Sasanka Ramanadham

Among the family of phospholipases A₂ (PLA₂s) are the Ca²⁺-independent PLA₂s (iPLA₂s) and they are designated group VI iPLA₂s. In relation to secretory and cytosolic PLA₂s, the iPLA₂s are more recently described and details of their expression and roles in biological functions are rapidly emerging. The iPLA₂s or patatin-like phospholipases (PNPLAs) are intracellular enzymes that do not require Ca²⁺ for activity, and contain lipase (GXSXG) and nucleotide-binding (GXGXXG) consensus sequences. Though nine PNPLAs have been recognized, PNPLA8 (membrane-associated iPLA₂γ) and PNPLA9 (cytosol-associated iPLA₂β) are the most widely studied and understood. The iPLA₂s manifest a variety of activities in addition to phospholipase, are ubiquitously expressed, and participate in a multitude of biological processes, including fat catabolism, cell differentiation, maintenance of mitochondrial integrity, phospholipid remodeling, cell proliferation, signal transduction, and cell death. As might be expected, increased or decreased expression of iPLA₂s can have profound effects on the metabolic state, CNS function, cardiovascular performance, and cell survival; therefore, dysregulation of iPLA₂s can be a critical factor in the development of many diseases. This review is aimed at providing a general framework of the current understanding of the iPLA₂s and discussion of the potential mechanisms of action of the iPLA₂s and related involved lipid mediators.

Streptozotocin (STZ) is selectively toxic to insulin-secreting β-cells of pancreatic islets and induces impairment of islet glucose oxidation and of glucose-induced insulin secretion. Similar effects are induced by Interleukin-1 (IL-1), and the deleterious effects of IL-1 on islets appear to be mediated by nitric oxide (NO). STZ contains a nitroso moiety and may liberate NO by processes analogous to those for the NO-releasing drug nitroprusside. NO is rapidly transformed to nitrite in aqueous solution, and NO activates heme-containing enzymes such as guanylyl cyclase and inhibits iron-sulfur enzymes such as mitochondrial aconitase. Data presented here indicate that incubation of rat islets with STZ at concentrations that impair insulin secretion results in generation of nitrite, stimulation of islet guanylyl cyclase and accumulation of cGMP, and inhibition of islet mitochondrial aconitase activity to a degree similar to that achieved by IL-1. Effects of STZ on β-cells may be mediated by local liberation of NO from STZ within islets.

The Group VIA Phospholipase A(2) (iPLA(2)beta) is the first recognized cytosolic Ca(2+)-independent PLA(2) and has been proposed to participate in arachidonic acid (20:4) incorporation into glycerophosphocholine lipids, cell proliferation, exocytosis, apoptosis, and other processes. To study iPLA(2)beta functions, we disrupted its gene by homologous recombination to generate mice that do not express iPLA(2)beta. Heterozygous iPLA(2)beta(+/-) breeding pairs yield a Mendelian 1:2:1 ratio of iPLA(2)beta(+/+), iPLA(2)beta(+/-), and iPLA(2)beta(-/-) pups and a 1:1 male:female gender distribution of iPLA(2)beta(-/-) pups. Several tissues of wild-type mice express iPLA(2)beta mRNA, immunoreactive protein, and activity, and testes express the highest levels. Testes or other tissues of iPLA(2)beta(-/-) mice express no iPLA(2)beta mRNA or protein, but iPLA(2)beta(-/-) testes are not deficient in 20:4-containing glycerophosphocholine lipids, indicating that iPLA(2)beta does not play an obligatory role in formation of such lipids in that tissue. Spermatozoa from iPLA(2)beta(-/-) mice have reduced motility and impaired ability to fertilize mouse oocytes in vitro and in vivo, and inhibiting iPLA(2)beta with a bromoenol lactone suicide substrate reduces motility of wild-type spermatozoa in a time- and concentration-dependent manner. Mating iPLA(2)beta(-/-) male mice with iPLA(2)beta(+/+), iPLA(2)beta(+/-), or iPLA(2)beta(-/-) female mice yields only about 7% of the number of pups produced by mating pairs with an iPLA(2)beta(+/+) or iPLA(2)beta(+/-) male, but iPLA(2)beta(-/-) female mice have nearly normal fertility. These findings indicate that iPLA(2)beta plays an important functional role in spermatozoa, suggest a target for developing male contraceptive drugs, and complement reports that disruption of the Group IVA PLA(2) (cPLA(2)alpha) gene impairs female reproductive ability.

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTInhibition of arachidonate release by secretagogue-stimulated pancreatic islets suppresses both insulin secretion and the rise in .beta.-cell cytosolic calcium ion concentrationSasanka Ramanadham, Richard W. Gross, Xianlin Han, and John TurkCite this: Biochemistry 1993, 32, 1, 337–346Publication Date (Print):January 12, 1993Publication History Published online1 May 2002Published inissue 12 January 1993https://doi.org/10.1021/bi00052a042RIGHTS & PERMISSIONSArticle Views126Altmetric-Citations104LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (2 MB) Get e-Alertsclose Get e-Alerts

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTRat and human pancreatic islet cells contain a calcium ion independent phospholipase A2 activity selective for hydrolysis of arachidonate which is stimulated by adenosine triphosphate and is specifically localized to islet .beta.-cellsRichard W. Gross, Sasanka Ramanadham, Kelly K. Kruszka, Xianlin Han, and John TurkCite this: Biochemistry 1993, 32, 1, 327–336Publication Date (Print):January 12, 1993Publication History Published online1 May 2002Published inissue 12 January 1993https://doi.org/10.1021/bi00052a041Request reuse permissionsArticle Views147Altmetric-Citations96LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (1 MB) Get e-Alertsclose Get e-Alerts

The vanadate and vanadyl forms of vanadium have been shown by many investigators to have insulinlike effects on glucose metabolism. Many investigators have shown that vanadium, or its salts, counteracts the hyperglycemia associated with streptozocin-induced diabetes (STZ-D) in the rat, although insulin secretion remains depressed. Studies of the action of vanadate on insulin secretion and glucose metabolism have not addressed the question of possible long-term effects of this compound on glucose metabolism extending beyond the period of oral administration. This study was undertaken to assess the effects of treatment (3 wk) and withdrawal of vanadyl sulfate (13 wk) on glucose metabolism, insulin secretion, and islet insulin content of STZ-D rats. Our results indicate that STZ-D rats that have had blood glucose levels normalized by 3 wk of vanadyl treatment remain normoglycemic after 13 wk of withdrawal from treatment. Normal glucose tolerance was observed in vanadyl-treated diabetic animals despite depressed fasting and glucose-stimulated plasma insulin levels. Insulin secretion from the isolated perfused pancreas was greater after vanadyl treatment than in untreated diabetic rats, although it was only 12% of values from controls. Three weeks of vanadyl treatment of STZ-D rats, followed by 13 wk of withdrawal, yielded islets close in size and insulin content of control islets, even though in vivo and in vitro insulin secretion was impaired. This study has shown that short-term vanadyl treatment of STZ-D rats yields normalization of glucose tolerance and protection of islets from destruction by STZ.(ABSTRACT TRUNCATED AT 250 WORDS)

Endoplasmic reticulum (ER) stress induces INS-1 cell apoptosis by a pathway involving Ca2+-independent phospholipase A2 (iPLA2β)-mediated ceramide generation, but the mechanism by which iPLA2β and ceramides contribute to apoptosis is not well understood. We report here that both caspase-12 and caspase-3 are activated in INS-1 cells following induction of ER stress with thapsigargin, but only caspase-3 cleavage is amplified in iPLA2β overexpressing INS-1 cells (OE), relative to empty vector-transfected cells, and is suppressed by iPLA2β inhibition. ER stress also led to the release of cytochrome c and Smac and, unexpectedly, their accumulation in the cytosol is amplified in OE cells. These findings raise the likelihood that iPLA2β participates in ER stress-induced apoptosis by activating the intrinsic apoptotic pathway. Consistent with this possibility, we find that ER stress promotes iPLA2β accumulation in the mitochondria, opening of mitochondrial permeability transition pore, and loss in mitochondrial membrane potential (ΔΨ) in INS-1 cells and that these changes are amplified in OE cells. ER stress also led to greater ceramide generation in ER and mitochondria fractions of OE cells. Exposure to ceramide alone induces loss in ΔΨ and apoptosis and these are suppressed by forskolin. ER stress-induced mitochondrial dysfunction and apoptosis are also inhibited by forskolin, as well as by inactivation of iPLA2β or NSMase, suggesting that iPLA2β-mediated generation of ceramides via sphingomyelin hydrolysis during ER stress affect the mitochondria. In support, inhibition of iPLA2β or NSMase prevents cytochrome c release. Collectively, our findings indicate that the iPLA2β-ceramide axis plays a critical role in activating the mitochondrial apoptotic pathway in insulin-secreting cells during ER stress. Endoplasmic reticulum (ER) stress induces INS-1 cell apoptosis by a pathway involving Ca2+-independent phospholipase A2 (iPLA2β)-mediated ceramide generation, but the mechanism by which iPLA2β and ceramides contribute to apoptosis is not well understood. We report here that both caspase-12 and caspase-3 are activated in INS-1 cells following induction of ER stress with thapsigargin, but only caspase-3 cleavage is amplified in iPLA2β overexpressing INS-1 cells (OE), relative to empty vector-transfected cells, and is suppressed by iPLA2β inhibition. ER stress also led to the release of cytochrome c and Smac and, unexpectedly, their accumulation in the cytosol is amplified in OE cells. These findings raise the likelihood that iPLA2β participates in ER stress-induced apoptosis by activating the intrinsic apoptotic pathway. Consistent with this possibility, we find that ER stress promotes iPLA2β accumulation in the mitochondria, opening of mitochondrial permeability transition pore, and loss in mitochondrial membrane potential (ΔΨ) in INS-1 cells and that these changes are amplified in OE cells. ER stress also led to greater ceramide generation in ER and mitochondria fractions of OE cells. Exposure to ceramide alone induces loss in ΔΨ and apoptosis and these are suppressed by forskolin. ER stress-induced mitochondrial dysfunction and apoptosis are also inhibited by forskolin, as well as by inactivation of iPLA2β or NSMase, suggesting that iPLA2β-mediated generation of ceramides via sphingomyelin hydrolysis during ER stress affect the mitochondria. In support, inhibition of iPLA2β or NSMase prevents cytochrome c release. Collectively, our findings indicate that the iPLA2β-ceramide axis plays a critical role in activating the mitochondrial apoptotic pathway in insulin-secreting cells during ER stress. Diabetes mellitus is the most prevalent human metabolic disease resulting from the loss and/or dysfunction of β-cells in pancreatic islets. Type 1 diabetes mellitus (T1DM) 2The abbreviations used are: T1DM, type 1 diabetes mellitus; T2DM, type 2 diabetes mellitus; BEL, bromoenol lactone suicide inhibitor of iPLA2β; CM, ceramide; ECL, enhanced chemiluminescence; ER, endoplasmic reticulum; GPC, glycerophosphocholine; iPLA2β, β-isoform of group VIA calcium-independent phospholipase A2; ESI, electrospray ionization; ΔΨ, mitochondrial membrane potential; MS, mass spectrometry; PTP, mitochondrial permeability transition pore; NSMase, neutral sphingomyelinase; OE, iPLA2β-overexpressing INS-1 cells; PBS, phosphate-buffered saline; PLA2, phospholipase A2; SM, sphingomyelin; TUNEL, terminal deoxynucleotidyl transferase-mediated (fluorescein) dUTP nick end labeling; DMSO, dimethyl sulfoxide; PERK, pancreatic ER kinase; eIF, eukaryotic initiation factor; DAPI, 4′,6-diamidino-2-phenylindole. is caused by autoimmune β-cell destruction (1.Tisch R. McDevitt H. Cell. 1996; 85: 291-297Abstract Full Text Full Text PDF PubMed Scopus (854) Google Scholar) and apoptosis plays a prominent role in the loss of β-cells during development of T1DM (1.Tisch R. McDevitt H. Cell. 1996; 85: 291-297Abstract Full Text Full Text PDF PubMed Scopus (854) Google Scholar, 2.Mathis D. Vence L. Benoist C. Nature. 2001; 414: 792-798Crossref PubMed Scopus (763) Google Scholar). Type 2 diabetes mellitus (T2DM) results from a progressive decline in β-cell function and chronic insulin resistance (3.DeFronzo R.A. Diabetes. 1988; 37: 667-687Crossref PubMed Google Scholar, 4.Kudva Y.C. Butler P.C. Draznin B. Rizza R. Clinical Research in Diabetes and Obesity. Humana Press, Totowa, NJ1997: 119-136Crossref Google Scholar) that is also associated with decreases in β-cell mass due to increased β-cell apoptosis (5.Butler A.E. Janson J. Bonner-Weir S. Ritzel R. Rizza R.A. Butler P.C. Diabetes. 2003; 52: 102-110Crossref PubMed Scopus (3281) Google Scholar, 6.Yoon K.H. Ko S.H. Cho J.H. Lee J.M. Ahn Y.B. Song K.H. Yoo S.J. Kang M.I. Cha B.Y. Lee K.W. Son H.Y. Kang S.K. Kim H.S. Lee I.K. Bonner-Weir S. J. Clin. Endocrinol. Metab. 2003; 88: 2300-2308Crossref PubMed Scopus (503) Google Scholar). Autopsy studies indicate that the β-cell mass in obese T2DM subjects is smaller than that in obese non-diabetic subjects (7.Kloppel G. Lohr M. Habich K. Oberholzer M. Heitz P.U. Surv. Synth. Pathol. Res. 1985; 4: 110-125PubMed Google Scholar, 8.Stefan Y. Orci L. Malaisse-Lagae F. Perrelet A. Patel Y. Unger R.H. Diabetes. 1982; 31: 694-700Crossref PubMed Scopus (0) Google Scholar) and that the loss in β-cell function in non-obese T2DM is associated with decreases in β-cell mass (5.Butler A.E. Janson J. Bonner-Weir S. Ritzel R. Rizza R.A. Butler P.C. Diabetes. 2003; 52: 102-110Crossref PubMed Scopus (3281) Google Scholar, 6.Yoon K.H. Ko S.H. Cho J.H. Lee J.M. Ahn Y.B. Song K.H. Yoo S.J. Kang M.I. Cha B.Y. Lee K.W. Son H.Y. Kang S.K. Kim H.S. Lee I.K. Bonner-Weir S. J. Clin. Endocrinol. Metab. 2003; 88: 2300-2308Crossref PubMed Scopus (503) Google Scholar). β-Cell mass is regulated by a balance between β-cell replication/neogenesis and β-cell death resulting from apoptosis (9.Bernard C. Berthault M.-F. Saulnier C. Ktorza A. Fed. Am. Soc. Exp. Biol. J. 1999; 13: 1195-1205Crossref PubMed Scopus (118) Google Scholar, 10.Pick A. Clark J. Kubstrup C. Levisetti M. Pugh W. Bonner-Weir S. Polonsky K.S. Diabetes. 1998; 47: 358-364Crossref PubMed Scopus (474) Google Scholar). Findings in rodent models of T2DM (10.Pick A. Clark J. Kubstrup C. Levisetti M. Pugh W. Bonner-Weir S. Polonsky K.S. Diabetes. 1998; 47: 358-364Crossref PubMed Scopus (474) Google Scholar, 11.Butler A.E. Janson J. Soeller W.C. Butler P.C. Diabetes. 2003; 52: 2304-2314Crossref PubMed Scopus (337) Google Scholar) and in human T2DM (5.Butler A.E. Janson J. Bonner-Weir S. Ritzel R. Rizza R.A. Butler P.C. Diabetes. 2003; 52: 102-110Crossref PubMed Scopus (3281) Google Scholar, 6.Yoon K.H. Ko S.H. Cho J.H. Lee J.M. Ahn Y.B. Song K.H. Yoo S.J. Kang M.I. Cha B.Y. Lee K.W. Son H.Y. Kang S.K. Kim H.S. Lee I.K. Bonner-Weir S. J. Clin. Endocrinol. Metab. 2003; 88: 2300-2308Crossref PubMed Scopus (503) Google Scholar) indicate that the decrease in β-cell mass in T2DM is not attributable to reduced β-cell proliferation or neogenesis but to increased β-cell apoptosis. Emerging evidence also suggests that cytokine-mediated β-cell apoptosis is a contributor to β-cell death during the development of autoimmune T1DM (1.Tisch R. McDevitt H. Cell. 1996; 85: 291-297Abstract Full Text Full Text PDF PubMed Scopus (854) Google Scholar, 2.Mathis D. Vence L. Benoist C. Nature. 2001; 414: 792-798Crossref PubMed Scopus (763) Google Scholar, 12.Araki E. Oyadomari S. Mori M. Exp. Biol. Med. 2003; 228: 1213-1217Crossref PubMed Scopus (152) Google Scholar, 13.Cardozo A.K. Ortis F. Storling J. Feng Y.-M. Rasschaert J. Tonnesen M. Van Eylen F. Mandrup-Poulsen T. Herchuelz A. Eizirik D.L. Diabetes. 2005; 54: 452-461Crossref PubMed Scopus (427) Google Scholar). It is therefore important to understand the mechanisms underlying β-cell apoptosis if this process is to be prevented or delayed. β-Cell apoptosis can be mediated via an extrinsic pathway involving interaction of a stimulant with death receptors residing in the plasma membrane or via an intrinsic pathway involving mitochondrial signaling (14.Diaz-Horta O. Kamagate A. Herchuelz A. Van Eylen F. Diabetes. 2002; 51: 1815-1824Crossref PubMed Scopus (45) Google Scholar). A third organelle gaining prominence as a participant in apoptosis is the endoplasmic reticulum (ER) (14.Diaz-Horta O. Kamagate A. Herchuelz A. Van Eylen F. Diabetes. 2002; 51: 1815-1824Crossref PubMed Scopus (45) Google Scholar, 15.Rao R.V. Castro-Obregon S. Frankowski H. Schuler M. Stoka V. del Rio G. Bredesen D.E. Ellerby H.M. J. Biol. Chem. 2002; 277: 21836-21842Abstract Full Text Full Text PDF PubMed Scopus (438) Google Scholar). A number of factors can induce ER stress leading to the onset of various diseases, including Alzheimer and Parkinson (16.Kaufman R.J. Genes Dev. 1999; 13: 1211-1233Crossref PubMed Scopus (1934) Google Scholar). β-Cell death in the Akita diabetic (17.Oyadomari S. Araki E. Mori M. Apoptosis. 2002; 7: 335-345Crossref PubMed Scopus (448) Google Scholar, 18.Oyadomari S. Koizumi A. Takeda K. Gotoh T. Akira S. Araki E. Mori M. J. Clin. Investig. 2002; 109: 525-532Crossref PubMed Scopus (790) Google Scholar) and NOD.k iHEL nonimmune (19.Socha L. Silva D. Lesage S. Goodnow C. Petrovsky N. Ann. N. Y. Acad. Sci. 2003; 1005: 178-183Crossref PubMed Scopus (23) Google Scholar) diabetic mouse models is also attributed to ER stress. In addition, mutations in genes encoding the ER-stress transducing enzyme pancreatic ER kinase (PERK) (20.Harding H.P. Zeng H. Zhang Y. Jungries R. Chung P. Plesken H. Sabatini D.D. Ron D. Cell Prog. 2001; 7: 1153-1163Scopus (1009) Google Scholar) and the ER resident protein involved in degradation of malfolded ER proteins have been clinically linked to diminished β-cell health (21.Delepine M. Nicolino M. Barrett T. Golamaully M. Lathrop G.M. Julier C. Nat. Genet. 2000; 25: 406-409Crossref PubMed Scopus (667) Google Scholar, 22.Takeda K. Inoue H. Tanizawa Y. Matsuzaki Y. Oba J. Watanabe Y. Shinoda K. Oka Y. Hum. Mol. Genet. 2001; 10: 477-484Crossref PubMed Scopus (267) Google Scholar). Several recent reports suggest that ER stress can play a prominent role in the autoimmune destruction of β-cells during the development of T1DM (13.Cardozo A.K. Ortis F. Storling J. Feng Y.-M. Rasschaert J. Tonnesen M. Van Eylen F. Mandrup-Poulsen T. Herchuelz A. Eizirik D.L. Diabetes. 2005; 54: 452-461Crossref PubMed Scopus (427) Google Scholar, 23.Fonseca S.G. Fukuma M. Lipson K.L. Nguyen L.X. Allen J.R. Oka Y. Urano F. J. Biol. Chem. 2005; 280: 39609-39615Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 24.Oyadomari S. Takeda K. Takiguchi M. Gotoh T. Matsumoto M. Wada I. Akira S. Araki E. Mori M. Proc. Natl. Acad. Sci. 2001; 98: 10845-10850Crossref PubMed Scopus (517) Google Scholar). Because the secretory function of β-cells endows them with a highly developed ER and the β-cell is one of the most sensitive cells to nitric oxide (25.Kroncke K.-D. Brenner H.-H. Rodriguez M.-L. Etzkorn K. Noack E.A. Kolb H. Kolb-Bachofen V. Biochim. Biophys. Acta. 1993; 1182: 221-229Crossref PubMed Scopus (104) Google Scholar), it is not unexpected that β-cells exhibit a heightened susceptibility to autoimmune-mediated ER stress (26.Corbett J.A. McDaniel M.L. Diabetes. 1992; 41: 897-903Crossref PubMed Scopus (349) Google Scholar, 27.Mandrup-Poulsen T. Diabetologia. 1996; 39: 1005-1029Crossref PubMed Scopus (517) Google Scholar). In support of this, Wolfram syndrome, which is associated with juvenile-onset diabetes mellitus, is recognized to be a consequence of chronic ER stress in pancreatic β-cells (23.Fonseca S.G. Fukuma M. Lipson K.L. Nguyen L.X. Allen J.R. Oka Y. Urano F. J. Biol. Chem. 2005; 280: 39609-39615Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 28.Yamada T. Ishihara H. Tamura A. Takahashi R. Yamaguchi S. Takei D. Tokita A. Satake C. Tashiro F. Katagiri H. Aburatani H. Miyazaki J.-i. Oka Y. Hum. Mol. Genet. 2006; 15: 1600-1609Crossref PubMed Scopus (194) Google Scholar). In addition to serving as a cellular Ca2+ store, the ER is the site of secretory protein synthesis, assembly, folding, and post-translationally modification. Interruption of any of these functions can lead to production of malfolded mutant proteins that require rapid degradation. When an imbalance between the load of client proteins on the ER and the ability of the ER to process the load occurs, ER stress results (29.Ron D. J. Clin. Investig. 2002; 110: 1383-1388Crossref PubMed Scopus (740) Google Scholar). Prolonged ER stress promotes induction of stress factors and activation of caspase-12, localized to the ER (15.Rao R.V. Castro-Obregon S. Frankowski H. Schuler M. Stoka V. del Rio G. Bredesen D.E. Ellerby H.M. J. Biol. Chem. 2002; 277: 21836-21842Abstract Full Text Full Text PDF PubMed Scopus (438) Google Scholar), and can subsequently lead to downstream activation of caspase-3, a protease recognized to be the executioner of apoptosis (30.Cohen G.M. Biochem. J. 1997; 326: 1-16Crossref PubMed Scopus (4132) Google Scholar). Being a site for Ca2+ storage, the ER responds to various stimuli to release Ca2+ and is therefore extremely sensitive to changes in cellular homeostasis. Although ER stress alone can induce the necessary factors to cause apoptosis, it is becoming increasingly apparent that the mitochondria, as an organelle that sequesters Ca2+ released from the ER, plays an important role in supporting the apoptosis process initiated by ER stress (31.Duchen M.R. J. Physiol. 2000; 529: 57-68Crossref PubMed Scopus (935) Google Scholar, 32.Berridge M.J. Cell Calcium. 2002; 32: 235-249Crossref PubMed Scopus (785) Google Scholar). Thapsigargin, which depletes ER Ca2+ stores by inhibiting sarcoendoplasmic reticulum Ca2+-ATPase, causes ER stress in pancreatic islets and promotes hydrolysis of arachidonic acid. Surprisingly, the accumulation in arachidonic acid is suppressed by a bromoenol lactone (BEL) suicide-substrate inhibitor of Ca2+-independent phospholipase A2 (iPLA2β) (33.Nowatzke W. Ramanadham S. Ma Z. Hsu F.F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (54) Google Scholar). These observations raise the possibility that iPLA2β participates in ER stress in β-cells. In support of this, ER stress-induced INS-1 cell apoptosis is amplified in iPLA2β overexpressing cells and is suppressed by BEL (34.Lei X. Zhang S. Bohrer A. Bao S. Song H. Ramanadham S. Biochemistry. 2007; 46: 10170-10185Crossref PubMed Scopus (65) Google Scholar, 35.Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Song H. Bao S. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Scopus (91) Google Scholar). The PLA2s are a diverse group of enzymes that catalyze hydrolysis of the sn-2 substituent from glycerophospholipid substrates to yield a free fatty acid and a 2-lysophospholipid (36.Gijon M.A. Leslie C.C. Semin. Cell Dev. Biol. 1997; 8: 297-303Crossref PubMed Scopus (60) Google Scholar). Among the recognized PLA2s is one that does not require Ca2+ for activity and is classified as a Group VIA iPLA2 and is designated as the β-isoform of iPLA2 (iPLA2β) (37.Schaloske R.H. Dennis E.A. Biochim. Biophys. Acta. 2006; 176: 1246-1259Crossref Scopus (728) Google Scholar). The iPLA2β enzyme is activated by ATP and is inhibited by BEL (38.Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). In addition to its proposed roles in phospholipid remodeling and signal transduction (39.Turk J. Ramanadham S. Can. J. Physiol. Pharmacol. 2004; 82: 824-832Crossref PubMed Scopus (31) Google Scholar), iPLA2β contributes to apoptosis in many cell types, including β-cells (34.Lei X. Zhang S. Bohrer A. Bao S. Song H. Ramanadham S. Biochemistry. 2007; 46: 10170-10185Crossref PubMed Scopus (65) Google Scholar, 35.Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Song H. Bao S. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Scopus (91) Google Scholar, 40.Wilkins III, W.P. Barbour S.E. Curr. Drug Targ. 2008; 9: 683-697Crossref PubMed Scopus (40) Google Scholar). However, the mechanism by which iPLA2β activation contributes to apoptotic cell death has not yet been elucidated. Pancreatic islet β-cells and insulinoma cells express iPLA2β activity that is sensitive to inhibition by BEL (41.Ramanadham S. Gross R.W. Han X. Turk J. Biochemistry. 1993; 32: 337-346Crossref PubMed Scopus (123) Google Scholar) and recent reports demonstrate that induction of ER stress promotes ceramide accumulations in INS-1 cells that can be attenuated by inactivation of iPLA2β (34.Lei X. Zhang S. Bohrer A. Bao S. Song H. Ramanadham S. Biochemistry. 2007; 46: 10170-10185Crossref PubMed Scopus (65) Google Scholar, 35.Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Song H. Bao S. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Scopus (91) Google Scholar). Ceramides are complex lipids that can suppress cell growth and induce apoptosis (42.Ogretmen B. Hannun Y.A. Nat. Rev. Cancer. 2004; 4: 604-616Crossref PubMed Scopus (1009) Google Scholar, 43.van Blitterswijk W.J. van der Luit A.H. Veldman R.J. Verheij M. Borst J. Biochem. J. 2003; 369: 199-211Crossref PubMed Scopus (389) Google Scholar) and various reports (31.Duchen M.R. J. Physiol. 2000; 529: 57-68Crossref PubMed Scopus (935) Google Scholar, 44.Hajnoczky G. Csordas G. Madesh M. Pacher P. J. Physiol. 2000; 529: 69-81Crossref PubMed Scopus (177) Google Scholar) suggest that ceramides can also disturb mitochondrial homeostasis. Here, we present evidence for the involvement of iPLA2β-mediated ceramide generation in activating the mitochondrial apoptotic pathway during ER stress-induced insulin-secreting cell death. Materials—The sources for the material used were as follows: (16:0/[14C]-18:2)-GPC (PLPC, 55 mCi/mmol), rainbow molecular mass standards, and enhanced chemiluminescence (ECL) reagent, Amersham Biosciences; ceramide and other lipid standards, Avanti Polar Lipids, Alabaster, AL; Coomassie reagent, SDS-PAGE supplies and Triton X-100, Bio-Rad; mitochondrial membrane potential detection kit, Cell Technology Inc., Mountain View, CA; paraformaldehyde, Electron Microscopy Sciences, Ft. Washington, PA; forskolin, EMD Biosciences, San Diego, CA; normal goat serum, Cy3-conjugated affinipure goat anti-rabbit IgG (H+L), Jackson Immuno-Research Laboratories, West Grove, PA; pentex fraction V fatty acid-free bovine serum albumin, Miles Laboratories, Eckert, IN; mitoprobe transition pore assay kit, Slow Fade® light antifade kit, Molecular Probes, Eugene, OR; peroxidase-conjugated goat anti-rabbit IgG antibody, TUNEL kit, Roche Diagnostic Corporation; primary antibodies, Santa Cruz Biotechnology. Inc., Santa Cruz, CA; and C2-ceramide, protease inhibitor mixture, thapsigargin, common reagents, and salts, Sigma. Preparation, Culture, and Treatment of Stably Transfected INS-1 Cells—Control (empty-vector transfected) and iPLA2β overexpressing INS-1 cells were generated and cultured, as described (34.Lei X. Zhang S. Bohrer A. Bao S. Song H. Ramanadham S. Biochemistry. 2007; 46: 10170-10185Crossref PubMed Scopus (65) Google Scholar). The cells were grown to confluence in cell culture Petri dishes or flasks and treated with vehicle (DMSO, 0.50 μl/ml), thapsigargin (1 μm), or C2-ceramide (C2-CM, 50 μm). To examine the effects of inhibiting iPLA2β activity, BEL (1 μm) was added to cells for 1 h and the medium was replaced with one containing DMSO or thapsigargin. The effects of elevating intracellular cAMP concentrations or inhibiting neutral sphingomyelinase were examined by treating the cells for 1 h with forskolin (2.5 μm) or GW4869 (10 μm), respectively, prior to addition of DMSO, thapsigargin, or C2-CM. All incubations were done at 37 °C under an atmosphere of 95% air, 5% CO2. In Situ Detection of DNA Cleavage by TUNEL and DAPI Staining—At the end of a treatment protocol, INS-1 cells were harvested and washed twice with ice-cold PBS. The cells were then immobilized on slides by cytospin (35.Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Song H. Bao S. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Scopus (91) Google Scholar) and fixed with 4% paraformaldehyde (in PBS, pH 7.4, 1 h, room temperature). The cells were then washed with PBS, and incubated in permeabilization solution (0.1% Triton-X-100 in 0.1% sodium citrate, PBS, 30 min, room temperature). The permeabilization solution was then removed and the TUNEL reaction mixture (50 μl) was added and the cells were incubated (1 h, 37 °C) in a humidified chamber. The cells were washed again with PBS and counter-stained with DAPI (1 μg/ml) in PBS for 10 min to identify cellular nuclei. The incidence of apoptosis was assessed under a fluorescence microscope (Nikon Eclipse TE300) using a fluorescein isothiocyanate filter. Cells with TUNEL-positive nuclei were considered apoptotic. DAPI staining was used to determine the total number of cells in a field. A minimum of three fields per slide was used to calculate percent of apoptotic cells. Assessment of Mitochondrial Membrane Potential (ΔΨ) by Flow Cytometry—Loss of ΔΨ is an important step in the induction of cellular apoptosis (46.Desagher S. Osen-Sand A. Nichols A. Eskes R. Montessuit S. Lauper S. Maundrell K. Antonsson B. Martinou J.-C. J. Cell Biol. 1999; 144: 891-901Crossref PubMed Scopus (1093) Google Scholar). INS-1 cell ΔΨ was therefore measured using a commercial kit according to the manufacturer's instructions. Briefly, harvested cells were washed once with PBS and resuspended in 100 μl of PBS (∼1 × 105 cells/ml). An aliquot (5 μl) of Mito Flow fluorescent reagent was then added and the cell suspension was incubated at 37 °C for 30 min. The cells were then transferred to appropriate fluorescence-activated cell sorting tubes and diluted 1:5 with buffer provided in the kit. Fluorescence in cells was analyzed by flow cytometry (BD Biosciences) at an excitation wavelength of 488 nm. Mitochondrial Permeability Transition Pore (PTP)—The PTP opening was measured in intact INS-1 cells by monitoring calcein-AM fluorescence in the absence and presence of CoCl2, which quenches cytosolic fluorescence, as described (47.Predescu S.A. Predescu D.N. Knezevic I. Klein I.K. Malik A.B. J. Biol. Chem. 2007; 282: 17166-17178Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Briefly, INS-1 cells were washed twice with PBS and resuspended (1 × 106 cells/ml) in pre-warmed Hanks' balanced salt solution containing 2 mm Ca2+. The cells were then loaded with calcein-AM for 15 min at 37 °C according to the manufacturer's instructions (Molecular Probes). In parallel experiments, similar cell samples were loaded with calcein-AM in the presence of CoCl2. After washing away excess stain and quenching reagent, the cell pellets were resuspended in 400 μl of Hanks' balanced salt solution containing Ca2+ and analyzed for calcein-AM fluorescence by flow cytometry using a BD Biosciences FACscan flow cytometer in conjunction with WinMDI 2.8 software (excitation/emission, 494/517 nm). Cell Fractionation—Cells were harvested and washed twice (750 × g, 5 min, 4 °C) with 10 volumes of ice-cold PBS. The cell pellet was suspended in 3 volumes of ice-cold isolation buffer (20 mm HEPES-KOH, pH 7.8, 250 mm sucrose, 1 mm EGTA, 10 mm potassium chloride), supplemented with protease inhibitor mixture (50 μl/ml). The cells were placed on ice for 15 min and then transferred to a Dounce homogenizer (Kimble/Kontes, Vineland, NJ) and disrupted by douncing 15 times on ice. The homogenate was centrifuged at 800 × g for 5 min to remove unbroken cells and nuclei, and the supernatant was then re-centrifuged (10,000 × g, 15 min, 4 °C) to obtain mitochondria. The supernatant was further subjected to ultracentrifugation (100,000 × g, 60 min, 4 °C). The resultant supernatant was the cytosolic fraction and the pellet contained ER. Plasma membrane fraction was prepared as described (48.Ramanadham S. Bohrer A. Mueller M. Jett P. Gross R.W. Turk J. Biochemistry. 1993; 32: 5339-5351Crossref PubMed Scopus (73) Google Scholar). Purity of the cellular fractions was verified by the 5′-nucleotidase (plasma membrane enzyme) activity assay and immunoblotting analyses for organelle-specific markers: ER (calnexin), mitochondria (complex IV), Golgi apparatus (FTCD), and nuclei (Oct-1). Immunoblotting Analyses—INS-1 cells were harvested at various times (0–24 h) following induction of ER stress, sonicated, and the homogenate centrifuged (100,000 × g, 1 h, 4°C) to obtain cytosol. To examine mitochondrial apoptotic factors, the mitochondrial fraction was prepared as described above. An aliquot (30 μg) of cytosolic or mitochondrial protein was analyzed by SDS-PAGE (8 or 15%), transferred onto Immobilin-P polyvinylidene difluoride membranes, and processed for immunoblotting analyses, as described (35.Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Song H. Bao S. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Scopus (91) Google Scholar). The targeted factors and the primary antibody concentrations were as follows: PERK (1:1000), pPERK (1:1000), eIF2a (1:500), peIF2a (1:1000), iPLA2β (T-14; 1:500), calnexin (1:1,000), FTCD (1:1500), complex IV (1:2,000), Oct-1 (1:1,000), cytochrome c (1:1,000), caspase-12 and caspase-3 (1:1,000), and tubulin (1:2000). The secondary antibody concentration was 1:10,000. Immunoreactive bands were visualized by enhanced chemiluminescence (ECL). Measurement of 5′-Nucleotidase Activity—A spectrophotometric enzymatic assay was used to measure the activity of the plasma membrane enzyme 5′-nucleotidase, according to instructions provided by Sigma (EC 3.1.3.5). This procedure measures the 5′-nucleotidase-mediated liberation of inorganic phosphorous from 5′-AMP, as reflected by monitoring absorbance at 660 nm. Assay for iPLA2β Activity in the Mitochondria—Mitochondrial fraction was prepared from INS-1 cells harvested at 4, 8, and 16 h following induction of ER stress. Protein concentration was determined using Coomassie reagent. Ca2+-independent PLA2 activity in an aliquot of mitochondrial protein (30 μg) was assayed under zero Ca2+ conditions (no added Ca2+ plus 10 mm EGTA) in the presence of [14C]PLPC (5 μm) as the substrate, and specific enzymatic activity was quantitated, as described (35.Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Song H. Bao S. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Scopus (91) Google Scholar). To verify that the mitochondrial phospholipase activity is manifested by iPLA2β, activity was also assayed in the presence of BEL (1 μm). Ceramide Analyses by ESI/MS/MS—Lipids were extracted from the mitochondria and ER of INS-1 cells under acidic conditions, as described (34.Lei X. Zhang S. Bohrer A. Bao S. Song H. Ramanadham S. Biochemistry. 2007; 46: 10170-10185Crossref PubMed Scopus (65) Google Scholar, 35.Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Song H. Bao S. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Scopus (91) Google Scholar). Briefly, extraction buffer (chloroform, methanol, 2% acetic acid, 2/2/1.8; v/v/v) containing C8-ceramide (m/z 432) internal standard (500 ng), which is not an endogenous component of INS-1 cell lipids, was added to each fraction of mitochondria and ER. After vigorous vortexing, the mixture was centrifuged (800 × g, 5 min, room temperature) and the organic bottom layer collected, concentrated to dryness under nitrogen, and reconstituted in chloroform/methanol (1:4) containing 10 pmol/μl of LiOH. The relative abundance of individual ceramide species, relative to the C8-ceramide internal standard, in the mitochondria and ER were determined separately by ESI/MS/MS scanning for constant neutral loss of 48, which reflects the elimination of formaldehyde and water from the [M + Li+] ion (49.Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). This loss is characteristic of ceramide-Li+ adducts upon low energy collisionally activated dissociation ESI/MS/MS (50.Hsu F.F. Turk J. J. Am. Soc. Mass Spectrom. 2002; 13: 558-570Crossref PubMed Scopus (87) Google Scholar). To measure ceramide content, ESI/MS/MS standard curves were generated from a series of samples containing a fixed amount of C8-CM standard and varied amounts of long chain CM standards, as described (35.Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Song H. Bao S. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Scopus (91) Google Scholar). Total (pmol) ceramide species in each fraction was determined and normalized to milligrams of protein. Changes between control and treated ER and mitochondrial fractions on each experimental day were combined and mean differences ± S.E. over 7 separate experimental analyses in each group were determined. Sphingomye

An 84-kDa group VI phospholipase A2 (iPLA2) that does not require Ca2+ for catalysis has been cloned from Chinese hamster ovary cells, murine P388D1 cells, and pancreatic islet β-cells. A housekeeping role for iPLA2 in generating lysophosphatidylcholine (LPC) acceptors for arachidonic acid incorporation into phosphatidylcholine (PC) has been proposed because iPLA2 inhibition reduces LPC levels and suppresses arachidonate incorporation and phospholipid remodeling in P388D1 cells. Because islet β-cell phospholipids are enriched in arachidonate, we have examined the role of iPLA2 in arachidonate incorporation into islets and INS-1 insulinoma cells. Inhibition of iPLA2 with a bromoenol lactone (BEL) suicide substrate did not suppress and generally enhanced [3H]arachidonate incorporation into these cells in the presence or absence of extracellular calcium at varied time points and BEL concentrations. Arachidonate incorporation into islet phospholipids involved deacylation-reacylation and not de novo synthesis, as indicated by experiments with varied extracellular glucose concentrations and by examining [14C]glucose incorporation into phospholipids. BEL also inhibited islet cytosolic phosphatidate phosphohydrolase (PAPH), but the PAPH inhibitor propranolol did not affect arachidonate incorporation into islet or INS-1 cell phospholipids. Inhibition of islet iPLA2 did not alter the phospholipid head-group classes into which [3H]arachidonate was initially incorporated or its subsequent transfer from PC to other lipids. Electrospray ionization mass spectrometric measurements indicated that inhibition of INS-1 cell iPLA2 accelerated arachidonate incorporation into PC and that inhibition of islet iPLA2 reduced LPC levels by 25%, suggesting that LPC mass does not limit arachidonate incorporation into islet PC. Gas chromatography/mass spectrometry measurements indicated that BEL but not propranolol suppressed insulin secretagogue-induced hydrolysis of arachidonate from islet phospholipids. In islets and INS-1 cells, iPLA2 is thus not required for arachidonate incorporation or phospholipid remodeling and may play other roles in these cells. An 84-kDa group VI phospholipase A2 (iPLA2) that does not require Ca2+ for catalysis has been cloned from Chinese hamster ovary cells, murine P388D1 cells, and pancreatic islet β-cells. A housekeeping role for iPLA2 in generating lysophosphatidylcholine (LPC) acceptors for arachidonic acid incorporation into phosphatidylcholine (PC) has been proposed because iPLA2 inhibition reduces LPC levels and suppresses arachidonate incorporation and phospholipid remodeling in P388D1 cells. Because islet β-cell phospholipids are enriched in arachidonate, we have examined the role of iPLA2 in arachidonate incorporation into islets and INS-1 insulinoma cells. Inhibition of iPLA2 with a bromoenol lactone (BEL) suicide substrate did not suppress and generally enhanced [3H]arachidonate incorporation into these cells in the presence or absence of extracellular calcium at varied time points and BEL concentrations. Arachidonate incorporation into islet phospholipids involved deacylation-reacylation and not de novo synthesis, as indicated by experiments with varied extracellular glucose concentrations and by examining [14C]glucose incorporation into phospholipids. BEL also inhibited islet cytosolic phosphatidate phosphohydrolase (PAPH), but the PAPH inhibitor propranolol did not affect arachidonate incorporation into islet or INS-1 cell phospholipids. Inhibition of islet iPLA2 did not alter the phospholipid head-group classes into which [3H]arachidonate was initially incorporated or its subsequent transfer from PC to other lipids. Electrospray ionization mass spectrometric measurements indicated that inhibition of INS-1 cell iPLA2 accelerated arachidonate incorporation into PC and that inhibition of islet iPLA2 reduced LPC levels by 25%, suggesting that LPC mass does not limit arachidonate incorporation into islet PC. Gas chromatography/mass spectrometry measurements indicated that BEL but not propranolol suppressed insulin secretagogue-induced hydrolysis of arachidonate from islet phospholipids. In islets and INS-1 cells, iPLA2 is thus not required for arachidonate incorporation or phospholipid remodeling and may play other roles in these cells. Phospholipases A2(PLA2) 1The abbreviations used are: PLA2, phospholipase A2; BEL, bromoenol lactone suicide substrate; BSA, bovine serum albumin; cPLA2, group IV phospholipase A2; ECL, enhanced chemiluminescence; ESI, electrospray ionization; GC, gas chromatography; GPC, glycerophosphocholine; HBSS, Hank's balanced salt solution; iPLA2, group VI phospholipase A2; LPC, lysophosphatidylcholine; MS, mass spectrometry; MS/MS, tandem mass spectrometry; NEM, N-ethylmaleimide; NMMA, N G-monomethyl-l-arginine acetate; NP-HPLC, normal phase-high performance liquid chromatography; PA, phosphatidic acid; PAPH, phosphatidate phosphohydrolase; PAGE, polyacrylamide gel electrophoresis; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; RP-HPLC, reverse phase high performance liquid chromatography; RT, reverse transcriptase; PCR, polymerase chain reaction; IL, interleukin; bp, base pair; BAPTA-AM, 1,2-bis-(O-aminophenoxylethane-N,N,N′,N′-tetraacetic acid tetra(acetoxymethyl) ester 1The abbreviations used are: PLA2, phospholipase A2; BEL, bromoenol lactone suicide substrate; BSA, bovine serum albumin; cPLA2, group IV phospholipase A2; ECL, enhanced chemiluminescence; ESI, electrospray ionization; GC, gas chromatography; GPC, glycerophosphocholine; HBSS, Hank's balanced salt solution; iPLA2, group VI phospholipase A2; LPC, lysophosphatidylcholine; MS, mass spectrometry; MS/MS, tandem mass spectrometry; NEM, N-ethylmaleimide; NMMA, N G-monomethyl-l-arginine acetate; NP-HPLC, normal phase-high performance liquid chromatography; PA, phosphatidic acid; PAPH, phosphatidate phosphohydrolase; PAGE, polyacrylamide gel electrophoresis; PC, phosphatidylcholine; PE, phosphatidylethanolamine; PI, phosphatidylinositol; RP-HPLC, reverse phase high performance liquid chromatography; RT, reverse transcriptase; PCR, polymerase chain reaction; IL, interleukin; bp, base pair; BAPTA-AM, 1,2-bis-(O-aminophenoxylethane-N,N,N′,N′-tetraacetic acid tetra(acetoxymethyl) ester catalyze hydrolysis of the sn-2 fatty acid substituent from glycerophospholipid substrates to yield a free fatty acid and a 2-lysophospholipid (1Dennis E.A. J. Biol. Chem. 1994; 269: 13057-13060Abstract Full Text PDF PubMed Google Scholar, 2Gijon M.A. Leslie C.C. Cell. Dev. Biol. 1997; 8: 297-303Crossref PubMed Scopus (59) Google Scholar, 3Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (756) Google Scholar, 4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 5Leslie C.C. J. Biol. Chem. 1997; 272: 16709-16712Abstract Full Text Full Text PDF PubMed Scopus (740) Google Scholar, 6Tischfield J.A. J. Biol. Chem. 1997; 272: 17247-17250Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar, 7Stafforini D.M. McIntyre T.M. Zimmerman G.A. Prescott S.M. J. Biol. Chem. 1997; 272: 17895-17898Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar). PLA2 are a diverse group of enzymes, and the first members to be well characterized have low molecular masses (∼14 kDa), require millimolar [Ca2+] for catalytic activity, and function as extracellular secreted enzymes designated sPLA2 (3Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (756) Google Scholar, 6Tischfield J.A. J. Biol. Chem. 1997; 272: 17247-17250Abstract Full Text Full Text PDF PubMed Scopus (268) Google Scholar). The first PLA2 to be cloned that is active at [Ca2+] that can be achieved in the cytosol of living cells is an 85-kDa protein classified as a group IV PLA2 and designated cPLA2 (3Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (756) Google Scholar, 5Leslie C.C. J. Biol. Chem. 1997; 272: 16709-16712Abstract Full Text Full Text PDF PubMed Scopus (740) Google Scholar). This enzyme is induced to associate with its substrates in membranes by rises in cytosolic [Ca2+] within the range achieved in cells stimulated by extracellular signals that induce Ca2+release from intracellular sequestration sites or Ca2+entry from the extracellular space, is also regulated by phosphorylation, and prefers substrates with sn-2 arachidonoyl residues (5Leslie C.C. J. Biol. Chem. 1997; 272: 16709-16712Abstract Full Text Full Text PDF PubMed Scopus (740) Google Scholar).Recently, a second PLA2 that is active at [Ca2+] that can be achieved in cytosol has been cloned (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar, 9Balboa M.A. Balsinde J. Jones S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). This enzyme does not require Ca2+ for catalysis, is classified as a group VI PLA2, and is designated iPLA2 (3Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (756) Google Scholar, 4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar). The iPLA2 enzymes cloned from hamster (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar), mouse (9Balboa M.A. Balsinde J. Jones S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar), and rat (10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar) cells represent species homologs, and all are 84-kDa proteins containing 751–752 amino acid residues with highly homologous (∼95% identity) sequences. Each contains a GXSXG lipase consensus motif and eight stretches of a repeating sequence motif homologous to a repetitive motif in the integral membrane protein binding domain of ankyrin (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar, 9Balboa M.A. Balsinde J. Jones S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). The substrate preference of these iPLA2 enzymes varies widely with the mode of presentation (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar), but each is susceptible to inhibition (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar, 9Balboa M.A. Balsinde J. Jones S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar) by a bromoenol lactone (BEL) suicide substrate (11Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 12Zupan L.A. Weiss R.H. Hazen S. Parnas B.L. Aston K.W. Lennon P.J. Getman D.P. Gross R.W. J. Med. Chem. 1993; 36: 95-100Crossref PubMed Scopus (55) Google Scholar) that is not an effective inhibitor of sPLA2 or cPLA2 enzymes at comparable concentrations (4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 11Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 12Zupan L.A. Weiss R.H. Hazen S. Parnas B.L. Aston K.W. Lennon P.J. Getman D.P. Gross R.W. J. Med. Chem. 1993; 36: 95-100Crossref PubMed Scopus (55) Google Scholar, 13Balsinde J. Dennis E.A. J. Biol. Chem. 1996; 271: 6758-6765Abstract Full Text Full Text PDF PubMed Scopus (341) Google Scholar, 14Ma Z. Ramanadham S. Hu Z. Turk J. Biochim. Biophys. Acta. 1998; 1391: 384-400Crossref PubMed Scopus (43) Google Scholar).Proposed functions for iPLA2 include a housekeeping role in phospholipid remodeling that involves generation of lysophospholipid acceptors for incorporation of arachidonic acid into phospholipids of murine P388D1 macrophage-like cells (4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar, 16Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar), although signaling functions of iPLA2 have been suggested in other cells (10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 17Larsson Forsell P.K.A. Runarsson G. Ibrahim M. Bjorkholm M. Claesson H.-E. FEBS Lett. 1998; 434: 295-299Crossref PubMed Scopus (35) Google Scholar, 18Gubitosi-Klug R.A. Yu S.P. Choi D.W. Gross R.W. J. Biol. Chem. 1995; 270: 2885-2888Abstract Full Text Full Text PDF PubMed Scopus (48) Google Scholar, 19Eddlestone G.T. Am. J. Physiol. 1995; 268: C181-C190Crossref PubMed Google Scholar, 20Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar, 21Larsson P.K.A. Claesson H.-E. Kennedy B.P. J. Biol. Chem. 1998; 273: 207-214Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar). The proposed housekeeping function for iPLA2 (4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar) has been deduced from experiments involving inhibition of iPLA2 activity in P388D1 cells with BEL (15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar) or with an antisense oligonucleotide (16Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). Inhibition of iPLA2 activity in P388D1 cells suppresses incorporation of [3H]arachidonic acid into phospholipids by about 60%, but [3H]palmitic acid incorporation is reduced only slightly (15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar, 16Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). Incorporation of [3H]arachidonic acid into P388D1 cells is Ca2+-independent and unaffected by chelation of extracellular or intracellular Ca2+ (15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar). Inhibition of iPLA2 also reduces [3H]lysophosphatidylcholine (LPC) levels by about 60% in [3H]choline-labeled P388D1 cells, and this is thought to represent the mechanism whereby iPLA2 inhibition reduces incorporation of [3H]arachidonic acid into P388D1 cell phospholipids (15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar, 16Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). Such incorporation (15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar, 16Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar) reflects a deacylation/reacylation cycle (22Lands W.E.M. Crawford C.G. Martonosi A. The Enzymes of Biological Membranes. 2. Plenum Publishing Corp., New York1976: 3-85Google Scholar, 23Chilton F.H. Fonteh A.N. Suarette M.E. Triggiani M. Winkler J.D. Biochim. Biophys. Acta. 1996; 1299: 1-15Crossref PubMed Scopus (209) Google Scholar) of phospholipid remodeling rather than de novo synthesis (24Dennis E.A. Methods Enzymol. 1992; 209: 1-4Crossref PubMed Scopus (15) Google Scholar), and the level of LPC acceptors is thought to limit the rate of [3H]arachidonic acid incorporation into P388D1 cell phosphatidylcholine (PC) (15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar, 16Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar). Activity of iPLA2 appears to be required to maintain sufficient levels of LPC in P388D1 cells to support [3H]arachidonic acid incorporation into PC (15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar, 16Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar).It is not yet certain that the observations with P388D1 cells reflect a general mechanism for incorporation of arachidonic acid into phospholipids of all cells, and P388D1 cells exhibit some atypical features of arachidonate incorporation. Arachidonate represents about 25% of the total esterified fatty acyl mass in native murine macrophage phospholipids (25Scott W.A. Zrike J.M. Hammill A.L. Cohn Z.A. J. Exp. Med. 1980; 152: 324-335Crossref PubMed Scopus (188) Google Scholar, 26Kroner E.E. Peskar B. Fischer H. Ferber E. J. Biol. Chem. 1981; 256: 3690-3697Abstract Full Text PDF PubMed Google Scholar) but only 3% of that in murine P388D1 macrophage-like cells (27Asmis R. Dennis E.A. Ann. N. Y. Acad. Sci. 1994; 744: 1-10Crossref PubMed Scopus (5) Google Scholar, 28Balsinde J. Barbour S.E. Bianco I.D. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 11060-11064Crossref PubMed Scopus (127) Google Scholar, 29Balsinde J. Dennis E.A. Eur. J. Biochem. 1996; 235: 480-485Crossref PubMed Scopus (29) Google Scholar). A significant portion of exogenous arachidonate provided to P388D1 cells is also found in the intracellular free fatty acid fraction (29Balsinde J. Dennis E.A. Eur. J. Biochem. 1996; 235: 480-485Crossref PubMed Scopus (29) Google Scholar), and this is not the case in other cell types (30Blank M. Smith Z.L. Snyder F. Biochim. Biophys. Acta. 1992; 1124: 262-272Crossref PubMed Scopus (25) Google Scholar, 31Chilton F.H. Murphy R.C. J. Biol. Chem. 1986; 261: 7771-7777Abstract Full Text PDF PubMed Google Scholar, 32Kennedy C. Slack R. Xin Ding L. Proulx P. Biochim. Biophys. Acta. 1994; 1211: 326-334Crossref PubMed Scopus (5) Google Scholar), in which nonesterified arachidonate is maintained at a very low level by an efficient esterification system (26Kroner E.E. Peskar B. Fischer H. Ferber E. J. Biol. Chem. 1981; 256: 3690-3697Abstract Full Text PDF PubMed Google Scholar, 33Irvine R.F. Biochem. J. 1982; 204: 3-16Crossref PubMed Scopus (966) Google Scholar, 34MacDonald J.I.S. Sprecher H. Biochim. Biophys. Acta. 1989; 1084: 105-121Crossref Scopus (246) Google Scholar). In many cells, nonesterified arachidonate imported from the extracellular space or released intracellularly by PLA2enzymes is quickly converted to arachidonoyl-CoA in an ATP-dependent step and then rapidly incorporated into phospholipids by acyltransferases (35Hill E.E. Husbands D.R. Lands W.E.M. J. Biol. Chem. 1968; 243: 4440-4451Abstract Full Text PDF PubMed Google Scholar, 36Chilton F.H. Hadley J.S. Murphy R.C. Biochim. Biophys. Acta. 1987; 917: 48-56Crossref PubMed Scopus (32) Google Scholar). The low levels of esterified arachidonate and the relatively high levels of nonesterified arachidonate observed in P388D1 cells (27Asmis R. Dennis E.A. Ann. N. Y. Acad. Sci. 1994; 744: 1-10Crossref PubMed Scopus (5) Google Scholar, 28Balsinde J. Barbour S.E. Bianco I.D. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 11060-11064Crossref PubMed Scopus (127) Google Scholar, 29Balsinde J. Dennis E.A. Eur. J. Biochem. 1996; 235: 480-485Crossref PubMed Scopus (29) Google Scholar) suggest that they may be deficient in arachidonate incorporation mechanisms expressed by other cells.One biomedically important cell that may require especially effective arachidonate incorporation mechanisms is the insulin-secreting pancreatic islet beta cell, the function of which is impaired in diabetes mellitus. Arachidonate represents 30–36% of the total esterified fatty acyl mass in phospholipids of normal rat and human islets and isolated beta cells (37Ramanadham S. Bohrer A. Mueller M. Jett P. Gross R. Turk J. Biochemistry. 1993; 32: 5339-5351Crossref PubMed Scopus (72) Google Scholar, 38Ramanadham S. Bohrer A. Gross R.W. Turk J. Biochemistry. 1993; 32: 13499-13509Crossref PubMed Scopus (57) Google Scholar), and arachidonate-containing species are the most abundant components of all major islet phospholipid head-group classes (39Ramanadham S. Hsu F.-F. Bohrer A. Nowatzke W. Ma Z. Turk J. Biochemistry. 1998; 37: 4553-4567Crossref PubMed Scopus (68) Google Scholar). The abundance of arachidonate-containing phospholipid species is higher in islets than in many other tissues (39Ramanadham S. Hsu F.-F. Bohrer A. Nowatzke W. Ma Z. Turk J. Biochemistry. 1998; 37: 4553-4567Crossref PubMed Scopus (68) Google Scholar), and islet plasma membranes and secretory granule membranes are especially enriched in such species (38Ramanadham S. Bohrer A. Gross R.W. Turk J. Biochemistry. 1993; 32: 13499-13509Crossref PubMed Scopus (57) Google Scholar, 39Ramanadham S. Hsu F.-F. Bohrer A. Nowatzke W. Ma Z. Turk J. Biochemistry. 1998; 37: 4553-4567Crossref PubMed Scopus (68) Google Scholar). Fusion of secretory granule and plasma membranes is the final event in insulin exocytosis, and the high content of certain arachidonate-containing phospholipids in those membranes may facilitate their fusion (39Ramanadham S. Hsu F.-F. Bohrer A. Nowatzke W. Ma Z. Turk J. Biochemistry. 1998; 37: 4553-4567Crossref PubMed Scopus (68) Google Scholar, 40Han X. Ramanadham S. Turk J. Gross R.W. Biochim. Biophys. Acta. 1998; 1414: 95-107Crossref PubMed Scopus (28) Google Scholar). Because both rat and human beta cells also express iPLA2 (10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 41Ma Z. Wang X. Nowatzke W. Ramanadham S. Turk K. J. Biol. Chem. 1998; 274: 9607-9616Abstract Full Text Full Text PDF Scopus (94) Google Scholar), we have examined the participation of iPLA2 in arachidonic acid incorporation into islet and insulinoma cell phospholipids, and our findings differ from those in P388D1 cells.RESULTSIn the report that motivated our study, 25 μm BEL maximally inhibited iPLA2 activity and suppressed [3H]arachidonic acid incorporation into P388D1 cell phospholipids during a 10-min incubation but only slightly suppressed [3H]palmitic acid incorporation, and [3H]arachidonic acid incorporation was unaffected by chelation of extracellular or intracellular [Ca2+] (15Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (255) Google Scholar). To examine the generality of these phenomena, we performed similar experiments with islets. Control islets exhibited PLA2activity in the absence of Ca2+ that was stimulated by ATP, and activity was 98% inhibited in 25 μm BEL-treated islets (Fig. 1, left panel), consistent with properties of recombinant iPLA2 expressed from cDNA cloned from an islet library (10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). Despite effective iPLA2 inhibition, no suppression of [3H]arachidonic acid incorporation into phospholipids was observed in BEL-treated islets during 10-min incubations in Ca2+-replete medium, in Ca2+-free EGTA-containing medium, or in islets that had been loaded with the intracellular Ca2+-chelator BAPTA-AM and incubated in Ca2+-free EGTA-containing medium (Fig. 1, center panel). [3H]Arachidonic acid incorporation was greater in Ca2+-free EGTA-containing medium than in Ca2+-replete medium, consistent with reports that exogenous arachidonate achieves greater intracellular access in islets (64Metz S.A. Draznin B. Sussman K.E. Leitner J.W. Biochem. Biophys. Res. Commun. 1987; 142: 251-258Crossref PubMed Scopus (59) Google Scholar, 65Metz S.A. Diabetes. 1988; 37: 1453-1469Crossref PubMed Scopus (68) Google Scholar) and other tissues (66Weis M.T. Malik K.U. Circ. Res. 1986; 59: 694-703Crossref PubMed Scopus (10) Google Scholar) in Ca2+-free compared with Ca2+-replete medium and that this also occurs with palmitate (67Messineo F.C. Rathier M. Favreau C. Watras J. Takenaka H. J. Biol. Chem. 1984; 259: 1336-1343Abstract Full Text PDF PubMed Google Scholar).In Ca2+-free EGTA-containing medium, non-BAPTA-loaded islets incorporated more [3H]arachidonic acid into phospholipids than did BAPTA-loaded islets (Fig. 1, center panel), under conditions where BAPTA reduces islet beta cell cytosolic [Ca2+] by 50% and prevents ionophore A23187-induced rises in cytosolic [Ca2+] (49Nowatzke W. Ramanadham S. Ma Z. Hsu F.-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (54) Google Scholar). This indicates that [3H]arachidonic acid incorporation into islet phospholipids is not completely Ca2+-independent. Incorporation of [3H]palmitic acid into islet phospholipids (Fig. 1, right panel) exhibited features similar to those for [3H]arachidonic acid, and incorporation of both fatty acids was generally higher in BEL-treated than control islets. This effect was observed at all incubation times between 10 and 60 min (Fig. 2), and no suppression of [3H]arachidonic acid incorporation into islet phospholipids was observed at any BEL concentration that reduced islet iPLA2 activity (Fig.3). Incorporation of both fatty acids into human islet phospholipids was affected by BEL and by manipulating Ca2+ in ways similar to those with rat islets (not shown).Figure 2Time course of incorporation of [3]arachidonic acid or [3]palmitic acid into islet phospholipids. Islets were incubated with vehicle (open symbols) or 25 μm BEL (closed symbols) for 30 min at 37 °C and were then incubated with [3H]arachidonic acid (left panel) or [3H]palmitic acid (right panel) for 10–60 min. The 3H content of islet phospholipids was determined as in Fig. 1 and is expressed as disintegrations/min per 20 μg of islet protein (n = 6).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Effects of varied concentrations of BEL on islet iPLA 2 activity and on incorporation of [3]arachidonic acid into islet phospholipids. Islets were incubated with vehicle or with 1, 3, or 10 μmBEL for 30 min at 37 °C. Islets were then homogenized and assayed for iPLA2 activity (left panel) or incubated with [3H]arachidonic acid for 10 min at 37 °C (right panel). Incorporation of [3H]arachidonic acid into islet phospholipids was determined as in Fig. 1 and is expressed as disintegrations/min per 20 μg of islet protein (n = 9).View Large Image Figure ViewerDownload Hi-res image Download (PPT)To determine whether it is possible to suppress fatty acid incorporation into islet phospholipids under our conditions, we examined effects of incubating islets with interleukin-1 (IL-1) (Fig.4), which stimulates islet production of nitric oxide and causes accumulation of nonesterified arachidonic acid by an NO-dependent mechanism that is thought to reflect impaired arachidonoyl-CoA generation (51Ma Z. Ramanadham S. Corbett J.A. Bohrer A. Gross R.W. McDaniel M.L. Turk J. J. Biol. Chem. 1996; 271: 1029-1042Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Incubating islets with IL-1 impairs incorporation of [3H]arachidonic acid into islet phospholipids in Ca2+-replete medium (51Ma Z. Ramanadham S. Corbett J.A. Bohrer A. Gross R.W. McDaniel M.L. Turk J. J. Biol. Chem. 1996; 271: 1029-1042Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), and we found that this is also true in Ca2+-free medium and that incorporation of [3H]palmitic acid is similarly suppressed (Fig. 4). Coincubation of islets with IL-1 and the nitric oxide synthase inhibitor NMMA prevented IL-1-induced sup

Pancreatic islets express a Ca2+-independent phospholipase A2 (CaI-PLA2) activity that is sensitive to inhibition by a haloenol lactone suicide substrate that also attenuates glucose-induced hydrolysis of arachidonic acid from islet phospholipids and insulin secretion. A cDNA has been cloned from a rat islet cDNA library that encodes a protein with a deduced amino acid sequence of 751 residues that is homologous to a CaI-PLA2 enzyme recently cloned from Chinese hamster ovary cells. Transient transfection of both COS-7 cells and Chinese hamster ovary cells with the cloned islet CaI-PLA2 cDNA resulted in an increase in cellular CaI-PLA2 activity, and this activity was susceptible to inhibition by haloenol lactone suicide substrate. The domain of the islet CaI-PLA2 from amino acid residues 150-414 is composed of eight stretches of a repeating sequence motif of approximately 33-amino acid residues in length that is highly homologous to domains of ankyrin that bind both tubulin and integral membrane proteins, including several proteins that regulate ionic fluxes across membranes. These findings complement previous pharmacologic observations that suggest that CaI-PLA2 may participate in regulating transmembrane ion flux in glucose-stimulated β-cells. Pancreatic islets express a Ca2+-independent phospholipase A2 (CaI-PLA2) activity that is sensitive to inhibition by a haloenol lactone suicide substrate that also attenuates glucose-induced hydrolysis of arachidonic acid from islet phospholipids and insulin secretion. A cDNA has been cloned from a rat islet cDNA library that encodes a protein with a deduced amino acid sequence of 751 residues that is homologous to a CaI-PLA2 enzyme recently cloned from Chinese hamster ovary cells. Transient transfection of both COS-7 cells and Chinese hamster ovary cells with the cloned islet CaI-PLA2 cDNA resulted in an increase in cellular CaI-PLA2 activity, and this activity was susceptible to inhibition by haloenol lactone suicide substrate. The domain of the islet CaI-PLA2 from amino acid residues 150-414 is composed of eight stretches of a repeating sequence motif of approximately 33-amino acid residues in length that is highly homologous to domains of ankyrin that bind both tubulin and integral membrane proteins, including several proteins that regulate ionic fluxes across membranes. These findings complement previous pharmacologic observations that suggest that CaI-PLA2 may participate in regulating transmembrane ion flux in glucose-stimulated β-cells.

The death of insulin-secreting beta-cells that causes type I diabetes mellitus (DM) occurs in part by apoptosis, and apoptosis also contributes to progressive beta-cell dysfunction in type II DM. Recent reports indicate that ER stress-induced apoptosis contributes to beta-cell loss in diabetes. Agents that deplete ER calcium levels induce beta-cell apoptosis by a process that is independent of increases in [Ca(2+)](i). Here we report that the SERCA inhibitor thapsigargin induces apoptosis in INS-1 insulinoma cells and that this is inhibited by a bromoenol lactone (BEL) inhibitor of group VIA calcium-independent phospholipase A(2) (iPLA(2)beta). Overexpression of iPLA(2)beta amplifies thapsigargin-induced apoptosis of INS-1 cells, and this is also suppressed by BEL. The magnitude of thapsigargin-induced INS-1 cell apoptosis correlates with the level of iPLA(2)beta expression in various cell lines, and apoptosis is associated with stimulation of iPLA(2)beta activity, perinuclear accumulation of iPLA(2)beta protein and activity, and caspase-3-catalyzed cleavage of full-length 84 kDa iPLA(2)beta to a 62 kDa product that associates with nuclei. Thapsigargin also induces ceramide accumulation in INS-1 cells, and this response is amplified in cells that overexpress iPLA(2)beta. These findings indicate that iPLA(2)beta participates in ER stress-induced apoptosis, a pathway that promotes beta-cell death in diabetes.

An 85-kDa Group VI phospholipase A 2 enzyme (iPLA 2 ) that does not require Ca 2؉ for catalysis has recently been cloned from three rodent species.A homologous 88-kDa enzyme has been cloned from human B-lymphocyte lines that contains a 54-amino acid insert not present in the rodent enzymes, but human cells have not previously been observed to express catalytically active iPLA 2 isoforms other than the 88-kDa protein.We have cloned cDNA species that encode two distinct iPLA 2 isoforms from human pancreatic islet RNA and a human insulinoma cDNA library.One isoform is an 85-kDa protein (short isoform of human iPLA 2 (SH-iPLA 2 )) and the other an 88-kDa protein (long isoform of human iPLA 2 (LH-iPLA 2 )).Transcripts encoding both isoforms are also observed in human promonocytic U937 cells.Recombinant SH-iPLA 2 and LH-iPLA 2 are both catalytically active in the absence of Ca 2؉ and inhibited by a bromoenol lactone suicide substrate, but LH-iPLA 2 is activated by ATP, whereas SH-iPLA 2 is not.The human iPLA 2 gene has been found to reside on chromosome 22 in region q13.1 and to contain 16 exons represented in the LH-iPLA 2 transcript.Exon 8 is not represented in the SH-iPLA 2 transcript, indicating that it arises by an exon-skipping mechanism of alternative splicing.The amino acid sequence encoded by exon 8 of the human iPLA 2 gene is proline-rich and shares a consensus motif of PX 5 PX 8 HHPX 12 NX 4 Q with the proline-rich middle linker domains of the Smad proteins DAF-3 and Smad4.Expression of mRNA species encoding two active iPLA 2 isoforms with distinguishable catalytic properties in two different types of human cells demonstrated here may have regulatory or functional implications about the roles of products of the iPLA 2 gene in cell biologic processes.

To identify the phospholipase mediating the majority of [Arg8]vasopressin (AVP)-induced release of arachidonic acid in A-10 smooth muscle cells, we exploited the specificity inherent in the mechanism-based inhibitor, (E)-6-(bromomethylene)tetrahydro-3-(1-naphthalenyl)-2H-pyran-2-one (HELSS), which possesses a 1,000-fold selectivity for inhibition of calcium-independent versus calcium-dependent phospholipases A2. Utilizing [3H]arachidonic acid-labeled A-10 smooth muscle cells, one-half of AVP-inducible [3H]arachidonic acid release was inhibited by pretreatment with only 1 microM HELSS and two-thirds of AVP-stimulated [3H]arachidonic acid release was inhibited by 5 microM HELSS. The inhibition of [3H]arachidonic acid release by HELSS was saturable (i.e. no additional inhibition of [3H]arachidonic acid release was present at 10 microM HELSS), specific (i.e. the activities of six intracellular enzymes, as well as the rate of glucose oxidation, were not altered by HELSS treatment), and nontoxic (i.e. HELSS-treated cells excluded trypan blue dye and did not leak intracellular enzymes into the medium). Collectively, these results demonstrate that HELSS blocks AVP-induced arachidonic acid release by specific and irreversible inhibition of calcium-independent phospholipase A2 and underscore the importance of calcium-independent phospholipase A2 in agonist-induced arachidonic acid release in at least some cell types.

Recent reports have suggested that vanadium in the form of vanadyl (+IV) possesses insulin-like activity. Therefore, in the present study we examined the effects of administering oral vanadyl to diabetic animals. Wistar rats made diabetic with streptozotocin and age-matched controls were maintained for 10 wk in the absence and presence of vanadyl sulfate trihydrate in the drinking water. In the presence of vanadyl, decreases in rate of growth and circulating levels of insulin were the only significant alterations recorded in control animals. In contrast, diabetic animals treated with vanadyl, despite having lower body weights and insulin levels, had normal plasma concentrations of glucose, lipid, creatinine, and thyroid hormone. In addition, abnormalities in isolated working heart function and glycerol output from adipose tissue of diabetic animals were also corrected after vanadyl treatment. These results suggest that vanadium when used in the vanadyl form is effective in diminishing the diabetic state in the rat by substituting for and replacing insulin or possibly by enhancing the effects of endogenous insulin.

We analyzed a recently reported (K. Seno, T. Okuno, K. Nishi, Y. Murakami, F. Watanabe, T. Matsuur, M. Wada, Y. Fujii, M. Yamada, T. Ogawa, T. Okada, H. Hashizume, M. Kii, S.-H. Hara, S. Hagishita, S. Nakamoto, J. Med. Chem. 43 (2000)) pyrrolidine-based inhibitor, pyrrolidine-1, against the human group IV cytosolic phospholipase A(2) alpha-isoform (cPLA(2)alpha). Pyrrolidine-1 inhibits cPLA(2)alpha by 50% when present at approx. 0.002 mole fraction in the interface in a number of in vitro assays. It is much less potent on the cPLA(2)gamma isoform, calcium-independent group VI PLA(2) and groups IIA, X, and V secreted PLA(2)s. Pyrrolidine-1 blocked all of the arachidonic acid released in Ca(2+) ionophore-stimulated CHO cells stably transfected with cPLA(2)alpha, in zymosan- and okadaic acid-stimulated mouse peritoneal macrophages, and in ATP- and Ca(2+) ionophore-stimulated MDCK cells.

Studies involving pharmacologic or molecular biologic manipulation of Group VIA phospholipase A(2) (iPLA(2)beta) activity in pancreatic islets and insulinoma cells suggest that iPLA(2)beta participates in insulin secretion. It has also been suggested that iPLA(2)beta is a housekeeping enzyme that regulates cell 2-lysophosphatidylcholine (LPC) levels and arachidonate incorporation into phosphatidylcholine (PC). We have generated iPLA(2)beta-null mice by homologous recombination and have reported that they exhibit reduced male fertility and defective motility of spermatozoa. Here we report that pancreatic islets from iPLA(2)beta-null mice have impaired insulin secretory responses to D-glucose and forskolin. Electrospray ionization mass spectrometric analyses indicate that the abundance of arachidonate-containing PC species of islets, brain, and other tissues from iPLA(2)beta-null mice is virtually identical to that of wild-type mice, and no iPLA(2)beta mRNA was observed in any tissue from iPLA(2)beta-null mice at any age. Despite the insulin secretory abnormalities of isolated islets, fasting and fed blood glucose concentrations of iPLA(2)beta-null and wild-type mice are essentially identical under normal circumstances, but iPLA(2)beta-null mice develop more severe hyperglycemia than wild-type mice after administration of multiple low doses of the beta-cell toxin streptozotocin, suggesting an impaired islet secretory reserve. A high fat diet also induces more severe glucose intolerance in iPLA(2)beta-null mice than in wild-type mice, but PLA(2)beta-null mice have greater responsiveness to exogenous insulin than do wild-type mice fed a high fat diet. These and previous findings thus indicate that iPLA(2)beta-null mice exhibit phenotypic abnormalities in pancreatic islets in addition to testes and macrophages.

This study explored some toxicological aspects of vanadyl sulphate (VOSO4) treatment of rats made diabetic with a single intravenous injection of streptozotocin (60 mg/kg). Administered in drinking water (0.25, 0.5, 0.75 or 1 mg of VOSO4, 5H2O ml) VOSO4 treatment partially or totally corrected some of the alterations associated with the diabetic state (hyperglycaemia, polydipsia, polyphagia, high cholesterol and triglycerides levels) and did not produce any changes in various plasma or blood cell parameters which were not previously altered by diabetes. Measurement of vanadium levels indicated that tissues accumulated vanadium in the following order of concentrations: bone greater than kidney greater than spleen greater than liver greater than lung greater than or equal to muscle greater than blood. Histopathological studies did not reveal any difference in liver, stomach, ileum, spleen, heart and lung from control, non-treated diabetic or VOSO4-treated diabetic animals. Kidney of all non-treated diabetic animals showed an epithelial cellular swelling of distal tubules while only 2 of 6 VOSO4-treated diabetic animals showed this alteration. Cellular degeneration of pancreas B-cells was less marked in VOSO4-treated that in non-treated diabetic animals. The study indicates that VOSO4 may be a potential antidiabetic agent.

Beta-cell mass is regulated by a balance between beta-cell growth and beta-cell death, due to apoptosis. We previously reported that apoptosis of INS-1 insulinoma cells due to thapsigargin-induced ER stress was suppressed by inhibition of the group VIA Ca2+-independent phospholipase A2 (iPLA2beta), associated with an increased level of ceramide generation, and that the effects of ER stress were amplified in INS-1 cells in which iPLA2beta was overexpressed (OE INS-1 cells). These findings suggested that iPLA2beta and ceramides participate in ER stress-induced INS-1 cell apoptosis. Here, we address this possibility and also the source of the ceramides by examining the effects of ER stress in empty vector (V)-transfected and iPLA2beta-OE INS-1 cells using apoptosis assays and immunoblotting, quantitative PCR, and mass spectrometry analyses. ER stress induced expression of ER stress factors GRP78 and CHOP, cleavage of apoptotic factor PARP, and apoptosis in V and OE INS-1 cells. Accumulation of ceramide during ER stress was not associated with changes in mRNA levels of serine palmitoyltransferase (SPT), the rate-limiting enzyme in de novo synthesis of ceramides, but both message and protein levels of neutral sphingomyelinase (NSMase), which hydrolyzes sphingomyelins to generate ceramides, were temporally increased in the INS-1 cells. The increases in the level of NSMase expression in the ER-stressed INS-1 cells were associated with corresponding temporal elevations in ER-associated iPLA2beta protein and catalytic activity. Pretreatment with BEL inactivated iPLA2beta and prevented induction of NSMase message and protein in ER-stressed INS-1 cells. Relative to that in V INS-1 cells, the effects of ER stress were accelerated and/or amplified in the OE INS-1 cells. However, inhibition of iPLA2beta or NSMase (chemically or with siRNA) suppressed induction of NSMase message, ceramide generation, sphingomyelin hydrolysis, and apoptosis in both V and OE INS-1 cells during ER stress. In contrast, inhibition of SPT did not suppress ceramide generation or apoptosis in either V or OE INS-1 cells. These findings indicate that iPLA2beta activation participates in ER stress-induced INS-1 cell apoptosis by promoting ceramide generation via NSMase-catalyzed hydrolysis of sphingomyelins, raising the possibility that this pathway contributes to beta-cell apoptosis due to ER stress.

Earlier studies revealed a general amelioration of diabetes-induced alterations in the rat following chronic oral vanadyl treatment. Recently, some streptozotocin-diabetic animals treated similarly were observed to remain euglycemic after withdrawal from vanadyl. In the present study, the diabetic profile of these animals (STZ-T) was investigated. After 3 weeks of treatment with vanadyl followed by 13 weeks of withdrawal, plasma concentrations of glucose, insulin, lipids, and thyroid hormones in the STZ-T animals were returned to control levels. Myocardial dysfunction and increased glycerol output from adipose tissue in untreated-diabetic (STZ) rats were also found to be normalized in the STZ-T group. Furthermore, there was no evidence of cataracts in these animals compared with age-matched STZ rats. These findings indicate that short-term oral treatment of diabetic rats with vanadyl induces beneficial changes that persist following withdrawal of the treatment. The results of these studies may suggest a possible new treatment protocol that could be incorporated into the management of diabetes.

Our recent studies indicate that endoplasmic reticulum (ER) stress causes INS-1 cell apoptosis by a Ca(2+)-independent phospholipase A(2) (iPLA(2)beta)-mediated mechanism that promotes ceramide generation via sphingomyelin hydrolysis and subsequent activation of the intrinsic pathway. To elucidate the association between iPLA(2)beta and ER stress, we compared beta-cell lines generated from wild type (WT) and Akita mice. The Akita mouse is a spontaneous model of ER stress that develops hyperglycemia/diabetes due to ER stress-induced beta-cell apoptosis. Consistent with a predisposition to developing ER stress, basal phosphorylated PERK and activated caspase-3 are higher in the Akita cells than WT cells. Interestingly, basal iPLA(2)beta, mature SREBP-1 (mSREBP-1), phosphorylated Akt, and neutral sphingomyelinase (NSMase) are higher, relative abundances of sphingomyelins are lower, and mitochondrial membrane potential (DeltaPsi) is compromised in Akita cells, in comparison with WT cells. Exposure to thapsigargin accelerates DeltaPsi loss and apoptosis of Akita cells and is associated with increases in iPLA(2)beta, mSREBP-1, and NSMase in both WT and Akita cells. Transfection of Akita cells with iPLA(2)beta small interfering RNA, however, suppresses NSMase message, DeltaPsi loss, and apoptosis. The iPLA(2)beta gene contains a sterol-regulatory element, and transfection with a dominant negative SREBP-1 reduces basal mSREBP-1 and iPLA(2)beta in the Akita cells and suppresses increases in mSREBP-1 and iPLA(2)beta due to thapsigargin. These findings suggest that ER stress leads to generation of mSREBP-1, which can bind to the sterol-regulatory element in the iPLA(2)beta gene to promote its transcription. Consistent with this, SREBP-1, iPLA(2)beta, and NSMase messages in Akita mouse islets are higher than in WT islets.

Glioblastoma (GBM) is a primary malignant brain tumor with a dismal prognosis, partially due to our inability to completely remove and kill all GBM cells. Rapid tumor recurrence contributes to a median survival of only 15 months with the current standard of care which includes maximal surgical resection, radiation, and temozolomide (TMZ), a blood-brain barrier (BBB) penetrant chemotherapy. Radiation and TMZ cause sphingomyelinases (SMase) to hydrolyze sphingomyelins to generate ceramides, which induce apoptosis. However, cells can evade apoptosis by converting ceramides to sphingosine-1-phosphate (S1P). S1P has been implicated in a wide range of cancers including GBM. Upregulation of S1P has been linked to the proliferation and invasion of GBM and other cancers that display a propensity for brain metastasis. To mediate their biological effects, SMases and S1P modulate signaling via phospholipase C (PLC) and phospholipase D (PLD). In addition, both SMase and S1P may alter the integrity of the BBB leading to infiltration of tumor-promoting immune populations. SMase activity has been associated with tumor evasion of the immune system, while S1P creates a gradient for trafficking of innate and adaptive immune cells. This review will explore the role of sphingolipid metabolism and pharmacological interventions in GBM and metastatic brain tumors with a focus on SMase and S1P.

A cytosolic 84-kDa group VIA phospholipase A2 (iPLA2β) that does not require Ca2+ for catalysis has been cloned from several sources, including rat and human pancreatic islet β-cells and murine P388D1 cells. Many potential iPLA2β functions have been proposed, including a signaling role in β-cell insulin secretion and a role in generating lysophosphatidylcholine acceptors for arachidonic acid incorporation into P388D1 cell phosphatidylcholine (PC). Proposals for iPLA2β function rest in part on effects of inhibiting iPLA2β activity with a bromoenol lactone (BEL) suicide substrate, but BEL also inhibits phosphatidate phosphohydrolase-1 and a group VIB phospholipase A2. Manipulation of iPLA2β expression by molecular biologic means is an alternative approach to study iPLA2β functions, and we have used a retroviral construct containing iPLA2β cDNA to prepare two INS-1 insulinoma cell clonal lines that stably overexpress iPLA2β. Compared with parental INS-1 cells or cells transfected with empty vector, both iPLA2β-overexpressing lines exhibit amplified insulin secretory responses to glucose and cAMP-elevating agents, and BEL substantially attenuates stimulated secretion. Electrospray ionization mass spectrometric analyses of arachidonic acid incorporation into INS-1 cell PC indicate that neither overexpression nor inhibition of iPLA2β affects the rate or extent of this process in INS-1 cells. Immunocytofluorescence studies with antibodies directed against iPLA2β indicate that cAMP-elevating agents increase perinuclear fluorescence in INS-1 cells, suggesting that iPLA2β associates with nuclei. These studies are more consistent with a signaling than with a housekeeping role for iPLA2β in insulin-secreting β-cells. A cytosolic 84-kDa group VIA phospholipase A2 (iPLA2β) that does not require Ca2+ for catalysis has been cloned from several sources, including rat and human pancreatic islet β-cells and murine P388D1 cells. Many potential iPLA2β functions have been proposed, including a signaling role in β-cell insulin secretion and a role in generating lysophosphatidylcholine acceptors for arachidonic acid incorporation into P388D1 cell phosphatidylcholine (PC). Proposals for iPLA2β function rest in part on effects of inhibiting iPLA2β activity with a bromoenol lactone (BEL) suicide substrate, but BEL also inhibits phosphatidate phosphohydrolase-1 and a group VIB phospholipase A2. Manipulation of iPLA2β expression by molecular biologic means is an alternative approach to study iPLA2β functions, and we have used a retroviral construct containing iPLA2β cDNA to prepare two INS-1 insulinoma cell clonal lines that stably overexpress iPLA2β. Compared with parental INS-1 cells or cells transfected with empty vector, both iPLA2β-overexpressing lines exhibit amplified insulin secretory responses to glucose and cAMP-elevating agents, and BEL substantially attenuates stimulated secretion. Electrospray ionization mass spectrometric analyses of arachidonic acid incorporation into INS-1 cell PC indicate that neither overexpression nor inhibition of iPLA2β affects the rate or extent of this process in INS-1 cells. Immunocytofluorescence studies with antibodies directed against iPLA2β indicate that cAMP-elevating agents increase perinuclear fluorescence in INS-1 cells, suggesting that iPLA2β associates with nuclei. These studies are more consistent with a signaling than with a housekeeping role for iPLA2β in insulin-secreting β-cells. Phospholipases A2(PLA2) 1The abbreviations used are:PLA2phospholipase A2BELbromoenol lactone suicide substrateBSAbovine serum albumincPLA2group IV phospholipase A2ERendoplasmic reticulumESIelectrospray ionizationGCgas chromatographyGPCglycerophosphocholineIBMXisobutylmethylxanthineiPLA2βgroup VIA phospholipase A2iPLA2γgroup VIB phospholipase A2, MS, mass spectrometryNP-HPLCnormal phase high performance liquid chromatographyPAPHphosphatidate phosphohydrolasePAGEpolyacrylamide gel electrophoresisPBSphosphate-buffered salinePCphosphatidylcholineRP-HPLCreverse phase high performance liquid chromatographysPLA2secretory phospholipase A2TLCthin layer chromatographyTBS-TTris-buffered saline with Tween 20LPClysophosphatidylcholine catalyze hydrolysis of the sn-2 fatty acid substituent from glycerophospholipid substrates to yield a free fatty acid and a 2-lysophospholipid (1Dennis E.A. J. Biol. Chem. 1994; 269: 13057-13060Abstract Full Text PDF PubMed Google Scholar, 2Gijon M.A. Leslie C.C. Semin. Cell Dev. Biol. 1997; 8: 297-303Crossref PubMed Google Scholar, 3Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (733) Google Scholar, 4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar, 5Leslie C.C. J. Biol. Chem. 1997; 272: 16709-16712Abstract Full Text Full Text PDF PubMed Scopus (719) Google Scholar, 6Tischfield J.A. J. Biol. Chem. 1997; 272: 17247-17250Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar, 7Stafforini D.M. McIntyre T.M. Zimmerman G.A. Prescott S.M. J. Biol. Chem. 1997; 272: 17895-17898Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar). PLA2 are a diverse group of enzymes, and the first members to be well characterized have low molecular masses (∼14 kDa), require millimolar [Ca2+] for catalytic activity, and function as extracellular secreted enzymes designated sPLA2 (3Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (733) Google Scholar, 6Tischfield J.A. J. Biol. Chem. 1997; 272: 17247-17250Abstract Full Text Full Text PDF PubMed Scopus (264) Google Scholar). The first PLA2 to be cloned that is active at [Ca2+] that can be achieved in the cytosol of living cells is an 85-kDa protein classified as a group IV PLA2 and designated cPLA2 (3Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (733) Google Scholar, 5Leslie C.C. J. Biol. Chem. 1997; 272: 16709-16712Abstract Full Text Full Text PDF PubMed Scopus (719) Google Scholar). This enzyme is induced to associate with its substrates in membranes by rises in cytosolic [Ca2+] within the range achieved in cells stimulated by extracellular signals that induce Ca2+release from intracellular sequestration sites or Ca2+entry from the extracellular space, is also regulated by phosphorylation, and prefers substrates with sn-2 arachidonoyl residues (5Leslie C.C. J. Biol. Chem. 1997; 272: 16709-16712Abstract Full Text Full Text PDF PubMed Scopus (719) Google Scholar). phospholipase A2 bromoenol lactone suicide substrate bovine serum albumin group IV phospholipase A2 endoplasmic reticulum electrospray ionization gas chromatography glycerophosphocholine isobutylmethylxanthine group VIA phospholipase A2 group VIB phospholipase A2, MS, mass spectrometry normal phase high performance liquid chromatography phosphatidate phosphohydrolase polyacrylamide gel electrophoresis phosphate-buffered saline phosphatidylcholine reverse phase high performance liquid chromatography secretory phospholipase A2 thin layer chromatography Tris-buffered saline with Tween 20 lysophosphatidylcholine A second cytosolic PLA2 has been cloned (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (263) Google Scholar, 9Balboa M.A. Balsinde J. Jones S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar) that does not require Ca2+ for catalysis, and it is classified as a group VIA PLA2 and has been designated iPLA2(3Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (733) Google Scholar, 4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar). The iPLA2 enzymes cloned from hamster (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (263) Google Scholar), mouse (9Balboa M.A. Balsinde J. Jones S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar), and rat (10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar) cells represent species homologs, and all are 84-kDa proteins containing 752 amino acid residues with highly homologous sequences. Each contains a GXSXG lipase consensus motif and eight stretches of a repeating motif homologous to a repetitive motif in the integral membrane protein-binding domain of ankyrin (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (263) Google Scholar, 9Balboa M.A. Balsinde J. Jones S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar). Each of these iPLA2 enzymes is susceptible to inhibition (8Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (263) Google Scholar, 9Balboa M.A. Balsinde J. Jones S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar) by a bromoenol lactone (BEL) suicide substrate (11Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 12Zupan L.A. Weiss R.H. Hazen S. Parnas B.L. Aston K.W. Lennon P.J. Getman D.P. Gross R.W. J. Med. Chem. 1993; 36: 95-100Crossref PubMed Google Scholar) that is not an effective inhibitor of sPLA2 or cPLA2 enzymes at comparable concentrations (4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar, 11Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 12Zupan L.A. Weiss R.H. Hazen S. Parnas B.L. Aston K.W. Lennon P.J. Getman D.P. Gross R.W. J. Med. Chem. 1993; 36: 95-100Crossref PubMed Google Scholar, 13Balsinde J. Dennis E.A. J. Biol. Chem. 1996; 271: 6758-6765Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar, 14Ma Z. Ramanadham S. Hu Z. Turk J. Biochim. Biophys. Acta. 1998; 1391: 384-400Crossref PubMed Scopus (42) Google Scholar). It has been proposed that this enzyme now be designated iPLA2β to distinguish it from a membrane-associated, Ca2+-independent PLA2 that contains a peroxisomal targeting sequence and is designated iPLA2γ (15Mancuso D.J. Jenkins C.M. Gross R.W. J. Biol. Chem. 2000; 275: 9937-9945Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar, 16Tanaka H. Takeya R. Sumimoto H. Biochem. Biophys. Res. Commun. 2000; 272: 320-326Crossref PubMed Scopus (0) Google Scholar). Proposed functions for iPLA2β include a housekeeping role in phospholipid remodeling that involves generation of lysophospholipid acceptors for incorporation of arachidonic acid into phospholipids of murine P388D1 macrophage-like cells (4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar, 17Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar, 18Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). This proposal (4Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (278) Google Scholar) derives from experiments involving inhibition of iPLA2activity in P388D1 cells with BEL (17Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar) or with an antisense oligonucleotide (18Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Inhibition of P388D1 cell iPLA2activity suppresses incorporation of [3H]arachidonic acid into phospholipids and reduces [3H]lysophosphatidylcholine (LPC) levels in [3H]choline-labeled cells (17Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar, 18Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Arachidonate incorporation (17Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar, 18Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar) reflects a deacylation/reacylation cycle (19Lands W.E.M. Crawford C.G. Martonosi A. The Enzymes of Biological Membranes. Plenum Press, New York1976: 3-85Google Scholar,20Chilton F.H. Fonteh A.N. Suarette M.E. Triggiani M. Winkler J.D. Biochim. Biophys. Acta. 1996; 1299: 1-15Crossref PubMed Scopus (198) Google Scholar) of phospholipid remodeling rather than de novo synthesis (21Dennis E.A. Methods Enzymol. 1992; 209: 1-4Crossref PubMed Scopus (0) Google Scholar), and the level of LPC acceptors is thought to limit the rate of [3H]arachidonic acid incorporation into P388D1 cell phosphatidylcholine (PC) (17Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar, 18Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (191) Google Scholar). Many other potential iPLA2β functions have been proposed (22Derrickson B.H. Mandel L.J. Am. J. Physiol. 1997; 272: F781-F788PubMed Google Scholar, 23Larsson P.K.A. Claesson H.E. Kennedy B.P. J. Biol. Chem. 1998; 273: 207-214Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar, 24Molloy G.Y. Rattray M. Williams R.J. Neurosci. Lett. 1998; 258: 139-142Crossref PubMed Scopus (98) Google Scholar, 25Alzola E. Perez-Etxebarria A. Kabre E. Fogarty D.J. Metioui M. Chaib N. Macarulla J.M. Matute C. Dehaye J.P. Marino A. J. Biol. Chem. 1998; 273: 30127-30208Abstract Full Text Full Text PDF Scopus (81) Google Scholar, 26Larsson Forsell P.K.A. Runarsson G. Ibrahim M. Bjorkholm M. Claesson H.E. FEBS Lett. 1998; 434: 295-299Crossref PubMed Scopus (0) Google Scholar, 27Atsumi G.I. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar, 28Zhou Y.P. Teng D. Drayluk F. Ostrega D. Roe M.W. Philipson L. Polonsky K.S. J. Clin. Invest. 1998; 101: 1623-1632Crossref PubMed Google Scholar, 29Tithof P.K. Peters-Golden M. Ganey P.E. J. Immunol. 1998; 160: 953-960PubMed Google Scholar, 30Akiba S. Hayama M. Sato T. FEBS Lett. 1998; 437: 225-228Crossref PubMed Scopus (0) Google Scholar, 31Larsson Forsell P.K.A. Kennedy B.P. Claesson H.E. Eur. J. Biochem. 1999; 262: 575-585Crossref PubMed Scopus (0) Google Scholar, 32Murakami M. Kambe T. Shimbara S. Kudo I. J. Biol. Chem. 1999; 274: 3103-3115Abstract Full Text Full Text PDF PubMed Scopus (324) Google Scholar, 33Akiba S. Mizunga S. Kume K. Hayama M. Sato T. J. Biol. Chem. 1999; 274: 19906-19912Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 34Yang H.C. Mosior M. Ni B. Dennis E.A. J. Neurochem. 1999; 73: 1278-1287Crossref PubMed Scopus (107) Google Scholar, 35Yang H.C. Mosior M. Johnson C.A. Chen Y. Dennis E.A. Anal. Biochem. 1999; 269: 278-288Crossref PubMed Scopus (137) Google Scholar, 36Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 9400-9408Abstract Full Text Full Text PDF PubMed Scopus (157) Google Scholar, 37Barbour S.E. Kapur A. Deal C.L. Biochim. Biophys. Acta. 1999; 1439: 77-78Crossref PubMed Scopus (72) Google Scholar, 38Paget C. Rey A. Lafontan M. Valet P. Saulnier-Blache J.S. Biochem. Biophys. Res. Commun. 1999; 265: 572-576Crossref PubMed Scopus (15) Google Scholar, 39Atsumi G.I. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 40Olivero J. Ganey P.E. Toxicol. Appl. Pharmacol. 2000; 163: 9-16Crossref PubMed Scopus (29) Google Scholar, 41Nofer J.R. Junker R. Walter M. Seedorf U. Assman G. Zidek W. Tepel M. Arch. Biochem. Biophys. 2000; 374: 213-221Crossref PubMed Scopus (4) Google Scholar, 42Isenovic E. LaPointe M.C. Hypertension. 2000; 35: 249-254Crossref PubMed Google Scholar, 43Wakev I. Klein J. Husman M. Valeva A. Strauch S. Wirtz H. Weichel O. Bhakdi S. J. Immunol. 2000; 164: 5120-5124Crossref PubMed Scopus (63) Google Scholar, 44Ma Z. Wang X. Nowatzke W. Ramanadham S. Turk J. J. Biol. Chem. 1999; 274: 9607-9616Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 45Ma Z. Turk J. Progr. Nucleic Acid Res. Mol Biol. 2001; 67PubMed Google Scholar, 46Nowatzke W. Ramanadham S. Hsu F.F. Ma Z. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (52) Google Scholar, 47Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 48Owada S. Larsson O. Arkhammar P. Katz A.I. Chibalin A.V. Berggren P.O. Bertorello A.M. J. Biol. Chem. 1999; 274: 200-2008Abstract Full Text Full Text PDF Scopus (58) Google Scholar, 49Simonsson E. Karlsson S. Ahren B. Diabetes. 1998; 47: 1436-1443Crossref PubMed Scopus (34) Google Scholar, 50Simonsson E. Ahren B. Int. J. Pharmacol. 2000; 27: 1-11Google Scholar, 51Thams P. Capito K. Biochem. Pharm. 1997; 53: 1077-1086Crossref PubMed Scopus (0) Google Scholar, 52Ramanadham S. Gross R.W. Han X. Turk J. Biochemistry. 1993; 32: 337-346Crossref PubMed Google Scholar, 53Turk J. Gross R.W. Ramanadham S. Diabetes. 1993; 42: 367-374Crossref PubMed Scopus (0) Google Scholar, 54Ramanadham S. Wolf M. Li B. Bohrer A. Turk J. Biochim. Biophys. Acta. 1997; 1344: 153-164Crossref PubMed Scopus (33) Google Scholar), and the facts that multiple splice variants are differentially expressed among cells and form hetero-oligomers with distinct properties suggest that iPLA2 gene products might have multiple functions (23Larsson P.K.A. Claesson H.E. Kennedy B.P. J. Biol. Chem. 1998; 273: 207-214Abstract Full Text Full Text PDF PubMed Scopus (171) Google Scholar, 31Larsson Forsell P.K.A. Kennedy B.P. Claesson H.E. Eur. J. Biochem. 1999; 262: 575-585Crossref PubMed Scopus (0) Google Scholar, 44Ma Z. Wang X. Nowatzke W. Ramanadham S. Turk J. J. Biol. Chem. 1999; 274: 9607-9616Abstract Full Text Full Text PDF PubMed Scopus (92) Google Scholar, 45Ma Z. Turk J. Progr. Nucleic Acid Res. Mol Biol. 2001; 67PubMed Google Scholar). Proposed iPLA2β functions include signaling in secretion (10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar, 22Derrickson B.H. Mandel L.J. Am. J. Physiol. 1997; 272: F781-F788PubMed Google Scholar, 25Alzola E. Perez-Etxebarria A. Kabre E. Fogarty D.J. Metioui M. Chaib N. Macarulla J.M. Matute C. Dehaye J.P. Marino A. J. Biol. Chem. 1998; 273: 30127-30208Abstract Full Text Full Text PDF Scopus (81) Google Scholar, 29Tithof P.K. Peters-Golden M. Ganey P.E. J. Immunol. 1998; 160: 953-960PubMed Google Scholar, 48Owada S. Larsson O. Arkhammar P. Katz A.I. Chibalin A.V. Berggren P.O. Bertorello A.M. J. Biol. Chem. 1999; 274: 200-2008Abstract Full Text Full Text PDF Scopus (58) Google Scholar, 49Simonsson E. Karlsson S. Ahren B. Diabetes. 1998; 47: 1436-1443Crossref PubMed Scopus (34) Google Scholar, 50Simonsson E. Ahren B. Int. J. Pharmacol. 2000; 27: 1-11Google Scholar), and we and others (47Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 48Owada S. Larsson O. Arkhammar P. Katz A.I. Chibalin A.V. Berggren P.O. Bertorello A.M. J. Biol. Chem. 1999; 274: 200-2008Abstract Full Text Full Text PDF Scopus (58) Google Scholar, 49Simonsson E. Karlsson S. Ahren B. Diabetes. 1998; 47: 1436-1443Crossref PubMed Scopus (34) Google Scholar, 50Simonsson E. Ahren B. Int. J. Pharmacol. 2000; 27: 1-11Google Scholar, 51Thams P. Capito K. Biochem. Pharm. 1997; 53: 1077-1086Crossref PubMed Scopus (0) Google Scholar, 52Ramanadham S. Gross R.W. Han X. Turk J. Biochemistry. 1993; 32: 337-346Crossref PubMed Google Scholar, 53Turk J. Gross R.W. Ramanadham S. Diabetes. 1993; 42: 367-374Crossref PubMed Scopus (0) Google Scholar, 54Ramanadham S. Wolf M. Li B. Bohrer A. Turk J. Biochim. Biophys. Acta. 1997; 1344: 153-164Crossref PubMed Scopus (33) Google Scholar) have found that, in pancreatic islets, BEL attenuates glucose-induced insulin secretion, arachidonate release, and rises in islet β-cell cytosolic [Ca2+]. Both pancreatic islets and brain contain electrically active secretory cells that express high levels of iPLA2β (10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar), and iPLA2β is the vastly predominant brain cytosolic PLA2 (24Molloy G.Y. Rattray M. Williams R.J. Neurosci. Lett. 1998; 258: 139-142Crossref PubMed Scopus (98) Google Scholar, 34Yang H.C. Mosior M. Ni B. Dennis E.A. J. Neurochem. 1999; 73: 1278-1287Crossref PubMed Scopus (107) Google Scholar, 35Yang H.C. Mosior M. Johnson C.A. Chen Y. Dennis E.A. Anal. Biochem. 1999; 269: 278-288Crossref PubMed Scopus (137) Google Scholar). BEL also inhibits iPLA2γ (15Mancuso D.J. Jenkins C.M. Gross R.W. J. Biol. Chem. 2000; 275: 9937-9945Abstract Full Text Full Text PDF PubMed Scopus (174) Google Scholar) and phosphatidate phosphohydrolase-1 (PAPH-1) (55Balsinde J. Dennis E.A. J. Biol. Chem. 1996; 271: 31937-31941Abstract Full Text Full Text PDF PubMed Scopus (180) Google Scholar), and the ambiguity of pharmacologic studies makes manipulating iPLA2β expression by molecular biologic means an attractive alternative to study iPLA2β functions. We report here the preparation of two stably transfected insulinoma cell lines that overexpress iPLA2β. We have studied insulin secretory responses, arachidonate incorporation into phosphatidylcholine, and iPLA2β subcellular location in these lines. ECL detection reagents and 1-palmitoyl-2-[14C]linoleoyl-sn-glycero-3-phosphocholine (55 mCi/mmol) were purchased from Amersham Pharmacia Biotech. Phosphatidylcholine standards were obtained from Avanti Polar Lipids (Birmingham, AL) and arachidonic acid from Nu-Chek Prep (Elysian, MN). BEL iPLA2 suicide substrate (E)-6-(bromomethylene)tetrahydro-3-(1-naphthalenyl)-2H-pyran-2-one was purchased from Cayman Chemical (Ann Arbor, MI). Tissue culture media (CMRL-1066, RPMI, and minimal essential medium), penicillin, streptomycin, Hanks' balanced salt solution, andl-glutamine were purchased from Life Technologies, Inc. Fetal bovine serum was obtained from HyClone (Logan, UT) and Pentex bovine serum albumin (BSA, fatty acid-free, fraction V) from ICN Biomedical (Aurora, OH). ATP, ampicillin, IBMX, propranolol, and kanamycin were obtained from Sigma and forskolin from Calbiochem (La Jolla, CA). Krebs-Ringer bicarbonate buffer (KRB) contained 25 mm HEPES, pH 7.4, 115 mm NaCl, 24 mm NaHCO3, 5 mm KCl, 1 mm MgCl2. INS-1 insulinoma cells provided by Dr. Christopher Newgard (University of Texas, Dallas, TX) were cultured as described (56Frodin M. Sekine N. Roche E. Fillous C. Prentki M. Wollheim C.B. Obberghen E.V. J. Biol. Chem. 1995; 270: 7882-7889Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar, 57Assimacopoulos-Jeannett F. Thumelin S. Roche E. Esser V. McGarry J.D. Prentki M. J. Biol. Chem. 1997; 272: 1659-1664Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar, 58Sekine N. Fasolato C. Pralong W.F. Theler J.-M. Wollheim C.B. Diabetes. 1997; 46: 1424-1433Crossref PubMed Scopus (26) Google Scholar) in RPMI 1640 medium containing 11 mmglucose, 10% fetal calf serum, 10 mm Hepes buffer, 2 mm glutamine, 1 mm sodium pyruvate, 50 mm β-mercaptoethanol, 100 units/ml penicillin, and 100 μg/ml streptomycin. RetroPack PT 67 cells (CLONTECH, Palo Alto, CA) were maintained in Dulbecco's modified Eagle's medium (4.5 mg/ml glucose) containing 10% fetal bovine serum, 4 mml-glutamine, 100 units/ml penicillin, and 100 μg/ml streptomycin. A retroviral system (59Coffin J.M. Varmus H.E. Retrovirus. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1996Google Scholar, 60Morgenstern J.P. Land H. Nucleic Acids Res. 1990; 18: 3587-3590Crossref PubMed Google Scholar) was used to stably transfect INS-1 cells with iPLA2β cDNA and achieve overexpression. To construct the retroviral vector, iPLA2β cDNA (10Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (0) Google Scholar) was subcloned into EcoRI-BglII multiple cloning sites of pMSCVneo vector using the CLONTECH murine stem cell retrovirus (MSCV) expression system. Full-length rat pancreatic islet iPLA2β cDNA was excised from pBK-CMV-iPLA2β vector and subcloned into the retroviral vector pMSCVneo at the recognition sites for restriction endonucleasesEcoRI and XhoI. The construct containing the iPLA2β cDNA (pMSCVneo-iPLA2β) was transfected into CLONTECH RetroPack PT 67 packaging cells with a GenePORTER transfection system according to the manufacturer's instructions (Gene Therapy Systems, San Diego, CA). Upon transfection of packaging cells, pMSCVneo integrated into the genome and expressed a transcript containing viral packaging signal, a neomycin resistance gene that confers resistance to the selection agent G418, and iPLA2β cDNA. This transcript is recognized by viral proteins in packaging cells. Introduction of pMSCVneo-iPLA2β into PT 67 cells results in production of high titer, replication-incompetent infectious virus particles that were released into the culture medium, collected, and used to infect INS-1 cells. INS-1 cells were plated on 100-mm Petri dishes at a density of 3–5 × 105 cells/plate 12–18 h before infection. Freshly collected, retrovirus-containing medium was passed through a 0.45-μm filter and added to INS-1 cell monolayers. Polybrene (final concentration 4 μg/ml) was added to culture medium, and medium was replaced after 24 h of incubation. To select stably transfected cells that expressed high levels of iPLA2β, retrovirally infected cells were cultured with G418 (0.4 mg/ml) for 1–2 weeks. After G418-resistant colonies became apparent, cell culture was continued for several days. Individual colonies were transferred to a 48-well plate for expansion of clonal cells. Two iPLA2β-overexpressing (iPLA2-X) lines were obtained that exhibit similar properties not shared by parental cells or clonal lines selected after transfection with empty vector. Seeded INS-1 were washed with phosphate-buffered saline (PBS) and detached by trituration. Cells were collected by centrifugation and disrupted by sonication (Vibra Cell High Intensity Processor, five 1-s pulses, amplitude 12%) in homogenization buffer (250 mm sucrose, 40 mm Tris-HCI, pH 7.1, 4 °C). Homogenates were centrifuged (15,000 × g, 45 min, 4 °C) to yield a cytosolic supernatant. Protein content was measured with Coomassie regent (Pierce) against bovine serum albumin standard. Ca2+-independent PLA2 activity in aliquots of cytosol (25 μg of protein) was assayed by ethanolic injection (5 μl) of 1-palmitoyl-2-[14C]linoleoyl-sn-glycero-3-phosphocholine (final concentration 5 μm) in assay buffer (40 mm Tris, pH 7.5, 5 mm EGTA; total volume 200 μl). Assay mixtures were incubated (3 min, 37 °C, with shaking) and reactions terminated by adding butanol (0.1 ml) and vortexing. After centrifugation (2,000 × g, 5 min), products in the butanol layer were analyzed by silica gel G TLC in petroleum ether/ethyl ether/acetic acid (80/20/1). The TLC plate region containing free fatty acid was identified with iodine vapor and scraped into a scintillation vial. Released [14C]fatty acid was measured by liquid scintillation spectrometry, and PLA2specific activity was calculated from dpm of released fatty acid and protein content as described (61Gross R.W. Ramanadham S. Kruszka K. Han X. Turk J. Biochemistry. 1993; 32: 327-336Crossref PubMed Scopus (0) Google Scholar). INS-1 cell cytosolic proteins were analyzed by SDS-PAGE and transferred to a nylon membrane that was subsequently blocked (3 h, room temperature) with Tris-buffered saline plus Tween (TBS-T, 20 mm Tris-HCl, 137 mm NaCl, pH 7.6, 0.05% Tween 20) containing 5% milk protein. The blot was then washed (TBS-T, 5 min, five times) and incubated (1 h, room temperature) with a polyclonal antibody (1:2000 dilution in TBS-T) to iPLA2β generated by multiple antigen core technology against peptides in the iPLA2β deduced amino acid sequence, as described below. The nylon membrane was then washed in TBS-T (5 min, five times) and incubated (1 h, room temperature) with a secondary antibody coupled to horseradish

The insulin secretagogue D-glucose induces both accumulation of nonesterified arachidonic acid (35 μM) in pancreatic islets and a rise in beta cell cytosolic [Ca++]i. Arachidonate amplifies both voltage-dependent Ca++ entry in secretory cells and depolarization-induced insulin secretion. Here, arachidonate induced a biphasic rise in [Ca++]i of Fura-2AM loaded beta cells which increased with arachidonate concentration (5–30 μM), was reversed upon washout, and was unaffected by the arachidonate oxygenase inhibitor BW755C. The sustained phase of the rise was abolished by removal of extracellular Ca++ and amplified by depolarization with KCl. The accumulation of nonesterified arachidonate in islets stimulated by D-glucose may therefore promote the D-glucose-induced rise in beta cell [Ca++]i.

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTMass spectrometric identification and quantitation of arachidonate-containing phospholipids in pancreatic islets: Prominence of plasmenylethanolamine molecular speciesSasanka Ramanadham, Alan Bohrer, Mary Mueller, Patricia Jett, Richard W. Gross, and John TurkCite this: Biochemistry 1993, 32, 20, 5339–5351Publication Date (Print):May 25, 1993Publication History Published online1 May 2002Published inissue 25 May 1993https://doi.org/10.1021/bi00071a009RIGHTS & PERMISSIONSArticle Views123Altmetric-Citations67LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (2 MB) Get e-Alerts Get e-Alerts

Glucose-induced insulin secretion from pancreatic islets involves hydrolysis of arachidonic acid from phospholipids as an intermediary event. Accumulation of nonesterified arachidonate in islet membranes may influence both ion fluxes that trigger insulin secretion and fusion of secretory granule and plasma membranes. Recent findings indicate that plasmenylethanolamine species may also participate in fusion of such membranes, but high-performance liquid chromatographic (HPLC) and gas chromatographic/mass spectrometric (GC/MS) analyses of islet secretory granule phospholipids suggested that they contain little plasmenylethanolamine. Here, electrospray ionization mass spectrometry (ESI/MS) of intact phospholipid molecules is used to demonstrate that the most prominent components of all major glycerophospholipid headgroup classes in islets are arachidonate-containing species. Such species contribute the majority of the ESI/MS negative ion current from rat and human islet glycerophosphoethanolamine (GPE), and the fraction of GPE negative ion current contributed by plasmenylethanolamine species in rat islets is higher than that for rat liver or heart and similar to that for brain. The most prominent sn-2 substituent of plasmenylethanolamine species in brain is docosahexaenoate and in islets is arachidonate. Arachidonate-containing plasmenylethanolamine species are also prominent components of GPE from islet secretory granules and plasma membranes. Fusion of islet secretory granule and plasma membranes is demonstrated to be catalyzed by cytosolic components from insulinoma cells and rat brain with chromatographic similarities to a rabbit brain factor that specifically catalyzes fusion of plasmenylethanolamine-containing membranes.

Insulin secretion is associated with changes in pancreatic β-cell K+ permeability. A degenerate polymerase chain reaction strategy based on the conserved features of known inwardly rectifying K+ (KIR) channel genes was used to identify members of this family expressed in human pancreatic islets and insulinoma. Three related human KIR transcript sequences were found: CIR (also known as cardiac KATP-1), GIRK1, and GIRK2 (KATP-2). The pancreatic islet CIR and GIRK2 full-length cDNAs were cloned, and their genes were localized to human chromosomes 11q23-ter and 21, respectively. Northern blot analysis detected CIR mRNA at similar levels in human islets and exocrine pancreas, while the abundance of GIRK2 mRNA in the two tissues was insufficient for detection by this method. Using competitive reverse-transcription polymerase chain reaction, CIR was found to be present at higher levels than GIRK2 mRNA in native purified β-cells. Xenopus oocytes injected with M2 muscarinic receptor (M2) plus either GIRK2 or CIR cRNA expressed only very small carbachol-induced currents, while co-injection of CIR plus GIRK2 along with M2 resulted in expression of carbachol-activated strong inwardly rectifying currents. Activators of KATP channels failed to elicit currents in the presence or absence of co-expressed sulfonylurea receptor. These results show that two components of islet cell KIR channels, CIR and GIRK2, may interact to form heteromeric G-protein-activated inwardly rectifying K+ channels that do not possess the typical properties of KATP channels. Insulin secretion is associated with changes in pancreatic β-cell K+ permeability. A degenerate polymerase chain reaction strategy based on the conserved features of known inwardly rectifying K+ (KIR) channel genes was used to identify members of this family expressed in human pancreatic islets and insulinoma. Three related human KIR transcript sequences were found: CIR (also known as cardiac KATP-1), GIRK1, and GIRK2 (KATP-2). The pancreatic islet CIR and GIRK2 full-length cDNAs were cloned, and their genes were localized to human chromosomes 11q23-ter and 21, respectively. Northern blot analysis detected CIR mRNA at similar levels in human islets and exocrine pancreas, while the abundance of GIRK2 mRNA in the two tissues was insufficient for detection by this method. Using competitive reverse-transcription polymerase chain reaction, CIR was found to be present at higher levels than GIRK2 mRNA in native purified β-cells. Xenopus oocytes injected with M2 muscarinic receptor (M2) plus either GIRK2 or CIR cRNA expressed only very small carbachol-induced currents, while co-injection of CIR plus GIRK2 along with M2 resulted in expression of carbachol-activated strong inwardly rectifying currents. Activators of KATP channels failed to elicit currents in the presence or absence of co-expressed sulfonylurea receptor. These results show that two components of islet cell KIR channels, CIR and GIRK2, may interact to form heteromeric G-protein-activated inwardly rectifying K+ channels that do not possess the typical properties of KATP channels. INTRODUCTIONThe permeability of K+ ions plays a crucial role in the control of pancreatic islet β-cell excitability and insulin secretion(1Misler S. Barnett D.W. Gillis K.D. Pressel D.M. Diabetes. 1992; 41: 1221-1228Crossref PubMed Google Scholar, 2Ashcroft F.M. Rorsman P. Prog. Biophys. Mol. Biol. 1991; 54: 87-143Crossref Scopus (945) Google Scholar). Electrophysiological studies have revealed at least four classes of functionally distinct K+ currents in β-cells: 1) ATP-sensitive K+ channels that close in response to increased intracellular ATP/ADP ratios generated by increased metabolic flux, 2) voltage-gated K+ channels activated by depolarization, 3) large and small conductance calcium-activated K+ channels, and 4) ligand-gated K+ channels that respond to physiological agonists acting through G-protein-coupled receptors(1Misler S. Barnett D.W. Gillis K.D. Pressel D.M. Diabetes. 1992; 41: 1221-1228Crossref PubMed Google Scholar, 3Cook D.L. Hales C.N. Nature. 1984; 311: 271-273Crossref PubMed Scopus (968) Google Scholar, 4Rorsman P. Bokvist K. Ammala C. Arkhammar P. Berggren P.O. Larsson O. Wahlander K. Nature. 1991; 349: 77-79Crossref PubMed Scopus (109) Google Scholar, 5Rorsman P. Trube G. J. Physiol. (Lond.). 1986; 374: 531-550Crossref Scopus (284) Google Scholar). Because pancreatic islet K+ channel genes are only beginning to be identified, the molecular basis for most of these currents remains unknown(6Inagaki N. Tsuura Y. Namba N. Masuda K. Gonoi T. Horie M. Seino Y. Mizuta M. Seino M. J. Biol. Chem. 1995; 270: 5691-5694Abstract Full Text Full Text PDF PubMed Scopus (369) Google Scholar, 7Philipson L.H. Hice R.E. Schaefer K. LaMendola J. Bell G.I. Nelson D.J. Steiner D. Proc. Natl. Acad. Sci. U. S. A. 1991; 88: 53-57Crossref PubMed Scopus (71) Google Scholar, 8Yano H. Philipson L.H. Kugler J.L. Tokuyama Y. David E.M. LeBeau M. Nelson D.J. Bell G.I. Takeda J. Mol. Pharmacol. 1994; 45: 854-860PubMed Google Scholar). Furthermore, their precise contribution to insulin secretory activity is largely not understood. The characterization of K+ channel proteins synthesized in islet cells is of great practical interest, as it will contribute to understanding β-cell electrophysiology and potentially enhance the development of more effective and specific drugs to manipulate insulin secretory function. Furthermore, because defective insulin release is central to the pathogenesis of non-insulin-dependent diabetes mellitus(9Porte Jr., D.J. Diabetes. 1991; 40: 166-180Crossref PubMed Scopus (0) Google Scholar), these molecules provide a valuable source of candidate genes to study the inherited basis of this disorder.A novel superfamily of genes encoding inward rectifying K+ (KIR) channels has been recently identified(10Ho K. Nichols C.G. Lederer W.J. Lytton J. Vassilev P.M. Kanazirska M.V. Hebert S.C. Nature. 1993; 362: 31-38Crossref PubMed Scopus (831) Google Scholar, 11Kubo Y. Baldwin T.J. Jan Y.N. Jan L.Y. Nature. 1993; 362: 127-133Crossref PubMed Scopus (936) Google Scholar, 12Kubo Y. Reuveny E. Slesinger P.A. Jan Y.N. Jan L.Y. Nature. 1993; 364: 802-806Crossref PubMed Scopus (542) Google Scholar, 13Stoffel M. Espinosa R. Powell K.L. Philipson L.H. Lebeau M.M. Bell G.I. Genomics. 1994; 21: 254-256Crossref PubMed Scopus (28) Google Scholar). Unlike voltage-activated K+ channels of the Shaker gene family which are opened by membrane depolarization(14Salkoff L. Baker K. Butler A. Covarrubias M. Pak M. Wei A. Trends Neurosci. 1992; 15: 161-166Abstract Full Text PDF PubMed Scopus (254) Google Scholar), KIR channels are open at hyperpolarized potentials. These channels share an underlying conserved structure, with two predicted membrane spanning domains, homologous to the fifth (S5) and sixth (S6) transmembrane domains of voltage-gated channels, encompassing a region homologous to the pore-forming portion of voltage-activated channels(14Salkoff L. Baker K. Butler A. Covarrubias M. Pak M. Wei A. Trends Neurosci. 1992; 15: 161-166Abstract Full Text PDF PubMed Scopus (254) Google Scholar). KIR channels, however, lack a portion homologous to the amino-terminal region of voltage-gated channels (S1-S4).Islet β-cells contain K+ channels which have gating properties similar to members of the KIR family of channels, including ATP-sensitive channels (KATP) and G-protein-activated K+ channels that do not possess features of KATP channels(2Ashcroft F.M. Rorsman P. Prog. Biophys. Mol. Biol. 1991; 54: 87-143Crossref Scopus (945) Google Scholar, 4Rorsman P. Bokvist K. Ammala C. Arkhammar P. Berggren P.O. Larsson O. Wahlander K. Nature. 1991; 349: 77-79Crossref PubMed Scopus (109) Google Scholar). These channels may be involved in the regulation of insulin secretion by glucose and/or neurotransmitters acting through G-protein-coupled receptors(1Misler S. Barnett D.W. Gillis K.D. Pressel D.M. Diabetes. 1992; 41: 1221-1228Crossref PubMed Google Scholar, 4Rorsman P. Bokvist K. Ammala C. Arkhammar P. Berggren P.O. Larsson O. Wahlander K. Nature. 1991; 349: 77-79Crossref PubMed Scopus (109) Google Scholar, 15Ashford M.L.J. Bond C.T. Blair T.A. Adelman J.P. Nature. 1994; 370: 456-459Crossref PubMed Scopus (168) Google Scholar, 16Dunne M.J. Bullett M.J. Li G. Wollheim C.B. Petersen O.H. EMBO J. 1989; 8: 413-420Crossref PubMed Scopus (130) Google Scholar). Because islet KIR proteins are likely to share homology to other KIR molecules, we have employed a degenerate polymerase chain reaction strategy based on the conserved features of known KIR genes to identify and clone members of this family expressed in pancreatic islets. We demonstrate here the presence of three related KIR transcript sequences, CIR, GIRK1, and GIRK2, in human pancreatic islet cells. In contrast to previous work based on studies with cultured tumor β-cell lines which disclosed the presence of GIRK2, but not CIR(15Ashford M.L.J. Bond C.T. Blair T.A. Adelman J.P. Nature. 1994; 370: 456-459Crossref PubMed Scopus (168) Google Scholar, 17Tsaur M.L. Menzel S. Lai F.P. Espinosa III, R. Concannon P. Spielman R.S. Hanis C.L. Cox N.J. Lebeau M.M. German M.S. Jan L.Y. Bell G.I. Stoffel M. Diabetes. 1995; 44: 592-596Crossref PubMed Scopus (40) Google Scholar), CIR was found to be more abundant than GIRK2 in native purified pancreatic β-cells. Cloned islet cell CIR and GIRK2 cDNAs are shown to express heteromultimeric G-protein-activated KIR channels that do not possess characteristic features of KATP channels in the presence or absence of co-expressed sulfonylurea receptor (18Aguilar-Bryan L. Nichols C.G. Wechsler S.W. Clement J.P.I. Boyd A.E.I. Gonzalez G. Herrera-Sosa H. Nguy K. Bryan J. Nelson D. Science. 1995; 268: 423-426Crossref PubMed Scopus (1279) Google Scholar).EXPERIMENTAL PROCEDURESTissue Procurement and Isolation of RNAPurified human pancreatic islets were obtained from the Human Islet Transplantation Center, Washington University School of Medicine (Dr. David Scharp), by a previously described method(19Ricordi C. Lacy P.E. Finke E.H. Olack B.J. Scharp D.W. Diabetes. 1988; 37: 413-420Crossref PubMed Google Scholar). A surgical specimen from a human insulinoma was kindly provided by Dr. W. Dilley, Department of Surgery, Washington University School of Medicine, St. Louis, MO. Rat pancreatic islets were obtained by collagenase digestion and Ficoll gradient purification, and single-cell preparations enriched in pancreatic islet β and non-β cells were obtained by fluorescence activated cell sorting, exactly as described previously(20Gross R.W. Ramanadham S. Kruszka K.K. Han X. Turk J. Biochemistry. 1993; 32: 327-336Crossref PubMed Scopus (112) Google Scholar). Total RNA was extracted by homogenization in guanidinium thiocyanate and cesium chloride gradient ultracentrifugation(21Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). The poly(A)+-enriched fraction was purified by two successive passages through oligo(dT)-cellulose columns, using standard procedures(21Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar).Reverse Transcription PCR1 with Degenerate PrimersFour-hundred ng of total RNA derived from human pancreatic islets and from a human β-cell tumor specimen were primed with random hexamers to reverse-transcribed cDNA. Degenerate primers that contained flanking restriction sites were designed based on the existence of sequence conservation among known KIR genes(6Inagaki N. Tsuura Y. Namba N. Masuda K. Gonoi T. Horie M. Seino Y. Mizuta M. Seino M. J. Biol. Chem. 1995; 270: 5691-5694Abstract Full Text Full Text PDF PubMed Scopus (369) Google Scholar, 10Ho K. Nichols C.G. Lederer W.J. Lytton J. Vassilev P.M. Kanazirska M.V. Hebert S.C. Nature. 1993; 362: 31-38Crossref PubMed Scopus (831) Google Scholar, 11Kubo Y. Baldwin T.J. Jan Y.N. Jan L.Y. Nature. 1993; 362: 127-133Crossref PubMed Scopus (936) Google Scholar, 12Kubo Y. Reuveny E. Slesinger P.A. Jan Y.N. Jan L.Y. Nature. 1993; 364: 802-806Crossref PubMed Scopus (542) Google Scholar, 15Ashford M.L.J. Bond C.T. Blair T.A. Adelman J.P. Nature. 1994; 370: 456-459Crossref PubMed Scopus (168) Google Scholar). The forward primer was 5′-TGAGAATTCTAGTGTTTCTGCTC(T/G)(T/C)TT(T/C)TTNGG-3′, corresponding to a portion of the pore domain, and the reverse primer was 5′-TTCTCCTTCTAGACTCAAGTTACNAT(A/C/T)GGNTA(C/T)GG-3′. PCR amplification was carried out for 30 cycles at 94, 56, and 72°C for 1 min each step. First round PCR products were used as templates for a second round of PCR with flanking primers 5′-ATGAGAATTCTAGTGTTTCTGCTC-3′ and 5′-TTCTCCTTCTAGACTCAAGTTAC-3′. PCR products within the expected region of 186 bp were purified and cloned into the XbaI-EcoRI site of M13mp18. Twenty-five colonies were picked, and single-stranded DNA was sequenced on an ABI 373A automated sequencer. Sequences were compared with the nonredundant nucleic acid and protein data bases using BLASTN and BLASTX algorithms.Construction of Human Insulinoma and Rat Islet cDNA LibrariesThree μg of poly(A)+-enriched RNA from purified Wistar rat pancreatic islets was used to synthesize an oligo(dT)-primed, directionally cloned cDNA library in lZAP Express (Stratagene, La Jolla, Ca). This library contained 1.5 × 102 primary pfu and had an average insert size of 1.5 kb. One μg of poly(A)+-enriched RNA was employed to construct random primed nondirectionally cloned library in lZAP II (Stratagene, La Jolla, CA), which contained 0.7 × 102 primary pfu and an average insert size of 1.1 kb. Three μg of poly(A)+-enriched RNA from human insulinoma was used to synthesize an oligo(dT)-primed, directionally cloned cDNA library in lZAP II, with 1.55 × 102 primary pfu and an average insert size of 1.7 kb. The libraries were amplified and stored as 2% MeSO stocks at −80°C.Screening of Human and Rat Islet cDNA LibrariesPCR products from islet KIR sequences were 32P-labeled by random priming to a specific activity greater than 1 × 109 cpm/μg and used as a hybridization probe to screen 5 × 105 pfu from the human insulinoma library, 3 × 105 pfu from the oligo(dT)-primed rat islet library, and 2 × 105 pfu from the random primed rat islet library. Hybridization conditions were 50% formamide, 2 × PIPES, 2% SDS, 100 μg/ml sonicated and denatured salmon sperm DNA, at 42°C for 16-20 h. Filters were washed in 0.5 × SSC, 0.1% SDS, first at room temperature and then at 50°C, and exposed to x-ray film with an intensifying screen for approximately 48 h. Plaques that showed hybridization signals on replica filters were purified by secondary screening and the pBluescript or pBK CMV sequence was excised for sequencing.Reverse Transcription-PCR and Northern Blot Analysis of Islet KIRGenesFor RT-PCR analysis of tissue distribution, RNAs from multiple human tissues were treated with RNase-free DNase (Life Technologies, Inc.), extracted with phenol-chloroform, ethanol-precipitated, and quantified by spectrophotometry. The integrity and accuracy of quantitation of RNA was ascertained by formaldehyde-agarose gel electrophoresis and ethidium bromide staining. cDNA was synthesized with oligo(dT). For each tissue, PCR with specific primers was carried out from cDNA corresponding to 80, 20, 5, and 1.25 ng of total RNA, using conditions described above except for modifications of annealing temperature and cycle number. A limited number of cycles, 25-28, were used to avoid the plateau phase of amplification. Reactions with H20 instead of cDNA and RNA lacking reverse transcriptase were used as controls. For human islet CIR, primers were 5′-GAAATGAAGAGGGAAGGCCG-3′ and 5′-GGCTCATCTTCTTCATTCTG-3′ (annealing temperature, 62°C), and primers for human islet GIRK2 were 5′- CCAATTCATTTCATCTACCA-3′ and 5′-CATGCTGGGTTTTATTACTA-3′ (annealing temperature, 58°C). Primers to co-amplify rat CIR and GIRK2 were 5′-(A/T)AGAGACAGAAAG(C/A)ACCATT-3′ and 5′-(T/C)TTC(C/T)CATCCCGCATGGAGA-3′ (annealing temperature, 58°C). PCR products were resolved on an ethidium bromide-stained 2% agarose gel and visualized under ultraviolet light.The 3′ rapid amplification of human islet KATP-1/CIR cDNA was performed as follows: reverse transcription of RNA was primed with T12(A/G/C)N, where N is A, G, C, and T. PCR amplification was performed for 35 cycles at 94, 48, and 72°C for 1 min each step with primer 5′-GGGCATTATACTCCTCTTGG-3′, derived from the insulinoma CIR degenerate PCR fragment sequence, and T12(A/G/C)N. A unique 2.4-kb band was purified and partially sequenced directly.Northern blots were prepared with selected human poly(A)+ RNA-enriched samples, hybridized with 32P-labeled probes, and washed at a final stringency of 0.1 × SSC, 0.1% SDS, 65°C before exposure to x-ray film for 48 h.Chromosomal Localization of Islet KIRGenesThe chromosomal localization of islet KIR genes was determined by PCR amplification of DNA from a panel of rodent/human somatic cell hybrids, each of which contained one of the 24 different human chromosomes(22Matsutani A. Janssen R. Donis Keller H. Permutt M.A. Genomics. 1992; 12: 319-325Crossref PubMed Scopus (53) Google Scholar). Primers and PCR conditions were identical to those used in tissue distribution studies. Sublocalization within chromosome 11 was achieved by typing a panel of well characterized human chromosome 11-Chinese hamster ovary cell hybrids containing only defined portions of human chromosome 11. A description of the chromosomal breakpoints is described in detail in (23Gerhard D.S. Lawrence E. Wu J. Chua H. Ma N. Bland S. Jones C. Genomics. 1992; 13: 1133-1142Crossref PubMed Scopus (34) Google Scholar, 24Glaser T. Housman D. Lewis W.H. Gerhard D. Jones C. Somatic Cell Mol. Genet. 1989; 15: 477-501Crossref PubMed Scopus (128) Google Scholar, 25van den Elsen P. Bruns G. Gerhard D.S. Pravtcheva D. Jones C. Housman D. Ruddle F.A. Orkin S. Terhorst C. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 2920-2924Crossref PubMed Scopus (38) Google Scholar).Oocyte Expression of KIRChannelsCapped cRNAs were transcribed in vitro from linearized cDNAs using T3 RNA polymerase (Promega, Madison, WI). Stage V-VI Xenopus oocytes were isolated by partial ovariectomy under tricaine anesthesia and then defolliculated by treatment with 1 mg/ml collagenase (Sigma Type 1A, Sigma) in zero Ca2+ ND96 for 1 h. Two to 24 h after defolliculation, oocytes were pressure-injected with ~50 nl of 1-100 ng/μl cRNA. Oocytes were kept in ND96 + 1.8 mM Ca2+ (below), supplemented with penicillin (100 units/ml) and streptomycin (100 μg/ml) for 1-7 days prior to experimentation.ElectrophysiologyOocytes were voltage-clamped using a commercial voltage-clamp amplifier (Warner Instruments, Inc.) in a small chamber (volume 200 μl) mounted on the stage of a SMZ-1 microscope (Nikon Instruments). The standard extracellular solution (KD98) contained (in mM): KCl, 98; MgCl2, 1; HEPES, 5; pH 7.5. Additions to this solution are described in the text. Electrodes were filled with 3 M KCl and had tip resistances of 1-5 M. Experiments were performed at room temperature. PClamp software and a Labmaster TL125 D/A converter were used to generate voltage pulses. Data were normally filtered at 1 kHz, signals were digitized at 22 kHz (Neurocorder, Neurodata, New York) and stored on video tape. Experiments could then be replayed onto a chart recorder or digitized into a microcomputer using Axotape software (Axon Instruments). Alternatively, signals were digitized on-line using Pclamp and stored on disk for off-line analysis.RESULTS AND DISCUSSIONCloning of Human Islet KIRmRNAs Using Degenerate PCRRT-PCR amplification of human islet and insulinoma RNA was carried out with degenerate primers corresponding to two conserved regions of KIR genes. PCR products corresponding to the expected 186-bp size were subcloned, and a total of 25 subclones were sequenced. The sequences were compared with nucleic acid and protein data bases, and 13 were found to be related to previously described KIR sequences. These could be grouped into three different islet KIR-related sequences (Fig. 1). The first sequence, labeled hi-CIR.pcr in Fig. 1, was derived from human β-cell tumor RNA. It was identical to a KIR described by different groups as the cardiac inward rectifying channel (CIR) (26Krapivinsky G. Gordon E.A. Wickman K. Velimirovic B. Krapivinski L. Clapham D.E. Nature. 1995; 394: 135-141Crossref Scopus (751) Google Scholar) or cardiac ATP-sensitive potassium channel (rat cardiac KATP-1)(15Ashford M.L.J. Bond C.T. Blair T.A. Adelman J.P. Nature. 1994; 370: 456-459Crossref PubMed Scopus (168) Google Scholar). Another islet KIR cDNA (hi-GIRK1.pcr) was represented by two clones derived from human islet RNA which had 97% nucleic acid identity with the rat G-protein-activated inward rectifying potassium channel cDNA (GIRK1)(12Kubo Y. Reuveny E. Slesinger P.A. Jan Y.N. Jan L.Y. Nature. 1993; 364: 802-806Crossref PubMed Scopus (542) Google Scholar). The translated open reading frame was identical to GIRK1(12Kubo Y. Reuveny E. Slesinger P.A. Jan Y.N. Jan L.Y. Nature. 1993; 364: 802-806Crossref PubMed Scopus (542) Google Scholar, 26Krapivinsky G. Gordon E.A. Wickman K. Velimirovic B. Krapivinski L. Clapham D.E. Nature. 1995; 394: 135-141Crossref Scopus (751) Google Scholar). While initial reports showed that GIRK1 is expressed in rat heart, muscle, and brain(12Kubo Y. Reuveny E. Slesinger P.A. Jan Y.N. Jan L.Y. Nature. 1993; 364: 802-806Crossref PubMed Scopus (542) Google Scholar), we now provide evidence for the expression of this mRNA in human islets. This is consistent with a recent publication that described cloning of a GIRK1 cDNA from a rat insulinoma cell line and subsequent mapping of the gene to chromosome 2q24(13Stoffel M. Espinosa R. Powell K.L. Philipson L.H. Lebeau M.M. Bell G.I. Genomics. 1994; 21: 254-256Crossref PubMed Scopus (28) Google Scholar). Finally, a third islet KIR cDNA fragment, hi-GIRK2.pcr, was also generated from non-tumoral human islets and had high identity (87%) with a mouse G-protein-activated brain inward rectifier mRNA which has been designated GIRK2(27Lesage F. Duprat F. Fink M. Guillemare E. Coppola T. Lazdunski M. Hugnot J.P. FEBS Lett. 1994; 353: 37-42Crossref PubMed Scopus (268) Google Scholar). A total of three distinct, though closely related, KIR sequences were thus identified in human pancreatic islet and insulinoma RNA.Isolation and Characterization of hi-GIRK2The partial hi-GIRK2 sequence derived from degenerate PCR was radiolabeled and used as a hybridization probe to screen for full-length cDNAs in pancreatic islet-cell libraries. Three clones were isolated from a human β-cell tumor library, which contained a novel 2.1-kb cDNA insert (hi-GIRK2). hi-GIRK2 was predicted to encode a 423-amino acid polypeptide, with a calculated Mr of 48,455. Two of the GIRK2 clones, however, contained a single adenosine nucleotide insertion at amino acid position 401 (nucleotide position 1416) which caused an open reading frameshift in the COOH terminus. This is presumed to have resulted from a cloning artifact given that human genomic and reverse-transcribed islet cDNA lacks this single nucleotide insertion (not shown). In addition, hi-GIRK2 cDNA contained 212 bp of 5′-untranslated region, and a 481-bp 3′-untranslated portion. A canonical polyadenylation site was present 23 bp upstream of the terminal poly(A) stretch. Overall, the nucleic acid sequence was 92% identical to that of mouse brain GIRK2. The translated product of hi-GIRK2 displayed 95% amino acid identity with the mouse brain GIRK2(27Lesage F. Duprat F. Fink M. Guillemare E. Coppola T. Lazdunski M. Hugnot J.P. FEBS Lett. 1994; 353: 37-42Crossref PubMed Scopus (268) Google Scholar), with most divergent residues present in the COOH and NH2 termini (Fig. 2). mb-GIRK2 was recently cloned from mouse brain, co-expressed in Xenopus oocytes along with opioid receptors and shown to express a G-protein-activated K+ channel(27Lesage F. Duprat F. Fink M. Guillemare E. Coppola T. Lazdunski M. Hugnot J.P. FEBS Lett. 1994; 353: 37-42Crossref PubMed Scopus (268) Google Scholar). Prior to submission of this manuscript, a hamster insulinoma clone homologous to mouse GIRK2 was reported, and designated KATP-2 based on its similarity to CIR/KATP-1(17Tsaur M.L. Menzel S. Lai F.P. Espinosa III, R. Concannon P. Spielman R.S. Hanis C.L. Cox N.J. Lebeau M.M. German M.S. Jan L.Y. Bell G.I. Stoffel M. Diabetes. 1995; 44: 592-596Crossref PubMed Scopus (40) Google Scholar), and a partial identical human cDNA sequence referred to as BIR1 was deduced from genomic DNA (28Sakura H. Bond C. Warren-Perry M. Horsley S. Kearney L. Tucker S. Adelman J. Turner R. Ashcroft F.M. FEBS Lett. 1995; 367: 193-197Crossref PubMed Scopus (46) Google Scholar). Like other KIR sequences, hi-GIRK2 had a primary structure compatible with a model that includes two hydrophobic membrane spanning domains, M1 and M2, which encompass a putative pore region, and a long COOH-terminal tail believed to be predominantly cytoplasmic (Fig. 2)(10Ho K. Nichols C.G. Lederer W.J. Lytton J. Vassilev P.M. Kanazirska M.V. Hebert S.C. Nature. 1993; 362: 31-38Crossref PubMed Scopus (831) Google Scholar, 26Krapivinsky G. Gordon E.A. Wickman K. Velimirovic B. Krapivinski L. Clapham D.E. Nature. 1995; 394: 135-141Crossref Scopus (751) Google Scholar). There are six potential protein kinase C phosphorylation sites (positions 49, 73, 212, 236, 236, 366, and 386), all of which are conserved between human and mouse. There are no putative N-glycosylation sites in regions commonly regarded as extracellular in KIR proteins. Interestingly, at residue 256 there is an N-glycosylation motif near several short stretches of hydrophobic segments of unknown topology, which is conserved among both CIR and GIRK2 in humans and rodents (Fig. 2). No consensus ATP-binding site was encountered. Other than mouse brain GIRK2, hi-GIRK2 resembled CIR more than any other KIR channel gene in nonredundant nucleic acid and protein data bases, with approximately 69% overall amino acid identity (Fig. 2). The homology between hi-GIRK2 and CIR was most pronounced in the central 360-amino acid segment, while a lower degree of conservation was apparent in the COOH- and NH2-terminal portions. Amino acid identity of hi-GIRK2 with GIRK1 was 57%.Figure 2Alignment of the deduced amino acid sequence of human islet GIRK2 (hi-GIRK2), mouse brain GIRK2 (mb-GIRK2), human cardiac KATP-1/CIR (hc-KATP-1/CIR), and rat islet CIR (ri CIR). Sequence alignments were created with Megalign (DNASTAR) and visual modification. Amino acid identities are indicated by background shading. Predicted M1 and M2 transmembrane domains and the P pore region are highlighted by a line above the sequence lineup. Conserved consensus serine/threonine phosphorylation sites are boxed. Two possible N-glycosylation sites are marked, one presumed extracellular site present only in the CIR sequences (∗), the other of uncertain topology but conserved in the four proteins (∗∗).View Large Image Figure ViewerDownload Hi-res image Download (PPT)The expression of hi-GIRK2 in human tissues was evaluated by Northern blot and RT-PCR analysis. A distinct band of approximately 5.7 kb, and a more diffuse signal of approximately 2.4-2.8 kb, were observed by Northern analysis in poly(A)+-enriched RNA from human insulinoma (Fig. 3), while the abundance in purified human islets was insufficient to detect a similar signal. To further define the tissue distribution of hi-GIRK2 mRNA, RT-PCR analysis of a serial dilution of cDNAs was performed under reduced cycling conditions that allowed relative semiquantitation among tissues (Fig. 3). Using primers specific for hi-GIRK2, a unique PCR product of the expected size was observed to be most abundant in insulinoma and cerebellum RNA, while lower levels of expression were detected in all other tissues examined, including human islet and pancreatic exocrine tissue (Fig. 3). The fact that RT-PCR product signals were only slightly enhanced in islets relative to exocrine samples could reflect significant cross-contamination of the exocrine and islet preparations and/or the existence of GIRK2 mRNA at lower levels in exocrine tissue.Figure 3Distribution of GIRK2 and CIR mRNA in adult human tissues. A, Northern blot analysis. Poly(A)+ RNA from human islets (HI) (2 and 1.5 μg), insulinoma surgical specimen (INS) (2 μg), and pancreatic exocrine (EXO) (1.5 μg) was blotted and hybridized with 32P-labeled hi-GIRK2 cDNA first, then stripped and rehybridized with a 32P-labeled human islet CIR 0.7-kb PCR product. B, reverse transcription-PCR analysis. Total RNA from human tissues was treated with RNase-free DNase, reverse-transcribed, and cDNA corresponding to 80, 20, 5, and 1.25 ng of RNA was amplified for 25 or 28 cycles using primers specific for human islet GIRK2 and CIR, respectively. INS, insulinoma; HI, pancreatic islets; EXO, exocrine; LIV, liver; CER, cerebellum; MUS, muscle; VEN, left ventricle; and DUO, duodenum.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Segregation analysis of a panel of human-Chinese hamster ovary/mouse somatic cell hybrids with specific oligonucleotides that amplified a 130-bp fragment from the 3′-untranslated region of the hi-GIRK2 gene allowed unequivocal localization of this gene to chromosome 21 (data not shown). This confirms data reported by others during revision of this manuscript, w

Studies involving pharmacologic inhibition or transient reduction of Group VIA phospholipase A2 (iPLA2beta) expression have suggested that it is a housekeeping enzyme that regulates cell 2-lysophosphatidylcholine (LPC) levels, rates of arachidonate incorporation into phospholipids, and degradation of excess phosphatidylcholine (PC). In insulin-secreting islet beta-cells and some other cells, in contrast, iPLA2beta signaling functions have been proposed. Using retroviral vectors, we prepared clonal INS-1 beta-cell lines in which iPLA2beta expression is stably suppressed by small interfering RNA. Two such iPLA2beta knockdown (iPLA2beta-KD) cell lines express less than 20% of the iPLA2beta of control INS-1 cell lines. The iPLA2beta-KD INS-1 cells exhibit impaired insulin secretory responses and reduced proliferation rates. Electrospray ionization mass spectrometric analyses of PC and LPC species that accumulate in INS-1 cells cultured with arachidonic acid suggest that 18:0/20:4-glycerophosphocholine (GPC) synthesis involves sn-2 remodeling to yield 16:0/20:4-GPC and then sn-1 remodeling via a 1-lyso/20:4-GPC intermediate. Electrospray ionization mass spectrometric analyses also indicate that the PC and LPC content and composition of iPLA2beta-KD and control INS-1 cells are nearly identical, as are the rates of arachidonate incorporation into PC and the composition and remodeling of other phospholipid classes. These findings indicate that iPLA2beta plays signaling or effector roles in beta-cell secretion and proliferation but that stable suppression of its expression does not affect beta-cell GPC lipid content or composition even under conditions in which LPC is being actively consumed by conversion to PC. This calls into question the generality of proposed housekeeping functions for iPLA2beta in PC homeostasis and remodeling.

Vanadium has been reported to have insulin-like properties and has recently been demonstrated to be beneficial in the treatment of diabetic animals. In the present study, concentration dependence of the therapeutic effects of vanadium and the nature of interaction under in vivo conditions between vanadium and insulin were examined in streptozotocin-diabetic rats. During a 2-week period, blood glucose levels in all treated animals were decreased. At higher concentrations of vanadyl this decrease was greater and more rapid, and remained consistently lower for the entire treatment period. Daily intake of vanadyl, however, reached a similar steady state in all groups. Acute administration of submaximal doses of insulin, which had minimal effects in untreated diabetic rats, lowered blood glucose concentrations in vanadyl-treated and vanadyl-withdrawn animals to control levels. Chronic treatment of streptozotocin-diabetic rats with submaximal levels of vanadyl and insulin, ineffective alone, also produced significant decreases in blood glucose levels when used in combination. Finally, the insulin dosage required to maintain a nonglycosuric state in spontaneously diabetic (BB) rats was reduced in the presence of vanadyl. These studies indicate that chronic oral vanadyl treatment (a) produces a concentration-related lowering of blood glucose in diabetic rats, (b) potentiates the in vivo glucose lowering effects of acute and chronic administrations of insulin in streptozotocin-diabetic rats, and (c) substitutes for, or potentiates, the effects of chronic insulin therapy in spontaneously diabetic BB rats.Key words: vanadium, diabetes, insulin, blood glucose.

D-glucose induces a rise in pancreatic islet beta-cell cytosolic [Ca2+] by processes requiring both glucose metabolism and Ca2+ entry from the extracellular space, and this Ca2+ signal is thought to be critical to the induction of insulin secretion. Insulin secretagogues also induce phospholipid hydrolysis and accumulation of phospholipid-derived mediators in islets, including the lipid messengers DAG, nonesterified arachidonic acid, and arachidonate 12-LO products. This study offers the following viewpoints on potential roles of these lipid messengers in insulin secretion as working hypotheses: 1) the Ca2+ signal provided to the beta-cell by D-glucose induces insulin secretion only in the context of amplifying background signals provided by the beta-cell content of messengers including DAG; 2) muscarinic receptor agonists amplify glucose-induced insulin secretion in part by altering the beta-cell content of DAG; 3) the Ca2+ signal provided by metabolism of D-glucose is amplified by the level of nonesterified arachidonic acid in beta-cell membranes, which acts to facilitate Ca2+ entry; 4) metabolism of glucose induces accumulation of nonesterified arachidonate in beta-cells via activation of a recently identified ASCI-PLA2 enzyme, which may be a component of the beta-cell fuel sensor apparatus; and 5) arachidonate 12-LO metabolites are potential candidates as adjunctive modulators of beta-cell K(+)-channel activity.

In the present study, responses to various agonists in thoracic aorta and tail artery strips, obtained from 4-week streptozotocin (STZ)-treated rats and age-matched controls, were studied. Responses in aorta obtained from diabetic animals to the α-agonists, norepinephrine (NE), and methoxamine (MOX), to calcium (Ca 2+ ) and potassium (K + ) were found to be depressed relative to control tissue. Responses in tail artery however, were found to be different. While responses to K + were decreased and to Ca 2+ unchanged, tail artery strips obtained from diabetic animals were found to be supersensitive to both α-agonists relative to control tissue. Another observed difference between the two tissues was in their catecholamine content. While induction of diabetes did not alter catecholamine levels in the aorta, a significant decrease was produced in the tail artery, relative to control tissue levels. Our results indicate that inherent differences (such as the degree of innervation) may contribute to the differential responses observed in the two tissues studied. They further suggest the possible involvement of alterations in calcium utilization in aorta and the development of postjunctional supersensitivity in tail artery obtained from STZ-treated animals.

Phospholipases A(2) (PLA(2)) hydrolyze the sn-2 fatty acid substituent, such as arachidonic acid, from phospholipids, and arachidonate metabolites are recognized mediators of bone modeling. We have previously generated knockout (KO) mice lacking the group VIA PLA(2) (iPLA(2)beta), which participates in a variety of signaling events; iPLA(2)beta mRNA is expressed in bones of wild-type (WT) but not KO mice. Cortical bone size, trabecular bone volume, bone mineralizing surfaces, and bone strength are similar in WT and KO mice at 3 months and decline with age in both groups, but the decreases are more pronounced in KO mice. The lower bone mass phenotype observed in KO mice is not associated with an increase in osteoclast abundance/activity or a decrease in osteoblast density, but is accompanied by an increase in bone marrow fat. Relative to WT mice, undifferentiated bone marrow stromal cells (BMSCs) from KO mice express higher levels of PPAR-gamma and lower levels of Runx2 mRNA, and this correlates with increased adipogenesis and decreased osteogenesis in BMSCs from these mice. In summary, our studies indicate that age-related losses in bone mass and strength are accelerated in iPLA(2)beta-null mice. Because adipocytes and osteoblasts share a common mesenchymal stem cell origin, our findings suggest that absence of iPLA(2)beta causes abnormalities in osteoblast function and BMSC differentiation and identify a previously unrecognized role of iPLA(2)beta in bone formation.

Activation of phospholipases A(2) (PLA(2)s) leads to the generation of biologically active lipid mediators that can affect numerous cellular events. The Group VIA Ca(2+)-independent PLA(2), designated iPLA(2)beta, is active in the absence of Ca(2+), activated by ATP, and inhibited by the bromoenol lactone suicide inhibitor (BEL). Over the past 10-15 years, studies using BEL have demonstrated that iPLA(2)beta participates in various biological processes and the recent availability of mice in which iPLA(2)beta expression levels have been genetically-modified are extending these findings. Work in our laboratory suggests that iPLA(2)beta activates a unique signaling cascade that promotes beta-cell apoptosis. This pathway involves iPLA(2)beta dependent induction of neutral sphingomyelinase, production of ceramide, and activation of the intrinsic pathway of apoptosis. There is a growing body of literature supporting beta-cell apoptosis as a major contributor to the loss of beta-cell mass associated with the onset and progression of Type 1 and Type 2 diabetes mellitus. This underscores a need to gain a better understanding of the molecular mechanisms underlying beta-cell apoptosis so that improved treatments can be developed to prevent or delay the onset and progression of diabetes mellitus. Herein, we offer a general review of Group VIA Ca(2+)-independent PLA(2) (iPLA(2)beta) followed by a more focused discussion of its participation in beta-cell apoptosis. We suggest that iPLA(2)beta-derived products trigger pathways which can lead to beta-cell apoptosis during the development of diabetes.

Autoimmune β-cell death leads to type 1 diabetes, and with findings that Ca2+-independent phospholipase A2β (iPLA2β) activation contributes to β-cell death, we assessed the effects of iPLA2β inhibition on diabetes development. Administration of FKGK18, a reversible iPLA2β inhibitor, to NOD female mice significantly reduced diabetes incidence in association with 1) reduced insulitis, reflected by reductions in CD4+ T cells and B cells; 2) improved glucose homeostasis; 3) higher circulating insulin; and 4) β-cell preservation. Furthermore, FKGK18 inhibited production of tumor necrosis factor-α (TNF-α) from CD4+ T cells and antibodies from B cells, suggesting modulation of immune cell responses by iPLA2β-derived products. Consistent with this, 1) adoptive transfer of diabetes by CD4+ T cells to immunodeficient and diabetes-resistant NOD.scid mice was mitigated by FKGK18 pretreatment and 2) TNF-α production from CD4+ T cells was reduced by inhibitors of cyclooxygenase and 12-lipoxygenase, which metabolize arachidonic acid to generate bioactive inflammatory eicosanoids. However, adoptive transfer of diabetes was not prevented when mice were administered FKGK18-pretreated T cells or when FKGK18 administration was initiated with T-cell transfer. The present observations suggest that iPLA2β-derived lipid signals modulate immune cell responses, raising the possibility that early inhibition of iPLA2β may be beneficial in ameliorating autoimmune destruction of β-cells and mitigating type 1 diabetes development.

Insulin release from pancreatic β-cells plays a critical role in blood glucose homeostasis, and β-cell dysfunction leads to the development of diabetes mellitus. In cases of monogenic type 1 diabetes mellitus (T1DM) that involve mutations in the insulin gene, we hypothesized that misfolding of insulin could result in endoplasmic reticulum (ER) stress, oxidant production, and mitochondrial damage. To address this, we used the Akita(+/Ins2) T1DM model in which misfolding of the insulin 2 gene leads to ER stress-mediated β-cell death and thapsigargin to induce ER stress in two different β-cell lines and in intact mouse islets. Using transformed pancreatic β-cell lines generated from wild-type Ins2(+/+) (WT) and Akita(+/Ins2) mice, we evaluated cellular bioenergetics, oxidative stress, mitochondrial protein levels, and autophagic flux to determine whether changes in these processes contribute to β-cell dysfunction. In addition, we induced ER stress pharmacologically using thapsigargin in WT β-cells, INS-1 cells, and intact mouse islets to examine the effects of ER stress on mitochondrial function. Our data reveal that Akita(+/Ins2)-derived β-cells have increased mitochondrial dysfunction, oxidant production, mtDNA damage, and alterations in mitochondrial protein levels that are not corrected by autophagy. Together, these findings suggest that deterioration in mitochondrial function due to an oxidative environment and ER stress contributes to β-cell dysfunction and could contribute to T1DM in which mutations in insulin occur.

Heart failure and arrhythmias occur at 3 to 5 times higher rates among individuals with diabetes mellitus, compared with age-matched, healthy individuals. Studies attribute these defects in part to alterations in the function of cardiac type 2 ryanodine receptors (RyR2s), the principal Ca(2+)-release channels on the internal sarcoplasmic reticulum (SR). To date, mechanisms underlying RyR2 dysregulation in diabetes remain poorly defined. A rat model of type 1 diabetes, in combination with echocardiography, in vivo and ex vivo hemodynamic studies, confocal microscopy, Western blotting, mass spectrometry, site-directed mutagenesis, and [(3)H]ryanodine binding, lipid bilayer, and transfection assays, was used to determine whether post-translational modification by reactive carbonyl species (RCS) represented a contributing cause. After 8 weeks of diabetes, spontaneous Ca(2+) release in ventricular myocytes increased ~5-fold. Evoked Ca(2+) release from the SR was nonuniform (dyssynchronous). Total RyR2 protein levels remained unchanged, but the ability to bind the Ca(2+)-dependent ligand [(3)H]ryanodine was significantly reduced. Western blotting and mass spectrometry revealed RCS adducts on select basic residues. Mutation of residues to delineate the physiochemical impact of carbonylation yielded channels with enhanced or reduced cytoplasmic Ca(2+) responsiveness. The prototype RCS methylglyoxal increased and then decreased the RyR2 open probability. Methylglyoxal also increased spontaneous Ca(2+) release and induced Ca(2+) waves in healthy myocytes. Treatment of diabetic rats with RCS scavengers normalized spontaneous and evoked Ca(2+) release from the SR, reduced carbonylation of RyR2s, and increased binding of [(3)H]ryanodine to RyR2s. From these data, we conclude that post-translational modification by RCS contributes to the heterogeneity in RyR2 activity that is seen in experimental diabetes.

Macrophages are important in innate and adaptive immunity. Macrophage participation in inflammation or tissue repair is directed by various extracellular signals and mediated by multiple intracellular pathways. Activation of group VIA phospholipase A₂ (iPLA₂β) causes accumulation of arachidonic acid, lysophospholipids, and eicosanoids that can promote inflammation and pathologic states. We examined the role of iPLA₂β in peritoneal macrophage immune function by comparing wild type (WT) and iPLA₂β^−/− mouse macrophages. Compared with WT, iPLA₂β^−/− macrophages exhibited reduced proinflammatory M1 markers when classically activated. In contrast, anti-inflammatory M2 markers were elevated under naïve conditions and induced to higher levels by alternative activation in iPLA₂β^−/− macrophages compared with WT. Induction of eicosanoid (12-lipoxygenase (12-LO) and cyclooxygenase 2 (COX2))- and reactive oxygen species (NADPH oxidase 4 (NOX4))-generating enzymes by classical activation pathways was also blunted in iPLA₂β^−/− macrophages compared with WT. The effects of inhibitors of iPLA₂β, COX2, or 12-LO to reduce M1 polarization were greater than those to enhance M2 polarization. Certain lipids (lysophosphatidylcholine, lysophosphatidic acid, and prostaglandin E₂) recapitulated M1 phenotype in iPLA₂β^−/− macrophages, but none tested promoted M2 phenotype. These findings suggest that (<i>a</i>) lipids generated by iPLA₂β and subsequently oxidized by cyclooxygenase and 12-LO favor macrophage inflammatory M1 polarization, and (<i>b</i>) the absence of iPLA₂β promotes macrophage M2 polarization. Reducing macrophage iPLA₂β activity and thereby attenuating macrophage M1 polarization might cause a shift from an inflammatory to a recovery/repair milieu.

The Ca2+-independent phospholipases, designated as group VI iPLA2s, also referred to as PNPLAs due to their shared homology with patatin, include the β, γ, δ, ε, ζ, and η forms of the enzyme. The iPLA2s are ubiquitously expressed, share a consensus GXSXG catalytic motif, and exhibit organelle/cell-specific localization. Among the iPLA2s, iPLA2β has received wide attention as it is recognized to be involved in membrane remodeling, cell proliferation, cell death, and signal transduction. Ongoing studies implicate participation of iPLA2β in a variety of disease processes including cancer, cardiovascular abnormalities, glaucoma, and peridonditis. This review will focus on iPLA2β and its links to male fertility, neurological disorders, metabolic disorders, and inflammation.

Endoplasmic reticulum (ER) stress contributes to pancreatic beta-cell apoptosis in diabetes, but the factors involved are still not fully elucidated. Growth differentiation factor 15 (GDF15) is a stress response gene and has been reported to be increased and play an important role in various diseases. However, the role of GDF15 in beta cells in the context of ER stress and diabetes is still unclear. In this study, we have discovered that GDF15 promotes ER stress-induced beta-cell apoptosis and that downregulation of GDF15 has beneficial effects on beta-cell survival in diabetes. Specifically, we found that GDF15 is induced by ER stress in beta cells and human islets, and that the transcription factor C/EBPβ is involved in this process. Interestingly, ER stress-induced apoptosis was significantly reduced in INS-1 cells with Gdf15 knockdown and in isolated Gdf15 knockout mouse islets. In vivo, we found that Gdf15 deletion attenuates streptozotocin-induced diabetes by preserving beta cells and insulin levels. Moreover, deletion of Gdf15 significantly delayed diabetes development in spontaneous ER stress-prone Akita mice. Thus, our findings suggest that GDF15 contributes to ER stress-induced beta-cell apoptosis and that inhibition of GDF15 may represent a novel strategy to promote beta-cell survival and treat diabetes.

Upon differentiation, U937 promonocytic cells gain the ability to release a large fraction of arachidonate esterified in phospholipids when stimulated, but the mechanism is unclear. U937 cells express group IV phospholipase A2(cPLA2), but neither its level nor its phosphorylation state increases upon differentiation. A group VI PLA2(iPLA2) that is sensitive to a bromoenol lactone inhibitor catalyzes arachidonate hydrolysis from phospholipids in some cells and facilitates arachidonate incorporation into glycerophosphocholine (GPC) lipids in others, but it is not known whether U937 cells express iPLA2. We confirm that ionophore A23187 induces substantial [3H]arachidonate release from differentiated but not control U937 cells, and electrospray ionization mass spectrometric (ESI/MS) analyses indicate that differentiated cells contain a higher proportion of arachidonate-containing GPC species than control cells. U937 cells express iPLA2 mRNA and activity, but iPLA2 inhibition impairs neither [3H]arachidonate incorporation into nor release from U937 cells. Experiments with phosphatidate phosphohydrolase (PAPH) and phospholipase D (PLD) inhibitors coupled with ESI/MS analyses of PLD-PAPH products indicate that differentiated cells gain the ability to produce diacylglycerol (DAG) via PLD-PAPH. DAG promotes arachidonate release by a mechanism that does not require DAG hydrolysis, is largely independent of protein kinase C, and requires cPLA2activity. This may reflect DAG effects on cPLA2 substrate state. Upon differentiation, U937 promonocytic cells gain the ability to release a large fraction of arachidonate esterified in phospholipids when stimulated, but the mechanism is unclear. U937 cells express group IV phospholipase A2(cPLA2), but neither its level nor its phosphorylation state increases upon differentiation. A group VI PLA2(iPLA2) that is sensitive to a bromoenol lactone inhibitor catalyzes arachidonate hydrolysis from phospholipids in some cells and facilitates arachidonate incorporation into glycerophosphocholine (GPC) lipids in others, but it is not known whether U937 cells express iPLA2. We confirm that ionophore A23187 induces substantial [3H]arachidonate release from differentiated but not control U937 cells, and electrospray ionization mass spectrometric (ESI/MS) analyses indicate that differentiated cells contain a higher proportion of arachidonate-containing GPC species than control cells. U937 cells express iPLA2 mRNA and activity, but iPLA2 inhibition impairs neither [3H]arachidonate incorporation into nor release from U937 cells. Experiments with phosphatidate phosphohydrolase (PAPH) and phospholipase D (PLD) inhibitors coupled with ESI/MS analyses of PLD-PAPH products indicate that differentiated cells gain the ability to produce diacylglycerol (DAG) via PLD-PAPH. DAG promotes arachidonate release by a mechanism that does not require DAG hydrolysis, is largely independent of protein kinase C, and requires cPLA2activity. This may reflect DAG effects on cPLA2 substrate state. dimethyl sulfoxide (E)-6-(bromomethylene)tetrahydro-3-(1-naphthalenyl)-2H-pyran-2-one collisionally activated dissociation group IV phospholipase A2 diacylglycerol electrospray ionization gas chromatography glycerophosphocholine glycerophosphoethanolamine high performance liquid chromatography group VI phospholipase A2 lysophosphatidylcholine mass spectrometry negative ion electron capture normal phase (1-oleoyl,2-acetyl)-sn-glycerol phosphatidic acid phosphatidate phosphohydrolase protein kinase C phospholipase A2 phospholipase D phosphatidylethanol secretory phospholipase A2 reverse transcriptase-polymerase chain reaction prostaglandin Bx base pair N-ethylmaleimide U937 cells are derived from a human histiocytic lymphoma and differentiate into monocyte-like cells when treated with various agents, including dimethyl sulfoxide (Me2SO)1 (1.Harris P. Ralph P. J. Leukocyte Biol. 1985; 37: 407-422Crossref PubMed Scopus (523) Google Scholar). Differentiated but not undifferentiated U937 cells release a large fraction of arachidonic acid esterified in their phospholipids when stimulated with various agonists, including Ca2+ ionophores (2.Rzigalinski B.A. Rosenthal M.D. Biochim. Biophys. Acta. 1994; 1223: 219-225Crossref PubMed Scopus (20) Google Scholar, 3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar, 4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar). This has been attributed to enhanced activation of group IV phospholipase A2 (cPLA2) in differentiated U937 cells because the response is suppressed by cPLA2inhibitors (3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar, 4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar). Like other PLA2 enzymes (5.Gijon M.A. Leslie C.C. Cell Dev. Biol. 1997; 8: 297-303Crossref PubMed Scopus (60) Google Scholar, 6.Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (758) Google Scholar, 7.Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 8.Leslie C.C. J. Biol. Chem. 1997; 272: 16709-16712Abstract Full Text Full Text PDF PubMed Scopus (740) Google Scholar, 9.Tischfield J.A. J. Biol. Chem. 1997; 272: 17247-17250Abstract Full Text Full Text PDF PubMed Scopus (269) Google Scholar), cPLA2 catalyzes hydrolysis of the sn-2 fatty acid substituent from glycerophospholipid substrates to yield a free fatty acid and a 2-lysophospholipid. The first PLA2 enzymes to be well characterized have low molecular masses (∼14 kDa), require mm[Ca2+] for catalysis, and function as extracellular, secreted enzymes (sPLA2) (6.Dennis E.A. Trends Biochem. Sci. 1997; 22: 1-2Abstract Full Text PDF PubMed Scopus (758) Google Scholar, 9.Tischfield J.A. J. Biol. Chem. 1997; 272: 17247-17250Abstract Full Text Full Text PDF PubMed Scopus (269) Google Scholar). Neither undifferentiated nor differentiated U937 cells express detectable sPLA2activity or immunoreactive protein (4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar), suggesting that sPLA2 is not responsible for enhanced arachidonate release in differentiated U937 cells (3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar, 4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar). U937 cells do express cPLA2 (2.Rzigalinski B.A. Rosenthal M.D. Biochim. Biophys. Acta. 1994; 1223: 219-225Crossref PubMed Scopus (20) Google Scholar, 3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar, 4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar) and were among the first sources from which cPLA2 was purified (10.Clark J.D. Milona N. Knopf J. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7708-7712Crossref PubMed Scopus (422) Google Scholar). The cPLA2 enzyme is induced to associate with its membrane substrates by rises in cytosolic [Ca2+], is also regulated by phosphorylation, and prefers substrates with sn-2 arachidonoyl residues (5.Gijon M.A. Leslie C.C. Cell Dev. Biol. 1997; 8: 297-303Crossref PubMed Scopus (60) Google Scholar, 10.Clark J.D. Milona N. Knopf J. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 7708-7712Crossref PubMed Scopus (422) Google Scholar). How cPLA2 might be more readily activated in differentiated U937 cells than in control cells is incompletely understood. Undifferentiated U937 cells express cPLA2 (2.Rzigalinski B.A. Rosenthal M.D. Biochim. Biophys. Acta. 1994; 1223: 219-225Crossref PubMed Scopus (20) Google Scholar, 3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar, 4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar), and neither its level nor phosphorylation state increase upon differentiation (4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar). Both undifferentiated and differentiated U937 cells undergo a similar rise in cytosolic [Ca2+] when treated with Ca2+ ionophores (3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar, 4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar). It has been suggested that cPLA2 activation in differentiated U937 cells is coupled to depletion of internal Ca2+ stores and that products of its action mediate store depletion-induced Ca2+entry (3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar). A recently cloned (11.Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra S. Jones S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar, 12.Balboa M. Balsinde J. Jones S. Dennis E. J. Biol. Chem. 1997; 272: 8576-8590Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar, 13.Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar, 14.Larsson P.K. Claesson H.-E. Kennedy B.P. J. Biol. Chem. 1998; 273: 207-214Abstract Full Text Full Text PDF PubMed Scopus (178) Google Scholar, 15.Ma Z. Wang X. Nowatzke W. Ramanadham S. Turk J. J. Biol. Chem. 1999; 274: 9607-9616Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar) group VI PLA2(iPLA2) does not require Ca2+ for catalysis and is inhibited by a bromoenol lactone (BEL) suicide substrate (16.Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 17.Zupan L.A. Weiss R.H. Hazen S. Parnas B.L. Aston K.W. Lennon P.J. Getman D.P. Gross R.W. J. Med. Chem. 1993; 36: 95-100Crossref PubMed Scopus (55) Google Scholar) that does not inhibit sPLA2 or cPLA2 enzymes at comparable concentrations (7.Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 16.Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 17.Zupan L.A. Weiss R.H. Hazen S. Parnas B.L. Aston K.W. Lennon P.J. Getman D.P. Gross R.W. J. Med. Chem. 1993; 36: 95-100Crossref PubMed Scopus (55) Google Scholar, 18.Balsinde J. Dennis E.A. J. Biol. Chem. 1996; 271: 6758-6765Abstract Full Text Full Text PDF PubMed Scopus (342) Google Scholar). The iPLA2 enzyme appears to be activated by agents that induce Ca2+-store depletion in some cells (19.Wolf M.J. Wang J. Turk J. Gross R.W. J. Biol. Chem. 1997; 272: 1522-1526Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 20.Nowatzke W. Ramanadham S. Ma Z. Hsu F.-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (54) Google Scholar, 21.Larsson Forsell P.K.A. Runarsson G. Ibrahim M. Bjorkholm M. Claesson H.-E. FEBS Lett. 1998; 434: 295-299Crossref PubMed Scopus (35) Google Scholar) and to catalyze arachidonate hydrolysis from phospholipids of such cells by a mechanism that does not require a rise in cytosolic [Ca2+] (19.Wolf M.J. Wang J. Turk J. Gross R.W. J. Biol. Chem. 1997; 272: 1522-1526Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 20.Nowatzke W. Ramanadham S. Ma Z. Hsu F.-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (54) Google Scholar). Because Ca2+-store depletion also induces arachidonate release from differentiated U937 cells (3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar), these observations (19.Wolf M.J. Wang J. Turk J. Gross R.W. J. Biol. Chem. 1997; 272: 1522-1526Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 20.Nowatzke W. Ramanadham S. Ma Z. Hsu F.-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (54) Google Scholar, 21.Larsson Forsell P.K.A. Runarsson G. Ibrahim M. Bjorkholm M. Claesson H.-E. FEBS Lett. 1998; 434: 295-299Crossref PubMed Scopus (35) Google Scholar) raise the questions of whether U937 cells express iPLA2 and whether differentiation increases its expression. Differentiation induced expression of Ca2+-independent PLA2 activity does occur in HL-60 cells (22.Hullin-Matsuda F. Tsuhishita Y. Nishizuka Y. FEBS Lett. 1997; 419: 117-120Crossref PubMed Scopus (5) Google Scholar), a human myeloblast cell line that, like U937 cells, differentiates when treated with Me2SO (1.Harris P. Ralph P. J. Leukocyte Biol. 1985; 37: 407-422Crossref PubMed Scopus (523) Google Scholar). U937 cells have been reported to express a Ca2+-independent PLA2 activity that participates in Fas-induced apoptosis and arachidonate release under conditions in which cPLA2 is inactivated proteolytically by caspases (23.Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar), but whether this activity resides in iPLA2 gene product(s) has not been established. The possible participation of iPLA2 in U937 cell apoptosis (23.Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (201) Google Scholar) is of interest because Ca2+-store depletion induces apoptosis of pancreatic islet β-cells by a mechanism that does not require a rise in cytosolic [Ca2+] but that does require arachidonate release and metabolism (24.Zhou Y.-P. Teng D. Drayluk F. Ostrega D. Roe M.W. Philipson L. Polonsky K. J. Clin. Invest. 1998; 101: 1623-1632Crossref PubMed Scopus (119) Google Scholar). Ca2+-store depletion also induces arachidonic acid hydrolysis from β-cell phospholipids by a BEL-sensitive mechanism thought to reflect iPLA2 action (20.Nowatzke W. Ramanadham S. Ma Z. Hsu F.-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (54) Google Scholar). The iPLA2 enzyme has also been proposed to provide lysophosphatidylcholine (LPC) acceptors for arachidonate incorporation into glycerophosphocholine (GPC) lipids in murine P388D1 cells (25.Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (256) Google Scholar,26.Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 46: 29317-29321Abstract Full Text Full Text PDF Scopus (198) Google Scholar), which, like U937 cells, are of monocyte-macrophage lineage. If increased iPLA2 expression occurred upon U937 differentiation and accelerated arachidonate incorporation into GPC, any resultant accumulation of arachidonate-containing GPC lipids might increase hydrolysis of arachidonate from U937 cell phospholipids by cPLA2. Increasing the mole fraction of arachidonate-containing GPC species in lipid vesicles has been reported to facilitate hydrolysis of substrates by cPLA2 in a cooperative manner (27.Burke J. Witmer M.R. Tredup J. Micanovic R. Gregor K.R. Lahiri J. Tramposch K.M. Villafranca J.J. Biochemistry. 1995; 34: 15165-15174Crossref PubMed Scopus (35) Google Scholar), although this effect is influenced by other lipids in such vesicles (28.Bayburt T. Gelb M.H. Biochemistry. 1997; 36: 3216-3231Crossref PubMed Scopus (62) Google Scholar). Here we examine effects of differentiation on U937 cell GPC lipid composition, expression of Ca2+-independent PLA2 activity, sensitivity of this activity to BEL, and effects of BEL on arachidonate incorporation into and release from U937 cell phospholipids. (5,6,8,9,11,12,14,15-3H]Arachidonic acid (217 Ci/mmol), [9,10-3H]palmitic acid (54 Ci/mmol), and 1-palmitoyl-2-[14C]arachidonoyl-sn-glycero-3-phosphoethanolamine (55 mCi/mmol) were obtained from Amersham Pharmacia Biotech. Arachidonic acid and dinonadecadienoin were obtained from Nu-Chek Prep (Elysian, MN). Standard phospholipids and phosphatidylethanols were obtained from Avanti Polar Lipids (Birmingham, AL). Prostaglandin Bx (PGBx) and the bromoenol lactone (BEL) iPLA2 inhibitor (E)-6-(bromomethylene)tetrahydro-3-(1-naphthalenyl)-2H-pyran-2-one were obtained from Cayman Chemical (Ann Arbor, MI). [5,6,8,9,11,12,14,15-2H8]Arachidonic acid, RHC80267, staurosporine, (1-oleoyl,2-acetyl)-sn-glycerol (OAG), and arachidonoyl trifluoromethyl ketone were obtained from Biomol (Plymouth Meeting, PA). U937 cells from American Type Culture Collection (Manassas, VA) were cultured in RPMI 1640 medium containing 15% heat-inactivated fetal bovine serum, 2% glutamine, and 1% nonessential amino acids (w/v). Differentiation was induced by treating (96 h) cells (2.5 × 105/ml) with 1.2% Me2SO (v/v). Cells were labeled (24 h) with [3H]arachidonic acid (0.1 μCi/ml) and washed in Hanks' balanced salt solution medium containing 0.1% bovine serum albumin to remove unincorporated label. In some cases, cells were pretreated (15 min) with vehicle, PGBx (50 μg/ml), BEL (1–100 μm), propranolol (200 μm), ethanol (1–4%, v/v),n-butyl alcohol (0.1–0.4%, v/v), RHC80267 (20–175 μm), OAG (5–40 μm), staurosporine (2–100 nm), or arachidonoyl trifluoromethyl ketone (15–75 μm) before experimental incubations. [3H]Arachidonic acid release experiments were performed (10 min) at a density of 1.2 × 106 cells/ml and initiated by adding vehicle or A23187 (1.5 μm). Cells were sedimented by centrifugation, and supernatant 3H was determined by liquid scintillation spectrometry. Cell number was measured with a hemocytometer and protein with Coomassie Blue (Pierce) and lipid phosphorus as described (29.Hallberg A. Biochim. Biophys. Acta. 1984; 796: 328-335Crossref PubMed Scopus (23) Google Scholar). Phospholipids from U937 cells were extracted with chloroform/methanol under neutral conditions (30.Bligh E.G. Dyer W.J. Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (42694) Google Scholar). Incorporation of [3H]arachidonate into phospholipids was determined by TLC, as described previously (25.Balsinde J. Bianco I.D. Ackerman E.J. Conde-Friebos K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (256) Google Scholar, 26.Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 46: 29317-29321Abstract Full Text Full Text PDF Scopus (198) Google Scholar, 31.Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Phospholipid head group classes were isolated by NP-HPLC, as described previously (31.Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). ESI/MS and ESI/MS/MS analyses were performed on a Finnigan (San Jose, CA) TSQ-7000 triple stage quadrupole mass spectrometer, as described previously (32.Ramanadham S. Hsu F.-F. Bohrer A. Nowatzke W. Ma Z. Turk J. Biochemistry. 1998; 37: 4553-4567Crossref PubMed Scopus (68) Google Scholar, 33.Hsu F.-F. Bohrer A. Turk J. J. Am. Soc. Mass Spectrom. 1998; 9: 516-526Crossref PubMed Scopus (176) Google Scholar). To quantitate arachidonate mass in phospholipids, alkaline hydrolysis was performed in the presence of [2H8]arachidonate internal standard, and liberated fatty acids were extracted, converted to pentafluorobenzyl ester derivatives, and measured by isotope dilution GC/NIEC/MS, as described previously (31.Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). RNA was isolated from U937 cells and RT-PCR performed using standard procedures, as described previously (13.Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J.L. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). To amplify iPLA2 cDNA, primers used were sense (5′-TTCGGAGCAGAAGTGGACAC-3′) and antisense (5′-TGAAAGTACATGCCG-CGCATG-3′). PCR with these primers amplifies cDNA species for long (LH-iPLA2) and short (SH-iPLA2) isoforms of human iPLA2 (15.Ma Z. Wang X. Nowatzke W. Ramanadham S. Turk J. J. Biol. Chem. 1999; 274: 9607-9616Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar) to yield products of 515 and 353 bp, respectively, and both products were observed using U937 cell RNA as template. These products were then digested with endonuclease AvaI, which converted the RT-PCR product for LH-iPLA2 into two products (396 and 119 bp) and for SH-iPLA2 (353 bp) into two products (234 and 119 bp). These products correspond to the lengths expected from the corresponding cDNA sequences (15.Ma Z. Wang X. Nowatzke W. Ramanadham S. Turk J. J. Biol. Chem. 1999; 274: 9607-9616Abstract Full Text Full Text PDF PubMed Scopus (94) Google Scholar). Islets were isolated from Harlan Sprague-Dawley rats, as described previously (34.Turk J. Colca J. Kotagal N. McDaniel M. Biochim. Biophys. Acta. 1984; 794: 125-136Crossref PubMed Scopus (66) Google Scholar). INS-1 insulinoma cells provided by Dr. Christopher Newgard (University of Texas-Southwestern, Dallas) were cultured as described (35.Trinh K. Minassian C. Lange A.J. O'Doherty R.M. Newgard C.B. J. Biol. Chem. 1997; 272: 24837-24842Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar). Cells were disrupted by sonication (Vibra Cell, High Intensity Ultrasonic Processor) in homogenization buffer (0.25m sucrose, 40 mm Tris-HCl, pH 7.1). Homogenates were centrifuged (15,000 × g, 45 min) to yield a cytosolic supernatant, and protein content was determined. Ca2+-independent PLA2 activity in aliquots of cytosol (20 μg of protein) was assayed after injection in ethanol (5 μl) of the substrate 1-palmitoyl-2-[14C]arachidonoyl-sn-glycero-3-phosphoethanolamine (final concentration 5 μm) and incubating (5 min, 37 °C) in assay buffer (50 mm Tris-HCl, pH 7.5, 5 mm EGTA, total volume 200 μl). Lipids were extracted and analyzed by TLC, and PLA2-specific activity was calculated from released [14C]arachidonate dpm and protein content as described (36.Gross R.W. Ramanadham S. Kruszka K. Han X. Turk J. Biochemistry. 1993; 32: 327-336Crossref PubMed Scopus (112) Google Scholar). In some experiments, cytosol was preincubated (4 min, room temperature) with various concentrations of BEL before activity assays. U937 cell or INS-1 cell cytosolic proteins were analyzed by SDS-polyacrylamide gel electrophoresis, and immunoreactive iPLA2 was visualized with an antibody from Dr. Simon Jones (Genetics Institute, Boston), as described previously (31.Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Assays examined conversion of [glycerol-14C]phosphatidic acid (PA) to [14C]diglyceride by cytosolic phosphatidate phosphohydrolase (PAPH) and were performed as described previously (31.Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar,37.Balsinde J. Dennis E.A. J. Biol. Chem. 1996; 271: 31937-31941Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar, 38.Balboa M. Balsinde J. Dennis E. Insel P. J. Biol. Chem. 1995; 270: 11738-11740Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). When NEM (8 mm) or BEL was used, samples were incubated (10 min) with them before adding [14C]PA. U937 cells (106/ml) were preincubated (15 min, 37 °C) with vehicle only (control) or BEL (25 μm) in RPMI 1640 medium containing supplements described above. After preincubation, incorporation experiments (10–60 min, 37 °C) were initiated by adding [3H]arachidonic acid (0.5 μCi/ml, 5 nm). Cells were washed three times to remove unincorporated label. Lipids were extracted and analyzed by TLC to isolate phospholipids, and their 3H content was determined as described (31.Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). For radiochemical experiments, U937 cells were labeled (24 h) with [3H]palmitic acid (3 μCi/106 cells), washed free of unincorporated label, and incubated without or with ionophore A23187 in the presence or absence of ethanol. Lipids were extracted, mixed with 18:1/18:1-phosphatidylethanol standard, and analyzed by TLC on silica gel G plates (Whatman) using the upper phase of a solvent system prepared with ethyl acetate/isooctane/acetic acid/water (13:2:3:10). The phosphatidylethanol band was identified with iodine vapor and its 3H content determined. For ESI/MS analyses of U937 cell phosphatidylethanol species, experiments were similar, except that cells were not labeled with [3H]palmitate, and no standard phosphatidylethanol was added. For radiochemical experiments, U937 cells were labeled with [3H]palmitic acid as above and incubated without or with ionophore A23187 (1.5 μm) for 1–10 min. Lipids were extracted, mixed with 10 μg of dinonadecadienoin standard, and analyzed by TLC to isolate diacylglycerol (DAG) (31.Ramanadham S. Hsu F.-F. Bohrer A. Ma Z. Turk J. J. Biol. Chem. 1999; 274: 13915-13927Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). The3H content of the DAG was then determined. For ESI/MS analyses of U937 cell DAG species, experiments were similar, except that cells were not labeled with [3H]palmitate, and no dinonadecadienoin standard was added. Student's t test was used to compare two groups, and multiple groups were compared by one-way analysis of variance with post hoc Newman-Keul's analyses. When control, undifferentiated U937 cells were labeled with [3H]arachidonate and incubated with or without Ca2+ ionophore A23187, less than 2% of incorporated 3H was released into the medium. In similar experiments with Me2SO-differentiated U937 cells, A23187 induced release of 18% of incorporated 3H, and this was suppressed by the PLA2 inhibitor (39.Rosenthal M.D. Lattanzio K.S. Franson R.C. Biochim. Biophys. Acta. 1993; 1177: 79-86Crossref PubMed Scopus (12) Google Scholar) PGBx (not shown). This confirms reports (2.Rzigalinski B.A. Rosenthal M.D. Biochim. Biophys. Acta. 1994; 1223: 219-225Crossref PubMed Scopus (20) Google Scholar, 3.Rzigalinski B.A. Blackmore P.F. Rosenthal M.D. Biochim. Biophys. Acta. 1996; 1299: 342-353Crossref PubMed Scopus (41) Google Scholar, 4.Burke J.R. Davern L.B. Gregor K.R. Todderud G. Alford J.G. Tramposch K.M. Biochim. Biophys. Acta. 1997; 1341: 223-237Crossref PubMed Scopus (35) Google Scholar) that differentiated but not undifferentiated U937 cells release a large fraction of [3H]arachidonate esterified in their phospholipids upon stimulation with Ca2+ ionophores. When phospholipids into which [3H]arachidonic acid was incorporated were examined by NP-HPLC, control U937 cells incorporated the majority of 3H into glycerophosphoethanolamine (GPE) lipids and a smaller amount into glycerophosphocholine (GPC) lipids (Table I). Differentiated U937 cells incorporated a greater proportion of 3H into GPC lipids than did control cells (Table I). Quantitation of arachidonate content of phospholipid extracts by isotope dilution GC/NIEC/MS after saponification indicated that the amount of esterified arachidonate per nmol of lipid phosphorus in differentiated U937 cells exceeded that in control cells (Table I). This suggests that differentiation of U937 cells is associated with an increased content of arachidonate-containing phospholipid species, and this possibility was examined by electrospray ionization mass spectrometric (ESI/MS) analyses of U937 cell GPC and GPE lipids isolated by NP-HPLC.Table IEsterified arachidonate mass in U937 cell lipids and distribution of [ 3 H]arachidonate label among phospholipid classes[3H]Arachidonate content of phospholipid classU937 cellsTotal esterified arachidonate massPhosphatidylethanolaminePhosphatidic acidPhosphatidylcholineResting (R)R-A23187Resting (R)R-A23187Resting (R)R-A23187Resting (R)R-A23187pmol/nmol lipid Pdpm/nmol lipid PUndifferentiated173 ± 7−1.9 ± 0.41761 ± 331−122 ± 67439 ± 141−26 ± 25990 ± 20863 ± 58Me2SO-treated275 ± 1050 ± 1.92115 ± 432346 ± 283872 ± 167156 ± 1492223 ± 368823 ± 182Control and Me2SO-treated U937 cells were labeled with [3H]arachidonate, washed free of unincorporated label, and incubated without or with ionophore A23187 as in Fig. 1. Cells were then collected by centrifugation and their lipids extracted. Lipid phosphorus was measured in 1 aliquot of the extract. Arachidonic acid mass was measured by isotope dilution GC/NIEC/MS in a second aliquot before and after saponification to determine esterified arachidonate content. The remainder of lipid extracts was analyzed by NP-HPLC, and the 3H and lipid phosphorus contents of isolated phospholipid head group classes were determined. Values for cells incubated without A23187 are designated “Resting (R).” The difference between that value and the value observed for A23187-

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTCharacterization of an ATP-stimulatable calcium2+ independent phospholipase A2 from clonal insulin-secreting HIT cells and rat pancreatic islets: a possible molecular component of the .beta.-cell fuel sensorSasanka Ramanadham, Matthew J. Wolf, Patricia A. Jett, Richard W. Gross, and John TurkCite this: Biochemistry 1994, 33, 23, 7442–7452Publication Date (Print):June 1, 1994Publication History Published online1 May 2002Published inissue 1 June 1994https://doi.org/10.1021/bi00189a052RIGHTS & PERMISSIONSArticle Views98Altmetric-Citations49LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (2 MB) Get e-Alerts Get e-Alerts

ADVERTISEMENT RETURN TO ISSUEPREVArticleNEXTMass spectrometric characterization of arachidonate-containing plasmalogens in human pancreatic islets and in rat islet .beta.-cells and subcellular membranesSasanka Ramanadham, Alan Bohrer, Richard W. Gross, and John TurkCite this: Biochemistry 1993, 32, 49, 13499–13509Publication Date (Print):December 14, 1993Publication History Published online1 May 2002Published inissue 14 December 1993https://doi.org/10.1021/bi00212a015Request reuse permissions Article Views164Altmetric-Citations52LEARN ABOUT THESE METRICSArticle Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated. Share Add toView InAdd Full Text with ReferenceAdd Description ExportRISCitationCitation and abstractCitation and referencesMore Options Share onFacebookTwitterWechatLinked InReddit PDF (1 MB) Get e-Alertsclose Get e-Alerts

Phospholipases A2 (PLA2) comprise a superfamily of enzymes that hydrolyze phospholipids to a free fatty acid, e.g., arachidonate, and a 2-lysophospholipid. Dissecting their individual functions has relied in large part on pharmacological inhibitors that discriminate among PLA2. Group VIA PLA2 (iPLA2β) has a GTSTG serine lipase consensus sequence, and studies with a bromoenol lactone (BEL) suicide substrate inhibitor have been taken to suggest that iPLA2β participates in a wide variety of biological processes. Such conclusions presume inhibitor specificity. Inhibition by BEL requires its hydrolysis by and results in uncharacterized covalent modification(s) of iPLA2β. We performed mass spectrometric analyses of proteolytic digests of BEL-treated iPLA2β to identify modifications associated with loss of activity. The GTSTG active site and large flanking regions of sequence are not modified by BEL treatment, but most iPLA2β Cys residues are alkylated at various BEL concentrations to form a thioether linkage to a BEL keto acid hydrolysis product. Synthetic Cys-containing peptides are alkylated when incubated with iPLA2β and BEL, which reflects iPLA2β-catalyzed BEL hydrolysis to a diffusible bromomethyl keto acid product that reacts with distant thiols. The BEL concentration dependence of Cys651 alkylation closely parallels that of loss of iPLA2β activity. No amino acid residues other than Cys were found to be modified, suggesting that Cys alkylation is the covalent modification of iPLA2β responsible for loss of activity, and the alkylating species appears to be a diffusible hydrolysis product of BEL rather than a tethered acyl-enzyme intermediate.

Mouse macrophages undergo ER stress and apoptosis upon free cholesterol loading (FCL). We recently generated iPLA2β-null mice, and here we demonstrate that iPLA2β-null macrophages have reduced sensitivity to FCL-induced apoptosis, although they and wild-type (WT) cells exhibit similar increases in the transcriptional regulator CHOP. iPLA2β-null macrophages are also less sensitive to apoptosis induced by the sarcoplasmic reticulum Ca2+-ATPase inhibitor thapsigargin and the scavenger receptor A ligand fucoidan, and restoring iPLA2βexpression with recombinant adenovirus increases apoptosis toward WT levels. WT and iPLA2β-null macrophages incorporate [3H]arachidonic acid ([3H]AA]) into glycerophosphocholine lipids equally rapidly and exhibit identical zymosan-induced, cPLA2α-catalyzed [3H]AA release. In contrast, although WT macrophages exhibit robust [3H]AA release upon FCL, this is attenuated in iPLA2β-null macrophages and increases toward WT levels upon restoring iPLA2β expression. Recent reports indicate that iPLA2β modulates mitochondrial cytochrome c release, and we find that thapsigargin and fucoidan induce mitochondrial phospholipid loss and cytochrome c release into WT macrophage cytosol and that these events are blunted in iPLA2β-null cells. Immunoblotting studies indicate that iPLA2β associates with mitochondria in macrophages subjected to ER stress. AA incorporation into glycerophosphocholine lipids is unimpaired in iPLA2β-null macrophages upon electrospray ionization-tandem mass spectrometry analyses, and their complex lipid composition is similar to WT cells. These findings suggest that iPLA2β participates in ER stress-induced macrophage apoptosis caused by FCL or thapsigargin but that deletion of iPLA2β does not impair macrophage arachidonate incorporation or phospholipid composition. Mouse macrophages undergo ER stress and apoptosis upon free cholesterol loading (FCL). We recently generated iPLA2β-null mice, and here we demonstrate that iPLA2β-null macrophages have reduced sensitivity to FCL-induced apoptosis, although they and wild-type (WT) cells exhibit similar increases in the transcriptional regulator CHOP. iPLA2β-null macrophages are also less sensitive to apoptosis induced by the sarcoplasmic reticulum Ca2+-ATPase inhibitor thapsigargin and the scavenger receptor A ligand fucoidan, and restoring iPLA2βexpression with recombinant adenovirus increases apoptosis toward WT levels. WT and iPLA2β-null macrophages incorporate [3H]arachidonic acid ([3H]AA]) into glycerophosphocholine lipids equally rapidly and exhibit identical zymosan-induced, cPLA2α-catalyzed [3H]AA release. In contrast, although WT macrophages exhibit robust [3H]AA release upon FCL, this is attenuated in iPLA2β-null macrophages and increases toward WT levels upon restoring iPLA2β expression. Recent reports indicate that iPLA2β modulates mitochondrial cytochrome c release, and we find that thapsigargin and fucoidan induce mitochondrial phospholipid loss and cytochrome c release into WT macrophage cytosol and that these events are blunted in iPLA2β-null cells. Immunoblotting studies indicate that iPLA2β associates with mitochondria in macrophages subjected to ER stress. AA incorporation into glycerophosphocholine lipids is unimpaired in iPLA2β-null macrophages upon electrospray ionization-tandem mass spectrometry analyses, and their complex lipid composition is similar to WT cells. These findings suggest that iPLA2β participates in ER stress-induced macrophage apoptosis caused by FCL or thapsigargin but that deletion of iPLA2β does not impair macrophage arachidonate incorporation or phospholipid composition. Phospholipases A2 (PLA2) 2The abbreviations used are:PLA2phospholipase A2BELbromoenol lactone suicide substrateCADcollisionally activated dissociationESIelectrospray ionizationGPCglycerophosphocholineiPLA2βgroup VIA phospholipase A2LPClysophosphatidylcholineMSmass spectrometryMS/MStandem MSPAFplatelet-activating factorPCphosphatidylcholineRTreverse transcriptaseWTwild typeERendoplasmic reticulumSERCAsarcoplasmic reticulum Ca2+-ATPasePBSphosphate-buffered salineBSAbovine serum albuminAAarachidonic acidAc-LDLacetyl-low density lipoproteinACATacyl-CoA:cholesterol O-acyltransferaseJNKc-Jun NH2-terminal kinaseSRAscavenger receptor AsPLA2secretory PLA2cPLA2cytosolic PLA2KOknock out. catalyze hydrolysis of the sn-2 fatty acid substituent from glycerophospholipid substrates to yield a free fatty acid, e.g. arachidonic acid, and a 2-lysophospholipid (1Six D.A. Dennis E.A. Biochim. Biophys. Acta. 2000; 1488: 1-19Crossref PubMed Scopus (1161) Google Scholar, 2Ma Z. Turk J. Prog. Nucleic Acids Res. Mol. Biol. 2001; 67: 1-33Crossref PubMed Google Scholar) that have intrinsic mediator functions (3Brash A.R. J. Clin. Investig. 2001; 107: 1339-1345Crossref PubMed Google Scholar, 4Radu C.G. Yang L.V. Riedinger M. Au M. Witte O.N. Proc. Natl. Acad. Sci. U. S. A. 2004; 101: 245-250Crossref PubMed Scopus (147) Google Scholar) and can initiate synthesis of other mediators, such as prostaglandins, leukotrienes, epoxy-eicosatrienoates, and platelet-activating factor (PAF) (5Murphy R.C. Sala A. Methods Enzymol. 1990; 187: 90-98Crossref PubMed Google Scholar). Mammalian PLA2s include the PAF-acetylhydrolase PLA2 family, which exhibits substrate specificity for PAF and oxidized phospholipids, and the secretory PLA2 (sPLA2), which are low molecular weight enzymes that require millimolar concentrations of [Ca2+] for catalysis and affect inflammation and other processes (1Six D.A. Dennis E.A. Biochim. Biophys. Acta. 2000; 1488: 1-19Crossref PubMed Scopus (1161) Google Scholar). Of the group IV cytosolic PLA2 (cPLA2) family members (1Six D.A. Dennis E.A. Biochim. Biophys. Acta. 2000; 1488: 1-19Crossref PubMed Scopus (1161) Google Scholar), cPLA2α was the first identified and prefers substrates with sn-2 arachidonoyl residues, associates with its substrates in membranes when cytosolic [Ca2+] rises, and is also regulated by phosphorylation (6Gijon M.A. Spencer D.M. Kaiser A.L. Leslie C.C. J. Cell Biol. 1999; 145: 1219-1232Crossref PubMed Scopus (178) Google Scholar). Additional cPLA2 family members are encoded by separate genes (7Underwood K.W. Song C. Kriz R.W. Chang X.J. Knopf J.L. Lin L-L. J. Biol. Chem. 1998; 273: 21926-21932Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar, 8Pickard R.T. Strifler B.A. Kramer R.M. Sharp J.D. J. Biol. Chem. 1999; 274: 8823-8831Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar, 9Song C. Chang X.J. Bean K.M. Proia M.S. Knopf J.L. Kriz R.W. J. Biol. Chem. 1999; 274: 17063-17067Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 10Ohto T. Uozumi N. Hirabayashi T. Shimizu T. J. Biol. Chem. 2005; 280: 24576-24583Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). phospholipase A2 bromoenol lactone suicide substrate collisionally activated dissociation electrospray ionization glycerophosphocholine group VIA phospholipase A2 lysophosphatidylcholine mass spectrometry tandem MS platelet-activating factor phosphatidylcholine reverse transcriptase wild type endoplasmic reticulum sarcoplasmic reticulum Ca2+-ATPase phosphate-buffered saline bovine serum albumin arachidonic acid acetyl-low density lipoprotein acyl-CoA:cholesterol O-acyltransferase c-Jun NH2-terminal kinase scavenger receptor A secretory PLA2 cytosolic PLA2 knock out Group VI PLA2 (iPLA2) enzymes (11Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra J. Jones S.S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar, 12Balboa M.A. Balsinde J. Jones S.S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8580Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 13Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar) do not require Ca2+ for catalysis and are inhibited by a bromoenol lactone (BEL) suicide substrate (14Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar) that does not inhibit sPLA2 or cPLA2 at similar concentrations (14Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 15Balsinde J. Dennis E.A. J. Biol. Chem. 1997; 272: 16069-16072Abstract Full Text Full Text PDF PubMed Scopus (279) Google Scholar, 16Ma Z. Ramanadham S. Hu Z. Turk J. Biochim. Biophys. Acta. 1998; 1391: 384-400Crossref PubMed Scopus (42) Google Scholar, 17Balsinde J. Dennis E.A. J. Biol. Chem. 1996; 271: 6758-6765Abstract Full Text Full Text PDF PubMed Scopus (337) Google Scholar). Group VIA PLA2 (iPLA2β) resides in the cytoplasm of resting cells and undergoes subcellular redistribution upon cellular stimulation (2Ma Z. Turk J. Prog. Nucleic Acids Res. Mol. Biol. 2001; 67: 1-33Crossref PubMed Google Scholar). Group VIB PLA2 (iPLA2γ) contains a peroxisomal targeting sequence and is membrane-associated (18Mancuso D.J. Jenkins C.M. Gross R.W. J. Biol. Chem. 2000; 275: 9937-9945Abstract Full Text Full Text PDF PubMed Scopus (175) Google Scholar, 19Tanaka H. Takeya R. Sumimoto H. Biochem. Biophys. Res. Commun. 2000; 272: 320-326Crossref PubMed Scopus (76) Google Scholar). These enzymes belong to a larger class of serine lipases encoded by several genes (20van Tienhoven M. Atkins J. Li Y. Glynn P. J. Biol. Chem. 2002; 277: 20942-20948Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar, 21Jenkins C.M. Mancuso D.J. Yan W. Sims H.F. Gibson B. Gross R.W. J. Biol. Chem. 2004; 279: 48968-48975Abstract Full Text Full Text PDF PubMed Scopus (622) Google Scholar). The iPLA2β enzymes are 84–88-kDa proteins that contain a GXSXG lipase consensus sequence and 7 or 8 stretches of a repetitive motif homologous to that of the ankyrin protein-binding domain (11Tang J. Kriz R.W. Wolfman N. Shaffer M. Seehra J. Jones S.S. J. Biol. Chem. 1997; 272: 8567-8575Abstract Full Text Full Text PDF PubMed Scopus (265) Google Scholar, 12Balboa M.A. Balsinde J. Jones S.S. Dennis E.A. J. Biol. Chem. 1997; 272: 8576-8580Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 13Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). In murine P388D1 macrophage-like cells iPLA2β is proposed to generate lysophosphatidylcholine (LPC) acceptors for arachidonic acid incorporation into phosphatidylcholine (PC), based on studies with BEL or an antisense oligonucleotide that reduces iPLA2 expression (22Balsinde J. Biochem. J. 2002; 364: 695-702Crossref PubMed Scopus (70) Google Scholar, 23Balsinde J. Balboa M.A. Cell. Signal. 2005; 17: 1052-1062Crossref PubMed Scopus (170) Google Scholar, 24Balsinde J. Bianco I.D. Ackermann E.J. Conde-Frieboes K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar, 25Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar). It has also been proposed that iPLA2β cooperates with CTP:phosphocholine cytidylyltransferase (26Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 9400-9408Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 27Barbour S.E. Kapur A. Deal C.L. Biochim. Biophys. Acta. 1999; 1439: 77-88Crossref PubMed Scopus (72) Google Scholar), which catalyzes the rate-limiting step in PC synthesis, to maintain PC homeostasis by degrading excess PC, based on studies with BEL in cells that overexpress CTP:phosphocholine cytidylyltransferase (26Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 9400-9408Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 27Barbour S.E. Kapur A. Deal C.L. Biochim. Biophys. Acta. 1999; 1439: 77-88Crossref PubMed Scopus (72) Google Scholar). Many other iPLA2β functions have been proposed (28Akiba S. Mizunaga S. Kume K. Hayama M. Sato T. J. Biol. Chem. 1999; 274: 19906-19912Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar, 29Atsumi G. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 30Jenkins C.M. Han X. Mancuso D.J. Gross R.W. J. Biol. Chem. 2002; 277: 32807-32814Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar, 31Seegers H.C. Gross R.W. Boyle W.A. J. Pharmacol. Exp. Ther. 2002; 302: 918-923Crossref PubMed Scopus (23) Google Scholar, 32Perez R. Melero R. Balboa M.A. Balsinde J. J. Biol. Chem. 2004; 279: 40385-40391Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 33Yellaturu C.R. Rao G.N. J. Biol. Chem. 2003; 278: 43831-43837Abstract Full Text Full Text PDF PubMed Scopus (43) Google Scholar, 34Smani T. Zakharov S.I. Csutora P. Leno E. Trepakova E.S. Bolotina V.M. Nat. Cell Biol. 2004; 6: 113-120Crossref PubMed Scopus (232) Google Scholar, 35Martinson B.D. Albert C.J. Corbett J.A. Wysolmerski R.B. Ford D.A. J. Lipid Res. 2003; 44: 1686-1691Abstract Full Text Full Text PDF PubMed Scopus (22) Google Scholar, 36Moran J.M. Buller R.M. McHowat J. Turk J. Wohltmann M. Gross R.W. Corbett J.A. J. Biol. Chem. 2005; 280: 28162-28168Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar, 37Guo Z. Su W. Ma Z. Smith G.M. Gong M.C. J. Biol. Chem. 2003; 278: 1856-1863Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar, 38Balboa M.A. Saez Y. Balsinde J. J. Immunol. 2003; 170: 5276-5280Crossref PubMed Scopus (54) Google Scholar, 39Song K. Zhang X. Zhao C. Ang N.T. Ma Z.A. Mol. Endocrinol. 2005; 19: 504-515Crossref PubMed Scopus (46) Google Scholar, 40Larsson Forsell P.K. Kennedy B.P. Claesson H.E. Eur. J. Biochem. 1999; 262: 575-585Crossref PubMed Scopus (111) Google Scholar, 41Ma Z. Wang X. Nowatzke W. Ramanadham S. Turk J. J. Biol. Chem. 1999; 274: 9607-9616Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), including a role for apoptosis in human U937 promonocytes induced by anti-Fas antibody (42Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar). Hydrolysis of arachidonic acid from U937 phospholipids induced by such antibodies is inhibited by BEL (42Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar), and U937 cell apoptosis is associated with cleavage of iPLA2β by caspase-3 (29Atsumi G. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar), a central protease in executing apoptosis. Overexpressing this iPLA2β cleavage product amplifies both thapsigargin-induced arachidonate release and cell death (29Atsumi G. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Thapsigargin is a SERCA inhibitor (43Thastrup O. Cullen P.J. Drobak B.K. Hanley M.R. Dawson A.P. Proc. Natl. Acad. Sci. U. S. A. 1990; 87: 2466-2470Crossref PubMed Google Scholar) and induces loss of ER Ca2+ stores and apoptosis in many cells by ER stress pathways. Thapsigargin-induced apoptosis of pancreatic islet β-cells and insulinoma cells requires hydrolysis of arachidonic acid from membrane phospholipids and generation of arachidonate metabolites (44Zhou Y-P. Teng D. Dralyuk F. Ostrega D. Roe M.W. Philipson L. Polonsky K. J. Clin. Investig. 1998; 101: 1623-1632Crossref PubMed Google Scholar) by a Ca2+-independent mechanism that is suppressed by BEL (45Nowatzke W. Ramanadham S. Ma Z. Hsu F-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (53) Google Scholar). Overexpressing iPLA2β also amplifies thapsigargin-induced apoptosis of insulinoma cells by a BEL-sensitive mechanism (46Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Google Scholar), and these observations suggest that iPLA2β participates in ER stress-induced β-cell apoptosis. Death of cholesterol-laden macrophages in atherosclerotic lesions (47Ross R. Annu. Rev. Physiol. 1995; 57: 791-804Crossref PubMed Google Scholar) is thought to contribute to plaque rupture and thrombosis (48Ball R.Y. Stowers E.D. Burton J.H. Cary N.R. Skepper J.N. Mitchinson M.J. Atherosclerosis. 1995; 114: 45-54Abstract Full Text PDF PubMed Scopus (185) Google Scholar), and mouse peritoneal macrophages undergo apoptosis by a mechanism that involves ER stress when loaded with free cholesterol by incubation with acetylated low density lipoprotein (Ac-LDL) and an inhibitor of the cholesterol esterification enzyme ACAT (49Yao P.M. Tabas I. J. Biol. Chem. 2000; 275: 23807-23813Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 50Feng B. Yao P.M. Li Y. Devlin C.M. Zhang D. Harding H.P. Sweeney M. Rong J.X. Kuriakose G. Fisher E.A. Marks A.R. Rong D. Tabas I. Nat. Cell Biol. 2003; 5: 781-792Crossref PubMed Scopus (662) Google Scholar, 51Li Y. Ge M. Ciani L. Kuriakose G. Westover E.J. Dura M. Covey D.F. Freed J.H. Mayfield F.R. Lytton J. Tabas I. J. Biol. Chem. 2004; 279: 37030-37039Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 52De Vries-Seimon T. Li Y. Yao P.M. Stone E. Wang Y. Davis R.J. Flavell R. Tabas I. J. Cell Biol. 2005; 171: 61-73Crossref PubMed Scopus (268) Google Scholar). Free cholesterol accumulates in macrophage ER membranes, which results in SERCA-2b inhibition (51Li Y. Ge M. Ciani L. Kuriakose G. Westover E.J. Dura M. Covey D.F. Freed J.H. Mayfield F.R. Lytton J. Tabas I. J. Biol. Chem. 2004; 279: 37030-37039Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar), and the macrophages subsequently undergo apoptosis, which might be attributable to ER Ca2+ loss and induction of ER stress in a manner analogous to events induced by thapsigargin (51Li Y. Ge M. Ciani L. Kuriakose G. Westover E.J. Dura M. Covey D.F. Freed J.H. Mayfield F.R. Lytton J. Tabas I. J. Biol. Chem. 2004; 279: 37030-37039Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 53Seimon T.A. Obstfeld A. Moore K.J. Golenbock D.T. Tabas I. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 19794-19799Crossref PubMed Scopus (155) Google Scholar). We generated iPLA2β-null mice by homologous recombination (54Bao S. Miller D.J. Ma Z. Wohltmann M. Eng G. Ramanadham S. Moley K. Turk J. J. Biol. Chem. 2004; 279: 38194-38200Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar), and their peritoneal macrophages exhibit defective transcriptional regulation of the inducible nitric-oxide synthase gene in response to viral infection (36Moran J.M. Buller R.M. McHowat J. Turk J. Wohltmann M. Gross R.W. Corbett J.A. J. Biol. Chem. 2005; 280: 28162-28168Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar). Because iPLA2β appears to participate in ER stress-induced apoptosis in U937 promonocytes (29Atsumi G. Murakami M. Kojima K. Hadano A. Tajima M. Kudo I. J. Biol. Chem. 2000; 275: 18248-18258Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar, 42Atsumi G. Tajima M. Hadano A. Nakatani Y. Murakami M. Kudo I. J. Biol. Chem. 1998; 273: 13870-13877Abstract Full Text Full Text PDF PubMed Scopus (195) Google Scholar) and β-cells (44Zhou Y-P. Teng D. Dralyuk F. Ostrega D. Roe M.W. Philipson L. Polonsky K. J. Clin. Investig. 1998; 101: 1623-1632Crossref PubMed Google Scholar, 45Nowatzke W. Ramanadham S. Ma Z. Hsu F-F. Bohrer A. Turk J. Endocrinology. 1998; 139: 4073-4085Crossref PubMed Scopus (53) Google Scholar, 46Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Google Scholar) and because iPLA2β-null mouse macrophages exhibit signaling defects (36Moran J.M. Buller R.M. McHowat J. Turk J. Wohltmann M. Gross R.W. Corbett J.A. J. Biol. Chem. 2005; 280: 28162-28168Abstract Full Text Full Text PDF PubMed Scopus (50) Google Scholar), we examined the possibility that iPLA2β might be involved in free cholesterol loading-induced apoptosis by comparing responses of wild-type and iPLA2β-null macrophages. We also compared the phospholipid composition of wild-type and iPLA2β-null macrophages to examine the proposed housekeeping functions of iPLA2β in phospholipid homeostasis (22Balsinde J. Biochem. J. 2002; 364: 695-702Crossref PubMed Scopus (70) Google Scholar, 23Balsinde J. Balboa M.A. Cell. Signal. 2005; 17: 1052-1062Crossref PubMed Scopus (170) Google Scholar, 24Balsinde J. Bianco I.D. Ackermann E.J. Conde-Frieboes K. Dennis E.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 8527-8531Crossref PubMed Scopus (251) Google Scholar, 25Balsinde J. Balboa M.A. Dennis E.A. J. Biol. Chem. 1997; 272: 29317-29321Abstract Full Text Full Text PDF PubMed Scopus (192) Google Scholar, 26Baburina I. Jackowski S. J. Biol. Chem. 1999; 274: 9400-9408Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar, 27Barbour S.E. Kapur A. Deal C.L. Biochim. Biophys. Acta. 1999; 1439: 77-88Crossref PubMed Scopus (72) Google Scholar). Materials—[5,6,8,9,11,12,14,15-3H]Arachidonic acid (217 Ci/mmol) was obtained from Amersham Biosciences; enhanced chemiluminescence (ECL) reagents from were Amersham Biosciences; standard phospholipids were from Avanti Polar Lipids (Birmingham, AL); SDS-PAGE supplies were from Bio-Rad; organic solvents were from Fisher; Coomassie reagent was from Pierce; ampicillin, kanamycin, zymosan, fucoidan, common reagents, and salts were from Sigma; culture media, penicillin, streptomycin, Hanks' balanced salt solution, l-glutamine, agarose, molecular mass standards, and RT-PCR reagents were from Invitrogen; Pentex bovine serum albumin (BSA, fatty acid-free, fraction V) was from ICN Biomedical (Aurora, OH); thapsigargin was from Calbiochem. Heat-inactivated (1 h, 65 °C) fetal bovine serum was obtained from Hyclone (Logan UT). Krebs-Ringer bicarbonate buffer contained 25 mm HEPES (pH 7.4), 115 mm NaCl, 24 mm NaHCO3, 5 mm KCl, 1 mm MgCl2, and 2.5 mm CaCl2. ACAT inhibitor 58035 (3-[decyldimethyl-silyl]-N-[2-(4methylphenyl)-1-phenylethyl]propanamide (55Ross A.C. Go K.J. Heider J.G. Rothblat G.H. J. Biol. Chem. 2004; 259: 815-819Abstract Full Text PDF Google Scholar) was provided by J. Heider, formerly of Sandoz (East Hanover, NJ); a 10 mg ml-1 stock solution was prepared in dimethyl sulfoxide (Me2SO), and final Me2SO concentration for treated and control cells was 0.05%. Cholesterol (>99% pure) was obtained from Nu Chek Prep. (Elysian, MN). LDL (d, 1.020–1.063 g ml-1) from fresh human plasma was isolated by preparative ultracentrifugation. Acetyl-LDL was prepared by reaction with acetic anhydride (56Basu S.K. Goldstein J.L. Anderson R.G.W. Brown M.S. Proc. Natl. Acad. Sci. U. S. A. 1976; 73: 3178-3182Crossref PubMed Google Scholar). Anti-GADD153 (CHOP) antibody was obtained from Santa Cruz Biotechnology. Horseradish peroxidase-conjugated goat anti-rabbit IgG and goat anti-mouse IgG were from Bio-Rad. Generating iPLA2β-/- Knock-out Mice—The Washington University Animal Studies Committee approved all studies described in this study. Preparation of the iPLA2β knock-out construct, its introduction into 129/SvJ mouse embryonic stem cells, their selection with G418, characterization by Southern blotting, injection into C57BL/6 mouse blastocysts, production of chimeras and then heterozygotes, and mating of heterozygotes to yield wild-type, heterozygous, and iPLA2β-null mice in a Mendelian distribution are described elsewhere, as is their genotyping by Southern blotting of tail genomic DNA (54Bao S. Miller D.J. Ma Z. Wohltmann M. Eng G. Ramanadham S. Moley K. Turk J. J. Biol. Chem. 2004; 279: 38194-38200Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar, 57Bao S. Song H. Wohltmann M. Bohrer A. Turk J. J. Biol. Chem. 2006; 281: 20958-20973Abstract Full Text Full Text PDF PubMed Scopus (75) Google Scholar). Isolation of Peritoneal Macrophages—As described previously (49Yao P.M. Tabas I. J. Biol. Chem. 2000; 275: 23807-23813Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar, 50Feng B. Yao P.M. Li Y. Devlin C.M. Zhang D. Harding H.P. Sweeney M. Rong J.X. Kuriakose G. Fisher E.A. Marks A.R. Rong D. Tabas I. Nat. Cell Biol. 2003; 5: 781-792Crossref PubMed Scopus (662) Google Scholar, 51Li Y. Ge M. Ciani L. Kuriakose G. Westover E.J. Dura M. Covey D.F. Freed J.H. Mayfield F.R. Lytton J. Tabas I. J. Biol. Chem. 2004; 279: 37030-37039Abstract Full Text Full Text PDF PubMed Scopus (214) Google Scholar, 52De Vries-Seimon T. Li Y. Yao P.M. Stone E. Wang Y. Davis R.J. Flavell R. Tabas I. J. Cell Biol. 2005; 171: 61-73Crossref PubMed Scopus (268) Google Scholar), peritoneal macrophages from adult female C57BL/6 mice and mutant mice were harvested 3 days after intraperitoneal injection of 40 μg of concanavalin A in PBS (0.2 ml). Cells were incubated in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum and 20% L-cell-conditioned medium. Medium was replaced every 24 h until macrophages were confluent. On days of experiments, cells were washed three times with warm PBS and incubated as indicated in the figures. Analyses of iPLA2β mRNA in Mouse Peritoneal Macrophages and Brain—Northern blots of iPLA2β mRNA were performed as described (54Bao S. Miller D.J. Ma Z. Wohltmann M. Eng G. Ramanadham S. Moley K. Turk J. J. Biol. Chem. 2004; 279: 38194-38200Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar). For RT-PCR, total RNA was isolated with an RNeasy kit (Qiagen Inc.). SuperScript First Strand Synthesis System (Invitrogen) was used to synthesize cDNA in 20-μl reactions that contained DNase I-treated total RNA (2 μg). The cDNA product was treated (20 min, 37 °C) with RNase H (2 units; Invitrogen) and heat-inactivated (70 °C, 15 min). Reactions without reverse transcriptase were performed to verify the absence of genomic DNA. PCR with the pair of primers 1 and 2 amplifies a fragment that spans the neomycin resistance cassette insertion site. PCR with the pair of primers 3 and 2 amplifies a fragment downstream from that site. The sequence of primer 1 is tgtgacgtggacagcactagc, that of primer 2 is ccccagagaaacgactatgga, and that of primer 3 is tatgcgtggtgtgtacttccg. Free Cholesterol Loading of Mouse Peritoneal Macrophages, Incubation with Thapsigargin and Fucoidan, Cell Death Assays, Caspase Activation, and Analyses of Internucleosomal DNA Cleavages—Macrophages were loaded with free cholesterol by incubation with 100 μg ml-1 acetyl-LDL in the presence of 10 μg ml-1 58035, which inhibits ACAT-mediated cholesterol esterification (49Yao P.M. Tabas I. J. Biol. Chem. 2000; 275: 23807-23813Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). Alternatively, macrophages were incubated with the SERCA inhibitor thapsigargin (0.5 μm), the scavenger receptor A ligand fucoidan (25 μg/ml), or both agents for 24 h as described (52De Vries-Seimon T. Li Y. Yao P.M. Stone E. Wang Y. Davis R.J. Flavell R. Tabas I. J. Cell Biol. 2005; 171: 61-73Crossref PubMed Scopus (268) Google Scholar). At the end of the incubation, macrophages were assayed for early-to-mid stage apoptosis (i.e. externalization of phosphatidylserine) by staining with Alexa-488-labeled annexin V and for late stage apoptosis (i.e. increased membrane permeability) by staining with propidium iodide (PI) as described (49Yao P.M. Tabas I. J. Biol. Chem. 2000; 275: 23807-23813Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar). Cells were viewed immediately with an Olympus IX-70 inverted fluorescence microscope, and six representative fields (∼1000 cells) for each condition were counted for the number of annexin-positive cells, PI-positive cells, and total cells. In other experiments, cell or nuclear preparations were subjected to immunoblot analyses, as described below. Activated caspase-3 in macrophages was detected with an EnzCheck caspase-3 assay kit (Invitrogen). DNA laddering kits (Roche Diagnostics) were used to analyze internucleosomal cleavages characteristic of apoptosis as described (46Ramanadham S. Hsu F.F. Zhang S. Jin C. Bohrer A. Ma Z. Turk J. Biochemistry. 2004; 43: 918-930Crossref PubMed Google Scholar). Immunoblotting of the Endoplasmic Reticulum Stress Marker CHOP—Immunoblotting of CHOP was performed as described (58Harding H.P. Novoa I. Zhang Y. Zeng H. Wek R. Schapira M. Ron D. Mol. Cell. 2000; 6: 1099-1108Abstract Full Text Full Text PDF PubMed Google Scholar, 59Calfon M. Zeng H. Urano F. Till J.H. Hubbard S.R. Harding H.P. Clark S.G. Ron D. Nature. 2002; 415: 92-96Crossref PubMed Scopus (1882) Google Scholar) with minor modifications. Briefly, cells were lysed in RIPA buffer to prepare whole-cell lysates, which were resuspended in 2× SDS-PAGE loading buffer and incubated (95 °C, 10 min). After SDS-PAGE analyses, samples were electrotransfered to 0.22-μm nitrocellulose membranes using a Bio-Rad mini-transfer tank and then incubated with primary antibodies. Protein bands were detected with horseradish peroxidase-conjugated secondary antibodies (Bio-Rad) by ECL (Amersham Biosciences). Membranes were also probed with an anti-β-actin monoclonal antibody to assess loading. Preparation of Recombinant Adenovirus to Restore iPLA2β Expression to iPLA2β-Null Cells—An adenovirus that caused expression of iPLA2β was prepared with a ViraPower adenovirus expression system (Invitrogen) according to the manufacturer's instructions. Briefly, cDNA that encodes the 84-kDa iPLA2β (13Ma Z. Ramanadham S. Kempe K. Chi X.S. Ladenson J. Turk J. J. Biol. Chem. 1997; 272: 11118-11127Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar) was subcloned into the

Existing evidence implicates regulatory roles for protein phosphatase 2A (PP2A) in a variety of cellular functions, including cytoskeletal remodeling, hormone secretion, and apoptosis. We report here activation of PP2A in normal rat islets and insulin-secreting INS-1 832/13 cells under the duress of hyperglycemic (HG) conditions. Small interfering RNA-mediated knockdown of the catalytic subunit of PP2A (PP2Ac) markedly attenuated glucose-induced activation of PP2A. HG, but not nonmetabolizable 3-O-methyl glucose or mannitol (osmotic control), significantly stimulated the methylation of PP2Ac at its C-terminal Leu-309, suggesting a novel role for this posttranslational modification in glucose-induced activation of PP2A. Moreover, knockdown of the cytosolic leucine carboxymethyl transferase 1 (LCMT1), which carboxymethylates PP2Ac, significantly attenuated PP2A activation under HG conditions. In addition, HG conditions, but not 3-O-methyl glucose or mannitol, markedly increased the expression of LCMT1. Furthermore, HG conditions significantly increased the expression of B55α, a regulatory subunit of PP2A, which has been implicated in islet dysfunction under conditions of oxidative stress and diabetes. Thapsigargin, a known inducer of endoplasmic reticulum stress, failed to exert any discernible effects on the carboxymethylation of PP2Ac, expression of LCMT1 and B55α, or PP2A activity, suggesting no clear role for endoplasmic reticulum stress in HG-induced activation of PP2A. Based on these findings, we conclude that exposure of the islet β-cell to HG leads to accelerated PP2A signaling pathway, leading to loss in glucose-induced insulin secretion.

Type 1 diabetes (T1D) is a complex autoimmune disorder whose pathogenesis involves an intricate interplay between β cells of the pancreatic islet, other islet cells, and cells of the immune system. Direct intercellular communication within the islet occurs via cell surface proteins and indirect intercellular communication has traditionally been seen as occurring via secreted proteins (e.g., endocrine hormones and cytokines). However, recent literature suggests that extracellular vesicles (EVs) secreted by β cells constitute an additional and biologically important mechanism for transmitting signals to within the islet.This review summarizes the general mechanisms of EV formation, with a particular focus on how lipids and lipid signaling pathways influence their formation and cargo. We review the implications of EV release from β cells for T1D pathogenesis, how EVs and their cargo might be leveraged as biomarkers of this process, and how EVs might be engineered as a therapeutic candidate to counter T1D outcomes.Islet β cells have been viewed as initiators and propagators of the cellular circuit giving rise to autoimmunity in T1D. In this context, emerging literature suggests that EVs may represent a conduit for communication that holds more comprehensive messaging about the β cells from which they arise. As the field of EV biology advances, it opens the possibility that intervening with EV formation and cargo loading could be a novel disease-modifying approach in T1D.

Stimulation of pancreatic islets with glucose induces phospholipid hydrolysis and accumulation of nonesterified arachidonic acid, which may amplify the glucose-induced Ca2+ entry into islet beta-cells that triggers insulin secretion. Ca2+ loss from beta-cell intracellular compartments has been proposed to induce both Ca2+ entry and events dependent on arachidonate metabolism. We examine here effects of inducing Ca2+ loss from intracellular sequestration sites with ionophore A23187 and thapsigargin on arachidonate hydrolysis from islet phospholipids. A23187 induces a decline in islet arachidonate-containing phospholipids and release of nonesterified arachidonate. A23187-induced arachidonate release is of similar magnitude when islets are stimulated in Ca2+-replete or in Ca2+-free media or when islets loaded with the intracellular Ca2+ chelator BAPTA are stimulated in Ca2+-free medium, a condition in which A23187 induces no rise in beta-cell cytosolic [Ca2+]. Thapsigargin also induces islet arachidonate release under these conditions. A23187- or thapsigargin-induced arachidonate release is prevented by a bromoenol lactone (BEL) inhibitor of a beta-cell phospholipase A2 (iPLA2), which does not require Ca2+ for catalytic activity and which is negatively modulated by and physically interacts with calmodulin by Ca2+-dependent mechanisms. Agents that cause Ca2+ loss from islet intracellular compartments thus induce arachidonate hydrolysis from phospholipids by a BEL-sensitive mechanism that does not require a rise in cytosolic [Ca2+], and a BEL-sensitive enzyme-like iPLA2 or a related membranous activity may participate in sensing Ca2+ compartment content.

Interleukin-1 (IL-1) impairs insulin secretion from pancreatic islets and may contribute to the pathogenesis of insulin-dependent diabetes mellitus. IL-1 increases islet expression of nitric oxide (NO) synthase, and the resultant overproduction of NO participates in inhibition of insulin secretion because NO synthase inhibitors, e.g. NG-monomethyl-arginine (NMMA), prevent this inhibition. While exploring effects of IL-1 on islet arachidonic acid metabolism, we found that IL-1 increases islet production of the 12-lipoxygenase product 12-hydroxyeicosatetraenoic acid 12-(HETE). This effect requires NO production and is prevented by NMMA. Exploration of the mechanism of this effect indicates that it involves increased availabilty of the substrate arachidonic acid rather than enhanced expression of 12-lipoxygenase. Evidence supporting this conclusion includes the facts that IL-1 does not increase islet 12-lipoxygenase protein or mRNA levels and does not enhance islet conversion of exogenous arachidonate to 12-HETE. Mass spectrometric stereochemical analyses nonetheless indicate that 12-HETE produced by IL-1-treated islets consists only of the S-enantiomer and thus arises from enzyme action. IL-1 does enhance release of nonesterified arachidonate from islets, as measured by isotope dilution mass spectrometry, and this effect is suppressed by NMMA and mimicked by the NO-releasing compound 3-morpholinosydnonimine. Although IL-1 increases neither islet phospholipase A2 (PLA2) activities nor mRNA levels for cytosolic or secretory PLA2, a suicide substrate which inhibits an islet Ca2+-independent PLA2 prevents enhancement of islet arachidonate release by IL-1. IL-1 also impairs esterification of [3H8]arachidonate into islet phospholipids, and this effect is prevented by NMMA and mimicked by the mitochondrial ATP-synthase inhibitor oligomycin. Experiments with exogenous substrates indicate that NMMA does not inhibit and that the NO-releasing compound does not activate islet 12-lipoxygenase or PLA2 activities. These results indicate that a novel action of NO is to increase levels of nonesterified arachidonic acid in islets. Interleukin-1 (IL-1) impairs insulin secretion from pancreatic islets and may contribute to the pathogenesis of insulin-dependent diabetes mellitus. IL-1 increases islet expression of nitric oxide (NO) synthase, and the resultant overproduction of NO participates in inhibition of insulin secretion because NO synthase inhibitors, e.g. NG-monomethyl-arginine (NMMA), prevent this inhibition. While exploring effects of IL-1 on islet arachidonic acid metabolism, we found that IL-1 increases islet production of the 12-lipoxygenase product 12-hydroxyeicosatetraenoic acid 12-(HETE). This effect requires NO production and is prevented by NMMA. Exploration of the mechanism of this effect indicates that it involves increased availabilty of the substrate arachidonic acid rather than enhanced expression of 12-lipoxygenase. Evidence supporting this conclusion includes the facts that IL-1 does not increase islet 12-lipoxygenase protein or mRNA levels and does not enhance islet conversion of exogenous arachidonate to 12-HETE. Mass spectrometric stereochemical analyses nonetheless indicate that 12-HETE produced by IL-1-treated islets consists only of the S-enantiomer and thus arises from enzyme action. IL-1 does enhance release of nonesterified arachidonate from islets, as measured by isotope dilution mass spectrometry, and this effect is suppressed by NMMA and mimicked by the NO-releasing compound 3-morpholinosydnonimine. Although IL-1 increases neither islet phospholipase A2 (PLA2) activities nor mRNA levels for cytosolic or secretory PLA2, a suicide substrate which inhibits an islet Ca2+-independent PLA2 prevents enhancement of islet arachidonate release by IL-1. IL-1 also impairs esterification of [3H8]arachidonate into islet phospholipids, and this effect is prevented by NMMA and mimicked by the mitochondrial ATP-synthase inhibitor oligomycin. Experiments with exogenous substrates indicate that NMMA does not inhibit and that the NO-releasing compound does not activate islet 12-lipoxygenase or PLA2 activities. These results indicate that a novel action of NO is to increase levels of nonesterified arachidonic acid in islets.

Stimulation of pancreatic islets with glucose induces phospholipid hydrolysis and accumulation of nonesterified arachidonic acid, which may play signaling or effector roles in insulin secretion. Of enzymes that catalyze phospholipid hydrolysis, islet beta-cells express low molecular weight secretory phospholipases A2 (PLA2) and a Group VI, Ca2+-independent PLA2 (iPLA2). Previous studies indicate that islets also express a protein recognized by antibodies against a Group IV, cytosolic, Ca2+-dependent PLA2 (cPLA2). To further examine the possible expression of cPLA2 by islets, we screened a rat islet cDNA library with a probe that recognizes cPLA2 sequence, and isolated a full-length cPLA2 cDNA. The rat islet cPLA2-deduced amino acid sequence is 96% identical to those of human and mouse cPLA2. Transfection of COS-7 cells with cPLA2 cDNA in an expression vector induced expression of Ca2+-dependent PLA2 activity and of a protein recognized by anti-cPLA2 antibody. Comparison of recombinant islet cPLA2 and iPLA2 activities expressed in transfected COS-7 cells indicated that iPLA2 but not cPLA2 is stimulated by ATP. Both activities are similarly sensitive to inhibition by arachidonyltrifluoromethyl ketone, but iPLA2 is more effectively inhibited by a haloenol lactone suicide substrate than cPLA2. RT-PCR experiments with RNA from purified islet beta-cells and from an alpha-cell-enriched population prepared by fluorescence-activated cell-sorting indicated that cPLA2 mRNA is more abundant in the beta-cell population. Immunoblotting analyses indicate that islets express cPLA2-immunoreactive protein, and that interleukin-1 does not affect its expression. The cPLA2 is thus one of at least three classes of PLA2 enzymes with distinct properties expressed in beta-cells.

Insulin resistance, hyperglycemia, and type 2 diabetes are among the sequelae of metabolic syndromes that occur in 60-80% of human immunodeficiency virus (HIV)-positive patients treated with HIV-protease inhibitors (PIs). Studies to elucidate the molecular mechanism(s) contributing to these changes, however, have mainly focused on acute, in vitro actions of PIs. Here, we examined the chronic (7 wk) in vivo effects of the PI indinavir (IDV) in male Zucker diabetic fatty (fa/fa) (ZDF) rats. IDV exposure accelerated the diabetic state and dramatically exacerbated hyperglycemia and oral glucose intolerance in the ZDF rats, compared with vehicle-treated ZDF rats. Oligonucleotide gene array analyses revealed upregulation of suppressor of cytokine signaling-1 (SOCS-1) expression in insulin-sensitive tissues of IDV rats. SOCS-1 is a known inducer of insulin resistance and diabetes, and immunoblotting analyses revealed increases in SOCS-1 protein expression in adipose, skeletal muscle, and liver tissues of IDV-administered ZDF rats. This was associated with increases in the upstream regulator TNF-alpha and downstream effector sterol regulatory element-binding protein-1 and a decrease in IRS-2. IDV and other PIs currently in clinical use induced the SOCS-1 signaling cascade also in L6 myotubes and 3T3-L1 adipocytes exposed acutely to PIs under normal culturing conditions and in tissues from Zucker wild-type lean control rats administered PIs for 3 wk, suggesting an effect of these drugs even in the absence of background hyperglycemia/hyperlipidemia. Our findings therefore indicate that induction of the SOCS-1 signaling cascade by PIs could be an important contributing factor in the development of metabolic dysregulation associated with long-term exposures to HIV-PIs.

Endoplasmic reticulum (ER) stress is becoming recognized as an important contributing factor in various diseases, including diabetes mellitus. Prolonged ER stress can cause β-cell apoptosis; however, the underlying mechanism(s) that contribute to this process are not well understood. Early reports suggested that arachidonic acid metabolites and a Ca(2+)-independent phospholipase A(2) (iPLA(2)) activity play a role in β-cell apoptosis. The PLA(2) family of enzymes catalyse the hydrolysis of the sn-2 substituent (i.e. arachidonic acid) of membrane phospholipids. In light of our findings that the pancreatic islet β-cells are enriched in arachidonate-containing phospholipids and express the group VIA iPLA(2)β, we considered the possibility that iPLA(2)β participates in ER stress-induced β-cell apoptosis. Our work revealed a novel mechanism, involving ceramide generation and triggering of mitochondrial abnormalities, by which iPLA(2)β participates in the β-cell apoptosis process. Here, we review our evidence linking ER stress, β-cell apoptosis and iPLA(2)β. Continued studies in this area will increase our understanding of the contribution of iPLA(2)β to the evolution of diabetes mellitus and will further our knowledge of factors that influence β-cell health in diabetes mellitus and identify potential targets for future therapeutic interventions to prevent β-cell death.

Inclusion of HIV protease inhibitors (PIs) in the treatment of people living with HIV+ has markedly decreased mortality but also increased the incidence of metabolic abnormalities, causes of which are not well understood. Here, we report that insulinopenia is exacerbated when Zucker fa/fa rats are exposed to a PI for 7 wk, suggesting that chronic PI exposure adversely affects pancreatic islet beta-cell function. In support of this possibility, we find increased apoptosis, as reflected by TUNEL fluorescence analyses, and reduced insulin-secretory capacity in insulinoma cells and human pancreatic islet cells after in vitro exposures (48-96 h) to clinically relevant PIs (ritonavir, lopinavir, atazanavir, or tipranavir). Furthermore, pancreatic islets isolated from rats administered an HIV-PI for 3 wk exhibit greater cell death than islets isolated from vehicle-administered rats. The higher incidence of HIV-PI-induced cell death was associated with cleavage and, hence, activation of caspase-3 and poly(ADP)-ribose polymerase but not with activation of phospho-pancreatic endoplasmic reticulum (ER) kinase or induction of ER stress apoptotic factor C/EBP homologous protein. Exposure to the HIV-PIs, however, led to activation of mitochondria-associated caspase-9, caused a loss in mitochondrial membrane potential, and promoted the release of cytochrome c, suggesting that HIV-PIs currently in clinically use can induce beta-cell apoptosis by activating the mitochondrial apoptotic pathway. These findings therefore highlight the importance of considering beta-cell viability and function when assessing loss of glycemic control and the course of development of diabetes in HIV+ subjects receiving a protease inhibitor.

Death of β-cells due to apoptosis is an important contributor to β-cell dysfunction in both type 1 and type 2 diabetes mellitus. Previously, we described participation of the Group VIA Ca 2+ -independent phospholipase A 2 (iPLA 2 β) in apoptosis of insulinoma cells due to ER stress. To examine whether islet β-cells are similarly susceptible to ER stress and undergo iPLA 2 β-mediated apoptosis, we assessed the ER stress response in human pancreatic islets. Here, we report that the iPLA 2 β protein is expressed predominantly in the β-cells of human islets and that thapsigargin-induced ER stress promotes β-cell apoptosis, as reflected by increases in activated caspase-3 in the β-cells. Furthermore, we demonstrate that ER stress is associated with increases in islet iPLA 2 β message, protein, and activity, iPLA 2 β-dependent induction of neutral sphingomyelinase and ceramide accumulation, and subsequent loss of mitochondrial membrane potential. We also observe that basal activated caspase-3 increases with age, raising the possibility that β-cells in older human subjects have a greater susceptibility to undergo apoptotic cell death. These findings reveal for the first time expression of iPLA 2 β protein in human islet β-cells and that induction of iPLA 2 β during ER stress contributes to human islet β-cell apoptosis. We hypothesize that modulation of iPLA 2 β activity might reduce β-cell apoptosis and this would be beneficial in delaying or preventing β-cell dysfunction associated with diabetes.

Ongoing studies suggest an important role for iPLA2β in a multitude of biological processes and it has been implicated in neurodegenerative, skeletal and vascular smooth muscle disorders, bone formation, and cardiac arrhythmias. Thus, identifying an iPLA2βinhibitor that can be reliably and safely used in vivo is warranted. Currently, the mechanism-based inhibitor bromoenol lactone (BEL) is the most widely used to discern the role of iPLA2β in biological processes. While BEL is recognized as a more potent inhibitor of iPLA2 than of cPLA2 or sPLA2, leading to its designation as a “specific” inhibitor of iPLA2, it has been shown to also inhibit non-PLA2 enzymes. A potential complication of its use is that while the S and R enantiomers of BEL exhibit preference for cytosol-associated iPLA2β and membrane-associated iPLA2γ, respectively, the selectivity is only 10-fold for both. In addition, BEL is unstable in solution, promotes irreversible inhibition, and may be cytotoxic, making BEL not amenable for in vivo use. Recently, a fluoroketone (FK)-based compound (FKGK18) was described as a potent inhibitor of iPLA2β. Here we characterized its inhibitory profile in beta-cells and find that FKGK18: (a) inhibits iPLA2β with a greater potency (100-fold) than iPLA2γ, (b) inhibition of iPLA2β is reversible, (c) is an ineffective inhibitor of α-chymotrypsin, and (d) inhibits previously described outcomes of iPLA2β activation including (i) glucose-stimulated insulin secretion, (ii) arachidonic acid hydrolysis; as reflected by PGE2 release from human islets, (iii) ER stress-induced neutral sphingomyelinase 2 expression, and (iv) ER stress-induced beta-cell apoptosis. These findings suggest that FKGK18 is similar to BEL in its ability to inhibit iPLA2β. Because, in contrast to BEL, it is reversible and not a non-specific inhibitor of proteases, it is suggested that FKGK18 is more ideal for ex vivo and in vivo assessments of iPLA2β role in biological functions.

β-cell apoptosis is a significant contributor to β-cell dysfunction in diabetes and ER stress is among the factors that contributes to β-cell death. We previously identified that the Ca2+-independent phospholipase A2β (iPLA2β), which in islets is localized in β-cells, participates in ER stress-induced β-cell apoptosis. Here, direct assessment of iPLA2β role was made using β-cell-specific iPLA2β overexpressing (RIP-iPLA2β-Tg) and globally iPLA2β-deficient (iPLA2β-KO) mice. Islets from Tg, but not KO, express higher islet iPLA2β and neutral sphingomyelinase, decrease in sphingomyelins, and increase in ceramides, relative to WT group. ER stress induces iPLA2β, ER stress factors, loss of mitochondrial membrane potential (∆Ψ), caspase-3 activation, and β-cell apoptosis in the WT and these are all amplified in the Tg group. Surprisingly, β-cells apoptosis while reduced in the KO is higher than in the WT group. This, however, was not accompanied by greater caspase-3 activation but with larger loss of ∆Ψ, suggesting that iPLA2β deficiency impacts mitochondrial membrane integrity and causes apoptosis by a caspase-independent manner. Further, autophagy, as reflected by LC3-II accumulation, is increased in Tg and decreased in KO, relative to WT. Our findings suggest that (1) iPLA2β impacts upstream (UPR) and downstream (ceramide generation and mitochondrial) pathways in β-cells and (2) both over- or under-expression of iPLA2β is deleterious to the β-cells. Further, we present for the first time evidence for potential regulation of autophagy by iPLA2β in islet β-cells. These findings support the hypothesis that iPLA2β induction under stress, as in diabetes, is a key component to amplifying β-cell death processes.

Glioblastoma (GBM) remains one of the most aggressive cancers, partially due to its ability to migrate into the surrounding brain. The sphingolipid balance, or the balance between ceramides and sphingosine-1-phosphate, contributes to the ability of GBM cells to migrate or invade. Of the ceramidases which hydrolyze ceramides, acid ceramidase (ASAH1) is highly expressed in GBM samples compared to non-tumor brain. ASAH1 expression also correlates with genes associated with migration and focal adhesion. To understand the role of ASAH1 in GBM migration, we utilized shRNA knockdown and observed decreased migration that did not depend upon changes in growth. Next, we inhibited ASAH1 using carmofur, a clinically utilized small molecule inhibitor. Inhibition of ASAH1 by carmofur blocks in vitro migration of U251 (GBM cell line) and GBM cells derived from patient-derived xenografts (PDXs). RNA-sequencing suggested roles for carmofur in MAPK and AKT signaling. We found that carmofur treatment decreases phosphorylation of AKT, but not of MAPK. The decrease in AKT phosphorylation was confirmed by shRNA knockdown of ASAH1. Our findings substantiate ASAH1 inhibition using carmofur as a potential clinically relevant treatment to advance GBM therapeutics, particularly due to its impact on migration.

Type 1 diabetes (T1D) is an autoimmune disease in which pro-inflammatory and cytotoxic signaling drive the death of the insulin-producing β cells. This complex signaling is regulated in part by fatty acids and their bioproducts, making them excellent therapeutic targets.We provide an overview of the fatty acid actions on β cells by discussing how they can cause lipotoxicity or regulate inflammatory response during insulitis. We also discuss how diet can affect the availability of fatty acids and disease development. Finally, we discuss development avenues that need further exploration.Fatty acids, such as hydroxyl fatty acids, ω-3 fatty acids, and their downstream products, are druggable candidates that promote protective signaling. Inhibitors and antagonists of enzymes and receptors of arachidonic acid and free fatty acids, along with their derived metabolites, which cause pro-inflammatory and cytotoxic responses, have the potential to be developed as therapeutic targets also. Further, because diet is the main source of fatty acid intake in humans, balancing protective and pro-inflammatory/cytotoxic fatty acid levels through dietary therapy may have beneficial effects, delaying T1D progression. Therefore, therapeutic interventions targeting fatty acid signaling hold potential as avenues to treat T1D.

Abstract A cytosolic 84 kDa Group VIA phospholipase A 2 (iPLA 2 β) that does not require Ca 2+ for catalysis was cloned from Chinese hamster ovary (CHO) cells, murine P388D1 cells, pancreatic islet β‐cells, and other sources. Proposed iPLA 2 β functions include participation in phosphatidylcholine (PC) homeostasis by degrading excess PC generated in CHO cells that overexpress CTP:phosphocholine cytidylyltransferase (CT), which catalyzes the rate‐limiting step in PC biosynthesis; participation in biosynthesis of arachidonate‐containing PC species in P388D1 cells by generating lysophosphatidylcholine (IPC) acceptors for arachidonate incorporation; and participation in signaling events in insulin secretion from islet β‐cells. To further examine iPLA 2 β functions in β‐cells, we prepared stably transfected INS‐1 insulinoma cell lines that overexpress iPLA 2 β activity eightfold compared to parental INS‐1 cells or to INS‐1 cells transfected with an empty retroviral vector that did not contain iPIA 2 β cDNA. The iPLA 2 β‐overexpressing cells exhibit a twofold increase in CT activity compared to parental cells but little change in rates of [ 3 H] choline incorporation into or disappearance from PC. Electrospray ionization (ESI) tandem mass spectrometric measurements indicate that iPLA 2 β‐overexpressing cells have 1.5‐fold higher LPC levels than parental INS‐1 cells but do not exhibit increased rates of [ 3 H]arachidonate incorporation into phospholipids, and incorporation is unaffected by a bromoenol lactone (BEL) suicide substrate inhibitor of iPLA 2 β. The rate of appearance of arachidonate‐containing phosphatidylethanolamine species visualized by ESI mass spectrometry is also similar in iPLA 2 β‐overexpressing and parental INS‐1 cells incubated with supplemental arachidonic acid, and this process is unaffected by BEL. Compared to parental INS‐1 cells, iPLA 2 β‐overexpressing cells proliferate more rapidly and exhibit amplified insulin secretory responses to a protein kinase C‐activating phorbol ester, glucose, and a cAMP analog. These findings suggest that iPLA 2 β plays a signaling role in β‐cells that differs from housekeeping functions in PC biosynthesis and degradation in P388D1 and CHO cells.

Insulin-secreting pancreatic islet β-cells express a Group VIA Ca²⁺-independent phospholipase A₂ (iPLA₂β) that contains a calmodulin binding site and protein interaction domains. We identified Ca²⁺/calmodulindependent protein kinase IIβ (CaMKIIβ) as a potential iPLA₂β-interacting protein by yeast two-hybrid screening of a cDNA library using iPLA₂β cDNA as bait. Cloning CaMKIIβ cDNA from a rat islet library revealed that one dominant CaMKIIβ isoform mRNA is expressed by adult islets and is not observed in brain or neonatal islets and that there is high conservation of the isoform expressed by rat and human β-cells. Binary two-hybrid assays using DNA encoding this isoform as bait and iPLA₂β DNA as prey confirmed interaction of the enzymes, as did assays with CaMKIIβ as prey and iPLA₂β bait. His-tagged CaMKIIβ immobilized on metal affinity matrices bound iPLA₂β, and this did not require exogenous calmodulin and was not prevented by a calmodulin antagonist or the Ca²⁺ chelator EGTA. Activities of both enzymes increased upon their association, and iPLA₂β reaction products reduced CaMKIIβ activity. Both the iPLA₂β inhibitor bromoenol lactone and the CaMKIIβ inhibitor KN93 reduced arachidonate release from INS-1 insulinoma cells, and both inhibit insulin secretion. CaMKIIβ and iPLA₂β can be coimmunoprecipitated from INS-1 cells, and forskolin, which amplifies glucose-induced insulin secretion, increases the abundance of the immunoprecipitatable complex. These findings suggest that iPLA₂β and CaMKIIβ form a signaling complex in β-cells, consistent with reports that both enzymes participate in insulin secretion and that their expression is coinduced upon differentiation of pancreatic progenitor to endocrine progenitor cells.

Many cells express a group VIA 84 kDa phospholipase A2 (iPLA2β) that is sensitive to inhibition by a bromoenol lactone (BEL) suicide substrate. Inhibition of iPLA2β in pancreatic islets and insulinoma cells suppresses, and overexpression of iPLA2β in INS-1 insulinoma cells amplifies, glucose-stimulated insulin secretion, suggesting that iPLA2β participates in secretion. Western blotting analyses reveal that glucose-responsive 832/13 INS-1 cells express essentially no 84 kDa iPLA2β-immunoreactive protein but predominantly express a previously unrecognized immunoreactive iPLA2β protein in the 70 kDa region that is not generated by a mechanism of alternate splicing of the iPLA2β transcript. To determine if the 70 kDa-immunoreactive protein is a short isoform of iPLA2β, protein from the 70 kDa region was digested with trypsin and analyzed by mass spectrometry. Such analyses reveal several peptides with masses and amino acid sequences that exactly match iPLA2β tryptic peptides. Peptide sequences identified in the 70 kDa tryptic digest include iPLA2β residues 7−53, suggesting that the N-terminus is preserved. We also report here that the 832/13 INS-1 cells express iPLA2β catalytic activity and that BEL inhibits secretagogue-stimulated insulin secretion from these cells but not the incorporation of arachidonic acid into membrane PC pools of these cells. These observations suggest that the catalytic iPLA2β activity expressed in 832/13 INS-1 cells is attributable to a short isoform of iPLA2β and that this isoform participates in insulin secretory but not in membrane phospholipid remodeling pathways. Further, the finding that pancreatic islets also express predominantly a 70 kDa iPLA2β-immunoreactive protein suggests that a signal transduction role of iPLA2β in the native β-cell might be attributable to a 70 kDa isoform of iPLA2β.

Many cells express a Group VIA phospholipase A2, designated iPLA2beta, that does not require calcium for activation, is stimulated by ATP, and is sensitive to inhibition by a bromoenol lactone suicide substrate (BEL). Studies in various cell systems have led to the suggestion that iPLA2beta has a role in phospholipid remodeling, signal transduction, cell proliferation, and apoptosis. We have found that pancreatic islets, beta-cells, and glucose-responsive insulinoma cells express an iPLA2beta that participates in glucose-stimulated insulin secretion but is not involved in membrane phospholipid remodeling. Additionally, recent studies reveal that iPLA2beta is involved in pathways that contribute to beta-cell proliferation and apoptosis, and that various phospholipid-derived mediators are involved in these processes. Detailed characterization of the enzyme suggests that the beta-cells express multiple isoforms of iPLA2beta, and we hypothesize that these participate in different cellular functions.

Evidence that group VIA cytosolic calcium-independent phospholipase A(2) (iPLA(2)beta) participates in beta-cell signal transduction includes the observations that inhibition of iPLA(2)beta with the bromoenol lactone suicide substrate suppresses glucose-stimulated insulin secretion and that overexpression of iPLA(2)beta amplifies insulin secretory responses in INS-1 insulinoma cells. Immunofluorescence analyses also reveal that iPLA(2)beta accumulates in the perinuclear region of INS-1 cells stimulated with glucose and forskolin. To characterize this phenomenon further, iPLA(2)beta was expressed as a fusion protein with enhanced green fluorescent protein (EGFP) in INS-1 cells so that movements of iPLA(2)beta are reflected by changes in the subcellular distribution of green fluorescence. Stimulation of INS-1 cells overexpressing iPLA(2)beta-EGFP induced greater insulin secretion and punctate accumulation of iPLA(2)beta-EGFP fluorescence in the perinuclear region. To determine the identity of organelles with which iPLA(2)beta might associate, colocalization of green fluorescence with fluorophores associated with specific trackers targeted to different subcellular organelles was examined. Such analyses reveal association of iPLA(2)beta-EGFP fluorescence with the ER and Golgi compartments. Arachidonate-containing plasmenylethanolamine phospholipid species are abundant in beta-cell endoplasmic reticulum (ER) and are excellent substrates for iPLA(2)beta. Arachidonic acid produced by iPLA(2)beta-catalyzed hydrolysis of their substrates induces release of Ca(2+) from ER stores-an event thought to participate in glucose-stimulated insulin secretion.

Group VIA phospholipase A2 (iPLA2β) is expressed in phagocytes, vascular cells, pancreatic islet β-cells, neurons, and other cells and plays roles in transcriptional regulation, cell proliferation, apoptosis, secretion, and other events. A bromoenol lactone (BEL) suicide substrate used to study iPLA2β functions inactivates iPLA2β by alkylating Cys thiols. Because thiol redox reactions are important in signaling and some cells that express iPLA2β produce biological oxidants, iPLA2β might be subject to redox regulation. We report that biological concentrations of H2O2, NO, and HOCl inactivate iPLA2β, and this can be partially reversed by dithiothreitol (DTT). Oxidant-treated iPLA2β modifications were studied by LC−MS/MS analyses of tryptic digests and included DTT-reversible events, e.g., formation of disulfide bonds and sulfenic acids, and others not so reversed, e.g., formation of sulfonic acids, Trp oxides, and Met sulfoxides. W460 oxidation could cause irreversible inactivation because it is near the lipase consensus sequence (463GTSTG467), and site-directed mutagenesis of W460 yields active mutant enzymes that exhibit no DTT-irreversible oxidative inactivation. Cys651-sulfenic acid formation could be one DTT-reversible inactivation event because Cys651 modification correlates closely with activity loss and its mutagenesis reduces sensitivity to inhibition. Intermolecular disulfide bond formation might also cause reversible inactivation because oxidant-treated iPLA2β contains DTT-reducible oligomers, and oligomerization occurs with time- and temperature-dependent iPLA2β inactivation that is attenuated by DTT or ATP. Subjecting insulinoma cells to oxidative stress induces iPLA2β oligomerization, loss of activity, and subcellular redistribution and reduces the rate of release of arachidonate from phospholipids. These findings raise the possibility that redox reactions affect iPLA2β functions.

Infection with human immunodeficiency virus (HIV) and treatment with HIV-protease inhibitor (PI)-based highly active antiretroviral therapies (HAART) is associated with dysregulated fatty acid and lipid metabolism. Enhanced lipolysis, increased circulating fatty acid levels, and hepatic and intramuscular lipid accumulation appear to contribute to insulin resistance in HIV-infected people treated with PI-based HAART. However, it is unclear whether currently prescribed HIV-PIs directly alter skeletal muscle fatty acid transport, oxidation, and storage. We find that ritonavir (r, 5micromol/l) plus 20micromol/l of atazanavir (ATV), lopinavir (LPV), or darunavir (DRV) reduce palmitate oxidation(16-21%) in differentiated C2C12 myotubes. Palmitate oxidation was increased following exposure to high fatty acid media but this effect was blunted when myotubes were pre-exposed to the HIV-PIs. However, LPV/r and DRV/r, but not ATV/r suppressed palmitate uptake into myotubes. We found no effect of the HIV-PIs on FATP1, FATP4, or FABPpm but both CD36/FAT and carnitine palmitoyltransferase 1 (CPT1) were reduced by all three regimens though ATV/r caused only a small decrease in CPT1, relative to LPV/r or DRV/r. In contrast, sterol regulatory element binding protein-1 was increased by all 3 HIV-PIs. These findings suggest that HIV-PIs suppress fatty acid oxidation in murine skeletal muscle cells and that this may be related to decreases in cytosolic- and mitochondrial-associated fatty acid transporters. HIV-PIs may also directly impair fatty acid handling and partitioning in skeletal muscle, and this may contribute to the cluster of metabolic complications that occur in people living with HIV.

Over the past decade, important roles for the 84-88kDa Group VIA Ca(2+)-independent phospholipase A(2) (iPLA(2)beta) in various organs have been described. We demonstrated that iPLA(2)beta participates in insulin secretion, insulinoma cells and native pancreatic islets express full-length and truncated isoforms of iPLA(2)beta, and certain stimuli promote perinuclear localization of iPLA(2)beta. To gain a better understanding of its mobilization, iPLA(2)beta was expressed in INS-1 cells as a fusion protein with EGFP, enabling detection of subcellular localization of iPLA(2)beta by monitoring EGFP fluorescence. Cells stably-transfected with fusion protein expressed nearly 5-fold higher catalytic iPLA(2)beta activity than control cells transfected with EGFP cDNA alone, indicating that co-expression of EGFP does not interfere with manifestation of iPLA(2)beta activity. Dual fluorescence monitoring of EGFP and organelle Trackers combined with immunoblotting analyses revealed expression of truncated iPLA(2)beta isoforms in separate subcellular organelles. Exposure to secretagogues and induction of ER stress are known to activate iPLA(2)beta in beta-cells and we find here that these stimuli promote differential localization of iPLA(2)beta in subcellular organelles. Further, mass spectrometric analyses identified iPLA(2)beta variants from which N-terminal residues were removed. Collectively, these findings provide evidence for endogenous proteolytic processing of iPLA(2)beta and redistribution of iPLA(2)beta variants in subcellular compartments. It might be proposed that in vivo processing of iPLA(2)beta facilitates its participation in multiple biological processes.

Abstract Type 1 diabetes (T1D) results from autoimmune destruction of islet β-cells, but the underlying mechanisms that contribute to this process are incompletely understood, especially the role of lipid signals generated by β-cells. Proinflammatory cytokines induce ER stress in β-cells and we previously found that the Ca2+-independent phospholipase A2β (iPLA2β) participates in ER stress-induced β-cell apoptosis. In view of reports of elevated iPLA2β in T1D, we examined if iPLA2β participates in cytokine-mediated islet β-cell apoptosis. We find that the proinflammatory cytokine combination IL-1β+IFNγ, induces: a) ER stress, mSREBP-1, and iPLA2β, b) lysophosphatidylcholine (LPC) generation, c) neutral sphingomyelinase-2 (NSMase2), d) ceramide accumulation, e) mitochondrial membrane decompensation, f) caspase-3 activation, and g) β-cell apoptosis. The presence of a sterol regulatory element in the iPLA2β gene raises the possibility that activation of SREBP-1 after proinflammatory cytokine exposure contributes to iPLA2β induction. The IL-1β+IFNγ-induced outcomes (b–g) are all inhibited by iPLA2β inactivation, suggesting that iPLA2β-derived lipid signals contribute to consequential islet β-cell death. Consistent with this possibility, ER stress and β-cell apoptosis induced by proinflammatory cytokines are exacerbated in islets from RIP-iPLA2β-Tg mice and blunted in islets from iPLA2β-KO mice. These observations suggest that iPLA2β-mediated events participate in amplifying β-cell apoptosis due to proinflammatory cytokines and also that iPLA2β activation may have a reciprocal impact on ER stress development. They raise the possibility that iPLA2β inhibition, leading to ameliorations in ER stress, apoptosis, and immune responses resulting from LPC-stimulated immune cell chemotaxis, may be beneficial in preserving β-cell mass and delaying/preventing T1D evolution.

Phospholipases A2 (PLA2s) catalyze hydrolysis of the sn-2 substituent from glycerophospholipids to yield a free fatty acid (i.e., arachidonic acid), which can be metabolized to pro- or anti-inflammatory eicosanoids. Macrophages modulate inflammatory responses and are affected by Ca2+-independent phospholipase A2 (PLA2)β (iPLA2β). Here, we assessed the link between iPLA2β-derived lipids (iDLs) and macrophage polarization. Macrophages from WT and KO (iPLA2β-/-) mice were classically M1 pro-inflammatory phenotype activated or alternatively M2 anti-inflammatory phenotype activated, and eicosanoid production was determined by ultra-performance LC ESI-MS/MS. As a genotypic control, we performed similar analyses on macrophages from RIP.iPLA2β.Tg mice with selective iPLA2β overexpression in β-cells. Compared with WT, generation of select pro-inflammatory prostaglandins (PGs) was lower in iPLA2β-/- , and that of a specialized pro-resolving lipid mediator (SPM), resolvin D2, was higher; both changes are consistent with the M2 phenotype. Conversely, macrophages from RIP.iPLA2β.Tg mice exhibited an opposite landscape, one associated with the M1 phenotype: namely, increased production of pro-inflammatory eicosanoids (6-keto PGF1α, PGE2, leukotriene B4) and decreased ability to generate resolvin D2. These changes were not linked with secretory PLA2 or cytosolic PLA2α or with leakage of the transgene. Thus, we report previously unidentified links between select iPLA2β-derived eicosanoids, an SPM, and macrophage polarization. Importantly, our findings reveal for the first time that β-cell iPLA2β-derived signaling can predispose macrophage responses. These findings suggest that iDLs play critical roles in macrophage polarization, and we posit that they could be targeted therapeutically to counter inflammation-based disorders.

Type 1 diabetes (T1D) is a consequence of autoimmune β cell destruction, but the role of lipids in this process is unknown. We previously reported that activation of Ca2+-independent phospholipase A2β (iPLA2β) modulates polarization of macrophages (MΦ). Hydrolysis of the sn-2 substituent of glycerophospholipids by iPLA2β can lead to the generation of oxidized lipids (eicosanoids), pro- and antiinflammatory, which can initiate and amplify immune responses triggering β cell death. As MΦ are early triggers of immune responses in islets, we examined the impact of iPLA2β-derived lipids (iDLs) in spontaneous-T1D prone nonobese diabetic mice (NOD), in the context of MΦ production and plasma abundances of eicosanoids and sphingolipids. We find that (a) MΦNOD exhibit a proinflammatory lipid landscape during the prediabetic phase; (b) early inhibition or genetic reduction of iPLA2β reduces production of select proinflammatory lipids, promotes antiinflammatory MΦ phenotype, and reduces T1D incidence; (c) such lipid changes are reflected in NOD plasma during the prediabetic phase and at T1D onset; and (d) importantly, similar lipid signatures are evidenced in plasma of human subjects at high risk for developing T1D. These findings suggest that iDLs contribute to T1D onset and identify select lipids that could be targeted for therapeutics and, in conjunction with autoantibodies, serve as early biomarkers of pre-T1D.

Insulin secretion by pancreatic islet β-cells is impaired in diabetes mellitus, and normal β-cells are enriched in phospholipids with arachidonate as sn-2 substituent. Such molecules may play structural roles in exocytotic membrane fusion or serve as substrates for phospholipases activated by insulin secretagogues. INS-1 insulinoma cells respond to secretagogues and permit the study of effects of culture with free fatty acids on phospholipid composition and secretion. INS-1 cell glycerophosphocholine (GPC) and glycerophosphoethanolamine (GPE) lipids are demonstrated here by electrospray ionization mass spectrometry to contain a lower fraction of molecules with arachidonate and a higher fraction with oleate as sn-2 substituent than native islets. Palmitic acid supplementation induces little change in these INS-1 cell lipids, but supplementation with linoleate or arachidonate induces a large rise in the fraction of INS-1 cell GPC species with polyunsaturated sn-2 substituents and a fall in oleate-containing species to yield a GPC profile similar to native islets. The fraction of GPE lipids comprised of plasmenylethanolamine species with polyunsaturated sn-2 substituents in early-passage INS-1 cells is similar to that of islets, but declines on serial passage. Such molecules might participate in exocytotic membrane fusion, and late-passage INS-1 cells have reduced insulin secretory responses. Arachidonate supplementation induces a rise in the fraction of INS-1 cell GPE lipids with polyunsaturated sn-2 substituents and partially restores responses to insulin secretagogues by late-passage INS-1 cells, but does not further amplify secretion by early-passage cells. Effects of extracellular free fatty acids on β-cell phospholipid composition and secretory responses could be involved in changes in β-cell function during the period of hyper-free fatty acidemia that precedes diabetes mellitus.

Accumulating evidence suggests that the cytosolic calcium-independent phospholipase A(2) (iPLA(2)beta) manifests a signaling role in insulin-secreting (INS-1) beta-cells. Earlier, we reported that insulin-secretory responses to cAMP-elevating agents are amplified in iPLA(2)beta-overexpressing INS-1 cells (Ma Z, Ramanadham S, Bohrer A, Wohltmann M, Zhang S, and Turk J. J Biol Chem 276: 13198-13208, 2001). Here, immunofluorescence, immunoaffinity, and enzymatic activity analyses are used to examine distribution of iPLA(2)beta in stimulated INS-1 cells in greater detail. Overexpression of iPLA(2)beta in INS-1 cells leads to increased accumulation of iPLA(2)beta in the nuclear fraction. Increasing glucose concentrations alone results in modest increases in insulin secretion, relative to parental cells, and in nuclear accumulation of the iPLA(2)beta protein. In contrast, cAMP-elevating agents induce robust increases in insulin secretion and in time-dependent nuclear accumulation of iPLA(2)beta fluorescence, which is reflected by increases in nuclear iPLA(2)beta protein content and specific enzymatic activity. The stimulated effects are significantly attenuated in the presence of cell-permeable inhibitors of protein phosphorylation and glycosylation. These findings suggest that conditions that amplify insulin secretion promote translocation of beta-cell iPLA(2)beta to the nuclei, where it may serve a crucial signaling role.

Previous investigations in our laboratory revealed subsensitivity of right ventricular tissue, isolated from one month STZ-diabetic rats, to the inotropic effects of isoproterenol. The present study was concerned with the characterization of this subsensitivity phenomenon. Observations of supersensitivity to methoxamine accompanied by decreased responsiveness to glucagon without a change in responsiveness to forskolin suggested a specific effect of diabetes on pathways involving receptor-mediated activation of adenylate cyclase. Radioligand binding analysis further revealed a specific decrease in the population of the high affinity state of the β-adrenoceptor. Since the high affinity receptor state is a necessary intermediate for adenylate cyclase activation and enhanced myocardial contractility, it is proposed that the specific decrease in the high affinity population of the β-adrenoceptor contributes to myocardial subsensitivity to isoproterenol observed in the diabetic animals. It is further proposed that the decrease in receptor population is related to increases in circulating epinephrine levels which were evident in the diabetic animals.

Diabetes is a consequence of reduced β-cell function and mass, due to β-cell apoptosis. Endoplasmic reticulum (ER) stress is induced during β-cell apoptosis due to various stimuli, and our work indicates that group VIA phospholipase A₂β (iPLA₂β) participates in this process. Delineation of underlying mechanism(s) reveals that ER stress reduces the anti-apoptotic Bcl-x(L) protein in INS-1 cells. The Bcl-x pre-mRNA undergoes alternative pre-mRNA splicing to generate Bcl-x(L) or Bcl-x(S) mature mRNA. We show that both thapsigargin-induced and spontaneous ER stress are associated with reductions in the ratio of Bcl-x(L)/Bcl-x(S) mRNA in INS-1 and islet β-cells. However, chemical inactivation or knockdown of iPLA₂β augments the Bcl-x(L)/Bcl-x(S) ratio. Furthermore, the ratio is lower in islets from islet-specific RIP-iPLA₂β transgenic mice, whereas islets from global iPLA₂β^−/− mice exhibit the opposite phenotype. In view of our earlier reports that iPLA₂β induces ceramide accumulation through neutral sphingomyelinase 2 and that ceramides shift the Bcl-x 5′-splice site (5′SS) selection in favor of Bcl-x(S), we investigated the potential link between Bcl-x splicing and the iPLA₂β/ceramide axis. Exogenous C₆-ceramide did not alter Bcl-x 5′SS selection in INS-1 cells, and neutral sphingomyelinase 2 inactivation only partially prevented the ER stress-induced shift in Bcl-x splicing. In contrast, 5(<i>S</i>)-hydroxytetraenoic acid augmented the ratio of Bcl-x(L)/Bcl-x(S) by 15.5-fold. Taken together, these data indicate that β-cell apoptosis is, in part, attributable to the modulation of 5′SS selection in the Bcl-x pre-mRNA by bioactive lipids modulated by iPLA₂β.

The field of bioactive lipids is ever expanding with discoveries of novel lipid molecules that promote human health. Adopting a lipidomic-assisted approach, two new families of previously unrecognized saturated hydroxy fatty acids (SHFAs), namely, hydroxystearic and hydroxypalmitic acids, consisting of isomers with the hydroxyl group at different positions, were identified in milk. Among the various regio-isomers synthesized, those carrying the hydroxyl at the 7- and 9-positions presented growth inhibitory activities against various human cancer cell lines, including A549, Caco-2, and SF268 cells. In addition, 7- and 9-hydroxystearic acids were able to suppress β-cell apoptosis induced by proinflammatory cytokines, increasing the possibility that they can be beneficial in countering autoimmune diseases, such as type 1 diabetes. 7-(R)-Hydroxystearic acid exhibited the highest potency both in cell growth inhibition and in suppressing β-cell death. We propose that such naturally occurring SHFAs may play a role in the promotion and protection of human health.

Stimulation of pancreatic islets with d-glucose induces insulin secretion from secretory granules contained within the islet β-cells. Accumulating evidence suggests that secretory phospholipases A2 (sPLA2) may play a role in the distal events of secretory processes in many different cell types. Since intact pancreatic islets have been reported to contain sPLA2, it was of interest to determine the cellular and subcellular localization of the sPLA2 enzymes in pancreatic islets. Our findings indicate that rat pancreatic islets express mRNA for both types IB and IIA sPLA2 enzymes and mRNA for an sPLA2 membrane receptor. Immunoblotting analyses with antibodies directed against type IB sPLA2 or against type IIA sPLA2 indicate that the type IB isoform is much more abundant than the type IIA isoform in islets. Studies with purified populations of islet β-cells prepared from dispersed islet cells by fluorescence-activated cell sorting indicate that both sPLA2 activity and type IB sPLA2 immunoreactive protein are substantially more abundant in β-cells than in non-β-cells. Subcellular fractionation studies indicate that sPLA2 activity and type IB sPLA2 immunoreactive protein are contained in insulin secretory granules. Stimulation of intact islets with insulin secretagogues results in the co-secretion of insulin and of sPLA2 activity and type IB sPLA2 immunoreactive protein into the incubation medium. These findings raise the possibility that type IB sPLA2 participates in the secretory process of pancreatic islet β-cells.

We have previously reported that pancreatic islet β-cells and clonal HIT insulinoma cells express an ATP-stimulatable Ca2+-independent phospholipase A2 (ASCI-PLA2) enzyme and that activation of this enzyme appears to participate in glucose-stimulated insulin secretion. To further examine this hypothesis, glucose-responsitivity and expression of ASCI-PLA2 activity in various insulinoma cell lines were examined. Secretagogue-stimulated insulin secretion was observed with βTC6-f7 and early passage (EP)-βTC6 cells. In contrast, RIN-m5f, βTC3, and late passage (LP)-βTC6 cells exhibited little secretagogue-induced secretion. A haloenollactone suicide substrate (HELSS) which inhibits ASCI-PLA2 activity ablated secretagogue-induced insulin secretion from βTC6-f7 and EP-βTC6 cells. All insulinoma cell lines studied expressed both cytosolic and membrane-associated Ca2+-independent PLA2 activities which were inhibited by HELSS. The cytosolic enzymatic activity in the glucose-responsive βTC6-f7 and EP-βTC6 cells was activated by ATP and protected against thermal denaturation by ATP, but this was not the case in the glucose-unresponsive RIN-m5f, βTC3, or LP-βTC6 cells. Comparison of the distribution of Ca2+-independent PLA2 activity revealed that membrane-associated activity was higher than cytosolic activity in βTC6-f7 and EP-βTC6 cells but not in RIN-m5f, βTC3, or LP-βTC6 cells. Insensitivity of cytosolic activity to ATP may prevent association of the PLA2 activity with membrane substrates and contribute to attenuated glucose-responsitivity in the RIN-m5f, βTC3, or LP-βTC6 cells. HIT insulinoma cells were also found to undergo a decline in both glucose-responsitivity and membrane-associated Ca2+-independent PLA2 activity upon serial passage in culture, and this was associated with a reduction in membrane content of arachidonate-containing phospholipids. These and previous results suggest that the ATP-stimulatable PLA2 enzyme may participate in glucose-induced insulin secretion.

The Zucker diabetic fatty (ZDF) rat is a genetic model of type II diabetes mellitus in which males homozygous for nonfunctional leptin receptors (fa/fa) develop obesity, hyperlipidemia, and hyperglycemia, but rats homozygous for normal receptors (+/+) remain lean and normoglycemic. Insulin resistance develops in young fa/fa rats and is followed by evolution of an insulin secretory defect that triggers hyperglycemia. Because insulin secretion and insulin sensitivity are affected by membrane phospholipid fatty acid composition, we have determined whether metabolic abnormalities in fa/fa rats are associated with changes in tissue phospholipids. Electrospray ionization mass spectrometric analyses of glycerophosphocholine (GPC) and glycerophosphoethanolamine (GPE) molecular species from tissues of prediabetic (6 wk of age) and overtly diabetic (12 wk) fa/fa rats and from +/+ rats of the same ages indicate that arachidonate-containing species from heart, aorta, and liver of prediabetic fa/fa rats made a smaller contribution to GPC total ion current than was the case for +/+ rats. There was a correspondingly larger contribution from species with sn-2 oleate or linoleate substituents in fa/fa heart and aorta. The relative contributions of arachidonate-containing GPC species increased in these tissues as fa/fa rats aged and were equal to or greater than those for +/+ rats by 12 wk. For heart and aorta, relative contributions from GPE species with sn-2 arachidonate or docosahexaenoate substituents to the total ion current increased and those from species with sn-2 oleate or linoleate substituents fell as fa/fa rats aged, but these tissue lipid profiles changed little with age in +/+ rats. GPC and GPE profiles for brain, kidney, sciatic nerve, and red blood cells were similar among fa/fa and +/+ rats at 6 and 12 wk of age, and pancreatic islets from fa/fa and +/+ rats exhibited similar GPC and GPE profiles at 12 wk of age. Under-representation of arachidonate-containing GPC and GPE species in some fa/fa rat tissues at 6 wk could contribute to insulin resistance, but depletion of islet arachidonate-containing GPC and GPE species is unlikely to explain the evolution of the insulin secretory defect that is well-developed by 12 wk of age.

An isoform of glyceraldehyde-3-phosphate dehydrogenase (GAPDH) isolated and purified from rabbit brain cytosol has previously been demonstrated to catalyze membrane fusion (Glaser and Gross, Biochemistry 33 (1994) 5805–5812; Glaser and Gross, Biochemistry 34 (1995) 12193–12203). Herein, we provide evidence suggesting that this GAPDH isoform can reconstitute in vitro protein-catalyzed fusion between naturally occurring subcellular membrane fractions involved in insulin exocytosis. Utilizing purified rat pancreatic β-cell plasma membranes and secretory granules, we show that a brain cytosolic factor catalyzed the rapid and efficient fusion of these two purified membrane fractions which could be inhibited by a monoclonal antibody directed against the brain isoform of GAPDH. Moreover, the brain cytosolic factor also catalyzed the fusion of reconstituted vesicles prepared from lipid extracts of islet plasma membranes and secretory granules. Although the brain cytosolic factor rapidly catalyzed membrane fusion between islet plasma membranes and secretory granules, it did not catalyze fusion between one secretory granule population with another. To identify the potential importance of brain cytosolic factor catalyzed membrane fusion in islet cells, we examined extracts of hamster insulinoma tumor cells (HIT cells) for fusion-catalyzing activity. A protein constituent was present in HIT cell cytosol which was immunologically similar to the rabbit brain GAPDH isoform. Although native HIT cell cytosol did not catalyze membrane fusion, removal of an endogenous protein inhibitor unmasked the presence of the protein which catalyzed membrane fusion activity and such fusion was ablated by a monoclonal antibody directed against the brain isoform of GAPDH. Collectively, these results suggest the possibility that an isoform of brain GAPDH, also evident in HIT cells, can catalyze fusion between the two naturally occurring subcellular membrane compartments involved in insulin secretion and suggest a novel paradigm potentially coupling glycolytic flux with insulin release.

Pancreatic islets stimulated with D-glucose are known to liberate arachidonic acid from membrane phospholipids and release prostaglandin E2 (PGE2). A component of the eicosanoid release induced by D-glucose has been demonstrated to occur without calcium influx and must be triggered by other coupling mechanisms. In this study, we have attempted to identify mechanisms other than calcium influx which might couple D-glucose stimulation to hydrolysis of arachidonate from membrane phospholipids in islet cells. We have found that occupancy of the beta cell plasma membrane D-glucose transporter is insufficient and that D-glucose metabolism is required to induce islet PGE2 release because 3-O-methylglucose fails to induce and mannoheptulose prevents PGE2 release otherwise induced by 17 mM D-glucose. The carbohydrate insulin secretagogues mannose and D-glyceraldehyde have also been found to induce islet PGE2 release, but the non-secretagogue carbohydrates L-glucose and lactate do not. Carbohydrate secretagogues are known to be metabolized to yield ATP and induce depolarization of the beta cell plasma membrane. We have found that depolarization by 40 mM KCl induces PGE2 release only in the presence and not in the absence of extracellular calcium, but exogenous ATP induces islet PGE2 release with or without extracellular calcium. Carbachol is demonstrated here to interact synergistically with increasing concentrations of glucose to amplify PGE2 release and insulin secretion. Pertussis toxin treatment is shown here not to prevent PGE2 release induced by glucose or carbachol but to increase the basal rate of PGE2 release and the islet cyclic AMP content. Theophylline (10 mM) exerts similar effects. Eicosanoid release in pancreatic islets can thus be activated by multiple pathways including muscarinic receptor occupancy, calcium influx, increasing cAMP content, and a metabolic signal derived from nutrient secretagogues, such as ATP.

One month after streptozotocin treatment, basal rate in spontaneously beating right atria was decreased and basal developed force in electrically-driven right ventricular tissue was increased. Atrial sensitivity to the chronotropic effects of isoproterenol was not altered. In contrast, sensitivity in ventricular tissue to the inotropic effects of isoproterenol was decreased while sensitivity to calcium was increased. Associated with these changes was a decrease in myocardial beta-adrenoceptor density. Data obtained 3 and 6 months after streptozotocin treatment were similar to the observed alterations at 1 month. These results suggest that alterations in the chronotropic and inotropic responses that are expressed within 1 month after streptozotocin treatment do not significantly progress during the 6 months following induction of diabetes. They therefore reveal the independence of myocardial alterations from age of the animal and duration of diabetes (up to 6 months).

The beta-isoform of group VIA calcium-independent phospholipase A(2) (iPLA(2)beta) does not require calcium for activation, is stimulated by ATP, and is sensitive to inhibition by a bromoenol lactone suicide substrate. Several potential functions have been proposed for iPLA(2)beta. Our studies indicate that iPLA(2)beta is expressed in beta-cells and participates in glucose-stimulated insulin secretion but is not involved in membrane phospholipid remodeling. If iPLA(2)beta plays a signaling role in glucose-stimulated insulin secretion, then conditions that impair iPLA(2)beta functions might contribute to the diminished capacity of beta-cells to secrete insulin in response to glucose, which is a prominent characteristic of type 2 diabetes. Our recent studies suggest that iPLA(2)beta might also participate in beta-cell proliferation and apoptosis and that various phospholipid-derived mediators are involved in these processes. Detailed characterization of the iPLA(2)beta protein level reveals that beta-cells express multiple isoforms of the enzyme, and our studies involve the hypothesis that different isoforms have different functions.

Bovine parathyroid hormone and its N-terminal (1–34) peptide fragment (bPTH-(1–34)) are known to possess direct hypotensive activity in the rat. The purpose of the present study was to determine if bPTH-(1–34) possessed a direct chronotropic action as well. In vivo studies revealed that bPTH-(1–34) did produce a chronotropic effect in the rat comprising both a direct component as well as a reflex tachycardia related to its hypotensive actions. In vitro studies of isolated right atria indicated that while bPTH-(1–34) had no positive inotropic effect, it did produce significant chronotropic effects which were direct and dose-dependent. The potency of bPTH-(1–34) was found to be similar to that of isoproterenol, however, it was only one-third as effective as isoproterenol in maximally increasing atrial rate. A slight but significant increase in atrial cyclic AMP was generated prior to the chronotropic actions of bPTH-(1–34).

Streptozotocin (65 mg/kg) was used to induce diabetes in male Sprague-Dawley rats. Isolated cardiac tissue exhibited a systematic depression in atrial pacemaker function and an enhancement in ventricular function accompanied by a supersensitivity to calcium relative to control animals. beta-Adrenoceptor density was found to be significantly lowered in the treated animals. However, no change in responsiveness of the tissues to isoproterenol was observed. The systematic changes in atria and ventricle were found to be completely and partially reversed respectively, by daily administration of 4-5 units of Ultralente (U-100) insulin, whereas the decrease in beta-adrenoceptor number and supersensitivity to calcium were completely reversed. These results suggest that STZ by itself might not have toxic effects in the heart and that its effects may be overcome by chronic insulin-replacement.

Among the phospholipases A2 (PLA2s) are the group VI Ca2+-independent PLA2s (iPLA2s), and expression of multiple transcripts of iPLA2 in skeletal muscle has been reported. In the present study, phospholipase activity and sequential ATP and calmodulin affinity column chromatography analyses reveal that skeletal muscle iPLA2 exhibits properties characteristic of the iPLA2β isoform. The phospholipase activity of iPLA2β has been demonstrated to participate in signal transduction, cell proliferation, and apoptosis. We report here that skeletal muscle from iPLA2β-null mice, relative to wild-type muscle, exhibits a reduced capacity to oxidize palmitate but not palmitoyl-CoA or acetyl-CoA in the absence of changes in fatty acid transporters CD36 and CPT1 or β-hydroxyacyl-CoA dehydrogenase activity. Recently, purified iPLA2β was demonstrated to manifest a thioesterase activity which catalyzes hydrolysis of fatty acyl-CoAs. The liberated CoA-SH facilitates fatty acid transport into the mitochondria. In this regard, we find that fractions eluted from the ATP column and containing iPLA2β phospholipase activity also contained acyl-CoA thioesterase activity that was inhibited by the bromoenol lactone (BEL) suicide inhibitor of iPLA2β. We further find that acyl-CoA thioesterase activity in skeletal muscle preparations from iPLA2β-null mice is significantly reduced, relative to WT activity. These findings suggest that the absence of acyl-CoA thioesterase activity of iPLA2β can lead to reduced fatty acyl-CoA generation and impair fatty acid oxidation in iPLA2β-null mice. Our findings therefore reveal a novel function of iPLA2β, related not to its phospholipase activity but to its thioesterase activity, which contributes to optimal fatty acid oxidation in skeletal muscle.

Earlier studies suggest that the accumulation of non-esterified arachidonic acid (AA) in islets following stimulation with glucose participates in the glucose-induced secretion of insulin. A possible role for AA might include the facilitation of Ca2+ influx into islet beta-cells. Recently, we demonstrated that AA induces Ca2+ influx into purified rat pancreatic islet beta-cells, prepared by fluorescence-activated cell sorting (FACS). This effect was abolished in the presence of the Ca(2+)-chelator EGTA, but was only partially reduced by the dihydropyridine (DHP) L-type Ca(2+)-channel blocker, nifedipine. This raised the possibility that DHP-insensitive Ca2+ entry mechanisms may exist in pancreatic beta-cells, in addition to the known DHP-sensitive L-type Ca2+ channels. Here we report that omega-conotoxin (CTX), which blocks omega-type Ca(2+)-channels, inhibits AA-induced Ca2+ influx by a magnitude similar to that of nifedipine and that the combination of omega-CTX and nifedipine results in a nearly additive decrement in AA-induced increases in beta-cell cytosolic [Ca2+]. We further demonstrate that bovine serum albumin, which complexes free AA and prevents AA-induced increases in cytosolic [Ca2+], also inhibits the glucose-induced increase in beta-cell [Ca2+]. These results suggest that rat pancreatic FACS-purified islet beta-cells express omega-type (DHP-insensitive) Ca(2+)-channels, in addition to DHP-sensitive Ca(2+)-channels. They further suggest that the glucose-induced accumulation of non-esterified AA in the membranes of beta-cells serves to amplify glucose-mediated Ca2+ influx into the beta-cells.

Using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), we have developed a simple method to isolate myosin heavy chain (MHC) and actin from small (60–80 mg) human skeletal muscle samples for the determination of their fractional synthesis rates. The amounts of MHC and actin isolated are adequate for the quantification of [ 13 C]leucine abundance by gas chromatography-combustion-isotope ratio mass spectrometry (GC-C-IRMS). Fractional synthesis rates of mixed muscle protein (MMP), MHC, and actin were determined in six healthy young subjects (27 ± 1 yr) after they received a 14-h intravenous infusion (prime = 7.58 μmol/kg body wt, constant infusion = 7.58 μmol ⋅ kg body wt −1 ⋅ h −1 ) of [1- 13 C]leucine. The fractional synthesis rates of MMP, MHC, and actin were found to be 0.0468 ± 0.0048, 0.0376 ± 0.0033, and 0.0754 ± 0.0078%/h, respectively. Overall, the synthesis rate of MHC was 20% lower ( P = 0.012), and the synthesis rate of actin was 61% higher ( P = 0.060, not significant) than the MMP synthesis rate. The isolation of these proteins for isotope abundance analysis by GC-C-IRMS provides important information about the synthesis rates of these specific contractile proteins, as opposed to the more general information provided by the determination of MMP synthesis rates.

In the evolution of Type II diabetes, an initial period of hyper-fatty acidemia leads to an insulin secretory defect which triggers overt hyperglycemia and frank diabetes. The mechanism by which elevated free fatty acids contribute to beta-cell dysfunction, however, is not clearly understood. We recently reported that arachidonic acid (20:4) or linoleic acid (18:2) supplementations result in increases in abundances of long chain polyunsaturated fatty acids in INS-1 beta-cell membrane lipids, suggesting that beta-cells express desaturases that catalyze generation of unsaturated fatty acids. As expression of desaturases by beta-cells has not yet been addressed, we initiated studies to examine this issue using INS-1 beta-cells and find that they express messages for the Delta6-, stearoyl CoA-, and Delta5-desaturase. Supplementation of the INS-1 beta-cells with arachidonic acid leads to decreased expression of all three desaturases, presumably in response to the decreased need for endogenous generation of unsaturated fatty acids. In contrast, linoleic acid supplementation promoted minimal changes in the three desaturases. These findings demonstrate for the first time that beta-cells express regulatable desaturases. Additionally, reverse transcriptase-polymerase chain reaction analyses reveal expression of the desaturases in native pancreatic islets. It might be speculated that long-term elevations in fatty acids can also adversely influence desaturase activity in beta-cells and affect PUFA composition in beta-cell membranes contributing to beta-cell membrane structural abnormalities and altered secretory function.

Summary: Streptozotocin-induced diabetes has previously been shown to alter the sensitivity and responsiveness of rat myocardial tissues to cardiotonic agonists. The objective of the present study was to determine if these alterations were due to the diabetogenic or possible direct cardiotoxic effects of streptozotocin. One month after streptozotocin treatment the following changes were observed in the rat: decrease in body weight; elevation of blood glucose and glycosylated hemoglobin levels; decrease in spontaneously beating atrial rate; elevation in basal developed force of electrically driven right ventricle; and inotropic subsensitivity of right ventricle to isoproterenol, which was associated with decreased β-adrenoceptor density and supersensitivity to calcium. Pretreatment with the nonmetabolizable glucose analog 3-O-methyl glucose prevented these alterations. Chronic insulin replenishment also reversed the effects of streptozotocin, with the exception of complete normalization of elevations in blood glucose and basal developed force. Acute exposure to high glucose in the medium preserved the subsensitivity to isoproterenol but resulted in an elevated basal developed force in both control and streptozotocin groups. These observations indicate that myocardial alterations after streptozotocin treatment are not the result of direct cardiotoxic effects but rather a consequence of the drug-induced diabetic state. They also suggest that the increase in basal developed force might be related to elevated glucose concentrations.

Responses in cardiac tissue isolated from streptozotocin (STZ)-treated and age-matched control rats to isoproterenol (ISO) and calcium were studied. 4 weeks after STZ, atrial function was found to be depressed, whereas right ventricular function was enhanced. Neither tissue exhibited an alteration in sensitivity to ISO. In contrast, while sensitivity to calcium was found to be unaltered in atrial tissue, supersensitivity to calcium was observed in ventricles after STZ treatment. β-Adrenoceptor number determination revealed a 36% decrease in Bmax with no change in affinity after STZ treatment. These results suggest that 4 weeks after STZ treatment pacemaker function is depressed, while enhancement in ventricular function is associated with an alteration in calcium utilization.

The integrity of the Golgi and trans-Golgi network (TGN) is disrupted by brefeldin A (BFA), which inhibits the Golgi-localized BFA-sensitive factor (GBF1) and brefeldin A-inhibited guanine nucleotide-exchange factors (BIG1 and BIG2). Using a cellular replacement assay to assess GBF1 functionality without interference from the BIGs, we show that GBF1 alone maintains Golgi architecture; facilitates secretion; activates ADP-ribosylation factor (ARF)1, 3, 4, and 5; and recruits ARF effectors to Golgi membranes. Unexpectedly, GBF1 also supports TGN integrity and recruits numerous TGN-localized ARF effectors. The impact of the catalytic Sec7 domain (Sec7d) on GBF1 functionality was assessed by swapping it with the Sec7d from ARF nucleotide-binding site opener (ARNO)/cytohesin-2, a plasma membrane GEF reported to activate all ARFs. The resulting chimera (GBF1-ARNO-GBF1 [GARG]) targets like GBF1, supports Golgi/TGN architecture, and facilitates secretion. However, unlike GBF1, GARG activates all ARFs (including ARF6) at the Golgi/TGN and recruits additional ARF effectors to the Golgi/TGN. Our results have general implications: 1) GEF's targeting is independent of Sec7d, but Sec7d influence the GEF substrate specificity and downstream effector events; 2) all ARFs have access to all membranes, but are restricted in their distribution by the localization of their activating GEFs; and 3) effector association with membranes requires the coincidental presence of activated ARFs and specific membrane identifiers.

To examine the role of group VIA phospholipase A2 (iPLA2β) in specific cell lineages in insulin secretion and insulin action, we prepared mice with a selective iPLA2β deficiency in cells of myelomonocytic lineage, including macrophages (MØ-iPLA2β-KO), or in insulin-secreting β-cells (β-Cell-iPLA2β-KO), respectively. MØ-iPLA2β-KO mice exhibited normal glucose tolerance when fed standard chow and better glucose tolerance than floxed-iPLA2β control mice after consuming a high-fat diet (HFD). MØ-iPLA2β-KO mice exhibited normal glucose-stimulated insulin secretion (GSIS) in vivo and from isolated islets ex vivo compared to controls. Male MØ-iPLA2β-KO mice exhibited enhanced insulin responsivity vs. controls after a prolonged HFD. In contrast, β-cell-iPLA2β-KO mice exhibited impaired glucose tolerance when fed standard chow, and glucose tolerance deteriorated further when introduced to a HFD. β-Cell-iPLA2β-KO mice exhibited impaired GSIS in vivo and from isolated islets ex vivo vs. controls. β-Cell-iPLA2β-KO mice also exhibited an enhanced insulin responsivity compared to controls. These findings suggest that MØ iPLA2β participates in HFD-induced deterioration in glucose tolerance and that this mainly reflects an effect on insulin responsivity rather than on insulin secretion. In contrast, β-cell iPLA2β plays a role in GSIS and also appears to confer some protection against deterioration in β-cell functions induced by a HFD.

Glucose-induced insulin secretion from pancreatic islets requires metabolism of glucose within islet beta-cells, and ATP has attracted interest as a messenger of glucose metabolism within beta-cells. Glucose-induced insulin secretion from islets and HIT insulinoma cells is accompanied by activation of an ATP-stimulatable Ca(2+)-independent phospholipase A2 (ASCI-PLA2) enzyme, the catalytic activity of which resides in a 40 kDa protein. An analogous PLA2 enzyme in myocardium was recently found to consist of a complex of a 40 kDa catalytic protein with a tetramer of an isoform of the glycolytic enzyme phosphofructokinase (PFK). Association of the PFK isoform with the myocardial PLA2 catalytic protein was found to confer ATP sensitivity onto the enzyme complex. Here we demonstrate that the majority of HIT cell and islet ASCI-PLA2 catalytic activity elutes from a gel filtration column in a region corresponding to 400 kDa, suggesting that the 40 kDa beta-cell ASCI-PLA2 catalytic protein exists as part of a larger molecular mass complex. Islet and HIT cell ASCI-PLA2 activities were immunoprecipitated by antibodies directed against PFK, and the immunoprecipitates contained 40 and 85 kDa proteins which correspond to the molecular masses of the PLA2 catalytic protein and of a PFK monomer, respectively. Islet and HIT cell ASCI-PLA2 activities were selectively and reversibly adsorbed to affinity matrices containing immobilized PFK but not to similar matrices containing immobilized transferrin or bovine serum albumin. Addition of free PFK prevented binding of HIT cell ASCI-PLA2 activity to immobilized PFK matrices and promoted desorption of activity previously bound to such matrices. These results suggest that beta-cell ASCI-PLA2, like the myocardial enzyme, exists as a complex comprised of a catalytic protein and a PFK-like protein and raise the possibility that the ASCI-PLA2 complex may represent a component of the beta-cell glucose sensor, which links glycolysis, phospholipid hydrolysis, and membrane electrochemical events involved in glucose-induced insulin secretion.

Dysregulation of proteolytic processing of the amyloid precursor protein (APP) contributes to the pathogenesis of Alzheimer's Disease, and the Group VIA phospholipase A(2) (iPLA(2)beta) is the dominant PLA(2) enzyme in the central nervous system and is subject to regulatory proteolytic processing. We have identified novel N-terminal variants of iPLA(2)beta and previously unrecognized proteolysis sites in APP constructs with a C-terminal 6-myc tag by automated identification of signature peptides in LC/MS/MS analyses of proteolytic digests. We have developed a Signature-Discovery (SD) program to characterize protein isoforms by identifying signature peptides that arise from proteolytic processing in vivo. This program analyzes MS/MS data from LC analyses of proteolytic digests of protein mixtures that can include incompletely resolved components in biological samples. This reduces requirements for purification and thereby minimizes artifactual modifications during sample processing. A new algorithm to generate the theoretical signature peptide set and to calculate similarity scores between predicted and observed mass spectra has been tested and optimized with model proteins. The program has been applied to the identification of variants of proteins of biological interest, including APP cleavage products and iPLA(2)beta, and such applications demonstrate the utility of this approach.

Effective energy expenditure is critical for maintaining body weight (BW). However, underlying mechanisms contributing to increased BW remain unknown. We characterized the role of brain angiogenesis inhibitor-3 (BAI3/ADGRB3), an adhesion G-protein coupled receptor (aGPCR), in regulating BW. A CRISPR/Cas9 gene editing approach was utilized to generate a whole-body deletion of the BAI3 gene (BAI3-/-). In both BAI3-/- male and female mice, a significant reduction in BW was observed compared to BAI3+/+ control mice. Quantitative magnetic imaging analysis showed that lean and fat masses were reduced in male and female mice with BAI3 deficiency. Total activity, food intake, energy expenditure (EE), and respiratory exchange ratio (RER) were assessed in mice housed at room temperature using a Comprehensive Lab Animal Monitoring System (CLAMS). While no differences were observed in the activity between the two genotypes in male or female mice, energy expenditure was increased in both sexes with BAI3 deficiency. However, at thermoneutrality (30 °C), no differences in energy expenditure were observed between the two genotypes for either sex, suggesting a role for BAI3 in adaptive thermogenesis. Notably, in male BAI3-/- mice, food intake was reduced, and RER was increased, but these attributes remained unchanged in the female mice upon BAI3 loss. Gene expression analysis showed increased mRNA abundance of thermogenic genes Ucp1, Pgc1α, Prdm16, and Elov3 in brown adipose tissue (BAT). These outcomes suggest that adaptive thermogenesis due to enhanced BAT activity contributes to increased energy expenditure and reduced BW with BAI3 deficiency. Additionally, sex-dependent differences were observed in food intake and RER. These studies identify BAI3 as a novel regulator of BW that can be potentially targeted to improve whole-body energy expenditure.

Impaired glucose tolerance (IGT) and β-cell dysfunction in insulin resistance associated with obesity lead to type 2 diabetes (T2D). Glucose-stimulated insulin secretion (GSIS) from β-cells occurs via a canonical pathway that involves glucose metabolism, ATP generation, inactivation of KATP channels, plasma membrane depolarization, and increases in cytosolic concentrations of [Ca2+]c. However, optimal insulin secretion requires amplification of GSIS by increases in cyclic adenosine monophosphate (cAMP) signaling. The cAMP effectors protein kinase A (PKA) and exchange factor activated by cyclic-AMP (Epac) regulate membrane depolarization, gene expression, and trafficking and fusion of insulin granules to the plasma membrane for amplifying GSIS. The widely recognized lipid signaling generated within β-cells by the β-isoform of Ca2+-independent phospholipase A2 enzyme (iPLA2β) participates in cAMP-stimulated insulin secretion (cSIS). Recent work has identified the role of a G-protein coupled receptor (GPCR) activated signaling by the complement 1q like-3 (C1ql3) secreted protein in inhibiting cSIS. In the IGT state, cSIS is attenuated, and the β-cell function is reduced. Interestingly, while β-cell-specific deletion of iPLA2β reduces cAMP-mediated amplification of GSIS, the loss of iPLA2β in macrophages (MØ) confers protection against the development of glucose intolerance associated with diet-induced obesity (DIO). In this article, we discuss canonical (glucose and cAMP) and novel noncanonical (iPLA2β and C1ql3) pathways and how they may affect β-cell (dys)function in the context of impaired glucose intolerance associated with obesity and T2D. In conclusion, we provide a perspective that in IGT states, targeting noncanonical pathways along with canonical pathways could be a more comprehensive approach for restoring β-cell function in T2D. © 2023 American Physiological Society. Compr Physiol 13:5023-5049, 2023.

Extracellular vesicles play major roles in cell-to-cell communication and are excellent biomarker candidates. However, studying plasma extracellular vesicles is challenging due to contaminants. Here, we performed a proteomics meta-analysis of public data to refine the plasma EV composition by separating EV proteins and contaminants into different clusters. We obtained two clusters with a total of 1717 proteins that were depleted of known contaminants and enriched in EV markers with independently validated 71% true-positive. These clusters had 133 clusters of differentiation (CD) antigens and were enriched with proteins from cell-to-cell communication and signaling. We compared our data with the proteins deposited in PeptideAtlas, making our refined EV protein list a resource for mechanistic and biomarker studies. As a use case example for this resource, we validated the type 1 diabetes biomarker proplatelet basic protein in EVs and showed that it regulates apoptosis of β cells and macrophages, two key players in the disease development. Our approach provides a refinement of the EV composition and a resource for the scientific community.

Abstract Sphingolipid metabolism is dysregulated in many cancers, allowing cells to evade apoptosis through increased sphingosine-1-phosphate (S1P) and decreased ceramides. Ceramidases hydrolyze ceramides to sphingosine, which is phosphorylated by sphingosine kinases to generate S1P. The S1P allows cells to evade apoptosis by shifting the equilibrium away from ceramides, which favor cell death. One tumor type that exhibits a shift in the sphingolipid balance towards S1P is glioblastoma (GBM), a highly aggressive brain tumor. GBMs almost always recur despite surgical resection, radiotherapy, and chemotherapy with temozolomide (TMZ). Understanding sphingolipid metabolism in GBM is still limited, and currently, there are no approved treatments to target dysregulation of sphingolipid metabolism in GBM. Carmofur, a derivative of 5-fluorouracil, inhibits acid ceramidase (ASAH1), a key enzyme in the production of S1P, and is in use outside the USA to treat colorectal cancer. We find that the mRNA for ASAH1 , but not other ceramidases, is elevated in recurrent GBM. When TMZ-resistant GBM cells were treated with carmofur, decreased cell growth and increased apoptosis were observed along with cell cycle perturbations. RNA-sequencing identified decreases in cell cycle control pathways that were specific to TMZ-resistant cells. Furthermore, the transcription factor and G1 to S phase regulator, E2F8, was upregulated in TMZ-resistant versus parental GBM cells and inhibited by carmofur treatment in TMZ-resistant GBM cells, specifically. These data suggest a possible role for E2F8 as a mediator of carmofur effects in the context of TMZ resistance. These data suggest the potential utility of normalizing the sphingolipid balance in the context of recurrent GBM.

Culture of rat pancreatic islets with interleukin-1 (IL-1) results in up-regulation of the inducible isoform of nitric oxide synthase and overproduction of nitric oxide (NO). This is associated with reversible inhibition of both glucose-induced insulin secretion and islet glucose oxidation, and these effects are prevented by the inducible nitric oxide synthase inhibitorN G-monomethylarginine. IL-1 also induces accumulation of nonesterified arachidonic acid in islets by an NO-dependent mechanism, and one potential explanation for that effect would involve an IL-1-induced enhancement of islet glycolytic flux. We have therefore examined effects of IL-1 on islet glycolytic utilization of glucose and find that culture of islets with IL-1 in medium containing 5.5 mm glucose results in suppression of islet glucose utilization subsequently measured at glucose concentrations between 6 and 18 mm. The IL-1-induced suppression of islet glucose utilization is associated with a decline in islet glucokinase mRNA content, as determined by competitive reverse transcriptase-polymerase chain reaction, and in glucokinase protein synthesis, as determined by immuoprecipitation experiments, and all of these effects are prevented byN G-monomethylarginine. These findings suggest that IL-1 can down-regulate islet glucokinase, which is the primary component of the islet glucose-sensor apparatus, by an NO-dependent mechanism. Because reductions in islet glucokinase levels are known to cause a form of type II diabetes mellitus, these observations raise the possibility that factors which increase islet NO levels might contribute to development of glucose intolerance. Culture of rat pancreatic islets with interleukin-1 (IL-1) results in up-regulation of the inducible isoform of nitric oxide synthase and overproduction of nitric oxide (NO). This is associated with reversible inhibition of both glucose-induced insulin secretion and islet glucose oxidation, and these effects are prevented by the inducible nitric oxide synthase inhibitorN G-monomethylarginine. IL-1 also induces accumulation of nonesterified arachidonic acid in islets by an NO-dependent mechanism, and one potential explanation for that effect would involve an IL-1-induced enhancement of islet glycolytic flux. We have therefore examined effects of IL-1 on islet glycolytic utilization of glucose and find that culture of islets with IL-1 in medium containing 5.5 mm glucose results in suppression of islet glucose utilization subsequently measured at glucose concentrations between 6 and 18 mm. The IL-1-induced suppression of islet glucose utilization is associated with a decline in islet glucokinase mRNA content, as determined by competitive reverse transcriptase-polymerase chain reaction, and in glucokinase protein synthesis, as determined by immuoprecipitation experiments, and all of these effects are prevented byN G-monomethylarginine. These findings suggest that IL-1 can down-regulate islet glucokinase, which is the primary component of the islet glucose-sensor apparatus, by an NO-dependent mechanism. Because reductions in islet glucokinase levels are known to cause a form of type II diabetes mellitus, these observations raise the possibility that factors which increase islet NO levels might contribute to development of glucose intolerance. Culture of rat pancreatic islets with interleukin-1 (IL-1) 1The abbreviations used are: IL-1, interleukin-1; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; KRB, Krebs-Ringer bicarbonate buffer; MEM, modified Eagle's medium; MODY, maturity-onset diabetes of the young; NMMA,N G-monomethylarginine; NO, nitric oxide; PAGE, polyacrylamide gel electrophoresis; PBS, phosphate-buffered saline; PCR, polymerase chain reaction; RT, reverse transcriptase; bp, base pair(s). induces islet expression of the inducible isoform of nitric oxide synthase and overproduction of nitric oxide (NO) (1Corbett J.A. Wang J.L. Hughes J.A. Wolf B.A. Sweetland M.A. Lancaster J.A. McDaniel M.L. Biochem. J. 1992; 287: 229-235Crossref PubMed Scopus (136) Google Scholar, 2Corbett J.A. Wang J.L. Sweetland M.A. Lancaster J.L. McDaniel M.L. J. Clin. Invest. 1992; 90: 2384-2391Crossref PubMed Scopus (301) Google Scholar, 3Delaney C.A. Green M.L. Lowe J.E. Green I.C. FEBS Lett. 1993; 333: 291-296Crossref PubMed Scopus (138) Google Scholar, 4Corbett J.A. Sweetland M.A. Wang J.L. Lancaster J.R. McDaniel M.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1731-1735Crossref PubMed Scopus (408) Google Scholar, 5Kaneto H. Fuji J. Seo H.G. Suzuki K. Matsuoka T. Nakamura M. Tatsumi H. Yamasaki Y. Kamada T. Taniguchi N. Diabetes. 1995; 44: 733-738Crossref PubMed Scopus (374) Google Scholar, 6Ma Z. Ramanadham S. Corbett J.A. Bohrer A. Gross R.W. McDaniel M.L. Turk J. J. Biol. Chem. 1996; 271: 1029-1042Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). This is associated with inhibition of glucose-induced insulin secretion (7Comens P.G. Wolf B.A. Unanue E.R. Lacy P.E. McDaniel M.L. Diabetes. 1987; 36: 963-970Crossref PubMed Scopus (145) Google Scholar, 8Sandler S. Andersson A. Hellerstrom C. Endocrinology. 1987; 121: 1424-1431Crossref PubMed Scopus (286) Google Scholar, 9Eizirik D.L. Sandler S. Hallberg A. Brendtzen K. Sener A. Malaisse W.J. Endocrinology. 1989; 125: 752-759Crossref PubMed Scopus (57) Google Scholar, 10Sandler S. Bendtzen K. Borg L.A.K. Eizirik D.L. Strandell E. Welsh N. Endocrinology. 1989; 124: 1492-1501Crossref PubMed Scopus (112) Google Scholar) and impaired islet oxidation of glucose (8Sandler S. Andersson A. Hellerstrom C. Endocrinology. 1987; 121: 1424-1431Crossref PubMed Scopus (286) Google Scholar, 9Eizirik D.L. Sandler S. Hallberg A. Brendtzen K. Sener A. Malaisse W.J. Endocrinology. 1989; 125: 752-759Crossref PubMed Scopus (57) Google Scholar, 10Sandler S. Bendtzen K. Borg L.A.K. Eizirik D.L. Strandell E. Welsh N. Endocrinology. 1989; 124: 1492-1501Crossref PubMed Scopus (112) Google Scholar, 11Eizirik D.L. Acta Endocrinol. ( Copenhagen ). 1988; 119: 321-325Crossref PubMed Scopus (81) Google Scholar, 12Welsh N. Bendtzen K. Sandler S. Diabetes. 1991; 40: 290-294Crossref PubMed Scopus (32) Google Scholar), and both of these effects are prevented by the inducible nitric oxide synthase inhibitorN G-monomethylarginine (NMMA) (1Corbett J.A. Wang J.L. Hughes J.A. Wolf B.A. Sweetland M.A. Lancaster J.A. McDaniel M.L. Biochem. J. 1992; 287: 229-235Crossref PubMed Scopus (136) Google Scholar, 2Corbett J.A. Wang J.L. Sweetland M.A. Lancaster J.L. McDaniel M.L. J. Clin. Invest. 1992; 90: 2384-2391Crossref PubMed Scopus (301) Google Scholar, 4Corbett J.A. Sweetland M.A. Wang J.L. Lancaster J.R. McDaniel M.L. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 1731-1735Crossref PubMed Scopus (408) Google Scholar), indicating that they occur through NO-dependent mechanisms. We have recently reported that IL-1 also induces accumulation of nonesterified arachidonic acid in islets by an NO-dependent mechanism (6Ma Z. Ramanadham S. Corbett J.A. Bohrer A. Gross R.W. McDaniel M.L. Turk J. J. Biol. Chem. 1996; 271: 1029-1042Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Our findings suggested that this reflected suppression of re-esterification of arachidonic acid released during phospholipid turnover, but others have found that NO stimulates arachidonic acid release from macrophage-like cells by a mechanism involving accelerated glycolytic flux (13Gross R.W. Rudolph A.E. Wang J. Sommers C.D. Wolf M.J. J. Biol. Chem. 1995; 270: 14855-14858Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar). This has been attributed to activation of a macrophage phospholipase A2 enzyme that is regulated by an isoform of the glycolytic enzyme phosphofructokinase (13Gross R.W. Rudolph A.E. Wang J. Sommers C.D. Wolf M.J. J. Biol. Chem. 1995; 270: 14855-14858Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar, 14Hazen S.L. Zupan L.A. Weiss R.H. Getman D.P. Gross R.W. J. Biol. Chem. 1991; 266: 7227-7232Abstract Full Text PDF PubMed Google Scholar, 15Hazen S.L. Gross R.W. J. Biol. Chem. 1991; 266: 14526-14534Abstract Full Text PDF PubMed Google Scholar, 16Hazen S.L. Gross R.W. J. Biol. Chem. 1993; 268: 9892-9900Abstract Full Text PDF PubMed Google Scholar). Because islets express a similar phospholipase A2 enzyme (17Gross R. Ramanadham S. Kruszka K. Han X. Turk J. Biochemistry. 1993; 32: 327-336Crossref PubMed Scopus (114) Google Scholar, 18Biochemistry 33, 7442–7452Ramanadham, S., Wolf, M., Jett, P. A., Gross, R. W. & Turk, J.Biochemistry, 33, 7442–7452.Google Scholar, 19Ramanadham S. Wolf M. Ma Z. Li B. Wang J. Gross R. Turk J. Biochemistry. 1996; 35: 5464-5471Crossref PubMed Scopus (22) Google Scholar), it seemed possible that NO-induced acceleration of glycolytic flux might also contribute to IL-1 induced accumulation of nonesterified arachidonic acid in islets. We have therefore examined effects of culturing islets with IL-1 on islet glycolytic utilization of glucose, as reflected by production of [3H]OH from [5-3H]glucose (20Ashcroft S.J.H. Weerasinghe C.C. Bassett J.M. Randle P.J. Biochem. J. 1972; 126: 525-532Crossref PubMed Scopus (252) Google Scholar, 21Pace C.S. Ellerman J. Hover B.A. Stillings S.N. Matschinsky F.M. Diabetes. 1975; 24: 476-488Crossref PubMed Scopus (17) Google Scholar, 22Malaisse W.J. Levy J. Sener A. Herchuelz A. Acta Diabet. Lat. 1976; 13: 202-215Crossref PubMed Scopus (56) Google Scholar, 23Zawalich W.S. Matschinsky F.M. Endocrinology. 1977; 100: 1-8Crossref PubMed Scopus (53) Google Scholar, 24Hakan L.A. Eide S.J. Andersson A. Hellerstrom C. Biochem. J. 1979; 182: 797-802Crossref PubMed Scopus (34) Google Scholar, 25Zawalich W.S. Karl I.C. Matschinsky F.M. Diabetologia. 1979; 16: 115-120Crossref PubMed Scopus (9) Google Scholar, 26Trus M.D. Zawalich W.S. Burch P.T. Berner D.K. Weill V.A. Matschinsky F.M. Diabetes. 1981; 30: 911-922Crossref PubMed Google Scholar, 27Meglasson M.D. Matschinksy F.M. Diabetes/Metabolism Rev. 1986; 2: 163-214Crossref PubMed Scopus (445) Google Scholar, 28Eizirik D.L. Sandler S. Sener A. Malaisse W.J. Endocrinology. 1988; 123: 1001-1007Crossref PubMed Scopus (45) Google Scholar), and on expression of glucokinase mRNA by competitive PCR. Male Sprague-Dawley rats (180–220 g body weight) were purchased from Sasco (O'Fallon, MO); collagenase from Boehringer Mannheim; tissue culture medium (CMRL-1066), penicillin, streptomycin, Hanks' balanced salt solution, heat-inactivated fetal bovine serum, and l-glutamine from Life Technologies, Inc. (Grand Island, NY); Pentex bovine serum albumin (fatty acid free, fraction V) from Miles Laboratories (Elkhart, IN); Rodent Chow 5001 from Ralston Purina (St. Louis, MO); d-glucose from the National Bureau of Standards (Washington, D.C.); IL-1β from Cistron Biotechnology (Pine Brook, NJ);N G-monomethyl-l-arginine acetate from Calbiochem (San Diego, CA); and Trans35S-labeled methionine (1117 Ci/mmol) from ICN (Costa Mesa, CA). Media included KRB (Krebs-Ringer bicarbonate buffer: 25 mm HEPES, pH 7.4, 115 mm NaCl, 24 mm NaHCO3, 5 mm KCl, 2.5 mm CaCl2, 1 mm MgCl2), nKRB (KRB supplemented with 3 mmd-glucose), cCMRL-1066 (CMRL-1066 supplemented with 10% heat-inactivated fetal bovine serum, 1% l-glutamine and 1% (w/v) each of penicillin and streptomycin), and Hank's balanced salt solution supplemented with 0.5% penicillin-streptomycin. Islets were isolated aseptically from male Sprague-Dawley rats by a described procedure (29McDaniel M.L. Colca J.R. Kotagal N. Lacy P.E. Methods Enzymol. 1983; 98: 182-200Crossref PubMed Scopus (123) Google Scholar) involving collagenase digestion of excised, minced pancreas, density gradient isolation, and manual selection under microscopic visualization. Isolated islets were transferred into Falcon Petri dishes containing 2.5 ml of cCMRL-1066, placed under an atmosphere of 95% air, 5% CO2, and cultured at 37 °C with or without IL-1 or other additives. Islets (400 per condition) were placed in Petri dishes (10 × 35 mm); suspended in cCMRL medium (1 ml) containing no additives, IL-1 (5 units/ml) alone, or both IL-1 and NMMA (0.5 mm); and incubated (2–48 h, 37 °C). In some experiments, islets were then removed from the incubation medium, and their secretion of insulin, oxidation of [U-14C]glucose to [14C]O2, or production of [3H]OH from [5-3H]glucose was examined in a subsequent incubation. In such experiments, islets were washed 3 times in nKRB, transferred to siliconized test tubes (12 × 75 mm), and preincubated (30 min, 37 °C) in nKRB (0.2 ml). For insulin secretion experiments, islets were placed in fresh in KRB medium containing various concentrations (3–18 mm) of d-glucose and incubated (30 min, 37 °C, under 95% air, 5% CO2). Aliquots of medium were then removed for measurement of insulin by radioimmunoassay. As in previously described procedures (20Ashcroft S.J.H. Weerasinghe C.C. Bassett J.M. Randle P.J. Biochem. J. 1972; 126: 525-532Crossref PubMed Scopus (252) Google Scholar, 25Zawalich W.S. Karl I.C. Matschinsky F.M. Diabetologia. 1979; 16: 115-120Crossref PubMed Scopus (9) Google Scholar), triplicate batches of 10 islets per incubation condition were placed into Microfuge tubes (0.5 ml). Medium was then removed, and radioactive mixture (15 μl) was added. This mixture was prepared by placing [5-3H]glucose (7 μl, Amersham, specific activity 1 mCi/ml) into silanized glass test tubes and concentrating the solution to dryness under nitrogen to evaporate any [3H]OH. The desired final glucose concentrations (3–18 mm) of the radioactive mixtures were achieved by adding various volumes (0–167 μl) of glucose-free KRB containing 1% bovine serum albumin and an appropriate corresponding volume (33–200 μl) of KRB containing 18 mm glucose and 1% bovine serum albumin. The total initial amount of [3H] added to each condition was determined by adding 15 μl of each radioactive mixture directly to scintillation vials containing water (0.5 ml). For blank incubations, radioactive mixture was added, but no islets were present. After all additions were complete, tubes containing the islets were placed in scintillation vials (20 ml) containing water (0.5 ml). The vials were then flushed with 95% air, 5% CO2, capped with Teflon/silicone septum lids, and incubated (1 h, 37 °C, shaking water bath). A Hamilton syringe was then used to introduce 1n HCl (20 μl) into the islet-containing tubes to prevent further catabolism of [5-3H]glucose. Vials containing these tubes were then incubated (24 h, 37 °C) to permit [3H]OH formed by the islets to evaporate and equilibrate with water in the vials. Vials were then cooled to room temperature. The Microfuge tubes were removed and their exterior surfaces rinsed with scintillation fluid (12 ml), which was placed in the vial containing the water in which the Microfuge tube had been immersed. The scintillation vial was then capped with the original septum-lid and mixed. The vials were then equilibrated in the dark, and their3H-content was measured by liquid scintillation spectrometry. Average disintegrations/min in blank tubes was subtracted from experimental measurements, and glucose utilization was calculated as: [{[3H]OH formed (dpm)}/{(specific radioactivity of [5-3H]glucose (dpm/pmol)}]. As in previously described procedures (30McDaniel M.L. King S. Anderson S. Fink J. Lacy P.E. Diabetologia. 1974; 10: 303-308PubMed Google Scholar, 31Hughes J.H. Easom R.A. Wolf B.A. Turk J. McDaniel M.L. Diabetes. 1989; 38 (Second Ed.): 1251-1257Crossref PubMed Scopus (0) Google Scholar), islets (30 from each incubation condition) were placed into Beckman polyallomer tubes. After centrifugation (Beckman Microfuge, 5 s, 10,000 × g), supernatant was discarded, and the islets were resuspended in fresh medium (nKRB, 0.2 ml) and preincubated (30 min, 37 °C). Islets were then collected by centrifugation, supernatant discarded, and KRB medium (0.15 ml) containing various concentrations (3–18 mm) of [U-14C]glucose was added. After resuspension of the islets, the polyallomer tubes were placed in scintillation vials containing filter paper covering the bottom of the vial. The vials were then equilibrated with 95% air, 5% CO2, sealed with lids containing gas-tight Teflon/silicone septa, and incubated (2 h, 37 °C, shaking water bath) to permit islet metabolism of [14C]glucose to [14C]O2. Hyamine base (0.2 ml) was then applied to the filter paper in the vials with a Hamilton syringe by penetrating the septa. Islet metabolism of [14C]glucose was then terminated and dissolved H[14C]O3− converted to [14C]O2 by acidifying (0.2 n HCl, 0.2 ml) the medium inside the polyallomer tube. The sealed vials were then incubated (overnight, room temperature, with shaking) to allow [14C]O2 to escape from the incubation solution and react with hyamine in the filter paper. The polyallomer tubes were then removed from the vials and their exterior surfaces rinsed with scintillation fluid (1 ml, ACS, Amersham), which was placed inside the scintillation vial. Additional scintillation fluid (9 ml) was added to each vial, and the 14C-content was measured by liquid scintillation spectrometry. Total 14C- content of the stock [U-14C]glucose solution and blank conversion of [U-14C]glucose to [14C]O2without islets were also determined. After incubation of islets under various conditions, total RNA was isolated after solubilization in guanidinium thiocyanate by phenol/chloroform/isoamyl alcohol extraction and isopropyl alcohol precipitation (32Davis L.G. Kuehl L.G. Battey J.F. Basic Methods in Molecular Biology. Appleton & Lange, Norwalk, CT1994Google Scholar). First strand cDNA was transcribed from total RNA with avian myeloblastosis virus reverse transcriptase (reverse transcriptase, Boehringer Mannheim). Polymerase chain reactions (PCR) were performed on a Perkin-Elmer DNA Thermal Cycler 480. Primer pairs used to amplify fragments of cDNA encoding glucokinase (33Magnusson M.A. Shelton K.D. J. Biol. Chem. 1989; 264: 15936-15942Abstract Full Text PDF PubMed Google Scholar) in competitive PCR reactions are described below. Primer pairs used for other gene products were: inducible nitric oxide synthase (34Geng Y.J. Almqvist M. Hansson G.K. Biochim. Biophys. Acta. 1994; 1218: 421-424Crossref PubMed Scopus (63) Google Scholar), sense 5′-TGCTTTGTGCGGAGTGTCAG and antisense 5′-AGATGCTGTAACTCTTCTGG (expected fragment 650 bp); and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) (35Tso J.Y. Sun X.H. Kao T.H. Reece K.S. Wu R. Nucleic Acids Res. 1985; 13: 2502-2845Crossref Scopus (1811) Google Scholar), sense 5′-TAGACAAGATGGTGAAGG and antisense 5′-TCCTTGGAGGCCATGTAG (expected fragment length 1006 bp). Amplification steps (30 cycles) included denaturation (95 °C, 1 min), annealing (50 to 60 °C, 1 min), and extension (72 °C, 2 min) and were performed inTaq-polymerase buffer (Life Technologies, Inc.) containing 1.5 mm MgCl2, 1 μm of each primer, 200 μm each of dATP, dGTP, dCTP, and dTTP, and 25 units/ml Taq DNA polymerase (Life Technologies, Inc.). PCR products were analyzed by 1% agarose gel electrophoresis and visualized by ethidium bromide staining (32Davis L.G. Kuehl L.G. Battey J.F. Basic Methods in Molecular Biology. Appleton & Lange, Norwalk, CT1994Google Scholar). Band intensities of PCR products were measured with an IS-1000 Digital Imaging System (Alpha Innotech Corp.). Fluorescence was recorded, and the areas of the peaks were measured. Increased levels of inducible nitric oxide synthase mRNA in islets could be detected by RT-PCR after 4 h exposure to IL-1. Levels of islet GAPDH mRNA, as detected by RT-PCR, were constant in control and in IL-1-treated islets for up to 48 h in culture. To examine the potential amplification of genomic DNA in PCR reactions, a control amplification was performed in which the reverse transcriptase step was omitted. In no case was a PCR product of the expected length obtained under these conditions. Competitive RT-PCR (72Gilliland G. Perrin S. Blanchard K. Bunn H.F. Proc. Natl. Acad. Sci. 1990; 87: 2725-2729Crossref PubMed Scopus (1435) Google Scholar, 73Siebert P.D. Larrick J.W. Nature. 1992; 359: 557-558Crossref PubMed Scopus (664) Google Scholar) was used to determine the abundance of glucokinase mRNA. In this approach, a competitor DNA species is prepared which contains the same primer template sequences as the target cDNA but which contains an intervening sequence which differs from the target in size or in restriction sites so that PCR products from the target and competitor can be distinguished (72Gilliland G. Perrin S. Blanchard K. Bunn H.F. Proc. Natl. Acad. Sci. 1990; 87: 2725-2729Crossref PubMed Scopus (1435) Google Scholar, 73Siebert P.D. Larrick J.W. Nature. 1992; 359: 557-558Crossref PubMed Scopus (664) Google Scholar). Using the competitor as an internal control, amounts of target cDNA can be determined by allowing known amounts of the competitor to compete with the target for primer binding during amplification (72Gilliland G. Perrin S. Blanchard K. Bunn H.F. Proc. Natl. Acad. Sci. 1990; 87: 2725-2729Crossref PubMed Scopus (1435) Google Scholar, 73Siebert P.D. Larrick J.W. Nature. 1992; 359: 557-558Crossref PubMed Scopus (664) Google Scholar). To prepare the competitor DNA, two composite primers were synthesized (sense 5′-TCACAAGTGGAGAGCGACTCACTGGCATGGCCTTCCG-3′ and antisense 5′-ATTTGTGGTGTGTGGAGTCCTTGGAGGCCATGTAGGC-3′). These primers contain the glucokinase primer sequence (underlined) attached to sequences which hybridize to rat GAPDH cDNA (35Tso J.Y. Sun X.H. Kao T.H. Reece K.S. Wu R. Nucleic Acids Res. 1985; 13: 2502-2845Crossref Scopus (1811) Google Scholar). This pair of primers was then used in PCR reactions with rat GAPDH cDNA as template. In these reactions, the glucokinase primer sequences are incorporated into the PCR product during amplification, and the intervening sequence derives from GAPDH. The resultant PCR product (360 bp in length) was analyzed by agarose gel electrophoresis, isolated with a QIAEX gel extraction kit (QIAGEN), and used as the competitor DNA species in subsequent PCR experiments. In these experiments, the primer pair (sense 5′-TCACAAGTGGAGAGCGACTC-3′ and antisense 5′-ATTTGTGGTGTGTGGAGTCC-3′) was used. These primers hybridize to the glucokinase cDNA sequence and to the competitor DNA sequence. The PCR product derived from the glucokinase cDNA is 450 bp in length, and that from the competitor DNA is 360 bp in length. The products were then analyzed by 1% agarose gel electrophoresis and visualized with ethidium bromide. Product band intensity was then determined with an IS-1000 Digital Imaging System. The primer set selected for amplification of glucokinase cDNA will not yield a product of the appropriate size with genomic DNA as template. In the rat glucokinase gene (75Magnusson M.A. Andreone T.L. Printz K.L. Koch S. Glanner D.K. Proc. Natl. Acad. Sci. U. S. A. 1989; 86: 4838-4842Crossref PubMed Scopus (190) Google Scholar), the sequence recognized by the sense primer is interrupted by the intron between exons 8 and 9, and the sequence recognized by the antisense primer occurs in exon 10. The amplified sequence of the cDNA therefore includes 11 bp of exon 8, the entirety of exon 9, and a fragment of exon 10. The intervening intron sequences would cause any product amplified from glucokinase genomic DNA to be far larger than that from glucokinase cDNA. In addition, no products of the expected size were observed in control competitive PCR reactions in which the the reverse transcriptase step was omitted. The target glucokinase RT-PCR product was also subcloned and sequenced. The sequence corresponded exactly to the appropriate region of the glucokinase cDNA. With a fixed amount of target and competitor, varying the PCR cycle number from 19 to 31 was found to yield a constant relative intensity of the target and competitor PCR product bands. In subsequent experiments, 28 PCR cycles were used. To examine the relationship between the amount of input DNA and the ratio of the signals for the target and competitor, in one set of experiments the competitor DNA solution was serially diluted, and aliquots of each dilution were added to a reaction mixture containing a fixed amount of glucokinase cDNA. In a second set of experiments, a solution of target glucokinase cDNA was serially diluted, and aliquots of each dilution were added to a reaction mixture containing a fixed amount of competitor DNA. After PCR amplification, products were analyzed by agarose gel electrophoresis, and product band intensity was determined as above. The ratio of target to competitor product band intensities was found to correspond to the amount of input DNA over a wide range of concentrations. To determine the relative abundance of glucokinase mRNA in islets after incubation under various conditions, total RNA was isolated as described above, and its concentration was determined spectrophotometrically (260 nm). Equal measured amounts of RNA from each incubation condition were then used in competitive RT-PCR reactions with a fixed amount of competitor DNA, and the target to competitor ratio was determined as described above. Medium nitrite content was measured spectrophotometrically (540 nm, Titertek Multiskan MCC/340 microtiter plate reader) after mixing medium (0.1 ml) with Griess reagent (0.1 ml of a solution of 1 part of 1.32% sulfanilamide in 60% acetic acid and 1 part of 0.1% naphthylethylenediamine-HCl) and incubation (10 min, room temperature), as described previously (1Corbett J.A. Wang J.L. Hughes J.A. Wolf B.A. Sweetland M.A. Lancaster J.A. McDaniel M.L. Biochem. J. 1992; 287: 229-235Crossref PubMed Scopus (136) Google Scholar, 2Corbett J.A. Wang J.L. Sweetland M.A. Lancaster J.L. McDaniel M.L. J. Clin. Invest. 1992; 90: 2384-2391Crossref PubMed Scopus (301) Google Scholar). To generate an anti-glucokinase antiserum, a fusion protein was prepared which contained the sequence of Schistosoma japonicum glutathioneS-transferase joined to that of human islet glucokinase. The fusion protein was prepared in Escherichia coli transformed with pGEX vector and purified from E. coli homogenates by affinity chromatography on glutathione-agarose (36Smith D.B. Johnson J.S. Gene ( Amst. ). 1988; 67: 31-40Crossref PubMed Scopus (5261) Google Scholar). The protein was injected subcutaneously on multiple occasions into a female New Zealand White rabbit as an emulsion in Freund's adjuvant. Immunoprecipitation experiments with this antiserum were performed essentially as described previously (37Corbett J.A. Kwon G. Turk J. McDaniel M.L. Biochemistry. 1993; 32: 13767-13770Crossref PubMed Scopus (247) Google Scholar, 38Davis L. Kuehl M. Battey J. Basic Methods in Molecular Biology. Second Ed. Appleton & Lange, Norwalk, CT1994: 669-679Google Scholar). After incubation under various conditions, islets were washed 3 times in methionine-deficient MEM (9 parts MEM without methionine per 1 part MEM with methionine) and incubated (1 h, 37 °C) in methionine-deficient MEM. [35S]Methionine (100 μCi/ml) was then added, and the islets were incubated (3 h, 37 °C), harvested by centrifugation, washed (3 times, 0.1m PBS), and lysed (1 h, 4 °C) in PBS (1 ml) containing 1% Triton X-100, 0.5% deoxycholate, 0.1% SDS, 1 μg/ml aprotinin, 100 μg/ml phenylmethanesulfonyl fluoride, 1 μg/ml leupeptin, and 1 mm iodoacetamide. Cell debris was removed (centrifugation, 15 min, 10,000 × g, 4 °C), and the protein content of the supernatants was measured. Aliquots of supernatants from each condition containing identical measured amounts of protein were then diluted with lysis buffer to achieve a final volume of 800 μl. These solutions were then preincubated (2 h) with preimmune serum (10 μl) and precleared by treatment (1 h) with 100 μl of stapylococcal protein A (Immunoprecipitin, Life Technologies, Inc.) and centrifugation (1 min, 4 °C, 200 × g). Anti-glucokinase antiserum (5 μl) was then added to the supernatants, and the mixture was incubated (overnight, 4 °C, with shaking). Staphylococcal protein A (100 μl) was then added, and the mixture was incubated (2 h, 4 °C, with shaking). Staphylococcal protein A-antibody complexes were then isolated by centrifugation and washed four times with PBS (1 ml) containing 0.5% Triton X-100 and 0.05% SDS. The immunoprecipitates were then washed twice with 10 mm PBS, reconstituted in SDS sample mixture (30 μl, 0.25m Tris-HCl, 20% β-mercaptoethanol, 4% SDS), and boiled (5 min). After centrifugation, proteins in the supernatants were analyzed on 10% SDS-polyacrylamide gels and visualized by autoradiography (39Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (212847) Google Scholar). Isolated islets were incubated under conditions described above with no additions (control), with IL-1 (5 units/ml) alone, or with IL-1 plus NMMA (0.5 mm) for 24 h. The islets were then washed three times with MEM without methionine containing 5% fetal bovine serum and, after 1 h of incubation in methionine-deficient medium, were incubated (3 h) with [35S]methionine under conditions described above. The islets were then placed in 15-ml conical test tubes, washed three times with PBS to remove unincorporated [35S]methionine, and homogenized by sonication (Vibracell probe sonicator, 0.5-s bursts at 12% amplitude for 20 s, Sonics & Materials, Inc., Danbury, CT) in buffer A (50 mm Tris-HCl, pH 7.4, 0.15 m NaCl, 1 μg/ml leupeptin, 1 μg/ml aprotinin, 1 mmphenylmethanesulfonyl fluoride). The homogenates were transferred to 1.5-ml Microfuge tubes and centrifuged (15,000 rpm, 4 °C, 15 min, Beckman Microfuge). Aliquots (10 μl) of the supernatants were then placed on 2-mm square sections of Whatman filter paper and allowed to dry. The filter paper pieces were then boiled in 10% trichloroacetic acid for 10 min, rinsed twice with ice-cold 5% trichloroacetic acid, rinsed once with ice-cold absolute ethanol, allowed to dry, and then placed in scintill

The immunohistochemical distribution of arachidonate lipoxygenases in rat pancreas was characterized with specific polyclonal anti-5-lipoxygenase and anti-12-lipoxygenase antibodies. Immunohistochemical analysis of formaldehyde-fixed paraffin-embedded rat pancreas using anti-12-lipoxygenase antibody and biotin-avidin-peroxidase detection demonstrated specific staining of islets and no staining of pancreatic exocrine tissue. Less intense staining of pancreatic vascular myocytes and endothelial cells was also observed. Immunoblotting of isolated pancreatic islet extracts with the anti-12-lipoxygenase antibody demonstrated immunoperoxidase staining of a single protein band which comigrated with purified 12-lipoxygenase (relative molecular weight = 72,000) on sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis. Dispersed cells prepared from isolated islets and then subjected to fluorescence-activated cell sorting and immunostaining exhibited 12-lipoxygenase antigen in beta-cell populations but not in non-beta-cell (predominantly alpha-cell) populations. Assays of enzymatic activity confirmed that the 12-lipoxygenase-catalyzed conversion of arachidonic acid to 12-hydroxyeicosatetraenoic acid methyl ester occurred only with purified beta-cells and not with islet non-beta-cells. No evidence of 5-lipoxygenase antigen or enzymatic activity was found in purified beta-cells or in islet non-beta-cells. We conclude that rat pancreatic islet beta-cells contain an arachidonate 12-lipoxygenase which shares antigenic epitopes with the homologous enzyme contained in tissues from other species. In addition, the selective localization of the 12-lipoxygenase to pancreatic beta-cells and its absence in pancreatic acinar cells and in islet non-beta-cells support observations suggesting that 12-lipoxygenase products may participate in glucose-induced insulin secretion from beta-cells.

Brefeldin A (BFA) is a fungal metabolite best known for its ability to inhibit activation of ADP-ribosylation factor (Arf) and thereby inhibit secretory traffic. BFA also appears to regulate the trafficking of the GLUT4 glucose transporter by inducing its relocation from intracellular stores to the cell surface. Such redistribution of GLUT4 is normally regulated by insulin-mediated signaling. Hence, we tested whether BFA may intersect with the insulin pathway. We report that BFA causes the activation of the insulin receptor (IR), IRS-1, Akt-2, and AS160 components of the insulin pathway. The response is mediated through phosphoinositol-3-kinase (PI3K) and Akt kinase since the PI3K inhibitor wortmannin and the Akt inhibitors MK2206 and perifosine inhibit the BFA effect. BFA-mediated activation of the insulin pathway results in Akt-mediated phosphorylation of the insulin-responsive transcription factor FoxO1. This leads to nuclear exclusion of FoxO1 and a decrease in transcription of the insulin-responsive gene SIRT-1. Our findings suggest novel effects for BFA in signaling and transcription, and imply that BFA has multiple intracellular targets and can be used to regulate diverse cellular responses that include vesicular trafficking, signaling and transcription.

Ca2+-independent phospholipase A2 (GVIA iPLA2) has gained increasing interest recently as it has been recognized as a participant in biological processes underlying diabetes development and autoimmune-based neurological disorders. The development of potent GVIA iPLA2 inhibitors is of great importance because only a few have been reported so far. We present a novel class of GVIA iPLA2 inhibitors based on the β-lactone ring. This functionality in combination with a four-carbon chain carrying a phenyl group at position-3 and a linear propyl group at position-4 of the lactone ring confers excellent potency. trans-3-(4-Phenylbutyl)-4-propyloxetan-2-one (GK563) was identified as being the most potent GVIA iPLA2 inhibitor ever reported ( XI(50) 0.0000021, IC50 1 nM) and also one that is 22 000 times more active against GVIA iPLA2 than GIVA cPLA2. It was found to reduce β-cell apoptosis induced by proinflammatory cytokines, raising the possibility that it can be beneficial in countering autoimmune diseases, such as type 1 diabetes.