Sarah Edkins

Cancers arise owing to the accumulation of mutations in critical genes that alter normal programmes of cell proliferation, differentiation and death. As the first stage of a systematic genome-wide screen for these genes, we have prioritized for analysis signalling pathways in which at least one gene is mutated in human cancer. The RAS–RAF–MEK–ERK–MAP kinase pathway mediates cellular responses to growth signals1. RAS is mutated to an oncogenic form in about 15% of human cancer. The three RAF genes code for cytoplasmic serine/threonine kinases that are regulated by binding RAS1,2,3. Here we report BRAF somatic missense mutations in 66% of malignant melanomas and at lower frequency in a wide range of human cancers. All mutations are within the kinase domain, with a single substitution (V599E) accounting for 80%. Mutated BRAF proteins have elevated kinase activity and are transforming in NIH3T3 cells. Furthermore, RAS function is not required for the growth of cancer cell lines with the V599E mutation. As BRAF is a serine/threonine kinase that is commonly activated by somatic point mutation in human cancer, it may provide new therapeutic opportunities in malignant melanoma.

Cancers arise owing to mutations in a subset of genes that confer growth advantage. The availability of the human genome sequence led us to propose that systematic resequencing of cancer genomes for mutations would lead to the discovery of many additional cancer genes. Here we report more than 1,000 somatic mutations found in 274 megabases (Mb) of DNA corresponding to the coding exons of 518 protein kinase genes in 210 diverse human cancers. There was substantial variation in the number and pattern of mutations in individual cancers reflecting different exposures, DNA repair defects and cellular origins. Most somatic mutations are likely to be ‘passengers’ that do not contribute to oncogenesis. However, there was evidence for ‘driver’ mutations contributing to the development of the cancers studied in approximately 120 genes. Systematic sequencing of cancer genomes therefore reveals the evolutionary diversity of cancers and implicates a larger repertoire of cancer genes than previously anticipated. Over 350 cancer-causing genes have been identified by established techniques such as mapping, bioassay and by identifying plausible biological candidates. The availability of the human genome sequence now means that large-scale sequencing studies can uncover many more candidate cancer genes. Protein kinase enzymes are key to many regulatory processes and their dysfunction is a common trigger for tumours. So a sample of 518 kinases associated with more than 200 different cancers was chosen for a major sequencing effort. The study reveals more than 1, 000 previously unknown mutations linked to tumour formation — some as 'passengers' that don't contribute to cancer formation, but over 100 of them as 'driver' mutations that do contribute to disease development. As well as revealing cancer-causing defects, gene family studies like this can uncover new targets for molecular diagnostics and therapeutics. 518 protein kinase genes in the human genome have been sequenced in a large sample of tumours, providing a global view of the patterns of mutations found and the variations in the number and type of mutations between individual tumours.

Multiple sclerosis is a disease of the central nervous system that involves interplay between inflammation and neurodegeneration. Despite intensive study, much of the genetic architecture underlying susceptibility to the disease remains to be defined. A large, international, collaborative genome-wide association study involving almost 10,000 cases, all of European descent, has confirmed about 20 previously reported multiple-sclerosis-linked regions of DNA, and identified an additional 29 novel susceptibility loci. Further analysis implicates the differentiation of T-helper cells as particularly relevant to the pathogenesis of this disease. Multiple sclerosis is a common disease of the central nervous system in which the interplay between inflammatory and neurodegenerative processes typically results in intermittent neurological disturbance followed by progressive accumulation of disability1. Epidemiological studies have shown that genetic factors are primarily responsible for the substantially increased frequency of the disease seen in the relatives of affected individuals2,3, and systematic attempts to identify linkage in multiplex families have confirmed that variation within the major histocompatibility complex (MHC) exerts the greatest individual effect on risk4. Modestly powered genome-wide association studies (GWAS)5,6,7,8,9,10 have enabled more than 20 additional risk loci to be identified and have shown that multiple variants exerting modest individual effects have a key role in disease susceptibility11. Most of the genetic architecture underlying susceptibility to the disease remains to be defined and is anticipated to require the analysis of sample sizes that are beyond the numbers currently available to individual research groups. In a collaborative GWAS involving 9,772 cases of European descent collected by 23 research groups working in 15 different countries, we have replicated almost all of the previously suggested associations and identified at least a further 29 novel susceptibility loci. Within the MHC we have refined the identity of the HLA-DRB1 risk alleles and confirmed that variation in the HLA-A gene underlies the independent protective effect attributable to the class I region. Immunologically relevant genes are significantly overrepresented among those mapping close to the identified loci and particularly implicate T-helper-cell differentiation in the pathogenesis of multiple sclerosis.

Mark McCarthy, Michael Boehnke, Andrew Morris and colleagues perform large-scale association analyses using the Metabochip to gain insights into the genetic architecture of type 2 diabetes. They report several new susceptibility loci, including two that show sex-differentiated effects on disease risk. To extend understanding of the genetic architecture and molecular basis of type 2 diabetes (T2D), we conducted a meta-analysis of genetic variants on the Metabochip, including 34,840 cases and 114,981 controls, overwhelmingly of European descent. We identified ten previously unreported T2D susceptibility loci, including two showing sex-differentiated association. Genome-wide analyses of these data are consistent with a long tail of additional common variant loci explaining much of the variation in susceptibility to T2D. Exploration of the enlarged set of susceptibility loci implicates several processes, including CREBBP-related transcription, adipocytokine signaling and cell cycle regulation, in diabetes pathogenesis.

All cancers carry somatic mutations. A subset of these somatic alterations, termed driver mutations, confer selective growth advantage and are implicated in cancer development, whereas the remainder are passengers. Here we have sequenced the genomes of a malignant melanoma and a lymphoblastoid cell line from the same person, providing the first comprehensive catalogue of somatic mutations from an individual cancer. The catalogue provides remarkable insights into the forces that have shaped this cancer genome. The dominant mutational signature reflects DNA damage due to ultraviolet light exposure, a known risk factor for malignant melanoma, whereas the uneven distribution of mutations across the genome, with a lower prevalence in gene footprints, indicates that DNA repair has been preferentially deployed towards transcribed regions. The results illustrate the power of a cancer genome sequence to reveal traces of the DNA damage, repair, mutation and selection processes that were operative years before the cancer became symptomatic.

Using the ImmunoChip custom genotyping array, we analyzed 14,498 subjects with multiple sclerosis and 24,091 healthy controls for 161,311 autosomal variants and identified 135 potentially associated regions (P < 1.0 × 10(-4)). In a replication phase, we combined these data with previous genome-wide association study (GWAS) data from an independent 14,802 subjects with multiple sclerosis and 26,703 healthy controls. In these 80,094 individuals of European ancestry, we identified 48 new susceptibility variants (P < 5.0 × 10(-8)), 3 of which we found after conditioning on previously identified variants. Thus, there are now 110 established multiple sclerosis risk variants at 103 discrete loci outside of the major histocompatibility complex. With high-resolution Bayesian fine mapping, we identified five regions where one variant accounted for more than 50% of the posterior probability of association. This study enhances the catalog of multiple sclerosis risk variants and illustrates the value of fine mapping in the resolution of GWAS signals.

Clear cell renal cell carcinoma (ccRCC) is the most common form of adult kidney cancer, characterized by the presence of inactivating mutations in the VHL gene in most cases, and by infrequent somatic mutations in known cancer genes. To determine further the genetics of ccRCC, we have sequenced 101 cases through 3,544 protein-coding genes. Here we report the identification of inactivating mutations in two genes encoding enzymes involved in histone modification-SETD2, a histone H3 lysine 36 methyltransferase, and JARID1C (also known as KDM5C), a histone H3 lysine 4 demethylase-as well as mutations in the histone H3 lysine 27 demethylase, UTX (KMD6A), that we recently reported. The results highlight the role of mutations in components of the chromatin modification machinery in human cancer. Furthermore, NF2 mutations were found in non-VHL mutated ccRCC, and several other probable cancer genes were identified. These results indicate that substantial genetic heterogeneity exists in a cancer type dominated by mutations in a single gene, and that systematic screens will be key to fully determining the somatic genetic architecture of cancer.

The contribution of rare and low-frequency variants to human traits is largely unexplored. Here we describe insights from sequencing whole genomes (low read depth, 7×) or exomes (high read depth, 80×) of nearly 10,000 individuals from population-based and disease collections. In extensively phenotyped cohorts we characterize over 24 million novel sequence variants, generate a highly accurate imputation reference panel and identify novel alleles associated with levels of triglycerides (APOB), adiponectin (ADIPOQ) and low-density lipoprotein cholesterol (LDLR and RGAG1) from single-marker and rare variant aggregation tests. We describe population structure and functional annotation of rare and low-frequency variants, use the data to estimate the benefits of sequencing for association studies, and summarize lessons from disease-specific collections. Finally, we make available an extensive resource, including individual-level genetic and phenotypic data and web-based tools to facilitate the exploration of association results.

Cancer is driven by mutation. Worldwide, tobacco smoking is the principal lifestyle exposure that causes cancer, exerting carcinogenicity through >60 chemicals that bind and mutate DNA. Using massively parallel sequencing technology, we sequenced a small-cell lung cancer cell line, NCI-H209, to explore the mutational burden associated with tobacco smoking. A total of 22,910 somatic substitutions were identified, including 134 in coding exons. Multiple mutation signatures testify to the cocktail of carcinogens in tobacco smoke and their proclivities for particular bases and surrounding sequence context. Effects of transcription-coupled repair and a second, more general, expression-linked repair pathway were evident. We identified a tandem duplication that duplicates exons 3-8 of CHD7 in frame, and another two lines carrying PVT1-CHD7 fusion genes, indicating that CHD7 may be recurrently rearranged in this disease. These findings illustrate the potential for next-generation sequencing to provide unprecedented insights into mutational processes, cellular repair pathways and gene networks associated with cancer.

To further understanding of the genetic basis of type 2 diabetes (T2D) susceptibility, we aggregated published meta-analyses of genome-wide association studies (GWAS), including 26,488 cases and 83,964 controls of European, east Asian, south Asian and Mexican and Mexican American ancestry. We observed a significant excess in the directional consistency of T2D risk alleles across ancestry groups, even at SNPs demonstrating only weak evidence of association. By following up the strongest signals of association from the trans-ethnic meta-analysis in an additional 21,491 cases and 55,647 controls of European ancestry, we identified seven new T2D susceptibility loci. Furthermore, we observed considerable improvements in the fine-mapping resolution of common variant association signals at several T2D susceptibility loci. These observations highlight the benefits of trans-ethnic GWAS for the discovery and characterization of complex trait loci and emphasize an exciting opportunity to extend insight into the genetic architecture and pathogenesis of human diseases across populations of diverse ancestry.

Richard Trembath, Peter Donnelly and colleagues report a genome-wide association study identifying six new psoriasis susceptibility loci. They also identify a statistical interaction between HLA-C and ERAP1 in psoriasis susceptibility. To identify new susceptibility loci for psoriasis, we undertook a genome-wide association study of 594,224 SNPs in 2,622 individuals with psoriasis and 5,667 controls. We identified associations at eight previously unreported genomic loci. Seven loci harbored genes with recognized immune functions (IL28RA, REL, IFIH1, ERAP1, TRAF3IP2, NFKBIA and TYK2). These associations were replicated in 9,079 European samples (six loci with a combined P < 5 × 10−8 and two loci with a combined P < 5 × 10−7). We also report compelling evidence for an interaction between the HLA-C and ERAP1 loci (combined P = 6.95 × 10−6). ERAP1 plays an important role in MHC class I peptide processing. ERAP1 variants only influenced psoriasis susceptibility in individuals carrying the HLA-C risk allele. Our findings implicate pathways that integrate epidermal barrier dysfunction with innate and adaptive immune dysregulation in psoriasis pathogenesis.

Richard Trembath and colleagues report a meta-analysis of genome-wide association studies for psoriasis, including 2 cohorts genotyped on the custom Immunochip array, in a total of 10,588 cases and 22,806 controls. They identify 15 new susceptibility loci and refine signals in previously known loci, highlighting a role for innate host defense in susceptibility to psoriasis. To gain further insight into the genetic architecture of psoriasis, we conducted a meta-analysis of 3 genome-wide association studies (GWAS) and 2 independent data sets genotyped on the Immunochip, including 10,588 cases and 22,806 controls. We identified 15 new susceptibility loci, increasing to 36 the number associated with psoriasis in European individuals. We also identified, using conditional analyses, five independent signals within previously known loci. The newly identified loci shared with other autoimmune diseases include candidate genes with roles in regulating T-cell function (such as RUNX3, TAGAP and STAT3). Notably, they included candidate genes whose products are involved in innate host defense, including interferon-mediated antiviral responses (DDX58), macrophage activation (ZC3H12C) and nuclear factor (NF)-κB signaling (CARD14 and CARM1). These results portend a better understanding of shared and distinctive genetic determinants of immune-mediated inflammatory disorders and emphasize the importance of the skin in innate and acquired host defense.

Multiple somatic rearrangements are often found in cancer genomes; however, the underlying processes of rearrangement and their contribution to cancer development are poorly characterized. Here we use a paired-end sequencing strategy to identify somatic rearrangements in breast cancer genomes. There are more rearrangements in some breast cancers than previously appreciated. Rearrangements are more frequent over gene footprints and most are intrachromosomal. Multiple rearrangement architectures are present, but tandem duplications are particularly common in some cancers, perhaps reflecting a specific defect in DNA maintenance. Short overlapping sequences at most rearrangement junctions indicate that these have been mediated by non-homologous end-joining DNA repair, although varying sequence patterns indicate that multiple processes of this type are operative. Several expressed in-frame fusion genes were identified but none was recurrent. The study provides a new perspective on cancer genomes, highlighting the diversity of somatic rearrangements and their potential contribution to cancer development. It has been known for decades that many tumours contain genomic rearrangements, but little is known about their causes and effects. Using new 'paired-end' sequencing technologies, Stephens et al. have now mapped the chromosome rearrangements in human breast cancers at high resolution. They find more rearrangements than previously recognized, most of them intrachromosomal rather than interchromosomal. Tandem duplications were remarkably common in some breast cancers but essentially absent from others, and may reflect a novel mutator phenotype. Multiple somatic rearrangements are often found in cancer genomes, but the underlying processes of rearrangement and the effects of this are unclear. A paired-end sequencing strategy is now used to map somatic rearrangements in human breast cancer genomes. More rearrangements in some breast cancers are found than previously recognized, including frequent tandem duplications that may reflect a specific defect in DNA maintenance.

Human cancers often carry many somatically acquired genomic rearrangements, some of which may be implicated in cancer development. However, conventional strategies for characterizing rearrangements are laborious and low-throughput and have low sensitivity or poor resolution. We used massively parallel sequencing to generate sequence reads from both ends of short DNA fragments derived from the genomes of two individuals with lung cancer. By investigating read pairs that did not align correctly with respect to each other on the reference human genome, we characterized 306 germline structural variants and 103 somatic rearrangements to the base-pair level of resolution. The patterns of germline and somatic rearrangement were markedly different. Many somatic rearrangements were from amplicons, although rearrangements outside these regions, notably including tandem duplications, were also observed. Some somatic rearrangements led to abnormal transcripts, including two from internal tandem duplications and two fusion transcripts created by interchromosomal rearrangements. Germline variants were predominantly mediated by retrotransposition, often involving AluY and LINE elements. The results demonstrate the feasibility of systematic, genome-wide characterization of rearrangements in complex human cancer genomes, raising the prospect of a new harvest of genes associated with cancer using this strategy.

Matthew Brown, Peter Donnelly and colleagues report results of a genome-wide association meta-analysis and follow-up study of ankylosing spondylitis. They identify three new risk variants and report a genetic interaction between ERAP1 and HLA-B27, implicating aberrant peptide handling in the pathophysiology of this disease. Ankylosing spondylitis is a common form of inflammatory arthritis predominantly affecting the spine and pelvis that occurs in approximately 5 out of 1,000 adults of European descent. Here we report the identification of three variants in the RUNX3, LTBR-TNFRSF1A and IL12B regions convincingly associated with ankylosing spondylitis (P < 5 × 10−8 in the combined discovery and replication datasets) and a further four loci at PTGER4, TBKBP1, ANTXR2 and CARD9 that show strong association across all our datasets (P < 5 × 10−6 overall, with support in each of the three datasets studied). We also show that polymorphisms of ERAP1, which encodes an endoplasmic reticulum aminopeptidase involved in peptide trimming before HLA class I presentation, only affect ankylosing spondylitis risk in HLA-B27–positive individuals. These findings provide strong evidence that HLA-B27 operates in ankylosing spondylitis through a mechanism involving aberrant processing of antigenic peptides.

Through genome-wide association meta-analyses of up to 133,010 individuals of European ancestry without diabetes, including individuals newly genotyped using the Metabochip, we have increased the number of confirmed loci influencing glycemic traits to 53, of which 33 also increase type 2 diabetes risk (q < 0.05). Loci influencing fasting insulin concentration showed association with lipid levels and fat distribution, suggesting impact on insulin resistance. Gene-based analyses identified further biologically plausible loci, suggesting that additional loci beyond those reaching genome-wide significance are likely to represent real associations. This conclusion is supported by an excess of directionally consistent and nominally significant signals between discovery and follow-up studies. Functional analysis of these newly discovered loci will further improve our understanding of glycemic control.

Somatically acquired epigenetic changes are present in many cancers. Epigenetic regulation is maintained via post-translational modifications of core histones. Here, we describe inactivating somatic mutations in the histone lysine demethylase gene UTX, pointing to histone H3 lysine methylation deregulation in multiple tumor types. UTX reintroduction into cancer cells with inactivating UTX mutations resulted in slowing of proliferation and marked transcriptional changes. These data identify UTX as a new human cancer gene.

Using variants from the 1000 Genomes Project pilot European CEU dataset and data from additional resequencing studies, we densely genotyped 183 non-HLA risk loci previously associated with immune-mediated diseases in 12,041 individuals with celiac disease (cases) and 12,228 controls. We identified 13 new celiac disease risk loci reaching genome-wide significance, bringing the number of known loci (including the HLA locus) to 40. We found multiple independent association signals at over one-third of these loci, a finding that is attributable to a combination of common, low-frequency and rare genetic variants. Compared to previously available data such as those from HapMap3, our dense genotyping in a large sample collection provided a higher resolution of the pattern of linkage disequilibrium and suggested localization of many signals to finer scale regions. In particular, 29 of the 54 fine-mapped signals seemed to be localized to single genes and, in some instances, to gene regulatory elements. Altogether, we define the complex genetic architecture of the risk regions of and refine the risk signals for celiac disease, providing the next step toward uncovering the causal mechanisms of the disease.

The cancer genome is moulded by the dual processes of somatic mutation and selection. Homozygous deletions in cancer genomes occur over recessive cancer genes, where they can confer selective growth advantage, and over fragile sites, where they are thought to reflect an increased local rate of DNA breakage. However, most homozygous deletions in cancer genomes are unexplained. Here we identified 2,428 somatic homozygous deletions in 746 cancer cell lines. These overlie 11% of protein-coding genes that, therefore, are not mandatory for survival of human cells. We derived structural signatures that distinguish between homozygous deletions over recessive cancer genes and fragile sites. Application to clusters of unexplained homozygous deletions suggests that many are in regions of inherent fragility, whereas a small subset overlies recessive cancer genes. The results illustrate how structural signatures can be used to distinguish between the influences of mutation and selection in cancer genomes. The extensive copy number, genotyping, sequence and expression data available for this large series of publicly available cancer cell lines renders them informative reagents for future studies of cancer biology and drug discovery.

To characterize type 2 diabetes (T2D)-associated variation across the allele frequency spectrum, we conducted a meta-analysis of genome-wide association data from 26,676 T2D case and 132,532 control subjects of European ancestry after imputation using the 1000 Genomes multiethnic reference panel. Promising association signals were followed up in additional data sets (of 14,545 or 7,397 T2D case and 38,994 or 71,604 control subjects). We identified 13 novel T2D-associated loci (P < 5 × 10-8), including variants near the GLP2R, GIP, and HLA-DQA1 genes. Our analysis brought the total number of independent T2D associations to 128 distinct signals at 113 loci. Despite substantially increased sample size and more complete coverage of low-frequency variation, all novel associations were driven by common single nucleotide variants. Credible sets of potentially causal variants were generally larger than those based on imputation with earlier reference panels, consistent with resolution of causal signals to common risk haplotypes. Stratification of T2D-associated loci based on T2D-related quantitative trait associations revealed tissue-specific enrichment of regulatory annotations in pancreatic islet enhancers for loci influencing insulin secretion and in adipocytes, monocytes, and hepatocytes for insulin action-associated loci. These findings highlight the predominant role played by common variants of modest effect and the diversity of biological mechanisms influencing T2D pathophysiology.

Using the Immunochip custom SNP array, which was designed for dense genotyping of 186 loci identified through genome-wide association studies (GWAS), we analyzed 11,475 individuals with rheumatoid arthritis (cases) of European ancestry and 15,870 controls for 129,464 markers. We combined these data in a meta-analysis with GWAS data from additional independent cases (n = 2,363) and controls (n = 17,872). We identified 14 new susceptibility loci, 9 of which were associated with rheumatoid arthritis overall and five of which were specifically associated with disease that was positive for anticitrullinated peptide antibodies, bringing the number of confirmed rheumatoid arthritis risk loci in individuals of European ancestry to 46. We refined the peak of association to a single gene for 19 loci, identified secondary independent effects at 6 loci and identified association to low-frequency variants at 4 loci. Bioinformatic analyses generated strong hypotheses for the causal SNP at seven loci. This study illustrates the advantages of dense SNP mapping analysis to inform subsequent functional investigations.

Approaches exploiting trait distribution extremes may be used to identify loci associated with common traits, but it is unknown whether these loci are generalizable to the broader population. In a genome-wide search for loci associated with the upper versus the lower 5th percentiles of body mass index, height and waist-to-hip ratio, as well as clinical classes of obesity, including up to 263,407 individuals of European ancestry, we identified 4 new loci (IGFBP4, H6PD, RSRC1 and PPP2R2A) influencing height detected in the distribution tails and 7 new loci (HNF4G, RPTOR, GNAT2, MRPS33P4, ADCY9, HS6ST3 and ZZZ3) for clinical classes of obesity. Further, we find a large overlap in genetic structure and the distribution of variants between traits based on extremes and the general population and little etiological heterogeneity between obesity subgroups.

Tarpey et al. carry out a large-scale systematic sequencing of the majority of X-chromosome coding exons from 208 families with multiple individuals with mental retardation and a pattern of transmission compatible with X linkage in order to identify XLMR-causative mutations. They find several mutations that appear to be causative in loci already known to be involved in XLMR, as well as new data about those loci, and make inferences about the role of the different classes of variants in these diseases. Large-scale systematic resequencing has been proposed as the key future strategy for the discovery of rare, disease-causing sequence variants across the spectrum of human complex disease. We have sequenced the coding exons of the X chromosome in 208 families with X-linked mental retardation (XLMR), the largest direct screen for constitutional disease-causing mutations thus far reported. The screen has discovered nine genes implicated in XLMR, including SYP, ZNF711 and CASK reported here, confirming the power of this strategy. The study has, however, also highlighted issues confronting whole-genome sequencing screens, including the observation that loss of function of 1% or more of X-chromosome genes is compatible with apparently normal existence.

Protein kinases are frequently mutated in human cancer and inhibitors of mutant protein kinases have proven to be effective anticancer drugs. We screened the coding sequences of 518 protein kinases (approximately 1.3 Mb of DNA per sample) for somatic mutations in 26 primary lung neoplasms and seven lung cancer cell lines. One hundred eighty-eight somatic mutations were detected in 141 genes. Of these, 35 were synonymous (silent) changes. This result indicates that most of the 188 mutations were "passenger" mutations that are not causally implicated in oncogenesis. However, an excess of approximately 40 nonsynonymous substitutions compared with that expected by chance (P = 0.07) suggests that some nonsynonymous mutations have been selected and are contributing to oncogenesis. There was considerable variation between individual lung cancers in the number of mutations observed and no mutations were found in lung carcinoids. The mutational spectra of most lung cancers were characterized by a high proportion of C:G > A:T transversions, compatible with the mutagenic effects of tobacco carcinogens. However, one neuroendocrine cancer cell line had a distinctive mutational spectrum reminiscent of UV-induced DNA damage. The results suggest that several mutated protein kinases may be contributing to lung cancer development, but that mutations in each one are infrequent.

Epilepsy and mental retardation limited to females (EFMR) is a disorder with an X-linked mode of inheritance and an unusual expression pattern. Disorders arising from mutations on the X chromosome are typically characterized by affected males and unaffected carrier females. In contrast, EFMR spares transmitting males and affects only carrier females. Aided by systematic resequencing of 737 X chromosome genes, we identified different protocadherin 19 (PCDH19) gene mutations in seven families with EFMR. Five mutations resulted in the introduction of a premature termination codon. Study of two of these demonstrated nonsense-mediated decay of PCDH19 mRNA. The two missense mutations were predicted to affect adhesiveness of PCDH19 through impaired calcium binding. PCDH19 is expressed in developing brains of human and mouse and is the first member of the cadherin superfamily to be directly implicated in epilepsy or mental retardation.

Malignant gliomas have a very poor prognosis. The current standard of care for these cancers consists of extended adjuvant treatment with the alkylating agent temozolomide after surgical resection and radiotherapy. Although a statistically significant increase in survival has been reported with this regimen, nearly all gliomas recur and become insensitive to further treatment with this class of agents. We sequenced 500 kb of genomic DNA corresponding to the kinase domains of 518 protein kinases in each of nine gliomas. Large numbers of somatic mutations were observed in two gliomas recurrent after alkylating agent treatment. The pattern of mutations in these cases showed strong similarity to that induced by alkylating agents in experimental systems. Further investigation revealed inactivating somatic mutations of the mismatch repair gene MSH6 in each case. We propose that inactivating somatic mutations of MSH6 confer resistance to alkylating agents in gliomas in vivo and concurrently unleash accelerated mutagenesis in resistant clones as a consequence of continued exposure to alkylating agents in the presence of defective mismatch repair. The evidence therefore suggests that when MSH6 is inactivated in gliomas, alkylating agents convert from induction of tumor cell death to promotion of neoplastic progression. These observations highlight the potential of large scale sequencing for revealing and elucidating mutagenic processes operative in individual human cancers.

Metformin is the most commonly used pharmacological therapy for type 2 diabetes. We report a genome-wide association study for glycemic response to metformin in 1,024 Scottish individuals with type 2 diabetes with replication in two cohorts including 1,783 Scottish individuals and 1,113 individuals from the UK Prospective Diabetes Study. In a combined meta-analysis, we identified a SNP, rs11212617, associated with treatment success (n = 3,920, P = 2.9 × 10(-9), odds ratio = 1.35, 95% CI 1.22-1.49) at a locus containing ATM, the ataxia telangiectasia mutated gene. In a rat hepatoma cell line, inhibition of ATM with KU-55933 attenuated the phosphorylation and activation of AMP-activated protein kinase in response to metformin. We conclude that ATM, a gene known to be involved in DNA repair and cell cycle control, plays a role in the effect of metformin upstream of AMP-activated protein kinase, and variation in this gene alters glycemic response to metformin.

The panel of 60 human cancer cell lines (the NCI-60) assembled by the National Cancer Institute for anticancer drug discovery is a widely used resource. The NCI-60 has been characterized pharmacologically and at the molecular level more extensively than any other set of cell lines. However, no systematic mutation analysis of genes causally implicated in oncogenesis has been reported. This study reports the sequence analysis of 24 known cancer genes in the NCI-60 and an assessment of 4 of the 24 genes for homozygous deletions. One hundred thirty-seven oncogenic mutations were identified in 14 (APC, BRAF, CDKN2, CTNNB1, HRAS, KRAS, NRAS, SMAD4, PIK3CA, PTEN, RB1, STK11, TP53, and VHL) of the 24 genes. All lines have at least one mutation among the cancer genes examined, with most lines (73%) having more than one. Identification of those cancer genes mutated in the NCI-60, in combination with pharmacologic and molecular profiles of the cells, will allow for more informed interpretation of anticancer agent screening and will enhance the use of the NCI-60 cell lines for molecularly targeted screens.

Genetic factors have been implicated in stroke risk, but few replicated associations have been reported. We conducted a genome-wide association study (GWAS) for ischemic stroke and its subtypes in 3,548 affected individuals and 5,972 controls, all of European ancestry. Replication of potential signals was performed in 5,859 affected individuals and 6,281 controls. We replicated previous associations for cardioembolic stroke near PITX2 and ZFHX3 and for large vessel stroke at a 9p21 locus. We identified a new association for large vessel stroke within HDAC9 (encoding histone deacetylase 9) on chromosome 7p21.1 (including further replication in an additional 735 affected individuals and 28,583 controls) (rs11984041; combined P = 1.87 × 10(-11); odds ratio (OR) = 1.42, 95% confidence interval (CI) = 1.28-1.57). All four loci exhibited evidence for heterogeneity of effect across the stroke subtypes, with some and possibly all affecting risk for only one subtype. This suggests distinct genetic architectures for different stroke subtypes.

We performed fine mapping of 39 established type 2 diabetes (T2D) loci in 27,206 cases and 57,574 controls of European ancestry. We identified 49 distinct association signals at these loci, including five mapping in or near KCNQ1. 'Credible sets' of the variants most likely to drive each distinct signal mapped predominantly to noncoding sequence, implying that association with T2D is mediated through gene regulation. Credible set variants were enriched for overlap with FOXA2 chromatin immunoprecipitation binding sites in human islet and liver cells, including at MTNR1B, where fine mapping implicated rs10830963 as driving T2D association. We confirmed that the T2D risk allele for this SNP increases FOXA2-bound enhancer activity in islet- and liver-derived cells. We observed allele-specific differences in NEUROD1 binding in islet-derived cells, consistent with evidence that the T2D risk allele increases islet MTNR1B expression. Our study demonstrates how integration of genetic and genomic information can define molecular mechanisms through which variants underlying association signals exert their effects on disease.

Highly rearranged and mutated cancer genomes present major challenges in the identification of pathogenetic events driving the neoplastic transformation process. Here we engineered lymphoma-prone mice with chromosomal instability to assess the usefulness of mouse models in cancer gene discovery and the extent of cross-species overlap in cancer-associated copy number aberrations. Along with targeted re-sequencing, our comparative oncogenomic studies identified FBXW7 and PTEN to be commonly deleted both in murine lymphomas and in human T-cell acute lymphoblastic leukaemia/lymphoma (T-ALL). The murine cancers acquire widespread recurrent amplifications and deletions targeting loci syntenic to those not only in human T-ALL but also in diverse human haematopoietic, mesenchymal and epithelial tumours. These results indicate that murine and human tumours experience common biological processes driven by orthologous genetic events in their malignant evolution. The highly concordant nature of genomic events encourages the use of genomically unstable murine cancer models in the discovery of biological driver events in the human oncogenome. Conventional mouse cancer models are made by transferring a cancer-causing oncogene into an embryo. The mice develop cancer, but the cancer does not show the marked genomic instability found in humans. Now a new mouse model that mimics the levels of genomic instability in human cancers has been developed. Genetic elements causing chromosome instability were engineered into lymphoma-prone mice. The resulting model closely resembles the human disease in many respects, including the occurrence of deletions and mutations of the genes FBXW7 and PTEN. A mouse lymphoma model that shows a similar level of genomic instability generally seen in human cancer has been created. In a comparative genomics approach, recurrent genetic alterations found in this model are used as a filter to identify overlapping alterations in human T-cell acute lymphoblastic lymphomas, including in the FBXW7 and NOTCH genes.

Patricia Munroe, Christopher Newton-Cheh, Andrew Morris and colleagues perform association studies in over 340,000 individuals of European ancestry and identify 66 loci, of which 17 are novel, involved in blood pressure regulation. The risk SNPs are enriched for cis-regulatory elements, particularly in vascular endothelial cells. To dissect the genetic architecture of blood pressure and assess effects on target organ damage, we analyzed 128,272 SNPs from targeted and genome-wide arrays in 201,529 individuals of European ancestry, and genotypes from an additional 140,886 individuals were used for validation. We identified 66 blood pressure–associated loci, of which 17 were new; 15 harbored multiple distinct association signals. The 66 index SNPs were enriched for cis-regulatory elements, particularly in vascular endothelial cells, consistent with a primary role in blood pressure control through modulation of vascular tone across multiple tissues. The 66 index SNPs combined in a risk score showed comparable effects in 64,421 individuals of non-European descent. The 66-SNP blood pressure risk score was significantly associated with target organ damage in multiple tissues but with minor effects in the kidney. Our findings expand current knowledge of blood pressure–related pathways and highlight tissues beyond the classical renal system in blood pressure regulation.

Anne Hinks and colleagues identify 14 new susceptibility loci for juvenile idiopathic arthritis through targeted analyses of genomic regions implicated in immune function. Their study implicates several pathways, including IL-2 signaling, in the pathogenesis of this common childhood autoimmune disease. We used the Immunochip array to analyze 2,816 individuals with juvenile idiopathic arthritis (JIA), comprising the most common subtypes (oligoarticular and rheumatoid factor–negative polyarticular JIA), and 13,056 controls. We confirmed association of 3 known JIA risk loci (the human leukocyte antigen (HLA) region, PTPN22 and PTPN2) and identified 14 loci reaching genome-wide significance (P < 5 × 10−8) for the first time. Eleven additional new regions showed suggestive evidence of association with JIA (P < 1 × 10−6). Dense mapping of loci along with bioinformatics analysis refined the associations to one gene in each of eight regions, highlighting crucial pathways, including the interleukin (IL)-2 pathway, in JIA disease pathogenesis. The entire Immunochip content, the HLA region and the top 27 loci (P < 1 × 10−6) explain an estimated 18, 13 and 6% of the risk of JIA, respectively. In summary, this is the largest collection of JIA cases investigated so far and provides new insight into the genetic basis of this childhood autoimmune disease.

Mutations in the glucocerebrosidase gene (GBA), which cause Gaucher disease, are also potent risk factors for Parkinson's disease. We examined whether a genetic burden of variants in other lysosomal storage disorder genes is more broadly associated with Parkinson's disease susceptibility. The sequence kernel association test was used to interrogate variant burden among 54 lysosomal storage disorder genes, leveraging whole exome sequencing data from 1156 Parkinson's disease cases and 1679 control subjects. We discovered a significant burden of rare, likely damaging lysosomal storage disorder gene variants in association with Parkinson's disease risk. The association signal was robust to the exclusion of GBA, and consistent results were obtained in two independent replication cohorts, including 436 cases and 169 controls with whole exome sequencing and an additional 6713 cases and 5964 controls with exome-wide genotyping. In secondary analyses designed to highlight the specific genes driving the aggregate signal, we confirmed associations at the GBA and SMPD1 loci and newly implicate CTSD, SLC17A5, and ASAH1 as candidate Parkinson's disease susceptibility genes. In our discovery cohort, the majority of Parkinson's disease cases (56%) have at least one putative damaging variant in a lysosomal storage disorder gene, and 21% carry multiple alleles. Our results highlight several promising new susceptibility loci and reinforce the importance of lysosomal mechanisms in Parkinson's disease pathogenesis. We suggest that multiple genetic hits may act in combination to degrade lysosomal function, enhancing Parkinson's disease susceptibility.

Mutations in leucine-rich repeat kinase 2 (LRRK2) cause inherited Parkinson disease (PD), and common variants around LRRK2 are a risk factor for sporadic PD. Using protein-protein interaction arrays, we identified BCL2-associated athanogene 5, Rab7L1 (RAB7, member RAS oncogene family-like 1), and Cyclin-G-associated kinase as binding partners of LRRK2. The latter two genes are candidate genes for risk for sporadic PD identified by genome-wide association studies. These proteins form a complex that promotes clearance of Golgi-derived vesicles through the autophagy-lysosome system both in vitro and in vivo. We propose that three different genes for PD have a common biological function. More generally, data integration from multiple unbiased screens can provide insight into human disease mechanisms.

Imputing genotypes from reference panels created by whole-genome sequencing (WGS) provides a cost-effective strategy for augmenting the single-nucleotide polymorphism (SNP) content of genome-wide arrays. The UK10K Cohorts project has generated a data set of 3,781 whole genomes sequenced at low depth (average 7x), aiming to exhaustively characterize genetic variation down to 0.1% minor allele frequency in the British population. Here we demonstrate the value of this resource for improving imputation accuracy at rare and low-frequency variants in both a UK and an Italian population. We show that large increases in imputation accuracy can be achieved by re-phasing WGS reference panels after initial genotype calling. We also present a method for combining WGS panels to improve variant coverage and downstream imputation accuracy, which we illustrate by integrating 7,562 WGS haplotypes from the UK10K project with 2,184 haplotypes from the 1000 Genomes Project. Finally, we introduce a novel approximation that maintains speed without sacrificing imputation accuracy for rare variants.

Nonsense-mediated mRNA decay (NMD) is of universal biological significance. It has emerged as an important global RNA, DNA and translation regulatory pathway. By systematically sequencing 737 genes (annotated in the Vertebrate Genome Annotation database) on the human X chromosome in 250 families with X-linked mental retardation, we identified mutations in the UPF3 regulator of nonsense transcripts homolog B (yeast) (UPF3B) leading to protein truncations in three families: two with the Lujan-Fryns phenotype and one with the FG phenotype. We also identified a missense mutation in another family with nonsyndromic mental retardation. Three mutations lead to the introduction of a premature termination codon and subsequent NMD of mutant UPF3B mRNA. Protein blot analysis using lymphoblastoid cell lines from affected individuals showed an absence of the UPF3B protein in two families. The UPF3B protein is an important component of the NMD surveillance machinery. Our results directly implicate abnormalities of NMD in human disease and suggest at least partial redundancy of NMD pathways.

An activating point mutation in codon 12 of the HRAS gene was the first somatic point mutation identified in a human cancer and established the role of somatic mutations as the common driver of oncogenesis. Since then, there have been over 11,000 mutations in the three RAS (HRAS, KRAS and NRAS) genes in codons 12, 13 and 61 reported in the literature. We report here the identification of recurrent somatic missense mutations at alanine 146, a highly conserved residue in the guanine nucleotide binding domain. In two independent series of colorectal cancers from Hong Kong and the United States we detected KRAS A146 mutations in 7/126 and 2/94 cases, respectively, giving a combined frequency of 4%. We also detected KRAS A146 mutations in 2/40 (5%) colorectal cell lines, including the NCI-60 colorectal cancer line HCC2998. Codon 146 mutations thus are likely to make an equal or greater contribution to colorectal cancer than codon 61 mutations (4.2% in our combined series, 1% in the literature). Lung adenocarcinomas and large cell carcinomas did not show codon 146 mutations. We did, however, identify a KRAS A146 mutation in the ML-2 acute myeloid leukemia cell line and an NRAS A146 mutation in the NALM-6 B-cell acute lymphoblastic leukemia line, suggesting that the contribution of codon 146 mutations is not entirely restricted to colorectal cancers or to KRAS.

Activation of the RAS/RAF/extracellular signal-regulated kinase-mitogen-activated protein kinase/extracellular signal-regulated kinase/mitogen-activated protein kinase pathway by RAS mutations is commonly found in human cancers. Recently, we reported that mutation of BRAF provides an alternative route for activation of this signaling pathway and can be found in melanomas, colorectal cancers, and ovarian tumors. Here we perform an extensive characterization of BRAF mutations in a large series of colorectal tumors in various stages of neoplastic transformation. BRAF mutations were found in 11 of 215 (5.1%) colorectal adenocarcinomas, 3 of 108 (2.8%) sporadic adenomas, 1 of 63 (1.6%) adenomas from familial adenomatous polyposis (FAP) patients, and 1 of 3 (33%) hyperplastic polyps. KRAS mutations were detected in 34% of carcinomas, 31% of sporadic adenomas, 9% of FAP adenomas, and no hyperplastic polyps. Eight of 16 BRAF mutations were V599E, the previously described hotspot, and none of these was associated with a KRAS mutation in the same lesion. The remaining eight mutations involve other conserved amino acids in the kinase domain, and 62.5% have a KRAS mutation in the same tumor. Our data suggest that BRAF mutations are, to some extent, biologically similar to RAS mutations in colorectal cancer because both occur at approximately the same stage of the adenoma-carcinoma sequence, both are associated with villous morphology, and both are less common in adenomas from FAP cases. By contrast, colorectal adenocarcinomas with BRAF mutations are associated with early Dukes' tumor stages (P = 0.006) and no such relationship was observed for KRAS mutations. The presence in some colorectal neoplasms of mutations in both BRAF and KRAS suggests that modulation of the RAS-RAF-extracellular signal-regulated kinase-mitogen-activated protein kinase/extracellular signal-regulated kinase/mitogen-activated protein kinase signaling pathway may occur by mutation of multiple components.

Linkage analysis and DNA sequencing in a family exhibiting an X-linked mental retardation (XLMR) syndrome, characterized by microcephaly, epilepsy, ataxia, and absent speech and resembling Angelman syndrome, identified a deletion in the <i>SLC9A6</i> gene encoding the Na⁺/H⁺ exchanger NHE6. Subsequently, other mutations were found in a male with mental retardation (MR) who had been investigated for Angelman syndrome and in two XLMR families with epilepsy and ataxia, including the family designated as having Christianson syndrome. Therefore, mutations in <i>SLC9A6</i> cause X-linked mental retardation. Additionally, males with findings suggestive of unexplained Angelman syndrome should be considered as potential candidates for <i>SLC9A6</i> mutations.

We have identified three truncating, two splice-site, and three missense variants at conserved amino acids in the CUL4B gene on Xq24 in 8 of 250 families with X-linked mental retardation (XLMR). During affected subjects' adolescence, a syndrome emerged with delayed puberty, hypogonadism, relative macrocephaly, moderate short stature, central obesity, unprovoked aggressive outbursts, fine intention tremor, pes cavus, and abnormalities of the toes. This syndrome was first described by Cazebas et al., in a family that was included in our study and that carried a CUL4B missense variant. CUL4B is a ubiquitin E3 ligase subunit implicated in the regulation of several biological processes, and CUL4B is the first XLMR gene that encodes an E3 ubiquitin ligase. The relatively high frequency of CUL4B mutations in this series indicates that it is one of the most commonly mutated genes underlying XLMR and suggests that its introduction into clinical diagnostics should be a high priority.

We performed a genome-wide association study (GWAS) in 1705 Parkinson's disease (PD) UK patients and 5175 UK controls, the largest sample size so far for a PD GWAS. Replication was attempted in an additional cohort of 1039 French PD cases and 1984 controls for the 27 regions showing the strongest evidence of association (P< 10(-4)). We replicated published associations in the 4q22/SNCA and 17q21/MAPT chromosome regions (P< 10(-10)) and found evidence for an additional independent association in 4q22/SNCA. A detailed analysis of the haplotype structure at 17q21 showed that there are three separate risk groups within this region. We found weak but consistent evidence of association for common variants located in three previously published associated regions (4p15/BST1, 4p16/GAK and 1q32/PARK16). We found no support for the previously reported SNP association in 12q12/LRRK2. We also found an association of the two SNPs in 4q22/SNCA with the age of onset of the disease.

High-throughput oligonucleotide microarrays are commonly employed to investigate genetic disease, including cancer. The algorithms employed to extract genotypes and copy number variation function optimally for diploid genomes usually associated with inherited disease. However, cancer genomes are aneuploid in nature leading to systematic errors when using these techniques. We introduce a preprocessing transformation and hidden Markov model algorithm bespoke to cancer. This produces genotype classification, specification of regions of loss of heterozygosity, and absolute allelic copy number segmentation. Accurate prediction is demonstrated with a combination of independent experimental techniques. These methods are exemplified with affymetrix genome-wide SNP6.0 data from 755 cancer cell lines, enabling inference upon a number of features of biological interest. These data and the coded algorithm are freely available for download.

Abdominal aortic aneurysm (AAA) is a common cause of morbidity and mortality and has a significant heritability. We carried out a genome-wide association discovery study of 1866 patients with AAA and 5435 controls and replication of promising signals (lead SNP with a p value < 1 × 10(-5)) in 2871 additional cases and 32,687 controls and performed further follow-up in 1491 AAA and 11,060 controls. In the discovery study, nine loci demonstrated association with AAA (p < 1 × 10(-5)). In the replication sample, the lead SNP at one of these loci, rs1466535, located within intron 1 of low-density-lipoprotein receptor-related protein 1 (LRP1) demonstrated significant association (p = 0.0042). We confirmed the association of rs1466535 and AAA in our follow-up study (p = 0.035). In a combined analysis (6228 AAA and 49182 controls), rs1466535 had a consistent effect size and direction in all sample sets (combined p = 4.52 × 10(-10), odds ratio 1.15 [1.10-1.21]). No associations were seen for either rs1466535 or the 12q13.3 locus in independent association studies of coronary artery disease, blood pressure, diabetes, or hyperlipidaemia, suggesting that this locus is specific to AAA. Gene-expression studies demonstrated a trend toward increased LRP1 expression for the rs1466535 CC genotype in arterial tissues; there was a significant (p = 0.029) 1.19-fold (1.04-1.36) increase in LRP1 expression in CC homozygotes compared to TT homozygotes in aortic adventitia. Functional studies demonstrated that rs1466535 might alter a SREBP-1 binding site and influence enhancer activity at the locus. In conclusion, this study has identified a biologically plausible genetic variant associated specifically with AAA, and we suggest that this variant has a possible functional role in LRP1 expression.

For decades, cytogenetic studies have demonstrated that somatically acquired structural rearrangements of the genome are a common feature of most classes of human cancer. However, the characteristics of these rearrangements at sequence-level resolution have thus far been subject to very limited description. One process that is dependent upon somatic genome rearrangement is gene amplification, a mechanism often exploited by cancer cells to increase copy number and hence expression of dominantly acting cancer genes. The mechanisms underlying gene amplification are complex but must involve chromosome breakage and rejoining. We sequenced 133 different genomic rearrangements identified within four cancer amplicons involving the frequently amplified cancer genes MYC, MYCN, and ERBB2. The observed architectures of rearrangement were diverse and highly distinctive, with evidence for sister chromatid breakage-fusion-bridge cycles, formation and reinsertion of double minutes, and the presence of bizarre clusters of small genomic fragments. There were characteristic features of sequences at the breakage-fusion junctions, indicating roles for nonhomologous end joining and homologous recombination-mediated repair mechanisms together with nontemplated DNA synthesis. Evidence was also found for sequence-dependent variation in susceptibility of the genome to somatic rearrangement. The results therefore provide insights into the DNA breakage and repair processes operative in somatic genome rearrangement and illustrate how the evolutionary histories of individual cancers can be reconstructed from large-scale cancer genome sequencing.

Idiopathic congenital nystagmus is characterized by involuntary, periodic, predominantly horizontal oscillations of both eyes. We identified 22 mutations in FRMD7 in 26 families with X-linked idiopathic congenital nystagmus. Screening of 42 singleton cases of idiopathic congenital nystagmus (28 male, 14 females) yielded three mutations (7%). We found restricted expression of FRMD7 in human embryonic brain and developing neural retina, suggesting a specific role in the control of eye movement and gaze stability.

We have identified one frameshift mutation, one splice-site mutation, and two missense mutations in highly conserved residues in ZDHHC9 at Xq26.1 in 4 of 250 families with X-linked mental retardation (XLMR). In three of the families, the mental retardation phenotype is associated with a Marfanoid habitus, although none of the affected individuals meets the Ghent criteria for Marfan syndrome. ZDHHC9 is a palmitoyltransferase that catalyzes the posttranslational modification of NRAS and HRAS. The degree of palmitoylation determines the temporal and spatial location of these proteins in the plasma membrane and Golgi complex. The finding of mutations in ZDHHC9 suggests that alterations in the concentrations and cellular distribution of target proteins are sufficient to cause disease. This is the first XLMR gene to be reported that encodes a posttranslational modification enzyme, palmitoyltransferase. Furthermore, now that the first palmitoyltransferase that causes mental retardation has been identified, defects in other palmitoylation transferases become good candidates for causing other mental retardation syndromes. We have identified one frameshift mutation, one splice-site mutation, and two missense mutations in highly conserved residues in ZDHHC9 at Xq26.1 in 4 of 250 families with X-linked mental retardation (XLMR). In three of the families, the mental retardation phenotype is associated with a Marfanoid habitus, although none of the affected individuals meets the Ghent criteria for Marfan syndrome. ZDHHC9 is a palmitoyltransferase that catalyzes the posttranslational modification of NRAS and HRAS. The degree of palmitoylation determines the temporal and spatial location of these proteins in the plasma membrane and Golgi complex. The finding of mutations in ZDHHC9 suggests that alterations in the concentrations and cellular distribution of target proteins are sufficient to cause disease. This is the first XLMR gene to be reported that encodes a posttranslational modification enzyme, palmitoyltransferase. Furthermore, now that the first palmitoyltransferase that causes mental retardation has been identified, defects in other palmitoylation transferases become good candidates for causing other mental retardation syndromes. Mental retardation is the clinical description of difficulties with intellectual processing. The underlying cellular abnormalities that cause this phenotype are enormously variable, and the term “mental retardation” reflects a final, common description of multiple, complex processes in brain development and sustained function. Mental retardation may occur if neuronal numbers are reduced early in embryogenesis due to a failure of appropriate cell division, as in microcephaly,1Bond J Roberts E Springell K Lizarraga SB Scott S Higgins J Hampshire DJ Morrison EE Leal GF Silva EO et al.A centrosomal mechanism involving CDK5RAP2 and CENPJ controls brain size.Nat Genet. 2005; 37: 353-355Crossref PubMed Scopus (442) Google Scholar, 2Bond J Scott S Hampshire DJ Springell K Corry P Abramowicz MJ Mochida GH Hennekam RC Maher ER Fryns JP et al.Protein-truncating mutations in ASPM cause variable reduction in brain size.Am J Hum Genet. 2003; 73: 1170-1177Abstract Full Text Full Text PDF PubMed Scopus (142) Google Scholar or if there is failure of neural migration.3des Portes V Pinard JM Billuart P Vinet MC Koulakoff A Carrie A Gelot A Dupuis E Motte J Berwald-Netter Y et al.A novel CNS gene required for neuronal migration and involved in X-linked subcortical laminar heterotopia and lissencephaly syndrome.Cell. 1998; 92: 51-61Abstract Full Text Full Text PDF PubMed Scopus (678) Google Scholar, 4Gleeson JG Allen KM Fox JW Lamperti ED Berkovic S Scheffer I Cooper EC Dobyns WB Minnerath SR Ross ME et al.Doublecortin, a brain-specific gene mutated in human X-linked lissencephaly and double cortex syndrome, encodes a putative signaling protein.Cell. 1998; 92: 63-72Abstract Full Text Full Text PDF PubMed Scopus (886) Google Scholar Also, abnormalities of the structural components of the synapse will affect the speed and accuracy of sustained neural processing,5Tarpey P Parnau J Blow M Woffendin H Bignell G Cox C Cox J Davies H Edkins S Holden S et al.Mutations in the DLG3 gene cause non-syndromic X-linked mental retardation.Am J Hum Genet. 2004; 75: 318-324Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar, 6Jamain S Quach H Betancur C Rastam M Colineaux C Gillberg IC Soderstrom H Giros B Leboyer M Gillberg C et al.Mutations of the X-linked genes encoding neuroligins NLGN3 and NLGN4 are associated with autism.Nat Genet. 2003; 34: 27-29Crossref PubMed Scopus (1382) Google Scholar and several transcription factors7Stromme P Mangelsdorf ME Shaw MA Lower KM Lewis SM Bruyere H Lutcherath V Gedeon AK Wallace RH Scheffer IE et al.Mutations in the human ortholog of Aristaless cause X-linked mental retardation and epilepsy.Nat Genet. 2002; 30: 441-445Crossref PubMed Scopus (383) Google Scholar, 8Gibbons RJ Picketts DJ Villard L Higgs DR Mutations in a putative global transcriptional regulator cause X-linked mental retardation with α-thalassemia (ATR-X syndrome).Cell. 1995; 80: 837-845Abstract Full Text PDF PubMed Scopus (512) Google Scholar and members of the guanosine triphosphastase protein signaling cascades have also been identified as causing mental retardation.9D’Adamo P Menegon A Lo Nigro C Grasso M Gulisano M Tamanini F Bienvenu T Gedeon AK Oostra B Wu SK et al.Mutations in GDI1 are responsible for X-linked non-specific mental retardation.Nat Genet. 1998; 19: 134-139Crossref PubMed Scopus (287) Google Scholar, 10Kutsche K Yntema H Brandt A Jantke I Nothwang HG Orth U Boavida MG David D Chelly J Fryns JP et al.Mutations in ARHGEF6, encoding a guanine nucleotide exchange factor for Rho GTPases, in patients with X-linked mental retardation.Nat Genet. 2000; 26: 247-250Crossref PubMed Scopus (269) Google Scholar To identify novel genes that cause X-linked mental retardation (XLMR), we have embarked on a systematic screen for mutations in genes on the X chromosome. We have collected and characterized a cohort of 250 families in which at least two males in the family have mental retardation as the predominant clinical phenotype and in which there was no known molecular diagnosis. All families have been examined and have no abnormalities by conventional karyotype analysis at 500 G-banding resolution. DNA from probands from the families have been screened and are negative for mutations in 61 known syndromic and nonsyndromic XLMR genes by sequence analysis of the coding exons and splice junctions. Expansions of the FMR1 trinucleotide repeat were also excluded. Although all families have mental retardation as the predominant feature, some families also had both consistent and inconsistent additional clinical abnormalities, such as macrocephaly, short stature, and spasticity. These features were recorded but were not used as selection criteria for screening. DNA from an affected individual from each family was screened for variants in the coding exons and splice junctions of the remaining 676 Vega-annotated X-chromosome genes (Vega Genome Browser) by bidirectional, PCR-based direct sequencing. Two truncating and two missense mutations were found in the zinc finger, DHHC-type containing 9 gene (ZDHHC9 [GenBank accession number NM_016032]), located in Xq26.1. In family 152, there is a 4-bp duplication, c.172_175dup (p.Y59fsX33), present in two brothers and their mother (fig. 1). The maternal uncle of the brothers, who was also affected, was unavailable for analysis. In family 602, a splice-site mutation, c.167+5G→C, was detected in two affected brothers and their mother and was absent from an unaffected brother. In silico analysis of the splice-site variant c.167+5G→C by use of NNSPLICE (BDGP: Splice Site Prediction by Neural Network) predicts the reduction of the strength of the splice-donor site from 76.46% to 62.23% . This was confirmed by sequence analysis of ZDHHC9 cDNA, prepared from lymphocytes from the proband and amplified using PCR primers situated within exons 2 and 4 (table 1). The transcript identified was abnormal and used an upstream splice-donor site (consensus strength 76.82%) within exon 2, resulting in a frameshift and protein truncation, T11fsX33 (fig. 2). In families 031 and 576, missense variants were identified. In family 031, c.442C→T (p.R148W) was detected in two brothers and their mother. In family 576, the variant c.448C→T (p.P150S) was found in four affected males (fig. 1). We evaluated the potential effects of these missense variants on ZDHHC9 function by comparing amino acid conservation at these positions in paralogs and orthologs within and across species (fig. 3). Both R148 and P150 are conserved from man to yeast in the context of only 31% total amino acid identity in ZDHHC9 between these two species (blastp [NCBI BLAST Web site]). Moreover, they reside within a larger block of 52 aa residues that are highly conserved and form the active site of the palmitoyltransferase enzyme (figs. 3 and 4). Comparison of paralogs of ZDHHC9 in humans show that the residues equivalent to R148 and P150 in ZDHHC14, ZDHHC5, ZDHHC18, ZDHHC8, and ZDHHC19 are also conserved (fig. 3). In the remaining 18 human paralogs, these residues are not universally conserved, but these paralogs are the more distantly related proteins. Conservation across species shows that these residues are conserved in ZDHHC14 and ZDHHC5 in D. rerio and in the only two paralogs of the ZDHHC family in C. elegans (fig. 3). The conservation of these amino acids and their position within a known functional domain of the protein indicate that they significantly influence ZDHHC9 function and, therefore, that these missense variants are likely to be disease causing (fig. 4). No other variants in ZDHHC9 were detected in the 250-case series. The four sequence variants were not detected in DNA from 445 normal control samples, which represent 667 X chromosomes. Furthermore, no additional common or rare coding sequence variants were detected in the control series, demonstrating that ZDHHC9 shows little variation in unaffected individuals. Details of PCR primers and sequencing temperatures are given in table 1.Table 1Primers Used for PCR Amplification of ZDHHC9Primer Sequence (5′→3′)SegmentForwardReverseExon 2ACCCAGCGGCAGGAATAGCAGCCCCAAATCAGTACTACAAAExon 3TGTATGTTATAGGTGGCAGCAGTCAGGATCTCAGAGAGAAAAGGCExon 4TGCATGCACTTAGTGGAGTTTTGATTTGCAGTTTTTCAGGAGCExon 5TTACAACTGAAATAGACAATGATCCTGACCAGTAATTATGGCCCCAGTExon 6GATGAGGCTCTTCACCCTTGATGAAGAACTGGTGGGGGAExon 7ATGGAAACATGGCTTTTTGTGGAGGCACCAGCTAGCCTTTAExon 8aPrimer was placed in the coding sequence because of flanking intronic repeats.GCAGATCAAAGGATCATGGAAGAGAGTTAACAAAGAACTGGGCExon 9GACATTTCCTGGTTTGTGGAAAATCTTAATCTACATCAAGGACACAExon 10TTCAGTTGTGTTCTGCCGAGCTTCTGCCACTGCCTTGAGTcDNA 2–4ACCCAGCGGCAGGAATAGGGAAGATCTTGCATGTGTAACAGa Primer was placed in the coding sequence because of flanking intronic repeats. Open table in a new tab Figure 2a, RT-PCR analysis of the ZDHHC9 gene by use of lymphocyte RNA from an affected male individual in family 602 and an unaffected control. A 547-bp PCR product was identified from cDNA made from control cells containing sequence from exons 2–4, by use of the predicted splice junctions. In family 602, only a 407-bp PCR product was identified. b, Diagram of the cDNA detected in family 602, which included an upstream splice-donor site, resulting in the loss of 140 bp at the terminus of exon 2, and the sequence chromatogram of the novel splicing event, leading to the mutation. c, Effect of the upstream splice-donor site within exon 2 spliced to exon 3. This results in a frameshift and truncated protein p.T11fsX33.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3Sequence alignment of the conserved palmitoyltransferase active site of proteins ZDHHC9, ZDHHC14, and ZDHHC5 in multiple species (Homo sapiens, Canis familiaris, Mus musculus, Gallus gallus, Danio rerio, Xenopus laevis, Tetraodon nigroviridis, Drosophila melanogaster, Caenorhabditis elegans, Neurospora crassa, and Saccharomyces cerevisiae). Sequence alignment was performed using ClustalW. Conserved amino acid residues are highlighted in yellow, and the two missense mutations are identified in red.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 4a, Diagrammatic representation of the exon structure of ZDHHC9, with positions of mutations found in families with XLMR. Exons that are translated are indicated by yellow shading. b, Diagrammatic representation of the protein ZDHHC9, with the palmitoyltransferase domain indicated by green shading. The location of the amino acid changes in the protein due to mutations in ZDHHC9 are indicated by arrows. The family numbers are in parentheses.View Large Image Figure ViewerDownload Hi-res image Download (PPT) The presenting phenotype in the four families was moderate mental retardation in two or more males. In three families (602, 031, and 576) a diagnosis of XLMR with a Marfanoid habitus or Marfan syndrome was considered. Although the physique of the affected individuals was generally a long and thin habitus, none met the Ghent criteria for Marfan syndrome.11De Paepe A Devereux RB Dietz HC Hennekam RC Pyeritz RE Revised diagnostic criteria for the Marfan syndrome.Am J Med Genet. 1996; 62: 417-426Crossref PubMed Scopus (1350) Google Scholar In family 152, FG syndrome was briefly considered for the diagnosis but was dismissed. The physique was not Marfanoid in this family either. In family 152, the uncle was said to be profoundly retarded and unable to walk or talk and needed full-time care. His problems were attributed to birth injury, because the umbilical cord was around his neck at birth. No other details are available. The two sibling nephews were referred when they were 6 and 4 years old, respectively, because both boys had developmental delay and moderate learning disability. The first child was born at term by elective cesarean delivery due to failure of progression during labor, but he did not require admission to a special-care baby unit after delivery. His birth weight was 3.4 kg. A solitary juvenile xanthogranuloma appeared at age 4 wk and disappeared at age 15 mo. Developmental delay was noted at age 8 mo, since the child was floppy and not sitting. He was not walking at age 18 mo, and speech and language were delayed. At age 6 years, his height was 111.8 cm (50th percentile), and his weight was 20.3 kg (25th percentile). His head circumference was 52.5 cm (75th percentile). A clinical diagnosis of FG syndrome was considered because of the presence of hypotonia, a cowlick, and a high forehead but, in the absence of macrocephaly, severe constipation, and hypertelorism, this clinical diagnosis was deemed unlikely. The clinical features of the second child were similar to those of the older brother, but the developmental progression was slower. His birth weight was 3.2 kg, and his growth parameters at age 4 years were the 25th percentile for height, the 75th percentile for weight, and the 75th percentile for head circumference. Results of metabolic investigations, including white blood cell enzymes, urine organic acids, very-long-chain fatty acids, and creatine kinase levels, were all normal. In family 602, two brothers presented with developmental delay. The older brother was delivered at term after an elective cesarean delivery at 42 wk gestation, and his birth weight was 4.2 kg. He walked at age 3 years 6 mo and developed limited speech at age 4 years 6 mo. At age 13 years, a diagnosis of Marfan syndrome was considered. His head circumference was 58 cm (>97th percentile), height was 178 cm (90th–97th percentile), arm span was 190 cm (span:height ratio 1.06), and upper:lower segment ratio was 0.93. Additional clinical features were pectus carinatum, pes planus, and arachnodactyly. Although he had at least two major skeletal features of Marfan syndrome, the results of eye examination and cardiac echocardiogram were normal. Additional investigations excluded homocystinuria and other metabolic diseases. The younger affected brother is a DZ twin and had similar features to the older affected brother, including pectus carinatum, pes planus, and thin facial features. The younger brother's height was in the 75th–90th percentile, his arm span:height ratio was 1.0, and his upper:lower segment ratio was 0.96. In adulthood, the younger affected brother has developed major behavioral problems, and a diagnosis of schizophrenia has been made. He receives medication in a supported environment. The unaffected twin is intellectually normal and does not have a Marfanoid habitus. In family 031, two brothers presented with developmental delay and mental retardation with unremarkable birth histories. They were described as having Marfanoid features. The older brother’s birth weight was 3.2 kg, and he was a slow feeder, sat at age 13 mo, walked at age 3 years, and talked at age 4 years. He attended a special school and lives semi-independently in a supervised home. As an adult, his head circumference is 55.5 cm (9th–25th percentile), his height is 169.5 cm (9th–25th percentile), and his arm span is 173.5 cm (span:height ratio 1.02), with mild fixed flexion deformity at the elbows. The younger brother has similar facial features, with large ears, long fingers and toes, and pes planus, and has similar growth and developmental parameters. His birth weight was 3.5 kg, and, at age 16 years, his height was 172.4 cm (25th percentile), his arm span was 176 cm (span:height ratio 1.02), and his head circumference was 57.6 cm (50th percentile). In family 576, the proband was referred to a genetics service because of joint hypermobility, pectus excavatum, long mobile digits, and delayed sitting at age 12 mo. Pregnancy and delivery were uncomplicated, but the child presented with pyloric stenosis at age 6 wk. Adducted thumbs were noted shortly after birth but gradually resolved spontaneously by age 14 mo. At age 14 mo, the child had a long face, strabismus, and prominent ears that were not crumpled. His palate was normal and not high, and examination of the spine showed that it was normal, with no evidence of kyphoscoliosis. Long, thin limbs were noted, with long digits, 5th-finger camptodactyly, and long toes with camptodactyly. His height was in the 90th–98th percentile, his weight was <50th percentile, and his head circumference was in the 50th–75th percentile. A clinical diagnosis of XLMR and Marfanoid habitus was made on the basis of the family history. The mother of this boy reported that her brother had a similar physique, was tall and thin, was double-jointed, and had similarly unusual hands. He also has significant learning difficulties and has managed little employment. She also has two maternal cousins who are affected. In summary, the clinical phenotype in the four families is one of hypotonia, significant delay in walking disproportionate to the intellectual disability, and a Marfanoid habitus in some individuals. ZDHHC9 (GenBank accession number NP_057116) is an integral membrane protein of 364 aa containing four predicted transmembrane spans, a proline-rich domain, and a zinc-finger DHHC (aspartic acid–histidine-histidine-cysteine) domain in the cytoplasmic loop. It is a palmitoyltransferase that catalyzes the posttranslational modification of RAS.12Swarthout JT Lobo S Farh L Croke MR Greentree WK Deschenes RJ Linder ME DHHC9 and GCP16 constitute a human protein fatty acyltransferase with specificity for H- and N-Ras.J Biol Chem. 2005; 280: 31141-31148Crossref PubMed Scopus (249) Google Scholar The ZDHHC9 gene is expressed highly in kidney, skeletal muscle, brain, lung, and liver; to a lesser extent in placenta, heart, colon, and small intestine; and at low levels in peripheral blood cells, thymus, and spleen.12Swarthout JT Lobo S Farh L Croke MR Greentree WK Deschenes RJ Linder ME DHHC9 and GCP16 constitute a human protein fatty acyltransferase with specificity for H- and N-Ras.J Biol Chem. 2005; 280: 31141-31148Crossref PubMed Scopus (249) Google Scholar ZDHHC9 forms a complex with GCP16 and colocalizes in the Golgi apparatus when overexpressed in mammalian cells. This complex palmitoylates HRAS and NRAS and not GAP-43 or Gαi1.12Swarthout JT Lobo S Farh L Croke MR Greentree WK Deschenes RJ Linder ME DHHC9 and GCP16 constitute a human protein fatty acyltransferase with specificity for H- and N-Ras.J Biol Chem. 2005; 280: 31141-31148Crossref PubMed Scopus (249) Google Scholar There may be additional target proteins modified by ZDHHC9, but they have not been identified thus far. In mammalian cells, palmitoylation determines both the temporal and spatial localization of NRAS and HRAS.13Rocks O Peyker A Kahms M Verveer PJ Koerner C Lumbierres M Kuhlmann J Waldmann H Wittinghofer A Bastiaens PI An acylation cycle regulates localization and activity of palmitoylated Ras isoforms.Science. 2005; 307: 1746-1752Crossref PubMed Scopus (647) Google Scholar KRAS is not subject to posttranslational modification by palmitoyltransferase and is mainly identified at the plasma membrane. Monopalmitoylated NRAS displays a more pronounced Golgi localization, a faster retrograde plasma membrane to Golgi trafficking, and a several-fold shorter time at the plasma membrane, compared with the dually palmitoylated HRAS species.13Rocks O Peyker A Kahms M Verveer PJ Koerner C Lumbierres M Kuhlmann J Waldmann H Wittinghofer A Bastiaens PI An acylation cycle regulates localization and activity of palmitoylated Ras isoforms.Science. 2005; 307: 1746-1752Crossref PubMed Scopus (647) Google Scholar, 14Rocks O Peyker A Bastiaens PI Spatio-temporal segregation of Ras signals: one ship, three anchors, many harbors.Curr Opin Cell Biol. 2006; 18: 351-357Crossref PubMed Scopus (114) Google Scholar Recently abnormalities in HRAS and KRAS have been identified in Costello syndrome (MIM 218040), cardiofaciocutaneous syndrome (MIM 115150), and Noonan syndrome (MIM 163950), suggesting that changes in these and other molecules in the RAS–mitogen-activated protein (MAP) kinase pathway can cause significant developmental abnormalities.15Aoki Y Niihori T Kawame H Kurosawa K Ohashi H Tanaka Y Filocamo M Kato K Suzuki Y Kure S et al.Germline mutations in HRAS proto-oncogene cause Costello syndrome.Nat Genet. 2005; 37: 1038-1040Crossref PubMed Scopus (525) Google Scholar, 16Schubbert S Zenker M Rowe SL Boll S Klein C Bollag G van der Burgt I Musante L Kalscheuer V Wehner LE et al.Germline KRAS mutations cause Noonan syndrome.Nat Genet. 2006; 38: 331-336Crossref PubMed Scopus (600) Google Scholar, 17Rodriguez-Viciana P Tetsu O Tidyman WE Estep AL Conger BA Cruz MS McCormick F Rauen KA Germline mutations in genes within the MAPK pathway cause cardio-facio-cutaneous syndrome.Science. 2006; 311: 1287-1290Crossref PubMed Scopus (462) Google Scholar, 18Niihori T Aoki Y Narumi Y Neri G Cave H Verloes A Okamoto N Hennekam RC Gillessen-Kaesbach G Wieczorek D et al.Germline KRAS and BRAF mutations in cardio-facio-cutaneous syndrome.Nat Genet. 2006; 38: 294-296Crossref PubMed Scopus (459) Google Scholar Interestingly, these syndromes are associated with a mental retardation phenotype, providing further evidence of the role of this pathway in intellectual processing. The mechanism by which loss-of-function mutations in ZDHHC9 cause mental retardation is unclear, but it may be through alteration of the relative proportion of the RAS proteins within the different compartments of nerve cells. This may result in alterations in the growth and development characteristics of neurons similar to those seen by alteration of palmitoylation of GAP-43 and PSD-95.19Gauthier-Campbell C Bredt DS Murphy TH El-Husseini AE-D Regulation of dendritic branching and filopodia formation in hippocampal neurons by specific acylated protein motifs.Mol Biol Cell. 2004; 15: 2205-2217Crossref PubMed Scopus (74) Google Scholar, 20El-Husseini AE-D Schnell E Dakoji S Sweeney N Zhou Q Prange O Gauthier-Campbell C Aguilera-Moreno A Nicoll RA Bredt DS Synaptic strength regulated by palmitate cycling on PSD-95.Cell. 2002; 108: 849-863Abstract Full Text Full Text PDF PubMed Scopus (463) Google Scholar Palmitoylation of PSD-95, a major component of the postsynaptic density, is required for postsynaptic targeting and clustering of glutamate receptors and palmitoylation of GAP43 is sufficient to alter the branching of dendrites and axons in hippocampal neurons. The finding of mutations in ZDHHC9 therefore adds a further layer of complexity to our understanding of the mental retardation phenotype, as it suggests that alterations in the concentrations and cellular distribution of normal proteins is sufficient to cause disease. Our findings provide further support for the importance of RAS signaling in the development of intellectual processing. Furthermore, now that the first palmitoyltransferase that causes mental retardation has been identified, defects in other palmitoylation transferases become good candidates for causing other forms of X-linked or autosomal forms of mental retardation.19Gauthier-Campbell C Bredt DS Murphy TH El-Husseini AE-D Regulation of dendritic branching and filopodia formation in hippocampal neurons by specific acylated protein motifs.Mol Biol Cell. 2004; 15: 2205-2217Crossref PubMed Scopus (74) Google Scholar, 20El-Husseini AE-D Schnell E Dakoji S Sweeney N Zhou Q Prange O Gauthier-Campbell C Aguilera-Moreno A Nicoll RA Bredt DS Synaptic strength regulated by palmitate cycling on PSD-95.Cell. 2002; 108: 849-863Abstract Full Text Full Text PDF PubMed Scopus (463) Google Scholar We thank the families, for their long-term cooperation in this work, and Luciannne Vandeleur, for tissue-culture support. This work was supported by Australian National Health and Medical Research Council program grant 400121; the State of New South Wales (NSW) Health Department, through their support of the NSW GOLD Service; National Institute of Child Health and Human Development grant HD26202; a grant from the South Carolina Department of Disabilities and Special Needs; and the Wellcome Trust.

Barrett's esophagus is an increasingly common disease that is strongly associated with reflux of stomach acid and usually a hiatus hernia, and it strongly predisposes to esophageal adenocarcinoma (EAC), a tumor with a very poor prognosis. We report the first genome-wide association study on Barrett's esophagus, comprising 1,852 UK cases and 5,172 UK controls in the discovery stage and 5,986 cases and 12,825 controls in the replication stage. Variants at two loci were associated with disease risk: chromosome 6p21, rs9257809 (Pcombined=4.09×10(-9); odds ratio (OR)=1.21, 95% confidence interval (CI)=1.13-1.28), within the major histocompatibility complex locus, and chromosome 16q24, rs9936833 (Pcombined=2.74×10(-10); OR=1.14, 95% CI=1.10-1.19), for which the closest protein-coding gene is FOXF1, which is implicated in esophageal development and structure. We found evidence that many common variants of small effect contribute to genetic susceptibility to Barrett's esophagus and that SNP alleles predisposing to obesity also increase risk for Barrett's esophagus.

We have identified truncating mutations in the human DLG3 (neuroendocrine dlg) gene in 4 of 329 families with moderate to severe X-linked mental retardation. DLG3 encodes synapse-associated protein 102 (SAP102), a member of the membrane-associated guanylate kinase protein family. Neuronal SAP102 is expressed during early brain development and is localized to the postsynaptic density of excitatory synapses. It is composed of three amino-terminal PDZ domains, an src homology domain, and a carboxyl-terminal guanylate kinase domain. The PDZ domains interact directly with the NR2 subunits of the NMDA glutamate receptor and with other proteins responsible for NMDA receptor localization, immobilization, and signaling. The mutations identified in this study all introduce premature stop codons within or before the third PDZ domain, and it is likely that this impairs the ability of SAP102 to interact with the NMDA receptor and/or other proteins involved in downstream NMDA receptor signaling pathways. NMDA receptors have been implicated in the induction of certain forms of synaptic plasticity, such as long-term potentiation and long-term depression, and these changes in synaptic efficacy have been proposed as neural mechanisms underlying memory and learning. The disruption of NMDA receptor targeting or signaling, as a result of the loss of SAP102, may lead to altered synaptic plasticity and may explain the intellectual impairment observed in individuals with DLG3 mutations.

A novel missense mutation in the mediator of RNA polymerase II transcription subunit 12 (MED12) gene has been found in the original family with Lujan syndrome and in a second family (K9359) that was initially considered to have Opitz-Kaveggia (FG) syndrome. A different missense mutation in the MED12 gene has been reported previously in the original family with FG syndrome and in five other families with compatible clinical findings. Neither sequence alteration has been found in over 1400 control X chromosomes. Lujan (Lujan-Fryns) syndrome is characterised by tall stature with asthenic habitus, macrocephaly, a tall narrow face, maxillary hypoplasia, a high narrow palate with dental crowding, a small or receding chin, long hands with hyperextensible digits, hypernasal speech, hypotonia, mild-to-moderate mental retardation, behavioural aberrations and dysgenesis of the corpus callosum. Although Lujan syndrome has not been previously considered to be in the differential diagnosis of FG syndrome, there are some overlapping clinical manifestations. Specifically, these are dysgenesis of the corpus callosum, macrocephaly/relative macrocephaly, a tall forehead, hypotonia, mental retardation and behavioural disturbances. Thus, it seems that these two X-linked mental retardation syndromes are allelic, with mutations in the MED12 gene.

Four groups recently reported the existence of an activating mutation of JAK2 in many patients with one of the classic myeloproliferative disorders (MPDs).[1][1]-[4][2] Mutant Janus kinase 2 (JAK2) has increased kinase activity, renders BaF3 cells cytokine independent, and produces erythrocytosis in

Mental retardation (MR) is the most frequent handicap among children and young adults. Although a large proportion of X-linked MR genes have been identified, only four genes responsible for autosomal-recessive nonsyndromic MR (AR-NSMR) have been described so far. Here, we report on two genes involved in autosomal-recessive and X-linked NSMR. First, autozygosity mapping in two sibs born to first-cousin French parents led to the identification of a region on 8p22-p23.1. This interval encompasses the gene N33/TUSC3 encoding one subunit of the oligosaccharyltransferase (OTase) complex, which catalyzes the transfer of an oligosaccharide chain on nascent proteins, the key step of N-glycosylation. Sequencing N33/TUSC3 identified a 1 bp insertion, c.787_788insC, resulting in a premature stop codon, p.N263fsX300, and leading to mRNA decay. Surprisingly, glycosylation analyses of patient fibroblasts showed normal N-glycan synthesis and transfer, suggesting that normal N-glycosylation observed in patient fibroblasts may be due to functional compensation. Subsequently, screening of the X-linked N33/TUSC3 paralog, the IAP gene, identified a missense mutation (c.932T-->G, p.V311G) in a family with X-linked NSMR. Recent studies of fucosylation and polysialic-acid modification of neuronal cell-adhesion glycoproteins have shown the critical role of glycosylation in synaptic plasticity. However, our data provide the first demonstration that a defect in N-glycosylation can result in NSMR. Together, our results demonstrate that fine regulation of OTase activity is essential for normal cognitive-function development, providing therefore further insights to understand the pathophysiological bases of MR.

LKB1/STK11 is a multitasking tumour suppressor kinase. Germline inactivating mutations of the gene are responsible for the Peutz-Jeghers hereditary cancer syndrome. It is also somatically inactivated in approximately 30% of non-small-cell lung cancer (NSCLC). Here, we report that LKB1/KRAS mutant NSCLC cell lines are sensitive to the MEK inhibitor CI-1040 shown by a dose-dependent reduction in proliferation rate, whereas LKB1 and KRAS mutations alone do not confer similar sensitivity. We show that this subset of NSCLC is also sensitised to the mTOR inhibitor rapamycin. Importantly, the data suggest that LKB1/KRAS mutant NSCLCs are a genetically and functionally distinct subset and further suggest that this subset of lung cancers might afford an opportunity for exploitation of anti-MAPK/mTOR-targeted therapies.

Parkinson's disease (PD) is the second most common neurodegenerative disease affecting 1-2% in people >60 and 3-4% in people >80. Genome-wide association (GWA) studies have now implicated significant evidence for association in at least 18 genomic regions. We have studied a large PD-meta analysis and identified a significant excess of SNPs (P < 1 × 10(-16)) that are associated with PD but fall short of the genome-wide significance threshold. This result was independent of variants at the 18 previously implicated regions and implies the presence of additional polygenic risk alleles. To understand how these loci increase risk of PD, we applied a pathway-based analysis, testing for biological functions that were significantly enriched for genes containing variants associated with PD. Analysing two independent GWA studies, we identified that both had a significant excess in the number of functional categories enriched for PD-associated genes (minimum P = 0.014 and P = 0.006, respectively). Moreover, 58 categories were significantly enriched for associated genes in both GWA studies (P < 0.001), implicating genes involved in the 'regulation of leucocyte/lymphocyte activity' and also 'cytokine-mediated signalling' as conferring an increased susceptibility to PD. These results were unaltered by the exclusion of all 178 genes that were present at the 18 genomic regions previously reported to be strongly associated with PD (including the HLA locus). Our findings, therefore, provide independent support to the strong association signal at the HLA locus and imply that the immune-related genetic susceptibility to PD is likely to be more widespread in the genome than previously appreciated.

Combining data from genome-wide association studies (GWAS) conducted at different locations, using genotype imputation and fixed-effects meta-analysis, has been a powerful approach for dissecting complex disease genetics in populations of European ancestry. Here we investigate the feasibility of applying the same approach in Africa, where genetic diversity, both within and between populations, is far more extensive. We analyse genome-wide data from approximately 5,000 individuals with severe malaria and 7,000 population controls from three different locations in Africa. Our results show that the standard approach is well powered to detect known malaria susceptibility loci when sample sizes are large, and that modern methods for association analysis can control the potential confounding effects of population structure. We show that pattern of association around the haemoglobin S allele differs substantially across populations due to differences in haplotype structure. Motivated by these observations we consider new approaches to association analysis that might prove valuable for multicentre GWAS in Africa: we relax the assumptions of SNP-based fixed effect analysis; we apply Bayesian approaches to allow for heterogeneity in the effect of an allele on risk across studies; and we introduce a region-based test to allow for heterogeneity in the location of causal alleles.

To identify susceptibility loci for visceral leishmaniasis, we undertook genome-wide association studies in two populations: 989 cases and 1,089 controls from India and 357 cases in 308 Brazilian families (1,970 individuals). The HLA-DRB1-HLA-DQA1 locus was the only region to show strong evidence of association in both populations. Replication at this region was undertaken in a second Indian population comprising 941 cases and 990 controls, and combined analysis across the three cohorts for rs9271858 at this locus showed P(combined) = 2.76 × 10(-17) and odds ratio (OR) = 1.41, 95% confidence interval (CI) = 1.30-1.52. A conditional analysis provided evidence for multiple associations within the HLA-DRB1-HLA-DQA1 region, and a model in which risk differed between three groups of haplotypes better explained the signal and was significant in the Indian discovery and replication cohorts. In conclusion, the HLA-DRB1-HLA-DQA1 HLA class II region contributes to visceral leishmaniasis susceptibility in India and Brazil, suggesting shared genetic risk factors for visceral leishmaniasis that cross the epidemiological divides of geography and parasite species.

Normal thyroid function is essential for health, but its genetic architecture remains poorly understood. Here, for the heritable thyroid traits thyrotropin (TSH) and free thyroxine (FT4), we analyse whole-genome sequence data from the UK10K project (N=2,287). Using additional whole-genome sequence and deeply imputed data sets, we report meta-analysis results for common variants (MAF≥1%) associated with TSH and FT4 (N=16,335). For TSH, we identify a novel variant in SYN2 (MAF=23.5%, P=6.15 × 10(-9)) and a new independent variant in PDE8B (MAF=10.4%, P=5.94 × 10(-14)). For FT4, we report a low-frequency variant near B4GALT6/SLC25A52 (MAF=3.2%, P=1.27 × 10(-9)) tagging a rare TTR variant (MAF=0.4%, P=2.14 × 10(-11)). All common variants explain ≥20% of the variance in TSH and FT4. Analysis of rare variants (MAF<1%) using sequence kernel association testing reveals a novel association with FT4 in NRG1. Our results demonstrate that increased coverage in whole-genome sequence association studies identifies novel variants associated with thyroid function.

Zeb1, a zinc finger E-box binding homeobox epithelial-mesenchymal transition (EMT) transcription factor, confers properties of “stemness,” such as self-renewal, in cancer. Yet little is known about the function of Zeb1 in adult stem cells. Here, we used the hematopoietic system as a well-established paradigm of stem cell biology to evaluate Zeb1-mediated regulation of adult stem cells. We employed a conditional genetic approach using the Mx1-Cre system to specifically knock out (KO) Zeb1 in adult hematopoietic stem cells (HSCs) and their downstream progeny. Acute genetic deletion of Zeb1 led to rapid-onset thymic atrophy and apoptosis-driven loss of thymocytes and T cells. A profound cell-autonomous self-renewal defect and multilineage differentiation block were observed in Zeb1-KO HSCs. Loss of Zeb1 in HSCs activated transcriptional programs of deregulated HSC maintenance and multilineage differentiation genes and of cell polarity consisting of cytoskeleton-, lipid metabolism/lipid membrane–, and cell adhesion–related genes. Notably, epithelial cell adhesion molecule (EpCAM) expression was prodigiously upregulated in Zeb1-KO HSCs, which correlated with enhanced cell survival, diminished mitochondrial metabolism, ribosome biogenesis, and differentiation capacity and an activated transcriptomic signature associated with acute myeloid leukemia (AML) signaling. ZEB1 expression was downregulated in AML patients, and Zeb1 KO in the malignant counterparts of HSCs — leukemic stem cells (LSCs) — accelerated MLL-AF9– and Meis1a/Hoxa9-driven AML progression, implicating Zeb1 as a tumor suppressor in AML LSCs. Thus, Zeb1 acts as a transcriptional regulator in hematopoiesis, critically coordinating HSC self-renewal, apoptotic, and multilineage differentiation fates required to suppress leukemic potential in AML.

Cherubism is a rare familial disease of childhood characterized by proliferative lesions within the mandible and maxilla that lead to prominence of the lower face and an appearance reminiscent of the cherubs portrayed in Renaissance art. Resolution of these bony abnormalities is often observed after puberty. Many cases are inherited in an autosomal dominant fashion, although several cases without a family history have been reported. Using two families with clinically, radiologically, and/or histologically proved cherubism, we have performed a genomewide linkage search and have localized the gene to chromosome 4p16.3, with a maximum multipoint LOD score of 5. 64. Both families showed evidence of linkage to this locus. Critical meiotic recombinants place the gene in a 3-cM interval between D4S127 and 4p-telomere. Within this region a strong candidate is the gene for fibroblast growth factor receptor 3 (FGFR3); mutations in this gene have been implicated in a diverse set of disorders of bone development.

In a systematic sequencing screen of the coding exons of the X chromosome in 250 families with X-linked mental retardation (XLMR), we identified two nonsense mutations and one consensus splice-site mutation in the AP1S2 gene on Xp22 in three families. Affected individuals in these families showed mild-to-profound mental retardation. Other features included hypotonia early in life and delay in walking. AP1S2 encodes an adaptin protein that constitutes part of the adaptor protein complex found at the cytoplasmic face of coated vesicles located at the Golgi complex. The complex mediates the recruitment of clathrin to the vesicle membrane. Aberrant endocytic processing through disruption of adaptor protein complexes is likely to result from the AP1S2 mutations identified in the three XLMR-affected families, and such defects may plausibly cause abnormal synaptic development and function. AP1S2 is the first reported XLMR gene that encodes a protein directly involved in the assembly of endocytic vesicles.

To identify a novel amplified cancer gene a systematic screen of 975 human cancer DNA samples, 750 cell lines and 225 primary tumors, using the Affymetrix 10K SNP microarray was undertaken. The screen identified 193 amplicons. A previously uncharacterized amplicon located on 6p21.2 whose 1 Mb minimal common amplified region contained eight genes (GLO1, DNAH8, GLP1R, C6orf64, KCNK5, KCNK17, KCNK16, and C6orf102) was further investigated to determine which gene(s) are the biological targets of this amplicon. Real time quantitative PCR (qPCR) analysis of all amplicon 6p21.2 genes in 618 human cancer cell lines identified GLO1, encoding glyoxalase 1, to be the most frequently amplified gene [twofold or greater amplification in 8.4% (49/536) of cancers]. Also the association between amplification and overexpression was greatest for GLO1. RNAi knockdown of GLO1 had the greatest and most consistent impact on cell accumulation and apoptosis. Cell lines with GLO1 amplification were more sensitive to inhibition of GLO1 by bromobenzylglutathione cyclopentyl diester (BBGC). Subsequent qPCR of 520 primary tumor samples identified twofold and greater amplification of GLO1 in 8/37 (22%) of breast, 12/71 (17%) of sarcomas, 6/53 (11.3%) of nonsmall cell lung, 2/23 (8.7%) of bladder, 6/93 (6.5%) of renal and 5/83 (6%) of gastric cancers. Amplification of GLO1 was rare in colon cancer (1/35) and glioma (1/94). Collectively the results indicate that GLO1 is at least one of the targets of gene amplification on 6p21.2 and may represent a useful target for therapy in cancers with GLO1 amplification.

Abdominal aortic aneurysm (AAA) is a common cardiovascular disease among older people and demonstrates significant heritability. In contrast to similar complex diseases, relatively few genetic associations with AAA have been confirmed. We reanalyzed our genome-wide study and carried through to replication suggestive discovery associations at a lower level of significance.A genome-wide association study was conducted using 1830 cases from the United Kingdom, New Zealand, and Australia with infrarenal aorta diameter≥30 mm or ruptured AAA and 5435 unscreened controls from the 1958 Birth Cohort and National Blood Service cohort from the Wellcome Trust Case Control Consortium. Eight suggestive associations with P<1×10(-4) were carried through to in silico replication in 1292 AAA cases and 30,503 controls. One single-nucleotide polymorphism associated with P<0.05 after Bonferroni correction in the in silico study underwent further replication (706 AAA cases and 1063 controls from the United Kingdom, 507 AAA cases and 199 controls from Denmark, and 885 AAA cases and 1000 controls from New Zealand). Low-density lipoprotein receptor (LDLR) rs6511720 A was significantly associated overall and in 3 of 5 individual replication studies. The full study showed an association that reached genome-wide significance (odds ratio, 0.76; 95% confidence interval, 0.70-0.83; P=2.08×10(-10)).LDLR rs6511720 is associated with AAA. This finding is consistent with established effects of this variant on coronary artery disease. Shared causal pathways with other cardiovascular diseases may present novel opportunities for preventative and therapeutic strategies for AAA.

Dissecting how genetic and environmental influences impact on learning is helpful for maximizing numeracy and literacy. Here we show, using twin and genome-wide analysis, that there is a substantial genetic component to children's ability in reading and mathematics, and estimate that around one half of the observed correlation in these traits is due to shared genetic effects (so-called Generalist Genes). Thus, our results highlight the potential role of the learning environment in contributing to differences in a child's cognitive abilities at age twelve.

Subversion of transcription factor (TF) activity in hematopoietic stem/progenitor cells (HSPCs) leads to the development of therapy-resistant leukemic stem cells (LSCs) that drive fulminant acute myeloid leukemia (AML). Using a conditional mouse model where zinc-finger TF Gata2 was deleted specifically in hematopoietic cells, we show that knockout of Gata2 leads to rapid and complete cell-autonomous loss of adult hematopoietic stem cells. By using short hairpin RNAi to target GATA2, we also identify a requirement for GATA2 in human HSPCs. In Meis1a/Hoxa9-driven AML, deletion of Gata2 impedes maintenance and self-renewal of LSCs. Ablation of Gata2 enforces an LSC-specific program of enhanced apoptosis, exemplified by attenuation of anti-apoptotic factor BCL2, and re-instigation of myeloid differentiation--which is characteristically blocked in AML. Thus, GATA2 acts as a critical regulator of normal and leukemic stem cells and mediates transcriptional networks that may be exploited therapeutically to target key facets of LSC behavior in AML.

Homozygous deletions of recessive cancer genes and fragile sites are known to occur in human cancers. We identified 281 homozygous deletions in 636 cancer cell lines. Of these deletions, 86 were homozygous deletions of known recessive cancer genes, 17 were of sequenced common fragile sites, and 178 were in genomic regions that do not overlap known recessive oncogenes or fragile sites (“unexplained” homozygous deletions). Some cancer cell lines have multiple homozygous deletions whereas others have none, suggesting intrinsic variation in the tendency to develop this type of genetic abnormality ( P &lt; 0.001). The 178 unexplained homozygous deletions clustered into 131 genomic regions, 27 of which exhibit homozygous deletions in more than one cancer cell line. This degree of clustering indicates that the genomic positions of the unexplained homozygous deletions are not randomly determined ( P &lt; 0.001). Many homozygous deletions, including those that are in multiple clusters, do not overlap known genes and appear to be in intergenic DNA. Therefore, to elucidate further the pathogenesis of homozygous deletions in cancer, we investigated the genome landscape within unexplained homozygous deletions. The gene count within homozygous deletions is low compared with the rest of the genome. There are also fewer short interspersed nuclear elements (SINEs), long interspersed nuclear elements (LINEs), and low-copy-number repeats (LCRs). However, DNA within homozygous deletions has higher flexibility. These features may signal the presence of currently unrecognized zones of susceptibility to DNA rearrangement. They may also reflect a tendency to reduce the adverse effects of homozygous deletions by minimizing the number of genes removed.

Abstract The protein kinase gene family is the most frequently mutated in human cancer. Previous work has documented activating mutations in the KIT receptor tyrosine kinase in testicular germ‐cell tumors (TGCT). To investigate further the potential role of mutated protein kinases in the development of TGCT and to characterize the prevalence and patterns of point mutations in these tumors, we have sequenced the coding exons and splice junctions of the annotated protein kinase family of 518 genes in a series of seven seminomas and six nonseminomas. Our results show a remarkably low mutation frequency, with only a single somatic point mutation, a K277E mutation in the STK10 gene, being identified in a total of more than 15 megabases of sequence analyzed. Sequencing of STK10 in an additional 40 TGCTs revealed no further mutations. Comparative genomic hybridization and LOH analysis using SNP arrays demonstrated that the 13 TGCTs mutationally screened through the 518 protein kinase genes were uniformly aneuploid with consistent chromosomal gains on 12p, 8q, 7, and X and losses on 13q, 18q, 11q, and 4q. Our results do not provide evidence for a mutated protein kinase implicated in the development of TGCT other than KIT . Moreover, they demonstrate that the general prevalence of point mutations in TGCT is low, in contrast to the high frequency of copy number changes. © 2005 Wiley‐Liss, Inc.

Abstract Mutations in known breast cancer susceptibility genes account for a minority of the familial aggregation of the disease. To search for further breast cancer susceptibility genes, we performed a combined analysis of four genome‐wide linkage screens, which included a total of 149 multiple case breast cancer families. All families included at least three cases of breast cancer diagnosed below age 60 years, at least one of whom had been tested and found not to carry a BRCA1 or BRCA2 mutation. Evidence for linkage was assessed using parametric linkage analysis, assuming both a dominant and a recessive mode of inheritance, and using nonparametric methods. The highest LOD score obtained in any analysis of the combined data was 1.80 under the dominant model, in a region on chromosome 4 close to marker D4S392 . Three further LOD scores over 1 were identified in the parametric analyses and two in the nonparametric analyses. A maximum LOD score of 2.40 was found on chromosome arm 2p in families with four or more cases of breast cancer diagnosed below age 50 years. The number of linkage peaks did not differ from the number expected by chance. These results suggest regions that may harbor novel breast cancer susceptibility genes. They also indicate that no single gene is likely to account for a large fraction of the familial aggregation of breast cancer that is not due to mutations in BRCA1 or BRCA2 . © 2006 Wiley‐Liss, Inc.

In the course of systematic screening of the X-chromosome coding sequences in 250 families with nonsyndromic X-linked mental retardation (XLMR), two families were identified with truncating mutations in BRWD3, a gene encoding a bromodomain and WD-repeat domain-containing protein. In both families, the mutation segregates with the phenotype in affected males. Affected males have macrocephaly with a prominent forehead, large cupped ears, and mild-to-moderate intellectual disability. No truncating variants were found in 520 control X chromosomes. BRWD3 is therefore a new gene implicated in the etiology of XLMR associated with macrocephaly and may cause disease by altering intracellular signaling pathways affecting cellular proliferation.

Mental retardation (MR) is characterized by cognitive impairment with an IQ <70. Many of the major causes are genetically determined and the approximately 30% male excess suggests that mutations in genes carried on the X chromosome are disproportionably represented. One such gene, jumonji AT-rich interactive domain 1C (JARID1C) on Xp11.2, has been identified in families with X-linked MR (XLMR), with 18 different mutations reported to date. As part of a systematic resequencing of 720 genes in 208 XLMR families of the International Genetic of Learning Disability (IGOLD) consortium, two novel nucleotide changes in the JARID1C coding region were identified, with the nucleotide changes segregating with the disease phenotype in the two families. The first mutation is a single-nucleotide insertion in exon 21 (c.3258_3259insC p.K1087fs(*)43) causing a frameshift and resulting in a premature termination codon (PTC). Such PTC-containing mRNAs are generally degraded by nonsense-mediated mRNA decay (NMD) surveillance, but our results show that this is not the case with this mutation. The other change is a single-nucleotide substitution in exon 12 (c.1160C>A) in a published family with nonsyndromic MR, MRX13. This change occurs in a highly conserved amino acid, with proline (P) being substituted by threonine (T) (p.P554T). [corrected] Functional analysis shows that this amino-acid substitution compromises both tri- and didemethylase activity of the JARID1C protein. We conclude that the two novel changes impair JARID1C protein function and are disease-causing mutations in these families.

The analysis of individuals with ciliary chondrodysplasias can shed light on sensitive mechanisms controlling ciliogenesis and cell signalling that are essential to embryonic development and survival. Here we identify TCTEX1D2 mutations causing Jeune asphyxiating thoracic dystrophy with partially penetrant inheritance. Loss of TCTEX1D2 impairs retrograde intraflagellar transport (IFT) in humans and the protist Chlamydomonas, accompanied by destabilization of the retrograde IFT dynein motor. We thus define TCTEX1D2 as an integral component of the evolutionarily conserved retrograde IFT machinery. In complex with several IFT dynein light chains, it is required for correct vertebrate skeletal formation but may be functionally redundant under certain conditions.

Bacteremia (bacterial bloodstream infection) is a major cause of illness and death in sub-Saharan Africa but little is known about the role of human genetics in susceptibility. We conducted a genome-wide association study of bacteremia susceptibility in more than 5,000 Kenyan children as part of the Wellcome Trust Case Control Consortium 2 (WTCCC2). Both the blood-culture-proven bacteremia case subjects and healthy infants as controls were recruited from Kilifi, on the east coast of Kenya. Streptococcus pneumoniae is the most common cause of bacteremia in Kilifi and was thus the focus of this study. We identified an association between polymorphisms in a long intergenic non-coding RNA (lincRNA) gene (AC011288.2) and pneumococcal bacteremia and replicated the results in the same population (p combined = 1.69 × 10(-9); OR = 2.47, 95% CI = 1.84-3.31). The susceptibility allele is African specific, derived rather than ancestral, and occurs at low frequency (2.7% in control subjects and 6.4% in case subjects). Our further studies showed AC011288.2 expression only in neutrophils, a cell type that is known to play a major role in pneumococcal clearance. Identification of this novel association will further focus research on the role of lincRNAs in human infectious disease.

Lymphedema-distichiasis (LD) is a dominantly inherited syndrome with onset of lymphedema at or just after puberty. Most affected individuals have distichiasis-fine hairs arising inappropriately from the eyelid meibomian glands-which is evident from birth. A study of three families with LD has shown linkage to chromosome 16q24.3, and subsequent analysis of the region for recombinant genes places the locus between D16S422 and D16S3074, a distance of approximately 16 cM. Possible candidate genes in this interval include the N-proteinase for type 3 collagen, PCOLN3; the metalloprotease PRSM1; and the cell matrix-adhesion regulator, CMAR.

Juvenile hyaline fibromatosis (JHF) is an autosomal recessive condition characterized by multiple subcutaneous nodular tumors, gingival fibromatosis, flexion contractures of the joints, and an accumulation of hyaline in the dermis. We performed a genomewide linkage search in two families with JHF from the same region of the Indian state of Gujarat and identified a region of homozygosity on chromosome 4q21. Dense microsatellite analyses within this interval in five families with JHF who were from diverse origins demonstrate that all are compatible with linkage to chromosome 4q21 (multipoint LOD score 5.5). Meiotic recombinants place the gene for JHF within a 7-cM interval bounded by D4S2393 and D4S395.

The catechol-O-methyltranferase (COMT) is one of the main enzymes that metabolise dopamine in the brain. The Val158Met polymorphism in the <i>COMT</i> gene (<i>rs4680</i>) causes a trimodal distribution of high (Val/Val), intermediate (Val/Met) and low (Met/Met) enzyme activity. We tested whether the Val158Met polymorphism is a modifier of the age at onset (AAO) in Parkinson9s disease (PD). The <i>rs4680</i> was genotyped in a total of 16 609 subjects from five independent cohorts of European and North American origin (5886 patients with PD and 10 723 healthy controls). The multivariate analysis for comparing PD and control groups was based on a stepwise logistic regression, with gender, age and cohort origin included in the initial model. The multivariate analysis of the AAO was a mixed linear model, with <i>COMT</i> genotype and gender considered as fixed effects and cohort and cohort-gender interaction as random effects. <i>COMT</i> genotype was coded as a quantitative variable, assuming a codominant genetic effect. The distribution of the COMT polymorphism was not significantly different in patients and controls (p=0.22). The Val allele had a significant effect on the AAO with a younger AAO in patients with the Val/Val (57.1±13.9, p=0.03) than the Val/Met (57.4±13.9) and the Met/Met genotypes (58.3±13.5). The difference was greater in men (1.9 years between Val/Val and Met/Met, p=0.007) than in women (0.2 years, p=0.81). Thus, the Val158Met COMT polymorphism is not associated with PD in the Caucasian population but acts as a modifier of the AAO in PD with a sexual dimorphism: the Val allele is associated with a younger AAO in men with idiopathic PD.

Abstract Variants at microRNA-137 (MIR137) , one of the most strongly associated schizophrenia risk loci identified to date, have been associated with poorer cognitive performance. As microRNA-137 is known to regulate the expression of ~1900 other genes, including several that are independently associated with schizophrenia, we tested whether this gene set was also associated with variation in cognitive performance. Our analysis was based on an empirically derived list of genes whose expression was altered by manipulation of MIR137 expression. This list was cross-referenced with genome-wide schizophrenia association data to construct individual polygenic scores. We then tested, in a sample of 808 patients and 192 controls, whether these risk scores were associated with altered performance on cognitive functions known to be affected in schizophrenia. A subgroup of healthy participants also underwent functional imaging during memory ( n =108) and face processing tasks ( n =83). Increased polygenic risk within the empirically derived miR-137 regulated gene score was associated with significantly lower performance on intelligence quotient, working memory and episodic memory. These effects were observed most clearly at a polygenic threshold of P =0.05, although significant results were observed at all three thresholds analyzed. This association was found independently for the gene set as a whole, excluding the schizophrenia-associated MIR137 SNP itself. Analysis of the spatial working memory fMRI task further suggested that increased risk score (thresholded at P =10 −5 ) was significantly associated with increased activation of the right inferior occipital gyrus. In conclusion, these data are consistent with emerging evidence that MIR137 associated risk for schizophrenia may relate to its broader downstream genetic effects.

Acute anterior uveitis (AAU) involves inflammation of the iris and ciliary body of the eye. It occurs both in isolation and as a complication of ankylosing spondylitis (AS). It is strongly associated with HLA-B*27, but previous studies have suggested that further genetic factors may confer additional risk. We sought to investigate this using the Illumina Exomechip microarray, to compare 1504 cases with AS and AAU, 1805 with AS but no AAU and 21 133 healthy controls. We also used a heterogeneity test to test the differences in effect size between AS with AAU and AS without AAU. In the analysis comparing AS+AAU+ cases versus controls, HLA-B*27 and HLA-A*02:01 were significantly associated with the presence of AAU (P<10−300 and P=6 × 10−8, respectively). Secondary independent association with PSORS1C3 (P=4.7 × 10−5) and TAP2 (P=1.1 × 10−5) were observed in the major histocompatibility complex. There was a new suggestive association with a low-frequency variant at zinc-finger protein 154 in the AS without AAU versus control analysis (zinc-finger protein 154 (ZNF154), P=2.2 × 10−6). Heterogeneity testing showed that rs30187 in ERAP1 has a larger effect on AAU compared with that in AS alone. These findings also suggest that variants in ERAP1 have a differential impact on the risk of AAU when compared with AS, and hence the genetic risk for AAU differs from AS.

Abstract Cranial growth and development is a complex process which affects the closely related traits of head circumference (HC) and intracranial volume (ICV). The underlying genetic influences shaping these traits during the transition from childhood to adulthood are little understood, but might include both age-specific genetic factors and low-frequency genetic variation. Here, we model the developmental genetic architecture of HC, showing this is genetically stable and correlated with genetic determinants of ICV. Investigating up to 46,000 children and adults of European descent, we identify association with final HC and/or final ICV + HC at 9 novel common and low-frequency loci, illustrating that genetic variation from a wide allele frequency spectrum contributes to cranial growth. The largest effects are reported for low-frequency variants within TP53 , with 0.5 cm wider heads in increaser-allele carriers versus non-carriers during mid-childhood, suggesting a previously unrecognized role of TP53 transcripts in human cranial development.

American Journal of Medical Genetics Part AVolume 143A, Issue 4 p. 390-394 Research Letter A novel Gln358Glu mutation in ectodysplasin A associated with X-linked dominant incisor hypodontia†‡ Patrick Tarpey, Patrick Tarpey Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorTrevor J. Pemberton, Trevor J. Pemberton Institute for Genetic Medicine, University of Southern California, Los Angeles, CaliforniaSearch for more papers by this authorDavid W. Stockton, David W. Stockton Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas Department of Internal Medicine, Baylor College of Medicine, Houston, Texas Department of Ophthalmology, Baylor College of Medicine, Houston, Texas Departments of Pediatrics and Internal Medicine, Wayne State University School of Medicine, Detroit, MichiganSearch for more papers by this authorParimal Das, Parimal Das Department of Neurology, Baylor College of Medicine, Houston, TexasSearch for more papers by this authorVasiliki Ninis, Vasiliki Ninis Department of Neurology, Baylor College of Medicine, Houston, TexasSearch for more papers by this authorSarah Edkins, Sarah Edkins Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorP. Andrew Futreal, P. Andrew Futreal Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorRichard Wooster, Richard Wooster Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorSushanth Kamath, Sushanth Kamath Kasturba Medical College, Mangalore, IndiaSearch for more papers by this authorRabindra Nayak, Rabindra Nayak Ambedkar Medical College, Kadugondanahalli, Bangalore, IndiaSearch for more papers by this authorMichael R. Stratton, Michael R. Stratton Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorPragna I. Patel, Corresponding Author Pragna I. Patel pragna@usc.edu Institute for Genetic Medicine, University of Southern California, Los Angeles, California Center for Craniofacial Molecular Biology, University of Southern California, Los Angeles, CaliforniaInstitute for Genetic Medicine, University of Southern California, 2250 Alcazar Street, IGM-240, Los Angeles, CA 90033.Search for more papers by this author Patrick Tarpey, Patrick Tarpey Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorTrevor J. Pemberton, Trevor J. Pemberton Institute for Genetic Medicine, University of Southern California, Los Angeles, CaliforniaSearch for more papers by this authorDavid W. Stockton, David W. Stockton Department of Molecular and Human Genetics, Baylor College of Medicine, Houston, Texas Department of Internal Medicine, Baylor College of Medicine, Houston, Texas Department of Ophthalmology, Baylor College of Medicine, Houston, Texas Departments of Pediatrics and Internal Medicine, Wayne State University School of Medicine, Detroit, MichiganSearch for more papers by this authorParimal Das, Parimal Das Department of Neurology, Baylor College of Medicine, Houston, TexasSearch for more papers by this authorVasiliki Ninis, Vasiliki Ninis Department of Neurology, Baylor College of Medicine, Houston, TexasSearch for more papers by this authorSarah Edkins, Sarah Edkins Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorP. Andrew Futreal, P. Andrew Futreal Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorRichard Wooster, Richard Wooster Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorSushanth Kamath, Sushanth Kamath Kasturba Medical College, Mangalore, IndiaSearch for more papers by this authorRabindra Nayak, Rabindra Nayak Ambedkar Medical College, Kadugondanahalli, Bangalore, IndiaSearch for more papers by this authorMichael R. Stratton, Michael R. Stratton Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, Cambridge, UKSearch for more papers by this authorPragna I. Patel, Corresponding Author Pragna I. Patel pragna@usc.edu Institute for Genetic Medicine, University of Southern California, Los Angeles, California Center for Craniofacial Molecular Biology, University of Southern California, Los Angeles, CaliforniaInstitute for Genetic Medicine, University of Southern California, 2250 Alcazar Street, IGM-240, Los Angeles, CA 90033.Search for more papers by this author First published: 26 January 2007 https://doi.org/10.1002/ajmg.a.31567Citations: 40 † Patrick Tarpey and Trevor Pemberton contributed equally to this work. ‡ How to cite this article: Tarpey P, Pemberton TJ, Stockton DW, Das P, Ninis V, Edkins S, Futreal PA, Wooster R, Kamath S, Nayak R, Stratton MR, Patel PI. 2007. A novel Gln358Glu mutation in ectodysplasin A associated with X-linked dominant incisor hypodontia. Am J Med Genet Part A 143A:390–394. Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Citing Literature Volume143A, Issue415 February 2007Pages 390-394 RelatedInformation

Rare and functional SIAE variants are not associated with autoimmune disease risk in up to 66,924 individuals of European ancestry

Ankylosing spondylitis (AS) is a common chronic immune-mediated arthropathy affecting primarily the spine and pelvis. The condition is strongly associated with HLA-B*27 as well as other human leukocyte antigen variants and at least 47 individual non-MHC-associated variants. However, substantial additional heritability remains as yet unexplained. To identify further genetic variants associated with the disease, we undertook an association study of AS in 5,040 patients and 21,133 healthy controls using the Illumina Exomechip microarray. A novel association achieving genome-wide significance was noted at CDKAL1. Suggestive associations were demonstrated with common variants in FAM118A, C7orf72 and FAM114A1 and with a low-frequency variant in PNPLA1. Two of the variants have been previously associated with inflammatory bowel disease (IBD; CDKAL1 and C7orf72). These findings further increase the evidence for the marked similarity of genetic risk factors for IBD and AS, consistent with the two diseases having similar aetiopathogenesis.

To discover quantitative trait loci for intraocular pressure, a major risk factor for glaucoma and the only modifiable one, we performed a genome-wide association study on a discovery cohort of 2175 individuals from Sydney, Australia. We found a novel association between intraocular pressure and a common variant at 7p21 near to GLCCI1 and ICA1. The findings in this region were confirmed through two UK replication cohorts totalling 4866 individuals (rs59072263, P(combined) = 1.10 × 10(-8)). A copy of the G allele at this SNP is associated with an increase in mean IOP of 0.45 mmHg (95%CI = 0.30-0.61 mmHg). These results lend support to the implication of vesicle trafficking and glucocorticoid inducibility pathways in the determination of intraocular pressure and in the pathogenesis of primary open-angle glaucoma.

We describe three families with X-linked mental retardation, two with a deletion of a single amino acid and one with a missense mutation in the proximal domain of the RSK2(RPS6KA3) (ribosomal protein S6 kinase, 90 kDa, polypeptide 3) protein similar to mutations found in Coffin-Lowry syndrome (CLS). In two families, the clinical diagnosis had been nonsyndromic X-linked mental retardation. In the third family, although CLS had been suspected, the clinical features were atypical and the degree of intellectual disability much less than expected. These families show that strict reliance on classical clinical criteria for mutation testing may result in a missed diagnosis. A less targeted screening approach to mutation testing is advocated.

We report the development of a heteroduplex-based mutation detection method using multicapillary automated sequencers, known as conformation-sensitive capillary electrophoresis (CSCE). Our optimized CSCE protocol detected 93 of 95 known base substitution sequence variants. Since the optimization of the method, we have analyzed 215 Mb of DNA and identified 3397 unique variants. An analysis of this data set indicates that the sensitivity of CSCE is above 95% in the central 56% of the average PCR product. To fully exploit the mutation detection capacity of this method, we have developed software, canplot, which automatically compares normal and test results to prioritize samples that are most likely to contain variants. Using multiple fluorescent dyes, CSCE has the capacity to screen over 2.2 Mb on one ABI3730 each day. Therefore this technique is suitable for projects where a rapid and sensitive DNA mutation detection system is required.

Machine learning (ML) algorithms are powerful tools that are increasingly being used for sepsis biomarker discovery in RNA-Seq data. RNA-Seq datasets contain multiple sources and types of noise (operator, technical and non-systematic) that may bias ML classification. Normalisation and independent gene filtering approaches described in RNA-Seq workflows account for some of this variability and are typically only targeted at differential expression analysis rather than ML applications. Pre-processing normalisation steps significantly reduce the number of variables in the data and thereby increase the power of statistical testing, but can potentially discard valuable and insightful classification features. A systematic assessment of applying transcript level filtering on the robustness and stability of ML based RNA-seq classification remains to be fully explored. In this report we examine the impact of filtering out low count transcripts and those with influential outliers read counts on downstream ML analysis for sepsis biomarker discovery using elastic net regularised logistic regression, L1-reguarlised support vector machines and random forests. We demonstrate that applying a systematic objective strategy for removal of uninformative and potentially biasing biomarkers representing up to 60% of transcripts in different sample size datasets, including two illustrative neonatal sepsis cohorts, leads to substantial improvements in classification performance, higher stability of the resulting gene signatures, and better agreement with previously reported sepsis biomarkers. We also demonstrate that the performance uplift from gene filtering depends on the ML classifier chosen, with L1-regularlised support vector machines showing the greatest performance improvements with our experimental data.

We investigated the correlation between polygenic risk of ischemic stroke (and its subtypes) and cognitive ability in 3 relatively healthy Scottish cohorts: the Lothian Birth Cohort 1936 (LBC1936), the Lothian Birth Cohort 1921 (LBC1921), and Generation Scotland: Scottish Family Health Study (GS).Polygenic risk scores for ischemic stroke were created in LBC1936 (n = 1005), LBC1921 (n = 517), and GS (n = 6,815) using genome-wide association study summary data from the METASTROKE collaboration. We investigated whether the polygenic risk scores correlate with cognitive ability in the 3 cohorts.In the largest cohort, GS, polygenic risk of all ischemic stroke, small vessel disease stroke, and large vessel disease stroke, but not cardioembolic stroke, were correlated with both fluid and crystallized cognitive abilities. The highest correlation was between a polygenic risk score for all ischemic stroke and general cognitive ability (r = -0.070, p = 1.95 × 10(-8)). Few correlations were identified in LBC1936 and LBC1921, but a meta-analysis of all 3 cohorts supported the correlation between polygenic risk of ischemic stroke and cognitive ability.The findings from this study indicate that even in the absence of stroke, being at high polygenic risk of ischemic stroke is associated with lower cognitive ability.

Pooled sequencing can be a cost-effective approach to disease variant discovery, but its applicability in association studies remains unclear. We compare sequence enrichment methods coupled to next-generation sequencing in non-indexed pools of 1, 2, 10, 20 and 50 individuals and assess their ability to discover variants and to estimate their allele frequencies. We find that pooled resequencing is most usefully applied as a variant discovery tool due to limitations in estimating allele frequency with high enough accuracy for association studies, and that in-solution hybrid-capture performs best among the enrichment methods examined regardless of pool size.

The undertaking of large-scale DNA sequencing screens for somatic variants in human cancers requires accurate and rapid processing of traces for variants. Due to their often aneuploid nature and admixed normal tissue, heterozygous variants found in primary cancers are often subtle and difficult to detect. To address these issues, we have developed a mutation detection algorithm, AutoCSA, specifically optimized for the high throughput screening of cancer samples.http://www.sanger.ac.uk/genetics/CGP/Software/AutoCSA.

Depot specific expansion of orbital-adipose-tissue (OAT) in Graves' Orbitopathy (GO) is associated with lipid metabolism signaling defects. We hypothesize that the unique adipocyte biology of OAT facilitates its expansion in GO. A comprehensive comparison of OAT and white-adipose-tissue (WAT) was performed by light/electron-microscopy, lipidomic and transcriptional analysis using ex vivo WAT, healthy OAT (OAT-H) and OAT from GO (OAT-GO). OAT-H/OAT-GO have a single lipid-vacuole and low mitochondrial number. Lower lipolytic activity and smaller adipocytes of OAT-H/OAT-GO, accompanied by similar essential linoleic fatty acid (FA) and (low) FA synthesis to WAT, revealed a hyperplastic OAT expansion through external FA-uptake via abundant SLC27A6 (FA-transporter) expression. Mitochondrial dysfunction of OAT in GO was apparent, as evidenced by the increased mRNA expression of uncoupling protein 1 (UCP1) and mitofusin-2 (MFN2) in OAT-GO compared to OAT-H. Transcriptional profiles of OAT-H revealed high expression of Iroquois homeobox-family (IRX-3&5), and low expression in HOX-family/TBX5 (essential for WAT/BAT (brown-adipose-tissue)/BRITE (BRown-in-whITE) development). We demonstrated unique features of OAT not presented in either WAT or BAT/BRITE. This study reveals that the pathologically enhanced FA-uptake driven hyperplastic expansion of OAT in GO is associated with a depot specific mechanism (the SLC27A6 FA-transporter) and mitochondrial dysfunction. We uncovered that OAT functions as a distinctive fat depot, providing novel insights into adipocyte biology and the pathological development of OAT expansion in GO.

Trio-based whole-exome sequence (WES) data have established confident genetic diagnoses in ∼40% of previously undiagnosed individuals recruited to the Deciphering Developmental Disorders (DDD) study. Here we aim to use the breadth of phenotypic information recorded in DDD to augment diagnosis and disease variant discovery in probands. Median Euclidean distances (mEuD) were employed as a simple measure of similarity of quantitative phenotypic data within sets of ≥10 individuals with plausibly causative de novo mutations (DNM) in 28 different developmental disorder genes. 13/28 (46.4%) showed significant similarity for growth or developmental milestone metrics, 10/28 (35.7%) showed similarity in HPO term usage, and 12/28 (43%) showed no phenotypic similarity. Pairwise comparisons of individuals with high-impact inherited variants to the 32 individuals with causative DNM in ANKRD11 using only growth z-scores highlighted 5 likely causative inherited variants and two unrecognized DNM resulting in an 18% diagnostic uplift for this gene. Using an independent approach, naive Bayes classification of growth and developmental data produced reasonably discriminative models for the 24 DNM genes with sufficiently complete data. An unsupervised naive Bayes classification of 6,993 probands with WES data and sufficient phenotypic information defined 23 in silico syndromes (ISSs) and was used to test a “phenotype first” approach to the discovery of causative genotypes using WES variants strictly filtered on allele frequency, mutation consequence, and evidence of constraint in humans. This highlighted heterozygous de novo nonsynonymous variants in SPTBN2 as causative in three DDD probands. Trio-based whole-exome sequence (WES) data have established confident genetic diagnoses in ∼40% of previously undiagnosed individuals recruited to the Deciphering Developmental Disorders (DDD) study. Here we aim to use the breadth of phenotypic information recorded in DDD to augment diagnosis and disease variant discovery in probands. Median Euclidean distances (mEuD) were employed as a simple measure of similarity of quantitative phenotypic data within sets of ≥10 individuals with plausibly causative de novo mutations (DNM) in 28 different developmental disorder genes. 13/28 (46.4%) showed significant similarity for growth or developmental milestone metrics, 10/28 (35.7%) showed similarity in HPO term usage, and 12/28 (43%) showed no phenotypic similarity. Pairwise comparisons of individuals with high-impact inherited variants to the 32 individuals with causative DNM in ANKRD11 using only growth z-scores highlighted 5 likely causative inherited variants and two unrecognized DNM resulting in an 18% diagnostic uplift for this gene. Using an independent approach, naive Bayes classification of growth and developmental data produced reasonably discriminative models for the 24 DNM genes with sufficiently complete data. An unsupervised naive Bayes classification of 6,993 probands with WES data and sufficient phenotypic information defined 23 in silico syndromes (ISSs) and was used to test a “phenotype first” approach to the discovery of causative genotypes using WES variants strictly filtered on allele frequency, mutation consequence, and evidence of constraint in humans. This highlighted heterozygous de novo nonsynonymous variants in SPTBN2 as causative in three DDD probands.

Combining data from genome-wide association studies (GWAS) conducted at different locations, using genotype imputation and fixed-effects meta-analysis, has been a powerful approach for dissecting complex disease genetics in populations of European ancestry.Here we investigate the feasibility of applying the same approach in Africa, where genetic diversity, both within and between populations, is far more extensive.We analyse genome-wide data from approximately 5,000 individuals with severe malaria and 7,000 population controls from three different locations in Africa.Our results show that the standard approach is well powered to detect known malaria susceptibility loci when sample sizes are large, and that modern methods for association analysis can control the potential confounding effects of population structure.We show that pattern of association around the haemoglobin S allele differs substantially across populations due to differences in haplotype structure.Motivated by these observations we consider new approaches to association analysis that might prove valuable for multicentre GWAS in Africa: we relax the assumptions of SNP-based fixed effect analysis; we apply Bayesian approaches to allow for heterogeneity in the effect of an allele on risk across studies; and we introduce a region-based test to allow for heterogeneity in the location of causal alleles.

Ankylosing spondylitis is a common form of inflammatory arthritis predominantly affecting the spine and pelvis that occurs in approximately 5 out of 1,000 adults of European descent. Here we report the identification of three variants in the RUNX3, LTBR-TNFRSF1A and IL12B regions convincingly associated with ankylosing spondylitis (P -8 in the combined discovery and replication datasets) and a further four loci at PTGER4, TBKBP1, ANTXR2 and CARD9 that show strong association across all our datasets (P -6 overall, with support in each of the three datasets studied). We also show that polymorphisms of ERAP1, which encodes an endoplasmic reticulum aminopeptidase involved in peptide trimming before HLA class I presentation, only affect ankylosing spondylitis risk in HLA-B27-positive individuals. These findings provide strong evidence that HLA-B27 operates in ankylosing spondylitis through a mechanism involving aberrant processing of antigenic peptides.

Groups of cows received a staphylococcal cell toxoid vaccine either systemically or locally into the udder at drying-off in the hope that this would prime lymphoid cells migrating to the udder during involution. Two weeks before calving, the animals received local infusions of plain vaccine into 2 quarters of the udder. Antitoxic and agglutinating antibodies in serum, colostrum and milk were measured at intervals. All cows had high colostral antibody titres which dropped to background levels by 2 weeks. There was an indication of some local antibody being produced in those quarters of animals which had previously received 2 infusions of plain vaccine, but this was short-lived. There was no evidence for any prolonged local antibody production in the infused glands which might influence the course of a mastitic infection.

Diagnosing neonatal sepsis is heavily dependent on clinical phenotyping as culture-positive body fluid has poor sensitivity, and existing blood biomarkers have poor specificity.A combination of machine learning, statistical and deep pathway biology analyses led to the identification of a tripartite panel of biologically connected immune and metabolic markers that showed greater than 99% accuracy for detecting bacterial infection with 100% sensitivity. The cohort study described here is designed as a large-scale clinical validation of this previous work.This multicentre observational study will prospectively recruit a total of 1445 newborn infants (all gestations)-1084 with suspected early-or late-onset sepsis, and 361 controls-over 4 years. A small volume of whole blood will be collected from infants with suspected sepsis at the time of presentation. This sample will be used for integrated transcriptomic, lipidomic and targeted proteomics profiling. In addition, a subset of samples will be subjected to cellular phenotype and proteomic analyses. A second sample from the same patient will be collected at 24 hours, with an opportunistic sampling for stool culture. For control infants, only one set of blood and stool sample will be collected to coincide with clinical blood sampling. Along with detailed clinical information, blood and stool samples will be analysed and the information will be used to identify and validate the efficacy of immune-metabolic networks in the diagnosis of bacterial neonatal sepsis and to identify new host biomarkers for viral sepsis.The study has received research ethics committee approval from the Wales Research Ethics Committee 2 (reference 19/WA/0008) and operational approval from Health and Care Research Wales. Submission of study results for publication will involve making available all anonymised primary and processed data on public repository sites.NCT03777670.

Supplementary Glioma Gene Mutations from A Hypermutation Phenotype and Somatic &lt;i&gt;MSH6&lt;/i&gt; Mutations in Recurrent Human Malignant Gliomas after Alkylator Chemotherapy

&lt;div&gt;Abstract&lt;p&gt;Malignant gliomas have a very poor prognosis. The current standard of care for these cancers consists of extended adjuvant treatment with the alkylating agent temozolomide after surgical resection and radiotherapy. Although a statistically significant increase in survival has been reported with this regimen, nearly all gliomas recur and become insensitive to further treatment with this class of agents. We sequenced 500 kb of genomic DNA corresponding to the kinase domains of 518 protein kinases in each of nine gliomas. Large numbers of somatic mutations were observed in two gliomas recurrent after alkylating agent treatment. The pattern of mutations in these cases showed strong similarity to that induced by alkylating agents in experimental systems. Further investigation revealed inactivating somatic mutations of the mismatch repair gene &lt;i&gt;MSH6&lt;/i&gt; in each case. We propose that inactivating somatic mutations of &lt;i&gt;MSH6&lt;/i&gt; confer resistance to alkylating agents in gliomas &lt;i&gt;in vivo&lt;/i&gt; and concurrently unleash accelerated mutagenesis in resistant clones as a consequence of continued exposure to alkylating agents in the presence of defective mismatch repair. The evidence therefore suggests that when &lt;i&gt;MSH6&lt;/i&gt; is inactivated in gliomas, alkylating agents convert from induction of tumor cell death to promotion of neoplastic progression. These observations highlight the potential of large scale sequencing for revealing and elucidating mutagenic processes operative in individual human cancers. (Cancer Res 2006; 66(8): 3987-91)&lt;/p&gt;&lt;/div&gt;

Supplementary Glioma Genes from A Hypermutation Phenotype and Somatic &lt;i&gt;MSH6&lt;/i&gt; Mutations in Recurrent Human Malignant Gliomas after Alkylator Chemotherapy