNA interference knockdown of cathepsin B expression, however, cannot prevent LT-mediated cell death, suggesting that CA-074Me may also act on other cellular proteases released during LMP. CA-074Me appears to function downstream of LT translocation to the cytosol (as assessed by mitogen-activated protein kinase kinase cleavage), K(+) effluxes, and proteasome activity. The initial increase in cytoplasmic activity of cathepsin B occurs at the same time or shortly before caspase-1 activation but precedes a larger-scale lysosomal destabilization correlated closely with cytolysis. We present results suggesting that LMP may be involved in the activation of the NLRP1b inflammasome.

Anthrax lethal toxin (LT), a major virulence determinant of anthrax disease, induces vascular collapse in mice and rats. LT activates the Nlrp1 inflammasome in macrophages and dendritic cells, resulting in caspase-1 activation, IL-1β and IL-18 maturation and a rapid cell death (pyroptosis). This review presents the current understanding of LT-induced activation of Nlrp1 in cells and its consequences for toxin-mediated effects in rodent toxin and spore challenge models.

Bacillus cereus is a spore-forming, Gram-positive bacterium commonly associated with outbreaks of food poisoning. It is also known as an opportunistic pathogen causing clinical infections such as bacteremia, meningitis, pneumonia, and gas gangrene-like cutaneous infections, mostly in immunocompromised patients. B. cereus secretes a plethora of toxins of which four are associated with the symptoms of food poisoning. Two of these, the non-hemolytic enterotoxin Nhe and the hemolysin BL (Hbl) toxin, are predicted to be structurally similar and are unique in that they require the combined action of three toxin proteins to induce cell lysis. Despite their dominant role in disease, the molecular mechanism of their toxic function is still poorly understood. We report here that B. cereus strain ATCC 10876 harbors not only genes encoding Nhe, but also two copies of the hbl genes. We identified Hbl as the major secreted toxin responsible for inducing rapid cell lysis both in cultured cells and in an intraperitoneal mouse toxicity model. Antibody neutralization and deletion of Hbl-encoding genes resulted in significant reductions of cytotoxic activity. Microscopy studies with Chinese Hamster Ovary cells furthermore showed that pore formation by both Hbl and Nhe occurs through a stepwise, sequential binding of toxin components to the cell surface and to each other. This begins with binding of Hbl-B or NheC to the eukaryotic membrane, and is followed by the recruitment of Hbl-L1 or NheB, respectively, followed by the corresponding third protein. Lastly, toxin component complementation studies indicate that although Hbl and Nhe can be expressed simultaneously and are predicted to be structurally similar, they are incompatible and cannot complement each other.

The urokinase plasminogen activator receptor (uPAR) has emerged as a potential regulator of cell adhesion, cell migration, proliferation, differentiation, and cell survival in multiple physiologic and pathologic contexts. The urokinase plasminogen activator (uPA) was the first identified ligand for uPAR, but elucidation of the specific functions of the uPA-uPAR interaction in vivo has been difficult because uPA has important physiologic functions that are independent of binding to uPAR and because uPAR engages multiple ligands. Here, we developed a new mouse strain (Plau(GFDhu/GFDhu)) in which the interaction between endogenous uPA and uPAR is selectively abrogated, whereas other functions of both the protease and its receptor are retained. Specifically, we introduced 4 amino acid substitutions into the growth factor domain (GFD) of uPA that abrogate uPAR binding while preserving the overall structure of the domain. Analysis of Plau(GFDhu/GFDhu) mice revealed an unanticipated role of the uPA-uPAR interaction in suppressing inflammation secondary to fibrin deposition. In contrast, leukocyte recruitment and tissue regeneration were unaffected by the loss of uPA binding to uPAR. This study identifies a principal in vivo role of the uPA-uPAR interaction in cell-associated fibrinolysis critical for suppression of fibrin accumulation and fibrin-associated inflammation and provides a valuable model for further exploration of this multifunctional receptor.

Signals of danger and damage in the cytosol of cells are sensed by NOD-like receptors (NLRs), which are components of multiprotein complexes called inflammasomes. Inflammasomes activate caspase-1, resulting in IL-1-beta and IL-18 secretion and an inflammatory response. To date, the only known activator of rodent Nlrp1 is anthrax lethal toxin (LT), a protease secreted by the bacterial pathogen Bacillus anthracis. Although susceptibility of mouse macrophages to LT has been genetically linked to Nlrp1b, mice harbor two additional Nlrp1 paralogs in their genomes (Nlrp1a and Nlrp1c). However, little is known about their expression profile and sequence in different mouse strains. Furthermore, simultaneous expression of these paralogs may lead to competitional binding of Nlrp1b interaction partners needed for inflammasome activation, thus influencing macrophages susceptibility to LT. To more completely understand the role(s) of Nlrp1 paralogs in mice, we surveyed for their expression in a large set of LT-resistant and sensitive mouse macrophages. In addition, we provide sequence comparisons for Nlrp1a and report on previously unrecognized splice variants of Nlrp1b.Our results show that macrophages from some inbred mouse strains simultaneously express different splice variants of Nlrp1b. In contrast to the highly polymorphic Nlrp1b splice variants, sequencing of expressed Nlrp1a showed the protein to be highly conserved across all mouse strains. We found that Nlrp1a was expressed only in toxin-resistant macrophages, with the sole exception of expression in LT-sensitive CAST/EiJ macrophages.Our data present a complex picture of Nlrp1 protein variations and provide a basis for elucidating their roles in murine macrophage function. Furthermore, the high conservation of Nlrp1a implies that it might be an important inflammasome sensor in mice.

Ribonucleic acid extracted from influenza virus was labeled at the 3' termini with (3)H and analyzed by polyacrylamide gel electrophoresis. Influenza virus was found to contain a minimum of seven and possibly as many as 10 polynucleotide chains, most of which appear to terminate at the 3' end in uridine.

Following the deadly anthrax attacks of 2001, the Centers for Disease Control and Prevention (CDC) determined that Bacillus anthracis and Yersinia pestis that cause anthrax and plague, respectively, are two Tier 1 select agents that pose the greatest threat to the national security of the United States. Both cause rapid death, in 3 to 6 days, of exposed individuals. We engineered a virus nanoparticle vaccine using bacteriophage T4 by incorporating key antigens of both B. anthracis and Y. pestis into one formulation. Two doses of this vaccine provided complete protection against both inhalational anthrax and pneumonic plague in animal models. This dual anthrax-plague vaccine is a strong candidate for stockpiling against a potential bioterror attack involving either one or both of these biothreat agents. Further, our results establish the T4 nanoparticle as a novel platform to develop multivalent vaccines against pathogens of high public health significance.

ABSTRACT Anthrax lethal toxin (LeTx), consisting of protective antigen (PA) and lethal factor (LF), rapidly kills primary mouse macrophages and macrophage-like cell lines such as RAW 264.7. LF is translocated by PA into the cytosol of target cells, where it acts as a metalloprotease to cleave mitogen-activated protein kinase kinase 1 (MEK1) and possibly other proteins. In this study, we show that proteasome inhibitors such as acetyl-Leu-Leu-norleucinal, MG132, and lactacystin efficiently block LeTx cytotoxicity, whereas other protease inhibitors do not. The inhibitor concentrations that block LF cytotoxicity are similar to those that inhibit the proteasome-dependent IκB-α degradation induced by lipopolysaccharide. The inhibitors did not interfere with the proteolytic cleavage of MEK1 in LeTx-treated cells, indicating that they do not directly block the proteolytic activity of LF. However, the proteasome inhibitors did prevent ATP depletion, an early effect of LeTx. No overall activation of the proteasome by LeTx was detected, as shown by the cleavage of fluorogenic substrates of the proteasome. All of these results suggest that the proteasome mediates a toxic process initiated by LF in the cell cytosol. This process probably involves degradation of unidentified molecules that are essential for macrophage homeostasis. Moreover, this proteasome-dependent process is an early step in LeTx intoxication, but it is downstream of the cleavage by LF of MEK1 or other putative substrates.

The alpha 2-macroglobulin (alpha 2M) receptor/low-density lipoprotein receptor-related protein (LRP) is important for the clearance of proteases, protease-inhibitor complexes, and various ligands associated with lipid metabolism. While the regulation of receptor function is poorly understood, the addition of high concentrations of the 39-kD receptor-associated protein (RAP) to cells inhibits the binding and/or uptake of many of these ligands. Previously, we (Kounnas, M.Z., R.E. Morris, M.R. Thompson, D.J. FitzGerald, D.K. Strickland, and C.B. Saelinger. 1992. J. Biol. Chem. 267:12420-12423) [corrected] showed that Pseudomonas exotoxin (PE) could bind immobilized LRP. Also, the addition of RAP blocked toxin-mediated cell killing. These findings suggested that PE might use LRP to gain entry into toxin-sensitive cells. Here we report on a strategy to select PE-resistant lines of Chinese hamster ovary cells that express altered amounts of LRP. An important part of this strategy is to screen PE-resistant clones for those that retain sensitivity to both diphtheria toxin and to a fusion protein composed of lethal factor (from anthrax toxin) fused to the adenosine diphosphate-ribosylating domain of PE. Two lines, with obvious changes in their expression of LRP, were characterized in detail. The 14-2-1 line had significant amounts of LRP, but in contrast to wild-type cells, little or no receptor was displayed on the cell surface. Instead, receptor protein was found primarily within cells, much of it apparently in an unprocessed state. The 14-2-1 line showed no uptake of chymotrypsin-alpha 2M and was 10-fold resistant to PE compared with wild-type cells. A second line, 13-5-1, had no detectable LRP mRNA or protein, did not internalize alpha 2M-chymotrypsin, and exhibited a 100-fold resistance to PE. Resistance to PE appeared to be due to receptor-specific defects, since these mutant lines showed no resistance to a PE chimeric toxin that was internalized via the transferrin receptor. The results of this investigation confirm that LRP mediates the internalization of PE.

Lethal factor is a protease, one component of Bacillus anthracis exotoxin, which cleaves many of the mitogen-activated protein kinase kinases (MEKs). Given the importance of MEK signaling in tumorigenesis, we assessed the effects of anthrax lethal toxin (LeTx) on tumor cells. LeTx was very effective in inhibiting mitogen-activated protein kinase activation in V12 H-ras-transformed NIH 3T3 cells. In vitro , treatment of transformed cells with LeTx caused them to revert to a nontransformed morphology, and inhibited their abilities to form colonies in soft agar and to invade Matrigel without markedly affecting cell proliferation. In vivo , LeTx inhibited growth of ras-transformed cells implanted in athymic nude mice (in some cases causing tumor regression) at concentrations that caused no apparent animal toxicity. Unexpectedly, LeTx also greatly decreased tumor neovascularization. These results demonstrate that LeTx potently inhibits ras-mediated tumor growth and is a potential antitumor therapeutic.

ABSTRACT Anthrax toxin from Bacillus anthracis is a three-component toxin consisting of lethal factor (LF), edema factor (EF), and protective antigen (PA). LF and EF are the catalytic components of the toxin, whereas PA is the receptor-binding component. To identify residues of PA that are involved in interaction with the cellular receptor, two solvent-exposed loops of domain 4 of PA (amino acids [aa] 679 to 693 and 704 to 723) were mutagenized, and the altered proteins purified and tested for toxicity in the presence of LF. In addition to the intended substitutions, novel mutations were introduced by errors that occurred during PCR. Substitutions within the large loop (aa 704 to 723) had no effect on PA activity. A mutated protein, LST-35, with three substitutions in the small loop (aa 679 to 693), bound weakly to the receptor and was nontoxic. A mutated protein, LST-8, with changes in three separate regions did not bind to receptor and was nontoxic. Toxicity was greatly decreased by truncation of the C-terminal 3 to 5 aa, but not by their substitution with nonnative residues or the extension of the terminus with nonnative sequences. Comparison of the 28 mutant proteins described here showed that the large loop (aa 704 to 722) is not involved in receptor binding, whereas residues in and near the small loop (aa 679 to 693) play an important role in receptor interaction. Other regions of domain 4, in particular residues at the extreme C terminus, appear to play a role in stabilizing a conformation needed for receptor-binding activity.

Bacillus anthracis lethal toxin (LT) produces symptoms of anthrax in mice and induces rapid lysis of macrophages (M phi) derived from certain inbred strains. We used nine inbred strains and two inducible nitric oxide synthase (iNOS) knockout C57BL/6J strains polymorphic for the LT M phi sensitivity Kif1C locus to analyze the role of M phi sensitivity (to lysis) in LT-mediated cytokine responses and lethality. LT-mediated induction of cytokines KC, MCP-1/JE, MIP-2, eotaxin, and interleukin-1 beta occurred only in mice having LT-sensitive M phi. However, while iNOS knockout C57BL/6J mice having LT-sensitive M phi were much more susceptible to LT than the knockout mice with LT-resistant M phi, a comparison of susceptibilities to LT in the larger set of inbred mouse strains showed a lack of correlation between M phi sensitivity and animal susceptibility to toxin. For example, C3H/HeJ mice, harboring LT-sensitive M phi and having the associated LT-mediated cytokine response, were more resistant than mice with LT-resistant M phi and no cytokine burst. Toll-like receptor 4 (Tlr4)-deficient, lipopolysaccharide-nonresponsive mice were not more resistant to LT. We also found that CAST/Ei mice are uniquely sensitive to LT and may provide an economical bioassay for toxin-directed therapeutics. The data indicate that while the cytokine response to LT in mice requires M phi lysis and while M phi sensitivity in the C57BL/6J background is sufficient for BALB/cJ-like mortality of that strain, the contribution of M phi sensitivity and cytokine response to animal susceptibility to LT differs among other inbred strains. Thus, LT-mediated lethality in mice is influenced by genetic factors in addition to those controlling M phi lysis and cytokine response and is independent of Tlr4 function.

A DNA vaccine encoding the immunogenic and biologically active portion of anthrax protective antigen (PA) was constructed. Spleen cells from BALB/c mice immunized intramuscularly with this vaccine were stimulated to secrete IFNγ and IL-4 when exposed to PA in vitro. Immunized mice also mounted a humoral immune response dominated by IgG1 anti-PA antibody production, the subclass previously shown to confer protection against anthrax toxin. A 1:100 dilution of serum from these animals protected cells in vitro against cytotoxic concentrations of PA. Moreover, 7/8 mice immunized three times with the PA DNA vaccine were protected against lethal challenge with a combination of anthrax protective antigen plus lethal factor.

The protective antigen (PA) component of anthrax toxin contains two sites that are uniquely sensitive to proteolytic cleavage. Cleavage at the sequence RKKR167 by the cellular protease furin is absolutely required for toxicity, whereas cleavage by chymotrypsin or thermolysin at the sequence FFD315 inactivates the protein, apparently by blocking the ability of PA to translocate the catalytic moieties of the toxins, lethal factor (LF) and edema factor (EF), to the cytosol of eukaryotic cells. To specify the role of the chymotrypsin-sensitive site of PA in the translocation of LF, we altered residues 313-315. None of the mutations in this region interfered with the ability of PA to bind to its cellular receptor, be cleaved by cell surface furin, and bind LF. Substitution of Ala for Asp315 or for both Phe313 and Phe314 reduced the ability of PA to intoxicate cells in the presence of LF by 3- and 7-fold, respectively. Substitution of Phe313 by Cys greatly reduced the rate of LF translocation and delayed toxicity. The rate at which the Cys-substituted PA killed cells was increased significantly by blocking the sulfhydryl group with iodoacetamide, suggesting that this added Cys interacts with cellular proteins and slows translocation of LF. Deletion of the 2 Phe rendered PA completely non-toxic. This deleted PA protein lacked the ability shown by native PA to form oligomers on cells and in solution and to induce release of 86Rb from Chinese hamster ovary cells. These results suggest that the chymotrypsin-sensitive site in PA is required for membrane channel formation and translocation of LF into the cytosol. PA double mutants were constructed that cannot be cleaved at either the furin or chymotrypsin sites. These PA proteins were more stable in Bacillus anthracis culture supernatants and may therefore be useful as a replacement for PA in anthrax vaccines.

The nucleotide sequence of the Bacillus anthracis edema factor (EF) gene (cya), which encodes a calmodulin-dependent adenylate cyclase, has been determined. EF is part of the tripartite protein exotoxin of B. anthracis. An ATG start codon, immediately upstream from codons which specify the first 15 amino acids (aa) of EF, was preceded by an AAAGGAGGT sequence which is its probable ribosome-binding site. Starting at this ATG codon, there was a continuous 2400-bp open reading frame which encodes the 800-aa EF-precursor protein with a Mr of 92464. The mature, secreted protein (767 aa; Mr 88808) was preceded by a 33-aa signal peptide which has characteristics m common with leader peptides for other secreted proteins of the Bacillus species. A consensus amino acid sequence (Gly-X-X-X-X-Gly-Lys-Ser, X = any aa), which was part of the presumed ATP binding site for EF, was also present. The codon usage of the EF gene reflected the high A + T (71%) base composition for its DNA. B. anthracis EF was not related to the Escherichia coli or yeast adenylate cyclases, but was related to the Bordetella pertussis calmodulin-dependent adenylate cyclase.

A challenge for subunit vaccines whose goal is to elicit CD8(+) cytotoxic T lymphocytes (CTLs) is to deliver the antigen to the cytosol of the living cell, where it can be processed for presentation by major histocompatibility complex (MHC) class I molecules. Several bacterial toxins have evolved to efficiently deliver catalytic protein moieties to the cytosol of eukaryotic cells. Anthrax lethal toxin consists of two distinct proteins that combine to form the active toxin. Protective antigen (PA) binds to cells and is instrumental in delivering lethal factor (LF) to the cell cytosol. To test whether the lethal factor protein could be exploited for delivery of exogenous proteins to the MHC class I processing pathway, we constructed a genetic fusion between the amino-terminal 254 aa of LF and the gp120 portion of the HIV-1 envelope protein. Cells treated with this fusion protein (LF254-gp120) in the presence of PA effectively processed gp120 and presented an epitope recognized by HIV-1 gp120 V3-specific CTL. In contrast, when cells were treated with the LF254-gp120 fusion protein and a mutant PA protein defective for translocation, the cells were not able to present the epitope and were not lysed by the specific CTL. The entry into the cytosol and dependence on the classical cytosolic MHC class I pathway were confirmed by showing that antigen presentation by PA + LF254-gp120 was blocked by the proteasome inhibitor lactacystin. These data demonstrate the ability of the LF amino-terminal fragment to deliver antigens to the MHC class I pathway and provide the basis for the development of novel T cell vaccines.

ABSTRACT Bacillus anthracis is nonhemolytic, even though it is closely related to the highly hemolytic Bacillus cereus. Hemolysis by B. cereus results largely from the action of phosphatidylcholine-specific phospholipase C (PC-PLC) and sphingomyelinase (SPH), encoded by the plc and sph genes, respectively. In B. cereus , these genes are organized in an operon regulated by the global regulator PlcR. B. anthracis contains a highly similar cereolysin operon, but it is transcriptionally silent because the B. anthracis PlcR is truncated at the C terminus. Here we report the cloning, expression, purification, and enzymatic characterization of PC-PLC and SPH from B. cereus and B. anthracis. We also investigated the effects of expressing PlcR on the expression of plc and sph . In B. cereus , PlcR was found to be a positive regulator of plc but a negative regulator of sph . Replacement of the B. cereus plcR gene by its truncated orthologue from B. anthracis eliminated the activities of both PC-PLC and SPH, whereas introduction into B. anthracis of the B. cereus plcR gene with its own promoter did not activate cereolysin expression. Hemolytic activity was detected in B. anthracis strains containing the B. cereus plcR gene on a multicopy plasmid under control of the strong B. anthracis protective antigen gene promoter or in a strain carrying a multicopy plasmid containing the entire B. cereus plc - sph operon. Slight hemolysis and PC-PLC activation were found when PlcR-producing B. anthracis strains were grown under anaerobic-plus-CO 2 or especially under aerobic-plus-CO 2 conditions. Unmodified parental B. anthracis strains did not demonstrate obvious hemolysis under the same conditions.

Macrophages from certain inbred mouse strains are rapidly killed (< 90 min) by anthrax lethal toxin (LT). LT cleaves cytoplasmic MEK proteins at 20 min and induces caspase-1 activation in sensitive macrophages at 50-60 min, but the mechanism of LT-induced death is unknown. Proteasome inhibitors block LT-mediated caspase-1 activation and can protect against cell death, indicating that the degradation of at least one cellular protein is required for LT-mediated cell death. Proteins can be degraded by the proteasome via the N-end rule, in which a protein's stability is determined by its N-terminal residue. Using amino acid derivatives that act as inhibitors of this pathway, we show that the N-end rule is required for LT-mediated caspase-1 activation and cell death. We also found that bestatin methyl ester, an aminopeptidase inhibitor protects against LT in vitro and in vivo and that the different inhibitors of the protein degradation pathway act synergistically in protecting against LT. We identify c-IAP1, a mammalian member of the inhibitor of apoptosis protein (IAP) family, as a novel N-end rule substrate degraded in macrophages treated with LT. We also show that LT-induced c-IAP1 degradation is independent of the IAP-antagonizing proteins Smac/DIABLO and Omi/HtrA2, but dependent on caspases.

ABSTRACT Genome engineering is a powerful method for the study of bacterial virulence. With the availability of the complete genomic sequence of Bacillus anthracis , it is now possible to inactivate or delete selected genes of interest. However, many current methods for disrupting or deleting more than one gene require use of multiple antibiotic resistance determinants. In this report we used an approach that temporarily inserts an antibiotic resistance marker into a selected region of the genome and subsequently removes it, leaving the target region (a single gene or a larger genomic segment) permanently mutated. For this purpose, a spectinomycin resistance cassette flanked by bacteriophage P1 loxP sites oriented as direct repeats was inserted within a selected gene. After identification of strains having the spectinomycin cassette inserted by a double-crossover event, a thermo-sensitive plasmid expressing Cre recombinase was introduced at the permissive temperature. Cre recombinase action at the loxP sites excised the spectinomycin marker, leaving a single loxP site within the targeted gene or genomic segment. The Cre-expressing plasmid was then removed by growth at the restrictive temperature. The procedure could then be repeated to mutate additional genes. In this way, we sequentially mutated two pairs of genes: pepM and spo0A , and mcrB and mrr . Furthermore, loxP sites introduced at distant genes could be recombined by Cre recombinase to cause deletion of large intervening regions. In this way, we deleted the capBCAD region of the pXO2 plasmid and the entire 30 kb of chromosomal DNA between the mcrB and mrr genes, and in the latter case we found that the 32 intervening open reading frames were not essential to growth.

Anthrax lethal toxin (LT), a virulence factor secreted by Bacillus anthracis, is selectively toxic to human melanomas with the BRAF V600E activating mutation because of its proteolytic activities toward the mitogen-activated protein kinase kinases (MEKs). To develop LT variants with lower in vivo toxicity and high tumor specificity, and therefore greater potential for clinical use, we generated a mutated LT that requires activation by matrix metalloproteinases (MMPs). This engineered toxin was less toxic than wild-type LT to mice because of the limited expression of MMPs by normal cells. Moreover, the systemically administered toxin produced greater anti-tumor effects than wild-type LT toward human xenografted tumors. This was shown to result from its greater bioavailability, a consequence of the limited uptake and clearance of the modified toxin by normal cells. Furthermore, the MMP-activated LT had very potent anti-tumor activity not only to human melanomas containing the BRAF mutation but also to other tumor types, including lung and colon carcinomas regardless of their BRAF status. Tumor histology and in vivo angiogenesis assays showed that this anti-tumor activity is due largely to the indirect targeting of tumor vasculature and angiogenic processes. Thus, even tumors genetically deficient in anthrax toxin receptors were still susceptible to the toxin therapy in vivo. Moreover, the modified toxin also displayed lower immunogenicity compared with the wild-type toxin. All these properties suggest that this MMP-activated anti-tumor toxin has potential for use in cancer therapy.

Anthrax lethal toxin, which consists of two separate proteins, protective antigen (Mr, 82,700) and lethal factor (Mr, approximately 83,000), is cytotoxic to the macrophagelike cell line J774A.1. Removal of calcium from the culture medium protected cells against the action of lethal toxin. Calcium depletion during the binding phase of intoxication afforded only partial protection. Further analysis showed that calcium removal caused some inhibition of protective antigen binding but that it had minimal effect on proteolytic conversion of protective antigen to the active 63-kilodalton fragment and that it had no effect on lethal factor binding. Cells to which lethal toxin had bound in the presence of calcium were protected when transferred to calcium-depleted culture medium, indicating a role for calcium at a postbinding stage. When ammonium chloride is present with lethal toxin, toxin accumulates in intracellular vesicles. Calcium-free medium protected these cells upon removal of the amine block, suggesting that calcium is also required at a step after internalization of lethal toxin. Calcium channel blockers inhibited 45Ca2+ uptake and protected cells against cytotoxicity. Calmodulin inhibitors also protected against the action of lethal toxin, suggesting involvement of calmodulin at a step during intoxication. We conclude that calcium is required at several steps in the intoxication of cells by anthrax lethal toxin.