Silvia Cetrullo

Cells adapt their metabolism and activities in response to signals from their surroundings, and this ability is essential for their survival in the face of environmental changes. In mammalian tissues a deficit of these mechanisms is commonly associated with cellular aging and degenerative diseases related to aging, such as cardiovascular disease, cancer, immune system decline, and neurological pathologies. Several proteins have been identified as able to respond directly to energy, nutrient, and growth factor levels and stress stimuli in order to mediate adaptations in the cell. Many of these proteins are enzymes that positively or negatively modulate the autophagic process. This review focuses on biochemical mechanisms involving enzymes--specifically, mTOR, AMPK, and Sirt1--that are currently considered important for these adaptive responses, providing an overview of the interactions of the main players in this process.

The prevalence of Osteoarthritis (OA) is increasing because of the progressive aging and unhealthy lifestyle. These risk factors trigger OA by removing constraints that keep the tightly regulated low turnover of the extracellular matrix (ECM) of articular cartilage, the correct chondrocyte phenotype, and the functionality of major homeostatic mechanisms, such as mitophagy, that allows for the clearance of dysfunctional mitochondria, preventing increased production of reactive oxygen species, oxidative stress, and senescence. After OA onset, the presence of ECM degradation products is perceived as a “danger” signal by the chondrocytes and the synovial macrophages that release alarmins with autocrine/paracrine effects on the same cells. Alarmins trigger innate immunity in the joint, with important systemic crosstalks that explain the beneficial effects of dietary interventions and improved lifestyle. Alarmins also boost low-grade inflammation: the release of inflammatory molecules and chemokines sustained by continuous triggering of NF- κ B within an altered cellular setting that allows its higher transcriptional activity. Chemokines exert pleiotropic functions in OA, including the recruitment of inflammatory cells and the induction of ECM remodeling. Some chemokines have been successfully targeted to attenuate structural damage or pain in OA animal models. This represents a promising strategy for the future management of human OA.

Hydroxytyrosol (HT), a major phenolic antioxidant found in olive oil, can afford protection from oxidative stress in several types of non-tumoral cells, including chondrocytes. Autophagy was recently identified as a protective process during osteoarthritis (OA) development and critical for survival of chondrocytes. Therefore we have investigated the possibility to modulate chondrocyte autophagy by HT treatment.DNA damage and cell death were estimated in human C-28/I2 and primary OA chondrocytes exposed to hydrogen peroxide. Autophagic flux and mitophagy were monitored by measuring levels and location of autophagy markers through western blot, immunostaining and confocal laser microscopy. Late autophagic vacuoles were stained with monodansylcadaverine. The involvement of sirtuin 1 (SIRT-1) was evaluated by immunohistochemistry, western blot and gene silencing with specific siRNA.HT increases markers of autophagy and protects chondrocytes from DNA damage and cell death induced by oxidative stress. The protective effect requires the deacetylase SIRT-1, which accumulated in the nucleus following HT treatment. In fact silencing of this enzyme prevented HT from promoting the autophagic process and cell survival. Furthermore HT supports autophagy even in a SIRT-1-independent manner, by increasing p62 transcription, required for autophagic degradation of polyubiquitin-containing bodies.These results support the potential of HT as a chondroprotective nutraceutical compound against OA, not merely for its antioxidant ability, but as an autophagy and SIRT-1 inducer as well.HT may exert a cytoprotective action by promoting autophagy in cell types that may be damaged in degenerative diseases by oxidative and other stress stimuli.

<h2>Summary</h2><h3>Objective</h3> Nutraceutical compounds, such as hydroxytyrosol (HT), have been found to exert protective effects in osteoarthritis (OA) by affecting a variety of key molecular and cellular processes in chondrocytes. However, to our knowledge, no relationship has been reported between nutraceuticals and microRNA (miR) network in OA models. Here, we identified a miR that is implicated in HT-mediated chondroprotection following oxidative stress condition by targeting sirtuin-1 (SIRT-1). <h3>Methods</h3> Human primary and C-28/I2 chondrocytes were pre-treated with 100 μM HT 30 min before 100 μM H₂O₂ addition. <i>In silico</i> analyses were exploited to select putative candidate miRs able to target SIRT-1 mRNA. Luciferase-based gene reporter assay was employed to demonstrate the direct link between miR-9 and its putative mRNA target. Transient transfection approach was performed to examine the effects of miR-9 levels on caspase activity, cell viability and expression of OA-related genes. <h3>Results</h3> MiR-9 was identified and confirmed as a post-transcriptional regulator of SIRT-1. MiR-9 and SIRT-1 levels showed opposite changes in chondrocytes following H₂O₂ and HT treatment. Moreover mir-9 silencing inhibited cell death induced by H₂O₂ partly through down-regulation of SIRT-1, whereas miR-9 overexpression markedly reduced the protective effect of HT. The manipulation of miR-9 levels also resulted in the modulation of OA-related gene expression, including MMP-13, VEGF and RUNX-2. <h3>Conclusions</h3> These results show that miR-9 is a critical mediator of the deleterious and OA-related effects of oxidative stress in chondrocytes and that modulation of miR expression may be a crucial mechanism underlying the protective action of HT.

Oxidative stress (OS) contributes to Osteoarthritis (OA) pathogenesis and its effects are worsened by the impairment of homeostatic mechanisms such as autophagy in OA chondrocytes. Rescue of an efficient autophagic flux could therefore reduce the bulk of damaged molecules, and at the same time improve cell function and viability. As a promising dietary or intra-articular supplement to rescue autophagy in OA chondrocytes, we tested spermidine (SPD), known to induce autophagy and to reduce OS in several other cellular models. Chondrocytes were obtained from OA cartilage and seeded at high-density to keep their differentiated phenotype. The damaging effects of OS and the chondroprotective activity of SPD were assessed by evaluating the extent of cell death, oxidative DNA damage and caspase 3 activation. The autophagy promoting activity of SPD was evaluated by assessing pivotal autophagic effectors, i.e. Beclin-1 (BECN-1), microtubule-associated protein 1 light chain 3 II (LC3-II) and p62. BECN-1 protein expression was significantly increased by SPD and reduced by H2O2 treatment. SPD also rescued the impaired autophagic flux consequent to H2O2 exposure by increasing mRNA and protein expression of LC3-II and p62. SPD induction of mitophagy was revealed by immunofluorescent co-localization of LC3-II and TOM20. The key protective role of autophagy was confirmed by the loss of SPD chondroprotection upon autophagy-related gene 5 (ATG5) silencing. Significant SPD tuning of the H2O2-dependent induction of degradative (MMP-13), inflammatory (iNOS, COX-2) and hypertrophy markers (RUNX2 and VEGF) was revealed by Real Time PCR and pointed at the SPD ability of reducing NF-κB activation through autophagy induction. Conversely, blockage of autophagy led to parallel increases of oxidative markers and p65 nuclear translocation. SPD also increased the proliferation of slow-proliferating primary cultures. Taken together, our findings highlight the chondroprotective, anti-oxidant and anti-inflammatory activity of SPD and suggest that the protection afforded by SPD against OS is exerted through the rescue of the autophagic flux.

Both life span and health span are influenced by genetic, environmental and lifestyle factors. With the genetic influence on human life span estimated to be about 20–25%, epigenetic changes play an important role in modulating individual health status and aging. Thus, a main part of life expectance and healthy aging is determined by dietary habits and nutritional factors. Excessive or restricted food consumption have direct effects on health status. Moreover, some dietary interventions including a reduced intake of dietary calories without malnutrition, or a restriction of specific dietary component may promote health benefits and decrease the incidence of aging-related comorbidities, thus representing intriguing potential approaches to improve healthy aging. However, the relationship between nutrition, health and aging is still not fully understood as well as the mechanisms by which nutrients and nutritional status may affect health span and longevity in model organisms. The broad effect of different nutritional conditions on health span and longevity occurs through multiple mechanisms that involve evolutionary conserved nutrient-sensing pathways in tissues and organs. These pathways interacting each other include the evolutionary conserved key regulators mammalian target of rapamycin, AMP-activated protein kinase, insulin/insulin-like growth factor 1 pathway and sirtuins. In this review we provide a summary of the main molecular mechanisms by which different nutritional conditions, i.e., specific nutrient abundance or restriction, may affect health span and life span.

Osteoarthritis (OA) is a disease associated to age or conditions that precipitate aging of articular cartilage, a post-mitotic tissue that remains functional until the failure of major homeostatic mechanisms. OA severely impacts the national health system costs and patients’ quality of life because of pain and disability. It is a whole-joint disease sustained by inflammatory and oxidative signaling pathways and marked epigenetic changes responsible for catabolism of the cartilage extracellular matrix. OA usually progresses until its severity requires joint arthroplasty. To delay this progression and to improve symptoms, a wide range of naturally derived compounds have been proposed and are summarized in this review. Preclinical in vitro and in vivo studies have provided proof of principle that many of these nutraceuticals are able to exert pleiotropic and synergistic effects and effectively counteract OA pathogenesis by exerting both anti-inflammatory and antioxidant activities and by tuning major OA-related signaling pathways. The latter are the basis for the nutrigenomic role played by some of these compounds, given the marked changes in the transcriptome, miRNome, and methylome. Ongoing and future clinical trials will hopefully confirm the disease-modifying ability of these bioactive molecules in OA patients.

Apoptotic cell death of cardiomyocytes is involved in several cardiovascular diseases including ischemia, hypertrophy, and heart failure. The polyamines putrescine, spermidine, and spermine are polycations absolutely required for cell growth and division. However, increasing evidence indicates that polyamines, cell growth, and cell death can be tightly connected. In this paper, we have studied the involvement of polyamines in apoptosis of H9c2 cardiomyoblasts in a model of simulated ischemia. H9c2 cells were exposed to a condition of simulated ischemia, consisting of hypoxia plus serum deprivation, that induces apoptosis. The activity of ornithine decarboxylase, the rate limiting enzyme of polyamine biosynthesis that synthesizes putrescine, is rapidly and transiently induced in ischemic cells, reaching a maximum after 3 h, and leading to increased polyamine levels. Pharmacological inhibition of ornithine decarboxylase by alpha-difluoromethylornithine (DFMO) depletes H9c2 cardiomyoblasts of polyamines and protects the cells against ischemia-induced apoptosis. DFMO inhibits several of the molecular events of apoptosis that follow simulated ischemia, such as the release of cytochrome c from mitochondria, caspase activation, downregulation of Bcl-xL, and DNA fragmentation. The protective effect of DFMO is lost when exogenous putrescine is provided to the cells, indicating a specific role of polyamine synthesis in the development of apoptosis in this model of simulated ischemia. In cardiomyocytes obtained from transgenic mice overexpressing ornithine decarboxylase in the heart, caspase activation is dramatically increased following induction of apoptosis, with respect to cardiomyocytes from control mice, confirming a proapoptotic effect of polyamines. It is presented for the first time evidence of the involvement of polyamines in apoptosis of ischemic cardiac cells and the beneficial effect of DFMO treatment. In conclusion, this finding may suggest novel pharmacological approaches for the protection of cardiomyocytes injury caused by ischemia.

Hydroxytyrosol (HT), a phenolic compound mainly derived from olives, has been proposed as a nutraceutical useful in prevention or treatment of degenerative diseases. In the present study we have evaluated the ability of HT to counteract the appearance of osteoarthritis (OA) features in human chondrocytes. Pre-treatment of monolayer cultures of chondrocytes with HT was effective in preventing accumulation of reactive oxidant species (ROS), DNA damage and cell death induced by H2O2 exposure, as well as the increase in the mRNA level of pro-inflammatory, matrix-degrading and hypertrophy marker genes, such as iNOS, COX-2, MMP-13, RUNX-2 and VEGF. HT alone slightly enhanced ROS production, but did not enhance cell damage and death or the expression of OA-related genes. Moreover HT was tested in an in vitro model of OA, i.e. three-dimensional micromass cultures of chondrocytes stimulated with growth-related oncogene α (GROα), a chemokine involved in OA pathogenesis and known to promote hypertrophy and terminal differentiation of chondrocytes. In micromass constructs, HT pre-treatment inhibited the increases in caspase activity and the level of the messengers for iNOS, COX-2, MMP-13, RUNX-2 and VEGF elicited by GROα. In addition, HT significantly increased the level of SIRT-1 mRNA in the presence of GROα. In conclusion, the present study shows that HT reduces oxidative stress and damage, exerts pro-survival and anti-apoptotic actions and favourably influences the expression of critical OA-related genes in human chondrocytes treated with stressors promoting OA-like features.

Osteoarthritis (OA) is a debilitating degenerative disease of the articular cartilage with a multifactorial etiology. Aging, the main risk factor for OA development, is associated with a systemic oxidative and inflammatory phenotype. Autophagy is a central housekeeping system that plays an antiaging role by supporting the clearance of senescence-associated alterations of macromolecules and organelles. Autophagy deficiency has been related to OA pathogenesis because of the accumulation of cellular defects in chondrocytes. Microribonucleic acids (microRNAs or miRs) are a well-established class of posttranscriptional modulators belonging to the family of noncoding RNAs that have been identified as key players in the regulation of cellular processes, such as autophagy, by targeting their own cognate mRNAs. Here, we present a state-of-the-art literature review on the role of miRs and autophagy in the scenario of OA pathogenesis. In addition, a comprehensive survey has been performed on the functional connections of the miR network and the autophagy pathway in OA by using “microRNA,” “autophagy,” and “osteoarthritis” as key words. Discussion of available evidence sheds light on some aspects that need further investigation in order to reach a more comprehensive view of the potential of this topic in OA.

Chondrocyte cell death can contribute to cartilage degeneration in articular diseases, such as osteoarthritis (OA). Sulforaphane (SFN), a natural compound derived from cruciferous aliment, is well known as an anti-carcinogen, but according to recent evidence it also shows cytoprotective effects on a variety of non-tumoral cells. Therefore we have tested the ability of SFN to protect chondrocytes from cell death in vitro. Treatment of growing monolayer cultures of human C-28/I2 chondrocytes with SFN in the low micro-molecular range for a few days, reduced cell growth without affecting cell survival or inducing apoptosis. However it decreased cell death in C-28/I2 chondrocytes exposed to stimuli previously reported to promptly trigger apoptosis, that is, the cytokine tumor necrosis factor-α (TNF) plus cycloheximide (CHX) or the polyamine analogue N1,N11-diethylnorspermine (DENSPM) plus CHX. In particular pre-treatment with SFN reduced effector and initiator caspase activities and the associated activation of JNK kinases. SFN exerted a cytoprotective action even versus H2O2, which differently from the previous stimuli induced cell death without producing an evident caspase activation. SFN pre-treatment also prevented caspase activation in three-dimensional micromass cultures of OA chondrocytes stimulated with growth-related oncogene α (GROα), a pro-apoptotic chemokine. The suppression of caspase activation in micromasses appeared to be related to the inhibition of p38 MAPK phosphorylation. In conclusion, the present work shows that low micro-molecular SFN concentrations exert pro-survival and anti-apoptotic actions and influence signaling pathways in a variety of experimental conditions employing chondrocyte cell lines and OA chondrocytes treated with a range of death stimuli. J. Cell. Physiol. 226: 1771–1779, 2011. © 2010 Wiley-Liss, Inc.

Alternatives to chemicals for plant management are increasingly used to reduce environmental pollution. Seed treatment with natural products may act as a priming effect by stimulating seedling growth and plant defence responses against fungal pathogens. In this framework, algae produce a wide variety of bioactive metabolites, which can be used in agriculture as biofertilizers or biostimulants. The purpose of this study was to investigate the possible role of water-soluble polysaccharides (WSPs) from the brown alga Ecklonia maxima applied on tomato seed in enhancing plant growth and inducing resistance to Fusarium oxysporum via modulation of multiple physiological parameters and metabolic pathways. Here, we first characterized the E. maxima WSPs by FT-IR spectroscopy, and then we tested the WSPs as growth promoters on tomato seedlings, and the physiological and defence responses of plants during pathogen infection. We found that WSP seed treatment without pathogen challenge stimulated seedling height and root growth by 24.5 and 62.9%, respectively. Under pathogen infection, plants exhibited long-lasting resistance against F. oxysporum until 46 days after seed treatment. The metabolic changes associated with resistance to Fusarium wilt in plant roots were related to an increase in phenols, flavonoids and protein contents as well as a higher chitinase and β-1,3-D-glucanase enzyme activity. Moreover, PR1a, PR3 and other defence gene expressions were significantly increased. Resistance to F. oxysporum as a result of WSP seed treatment was also supported by FT-IR analysis of tomato roots. Infected roots showed a decrease in the relative intensity of the bands due to the syringyl ring and amide I and amide II in proteins. In contrast, WSP treatment alone and in the presence of the pathogen exhibited a spectral profile similar to that of the control. This research emphasizes the potential role of algal polysaccharides applied by seed treatment in promoting seedling growth and priming plant resistance against soil-borne pathogens.

Apoptosis is a programmed cell death that plays a critical role in cell homeostasis. In particular, apoptosis in cardiomyocytes is involved in several cardiovascular diseases including heart failure. Recently autophagy has emerged as an important modulator of programmed cell death pathway. Recent evidence indicates that saturated fatty acids induce cell death through apoptosis and this effect is specific for palmitate. On the other hand, n-3 polyunsaturated fatty acids (PUFAs) have been implicated in the protection against cardiovascular diseases, cardiac ischemic damage and myocardial dysfunction. In the present study we show that n-3 PUFA eicosapentaenoic acid (EPA) treatment to culture medium of H9c2 rat cardiomyoblasts protects cells against palmitate-induced apoptosis, as well as counteracts palmitate-mediated increase of autophagy. Further investigation is required to establish whether the antiautophagic effect of EPA may be involved in its cytoprotective outcome and to explore the underlying biochemical mechanisms through which palmitate and EPA control the fate of cardiac cells.

The molecular mechanisms underlying spermine osteo-inductive activity on human adipose-derived stem cells (ASCs) grown in 3-dimensional (3D) cultures were investigated. Spermine belongs to the polyamine family, naturally occurring, positively charged polycations that are able to control several cellular processes. Spermine was used at a concentration close to that found in platelet-rich plasma (PRP), an autologous blood product containing growth and differentiation factors, which has recently become popular in in vitro and in vivo bone healing and engineering. Adipose tissue was surgically obtained from the hypodermis of patients undergoing hip arthroplasty. Patient age negatively affected both ASC yield and ASC ability to form 3D constructs. ASC 3D cultures were seeded in either non differentiating or chondrogenic conditions, with or without the addition of 5 μM spermine to evaluate its osteogenic potential across 1, 2, and 3 weeks of maturation. Osteogenic medium was used as a reference. The effects of the addition of spermine on molecular markers of osteogenesis, at both gene and protein level, and mineralization were evaluated. The effects of spermine were temporally defined and responsible for the progression from the early to the mature osteoblast differentiation phases. Spermine initially promoted gene and protein expression of Runx-2, an early marker of the osteoblast lineage; then, it increased β-catenin expression and activation, which led to the induction of Osterix gene expression, the mature osteoblast commitment factor. The finding that spermine induces ASC to differentiate toward mature osteoblasts supports the use of these easily accessible mesenchymal stem cells coupled with PRP for orthopedic applications.

The induction of systemic defence responses in zucchini leaves treated by a water extract of Anabaena sp. BEA0300B strain was studied firstly through a bioassay under Podosphaera xanthii (Castagne) U. Braun and Shishkoff challenge. In a second experiment, enzyme activities correlated to induced systemic resistance were assayed 1, 2 and 3 days after treatment (DAT) with BEA0300B on untreated cotyledonar leaves. Endochitinase, β-N-acetylhexosaminidase, chitin 1,4-β-chitobiosidase, β-1,3-glucanase and peroxidases were spectrophotometrically determined. Enzyme isoforms were detected after isoelectric focusing. The extract reduced P. xanthii symptoms by 25%, similarly to chitosan, the positive control. BEA0300B treatment caused systemic accumulation of all the enzymes. In particular, the treatment provoked an early increase of total chitinase activity (15–38%) and of the expression of two constitutive chitinase isoforms, pI 4.4 (159%) and pI 4.6 (433%). The total β-1,3-glucanase and peroxidase activities were transiently increased. The expression of two constitutive isoforms of these enzyme increased, particularly pI 5.0 glucanase (148%, 1 DAT) and pI 4.9 peroxidase (181%, 2 DAT). BEA0300B water extract also showed a direct antifungal activity on pathogen sporulation.

Aqueous extracts from Anabaena minutissima BEA 0300B (ANA), Ecklonia maxima (ECK) and Jania adhaerens (JAN) were evaluated for their antifungal effect against powdery mildew disease caused by Podosphaera xanthii on cucumber detached cotyledons and seedlings. All the extracts were sprayed on detached cotyledons at 2.5, 5.0 and 10.0 mg dry biomass mL−1 water and those of ANA and JAN at 5.0 and 10.0 mg mL−1 on seedlings before pathogen challenge (106 spores mL−1). ANA and JAN at 5.0 and 10.0 mg mL−1 reduced infected area and fungal sporulation on both detached cotyledons and seedlings. ANA and JAN at 5.0 and 10.0 mg mL−1 were also evaluated for their elicitation of seedling defence responses, 1, 2 and 3 days before P. xanthii inoculation. Treatments reduced disease symptoms depending on extract, concentration and application time. Both extracts differentially induced the expression of PR genes, which may have concurred to pathogen control. At all times, ANA mainly induced AePR3 and PR1 genes, at 5.0 and 10.0 mg mL−1, respectively, while JAN mainly induced AePR3 and PR4 at 5.0 mg mL−1. This suggests that both ANA and JAN activated the expression of genes within the jasmonic acid and salicylic acid pathway. Proteins, phycobiliproteins, chlorophylls, carotenoids and antioxidant activities determined in the extracts could be involved in the antifungal effect or induction of plant systemic resistance. These results demonstrate that aqueous extracts from algae and cyanobacteria may be considered for further studies as a bio-based strategy for sustainable disease management.

OPINION article Front. Cell Dev. Biol., 19 January 2023Sec. Stem Cell Research Volume 11 - 2023 | https://doi.org/10.3389/fcell.2023.1129263

Methoctramine and its analogues are polymethylene tetramines that selectively bind to a variety of receptor sites. Although these compounds are widely used as pharmacological tools for receptor characterization, the toxicological properties of these polyamine-based structures are largely unknown. We have evaluated the cytotoxic effects of methoctramine and related symmetrical analogues differing in polymethylene chain length between the inner nitrogens against a panel of cell lines. Methoctramine caused cell death only at high micromolar concentrations, whereas its pharmacological action is exerted at nanomolar level. Increasing the spacing between the inner nitrogen atoms resulted in a significative increase in cytotoxicity. In particular, an elevated cytotoxicity is associated to a methylene chain length of 12 units dividing the inner amine functions (compound 5). H9c2 cardiomyoblasts were the most sensitive cells, followed by SH-SY5Y neuroblastoma, whereas HL60 leukaemia cells were much more resistant. Methoctramine and related compounds down-regulated ornithine decarboxylase, the first enzyme of polyamine biosynthesis even at non-toxic concentration. Further, methoctramine and compound 5 caused a limited up-regulation of spermine/spermidine N-acetyltransferase, suggesting that interference in polyamine metabolism is not a primary mechanism of toxicity. Methoctramine and its analogues bound to DNA with a higher affinity than spermine, but the correlation with their toxic effect was poor. The highly toxic compound 5 killed the cells in the absence of caspase activation and caused an increase in p53 expression and ERK1/2 phosphorylation. Compound 5 was directly oxidized by cell homogenates producing hydrogen peroxide and its toxic effect was partially subdued by the inhibition of its uptake, by the NMDA ligand MK-801, and by the antioxidant N-acetylcysteine, suggesting that compound 5 can act at different cellular levels and lead to oxidative stress.

Managing soil-borne pathogens is complex due to the restriction of the most effective synthetic fungicides for soil treatment. In this study, we showed that seed priming with Jania adhaerens water-soluble polysaccharides (JA WSPs) was successful in protecting tomato plants from the soil-borne pathogens Rhizoctonia solani, Pythium ultimum, and Fusarium oxysporum under greenhouse conditions. WSPs were extracted from dry thallus by autoclave-assisted method, and the main functional groups were characterized by using FT-IR spectroscopy. WSPs were applied by seed treatment at 0.3, 0.6 and 1.2 mg/mL doses, and each pathogen was inoculated singly in a growing substrate before seeding/transplant. Overall, WSPs increased seedling emergence, reduced disease severity and increased plant development depending on the dose. Transcriptional expression of genes related to phenylpropanoid, chlorogenic acid, SAR and ISR pathways, and chitinase and β-1,3 glucanase activities were investigated. Among the studied genes, HQT, HCT, and PR1 were significantly upregulated depending on the dose, while all doses increased PAL and PR2 expression as well as β-1,3 glucanase activity. These results demonstrated that, besides their plant growth promotion activity, JA WSPs may play a protective role in triggering plant defense responses potentially correlated to disease control against soil-borne pathogens.

The responses of AMP-activated protein kinase (AMPK) and Ornithine decarboxylase (ODC) to isoproterenol have been examined in H9c2 cardiomyoblasts, AMPK represents the link between cell growth and energy availability whereas ODC, the key enzyme in polyamine biosynthesis, is essential for all growth processes and it is thought to have a role in the development of cardiac hypertrophy. Isoproterenol rapidly induced ODC activity in H9c2 cardiomyoblasts by promoting the synthesis of the enzyme protein and this effect was counteracted by inhibitors of the PI3K/Akt pathway. The increase in enzyme activity became significant between 15 and 30min after the treatment. At the same time, isoproterenol stimulated the phosphorylation of AMPKα catalytic subunits (Thr172), that was associated to an increase in acetyl coenzyme A carboxylase (Ser72) phosphorylation. Downregulation of both α1 and α2 isoforms of the AMPK catalytic subunit by siRNA to knockdown AMPK enzymatic activity, led to superinduction of ODC in isoproterenol-treated cardiomyoblasts. Downregulation of AMPKα increased ODC activity even in cells treated with other adrenergic agonists and in control cells. Analogue results were obtained in SH-SY5Y neuroblastoma cells transfected with a shRNA construct against AMPKα. In conclusion, isoproterenol quickly activates in H9c2 cardiomyoblasts two events that seem to contrast one another. The first one, an increase in ODC activity, is linked to cell growth, whereas the second, AMPK activation, is a homeostatic mechanism that negatively modulates the first. The modulation of ODC activity by AMPK represents a mechanism that may contribute to control cell growth processes.

A reparative approach of disrupted epithelium in obstructive airway diseases, namely asthma and chronic obstructive pulmonary disease (COPD), may afford protection and long-lasting results compared to conventional therapies, e.g. corticosteroids or immunosuppressant drugs. Here we propose the polyamine spermidine as a novel therapeutic agent in airways diseases, based on a recently identified mode of action: T-cell protein tyrosine phosphatase (TCPTP) agonism. It may include and surpass single-inhibitors of stress and secondary growth factor pathway signaling, i.e. the new medicinal chemistry in lung diseases. Enhanced polyamine biosynthesis has been charged with aggravating prognosis by competing for L-arginine at detriment of nitric oxide (NO) synthesis with bronchoconstrictive effects. Although excess spermine, a higher polyamine, is harmful to airways physiology, spermidine can pivot the cell homeostasis during stress conditions by the activation of TCPTP. In fact, the dephosphorylating activity of TCPTP inhibits the signaling cascade that leads to the expression of genes involved in detachment and epithelial-to-mesenchymal transition (EMT), and increases the expression of adhesion and tight junction proteins, thereby enhancing the barrier functionality in inflammation-prone tissues. Moreover, a further beneficial effect of spermidine may derive from its ability to promote autophagy, possibly in a TCPTP-dependent way. Since doses of spermidine in the μM range are sufficient to activate TCPTP, low amounts of spermidine administered in sustained release modality may provide an optimal pharmacologic profile for the treatment of obstructive airway diseases

Osteoarthritis (OA) is the most common form of arthritis with increasing prevalence. Although it is a multifactorial disease, it is accepted that ageing can induce the onset of OA and has been proposed as the main risk factor of this pathology.1 The main reactive oxygen species (ROS) detected in chondrocytes are peroxynitrite (ONOO−) and hydrogen peroxide (H2O2), and when their overproduction is not counter-balanced by an efficient antioxidant system, the oxidative stress condition occurs that enhances cartilage degeneration and OA.2 Furthermore, H2O2 supplementation has been shown to elicit oxidative stress in chondrocytes.3, 4 So far, innovative strategies of treatments with no side effects need to be elucidated. For this purpose, diet-derived natural compounds raised a noteworthy interest due to their preventive and therapeutic action in OA.5, 6 Hydroxytyrosol (HT), a polyphenol contained in olive oil and derivatives, has been proposed as a fascinating molecule able to reduce oxidative stress-induced cellular damage and to change epigenetic signature by modulating a microRNA (miR) in chondrocytes.7, 8 According to our findings, miR-9 results to be overexpressed under chondrocyte exposure to H2O2 and miR-9 dysregulation under TGF-β1-dependent ROS increase has been reported in other cell models,9, 10 thus confirming its susceptibility to redox state and oxidative stress. However, the priming mechanism by which oxidative stress and HT could trigger these modulations is still lacking. Indeed, the molecular key underlying regulation of miR expression in OA is not completely clear and needs further investigation. In humans, miR-9 is transcribed from three independent genomic loci mapping to chromosomes 1q22 (MIR9-1), 5q14.3 (MIR9-2) and 15q26.1 (MIR9-3). Our present work sought to clarify this aspect by studying DNA methylation of the three miR-9 promoters in response to H2O2 and HT treatments in C-28/I2 chondrocytes. C-28/I2 is a human cell line representative of primary chondrocytes11 that has been used for deeper molecular studies to provide mechanistic explanations to the findings of previous work carried out on human primary chondrocytes.7 Cells, grown in DMEM medium supplemented with 10% foetal bovine serum, were incubated in the absence or presence of 100 µmol/L H2O2 for 2 hours; 100 µmol/L HT (Cayman Chemical) was added 30 minutes before H2O2. The concentration of HT was chosen on the basis of a published study,12 and previous experiments reported in our published manuscripts3, 7, 13 have confirmed the efficacy of this concentration in protecting chondrocytes from cell death with lack of toxicity. To assess the effects of modulation of methylase activity on miR-9 transcription, in a separate series of experiments increasing doses of 5′-azacytidine (5′Aza; 1-50 mmol/L) (Sigma-Aldrich) were added to cells 24 hours before collection. C-28/I2 cells were seeded in 6-well plates at a density of 2.5 × 105 cells/well in medium without antibiotics. The next day cells were transfected with ON-TARGETplus Human Sirt1 siRNA (25 nmol/L) or ON-TARGETplus non-targeting pool (25 nmol/L) (Dharmacon) by Lipofectamine® RNAiMax Reagent in Opti-MEM® Medium (Life Technologies) according to manufacturer's instructions and incubated for 48 hours before collection. Total cellular RNA and genomic DNA were extracted with 700 µL TRIZOL (Invitrogen), according to manufacturer's instructions. Human Methylated & Non-methylated DNA Set (Zymo Research, Irvine, CA, USA) was used to provide negative and positive controls. 500 ng of sample and control DNA was treated with sodium bisulfite using the EZ DNA Methylation Kit (Zymo Research, Irvine, CA, USA) according to the manufacturer's protocol. Six pairs of methylation-specific primers were designed by the online MethPrimer software14 and purchased by Invitrogen (miR-9-1 meth forward AGGTAGAGGTTTTTTTAGTTTCGTC and reverse AACCTTTCCTCTCTCTTTAAATCG; miR-9-1 unmeth forward GGTAGAGGTTTTTTTAGTTTTGTTG and reverse AACCTTTCCTCTCTCTTTAAATCAC; miR-9-2 meth forward TTGTTAGAAGAAAAATGTAGGTAAAGAC and reverse CCTACTACCCGAACAACGAC; miR-9-2 unmeth forward TTAGAAGAAAAATGTAGGTAAAGATGT and reverse CCTACTACCCAAACAACAAC; miR-9-3 meth forward TTTGTTTATTTTTTTTGGTTTTTCG and reverse CTCTCGACTCCTCTAACTCTTACGA; miR-9-3 unmeth forward GTGTTTGTTTATTTTTTTTGGTTTTTT and reverse TCCTCTCAACTCCTCTAACTCTTACA). Primers were annealed at 53°C. Platinum™ Taq DNA Polymerase (Thermofisher) was used according to the manufacturer's protocol. RNA pellets were treated with DNAse (DNA-free, Ambion) and quantified by using RiboGreen RNA quantitation reagent (Molecular Probes). MicroRNA reverse transcription was conducted with TaqMan MicroRNA RT kit (Life Technologies), and qPCR was performed with TaqMan Universal Mastermix (Life Technologies) following kit instructions. Mature miR quantification was performed by using TaqMan MicroRNA Assays for miR-9 and U6 snRNA (internal control), according to manufacturer's recommended protocols. Proteins were separated on 10% SDS polyacrylamide gels, transferred to nitrocellulose membranes (Amersham), and probed with anti-β-ACTIN (Sigma-Aldrich) and anti-SIRT1 (Santa Cruz Biotechnology) primary antibodies at 4°C overnight. After washes, membranes were incubated with horseradish peroxidase-conjugated anti-mouse (Santa Cruz Biotechnology) IgG for 1 hour. The chemiluminescent signals were detected using an ECL system (Luminata™ Crescendo, Millipore). Data are reported as mean ± standard deviation (SD). Means were compared with GraphPad Prism5 statistical software (GraphPad Software, Inc). Differences were considered statistically significant at P < .05. Our previous study7 showed that miR-9 levels increase after treatment with H2O2 and decrease with HT. In order to evaluate if miR-9 expression could be influenced by methylation status of its promoters in our cellular model (as drawn in Figure 1A), 5′-Aza, a DNA methyltransferase (DNMT) inhibitor, was used. The levels of miR-9 increased after 5′-Aza treatment in a dose-dependent manner (Figure 1B). Therefore, the status of CpG islands surrounding promoters of miR-9 genes is important for the regulation of gene expression. Promoter methylation levels of miR-9-1, miR-9-2 and miR-9-3 were assessed in response to HT and/or H2O2 by using methylation-specific PCR (MSP). As shown in Figure 1C, levels of miR-9 methylation were decreased in all three promoters of cells treated with H2O2 and, on the contrary, reestablished after pretreatment with HT. From a qualitative point of view, no difference in the methylation status among the three different promoters has been observed. SIRT1 has been reported as a genuine target of miR-9 and SIRT1 levels decreased in response to H2O2-induced oxidative stress.7 To determine whether SIRT1 could modulate methylation of miR-9 promoters in a negative feedback loop, C-28/I2 cells were depleted of SIRT1 by RNA interference. Protein samples were immunoblotted with SIRT1 antibody to test the transfection outcome (Figure 2A). Then, sample DNA was extracted and analysed by MSP. As shown in Figure 2B, SIRT1 knockdown changes methylation status of promoters by hypomethylating all three of them. However, we did not observe a corresponding increase in miR-9 expression in SIRT1-silenced cells (Figure 2C). Thus, SIRT1 knockdown by siRNA transfection or H2O2 treatment can demethylate the promoters, though only H2O2 treatment is able to modulate miR-9 expression in response to methylation status of CpG islands. In our previous work, we demonstrated that HT, a polyphenol found in olives and derivatives, can prevent oxidative stress-induced cell death and autophagy dysfunction by modulating miR-9 availability and its cognate target SIRT1. Thus, miR-9 has been identified as a crucial factor orchestrating the molecular response to H2O2 and HT in chondrocytes.7, 13 Dysregulated levels of miR-9 in OA patients have been published,15 and besides SIRT-1, other targets associated with OA pathogenesis have been reported, including MMP-1316 and monocyte chemo-attractant protein 1-induced protein 1 (MCPIP-1).17 Nevertheless, the fuse triggering the variations of miR expression was unknown. A genome-wide DNA methylation study performed in OA cartilage identified miR-9 as an OA susceptibility gene among other factors.18 To explore whether our treatments could influence miR-9 expression by modifying methylation status of CpG islands surrounding the three promoters of miR-9 genes, we treated the cells with the DNMT inhibitor 5′-Aza and detected a dose-dependent increase in miR-9 levels. Furthermore, all three miR-9 promoters were shown to be hypomethylated in cells treated with H2O2 and hypermethylated in cells treated with HT alone or both. Taken together, these results suggest that these treatments modulate miR-9 expression by exerting opposite effects on the promoter methylation status, with oxidative stress reducing and HT rescuing and sustaining the hypermethylation of CpG islands. Since no methylation differences among the three promoters have been highlighted, we could speculate that all the three genes contribute to the expression levels of miR-9. Since miR-9 reduces its direct target SIRT1, as demonstrated by luciferase assay,7 we investigated whether, in turn, SIRT1 could be implicated in the modulation of miR-9 levels in a negative feedback loop. However, miR-9 promoter hypomethylation induced by SIRT1 silencing through RNA interference did not correspond to an increase in miR-9 expression. Thus, demethylation of miR-9 promoters can favour but per se may not be sufficient to promote miR-9 expression. It may be hypothesized that miR-9 expression requires the involvement of some transcription factors, triggered upon oxidative stress or 5’-aza-induced general hypomethylation, but not following just SIRT1 silencing that may elicit hypomethylation restricted to miR-9 promoters. If previous work7 elucidated the role of this miR in the H2O2-promoted cell death and in the protective effect of HT in chondrocytes, these new findings provide the upstream mechanism influencing the variations of miR-9 expression. The identification of a miR able to address the cell fate in response to a protective and/or stress agent opens novel perspectives in the field of molecular therapy for degenerative diseases, such as OA. Indeed, a better understanding of the interaction of different epigenetic levels in OA pathogenesis, including promoter methylation status, miR expression and transcriptome changes, could be useful to prime further investigations for a miR-based strategy with nutraceutical support in the treatment of this disease. This work was supported by grants from University of Bologna (RFO) and Ministero della Salute, Italy (Fondi Cinque per Mille, year 2016). The authors have declared that there is no conflict of interest. SD designed the experiments. SD and SC performed the experiments. SD, SC, RMB and FF analysed and interpreted the data. SD, SC, RMB and FF contributed in writing and approving the manuscript. The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.

Abstract According to previous research, natural polyamines exert a role in regulating cell committment and differentiation from stemness during skeletal development. In order to assess whether distinct polyamine patterns are associated with different skeletal cell types, primary cultures of stem cells, chondrocytes or osteoblasts were dedicated for HPLC analysis of intracellular polyamines. Spermine (SPM) and Spermidine (SPD) levels were higher in adipose derived stem cells (ASC) compared to mature skeletal cells, i.e. chondrocytes and osteoblasts, confirming the connection of polyamine content with stemness. To establish whether polyamines can protect ASC against oxidative DNA damage in a 3-D differentiation model, the level of γH2AX was measured by western blot, and found to correlate with age and BMI of patients. Addition of either polyamine to ASC was able to hinder DNA damage in the low micromolecular range, with marked reduction of γH2AX level at 10 µM SPM and 5 µM SPD. Molecular analysis of the mechanisms that might underlie the protective effect of polyamine supplementation evidences a possible involvement of autophagy. Altogether, these results support the idea that polyamines are able to manage both stem cell differentiation and cell oxidative damage, and therefore represent appealing tools for regenerative and cell based applications.

Notch signaling has been identified as a critical regulator of cartilage development and homeostasis. Its pivotal role was established by both several joint specific Notch signaling loss of function mouse models and transient or sustained overexpression. NOTCH1 is the most abundantly expressed NOTCH receptors in normal cartilage and its expression increases in osteoarthritis (OA), when chondrocytes exit from their healthy "maturation arrested state" and resume their natural route of proliferation, hypertrophy, and terminal differentiation. The latter are hallmarks of OA that are easily evaluated in vitro in 2-D or 3-D culture models. The aim of our study was to investigate the effect of NOTCH1 knockdown on proliferation (cell count and Picogreen mediated DNA quantification), cell cycle (flow cytometry), hypertrophy (gene and protein expression of key markers such as RUNX2 and MMP-13), and terminal differentiation (viability measured in 3-D cultures by luminescence assay) of human OA chondrocytes. NOTCH1 silencing of OA chondrocytes yielded a healthier phenotype in both 2-D (reduced proliferation) and 3-D with evidence of decreased hypertrophy (reduced expression of RUNX2 and MMP-13) and terminal differentiation (increased viability). This demonstrates that NOTCH1 is a convenient therapeutic target to attenuate OA progression.

Osteoarthritis (OA) is the most common joint disease, but no effective and safe disease-modifying treatment is available. Risk factors such as age, sex, genetics, injuries and obesity can concur to the onset of the disease, variably triggering the loss of maturational arrest of chondrocytes further sustained by oxidative stress, inflammation and catabolism. Different types of nutraceuticals have been studied for their anti-oxidative and anti-inflammatory properties. Olive-derived polyphenols draw particular interest due to their ability to dampen the activation of pivotal signaling pathways in OA. Our study aims to investigate the effects of oleuropein (OE) and hydroxytyrosol (HT) in in vitro OA models and elucidate their possible effects on NOTCH1, a novel therapeutic target for OA. Chondrocytes were cultured and exposed to lipopolysaccharide (LPS). Detailed analysis was carried out about the OE/HT mitigating effects on the release of ROS (DCHF-DA), the increased gene expression of catabolic and inflammatory markers (real time RT-PCR), the release of MMP-13 (ELISA and Western blot) and the activation of underlying signaling pathways (Western blot). Our findings show that HT/OE efficiently attenuates LPS-induced effects by firstly reducing the activation of JNK and of the NOTCH1 pathway downstream. In conclusion, our study provides molecular bases supporting the dietary supplementation of olive-derived polyphenols to revert/delay the progression of OA.

Chondrocyte survival is closely linked to cartilage integrity, and forms of chondrocyte apoptotic death can contribute to cartilage degeneration in articular diseases. Since growing evidence also implicates polyamines in the control of cell death, we have been investigating the role of polyamine metabolism in chondrocyte survival and apoptosis. Treatment of human C-28/I2 chondrocytes with N(1),N(11)-diethylnorspermine (DENSPM), a polyamine analogue with clinical relevance as an experimental anticancer agent, inhibited polyamine biosynthesis and induced polyamine catabolism, thus rapidly depleting all main polyamines. DENSPM did not increase significantly caspase activity, but provoked a late cell death associated to DNA fragmentation. A short treatment with DENSPM did not reduce cell viability when given alone, but enhanced caspase-3 and -9 activation in chondrocytes exposed to tumor necrosis factor-alpha (TNF) and cycloheximide (CHX). A longer treatment with DENSPM however reduced caspase response to TNF plus CHX. Depletion of all polyamines obtained by specific inhibitors of polyamine biosynthesis did not cause cell death and contrasted apoptosis by decreasing caspase activities. In conclusion, following DENSPM treatment, C-28/I2 chondrocytes are initially sensitized to caspase 9-dependent apoptosis in the presence of TNF and CHX and may eventually undergo a late and mainly caspase-independent cell death in the absence of other stimuli. Moreover, these results indicate that a reduction of polyamine levels not only leads to inhibition of cell proliferation, but also of caspase-mediated pathways of chondrocyte apoptosis.

Purpose: A major opportunity is represented by the search for food-derived molecules able to interfere with the processes involved in the pathogenesis or progression of chronic degenerative- and age-related diseases, such as osteoarthritis (OA). Recent findings attributed a potential role to autophagy in the regulation of the cellular response to several stress stimuli. Although its role is context- and tissue-dependent and still unclear, autophagy has been observed to decrease during aging and several age-related diseases, including OA.

While high levels of saturated fatty acids are associated with impairment of cardiovascular functions, n-3 polyunsaturated fatty acids (PUFAs) have been shown to exert protective effects. However the molecular mechanisms underlying this evidence are not completely understood. In the present study we have used rat H9c2 ventricular cardiomyoblasts as a cellular model of lipotoxicity to highlight the effects of palmitate, a saturated fatty acid, on genetic and epigenetic modulation of fatty acid metabolism and fate, and the ability of PUFAs, eicosapentaenoic acid, and docosahexaenoic acid, to contrast the actions that may contribute to cardiac dysfunction and remodeling. Treatment with a high dose of palmitate provoked mitochondrial depolarization, apoptosis, and hypertrophy of cardiomyoblasts. Palmitate also enhanced the mRNA levels of sterol regulatory element-binding proteins (SREBPs), a family of master transcription factors for lipogenesis, and it favored the expression of genes encoding key enzymes that metabolically activate palmitate and commit it to biosynthetic pathways. Moreover, miR-33a, a highly conserved microRNA embedded in an intronic sequence of the SREBP2 gene, was co-expressed with the SREBP2 messenger, while its target carnitine palmitoyltransferase-1b was down-regulated. Manipulation of the levels of miR-33a and SREBPs allowed us to understand their involvement in cell death and hypertrophy. The simultaneous addition of PUFAs prevented the effects of palmitate and protected H9c2 cells. These results may have implications for the control of cardiac metabolism and dysfunction, particularly in relation to dietary habits and the quality of fatty acid intake.

Purpose: Osteoarthritis (OA) is the most common form of arthritis and one of the most significant causes of disability in the world. OA mainly affects the major joints such as knee and hip, impairing the structural integrity of articular cartilage. At present, there are unsatisfactory drug treatments since current available pharmacologic therapies are not able to prevent or arrest the development of OA. In this scenario, an alternative and safe opportunity may be represented by nutraceuticals and natural occurring compounds. Among these, spermidine (SPD), an ubiquitous natural polyamine involved in a wide range of cellular processes, is widely recognized to induce autophagy and to reduce the oxidative stress in several cellular models. The object of this study has been to investigate the role of SPD in the context of OA cartilage, evaluating its ability to protect cultured articular chondrocytes against hydrogen peroxide (H2O2)-induced oxidative stress by modulating the autophagic process. Methods: Chondrocytes, obtained from OA patients undergoing knee arthroplasty, were isolated by sequential enzymatic digestion, expanded in vitro and then seeded at high-density. After 24 h starvation, we treated the cells with SPD (100 nM, 24 h) and oxidative stress was induced through incubation with H2O2 (500 μM, 24 h). The extent of cell death was analysed by Flow Cytometry detection of Sytox Green staining, a probe that is instead excluded by viable cells. SPD cytoprotection from oxidative stress was measured by flow cytometric analysis of reduction of γH2AX foci, markers of double strand breaks. Induction of autophagy was also evaluated with Flow Cytometry, evaluating the microtubule-associated protein 1 light chain 3 II (LC3II), a recognized autophagosomal marker. The role of autophagy in SPD cytoprotection was analysed in another series of experiments performed after the silencing of the autophagic gene ATG5, where cell viability was estimated through the trypan blue exclusion test. Finally, the cells were seeded in chamber slides to evaluate mitophagy (selective degradation of mitochondria by autophagy) by immunofluorescent co-localization of LC3II and TOM20, a mitochondrial outer membrane marker. The extent of SPD modulation of the H2O2-dependent induction of inflammatory and degradative markers was evaluated by Real Time PCR. Results: SPD pre-treatment was able to reduce the percentage of dead cells after H2O2 exposure. SPD pre-treatment was also able to reduce the induction of OA-related markers promoted by H2O2: specifically, we found a significant reduction in mRNA expression of several OA markers, such as MMP13, VEGF, RUNX2 and iNOS. The protection afforded by SPD was also confirmed by a significant reduction of the extent of the γH2AX-associated foci after exposure to H2O2. Furthermore, we detected an increased LC3II signal in cells pre-treated with SPD compared to non-treated controls, indicating SPD ability to induce autophagy in our cellular model. These findings prompted us to further investigating the link between SPD and autophagy by silencing ATG5. Our preliminary data suggested that an efficient autophagy is crucial for the protection afforded by SPD against oxidative stress since SPD cytoprotection was almost lost when ATG5 had been previously silenced. Finally, the results of fluorescence microscopy analysis of the co-localization of mitochondrial and autophagy markers indicate the occurrence of mitophagy in our cellular model, strongly increased by SPD. Conclusions: Our findings highlight the chondroprotective and anti-oxidant activity of SPD and suggest that an efficient autophagy is necessary for the protection afforded by SPD against oxidative stress. Considering the importance of non-invasive strategies in the treatment of OA, we propose SPD as a promising candidate for a non-pharmacologic treatment of OA.

OBJECTIVE: To our knowledge, no relationship has been revealed between nutraceutical compounds and microRNA (miR) network in OA models, so far.  Here, we investigated whether and how a miR is implicated in hydroxytyrosol (HT)-mediated chondroprotection following H2O2-promoted oxidative stress through the post-transcriptional modulation of sirtuin-1. METHODOLOGY: Human primary chondrocytes and C-28/I2 cell line were treated with 100µM HT 30 minutes before 100µM H2O2 addition. In silico analysis were exploited to select putative miR candidates able to target sirtuin-1 mRNA. Transient transfection approach was performed to examine the effects after modulation of miR levels. RESULTS: MiR-9 was identified as a putative regulator of sirtuin-1 and confirmed after luciferase-based gene reporter assay. Moreover, tuning of miR-9 levels is responsible for both cell death induced by H2O2 partly through down-regulation of sirtuin-1 and the protective effect of HT, as observed by trypan blue exclusion and caspase activity assays following transfection of miR-9 inhibitor and mimic. CONCLUSION: The molecular dissection of how bioactive compounds exert beneficial effects through induction of epigenetic changes, may disclose an interesting therapeutic tool and represents a research topic that deserves further investigation.

Purpose: Adipose derived stem cells (ASC) are an attractive cell source for regenerative purposes in orthopedics, because of their accessibility and high differentiation potential, upon delivery of appropriate stimuli which mimick the organogenetic natural microenvironment. Polyamines are naturally occurring, positively charged polycations able to interact with negatively charged compounds and structures within the living cell thus controlling several cellular processes including cell differentiation and already implicated in bone growth and development. Hence, we investigated the effects of exogenously added spermine in chondrogenesis of ASC recapitulated in 3D micromass cultures, to tease out the effects on gene and protein expression of key chondrogenesis regulatory transcription factors, markers and effectors. Methods: Adipose tissue was obtained from the surgical subcutaneous area of 20 OA patients (age 29-72) undergoing hip arthroplasty. ASC were obtained from the stromal vascular fraction with conventional procedures and used within p2-p3 passage. To monitor phenotypic homogeneity, flow cytometric analysis of the cells at p1 passage was carried out to evaluate the expression of CD 31, 34, 45, 271, 44, 73, 90 and 105. Micromasses were seeded in control (D-MEM 10% FCS and 50 μg/ml ascorbic acid) or chondrogenic medium, with or without the addition of 5 μM spermine to evaluate its chondrogenic ability across 1, 2 and 3 weeks chondrogenic maturation. Osteogenic medium was used as control. We evaluated the effects of spermine addition on molecular markers of chondrocyte differentiation at the level of gene (real time PCR) and protein (western blot and immunohistochemistry) expression as well as the effects on extracellular matrix deposition and mineralization. Results: The number of ASC per unit (g) of adipose tissue was inversely correlated with the age of both male and female subjects and positively correlated with the body mass index. ASC samples were highly positive for CD44, CD73 and CD90, being the expression of the latter inversely correlated with the age of the subjects. In micromasses, spermine was able to increase the gene expression of Sox-9 and Runx-2 which was particularly consistent at 2 weeks in chondrogenic medium, and alkaline phosphatase which was increased upon spermine addition already at early time points both in control and chondrogenic medium. Western blot confirmed an increased Runx-2 expression upon spermine addition. Mineralization evaluated in micromass lysates indicated an increased calcium content upon spermine addition particularly at 2 weeks in chondrogenic medium. Conclusions: Polyamine can represent a potential tool to improve the differentiation of ASC for bone tissue engineering via recapitulation of endochondral ossification. Acknowledgement: This work was supported by FIRB (MIUR, Italy) and Fondi cinque per mille (Ministero della Salute, Italy). The authors wish to thank Prof C. Ventura for helpful discussion during the early phase of the work.

Introduction: Apoptotic cell death of cardiomyocytes is involved in several cardiovascular diseases including ischemia, hypertrophy and heart failure, thus representing a potential therapeutic target. Apoptosis of cardiac cells can be induced experimentally by several stimuli including hypoxia, serum withdrawal or combination of both. Several lines of research suggest that neurohormonal mechanisms play a central role in the progression of heart failure. In particular, excessive activation of the sympathetic nervous system or the renin-angiotensin-aldosterone system is known to have deleterious effects on the heart. Recent studies report that norepinephrine (NE), the primary transmitter of sympathetic nervous system, and aldosterone (ALD), which is actively produced in failing human heart, are able to induce apoptosis of rat cardiomyocytes. Polyamines are biogenic amines involved in many cellular processes, including apoptosis. Actually it appears that these molecules can act as promoting, modulating or protective agents in apoptosis depending on apoptotic stimulus and cellular model. We have studied the involvement of polyamines in the apoptosis of cardiac cells induced in a model of simulated ischemia and following treatment with NE or ALD. Methods: H9c2 cardiomyoblasts were exposed to a condition of simulated ischemia, consisting of hypoxia plus serum deprivation. Cardiomyocyte cultures were prepared from 1-3 day-old neonatal Wistar rat hearts. Polyamine depletion was obtained by culturing the cells in the presence of α-difluoromethylornithine (DFMO). Polyamines were separated and quantified in acidic cellular extracts by HPLC after derivatization with dansyl chloride. Caspase activity was measured by the cleavage of the fluorogenic peptide substrate. Ornithine decarboxylase (ODC) activity was measured by estimation of the release of 14C-CO2 from 14C-ornithine. DNA fragmentation was visualized by the method of terminal transferase-mediated dUTP nick end-labeling (TUNEL), and DNA laddering on agarose gel electophoresis. Cytochrome c was detected by immunoflorescent staining. Activation of signal transduction pathways was investigated by western blotting. Results: The results indicate that simulated ischemia, NE and ALD cause an early induction of the activity of ornithine decarboxylase (ODC), the first enzyme in polyamine biosynthesis, followed by a later increase of caspase activity, a family of proteases that execute the death program and induce cell death. This effect was prevented in the presence of DFMO, an irreversible inhibitor of ODC, thus suggesting that polyamines are involved in the execution of the death program activated by these stimuli. In H9c2 cells DFMO inhibits several molecular events related to apoptosis that follow simulated ischemia, such as the release of cytochrome c from mitochondria, down-regulation of Bcl-xL, and DNA fragmentation. The anti-apoptotic protein survivin is down-regulated after ALD or NE treatement and polyamine depletion obtained by DFMO partially opposes survivin decrease. Moreover, a study of key signal transduction pathways governing cell death and survival, revealed an involvement of AMP activated protein kinase (AMPK) and AKT kinase, in the modulation by polyamines of the response of cardiomyocytes to NE. In fact polyamine depleted cells show an altered pattern of AMPK and AKT activation that may contrast apoptosis and appears to result from a differential effect on the specific phosphatases that dephosphorylate and switch off these signaling proteins. Conclusions: These results indicate that polyamines are involved in the execution of the death program activated in cardiac cells by heart failure-related stimuli, like ischemia, ALD and NE, and suggest that their apoptosis facilitating action is mediated by a network of specific phosphatases and kinases.