Sanjeev Francis

Transfusion therapy after cardiac surgery is empirically guided, partly due to a lack of specific point-of-care hemostasis monitors. In a randomized, blinded, prospective trial, we studied cardiac surgical patients at moderate to high risk of transfusion. Patients were randomly assigned to either a thromboelastography (TEG)-guided transfusion algorithm (n = 53) or routine transfusion therapy (n = 52) for intervention after cardiopulmonary bypass. Coagulation tests, TEG variables, mediastinal tube drainage, and transfusions were compared at multiple time points. There were no demographic or hemostatic test result differences between groups, and all patients were given prophylactic antifibrinolytic therapy. Intraoperative transfusion rates did not differ, but there were significantly fewer postoperative and total transfusions in the TEG group. The proportion of patients receiving freshfrozen plasma (FFP) was 4 of 53 in the TEG group compared with 16 of 52 in the control group (P < 0.002). Patients receiving platelets were 7 of 53 in the TEG group compared with 15 of 52 in the control group (P < 0.05). Patients in the TEG group also received less volume of FFP (36 +/- 142 vs 217 +/- 463 mL; P < 0.04). Mediastinal tube drainage was not statistically different 6, 12, or 24 h postoperatively. Point-of-care coagulation monitoring using TEG resulted in fewer transfusions in the postoperative period. We conclude that the reduction in transfusions may have been due to improved hemostasis in these patients who had earlier and specific identification of the hemostasis abnormality and thus received more appropriate intraoperative transfusion therapy. These data support the use of TEG in an algorithm to guide transfusion therapy in complex cardiac surgery. Implications: Transfusion of allogeneic blood products is common during complex cardiac surgical procedures. In a prospective, randomized trial, we compared a transfusion algorithm using point-of-care coagulation testing with routine laboratory testing, and found the algorithm to be effective in reducing transfusion requirements. (Anesth Analg 1999;88:312-9)

Background: Omega-3 fatty acids from fish oil have been associated with beneficial cardiovascular effects, but their role in modifying cardiac structures and tissue characteristics in patients who have had an acute myocardial infarction while receiving current guideline-based therapy remains unknown. Methods: In a multicenter, double-blind, placebo-controlled trial, participants presenting with an acute myocardial infarction were randomly assigned 1:1 to 6 months of high-dose omega-3 fatty acids (n=180) or placebo (n=178). Cardiac magnetic resonance imaging was used to assess cardiac structure and tissue characteristics at baseline and after study therapy. The primary study endpoint was change in left ventricular systolic volume index. Secondary endpoints included change in noninfarct myocardial fibrosis, left ventricular ejection fraction, and infarct size. Results: By intention-to-treat analysis, patients randomly assigned to omega-3 fatty acids experienced a significant reduction of left ventricular systolic volume index (–5.8%, P =0.017), and noninfarct myocardial fibrosis (–5.6%, P =0.026) in comparison with placebo. Per-protocol analysis revealed that those patients who achieved the highest quartile increase in red blood cell omega-3 index experienced a 13% reduction in left ventricular systolic volume index in comparison with the lowest quartile. In addition, patients in the omega-3 fatty acid arm underwent significant reductions in serum biomarkers of systemic and vascular inflammation and myocardial fibrosis. There were no adverse events associated with high-dose omega-3 fatty acid therapy. Conclusions: Treatment of patients with acute myocardial infarction with high-dose omega-3 fatty acids was associated with reduction of adverse left ventricular remodeling, noninfarct myocardial fibrosis, and serum biomarkers of systemic inflammation beyond current guideline-based standard of care. Clinical Trial Registration: URL: http://www.clinicaltrials.gov . Unique identifier: NCT00729430.

Transfusion therapy after cardiac surgery is empirically guided, partly due to a lack of specific point-of-care hemostasis monitors. In a randomized, blinded, prospective trial, we studied cardiac surgical patients at moderate to high risk of transfusion. Patients were randomly assigned to either a thromboelastography (TEG)-guided transfusion algorithm (n = 53) or routine transfusion therapy (n = 52) for intervention after cardiopulmonary bypass. Coagulation tests, TEG variables, mediastinal tube drainage, and transfusions were compared at multiple time points. There were no demographic or hemostatic test result differences between groups, and all patients were given prophylactic antifibrinolytic therapy. Intraoperative transfusion rates did not differ, but there were significantly fewer postoperative and total transfusions in the TEG group. The proportion of patients receiving fresh-frozen plasma (FFP) was 4 of 53 in the TEG group compared with 16 of 52 in the control group (P < 0.002). Patients receiving platelets were 7 of 53 in the TEG group compared with 15 of 52 in the control group (P < 0.05). Patients in the TEG group also received less volume of FFP (36 +/- 142 vs 217 +/- 463 mL; P < 0.04). Mediastinal tube drainage was not statistically different 6, 12, or 24 h postoperatively. Point-of-care coagulation monitoring using TEG resulted in fewer transfusions in the postoperative period. We conclude that the reduction in transfusions may have been due to improved hemostasis in these patients who had earlier and specific identification of the hemostasis abnormality and thus received more appropriate intraoperative transfusion therapy. These data support the use of TEG in an algorithm to guide transfusion therapy in complex cardiac surgery.Transfusion of allogeneic blood products is common during complex cardiac surgical procedures. In a prospective, randomized trial, we compared a transfusion algorithm using point-of-care coagulation testing with routine laboratory testing, and found the algorithm to be effective in reducing transfusion requirements.

We aimed to determine whether the myocardial extracellular volume (ECV), measured using T1 measurements obtained during cardiac magnetic resonance imaging were increased in patients treated with anthracyclines. We performed cardiac magnetic resonance imaging and echocardiography and measured the ECV in 42 patients treated with anthracyclines. The data from the cardiac magnetic resonance study were compared to those from healthy volunteers. The anthracycline-treated cohort consisted of 21 men and 21 women with a mean age of 55 ± 17 years, who presented a median of 84 months after chemotherapy with a cumulative anthracycline exposure of 282 ± 65 mg/m2 and a mean left ventricular ejection fraction of 52 ± 12%. The ECV was elevated in the anthracycline-treated patients compared to the age- and gender-matched controls (0.36 ± 0.03 vs 0.28 ± 0.02, p <0.001). A positive association was found between the ECV and left atrial volume (ECV vs indexed left atrial volume, r = 0.65, p <0.001), and negative association was found between the ECV and diastolic function (E′ lateral, r = −0.64, p <0.001). In conclusion, the myocardial ECV is elevated in patients with previous anthracycline treatment and is associated with the diastolic function and increased atrial volumes. We aimed to determine whether the myocardial extracellular volume (ECV), measured using T1 measurements obtained during cardiac magnetic resonance imaging were increased in patients treated with anthracyclines. We performed cardiac magnetic resonance imaging and echocardiography and measured the ECV in 42 patients treated with anthracyclines. The data from the cardiac magnetic resonance study were compared to those from healthy volunteers. The anthracycline-treated cohort consisted of 21 men and 21 women with a mean age of 55 ± 17 years, who presented a median of 84 months after chemotherapy with a cumulative anthracycline exposure of 282 ± 65 mg/m2 and a mean left ventricular ejection fraction of 52 ± 12%. The ECV was elevated in the anthracycline-treated patients compared to the age- and gender-matched controls (0.36 ± 0.03 vs 0.28 ± 0.02, p <0.001). A positive association was found between the ECV and left atrial volume (ECV vs indexed left atrial volume, r = 0.65, p <0.001), and negative association was found between the ECV and diastolic function (E′ lateral, r = −0.64, p <0.001). In conclusion, the myocardial ECV is elevated in patients with previous anthracycline treatment and is associated with the diastolic function and increased atrial volumes.

We aimed to describe the cardiac magnetic resonance (CMR) findings and determine the prognostic variables in patients with a cardiomyopathy after treatment with anthracyclines. CMR imaging was performed in 91 patients (58% men, mean age 43 ± 18 years, and mean anthracycline dose of 276 ± 82 mg/m(2)) with a reduced ejection fraction after anthracycline-based chemotherapy. Major adverse cardiovascular events were defined as cardiovascular death, appropriate implantable cardioverter-defibrillator therapy, and admission for decompensated heart failure. Patients presented a median of 88 months (interquartile range 37 to 138) after chemotherapy and were followed for 27 months (interquartile range 22 to 38). Late gadolinium enhancement was an uncommon finding (5 patients, 6%) despite a reduced ejection fraction (36 ± 8%). An inverse association was found between the anthracycline dose and the indexed left ventricular (LV) mass by CMR (r = -0.67, p <0.001). A total of 52 adverse cardiac events occurred (event rate of 22%/year). When the patients were grouped according to the presence or absence of a major adverse cardiovascular event, the indexed LV mass and glomerular filtration rate were lower and the anthracycline dose was greater among the patients who experienced an adverse event. In a multivariate model, the indexed LV mass demonstrated the strongest association with major adverse cardiovascular events (hazard ratio 0.89, chi-square 26, p <0.001). In conclusion, myocardial scar by late gadolinium enhancement-CMR is infrequent in patients with anthracycline-cardiomyopathy despite a reduced ejection fraction, the event rate in patients with established anthracycline-cardiotoxicity is high, and indexed LV mass by CMR imaging is a predictor of adverse cardiovascular events.

Peroxisome proliferator-activated receptors (PPARs) as ligand-activated nuclear receptors involved in the transcriptional regulation of lipid metabolism, energy balance, inflammation, and atherosclerosis are at the intersection of key pathways involved in the pathogenesis of diabetes and cardiovascular disease. Synthetic PPAR agonists like fibrates (PPAR-alpha) and thiazolidinediones (PPAR-gamma) are in therapeutic use to treat dyslipidaemia and diabetes. Despite strong encouraging in vitro, animal model, and human surrogate marker studies with these agents, recent prospective clinical cardiovascular trials have yielded mixed results, perhaps explained by concomitant drug use, study design, or a lack of efficacy of these agents on cardiovascular disease (independent of their current metabolic indications). The use of PPAR agents has also been limited by untoward effects. An alternative strategy to PPAR therapeutics is better understanding PPAR biology, the nature of natural PPAR agonists, and how these molecules are generated. Such insight might also provide valuable information about pathways that protect against the metabolic problems for which PPAR agents are currently indicated. This approach underscores the important distinction between the effects of synthetic PPAR agonists and the unequivocal biologic role of PPARs as key transcriptional regulators of metabolic and inflammatory pathways relevant to diabetes and atherosclerosis.

The major aim of this study is to test the hypothesis that stress cardiac magnetic resonance (CMR) imaging can provide robust prognostic value in women presenting with suspected ischemia, to the same extent as in men. Compelling evidence indicates that women with coronary artery disease (CAD) experience worse outcomes than men owing to a lack of early diagnosis and management. Numerous clinical studies have shown that stress CMR detects evidence of myocardial ischemia and infarction at high accuracy. Compared to nuclear scintigraphy, CMR is free of ionizing radiation, has high spatial resolution for imaging small hearts, and overcomes breast attenuation artifacts, which are substantial advantages when imaging women for CAD. We performed stress CMR in 405 patients (168 women, mean age 58 ± 14 years) referred for ischemia assessment. CMR techniques included cine cardiac function, perfusion imaging during vasodilating stress, and late gadolinium enhancement imaging. All patients were followed for major adverse cardiac events (MACE). At a median follow-up of 30 months, MACE occurred in 36 patients (9%) including 21 cardiac deaths and 15 acute myocardial infarctions. In women, CMR evidence of ischemia (ISCHEMIA) demonstrated strong association with MACE (unadjusted hazard ratio: 49.9, p < 0.0001). While women with ISCHEMIA(+) had an annual MACE rate of 15%, women with ISCHEMIA(−) had very low annual MACE rate (0.3%), which was not statistically different from the low annual MACE rate in men with ISCHEMIA(−) (1.1%). CMR myocardial ischemia score was the strongest multivariable predictor of MACE in this cohort, for both women and men, indicating robust cardiac prognostication regardless of sex. In addition to avoiding exposure to ionizing radiation, stress CMR myocardial perfusion imaging is an effective and robust risk-stratifying tool for patients of either sex presenting with possible ischemia.

Hypertension (HTN) is an established class effect of vascular endothelial growth factor receptor (VEGFR) inhibition. In the phase 3 Study of (E7080) Lenvatinib in Differentiated Cancer of the Thyroid (SELECT) trial, HTN was the most frequent adverse event of lenvatinib, an inhibitor of VEGFR1, VEGFR2, VEGFR3, fibroblast growth factor receptor 1 (FGFR1), FGFR2, FGFR3, FGFR4, platelet-derived growth factor receptor α (PDGFRα), ret proto-oncogene (RET), and stem cell factor receptor (KIT). This exploratory analysis examined treatment-emergent hypertension (TE-HTN) and its relation with lenvatinib efficacy and safety in SELECT.In the multicenter, double-blind SELECT trial, 392 patients with progressive radioiodine-refractory differentiated thyroid cancer (RR-DTC) were randomized 2:1 to lenvatinib (24 mg/d on a 28-day cycle) or placebo. Survival endpoints were assessed with Kaplan-Meier estimates and log-rank tests. The influence of TE-HTN on progression-free survival (PFS) and overall survival (OS) was analyzed with univariate and multivariate Cox proportional hazards models.Overall, 73% of lenvatinib-treated patients and 15% of placebo-treated patients experienced TE-HTN. The median PFS for lenvatinib-treated patients with (n = 190) and without TE-HTN (n = 71) was 18.8 and 12.9 months, respectively (hazard ratio [HR], 0.59; 95% confidence interval [CI], 0.39-0.88; P = .0085). For lenvatinib-treated patients, the objective response rate was 69% with TE-HTN and 56% without TE-HTN (odds ratio, 1.72; 95% CI, 0.98-3.01). The median change in tumor size for patients with and without TE-HTN was -45% and -40%, respectively (P = .2). The median OS was not reached for patients with TE-HTN; for those without TE-HTN, it was 21.7 months (HR, 0.43; 95% CI, 0.27-0.69; P = .0003).Although HTN is a clinically significant adverse event that warrants monitoring and management, TE-HTN was significantly correlated with improved outcomes in patients with RR-DTC, indicating that HTN may be predictive for lenvatinib efficacy in this population. Cancer 2018;124:2365-72. © 2018 American Cancer Society.

Anthracyclines are an important component of cancer treatments; however, their use is limited by the occurrence of cardiotoxicity. There are limited data on the occurrence of heart failure and the value of baseline and follow-up measurements of left ventricular (LV) ejection fraction (EF) in the current era. Therefore, the objectives of the present study were twofold: (1) to characterize the occurrence of and risk factors for major adverse cardiac events (MACEs: symptomatic heart failure and cardiac death) in a large contemporaneous population of adult patients treated with anthracyclines and (2) to test the value of LVEF and LV dimensions obtained using echocardiography in the prediction of MACE. Five thousand fifty-seven patients were studied, of whom 124 (2.4%) developed MACE. Of the total cohort, 2,285 patients had an available echocardiogram pre-chemotherapy. Patients with MACE were older (p <0.0001), predominantly men (p = 0.03), and with a higher incidence of cardiovascular risk factors and cardiac treatments. Patients with hematologic cancers had a higher incidence of cardiac events than patients with breast cancer (4.2% vs 0.7%, p <0.0001). Baseline LVEF, LVEF ≤5 points above the lower limits of normal, and LV internal diameter were predictive of the rate of occurrence of MACE. In conclusion, older patients with hematologic cancers and patients with a baseline LVEF ≤5 points above the lower limit of normal have higher incidence of MACE and should be closely monitored.

Cysteinyl leukotrienes (cys-LTs) are potent inflammatory lipid mediators, of which leukotriene (LT) E(4) is the most stable and abundant in vivo. Although only a weak agonist of established G protein-coupled receptors (GPCRs) for cys-LTs, LTE(4) potentiates airway hyper-responsiveness (AHR) by a cyclooxygenase (COX)-dependent mechanism and induces bronchial eosinophilia. We now report that LTE(4) activates human mast cells (MCs) by a pathway involving cooperation between an MK571-sensitive GPCR and peroxisome proliferator-activated receptor (PPAR)gamma, a nuclear receptor for dietary lipids. Although LTD(4) is more potent than LTE(4) for inducing calcium flux by the human MC sarcoma line LAD2, LTE(4) is more potent for inducing proliferation and chemokine generation, and is at least as potent for upregulating COX-2 expression and causing prostaglandin D(2) (PGD(2)) generation. LTE(4) caused phosphorylation of extracellular signal-regulated kinase (ERK), p90RSK, and cyclic AMP-regulated-binding protein (CREB). ERK activation in response to LTE(4), but not to LTD(4), was resistant to inhibitors of phosphoinositol 3-kinase. LTE(4)-mediated COX-2 induction, PGD(2) generation, and ERK phosphorylation were all sensitive to interference by the PPARgamma antagonist GW9662 and to targeted knockdown of PPARgamma. Although LTE(4)-mediated PGD(2) production was also sensitive to MK571, an antagonist for the type 1 receptor for cys-LTs (CysLT(1)R), it was resistant to knockdown of this receptor. This LTE(4)-selective receptor-mediated pathway may explain the unique physiologic responses of human airways to LTE(4) in vivo.

A recent large-scale clinical trial found that an initial invasive strategy does not improve cardiac outcomes beyond optimized medical therapy in patients with stable coronary artery disease. Novel methods to stratify at-risk patients may refine therapeutic decisions to improve outcomes.In a cohort of 815 consecutive patients referred for evaluation of myocardial ischemia, we determined the net reclassification improvement of the risk of cardiac death or nonfatal myocardial infarction (major adverse cardiac events) incremental to clinical risk models, using guideline-based low (<1%), moderate (1% to 3%), and high (>3%) annual risk categories. In the whole cohort, inducible ischemia demonstrated a strong association with major adverse cardiac events (hazard ratio=14.66; P<0.0001) with low negative event rates of major adverse cardiac events and cardiac death (0.6% and 0.4%, respectively). This prognostic robustness was maintained in patients with previous coronary artery disease (hazard ratio=8.17; P<0.0001; 1.3% and 0.6%, respectively). Adding inducible ischemia to the multivariable clinical risk model (adjusted for age and previous coronary artery disease) improved discrimination of major adverse cardiac events (C statistic, 0.81-0.86; P=0.04; adjusted hazard ratio=7.37; P<0.0001) and reclassified 91.5% of patients at moderate pretest risk (65.7% to low risk; 25.8% to high risk) with corresponding changes in the observed event rates (0.3%/y and 4.9%/y for low and high risk posttest, respectively). Categorical net reclassification index was 0.229 (95% confidence interval, 0.063-0.391). Continuous net reclassification improvement was 1.11 (95% confidence interval, 0.81-1.39).Stress cardiac magnetic resonance imaging effectively reclassifies patient risk beyond standard clinical variables, specifically in patients at moderate to high pretest clinical risk and in patients with previous coronary artery disease.http://www.clinicaltrials.gov. Unique identifier: NCT01821924.

Anthracyclines are one of the most commonly used antineoplastic agent classes, and a core part of the treatment in breast cancers, hematological malignancies, and sarcomas. Their benefit is decreased by their well-recognized cardiotoxicity. The purpose of this review is to outline the presentation, mechanisms, diagnosis, and treatment of anthracyclines-induced cardiotoxicity. Symptomatic heart failure occurs in 2% to 5% of patients treated with anthrayclines and may be higher in older patients or patients with cardiovascular risk factors. The mechanisms involved in anthracycline-induced cardiotoxicity involve myocyte loss by apoptosis in the presence of a limited regenerative capacity. Once symptomatic, anthracycline-induced cardiotoxicity is associated with markedly decreased survival. Left ventricular ejection fraction (LVEF), mostly determined using echocardiography, is used to monitor patients treated with anthracyclines. As more than 1/3 of patients treated with anthracyclines do not recover their baseline LVEF once it is decreased, more sensitive echocardiographic indices of LV function such as myocardial deformation or biomarkers have been studied in patients monitoring. Cardioprotective treatments such as angiotensin-converting enzyme inhibitors, beta-blockers, iron chelators, statins, and metformin are also the topic of research efforts.

Neutrophil migration requires continuous reorganization of the cytoskeleton and cellular adhesion apparatus. Chemoattractants initiate intracellular signals that direct this reorganization. The signaling pathways that link chemoattractant receptors to the cytoskeleton and cellular adhesion apparatus are now being defined. Formyl-peptide chemoattractants released from bacteria stimulate G-protein–linked receptors on the surface of neutrophils and regulate the neutrophil cytoskeleton and adhesion apparatus through RhoA-dependent pathways. Lsc is a RhoA guanine nucleotide exchange factor that binds the heterotrimeric G-protein α-subunits, Gα12 and Gα13. We have disrupted the Lsc gene and demonstrated that formyl-peptide–stimulated Lsc knock-out (KO) neutrophils are unable to generate and sustain a single-dominant pseudopod and migrate with increased speed and reduced directionality. Unexpectedly, we also found that Lsc is required for normal β2- and β1-integrin–dependent neutrophil adhesion. Lsc-deficient mice have a peripheral leukocytosis and extramedullary hematopoiesis, demonstrating that Lsc is required for leukocyte homeostasis. Lsc-deficient neutrophils are recruited normally to sites of bacterial peritonitis and chemical dermatitis, indicating that other signaling pathways compensate for the Lsc deficiency in some forms of inflammation. These results demonstrate that Lsc links formyl-peptide receptors to RhoA signaling pathways that regulate polarization, migration, and adhesion in neutrophils and that Lsc is required for leukocyte homeostasis.

This retrospective analysis aimed to establish the overall cardiac safety profile of bortezomib using patient-level data from one phase 2 and seven phase 3 studies in previously untreated and relapsed/refractory multiple myeloma (MM). Seven clinically relevant primary [congestive heart failure (CHF), arrhythmias, ischaemic heart disease (IHD), cardiac death] and secondary (hypertension, dyspnoea, oedema) cardiac endpoints were defined based on MedDRA v16.0 preferred terms. 2509 bortezomib-treated patients and 1445 patients in non-bortezomib-based control arms were included. The incidence of grade ≥3 CHF was 1·3-4·0% in studies in relapsed/refractory MM and 1·2-4·7% in previously untreated MM (2·0-7·6% all grades), with no significant differences between bortezomib- and non-bortezomib-based arms in comparative studies. Incidences of arrhythmias (1·3-5·9% grade ≥2; 0·6-4·1% grade ≥3), IHD (1·2-2·9% all grades; 0·4-2·7% grade ≥3) and cardiac death (0-1·4%) were low, with no differences between bortezomib-based and non-bortezomib-based arms. Higher rates of oedema (mostly grade 1/2) were seen in bortezomib-based versus non-bortezomib-based arms in one study and a pooled transplant study analysis. Logistic regression analyses of comparative studies showed no impact on cardiac risk with bortezomib-based versus non-bortezomib-based treatment. Bortezomib-based treatment was associated with low incidences of cardiac events.

<h2>Abstract</h2><h3>Background</h3> Omega-3 polyunsaturated fatty acids (O3-FA) have been shown to reduce inflammation and adverse cardiac remodeling after acute myocardial infarction (AMI). However, the impact O3FA on long-term clinical outcomes remains uncertain. <h3>Aims</h3> To investigate the impact of O3-FA on adverse cardiac events in long-term follow up post AMI in a pilot-study. <h3>Methods</h3> Consecutive patients with AMI were randomized 1:1 to receive 6 months of O3-FA (4 g/daily) or placebo in the prospective, multicenter OMEGA-REMODEL trial. Primary endpoint was a composite of major adverse cardiovascular events (MACE) encompassing all-cause death, heart failure hospitalizations, recurrent acute coronary syndrome, and late coronary artery bypass graft (CABG). <h3>Results</h3> A total of 358 patients (62.8% male; 48.1 ± 16.1 years) were followed for a median of 6.6 (IQR: 5.0–9.1) years. Among those receiving O3-FA (<i>n</i> = 180), MACE occurred in 65 (36.1%) compared to 62 (34.8%) of 178 assigned to placebo. By intention-to-treat analysis, O3-FA treatment assignment did not reduce MACE (HR = 1.014; 95%CI = 0.716–1.436; <i>p</i> = 0.938), or its individual components. However, patients with a positive response to O3-FA treatment (<i>n</i> = 43), defined as an increase in the red blood cell omega-3 index (O3I) ≥5% after 6 months of treatment, had lower annualized MACE rates compared to those without (2.9% (95%CI = 1.2–5.1) vs 7.1% (95%CI = 5.7–8.9); <i>p</i> = 0.001). This treatment benefit persisted after adjustment for baseline characteristics (HR_adjusted = 0.460; 95%CI = 0.218–0.970; <i>p</i> = 0.041). <h3>Conclusion</h3> In long-term follow-up of the OMEGA-REMODEL randomized trial, O3-FA did not reduce MACE after AMI by intention to treat principle, however, patients who achieved a ≥ 5% increase of O3I subsequent to treatment had favorable outcomes.

Objective— To investigate the effects of pioglitazone (PIO), a peroxisome proliferator–activated receptor γ agonist, on plaque matrix metalloproteinase (MMP) and macrophage (Mac) responses in vivo in a molecular imaging study. Methods and Results— In vitro, PIO suppressed MMP-9 protein expression in murine peritoneal Macs ( P &lt;0.05). To assess PIO’s effects on plaque inflammation, nondiabetic apolipoprotein E −/− mice receiving a high-cholesterol diet (HCD) were administered an MMP-activatable fluorescence imaging agent and a spectrally distinct Mac-avid fluorescent nanoparticle. After 24 hours, mice underwent survival dual-target intravital fluorescence microscopy of carotid arterial plaques. These mice were then randomized to HCD or HCD plus 0.012% PIO for 8 weeks, followed by a second intravital fluorescence microscopy study of the same carotid plaque. In the HCD group, in vivo MMP and Mac target-to-background ratios increased similarly ( P &lt;0.01 versus baseline). In contrast, PIO reduced MMP and Mac target-to-background ratios ( P &lt;0.01) versus HCD. Changes in MMP and Mac signals correlated strongly ( r ≥0.75). Microscopy demonstrated MMP and Mac reductions in PIO-treated mice and a PIO-modulated increase in plaque collagen. Conclusion— Serial optical molecular imaging demonstrates that plaque MMP and Mac activity in vivo intensify with hypercholesterolemia and are reduced by PIO therapy.

In addition to an extensively characterized role of high-density lipoprotein (HDL) in reverse cholesterol transport, bioactive lipids bound to HDL can also exert diverse vascular effects. Despite this, integration of HDL action in the vasculature with pathways that metabolize HDL and release bioactive lipids has been much less explored. The effects of HDL on endothelial cells are mediated in part by HDL-associated sphingosine 1-phosphate (S1P), which binds to S1P1 receptors and promotes activation of endothelial NO synthase (eNOS) and the kinase Akt. In these studies, we characterized the role of endothelial lipase (EL) in the control of endothelial signaling and biology, including those mediated by HDL-associated S1P.HDL-induced angiogenesis in aortic rings from EL-deficient (EL(-/-)) mice was markedly decreased compared with wild-type controls. In cultured endothelial cells, small interfering RNA-mediated knockdown of EL abrogated HDL-promoted endothelial cell migration and tube formation. Small interfering RNA-mediated EL knockdown also attenuated HDL-induced phosphorylation of eNOS(1179) and Akt(473). S1P stimulation restored HDL-induced endothelial migration and Akt/eNOS phosphorylation that had been blocked by small interfering RNA-mediated EL knockdown. HDL-induced endothelial cell migration and Akt/eNOS phosphorylation were completely inhibited by the S1P1 antagonist W146 but not by the S1P3 antagonist CAY10444.EL is a critical determinant of the effects of HDL on S1P-mediated vascular responses and acts on HDL to promote activation of S1P1, leading to Akt/eNOS phosphorylation and subsequent endothelial migration and angiogenesis. The role of EL in HDL-associated S1P effects provides new insights into EL action, the responses seen through EL and HDL interaction, and S1P signaling.

This study sought to determine feasibility and prognostic performance of stress cardiac magnetic resonance (CMR) in obese patients (body mass index [BMI] ≥30 kg/m(2)).Current stress imaging methods remain limited in obese patients. Given the impact of the obesity epidemic on cardiovascular disease, alternative methods to effectively risk stratify obese patients are needed.Consecutive patients with a BMI ≥30 kg/m(2) referred for vasodilating stress CMR were followed for major adverse cardiovascular events (MACE), defined as cardiac death or nonfatal myocardial infarction. Univariable and multivariable Cox regressions for MACE were performed to determine the prognostic association of inducible ischemia or late gadolinium enhancement (LGE) by CMR beyond traditional clinical risk indexes.Of 285 obese patients, 272 (95%) completed the CMR protocol, and among these, 255 (94%) achieved diagnostic imaging quality. Mean BMI was 35.4 ± 4.8 kg/m(2), with a maximum weight of 200 kg. Reasons for failure to complete CMR included claustrophobia (n = 4), intolerance to stress agent (n = 4), poor gating (n = 4), and declining participation (n = 1). Sedation was required in 19 patients (7%; 2 patients with intravenous sedation). Sixteen patients required scanning by a 70-cm-bore system (6%). Patients without inducible ischemia or LGE experienced a substantially lower annual rate of MACE (0.3% vs. 6.3% for those with ischemia and 6.7% for those with ischemia and LGE). Median follow-up of the cohort was 2.1 years. In a multivariable stepwise Cox regression including clinical characteristics and CMR indexes, inducible ischemia (hazard ratio 7.5; 95% confidence interval: 2.0 to 28.0; p = 0.002) remained independently associated with MACE. When patients with early coronary revascularization (within 90 days of CMR) were censored on the day of revascularization, both presence of inducible ischemia and ischemia extent per segment maintained a strong association with MACE.Stress CMR is feasible and effective in prognosticating obese patients, with a very low negative event rate in patients without ischemia or infarction.

To evaluate the efficiency and safety of emergency department (ED) coronary computed tomography angiography (CTA) during a 3-year clinical experience.Single-center registry of coronary CTA in consecutive ED patients with suspicion of acute coronary syndrome (ACS). The primary outcome was efficiency of coronary CTA defined as the length of hospitalization. Secondary endpoints of safety were defined as the rate of downstream testing, normalcy rates of invasive coronary angiography (ICA), absence of missed ACS, and major adverse cardiac events (MACE) during follow-up, and index radiation exposure.One thousand twenty two consecutive patients were referred for clinical coronary CTA with suspicion of ACS. Overall, median time to discharge home was 10.5 (5.7-24.1) hours. Patient disposition was 42.7 % direct discharge from the ED, 43.2 % discharge from emergency unit, and 14.1 % hospital admission. ACS rate during index hospitalization was 9.1 %. One hundred ninety two patients underwent additional diagnostic imaging and 77 underwent ICA. The positive predictive value of CTA compared to ICA was 78.9 % (95 %-CI 68.1-87.5 %). Median CT radiation exposure was 4.0 (2.5-5.8) mSv. No ACS was missed; MACE at follow-up after negative CTA was 0.2 %.Coronary CTA in an experienced tertiary care setting allows for efficient and safe management of patients with suspicion for ACS.• ED Coronary CTA using advanced systems is associated with low radiation exposure. • Negative coronary CTA is associated with low rates of MACE. • CTA in ED patients enables short median time to discharge home. • CTA strategy is characterized by few downstream tests including unnecessary ICA.

Anthracycline-associated cardiomyopathy and peripartum cardiomyopathy are nonischemic cardiomyopathies that often afflict previously healthy young patients; both diseases have been well described since at least the 1970s and both occur in the settings of predictable stressors (ie, cancer treatment and pregnancy). Despite this, the precise mechanisms and the ability to reliably predict who exactly will go on to develop cardiomyopathy and heart failure in the face of anthracycline exposure or childbirth have proven elusive. For both cardiomyopathies, recent advances in basic and molecular sciences have illuminated the complex balance between cardiomyocyte and endothelial homeostasis via 3 broad pathways: reactive oxidative stress, interference in apoptosis/growth/metabolism, and angiogenic imbalance. These advances have already shown potential for specific, disease-altering therapies, and as our mechanistic knowledge continues to evolve, further clinical successes are expected to follow.

Immune checkpoint blocker (ICB) associated myocarditis (ICB-myocarditis) may present similarly and/or overlap with other cardiac pathology including acute coronary syndrome presenting a challenge for prompt clinical diagnosis.An international registry was used to retrospectively identify cases of ICB-myocarditis. Presence of coronary artery disease (CAD) was defined as coronary artery stenosis >70% in patients undergoing coronary angiogram.Among 261 patients with clinically suspected ICB-myocarditis who underwent a coronary angiography, CAD was present in 59/261 patients (22.6%). Coronary revascularization was performed during the index hospitalisation in 19/59 (32.2%) patients. Patients undergoing coronary revascularization less frequently received steroids administration within 24 h of admission compared to the other groups (p = 0.029). Myocarditis-related 90-day mortality was 9/17 (52.7%) in the revascularised cohort, compared to 5/31 (16.1%) in those not revascularized and 25/156 (16.0%) in those without CAD (p = 0.001). Immune-related adverse event-related 90-day mortality was 9/17 (52.7%) in the revascularized cohort, compared to 6/31 (19.4%) in those not revascularized and 31/156 (19.9%) in no CAD groups (p = 0.007). All-cause 90-day mortality was 11/17 (64.7%) in the revascularized cohort, compared to 13/31 (41.9%) in no revascularization and 60/158 (38.0%) in no CAD groups (p = 0.10). After adjustment of age and sex, coronary revascularization remained associated with ICB-myocarditis-related death at 90 days (hazard ratio [HR] = 4.03, 95% confidence interval [CI] 1.84-8.84, p < 0.001) and was marginally associated with all-cause death (HR = 1.88, 95% CI, 0.98-3.61, p = 0.057).CAD may exist concomitantly with ICB-myocarditis and may portend a poorer outcome when revascularization is performed. This is potentially mediated through delayed diagnosis and treatment or more severe presentation of ICB-myocarditis.

With the need for healthcare cost-containment, increased scrutiny will be placed on new medical therapeutic or diagnostic technologies. Several challenges exist for a new diagnostic test to demonstrate cost-effectiveness. New diagnostic tests differ from therapeutic procedures due to the fact that diagnostic tests do not generally directly affect long-term patient outcomes. Instead, the results of diagnostic tests can influence management decisions for patients and by this route, diagnostic tests indirectly affect long-term outcomes. The benefits from a specific diagnostic technology depend therefore not only on its performance characteristics, but also on other factors such as prevalence of disease, and effectiveness of existing treatments for the disease of interest. We review the concepts and theories of cost-effectiveness analyses (CEA) as they apply to diagnostic tests in general. The limitations of CEA across different study designs and geographic regions are discussed, and we also examine the strengths and weakness of the existing publications where CMR was the focus of CEA compared to other diagnostic options.

Purpose Cancer and cardiovascular disease (CVD) are common causes of morbidity and mortality, and measurement and interpretation of their co-occurrence rate have important implications for public health and patient care. Here, we present the raw and adjusted co-occurrence rates of cancer and CVD in the overall population by using a visually intuitive network approach. Methods By using baseline survey and linked health outcome data from 490,842 individuals age 40 to 69 years from the UK Biobank, we recorded diagnoses between 1997 and 2014 of specific cancers and specific CVDs ascertained through hospital claims. We measured raw and adjusted rates of CVD for the following groups: individuals with Hodgkin or non-Hodgkin lymphoma, lung and trachea cancer, uterus cancer, colorectal cancer, prostate cancer, breast cancer, or no recorded diagnosed cancer during this time period. Analysis accounted for age, sex, and behavioral risk factors, without regard to the order of occurrence of cancer and CVD. Results A significantly increased rate of CVD was found in patients with multiple types of cancers, including Hodgkin and non-Hodgkin lymphoma and lung and trachea, uterus, colorectal, and breast cancer, compared with patients without cancer by using age and sex-adjusted models. Increased co-occurrence for many CVD categories remained after correction for behavioral risk factors. Construction of co-occurrence networks highlighted heart failure as a shared CVD diagnosis across multiple cancer types, including breast cancer, lung cancer, non-Hodgkin lymphoma, and colorectal cancer. Smoking, physical activity, and other lifestyle factors accounted for some but not all of the increased co-occurrence for many of the CVD diagnoses. Conclusion Increased co-occurrence of several common CVD conditions is seen widely across multiple malignancies, and shared diagnoses, such as heart failure, were highlighted by using network methods.

In this report, we describe the first chronic case of Q fever endocarditis in a 72-year-old woman in Iran. The patient developed radiation-associated heart disease status post (s/p) coronary artery bypass surgery, mitral and aortic valve replacements, and tricuspid valve repair. Endocarditis was also suspected due to a history of heart valve surgery. Blood cultures were negative, but a diagnosis of Q fever endocarditis was confirmed based on serologic titers (IgG phase I 1:32,768). The patient was treated with doxycycline and hydroxychloroquine.

We report three patients who presented with chest pain after receiving either the BNT162b2 Pfizer/BioNTech or mRNA-1273 Moderna/NIH vaccine. Clinical presentation, biomarker, and cardiac MRI supported myocarditis. It is imperative that potential side effects of COVID-19 vaccine are reported to improve our knowledge about COVID-19 and mRNA vaccines.

HomeJournal of the American Heart AssociationVol. 3, No. 1Heart Failure and Breast Cancer Therapies: Moving Towards Personalized Risk Assessment Open AccessEditorialPDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citations ShareShare onFacebookTwitterLinked InMendeleyReddit Jump toOpen AccessEditorialPDF/EPUBHeart Failure and Breast Cancer Therapies: Moving Towards Personalized Risk Assessment Sanjeev A. Francis, MD, Susan Cheng, MD, Carlos L. Arteaga, MD and Javid Moslehi, MD Sanjeev A. FrancisSanjeev A. Francis Cardio‐Oncology Program, Massachusetts General Hospital, Harvard Medical School, Boston, MA Search for more papers by this author , Susan ChengSusan Cheng Cardiovascular Division, Brigham and Women's Hospital, Boston, MA Search for more papers by this author , Carlos L. ArteagaCarlos L. Arteaga Department of Medicine and Cancer Biology, Vanderbilt‐Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN Department of Breast Cancer Research Program, Vanderbilt‐Ingram Cancer Center, Vanderbilt University School of Medicine, Nashville, TN Search for more papers by this author and Javid MoslehiJavid Moslehi Cardiovascular Division, Brigham and Women's Hospital, Boston, MA Cardio‐Oncology Program, Dana‐Farber Cancer Institute, Harvard Medical School, Boston, MA Search for more papers by this author Originally published28 Feb 2014https://doi.org/10.1161/JAHA.113.000780Journal of the American Heart Association. 2014;3:e000780IntroductionCardio‐oncology, a new clinical discipline focused on the cardiovascular care of cancer patients, represents a new avenue for interdisciplinary collaboration between clinical oncologists and cardiologists as well as between basic scientists and clinical investigators.1 Many of these collaborations have been driven by the emergence of novel targeted therapies that have revolutionized cancer treatment but also have the potential for cardiovascular toxicity.The recent history of treatment for HER2 positive breast cancer is an early example of how unanticipated cardiotoxicity has led to collaborative efforts to address the problem. HER2, a proto‐oncogene encoding the HER2 receptor tyrosine kinase, is amplified in >20% of patients with breast cancer, resulting in HER2 receptor overexpression and an aggressive phenotype associated with high metastatic potential and short survival. The development of trastuzumab (Herceptin), a humanized monoclonal antibody targeting HER2, over the past 15 years has led to significant improvements in the survival of patients with HER2‐positive breast cancer. A pivotal study by Slamon et al demonstrated a clear benefit of trastuzumab in metastatic HER2+ breast cancer. However, there was an alarming rate of cardiotoxicity with 27% of patients who received trastuzumab concurrently with traditional chemotherapy (doxorubicin, cyclophosphamide) developing either symptomatic heart failure or asymptomatic cardiac dysfunction.2 As a result of these data, initial regulatory approval of trastuzumab for metastatic breast cancer was accompanied by caveats with respect to cardiac safety. Several requirements were instituted for therapy in practice. First, all patients would undergo frequent periodic monitoring of cardiac function with determination of left ventricular ejection fraction (EF) during the course of trastuzumab treatment. Second, trastuzumab would be administered sequentially after treatment with anthracycline‐based chemotherapy under the assumption that synergistic toxicity could result if the 2 agents were given concomitantly. These stipulations were not only applied to patient care but also to subsequent clinical trials involving trastuzumab, especially as this agent was being tested in the adjuvant setting, to increase the chance of disease‐free survival. In the oncology community, these initial observations with cardiotoxicity also led to a debate regarding the added value of anthracyclines for patients with curable, early‐stage HER2 positive breast cancer being treated with trastuzumab.3Perhaps as a result of close cardiac monitoring, subsequent clinical trials of trastuzumab in the adjuvant setting have demonstrated a lower incidence of cardiotoxicity, typically defined as either symptomatic congestive heart failure (CHF) or asymptomatic decline in left ventricular systolic function (cardiomyopathy). In large, randomized clinical trials, the incidence of symptomatic CHF ranged from 0.6% to 4.1% while the incidence of cardiomyopathy is higher at 3% to 19%.4, 5, 6 The differences in the reported incidence may be related to several factors including differences in treatment regimens, differences in definitions of cardiomyopathy, and variation in the imaging modalities used to assess EF. Despite these sources of heterogeneity, it is clear that trastuzumab is associated with a small increased risk of clinical congestive heart failure and a larger increased risk of cardiomyopathy, especially on the background of anthracycline therapy. However, these risks are juxtaposed against the consistent finding in clinical trials that trastuzumab significantly decreases the risk of cancer recurrence and increases survival in women with HER2‐positive disease.An important, unanswered question is the clinical significance of the cardiotoxicity associated with HER2‐targeted therapies. In clinical trials involving trastuzumab, the majority of patients who developed heart failure or cardiomyopathy improved clinically, and most experienced an improvement in EF although approximately one‐third of patients had some degree of persistent LV systolic dysfunction.4, 6, 7 In two trials testing trastuzumab in the adjuvant setting, there were no cardiac deaths in the trastuzumab arms at a median follow‐up of 3.6 and 5.4 years, respectively.4, 8 In addition, new‐onset cardiomyopathy can interrupt and influence the course of cancer therapy. In clinical trials, 2% to 8% of HER2‐positive breast cancer patients were not candidates for trastuzumab due to LV dysfunction or cardiac symptoms after completing an anthracycline‐containing regimen.4, 7 Similarly, the development of cardiac events, many of them asymptomatic, during treatment with trastuzumab can lead to interruption or cessation of treatment in up to 16% of women with a proven survival benefit.6, 7Defining the exact short‐term and long‐term consequences of trastuzumab‐associated cardiomyopathy will be important as clinicians are forced to weigh the risks versus benefits of trastuzumab therapy in the breast cancer population. Moreover, accurate risk prediction tools are needed to assist clinicians in identifying patients at high risk of cardiotoxicity. Answering these questions in the context of a “real world” population is essential given that most oncology clinical trials enroll younger patients with no history of cardiovascular disease. In practice, over 40% of breast cancer patients are >65 years of age, many of whom carry the burden of traditional cardiovascular risk factors or have a history of cardiovascular disease.9In this issue of JAHA, Ezaz et al provide a risk prediction model for heart failure and cardiomyopathy after adjuvant trastuzumab therapy for breast cancer.10 The authors build on their previous work using the Surveillance, Epidemiology, and End Results (SEER) Medicare‐linked database where they identified 45 537 women who were 67 to 94 years of age (mean age 76) with early‐stage breast cancer. The adjusted 3‐year incidence of heart failure or cardiomyopathy was as high as 42% for patients receiving anthracycline and trastuzumab, 32% for patients receiving trastuzumab alone, compared to 18% with no adjuvant therapy.9 There are obvious limitations with such a retrospective approach, most of which are acknowledged by the authors. Outcomes data were based on administrative codes rather than a rigorous adjudication of events, which limits the discrimination between symptomatic and asymptomatic systolic dysfunction. The lack of data on ejection fraction (EF) also limits the distinction between systolic and diastolic heart failure, which may be important in an older population. The degree of surveillance for asymptomatic LV dysfunction was also not available given the nature of the dataset. The strength of this type of registry analysis is its large sample size and the fact that it is embedded within a “real world” population. Combined with the work of others, these data highlight a clear signal of increased cardiotoxicity in an older population with rates significantly higher than those reported in clinical trials.11 The long‐term prognosis of these patients remains unknown.The current paper by Ezaz et al represents an important contribution to the understanding of risk factors for the development of heart failure or cardiomyopathy in this population. Using a subset of patients from the SEER Medicare database, the authors developed a clinical risk score based on 7 factors: age, adjuvant chemotherapy, coronary artery disease, atrial fibrillation or flutter, diabetes, hypertension, and renal failure. In a split sample design, the authors developed the risk score in half the cohort and then demonstrated internal validity with the other half. Using this risk score allowed stratification of patients into low‐, medium‐, and high‐risk groups. Validating this risk score in other cohorts or registries will be critical for demonstrating its generalizability. Nevertheless, the finding that pre‐existing cardiovascular disease and the presence of traditional risk factors incrementally increase the risk of trastuzumab‐associated heart failure is an important finding and contribution to the field. Although these main results are not surprising (based on clinical experience and lessons from studying other forms of heart failure), formally reporting these findings in the cardio‐oncology population is important for confirming observations made in practice. All efforts to expand the evidence base in cardio‐oncology will not only guide future practice, but will also help to inform the design of future clinical trials. This is especially important because, at this time, patients with HER2+ breast cancer are treated with combinations of HER2‐targeted therapies, which, in turn, may add to the risk of cardiotoxicity.Several groups have previously reported risk factors for developing trastuzumab‐associated cardiomyopathy based on data from clinical trials testing the efficacy of trastuzumab in the adjuvant setting. In the Herceptin Adjuvant (HERA) trial, higher cumulative dose of doxorubicin, lower screening EF, and greater body mass index were associated with increased risk of clinical heart failure or cardiomyopathy.6 There was a nonsignificant trend towards higher risk with hypertension, smoking, and diabetes. Notably, this analysis involved a small number of patients with these risk factors, and the mean age of patients was 49 years. Similarly in another trial (NSABP‐31), age and EF were the only predictors of cardiotoxicity while the prevalence of co‐morbidities was also relatively low compared to that in the current study.7The current study should lead to further attempts by the cardio‐oncology community to improve cardiac risk stratification in patients with breast cancer. An increasing number of studies have indicated the utility of novel imaging parameters (eg, myocardial strain by echocardiography) and serum biomarkers (eg, troponin) on top of clinical risk factors in the prediction of cardiomyopathy in breast cancer patients prior to the onset of a reduction in EF.12, 13 Integrating clinical risk factors with novel imaging and serum biomarkers may ultimately provide the clinician with a comprehensive, robust risk prediction tool for all ages. A personalized risk score could influence a variety of decisions related to cancer therapy, such as whether to treat with an anthracycline, how frequently to conduct cardiac surveillance, and in which patients to initiate cardioprotective strategies (eg, beta blockers, ACE inhibitors) while continuing trastuzumab therapy (Figure). In an era of limited economic resources, such a risk tool may also have a high enough negative predictive value to identify a truly low‐risk population for whom no further intervention or surveillance is necessary. A carefully constructed comparative effectiveness study designed to capture both cardiovascular and oncologic outcomes would be necessary to validate such a tool. The current work by Ezaz et al is an important initial step towards a more patient‐centered approach in the assessment of cardiac risk during breast cancer therapy.Download PowerPointFigure 1. Proposed integrated cardiac risk assessment for patients undergoing breast cancer treatment.Establishing risk prediction models for heart failure and cardiomyopathy becomes even more important when one considers the evolving landscape of treatment options for HER2 positive breast cancer. HER2 directed therapy now includes a diverse class of therapies including small molecular tyrosine kinase inhibitors targeting HER2 (such as lapatinib, afatinib, neratinib) and HER2 receptor dimerization inhibitors (such as pertuzumab). In addition, trastuzumab has been covalently linked to cytotoxic agents allowing more effective tumor cell targeting such as in the case of Trastuzumab emtansine (TDM‐1), which was recently approved for treatment of HER2+ metastatic breast cancer. Increasingly, these HER2‐targeted therapies are used in combination for the treatment of breast cancer, potentially increasing the risk of cardiotoxicity.14, 15 HER2 signaling promotes breast cancer proliferation though the RAS‐MAPK pathway and inhibits cell death through the phosphatidylinositol 3′‐kinase‐AKT‐mammalian target of rapamycin (mTOR) pathway. Inhibitors targeting these downstream pathways are being developed to both more potently inhibit HER2 signaling and/or develop ways of addressing resistance to trastuzumab.16 At the present time, the cardiac implications of these novel HER2‐targeted therapies are unknown.The evolving narrative on cardiomyopathy in breast cancer patients treated with trastuzumab highlights the importance of a continued, close collaboration between oncologists and cardiologists. Further research into the mechanisms, risk factors, optimal methods of detection, and ultimately strategies for prevention will help to achieve the goal of optimizing both the cardiovascular and oncologic health in all of our patients.DisclosuresNone.Footnotes*Correspondence to: Sanjeev A. Francis, MD, Cardio‐Oncology Program, Massachusetts General Hospital, Harvard Medical School, 55 Fruit Street, Boston, MA. E‐mail: [email protected]org Javid Moslehi, MD, Cardio‐Oncology Program, Dana‐Farber Cancer Institute and Brigham and Women's Hospital, Harvard Medical School, 75 Francis Street, Boston, MA. E‐mail: [email protected]orgThe opinions expressed in this article are not necessarily those of the editors or of the American Heart Association.References1 Moslehi J, Cheng S. Cardio‐oncology: it takes two to translate. Sci Transl Med. 2013; 5:187fs20.CrossrefMedlineGoogle Scholar2 Slamon DJ, Leyland‐Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, Fleming T, Eiermann W, Wolter J, Pegram M, Baselga J, Norton L. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2. N Engl J Med. 2001; 344:783–792.CrossrefMedlineGoogle Scholar3 Burstein HJ, Piccart‐Gebhart MJ, Perez EA, Hortobagyi GN, Wolmark N, Albain KS, Norton L, Winer EP, Hudis CA. Choosing the best trastuzumab‐based adjuvant chemotherapy regimen: should we abandon anthracyclines?J Clin Oncol. 2012; 30:2179–2182.CrossrefMedlineGoogle Scholar4 Slamon D, Eiermann W, Robert N, Pienkowski T, Martin M, Press M, Mackey J, Glaspy J, Chan A, Pawlicki M, Pinter T, Valero V, Liu M‐C, Sauter G, Minckwitz von G, Visco F, Bee V, Buyse M, Bendahmane B, Tabah‐Fisch I, Lindsay M‐A, Riva A, Crown J; Breast Cancer International Research Group . Adjuvant trastuzumab in HER2‐positive breast cancer. N Engl J Med. 2011; 365:1273–1283.CrossrefMedlineGoogle Scholar5 Romond EH, Perez EA, Bryant J, Suman VJ, Geyer CE, Davidson NE, Tan‐Chiu E, Martino S, Paik S, Kaufman PA, Swain SM, Pisansky TM, Fehrenbacher L, Kutteh LA, Vogel VG, Visscher DW, Yothers G, Jenkins RB, Brown AM, Dakhil SR, Mamounas EP, Lingle WL, Klein PM, Ingle JN, Wolmark N. Trastuzumab plus adjuvant chemotherapy for operable HER2‐positive breast cancer. N Engl J Med. 2005; 353:1673–1684.CrossrefMedlineGoogle Scholar6 Suter TM, Procter M, van Veldhuisen DJ, Muscholl M, Bergh J, Carlomagno C, Perren T, Passalacqua R, Bighin C, Klijn JGM, Ageev FT, Hitre E, Groetz J, Iwata H, Knap M, Gnant M, Muehlbauer S, Spence A, Gelber RD, Piccart‐Gebhart MJ. Trastuzumab‐associated cardiac adverse effects in the herceptin adjuvant trial. J Clin Oncol. 2007; 25:3859–3865.CrossrefMedlineGoogle Scholar7 Romond EH, Jeong J‐H, Rastogi P, Swain SM, Geyer CE, Ewer MS, Rathi V, Fehrenbacher L, Brufsky A, Azar CA, Flynn PJ, Zapas JL, Polikoff J, Gross HM, Biggs DD, Atkins JN, Tan‐Chiu E, Zheng P, Yothers G, Mamounas EP, Wolmark N. Seven‐year follow‐up assessment of cardiac function in NSABP B‐31, a randomized trial comparing doxorubicin and cyclophosphamide followed by paclitaxel (ACP) with ACP plus trastuzumab as adjuvant therapy for patients with node‐positive, human epidermal growth factor receptor 2‐positive breast cancer. J Clin Oncol. 2012; 30:3792–3799.MedlineGoogle Scholar8 Procter M, Suter TM, de Azambuja E, Dafni U, van Dooren V, Muehlbauer S, Climent MA, Rechberger E, Liu WT‐W, Toi M, Coombes RC, Dodwell D, Pagani O, Madrid J, Hall M, Chen S‐C, Focan C, Muschol M, van Veldhuisen DJ, Piccart‐Gebhart MJ. Longer‐term assessment of trastuzumab‐related cardiac adverse events in the Herceptin Adjuvant (HERA) trial. J Clin Oncol. 2010; 28:3422–3428.CrossrefMedlineGoogle Scholar9 Chen J, Long JB, Hurria A, Owusu C, Steingart RM, Gross CP. Incidence of heart failure or cardiomyopathy after adjuvant trastuzumab therapy for breast cancer. J Am Coll Cardiol. 2012; 60:2504–2512.CrossrefMedlineGoogle Scholar10 Ezaz G, Long JB, Gross CP, Chen J. A risk prediction model for heart failure and cardiomyopathy after adjuvant trastuzumab therapy for breast cancer. J Am Heart Assoc. 2014; 3:e000472 doi: 10.1161/JAHA.113.000472LinkGoogle Scholar11 Chavez‐MacGregor M, Zhang N, Buchholz TA, Zhang Y, Niu J, Elting L, Smith BD, Hortobagyi GN, Giordano SH. Trastuzumab‐related cardiotoxicity among older patients with breast cancer. J Clin Oncol. 2013; 31:4222–4228.CrossrefMedlineGoogle Scholar12 Sawaya H, Sebag IA, Plana JC, Januzzi JL, Ky B, Tan TC, Cohen V, Banchs J, Carver JR, Wiegers SE, Martin RP, Picard MH, Gerszten RE, Halpern EF, Passeri J, Kuter I, Scherrer‐Crosbie M. Assessment of echocardiography and biomarkers for the extended prediction of cardiotoxicity in patients treated with anthracyclines, taxanes, and trastuzumab. Circ Cardiovasc Imaging. 2012; 5:596–603.LinkGoogle Scholar13 Ky B, Putt M, Sawaya H, French B, Januzzi JL, Sebag IA, Plana JC, Cohen V, Banchs J, Carver JR, Wiegers SE, Martin RP, Picard MH, Gerszten RE, Halpern EF, Passeri J, Kuter I, Scherrer‐Crosbie M. Early increases in multiple biomarkers predict subsequent cardiotoxicity in breast cancer patients treated with doxorubicin, taxanes, and trastuzumab. J Am Coll Cardiol. 2013; doi:10.1016/j.jacc.2013.10.061 (Epub ahead of print).CrossrefGoogle Scholar14 Blackwell KL, Burstein HJ, Storniolo AM, Rugo H, Sledge G, Koehler M, Ellis C, Casey M, Vukelja S, Bischoff J, Baselga J, O'Shaughnessy J. Randomized study of Lapatinib alone or in combination with trastuzumab in women with ErbB2‐positive, trastuzumab‐refractory metastatic breast cancer. J Clin Oncol. 2010; 28:1124–1130.CrossrefMedlineGoogle Scholar15 Baselga J, Cortés J, Kim S‐B, Im S‐A, Hegg R, Im Y‐H, Roman L, Pedrini JL, Pienkowski T, Knott A, Clark E, Benyunes MC, Ross G, Swain SM; CLEOPATRA Study Group . Pertuzumab plus trastuzumab plus docetaxel for metastatic breast cancer. N Engl J Med. 2012; 366:109–119.CrossrefMedlineGoogle Scholar16 Arteaga CL, Sliwkowski MX, Osborne CK, Perez EA, Puglisi F, Gianni L. Treatment of HER2‐positive breast cancer: current status and future perspectives. Nat Rev Clin Oncol. 2012; 9:16–32.CrossrefGoogle Scholar Previous Back to top Next FiguresReferencesRelatedDetailsCited By Harrison J, Friese C, Barton D, Janz N, Pressler S and Davis M (2018) Heart Failure and Long-Term Survival Among Older Women With Breast Cancer , Oncology Nursing Forum, 10.1188/18.ONF.77-87, 45:1, (77-87 ), Online publication date: 1-Jan-2018. Eisenberg E, Di Palo K and Piña I (2018) Sex differences in heart failure, Clinical Cardiology, 10.1002/clc.22917, 41:2, (211-216), Online publication date: 1-Feb-2018. Clark R, Marin T, Berry N, Atherton J, Foote J and Koczwara B (2017) Cardiotoxicity and cardiovascular disease risk assessment for patients receiving breast cancer treatment, Cardio-Oncology, 10.1186/s40959-017-0025-7, 3:1, Online publication date: 1-Dec-2017. Mandawat A, Williams A and Francis S (2017) Cardio-oncology, Heart Failure Clinics, 10.1016/j.hfc.2016.12.010, 13:2, (403-408), Online publication date: 1-Apr-2017. Dias A, Claudino W, Sinha R, Perez C and Jain D (2016) Human epidermal growth factor antagonists and cardiotoxicity—A short review of the problem and preventative measures, Critical Reviews in Oncology/Hematology, 10.1016/j.critrevonc.2016.04.015, 104, (42-51), Online publication date: 1-Aug-2016. De Iuliis F, Salerno G, Taglieri L, De Biase L, Lanza R, Cardelli P and Scarpa S (2015) Serum biomarkers evaluation to predict chemotherapy-induced cardiotoxicity in breast cancer patients, Tumor Biology, 10.1007/s13277-015-4183-7, 37:3, (3379-3387), Online publication date: 1-Mar-2016. Tan T and Scherrer-Crosbie M (2015) Author’s Reply, Journal of the American Society of Echocardiography, 10.1016/j.echo.2015.07.024, 28:9, (1129-1130), Online publication date: 1-Sep-2015. Patanè S (2014) Insights into cardio-oncology: adrenergic receptor signaling and pathways in breast cancer., Current Medical Research and Opinion, 10.1185/03007995.2014.932636, 31:2, (333-334), Online publication date: 1-Feb-2015. Patanè S (2014) HERG-targeted therapy in both cancer and cardiovascular system with cardiovascular drugs, International Journal of Cardiology, 10.1016/j.ijcard.2014.07.129, 176:3, (1082-1085), Online publication date: 1-Oct-2014. Patanè S (2014) Cancer multidrug resistance-targeted therapy in both cancer and cardiovascular system with cardiovascular drugs, International Journal of Cardiology, 10.1016/j.ijcard.2014.07.158, 176:3, (1306-1308), Online publication date: 1-Oct-2014. Patanè S (2014) Cardiotoxicity: Trastuzumab and cancer survivors, International Journal of Cardiology, 10.1016/j.ijcard.2014.08.117, 177:2, (554-556), Online publication date: 1-Dec-2014. Patanè S (2014) ERBB1/EGFR and ERBB2 (HER2/neu) — Targeted therapies in cancer and cardiovascular system with cardiovascular drugs, International Journal of Cardiology, 10.1016/j.ijcard.2014.07.161, 176:3, (1301-1303), Online publication date: 1-Oct-2014. Tan T, Neilan T, Francis S, Plana J and Scherrer‐Crosbie M (2015) Anthracycline‐Induced Cardiomyopathy in Adults Comprehensive Physiology, 10.1002/cphy.c140059, (1517-1540) January 27, 2014Vol 3, Issue 1Article InformationMetrics © 2014 The Authors. Published on behalf of the American Heart Association, Inc., by Wiley Blackwell.This is an open access article under the terms of the Creative Commons Attribution‐NonCommercial License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited and is not used for commercial purposes.https://doi.org/10.1161/JAHA.113.000780PMID: 24584746 Manuscript receivedJanuary 27, 2013Manuscript acceptedJanuary 28, 2013Originally publishedFebruary 28, 2014 Keywordsbreast cancerEditorialscardiotoxicitytrastuzumabcardio‐oncologyPDF download SubjectsCongenital Heart Disease

Rho GTPases control fundamental cellular processes, including cytoskeletal reorganization and transcription. Rho guanine nucleotide exchange factors (GEFs) compose a large (>65) and diverse family of related proteins that activate Rho GTPases. Lsc/p115-RhoGEF is a Rho-specific GEF required for normal B and T lymphocyte function. Despite its essential role in lymphocytes, Lsc/p115-RhoGEF signaling in vivo is not well understood. To define Lsc/p115-RhoGEF signaling pathways in vivo, we set out to identify proteins that interact with regulatory regions of Lsc. The 146-amino acid C terminus of Lsc contains a predicted coiled-coil domain, and we demonstrated that deletion of this C terminus confers a gain of function in vivo. Surprisingly, a yeast two-hybrid screen for proteins that interact with this regulatory C terminus isolated a larger C-terminal fragment of Lsc itself. Co-immunoprecipitation experiments in mammalian cells demonstrated that Lsc specifically homo-oligomerizes and that the coiled-coil domain in the C terminus is required for homo-oligomerization. Mutagenesis experiments revealed that homo-oligomerization and negative regulation are distinct functions of the C terminus. Two novel isoforms of Lsc found in the spleen lack portions of this C terminus, including the coiled-coil domain. Importantly, the C termini of both isoforms confer a gain of function and eliminate homo-oligomerization. These results define two important features of Lsc signaling. First, Lsc homo-oligomerizes and is negatively regulated through domains in its C terminus; and second, functionally distinct isoforms of Lsc lacking these domains are present in the spleen. Rho GTPases control fundamental cellular processes, including cytoskeletal reorganization and transcription. Rho guanine nucleotide exchange factors (GEFs) compose a large (>65) and diverse family of related proteins that activate Rho GTPases. Lsc/p115-RhoGEF is a Rho-specific GEF required for normal B and T lymphocyte function. Despite its essential role in lymphocytes, Lsc/p115-RhoGEF signaling in vivo is not well understood. To define Lsc/p115-RhoGEF signaling pathways in vivo, we set out to identify proteins that interact with regulatory regions of Lsc. The 146-amino acid C terminus of Lsc contains a predicted coiled-coil domain, and we demonstrated that deletion of this C terminus confers a gain of function in vivo. Surprisingly, a yeast two-hybrid screen for proteins that interact with this regulatory C terminus isolated a larger C-terminal fragment of Lsc itself. Co-immunoprecipitation experiments in mammalian cells demonstrated that Lsc specifically homo-oligomerizes and that the coiled-coil domain in the C terminus is required for homo-oligomerization. Mutagenesis experiments revealed that homo-oligomerization and negative regulation are distinct functions of the C terminus. Two novel isoforms of Lsc found in the spleen lack portions of this C terminus, including the coiled-coil domain. Importantly, the C termini of both isoforms confer a gain of function and eliminate homo-oligomerization. These results define two important features of Lsc signaling. First, Lsc homo-oligomerizes and is negatively regulated through domains in its C terminus; and second, functionally distinct isoforms of Lsc lacking these domains are present in the spleen. Rho monomeric GTPases control fundamental cellular processes, including cytoskeletal reorganization, transcription, and membrane trafficking (1Van Aelst L. D'Souza-Schorey C. Genes Dev. 1997; 11: 2295-2322Crossref PubMed Scopus (2097) Google Scholar, 2Etienne-Manneville S. Hall A. Nature. 2002; 420: 629-635Crossref PubMed Scopus (3861) Google Scholar). They serve as switches, cycling between active GTP-bound and inactive GDP-bound states (3Bourne H.R. Sanders D.A. McCormick F. Nature. 1991; 349: 117-127Crossref PubMed Scopus (2690) Google Scholar). Rho guanine nucleotide exchange factors (GEFs) 1The abbreviations used are: GEFs, guanine nucleotide exchange factors; DH, Dbl homology; PH, pleckstrin homology; aa, amino acid(s); HA, hemagglutinin peptide; DMEM, Dulbecco's modified Eagle's medium; BCS, bovine calf serum; nt, nucleotide(s); SRE, serum response element; EST, expressed sequence tag; BD, Gal4-binding domain; AD, Gal4 activation domain. compose a large and diverse family of proteins that activate Rho GTPases by catalyzing the release of GDP in exchange for GTP (4Boguski M.S. McCormick F. Nature. 1993; 366: 643-654Crossref PubMed Scopus (1761) Google Scholar, 5Sprang S.R. Coleman D.E. Cell. 1998; 95: 155-158Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 6Schmidt A. Hall A. Genes Dev. 2002; 16: 1587-1609Crossref PubMed Scopus (984) Google Scholar). Rho GEFs are characterized by a catalytic Dbl homology (DH) domain and a nearly invariant adjacent pleckstrin homology (PH) domain (6Schmidt A. Hall A. Genes Dev. 2002; 16: 1587-1609Crossref PubMed Scopus (984) Google Scholar, 7Gulli M.P. Peter M. Genes Dev. 2001; 15: 365-379Crossref PubMed Scopus (88) Google Scholar). Many Rho GEFs contain additional conserved domains dedicated to functional associations with molecules other than their cognate GTPases (6Schmidt A. Hall A. Genes Dev. 2002; 16: 1587-1609Crossref PubMed Scopus (984) Google Scholar, 7Gulli M.P. Peter M. Genes Dev. 2001; 15: 365-379Crossref PubMed Scopus (88) Google Scholar). Lsc/p115-RhoGEF (Arhgef1) is a Rho-specific GEF that is expressed in lymphoid and myeloid tissue and, to a lesser degree, in other organs (8Whitehead I.P. Khosravi-Far R. Kirk H. Trigo-Gonzalez G. Der C.J. Kay R. J. Biol. Chem. 1996; 271: 18643-18650Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar, 9Glaven J.A. Whitehead I.P. Nomanbhoy T. Kay R. Cerione R.A. J. Biol. Chem. 1996; 271: 27374-27381Abstract Full Text Full Text PDF PubMed Scopus (107) Google Scholar, 10Hart M.J. Sharma S. elMasry N. Qiu R.G. McCabe P. Polakis P. Bollag G. J. Biol. Chem. 1996; 271: 25452-25458Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). Lsc/p115-RhoGEF contains conserved DH and PH domains, an N-terminal RGS (regulator of G-protein signaling)-like domain, and a C-terminal predicted coiled-coil domain (see Fig. 1). Lsc/p115-RhoGEF is both an effector and a regulator of the heterotrimeric GTPase subunit Gα13. Gα13 activates Lsc/p115-RhoGEF exchange activity (11Hart M.J. Jiang X. Kozasa T. Roscoe W. Singer W.D. Gilman A.G. Sternweis P.C. Bollag G. Science. 1998; 280: 2112-2114Crossref PubMed Scopus (675) Google Scholar) and can be inhibited by the RGS-like domain of Lsc/p115-RhoGEF (12Kozasa T. Jiang X. Hart M.J. Sternweis P.M. Singer W.D. Gilman A.G. Bollag G. Sternweis P.C. Science. 1998; 280: 2109-2111Crossref PubMed Scopus (740) Google Scholar). This is of particular interest because it enables Lsc/p115-RhoGEF to couple ligand activation of G13-coupled receptors to Rho signaling pathways. Recently, targeted disruption of Lsc demonstrated that it is required for normal B and T lymphocyte function. Lsc–/– mice have reduced populations of splenic marginal zone B cells, enhanced marginal zone B cell chemotaxis, impaired proliferation of stimulated splenic B cells, and a reduced population of splenic T cells (13Girkontaite I. Missy K. Sakk V. Harenberg A. Tedford K. Potzel T. Pfeffer K. Fischer K.D. Nat. Immunol. 2001; 2: 855-862Crossref PubMed Scopus (146) Google Scholar). Lsc–/– mice have impaired thymus-dependent and type 2 thymus-independent immune responses (13Girkontaite I. Missy K. Sakk V. Harenberg A. Tedford K. Potzel T. Pfeffer K. Fischer K.D. Nat. Immunol. 2001; 2: 855-862Crossref PubMed Scopus (146) Google Scholar). Despite its essential role, Lsc/p115-RhoGEF signaling in lymphocytes in vivo is not well understood. Several ligands for G13-coupled receptors activate Rho and are known to affect lymphocyte function, including sphingosine 1-phosphate (14Sugimoto N. Takuwa N. Okamoto H. Sakurada S. Takuwa Y. Mol. Cell. Biol. 2003; 23: 1534-1545Crossref PubMed Scopus (234) Google Scholar, 15Mandala S. Hajdu R. Bergstrom J. Quackenbush E. Xie J. Milligan J. Thornton R. Shei G.J. Card D. Keohane C. Rosenbach M. Hale J. Lynch C.L. Rupprecht K. Parsons W. Rosen H. Science. 2002; 296: 346-349Crossref PubMed Scopus (1435) Google Scholar) and lysophosphatidic acid (16Graler M.H. Goetzl E.J. Biochim. Biophys. Acta. 2002; 1582: 168-174Crossref PubMed Scopus (157) Google Scholar, 17Gohla A. Harhammer R. Schultz G. J. Biol. Chem. 1998; 273: 4653-4659Abstract Full Text Full Text PDF PubMed Scopus (237) Google Scholar). However, it is not known which ligands activate Lsc/p115-RhoGEF or which effector pathways are activated by Lsc/p115-RhoGEF signaling in vivo. To define Lsc signaling pathways in vivo, we set out to identify proteins that interact with regulatory regions of Lsc. Previous work demonstrated that deletion of the C-terminal 110 or 152 amino acids (aa) C-terminal to the PH domain of p115-RhoGEF confers a gain of function in vivo (10Hart M.J. Sharma S. elMasry N. Qiu R.G. McCabe P. Polakis P. Bollag G. J. Biol. Chem. 1996; 271: 25452-25458Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar, 18Wells C.D. Gutowski S. Bollag G. Sternweis P.C. J. Biol. Chem. 2001; 276: 28897-28905Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). We hypothesized that the corresponding region might negatively regulate the murine ortholog Lsc. Deletion of the C-terminal 146 aa of Lsc conferred a 2–3-fold gain of function, suggesting that this region, containing a predicted coiled-coil domain, negatively regulates Lsc in vivo. We isolated a larger C-terminal fragment of Lsc itself in a screen for proteins that interact with this regulatory C terminus. We subsequently demonstrated that Lsc homo-oligomerizes and is negatively regulated through domains in its C terminus and that Lsc activity can be regulated by generating functionally distinct isoforms lacking these domains. Reagents and Antibodies—o-Nitrophenyl-β-d-galactopyranoside was obtained from ICN Biomedicals (Aurora, OH). Anti-FLAG monoclonal antibody M2, 3-amino-1,2,4-triazole, aprotinin, and phenylmethylsulfonyl fluoride were obtained from Sigma. Anti-hemagglutinin peptide (HA) monoclonal antibody 12CA5 was obtained from Roche Applied Science. Horseradish peroxidase-conjugated goat anti-mouse antibody was obtained from Bio-Rad. Protein A-Sepharose beads were obtained from Amersham Biosciences. All yeast media were obtained from Qbiogene (Carlsbad, CA). Grade 410 filter paper for yeast filter lifts was obtained from VWR (West Chester, PA). All other chemical reagents were obtained from Fisher unless noted otherwise. Cell Culture—COS-7 and NIH 3T3 cells were maintained in Dulbecco's modified Eagle's medium (DMEM) supplemented with 10% bovine calf serum (BCS), 4.5 g/liter glucose, 100 IU/ml penicillin, and 100 μg/ml streptomycin. Transfections were performed with LipofectAMINE and Plus reagents (Invitrogen) according to the manufacturer's instructions except where noted. Saccharomyces cerevisiae strain Y190 was obtained from Clontech (Palo Alto, CA) and maintained and manipulated according to standard protocols (19Guthrie C. Fink G. Methods Enzymology. 1991; 194: 3-21Crossref PubMed Scopus (2543) Google Scholar). cDNA—NIH 3T3 cells (ATCC CRL1658) were obtained from the American Type Culture Collection (Manassas, VA), and total RNA was extracted with Trizol reagent (Invitrogen) according to the manufacturer's instructions. C57BL/6J mice received ∼3 × 108 sheep red blood cells by intraperitoneal injection; and 10 days later, total RNA was extracted from their spleens with Trizol reagent. Total RNA was used to generate first-strand cDNA using an oligo(dT)12–18 primer with the Superscript first-strand synthesis kit (Invitrogen) according to the manufacturer's instructions. Plasmids—All DNA manipulations were performed using standard techniques (20Sambrook J. Russel D.W. Molecular Cloning: A Laboratory Manual. 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2001Google Scholar) and verified by DNA sequencing using dye terminator chemistry. Lsc cDNA nucleotide (nt) residues are numbered with reference to the deoxyadenosine of the start codon designated nt 1. The pAS2-1, pACT2, and pTD1-1 vectors were obtained from Clontech. pRL-TK was obtained from Promega (Madison, WI). The modified serum response element (SRE)-mediated reporter plasmid pSRE.L (21Mao J. Yuan H. Xie W. Wu D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12973-12976Crossref PubMed Scopus (114) Google Scholar) was a generous gift from Dianqing Wu (University of Rochester). pBJ1 was a generous gift from Mark Davis (Stanford University). Plasmid construction is described below. The oligonucleotides used to construct these plasmids are listed in Table I. For HA.Lsc-pBJ1 and FLAG.Lsc-pBJ1, Lsc cDNA nt 1–2760 encoding aa 1–919 and a stop codon were amplified by PCR from NIH 3T3 cDNA with DL1020 and DL1021 and subcloned into pCR2.1 (Invitrogen). A linker (DLh1 annealed to DLh2) encoding a consensus Kozak sequence (5′-GCCACCATGG-3′ on the sense strand) (22Kozak M. Mamm. Genome. 1996; 7: 563-574Crossref PubMed Scopus (757) Google Scholar) and an HA epitope (YPYDVPDYA) or a linker (DLf1 annealed to DLf2) encoding a consensus Kozak sequence and a FLAG epitope (DYKDDDDK) was subcloned into the XhoI-NdeI sites of this plasmid, and the XhoI-EcoRI fragments of the resulting plasmids were subcloned into the XhoI-EcoRI sites of pBJ1. For HA.Lsc.ΔCT-pBJ1 and FLAG.Lsc.ΔCT-pBJ1, a linker replacing Lsc nt 2320–2760 encoding aa 774–919 with a stop codon (DL1060 annealed to DL1061) was subcloned into the BamHI-BamHI sites of HA.Lsc-pBJ1 and FLAG.Lsc-pBJ1, respectively. For HA.Lsc.ΔDH-pBJ1, HA.Lsc-pBJ1 was digested with PmlI and religated to delete Lsc nt 1287–1995 encoding aa 430–665. For Lsc.CT-pAS2-1, Lsc cDNA nt 2320–2760 encoding aa 774–919 were amplified by PCR from NIH 3T3 cDNA with DL1003 and DL1004; the product was subcloned into pCR2.1 to generate Lsc.CT-pCR2.1; and the EcoRI-EcoRI fragment from this plasmid was subcloned into the EcoRI site of pAS2-1. For Lsc.PH+CT-pACT2, the NcoI-XhoI fragment of FLAG.Lsc.PH+CT-pBJ.KS was subcloned into the NcoI-XhoI sites of pACT2. For FLAG.Lsc.PH+CT-pBJ.KS, the EcoRI-XhoI fragment of the GIP9 library clone was subcloned into the EcoRI-XhoI sites of pBJ.KS, and then a linker encoding a consensus Kozak sequence and a FLAG epitope (DLA annealed to DLB) was subcloned into the SpeI-EcoRI sites of the resulting plasmid. For GIP9ΔLscORF-pACT2, the GIP9 library clone was digested with PmlI-StuI, and the blunt ends were religated to delete a region corresponding to Lsc nt 1959–2750. For Lsc.CT-pACT2, the NcoI-SalI fragment of Lsc.CT-pAS2-1 was subcloned into the NcoI-XhoI sites of pACT2. For Lsc.PH-pACT2, Lsc nt 1813–2319 encoding aa 605–773 were amplified by PCR from NIH 3T3 cDNA with DL1066 and DL1068 and subcloned into pCR-Blunt II-TOPO (Invitrogen), and the XmaI-SacI fragment of the resulting plasmid was subcloned into the XmaI-SacI sites of pACT2. For HA.Lsc.CT-pBJ1, the NheI-XbaI fragment of HA.Lsc.CT-pcDNA3.1 was subcloned into the XbaI site of pBJ1. For HA.Lsc.CT-pcDNA3.1, a linker encoding a consensus Kozak sequence and an HA epitope (LDW1 annealed to LDW2) was subcloned into the NheI-EcoRI sites of FLAG.Lsc.CT-pcDNA3.1. For FLAG.Lsc.CT-pcDNA3.1, a linker encoding a consensus Kozak sequence, a FLAG epitope, and an internal EcoRI site (DL1007 annealed to DL1008) was subcloned into the HindIII-XhoI sites of pcDNA3.1(+) (Invitrogen), and the EcoRI-EcoRI fragment of Lsc.CT-pCR2.1 was subcloned into the EcoRI site of the resulting plasmid. For FLAG.Lsc.CT-pBJ1, Lsc nt 2320–2760 encoding aa 774–919 were amplified from NIH 3T3 cDNA by PCR with DL1071, an N-terminal primer encoding a consensus Kozak sequence and a FLAG epitope, and DL1063. The product was subcloned into pCR2.1, and the XhoI-SpeI fragment of the resulting plasmid was subcloned into the XhoI-XbaI sites of pBJ1. For Lsc.CT-(774–836)-pAS2-1, a linker replacing Lsc nt 2512–2760 encoding aa 837–919 (DL2027 annealed to DL2028) was subcloned into the AlwNI-SalI sites of Lsc.CT-pAS2-1. For Lsc.CT(EST)-pAS2-1, the EcoRI-XhoI fragment of Lsc.PH+CT-pACT2 was subcloned into the EcoRI-XhoI sites of pBluescript II SK(–) (Stratagene, La Jolla, CA) to form Lsc.PH+CT-pBS. The SfiI-StuI fragment of the expressed sequence tag (EST) uu91h07.y1 (GenBank™/EBI accession number BG148369) was subcloned into the SfiI-StuI sites of this plasmid to form Lsc.PH+CT(EST)-pBS, and the BlpI-StuI fragment of this plasmid was subcloned into the BlpI-StuI sites of Lsc.CT-pAS2-1, deleting Lsc nt 2488–2706 encoding aa 830–902. For Lsc.CT(ΔCC)-pAS2-1, a linker deleting Lsc nt 2584–2679 encoding aa 862–893 (DL2003 annealed to DL2004) was subcloned into the ApaI-StuI sites of Lsc.CT-pAS2-1. For Lsc.CT-(834–919)-pAS2-1, a linker deleting Lsc nt 2320–2499 encoding aa 774–833 (DL2044 annealed to DL2045) was subcloned into the NcoI-AlwNI sites of Lsc.CT-pAST2–1. For Lsc.CT-(858–919)-pAS2-1, a linker deleting Lsc nt 2320–2571 encoding aa 774–857 (DL2046 annealed to DL2047) was subcloned into the NcoI-ApaI sites of Lsc.CT-pAST2–1. For HA.Lsc.ΔCC-pBJ1, the XbaI-EcoRI fragment from HA.Lsc-pBJ1 was subcloned into the XbaI-EcoRI sites of pBluescript II SK(–) to generate Lsc(X-E)-pBS; the SfiI-StuI fragment of Lsc.CT(ΔCC)-pAS2-1 was subcloned into the SfiI-StuI sites of Lsc(X-E)-pBS; and the XbaI-EcoRI fragment of the resulting plasmid was subcloned into the XbaI-EcoRI sites of HA.Lsc-pBJ1. For HA.Lsc.CC(P-P)-pBJ1, L875P and L882P missense mutations were introduced into HA.Lsc-pBJ1 using the QuikChange site-directed mutagenesis kit (Stratagene) with primers DL2090 and DL2091. The BamHI-BamHI fragment of the resulting plasmid was then subcloned into the corresponding BamHI-BamHI sites of a fresh copy of HA.Lsc-pBJ1. For HA.Lsc.237-pBJ1, the c237 amplicon from c237-pCR2.1-TOPO was released with EcoRI and religated in the opposite orientation, and the BamHI-BamHI fragment from the resulting plasmid was subcloned into the BamHI-BamHI sites of HA.Lsc-pBJ1. For HA.Lsc.249-pBJ1, the KpnI-XhoI fragment of c249-pCR2.1-TOPO was subcloned into the KpnI-XhoI sites of pBluescript II SK(–), and the BamHI-BamHI fragment from the resulting construct was subcloned into the BamHI-BamHI sites of HA.Lsc-pBJ1. For HA.Lsc.EST-pBJ1, the SfiI-StuI fragment of EST BG148369 was subcloned into the SfiI-StuI sites of Lsc(X-E)-pBS, and the XbaI-EcoRI fragment from the resulting plasmid was subcloned back into the XbaI-EcoRI sites of HA.Lsc-pBJ1. For HA.dynamin-pBJ1, human dynamin-1 was subcloned into the multicloning site of pBJ1. For βgal-pBJ.KS, the HindIII-BamHI fragment from pSV-β-galactosidase (Promega) was subcloned into the HindIII-BamHI sites of pBJ.KS. For pBJ.KS, the pBJ1 promoter and poly(A) tail were subcloned upstream and downstream, respectively, of the pBluescript KS(+) (Stratagene) multicloning site.Table IOligonucleotidesOligonucleotideSequence (5′ → 3′)DLACTAGCGCATCGATGCCACCATGGACTACAAAGACGACGACGACAAAAAGDLBATTCTTTTTGTCGTCGTCGTCTTTGTAGTCCATGGTGGCATCGATGCGDLf1TCGAGGCCACGTGGCCACCATGGACTACAAAGACGACGACGACAAACADLf2TATGTTTGTCGTCGTCGTCTTTGTAGTCCATGGTGGCCACGTGGCCDLh1TCGAGGCCACGTGGCCACCATGGGCTATCCTTATGATGTTCCAGATTATGCTTCCCADLh2TATGGGAAGCATAATCTGGAACATCATAAGGATAGCCCATGGTGGCCACGTGGCCDL1003TGAATTCAGCCCAAGCAGCATCCGAGAACCCCTGCTDL1004TCTCGAGTCATCATGAAAGGCCTGTCTGAGCAGAGCGTTCDL1007AGCTGCCGCCAAGATGGACTACAAGGACGATGACGATAAGGAATTCACTACTACTCDL1008TCGAGAGTAGTAGTGAATTCCTTATCGTCATCGTCCTTGTAGTCCATCTTGGCGGCDL1020TATCATATGGGAGAAGTCGCCGGAGGGDL1021GCTGAATTCTCATCATGAAAGGCCTGTCTGAGCDL1026GCTATAGAAGTGCACGTGCTCTTGDL1060GATCCCTGAAGGTCCCTGCCCCTGCCTCCCGCCTCAAACCGCGGCCCTGATCAGDL1061GATCCTGATCAGGGCCGCGGTTTGAGGCGGGAGGCAGGGGCAGGGACCTTCAGGDL1063TCATGAAAGGCCTGTCTGAGCAGADL1066GCCACCATGGACTACAAAGACGACGACGACAAAGCCCCGGGGCGTGACATGGAGGACCTGCTGCGGDL1068TCAGGGCCGGGGTTTGAGGCGGGAGGCDL1071GCCACCATGGACTACAAAGACGACGACGACAAAGCCCCGGGGAGCCCAAGCAGCATCCGAGAACCCDL2003CCCGGCCCCCTCCTGTCCCAGCTTGGGGGGACTCTGTCCCCCAACCTGGCTGCACCTGAACGCTCTGCTCAGACAGGDL2004CCTGTCTGAGCAGAGCGTTCAGGTGCAGCCAGGTTGGGGGACAGAGTCCCCCCAAGCTGGGACAGGAGGGGGCCGGGGGCCDL2027CTGTGAGDL2028CTGGACTCACAGGATDL2044CATGGAGGCCGAATTCCAGATCDL2045CTGGAATTCGGCCTCDL2046CATGGAGGCCGAATTCAGGGCCDL2047CTGAATTCGGCCTCDL2080ATTAAAAATAAACCTCCAGTCCAGGDL2090GGAAAACTTGCTTAGCCCAGAGGTGGCCATCAGACAACCGGAGGAGTTGGAAGDL2091CTTCCAACTCCTCCGGTTGTCTGATGGCCACCTCTGGGCTAAGCAAGTTTTCCLDW1CTAGCGCATCGATGCCACCATGGGCTATCCTTATGATGTTCCAGATTATGCTTCCGLDW2AATTCGGAAGCATAATCTGGAACATCATAAGGATAGCCCATGGTGGCATCGATGCG Open table in a new tab Yeast Two-hybrid Screen—S. cerevisiae strain Y190 with integrated GAL1-UAS-HIS3 and GAL1-UAS-β-galactosidase reporter genes (Clontech) was sequentially transformed with Lsc.CT-pAS2-1 and then an NIH 3T3 cDNA library in vector pACT2. pAS2-1 and pACT2 are Gal4-binding domain (BD) and Gal4 activation domain (AD) fusion protein vectors, respectively. Cotransformants were grown on synthetic dropout medium lacking tryptophan, leucine, and histidine and supplemented with 25 mm 3-amino-1,2,4-triazole. Candidate clones were identified by selecting for activation of the HIS3 reporter gene and screening for activation of the β-galactosidase reporter gene. HIS3 reporter gene expression was selected for by retrieving colonies ≥3 mm in diameter after 8 days of incubation at 30 °C. β-Galactosidase reporter activity was screened for by immersing a filter lift of cotransformed colonies in liquid nitrogen for 15 s and then exposing it to 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside (X-gal) for 8 h at 30 °C. Blue colonies were scored positive for β-galactosidase activity. A total of 2.5 × 105 colonies were evaluated for expression of the HIS3 reporter gene; 20 of these had robust growth (≥3 mm in diameter), and three of these demonstrated β-galactosidase reporter activation. An additional four cotransformants were <3 mm in diameter, but had particularly strong β-galactosidase reporter activity. The two groups were combined, and a total of seven cotransformants were selected for further workup. The library plasmid from each clone was isolated as described (23ClontechYeast Protocols Handbook, PT3024-1. Clontech, Palo Alto, CA2001Google Scholar), and the library insert was sequenced. Colony Filter Lift β-Galactosidase Assay—Single yeast colonies were streaked in a patch (10 × 15 mm) on synthetic dropout medium lacking tryptophan and leucine and incubated for 72 h at 30 °C. Filter lifts of the patches were processed as described for the yeast two-hybrid screen. Yeast Liquid Culture β-Galactosidase Assay—This assay was conducted as described (23ClontechYeast Protocols Handbook, PT3024-1. Clontech, Palo Alto, CA2001Google Scholar) with the modifications noted below. Three independent colonies of each cotransformed strain were grown separately to logarithmic phase in synthetic defined medium lacking tryptophan and leucine; the absorbance at 600 nm was measured; and the yeast cells in a 1.5-ml aliquot were pelleted by centrifugation. Each pellet was washed and resuspended in 200 μl of buffer A (60 mm Na2HPO4·7H2O, 40 mm NaH2PO4·H2O, 10 mm KCl, and 1 mm MgSO4·7H2O). 100-μl aliquots of resuspended cells were subjected to three freeze-thaw cycles in liquid nitrogen, and then 750 μl of 0.27% β-mercaptoethanol in buffer A and 150 μl of 4 mg/ml o-nitrophenyl-β-d-galactopyranoside in buffer A were added. When the supernatant turned pale yellow, 400 μl of 1 m Na2CO3 was added; the mixture was centrifuged; and the absorbance of the supernatant at 420 nm was recorded. β-Galactosidase units = 1000 × A 420/(t × V × A 600), where t is the time in minutes from the addition of o-nitrophenyl-β-d-galactopyranoside to the addition of Na2CO3, V is 0.1× starting cell volume of 1.5 ml/resuspended cell volume of 0.10 ml, and A 600 is the value for each sample measured during logarithmic growth phase (23ClontechYeast Protocols Handbook, PT3024-1. Clontech, Palo Alto, CA2001Google Scholar). The β-galactosidase units were normalized to the controls indicated in the figure legends. SRE-mediated Transcription Assay—The pSRE.L reporter plasmid has been described (21Mao J. Yuan H. Xie W. Wu D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12973-12976Crossref PubMed Scopus (114) Google Scholar). The pRL-TK plasmid contains the Renilla reniformis (sea pansy) luciferase cDNA downstream of the herpes simplex virus thymidine kinase gene promoter. COS-7 cells were plated at a density of 5 × 104 cells/well in Falcon Primaria 24-well plates (BD Biosciences), transfected in serum-free medium for 3 h, and incubated in medium with 0.5% BCS for 24 h; and then the firefly and Renilla luciferase activities of the cell lysate were measured using the dual luciferase assay reporter system (Promega) with a MicroLumat Plus LB96V luminometer (Berthold Technologies, Bad Wildbad, Germany). The firefly luciferase activities of cells transfected with Lsc and each Lsc mutant are presented as the mean ± S.D. of four independent wells in each experiment, where the measured firefly luciferase activity of each well was adjusted for transfection efficiency by calculating the ratio of measured firefly luciferase activity to Renilla luciferase activity and then normalized to the control transfected with only pRL-TK, pSRE.L, and βgal-pBJ.KS. The firefly luciferase activities of Lsc and Lsc mutants were compared using a one-way analysis of variance; and if a difference existed, post hoc pairwise comparisons were made using the Student-Newman-Keuls test (24Glantz S. Primer of Bi statistics. 2nd ed. McGraw-Hill Inc., New York1987Google Scholar). Immunoprecipitation and Immunoblotting—Immunoprecipitation and immunoblotting were performed using standard methods (25Harlow E. Lane D. Using Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1999Google Scholar) with the modifications noted below. COS-7 cells were plated at a density of 2 × 105 cells/well in Falcon Primaria 6-well plates (BD Biosciences), transiently transfected for 12–16 h, and then incubated in DMEM supplemented with 10% BCS for an additional 24 h. Cell lysates were harvested with 1 ml of cold lysis buffer (50 mm Hepes (pH 7.4), 150 mm NaCl, 2 mm EDTA, 1% Igepal, 10% glycerol, 10 mm NaF, 100 μg/ml phenylmethylsulfonyl fluoride, 1 μg/ml aprotinin, and one tablet of Complete protease inhibitor mixture (Roche Applied Bioscience)/50 ml of lysis buffer) and gentle scraping and spun at 14,000 × g for 10 min, and the protein concentration of the supernatants was measured (DC protein assay, Bio-Rad) and equalized by dilution in lysis buffer. Anti-FLAG antibody M2 was added to 400 μl of supernatant; the mixture was incubated on ice for 3 h; protein A-Sepharose beads (100 μl of a 50:50 slurry) were added; and the samples were rocked for 1 h and then washed three times with cold lysis buffer. The beads were pelleted; the supernatant was removed; and 2× Laemmli buffer with 10% dithiothreitol was added. The samples were boiled for 5 min, subjected to PAGE, transferred to a polyvinylidene difluoride membrane (Bio-Rad), and blotted sequentially with murine anti-HA monoclonal antibody 12CA5 and horseradish peroxidase-conjugated goat anti-mouse antibody. Crude lysate was removed prior to the addition of the M2 immunoprecipitating antibody, processed similarly, and blotted with either the 12CA5 or M2 antibody. The immunoblots were developed with the ECL Plus detection system (Amersham Biosciences) according to the manufacturer's instructions, and images were collected with a Storm 860 imager (Amersham Biosciences). Amplification of Lsc Partial cDNAs from Spleen—Lsc partial cDNA clones were amplified by PCR from mouse spleen first-strand cDNA using primers DL1026 and DL2080 with an annealing temperature of 60 °C for 40 cycles on a RoboCycler Gradient 96 temperature cycler (Stratagene). The PCR reaction products were subjected to agarose gel electrophoresis; and amplicons smaller than the common isoform amplicon were isolated, subcloned into pCR2.1-TOPO (Invitrogen), and sequenced. The sequences of these clones were aligned with the cDNA sequence of the common isoform of Lsc (GenBank™/EBI accession number U58203) to identify partial cDNAs lacking exonic sequence found in the common isoform. These clones were aligned with the Lsc genomic DNA sequence (GenBank™/EBI accession number AC073679) to predict the 5′- and 3′-splice junction sequences corresponding to the absent exonic sequence. Because >98% of introns utilize the consensus 5′-GT/3′-AG intronic splice site dinucleotide pair (26Burset M. Seledtsov I.A. Solovyev V.V. Nucleic Acids Res. 2000; 28: 4364-4375Crossref PubMed Scopus (447) Google Scholar), we considered only clones with this dinucleotide pair for further analysis. C-terminal Residues Negatively Regulate Lsc in Vivo—Before conducting a screen to identify proteins that interact with the C terminus of Lsc, we wanted to determine whether Lsc is negatively regulated by residues C-terminal to the PH domain. Activated Rho induces SRE-mediated transcription (27Hill C.S. Wynne J. Treisman R. Cell. 1995; 81: 1159-1170Abstract Full Text PDF PubMed Scopus (1207) Google Scholar, 28Treisman R. Alberts A.S. Sahai E. Cold Spring Harbor Symp. Quant. Biol. 1998; 63: 643-651Crossref PubMed Scopus (67) Google Scholar), and this can be used to measure GEF activity (21Mao J. Yuan H. Xie W. Wu D. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 12973-12976Crossref PubMed Scopus (114) Google Scholar). We compared the ability of Lsc and a mutant form of Lsc lacking the C-terminal 146 aa (Fig. 1) to activate SRE-mediated transcription from a firefly luciferase reporter plasmid (pSRE.L) in transiently transfected COS-7 cells. Deletion of the C-terminal 146 aa conferred a 2–3-fold increase in fi

Despite its challenges, a "big data" approach offers a unique opportunity within the field of cardio-oncology. A pharmacovigilant approach using large data sets can help characterize cardiovascular toxicities of the rapidly expanding armamentarium of targeted therapies. Creating a broad coalition of data sharing can provide insights into the incidence of cardiotoxicity and stimulate research into the underlying mechanisms. Population health necessitates the use of big data and can help inform public health interventions to prevent both cancer and cardiovascular disease. As a relatively new discipline, cardio-oncology is poised to take advantage of big data.

Survival in cancer has improved, shifting some of the focus of care to minimizing the long term complications of cancer therapy. Cardiovascular disease is a leading long-term cause of morbidity and mortality in patients who survive cancer. In the review we will focus on imaging techniques that are used to detect the cardiovascular consequences of chemotherapy. We will differentiate cardiotoxicity and cardiac injury from cardiac dysfunction and cardiomyopathy. We will discuss the current clinical measures that are used to monitor patients, the limitations of each technique, and then detail research into novel methods for tracking and detecting the cardiac toxicity and cardiac dysfunction that may occur as a result of chemotherapy.

The OMEGA-REMODEL (Effect of Omega-3 Acid Ethyl Esters on Left Ventricular Remodeling After Acute Myocardial Infarction) trial of patients with acute myocardial infarction (MI) reported significant attenuation of adverse left ventricular (LV) remodeling and noninfarct myocardial fibrosis after 6

HomeCirculation: Heart FailureVol. 11, No. 7Anthracycline Cardiomyopathy Free AccessEditorialPDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citationsPermissions ShareShare onFacebookTwitterLinked InMendeleyReddit Jump toFree AccessEditorialPDF/EPUBAnthracycline CardiomyopathyThe Plot Gets Thinner Amanda J. Favreau-Lessard, PhD, Douglas B. Sawyer, MD, PhD and Sanjeev A. Francis, MD Amanda J. Favreau-LessardAmanda J. Favreau-Lessard Maine Medical Center Research Institute, Scarborough (A.J.F.-L., D.B.S.). Search for more papers by this author , Douglas B. SawyerDouglas B. Sawyer Maine Medical Center Research Institute, Scarborough (A.J.F.-L., D.B.S.). Maine Medical Center, Portland (D.B.S., S.A.F.). Search for more papers by this author and Sanjeev A. FrancisSanjeev A. Francis Sanjeev A. Francis, MD, Maine Medical Center, 22 Bramhall St, Portland, ME 04102. E-mail E-mail Address: [email protected] Maine Medical Center, Portland (D.B.S., S.A.F.). The opinions expressed in this article are not necessarily those of the editors or of the American Heart Association. Search for more papers by this author Originally published10 Jul 2018https://doi.org/10.1161/CIRCHEARTFAILURE.118.005194Circulation: Heart Failure. 2018;11:e005194is related toLeft Ventricular Mass Change After Anthracycline ChemotherapySee Article by Jordan et alAnthracycline-based chemotherapy regimens remain in wide use for treatment of many malignancies, despite the rapid growth and development of targeted pathway inhibitors and immunotherapies (both of which can be associated with a variety of cardiovascular toxicities). Discovered in the late 1960s and commonly used as a chemotherapeutic in the early 1970s, anthracycline cardiotoxicity was quickly recognized as a serious complication1,2 and served as the canonical example of chemotherapy-associated cardiomyopathy, spurring the development of the field of cardio-oncology. The observation that left ventricular (LV) mass and growth potential are reduced after exposure to anthracycline chemotherapy was first observed in survivors of childhood cancer and the term Grinch Syndrome was coined by Lipshultz et al3 to describe the potential evolution of reduced LV mass after anthracycline therapy to a restrictive cardiomyopathy in some patients. In adults, a reduction in LV mass has been observed several years after anthracycline-based chemotherapy and is associated with increased cardiac events.4In this issue of Circulation: Heart Failure, Jordan et al5 provide further details to our understanding of how anthracycline chemotherapy alters cardiac structure and function, using serial cardiac magnetic resonance imaging in a cohort of adult cancer patients. LV mass, LV systolic function, aortic stiffness, and ventricular-arterial coupling were measured in 61 adults receiving an anthracycline-based regimen at baseline and 6 months after initiation of therapy. The comparator groups included a cohort of 15 patients receiving nonanthracycline chemotherapy as well as a control group of 24 subjects without cancer. The primary findings are that there was on average a 5% decline in both LV ejection fraction and LV mass, an increase in aortic stiffness, along with changes in ventricular-arterial coupling in the anthracycline group. Decreases in LV mass, but not ejection fraction, were associated with changes in heart failure symptoms as measured by the Minnesota Living with Heart Failure Questionnaire. The authors speculate that the early decrease in LV mass may serve as an imaging biomarker of anthracycline cardiotoxicity. The authors acknowledge that their observations will need to be validated in larger studies. The time course and persistence of these changes in cardiac morphology and function will need to be established with longer follow-up, and the link to hard clinical outcomes assessed in future trials. Time will tell whether LV mass serves as a reliable marker for cardiotoxicity and predictor of long-term risk.The relatively early reduction in LV mass does raise some intriguing questions about the mechanism of anthracycline toxicity and the potential protective pathways that may prevent or mitigate the loss of ventricular mass. Basic and clinical research has demonstrated that anthracyclines induce myocyte cell death through a variety of mechanisms,6 as well as sarcopenia, both of which can contribute to reductions in myocardial mass. In addition, anthracyclines are known to target both quiescent and proliferating cells through interactions with topoisomerase, similar to the mechanism for anthracycline therapeutic actions in proliferating cancer cells. Thus, it is not surprising that anthracyclines are toxic for endothelial and cardiac progenitor cell populations.7 Loss of endothelial cells can result in vascular damage, disrupting endothelial function, and increasing vascular stiffness. Cardiac progenitor cells have demonstrated the capability to rejuvenate the myocardium after injury and depletion of this pool halts repair mechanisms. Similarly, a growing heart depleted of progenitor cell pools would seem less likely to reach a normal size, explaining the Grinch Syndrome as a consequence of childhood anthracycline exposure.Physiological growth of the heart during maturation and in response to increased normal demand (ie, exercise training and pregnancy) occur through other mechanisms that may also be impacted by anthracycline exposure. It is interesting that at least one of the pathways for physiological growth—neuregulin-1 and the ERBB receptor tyrosine kinase family—has known interactions with anthracycline cardiotoxicity. ERBB2-targeted cancer therapies, when given concurrently with anthracyclines, augment cardiotoxicity.8 It is interesting that neuregulin/ERBB signaling is critical for myocardial development as well as postnatal cardiac growth, and physiological responses to exercise and pregnancy (reviewed by Odiete et al9). Exercise activates neuregulin,10 and circulating levels of neuregulin are increased in people with higher fitness.11 Circulating neuregulin levels decline with anthracycline-based chemotherapy both in adults12 and children,13 raising the possibility that disruption of this or other cardiac growth pathways is involved in the decline in LV mass seen by Jordan et al.5The finding that anthracycline exposure increased aortic stiffness and thereby disrupt ventricular-arterial coupling makes the findings of Jordan et al5 all the more interesting.14,15 Increases in arterial stiffness as occur in hypertension and aging are well known to increase myocardial demand and lead to increases in LV mass. The decline in LV mass in the face of increased arterial stiffness highlights how anthracycline exposure has completely disrupted the normal physiological mechanisms that couple adaptive changes in myocardial mass to load. Thus, the clinical impact of reduced myocardial mass and impaired LV function is likely compounded with increased vascular resistance. Additional studies are needed to further characterize the dynamic relationship between the cardiac and vascular effects of anthracycline and help us better identify those at greatest risk as early in their treatment as possible.The more we learn about anthracycline cardiotoxicity, the more the plot evolves. With >60 years of thinning hearts, we still have a lot to learn to reverse or inhibit the cardiotoxicity that is associated with anthracyclines. Basic and clinical research have uncovered numerous mechanisms involved with cardiac damage and early indicators of cardiac toxicity such as LV mass decline add to the clinical evidence base and may serve as a more accurate imaging biomarker. Perhaps one day our treatment strategies will evolve, allowing us to write the final chapter in this story. However, as suggested previously,16 it may be worth considering how to put the cardiac effects of anthracycline to good use when progressive increases in cardiac mass becomes a clinical problem.DisclosuresNone.FootnotesThe opinions expressed in this article are not necessarily those of the editors or of the American Heart Association.https://www.ahajournals.org/journal/circheartfailureSanjeev A. Francis, MD, Maine Medical Center, 22 Bramhall St, Portland, ME 04102. E-mail [email protected]orgReferences1. Tan C, Tasaka H, Yu KP, Murphy ML, Karnofsky DA. Daunomycin, an antitumor antibiotic, in the treatment of neoplastic disease. Clinical evaluation with special reference to childhood leukemia.Cancer. 1967; 20:333–353.CrossrefMedlineGoogle Scholar2. Ritchie JL, Singer JW, Thorning D, Sorensen SG, Hamilton GW. Anthracycline cardiotoxicity: clinical and pathologic outcomes assessed by radionuclide ejection fraction.Cancer. 1980; 46:1109–1116.CrossrefMedlineGoogle Scholar3. Lipshultz SE, Scully RE, Stevenson KE, Franco VI, Neuberg DS, Colan SD, Silverman LB, Moslehi JJ, Cheng S, Sallan SE. Hearts too small for body size after doxorubicin for childhood ALL: Grinch syndrome.J Clin Oncol. 2014; 32:10021–10021.CrossrefGoogle Scholar4. Neilan TG, Coelho-Filho OR, Pena-Herrera D, Shah RV, Jerosch-Herold M, Francis SA, Moslehi J, Kwong RY. Left ventricular mass in patients with a cardiomyopathy after treatment with anthracyclines.Am J Cardiol. 2012; 110:1679–1686. doi: 10.1016/j.amjcard.2012.07.040.CrossrefMedlineGoogle Scholar5. Jordan JH, Castellino SM, Meléndez GC, Klepin HD, Ellis LR, Lamar Z, Vasu S, Kitzman DW, Ntim WO, Brubaker PH, Reichek N, D’Agostino RB, Hundley WG. Left ventricular mass change after anthracycline chemotherapy.Circ Heart Fail. 2018; 11:e004560. doi: 10.1161/CIRCHEARTFAILURE.117.004560.LinkGoogle Scholar6. Sawyer DB, Peng X, Chen B, Pentassuglia L, Lim CC. Mechanisms of anthracycline cardiac injury: can we identify strategies for cardioprotection?Prog Cardiovasc Dis. 2010; 53:105–113. doi: 10.1016/j.pcad.2010.06.007.CrossrefMedlineGoogle Scholar7. Huang C, Zhang X, Ramil JM, Rikka S, Kim L, Lee Y, Gude NA, Thistlethwaite PA, Sussman MA, Gottlieb RA, Gustafsson AB. Juvenile exposure to anthracyclines impairs cardiac progenitor cell function and vascularization resulting in greater susceptibility to stress-induced myocardial injury in adult mice.Circulation. 2010; 121:675–683. doi: 10.1161/CIRCULATIONAHA.109.902221.LinkGoogle Scholar8. Slamon DJ, Leyland-Jones B, Shak S, Fuchs H, Paton V, Bajamonde A, Fleming T, Eiermann W, Wolter J, Pegram M, Baselga J, Norton L. Use of chemotherapy plus a monoclonal antibody against HER2 for metastatic breast cancer that overexpresses HER2.N Engl J Med. 2001; 344:783–792. doi: 10.1056/NEJM200103153441101.CrossrefMedlineGoogle Scholar9. Odiete O, Hill MF, Sawyer DB. Neuregulin in cardiovascular development and disease.Circ Res. 2012; 111:1376–1385. doi: 10.1161/CIRCRESAHA.112.267286.LinkGoogle Scholar10. Ennequin G, Boisseau N, Caillaud K, Chavanelle V, Gerbaix M, Metz L, Etienne M, Walrand S, Masgrau A, Guillet C, Courteix D, Niu A, Li YP, Capel F, Sirvent P. Exercise training and return to a well-balanced diet activate the neuregulin 1/ErbB pathway in skeletal muscle of obese rats.J Physiol. 2015; 593:2665–2677. doi: 10.1113/JP270026.CrossrefMedlineGoogle Scholar11. Moondra V, Sarma S, Buxton T, Safa R, Cote G, Storer T, Lebrasseur NK, Sawyer DB. Serum neuregulin-1beta as a biomarker of cardiovascular fitness.Open Biomark J. 2009; 2:1–5. doi: 10.2174/1875318300902010001.CrossrefMedlineGoogle Scholar12. Geisberg CA, Abdallah WM, da Silva M, Silverstein C, Smith HM, Abramson V, Mayer I, Means-Powell J, Freehardt D, White B, Lenihan D, Sawyer DB. Circulating neuregulin during the transition from stage A to stage B/C heart failure in a breast cancer cohort.J Card Fail. 2013; 19:10–15. doi: 10.1016/j.cardfail.2012.11.006.CrossrefMedlineGoogle Scholar13. Lipshultz S, Blonquist TM, Miller TL, Neuberg DS, Smith HM, Anderson B, Franco VI, Bansal N, Lipshultz ER, Scully RE, Silverman LB, Colan SD, Asselin BL, Athale U, Clavell LA, Laverdiere C, Michon B, Schorin MA, Sallan SE, Sawyer D. Cardiovascular signaling proteins as predictors of doxorubicin- related cardiac effects in children with acute lymphoblastic leukemia.J Am Coll Cardiol. 2018; 71:A927. doi: 10.1016/S0735-1097(18)31468-2.CrossrefGoogle Scholar14. Chaosuwannakit N, D’Agostino R, Hamilton CA, Lane KS, Ntim WO, Lawrence J, Melin SA, Ellis LR, Torti FM, Little WC, Hundley WG. Aortic stiffness increases upon receipt of anthracycline chemotherapy.J Clin Oncol. 2010; 28:166–172. doi: 10.1200/JCO.2009.23.8527.CrossrefMedlineGoogle Scholar15. Koelwyn GJ, Lewis NC, Ellard SL, Jones LW, Gelinas JC, Rolf JD, Melzer B, Thomas SM, Douglas PS, Khouri MG, Eves ND. Ventricular-arterial coupling in breast cancer patients after treatment with anthracycline-containing adjuvant chemotherapy.Oncologist. 2016; 21:141–149. doi: 10.1634/theoncologist.2015-0352.CrossrefMedlineGoogle Scholar16. Sawyer DB. Is there more for us to learn from oncology?: examining the implications of anthracycline effects on the young heart.Circulation. 2010; 121:623–625. doi: 10.1161/CIR.0b013e3181d2c996.LinkGoogle Scholar Previous Back to top Next FiguresReferencesRelatedDetailsCited By Čelutkienė J, Pudil R, López‐Fernández T, Grapsa J, Nihoyannopoulos P, Bergler‐Klein J, Cohen‐Solal A, Farmakis D, Tocchetti C, Haehling S, Barberis V, Flachskampf F, Čeponienė I, Haegler‐Laube E, Suter T, Lapinskas T, Prasad S, Boer R, Wechalekar K, Anker M, Iakobishvili Z, Bucciarelli‐Ducci C, Schulz‐Menger J, Cosyns B, Gaemperli O, Belenkov Y, Hulot J, Galderisi M, Lancellotti P, Bax J, Marwick T, Chioncel O, Jaarsma T, Mullens W, Piepoli M, Thum T, Heymans S, Mueller C, Moura B, Ruschitzka F, Zamorano J, Rosano G, Coats A, Asteggiano R, Seferovic P, Edvardsen T and Lyon A (2020) Role of cardiovascular imaging in cancer patients receiving cardiotoxic therapies: a position statement on behalf of the H eart F ailure A ssociation ( HFA ), the E uropean A ssociation of C ardiovascular I maging ( EACVI ) and the Cardio‐Oncology C ouncil of the E uropean S ociety of C ardiology ( ESC ) , European Journal of Heart Failure, 10.1002/ejhf.1957, 22:9, (1504-1524), Online publication date: 1-Sep-2020. Cowgill J, Francis S and Sawyer D (2019) Anthracycline and Peripartum Cardiomyopathies, Circulation Research, 124:11, (1633-1646), Online publication date: 24-May-2019.Related articlesLeft Ventricular Mass Change After Anthracycline ChemotherapyJennifer H. Jordan, et al. Circulation: Heart Failure. 2018;11 July 2018Vol 11, Issue 7 Advertisement Article InformationMetrics © 2018 American Heart Association, Inc.https://doi.org/10.1161/CIRCHEARTFAILURE.118.005194PMID: 29991489 Originally publishedJuly 10, 2018 KeywordsfailureendothelialEditorialsanthracyclinescellsheartcardiotoxicityPDF download Advertisement SubjectsCardio-OncologyCardiomyopathyHeart Failure

The antimetabolite chemotherapeutic agent 5-fluorouracil is used to treat a variety of cancers. Although 5-fluorouracil is generally well tolerated, its toxicity profile includes potential cardiac ischemia, vasospasm, arrhythmia, and direct myocardial injury. These actual or potential toxicities are thought to resolve upon cessation of the medication; however, information about the long-term cardiovascular effects of therapy is not sufficient. We present the case of a 58-year-old man who had 2 ventricular fibrillation cardiac arrests, with evidence of coronary vasospasm and myocarditis, on his 4th day of continuous infusion with 5-fluorouracil. External defibrillation and cessation of the 5-fluorouracil therapy resolved the patient's electrocardiographic abnormalities. In addition to reporting the clinical manifestations of 5-fluorouracil-associated cardiotoxicity in our patient, we discuss management challenges in patients who develop severe 5-fluorouracil-induced ventricular arrhythmias.

Spontaneous coronary artery dissection (SCAD) is an uncommon but important cause of acute myocardial infarction, particularly in younger women and in patients with underlying fibromuscular dysplasia (FMD). There is increasing literature on patients with SCAD reporting significant emotional stress, particularly stress related to unemployment, in the week prior to their cardiac event, and emotional triggers appear to be associated with worse in-hospital and follow-up cardiac events. Additionally, the COVID-19 pandemic has resulted in significant societal stressors and increased unemployment, which have been associated with increased cardiovascular morbidity. Here, we present a case of a female presenting with an acute MI secondary to SCAD in the setting of recently learning of impending unemployment due to COVID-19 vaccine refusal. This case highlights the importance of considering SCAD in patients with significant recent emotional stress who present with MI. Additionally, in light of the emotional stressors of the COVID-19 pandemic, clinicians must be aware of the consequences significant emotional stress plays on the development of adverse complications of chronic disease.

Future OncologyVol. 11, No. 14 OpinionOptimizing cardio-oncology programs for cancer patientsSanjeev A Francis, Aarti Asnani, Tomas Neilan & Marielle Scherrer-CrosbieSanjeev A Francis*Author for correspondence: E-mail Address: safrancis@partners.org Cardio-Oncology Program, Cardiology Division, Massachusetts General Hospital, Boston, MA, USASearch for more papers by this author, Aarti Asnani Cardio-Oncology Program, Cardiology Division, Massachusetts General Hospital, Boston, MA, USASearch for more papers by this author, Tomas Neilan Cardio-Oncology Program, Cardiology Division, Massachusetts General Hospital, Boston, MA, USASearch for more papers by this author & Marielle Scherrer-Crosbie Cardio-Oncology Program, Cardiology Division, Massachusetts General Hospital, Boston, MA, USASearch for more papers by this authorPublished Online:22 Jul 2015https://doi.org/10.2217/fon.15.128AboutSectionsView ArticleView Full TextPDF/EPUB ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareShare onFacebookTwitterLinkedInRedditEmail View articleKeywords: anthracyclinecardio-oncologychemotherapy-induced cardiomyopathycardiotoxicitycardiovascular screeningradiation-associated heart diseasesurvivorshipReferences1 Center for Disease Control. National Vital Statistic Reports Vol. 61, No. 6 (2012). www.cdc.gov/nchs/data/nsvr/nvsr61/nvsr61_06.pdf.Google Scholar2 Lipshultz SE, Colan SD, Gelber RD, Perez-Atayde AR, Sallan SE, Sanders SP. Late cardiac effects of doxorubicin therapy for acute lymphoblastic leukemia in childhood. N. Engl. J. Med. 324, 808–815 (1991).Crossref, Medline, CAS, Google Scholar3 Swain SM, Whaley FS, Ewer MS. Congestive heart failure in patients treated with doxorubicin. Cancer 97, 2869–2879 (2003).Crossref, Medline, CAS, Google Scholar4 Cardinale D, Colombo A, Bacchiani G et al. Early detection of anthracycline cardiotoxicity and improvement with heart failure therapy. Circulation doi:10.1161/CIRCULATIONAHA.114.013777 (2015) (Epub ahead of print).Crossref, Medline, Google Scholar5 Cardinale D et al. Prevention of high-dose chemotherapy-induced cardiotoxicity in high-risk patients by angiotensin-converting enzyme inhibition. Circulation 114, 2474–2481 (2006).Crossref, Medline, CAS, Google Scholar6 Bosch X, Rovira M, Sitges M et al. Enalapril and carvedilol for preventing chemotherapy-induced left ventricular systolic dysfunction in patients with malignant hemopathies. J. Am. Coll. Cardiol. 61(23), 2355–2362 (2013).Crossref, Medline, CAS, Google Scholar7 Sawyer DB. Anthracyclines and heart failure. N. Engl. J. Med. 368, 1154–1156 (2013).Crossref, Medline, CAS, Google Scholar8 Liu Y, Asnani A, Zou L et al. Visnagin protects against doxorubicin-induced cardiomyopathy through modulation of mitochondrial malate dehydrogenase. Sci. Transl. Med. 6, 266ra170 (2014).Crossref, Medline, Google Scholar9 Khouri MG, Douglas PS, Mackey JR et al. Cancer therapy-induced cardiac toxicity in early breast cancer: addressing the unresolved issues. Circulation 126, 2749–2763 (2012).Crossref, Medline, Google Scholar10 Ezaz G, Long JB, Gross CP, Chen J. Risk prediction model for heart failure and cardiomyopathy after adjuvant trastuzumab therapy for breast cancer. J. Am. Heart Assoc. 3, e000472–e000472 (2014).Crossref, Medline, Google Scholar11 Suter TM, Procter M, van Veldhuisen DJ et al. Trastuzumab-associated cardiac adverse effects in the herceptin adjuvant trial. J. Clin. Oncol. 25, 3859–3865 (2007).Crossref, Medline, CAS, Google Scholar12 Slusarz KM, Merker VL, Muzikansky A, Francis SA, Plotkin SR. Long-term toxicity of bevacizumab therapy in neurofibromatosis 2 patients. Cancer Chemother. Pharmacol. 73, 1197–1204 (2014).Crossref, Medline, CAS, Google Scholar13 Groarke JD, Nguyen PL, Nohria A, Ferrari R, Cheng S, Moslehi J. Cardiovascular complications of radiation therapy for thoracic malignancies: the role for non-invasive imaging for detection of cardiovascular disease. Eur. Heart J. 35, 612–623 (2014).Crossref, Medline, Google Scholar14 Darby SC, Ewertz M, McGale P et al. Risk of ischemic heart disease in women after radiotherapy for breast cancer. N. Engl. J. Med. 368, 987–998 (2013).Crossref, Medline, CAS, Google Scholar15 Mulrooney DA, Yeazel MW, Kawashima T et al. Cardiac outcomes in a cohort of adult survivors of childhood and adolescent cancer: retrospective analysis of the Childhood Cancer Survivor Study cohort. BMJ 339, b4606–b4606 (2009).Crossref, Medline, Google Scholar16 Patnaik JL, Byers T, DiGuiseppi C, Dabelea D, Denberg TD. Cardiovascular disease competes with breast cancer as the leading cause of death for older females diagnosed with breast cancer: a retrospective cohort study. Am. J. Cardiol. 13, R64 (2011).Google Scholar17 Long-Term Follow-Up Guidelines for Survivors of Childhood, Adolescent, and Young Adult Cancers. www.survivorshipguidelines.org.Google Scholar18 National Comprehensive Cancer Network. www.nccn.org.Google Scholar19 Lancellotti P, Nkomo VT, Badano LP et al. Expert consensus for multi-modality imaging evaluation of cardiovascular complications of radiotherapy in adults: a report from the European Association of Cardiovascular Imaging and the American Society of Echocardiography. J. Am. Soc. Echocardiogr. 26, 1013–1032 (2013).Crossref, Medline, Google Scholar20 Plana JC, Galderisi M, Barac A et al. Expert consensus for multimodality imaging evaluation of adult patients during and after cancer therapy: a report from the American Society of Echocardiography and the European Association of Cardiovascular Imaging. J. Am. Soc. Echocardiogr. 27, 911–939 (2014).Crossref, Medline, Google Scholar21 Sawaya H, Cochran TR, Wilkinson JD. Screening for long-term cardiac status during cancer treatment. Circ. Cardiovasc. Imaging 5, 555–558 (2012).Crossref, Medline, Google Scholar22 Neilan TG, Coelho-Filho OR, Shah RV et al. Myocardial extracellular volume by cardiac magnetic resonance imaging in patients treated with anthracycline-based chemotherapy. Am. J. Cardiol. 111(5), 717–22 (2013).Crossref, Medline, CAS, Google ScholarFiguresReferencesRelatedDetailsCited ByImpact of a cardio‐oncology unit on prevention of cardiovascular events in cancer patients1 April 2022 | ESC Heart Failure, Vol. 9, No. 3Pediatric Cardio-Oncology Medicine: A New Approach in Cardiovascular Care18 December 2021 | Children, Vol. 8, No. 12Cardio-oncologyHeart Failure Clinics, Vol. 13, No. 2Cardio-oncology: a special focus issue from Future OncologyRobin L Jones & Maria Teresa Sandri22 July 2015 | Future Oncology, Vol. 11, No. 14 Vol. 11, No. 14 STAY CONNECTED Metrics Downloaded 143 times History Published online 22 July 2015 Published in print July 2015 Information© Future Medicine LtdKeywordsanthracyclinecardio-oncologychemotherapy-induced cardiomyopathycardiotoxicitycardiovascular screeningradiation-associated heart diseasesurvivorshipFinancial & competing interests disclosureThe authors have no relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.No writing assistance was utilized in the production of this manuscript.PDF download

Standard interpretation of single photon emission computed tomography (SPECT) myocardial perfusion imaging (MPI) studies include analysis of the rest and stress perfusion images as well as evaluation of left ventricular function. However, it is also important to carefully review the rotating cinematic raw projections “rotatograms” for factors that may influence the interpretation and non-cardiac findings. Non-cardiac findings from rotating cinematic images have identified both benign and malignant conditions [ 1 Williams K.A. Hill K.A. Sheridan C.M. Noncardiac findings on dual-isotope myocardial perfusion SPECT. J Nucl Cardiol. 2003; 10: 395-402 Google Scholar , 2 Jones S.E. Aziz K. Yasuda T. Gewirtz H. Scott J.A. Importance of systematic review of rotating projection images from Tc99m-sestamibi cardiac perfusion imaging for noncardiac findings. Nucl Med Commun. 2008; 29: 607-613 Google Scholar ]. We report two male patients who underwent stress technetium 99m sestamibi SPECT and were found to have increased focal tracer uptake identified in the breast region on the rotating cine images; case 1 had a diagnosis of invasive ductal adenocarcinoma of the breast and case 2 had bilateral gynecomastia.

HomeCirculationVol. 120, No. 11Solitary Fatty Infiltration Within the Left Ventricle Detected by Cardiac Magnetic Resonance Imaging in a Patient Presenting With Ventricular Tachycardia Free AccessReview ArticlePDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citationsPermissionsDownload Articles + Supplements ShareShare onFacebookTwitterLinked InMendeleyReddit Jump toSupplementary MaterialsFree AccessReview ArticlePDF/EPUBSolitary Fatty Infiltration Within the Left Ventricle Detected by Cardiac Magnetic Resonance Imaging in a Patient Presenting With Ventricular Tachycardia Otavio R. Coelho-Filho, MD, Mahadevan Rajaram, MBBS, Michael Jerosh-Herold, PhD, Shuaib Abdullah, MD, David Carballo, MD, MPH, Luciana Feitosa, MD, Sanjeev Francis, MD, Roy John, MD, Ron Blankstein, MD and Raymond Y. Kwong, MD, MPH Otavio R. Coelho-FilhoOtavio R. Coelho-Filho From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. , Mahadevan RajaramMahadevan Rajaram From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. , Michael Jerosh-HeroldMichael Jerosh-Herold From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. , Shuaib AbdullahShuaib Abdullah From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. , David CarballoDavid Carballo From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. , Luciana FeitosaLuciana Feitosa From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. , Sanjeev FrancisSanjeev Francis From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. , Roy JohnRoy John From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. , Ron BlanksteinRon Blankstein From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. and Raymond Y. KwongRaymond Y. Kwong From the Cardiovascular Division, Department of Medicine (O.R.C.-F., M.R., S.A., D.C., L.F., S.F., R.J., R.B., R.Y.K.), and Department of Radiology (M.J.-H.), Brigham and Women's Hospital, Harvard Medical School, Boston, Mass. Originally published15 Sep 2009https://doi.org/10.1161/CIRCULATIONAHA.108.839142Circulation. 2009;120:1008–1010A 58-year-old black woman with a past medical history of recurrent presyncope, hypertension, depression, and breast cancer with right lumpectomy was admitted with symptoms of palpitations, chest pressure accompanied by numbness, and exertional dyspnea. An admission resting ECG revealed sinus rhythm without evidence of a prior myocardial infarction associated with occasional premature ventricular beats. A telemetry surveillance rhythm strip demonstrated nonsustained ventricular tachycardia with a left bundle block pattern (Figure 1). Transthoracic echocardiography examination was performed that showed normal biventricular morphology, size, and systolic function with no regional wall motion abnormalities (Movie I in the online-only Data Supplement). To further investigate the cause of the nonsustained ventricular tachycardia and to exclude any possible structural heart disease, a cardiac magnetic resonance (CMR) study with gadolinium contrast was performed. The CMR confirmed the normal biventricular size and systolic function (Movie II in the online-only Data Supplement) and, interestingly, revealed a region of intramyocardial fatty infiltration in the inferoseptal and septal walls of the left ventricle (LV) (Figure 2). The employed CMR protocol, which included cine steady state free precession images, resting first pass perfusion after gadolinium injection, late gadolinium enhancement images (LGE), and specific sequences to identify fat (T1-weighted turbo spin echo with and without fat suppression), provided clear identification of a layer of fatty infiltration in the inferoseptal and septal walls of the LV (Figure 3) and a matching resting first-pass perfusion defect (Figure 4A) without any evidence of scar documented by normal LGE images (Figure 4B). Among the various CMR techniques employed, only the T1-weighted turbo spin echo with and without fat suppression represents definitive evidence of fatty infiltration. LGE image sequences are not sufficient to definitively demonstrate fatty infiltration because fat suppression techniques are rarely used with LGE. Furthermore, gadolinium injection inherently changes the tissue T1 and T2 parameters, further reducing the ability to identify relatively small regions of fatty infiltration. Sequences other than the T1-weighted spin echo with and without fat saturation are in agreement with this finding; however, the abnormal intraventricular signal could be due to other changes in the tissue. Moreover, the CMR did not reveal any morphological abnormalities within the right ventricle. Subsequently, the patient underwent an invasive electrophysiology study revealing first-degree atrioventricular block with mild conduction delay in the His-Purkinje system (HV interval 80 ms). Programmed right ventricular (RV) stimulation reproducibly induced polymorphic ventricular tachycardia with double extrastimulation requiring external defibrillation for conversion to sinus rhythm. An implantable cardioverter-defibrillator was subsequently implanted, and during the same procedure, 3 different RV (apical, outflow, and anterior wall) tissue samples were obtained. The tissue samples did not show evidence of fatty infiltration or any other infiltrative disease, which also supports the CMR findings that revealed no abnormality within the RV. Download figureDownload PowerPointFigure 1. Telemetry surveillance rhythm strip (II, III, and V1) demonstrated the presence of nonsustained monomorphic ventricular tachycardia (NSVT) with left bundle block pattern.Download figureDownload PowerPointFigure 2. Axial steady state free precession CMR cine showing evidence of an area of high signal (arrows) within the mid to distal interventricular septal wall representing fatty infiltration. The RV is normal in size and morphology. Refer to Movie III in the online-only Data Supplement for the complete cine loop. AO indicates aorta.Download figureDownload PowerPointFigure 3. A, Midventricular short-axis T1-weighted turbo spin echo on CMR showing a layer of fatty infiltration in the inferoseptal and septal walls of the LV. B, The same short-axis cross section acquired with a T1-weighted turbo spin echo sequence with spectral fat saturation revealed a specific and clear nulling of a layer of fatty infiltration (black arrows).Download figureDownload PowerPointFigure 4. A, Short-axis CMR perfusion after gadolinium injection demonstrated a first-pass perfusion defect in the inferoseptal and septal wall of the LV (white arrows), which matched the region of fatty infiltration. B, Short-axis LGE revealed no evidence of myocardial scar. Refer to Movie IV in the online-only Data Supplement for the complete perfusion loop.Although several cases of arrhythmogenic RV cardiomyopathy with LV involvement have been reported, it often occurs in the later stage of the spectrum of the disease1–3 and usually does not present as an isolated phenomenon independent of RV involvement.4 More recently, Sen-Chowdhry et al5 defined the clinical and genetic profile of left-dominant arrhythmogenic cardiomyopathy, showing that >50% of the clinical left-dominant arrhythmogenic cardiomyopathy cohort had septal abnormalities detected by CMR, and >30% had LV dilation or impairment in the presence of preserved right-sided volumes and function.Guest Editor for this article was Francis J. Klocke, MD.The online-only Data Supplement is available with this article at http://circ.ahajournals.org/cgi/content/full/CIRCULATIONAHA.108.839142/DC1.DisclosuresNone.FootnotesCorrespondence to Raymond Y. Kwong, MD, MPH, Cardiovascular Division, Department of Medicine, Brigham and Women's Hospital, 75 Francis St, Boston, MA 02115. E-mail [email protected] References 1 Suzuki H, Sumiyoshi M, Kawai S, Takagi A, Wada A, Nakazato Y, Daida H, Sakurai H, Yamaguchi H. Arrhythmogenic right ventricular cardiomyopathy with an initial manifestation of severe left ventricular impairment and normal contraction of the right ventricle. Jpn Circ J. 2000; 64: 209–213.CrossrefMedlineGoogle Scholar2 Basso C, Thiene G, Corrado D, Angelini A, Nava A, Valente M. Arrhythmogenic right ventricular cardiomyopathy: dysplasia, dystrophy, or myocarditis? Circulation. 1996; 94: 983–991.CrossrefMedlineGoogle Scholar3 Corrado D, Basso C, Thiene G, McKenna WJ, Davies MJ, Fontaliran F, Nava A, Silvestri F, Blomstrom-Lundqvist C, Wlodarska EK, Fontaine G, Camerini F. Spectrum of clinicopathologic manifestations of arrhythmogenic right ventricular cardiomyopathy/dysplasia: a multicenter study. J Am Coll Cardiol. 1997; 30: 1512–1520.CrossrefMedlineGoogle Scholar4 Jain A, Tandri H, Calkins H, Bluemke DA. Role of cardiovascular magnetic resonance imaging in arrhythmogenic right ventricular dysplasia. J Cardiovasc Magn Reson. 2008; 10: 32.CrossrefMedlineGoogle Scholar5 Sen-Chowdhry S, Syrris P, Prasad SK, Hughes SE, Merrifield R, Ward D, Pennell DJ, McKenna WJ. Left-dominant arrhythmogenic cardiomyopathy: an under-recognized clinical entity. J Am Coll Cardiol. 2008; 52: 2175–2187.CrossrefMedlineGoogle Scholar Previous Back to top Next FiguresReferencesRelatedDetailsCited By Feliu E, Moscicki R, Carrillo L, García-Fernández A, Martínez Martínez J and Ruiz-Nodar J (2020) Importance of cardiac magnetic resonance findings in the diagnosis of left dominant arrythmogenic cardiomyopathy, Revista Española de Cardiología (English Edition), 10.1016/j.rec.2019.12.004, 73:11, (885-892), Online publication date: 1-Nov-2020. Feliu E, Moscicki R, Carrillo L, García-Fernández A, Martínez Martínez J and Ruiz-Nodar J (2020) Importancia de los hallazgos de la resonancia magnética cardiaca en el diagnóstico de la miocardiopatía arritmogénica del ventrículo izquierdo, Revista Española de Cardiología, 10.1016/j.recesp.2019.12.007, 73:11, (885-892), Online publication date: 1-Nov-2020. Hannoush H, Sachdev V, Brofferio A, Arai A, LaRocca G, Sapp J, Sidenko S, Brenneman C, Biesecker L and Keppler-Noreuil K (2014) Myocardial fat overgrowth in Proteus syndrome, American Journal of Medical Genetics Part A, 10.1002/ajmg.a.36773, 167:1, (103-110), Online publication date: 1-Jan-2015. Liu T, Pursnani A, Sharma U, Vorasettakarnkij Y, Verdini D, Deeprasertkul P, Lee A, Lumish H, Sidhu M, Medina H, Danik S, Abbara S, Holmvang G, Hoffmann U and Ghoshhajra B (2014) Effect of the 2010 task force criteria on reclassification of cardiovascular magnetic resonance criteria for arrhythmogenic right ventricular cardiomyopathy, Journal of Cardiovascular Magnetic Resonance, 10.1186/1532-429X-16-47, 16:1, Online publication date: 1-Dec-2014. September 15, 2009Vol 120, Issue 11 Advertisement Article InformationMetrics https://doi.org/10.1161/CIRCULATIONAHA.108.839142PMID: 19752351 Originally publishedSeptember 15, 2009 PDF download Advertisement SubjectsArrhythmiasCatheter Ablation and Implantable Cardioverter-DefibrillatorComputerized Tomography (CT)

Background Stress CMR myocardial perfusion is a strong risk-stratifying tool increasingly used for patient management. However, the cost-effectiveness of this technique in patients with suspected ischemia, has never been studied against nuclear SPECT. Methods From 2003-2011, 707 patients underwent CMR-MPI for ischemia assessment in our center. Estimated pre-test cardiac risk derived from a combined Framingham Heart Study and Diamond Forrester risk percentage was used to match CMR patients against 39,876 patients who underwent pharmacologic stress SPECT in another tertiary-care center during the same time period. Framingham scoring system for the prediction of cardiovascular risk was also stratified by presence or absence of prior evidence of CAD. A validated computer algorithm was used to perform 1:1 patient risk-matching. For all patients, cardiac events (acute MI/death), angiographically-significant CAD, percutaneous coronary intervention and bypass grafting, repeat stress testing/imaging within 2 years, and cost estimates for these events from national average were collected for cost-effectiveness analysis. One-to-one risk-profile matching between CMR-MPI and SPECT was successful in 704 patients (99.6%). Ischemia by SPECT was positive, negative, and equivocal in 8%, 74%, and 18%, which compared with 22%, 75%, and 3%, respectively by CMR-MPI. A negative SPECT was associated with a 2-year cardiac event rate of 4.6% compared to 1.3% by CMR-MPI (p=0.002). Other items relevant to cost-effectiveness analysis using imaging for “gate-keeping” stratification are shown in Table 1. Conclusions In patients with an intermediate risk of ischemic heart disease, stress CMR myocardial perfusion is cost-effective when compared to pharmacologic stress SPECT. A negative stress CMR perfusion study is associated with a lower 2 year event rate and lower downstream costs.

Since the publication of its first Core Cardiovascular Training Statement (COCATS) in 1995, 1 Alpert J.S. Guidelines for training in adult cardiovascular medicine core cardiology training symposium (COCATS) June 27–28, 1994. J Am Coll Cardiol. 1995; 25: 1-2 Crossref PubMed Scopus (18) Google Scholar the American College of Cardiology (ACC) has defined the knowledge, experiences, skills, and behaviors expected of clinical cardiologists. Subsequent revisions have moved toward competency-based training based on the 6-domain competency structure promulgated by the Accreditation Council for Graduate Medical Education (ACGME) and the American Board of Medical Specialties and endorsed by the American Board of Internal Medicine (ABIM). The ACC has taken a similar approach to describe the aligned general cardiology lifelong learning competencies that practicing cardiologists are expected to maintain. Many hospital systems now use the 6-domain structure as part of medical staff privileging, peer-review, and professional competence assessments.

HomeCirculationVol. 132, No. 19Introduction to the Cardio-Oncology Miniseries Free AccessResearch ArticlePDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citationsPermissions ShareShare onFacebookTwitterLinked InMendeleyReddit Jump toFree AccessResearch ArticlePDF/EPUBIntroduction to the Cardio-Oncology Miniseries Ravin Davidoff, MBBCh, Michael Fifer, MD and Sanjeev Francis, MD Ravin DavidoffRavin Davidoff Search for more papers by this author , Michael FiferMichael Fifer Search for more papers by this author and Sanjeev FrancisSanjeev Francis Search for more papers by this author Originally published10 Nov 2015https://doi.org/10.1161/CIRCULATIONAHA.115.019806Circulation. 2015;132:1834The intersection of cancer and cardiovascular disease occurs on several levels. The present miniseries, within Circulation’s Contemporary Reviews in Cardiovascular Medicine series, will highlight important areas within the emerging discipline of cardio-oncology. The miniseries will straddle a number of topics, as outlined below.The relationship of traditional cardiovascular risk factors with the development of cancer. This is a unique area within cardio-oncology that has not been fully covered in the current literature.The link between targeted chemotherapeutics and cardiac, vascular, and metabolic diseases with an emphasis on the molecular mechanisms. This has become an increasingly relevant area, given the rapid development and growth of this class of therapies.The clinically important area of cardioprotection during chemotherapy and the current data and areas that require additional research.A comprehensive review of the cardiovascular risks faced by cancer survivors and a concise review of current guidelines and areas of uncertainty for the practicing clinician.This miniseries will provide an in-depth review for the practicing clinician (cardiologist, oncologist, and internist) and provide insights, for the physician-scientist and scientist, into the mechanistic link between cancer and cardiovascular biology afforded by examining the cardiovascular impact of targeted cancer therapies and the impact of cardiovascular risk factors and medications in cancer biology.Ravin Davidoff, MBBChMichael Fifer, MDSanjeev Francis, MD Previous Back to top Next FiguresReferencesRelatedDetailsCited ByZaha V, Hundley W and Hill J (2018) Cardio-Oncology, Circulation, 138:7, (663-665), Online publication date: 14-Aug-2018. Sueta D, Tabata N, Akasaka T, Yamashita T, Ikemoto T and Hokimoto S (2016) The dawn of a new era in onco-cardiology: The Kumamoto Classification, International Journal of Cardiology, 10.1016/j.ijcard.2016.06.330, 220, (837-841), Online publication date: 1-Oct-2016. November 10, 2015Vol 132, Issue 19 Advertisement Article InformationMetrics © 2015 American Heart Association, Inc.https://doi.org/10.1161/CIRCULATIONAHA.115.019806PMID: 26553712 Originally publishedNovember 10, 2015 PDF download Advertisement SubjectsHeart Failure

ABSTRACT Aim: Hypertension (HTN), an on-target adverse event (AE) of VEGFR inhibition, is a biomarker for tyrosine kinase inhibitor efficacy in renal cell carcinoma treatment. In the phase 3 Study of (E7080) LEnvatinib in Differentiated Cancer of the Thyroid (SELECT), the most frequent AE in patients (pts) on lenvatinib (LEN)—an inhibitor of VEGFR1–3, FGFR1–4, PDGFRa, RET, and KIT—was HTN. This analysis examines treatment-emergent HTN (TE-HTN) and efficacy in SELECT. Methods: In this multicenter, double-blind study, pts with documented progressive 131I-refractory differentiated thyroid cancer (RR-DTC) were randomized 2:1 to LEN or placebo (24mg/d; 28-d cycle). Primary endpoint was progression-free survival (PFS); secondary endpoints were objective response rate (ORR), overall survival (OS), and safety. This analysis of investigator-assessed TE-HTN included increased blood pressure and prehypertension AEs. Results: Overall, 190/261 (73%) LEN-treated and 20/131 (15%) placebo-treated pts experienced TE-HTN. For LEN, percentages of pts with TE-HTN were: Grade 1, 7%; Grade 2, 22%; Grade 3, 44%; Grade 4, 0.4%. Median time to first onset of TE-HTN was 2.3 weeks (range, 1.4–5.0). Median PFS in LEN-treated pts with and without TE-HTN was 18.8 months (95% confidence interval [CI] 16.5–not estimable [NE]) and 12.9 months (95% CI 7.4–NE), respectively. Pts with TE-HTN had a 5.9-month median PFS advantage (hazard ratio 0.59 [95% CI 0.39–0.88]; P = 0.009). ORR for LEN-treated pts with TE-HTN was 69% vs 56% for those without (odds ratio 1.72 [95% CI 0.98–3.01]). Median change in tumor size for pts with and without TE-HTN was -45% and -40%, respectively (P = 0.2). Median OS had not been reached in pts with TE-HTN; in pts without TE-HTN: 21.7 months (95% CI 15.7–NE). LEN-HTN was managed concomitantly with antihypertensive agents (68%): calcium channel blockers (51%), ACE inhibitors (38%), and angiotensin II receptor antagonists (29%). TE-HTN led to LEN dose interruption in 34 (13%), dose reduction in 35 (13%), and drug discontinuation in 3 (1%) pts. Conclusions: Although HTN is a clinically significant AE that warrants careful monitoring and management, LEN-emergent HTN was significantly correlated with improved clinical outcome in pts with RR-DTC. Further studies will investigate HTN as a predictive indicator of LEN response. Disclosure: M. Tahara: Research Funding: Eisai, Boehringer-Ingelheim; B. Robinson: Advisory Role: AstraZeneca, Bayer, Eisai; M. Brose: Advisory Role: Eisai Research Funding: Eisai; N. Kiyota: Research Funding: Eisai C. Dutcus: Employee of Eisai Inc.; B.D.L. Heras: Employee of Eisai Ltd; J. Zhu: Employee of Eisai Inc. S. Sherman: Advisory Role: AstraZeneca, Amgen, Eisai, Exelixis, NovoNordisk, Eli Lilly Research Funding: Amgen; M. Schlumberger: Advisory Role/Expert Testimony: AstraZeneca, Bayer, Eisai, Genzyme-Sanofi. Honoraria: AstraZeneca, Bayer, Eisai, Genzyme-Sanofi, Sobi. Research Funding: AstraZeneca, Bayer, Eisai, Genzyme-Sanofi. All other authors have declared no conflicts of interest.

Since publication of its first Core Cardiovascular Training Statement (COCATS) in 1995, 1 Alpert J.S. Guidelines for training in adult cardiovascular medicine core cardiology training symposium (COCATS) June 27-28, 1994. J Am Coll Cardiol. 1995; 25: 1-2 Crossref PubMed Scopus (23) Google Scholar the American College of Cardiology (ACC) has defined the knowledge, experiences, skills, and behaviors expected of clinical cardiologists. Subsequent revisions have moved toward competency-based training based on the 6-domain competency structure promulgated by the Accreditation Council for Graduate Medical Education (ACGME) and the American Board of Medical Specialties and endorsed by the American Board of Internal Medicine (ABIM). 2 Swing S.R. The ACGME outcome project: retrospective and prospective. Med Teach. 2007; 29: 648-654 Crossref PubMed Scopus (622) Google Scholar ,3 The Accreditation Council for Graduate Medical EducationCardiovascular disease milestones. https://www.acgme.org/globalassets/pdfs/milestones/cardiovasculardiseasemilestones.pdf Google Scholar The ACC has taken a similar approach to describe the aligned general cardiology lifelong learning competencies that practicing cardiologists are expected to maintain. Many hospital systems now use the 6-domain structure as part of medical staff privileging, peer review, and professional competence assessments.

Introduction. Abnormal bleeding is a well-known complication following cardiopulmonary bypass (CPB). Causes of bleeding after CPB include inadequate surgical hemostasis, hypothermia, inadequate heparin reversal, fibrinolysis, and most commonly platelet dysfunction. Often patients are transfused at the clinician's discretion because results from intraoperative coagulation test results are delayed. Thromboelastography (TEG) is an established bedside monitor of coagulation which has been shown to be a better predictor of postoperative bleeding than routine coagulation studies [1]. The purpose of this pilot study was to use TEG in an intraoperative transfusion algorithm and to determine it's ability to reduce transfusion requirements and postoperative bleeding. Methods. After Institutional Review Board Approval, written consent was obtained from 67 patients scheduled to undergo CPB for cardiac reoperation, valvular, or combined procedures. Patients were randomized into two groups receiving intraoperative transfusions based on: (1) a TEG guided algorithm or (2) standard routine practice. All patients received intraoperative epsilon-aminocaproic acid. TEG and routine coagulation tests were sampled preoperatively and during specific intraoperative time points. Intraoperative and postoperative transfusion requirements for all blood products and postoperative mediastinal tube drainage (CTD) were recorded. All data were compared using the Student's T-test and Fisher's exact test. P<0.05 was considered significant. Results. Thirty-three patients were enrolled in the TEG study group, and 34 were enrolled in the control group. Patients in both groups were demographically similar. There were no differences in the intraoperative transfusion rates for any blood product. However, there was a significant reduction in platelet and fresh frozen plasma (FFP) transfusions postoperatively in the TEG group (p<or=to0.05 and p=0.007 respectively). See Table 1 for all postoperative transfusion requirements and CTD.Table 1Discussion. Our results indicate that utilization of TEG as a guide for intraoperative transfusions reduces postoperative transfusion requirements in high risk surgical patients and suggests that these patients have improved postoperative hemostasis. The use of intraoperative TEG allows for early identification and treatment of specific hemostatic defects. As a result, the empiric transfusion of allogenic blood products can be avoided.

C ardiac toxicity of cancer therapies remains an important clinical problem, despite decades of investigation.The prevention, surveillance, and treatment of cardiac toxicity are areas of active research, stimulated by recent attention from the National Institutes of Health. 1 This has brought new energy and novel methods to the table.For patients facing treatment of cancer, no one size fits all, and several teams of investigators have tried to identify genetic variables or biomarkers that might predict the risk for cardiac injury by anthracyclines and allow for a more personalized approach that allows for a cancer patient to receive the maximal benefit of these powerful chemotherapies at minimal risk.These studies have identified many molecular pathways that may be important determinants of cardiotoxicity and have led to recent proposals for use of genetic testing in this setting.

Diabetes remains an independent risk factor for adverse remodeling following acute myocardial infarction even with quantification of total infarct size and change in myocardial extracellular volume fraction by CMR Bobby Heydari, Ravi Shah, Siddique Abbasi, Jiazuo H Feng, Hoshang Farhad, Tomas G Neilan, Ron Blankstein, Rob J van der Geest, Shuaib Abdullah, Sanjeev Francis, Udo Hoffmann, Michael Jerosch-Herold, Raymond Y Kwong

Clinical History A previously healthy 26-year-old male presented after 4 days of episodic epigastric and chest pain, noting a recent viral prodrome (vomiting, fever, and headache) which had resolved prior to the onset of chest pain. His physical examination and review of symptoms at the time of presentation was otherwise unremarkable. ECG showed PR depression and diffuse 1-2mm concave ST elevations in leads I, II, aVF, V2-V6 and ST depression in V1. Serum C-reactive protein (25 mg/L), troponin T (2.46; which subsequently peaked at 4.02), CK (1572) and NT-BNP (822) levels were also significantly elevated. He was presumptively diagnosed with myopericarditis of likely viral etiology and colchicine was prescribed.

Importance:Immune checkpoint inhibitors (ICIs) are a class of immunotherapies that have significant clinical efficacy in treating many cancer types, but they are also associated with systemic effects, including myocarditis. Objective:This review describes potential mechanisms underlying ICI-associated myocarditis; data on epidemiology, including possible risk factors; diagnostic criteria for ICI-associated myocarditis; and recommendations for managing ICI-associated myocarditis. Review:This paper is a narrative literature review that summarizes existing literature to increase awareness of ICI-associated cardiotoxicities, including myocarditis. Findings:Reported cardiovascular adverse events include myocarditis, cardiomyopathy, arrhythmias, pericarditis, vasculitis, atherosclerotic cardiovascular events, Takotsubo syndrome, and venous thromboembolism.Myocarditis is associated with the highest risk of morbidity and mortality. Conclusions:With increasing use of ICIs, there is an urgent need for greater awareness and understanding of ICIassociated myocarditis.Clinicians need to recognize the diagnostic criteria and develop current treatment recommendations for ICI-associated myocarditis given the condition's variable clinical presentation and potential fulminant course.

Magnet is “always on” and therefore ANY ferromagnetic material entering the magnet room will be attracted to the bore of the magnet and potentially be a lethal projectile.

To determine whether the use of proton therapy would reduce the incidence of coronary artery calcification after mediastinal radiation when compared with conventional photon radiotherapy (RT) in patients treated for lymphoma. A single-institution retrospective chart review was performed to identify patients treated with either proton or photon RT who were at least 3 years from completion of therapy. To be eligible for the study, all staging and follow-up imaging must have been performed at our institution. Cardiac risk factors at the time of diagnosis were recorded for each patient. All post-treatment cardiac events were recorded. Presence of vascular calcifications (VCs) on routine chest CT was determined for each patient that met the eligibility requirements. Prevalence of VCs was compared between patients receiving proton and photon RT. Data for 65 patients diagnosed between August 1999 and July 2011 were collected; 14 patients (22%) received proton therapy and the remaining 51 were treated with photons. Radiation was delivered between March 2000 and February 2012. One patient (7%) in the proton cohort and 11 (22%) in the photon cohort had VCs; this difference was not statistically significant (p=0.44). VCs were identified in the large vessels (aorta and branches), as well as in the coronary arteries. The median age of patients in the entire cohort was 30; patients older than 35 (n=26) were significantly more likely to have VCs (p<0.01). Patients with Nodular Sclerosing Hodgkin Lymphoma (71% of cohort) were less likely to develop VCs (p=0.049). Risk factors including hypertension (HTN), hyperlipidemia (HLD), obesity, diabetes, and smoking were collected. Eighteen photon patients (35%) and 4 proton patients (29%) had post-treatment cardiac events; these ranged from changes noted on electrocardiogram to myocardial infarction and coronary artery stents or bypass grafting. Although neither HTN nor HLD independently were significant risk factors (p=0.11), when combined, we found a significant association with cardiac events (p=0.012). There is no difference in the prevalence of incidental VCs when comparing protons versus photons in this limited sample size. Traditional cardiac risk factors, in combination, are associated with an increased prevalence of clinical cardiac events. Future studies with a larger cohort of proton patients and longer-term follow-up are required to further elucidate the difference in cardiac outcomes among patients treated with protons versus conventional RT.

Clinical History An 82-year-old male presented with two weeks of dyspnea at rest and exertion, and orthopnea and lower extremity edema. Physical examination revealed a grade 3 out of 6 systolic ejection murmur, crackles at both lung bases and distended jugular venous pressure. His presentation was consistent with acute diastolic heart failure in the setting of severe aortic stenosis (AS). He was overweight and weighed 189 pounds, with a body-mass index of 27.8 kg/m2. Transthoracic echocardiography demonstrated a peak trans-aortic valve gradient of 63 mm Hg and a calculated aortic valve area of 0.5 square cm by the continuity equation, consistent with critical AS. He was referred to our center for consideration of transcatheter aortic valve replacement (TAVR) after he was deemed at high surgical risk given multiple comorbidities including acute on chronic renal insufficiency, with a 30-day mortality of at least 14% based on the Society of Thoracic Surgeons (STS) score.

Clinical History A 55 year-old woman without known risk factors developed sudden-onset, 3/10 chest pressure in the setting of a recent family tragedy. Her electrocardiogram revealed apical and inferior nonspecific T-wave changes. Troponin-T peaked at 2.4 mg/dL. Emergent invasive coronary angiography was consistent with a distal left anterior descending coronary dissection without significant stenosis. Echocardiography confirmed globally preserved left ventricular function, but apical inferior wall hypokinesis. She was conservatively managed and discharged on dual-antiplatelet therapy, statin, beta-blockade, and ACE inhibitor. At a 1 month outpatient follow-up visit, she noted intermittent chest discomfort. Coronary CT angiography (CTA) was requested to exclude extension of the dissection.

Clinical History A 45-year-old female with a history of hypertension, dyslipidemia and morbid obesity managed with gastric bypass resulting in 120 pound weight loss, presented to an outside hospital with chest pain and anterolateral ST-segment elevations on electrocardiogram. She was in her usual state of health until the day prior to presentation when she woke up with left chest, shoulder, and jaw pain associated with diaphoresis. Her chest pain spontaneously resolved in 30 minutes but recurred the next day. Emergent invasive coronary angiography (ICA) revealed a dual-left anterior descending (LAD) system with sluggish flow in the smaller, septal LAD, but no culprit vessel was apparent. The patient was presumed to have focal myocarditis involving the anterolateral wall.

Summary To test the hypothesis that fibrotic burden in remote myocardium quantified by CMR during early period of infarct healing is a strong determinant of the cardiac remodeling outcome. Background After acute myocardial infarction (AMI), co-existing myocardial stunning, ischemia, and architectural alteration may yield variable patterns of ventricular remodeling with potential long-term prognostic implications. We hypothesize that CMR quantification of fibrotic content, based on R1 (1/T1) assessment, in non-infarct myocardium early after infarction and during the infarct healing phases may provide novel prediction of the final infarct size and alteration of ventricular functions during infarct healing. Methods

In patients with recent MI, elevated fibrotic burden within the remote myocardium quantified by CMR is strongly associated with post-exercise heart rate variability (HRV) and QT dispersion (QTD). In contrast, infarct tissue heterogeneity demonstrated strong association with prolonged mean QRS duration at rest and during exercise. We postulate that these patterns of ischemic structural/arrhythmogenic affiliations during convalescent infarct healing, likely reflect differences in depolarization/repolarization characteristics of different post-ischemic myocardium and sympathetic innervation.

Clinical History A 54-year-old male presented with a presumed diagnosis of Ebstein’s anomaly and atrial fibrillation. His past medical history was remarkable due to an exploratory cardiac surgery in his childhood for a suspected cardiac mass, which revealed an enlarged right atrium. A recent comprehensive echocardiogram revealed a severely enlarged right atrium with no obvious finding that would suggest Ebstein’s anomaly. He was referred for a cardiac magnetic resonance imaging (MRI) for further evaluation of cardiac anatomy and function.

Findings Retrospectively-ECG gated CCTA with functional assessment was performed after the uneventful administration of sublingual nitroglycerine and without intravenous beta-blockade (due to ongoing COPD). Images revealed a 7cm segment total occlusion of the dominant right coronary artery, with distal reconstitution via collaterals. There was mild hypokinesia of the basal to mid inferior wall, with decreased left ventricular ejection fraction of 48%.

Clinical History A 54-year-old man presented 5 days after the onset of chest pain with an anterior ST elevation myocardial infarction (MI). Cardiac catheterization revealed a sub-total occlusion of his mid left anterior descending (LAD) artery, and percutaneous intervention was deferred secondary to his late presentation. A resting thallium viability study was suggestive of residual viability of the mid anterior wall, but minimal viability of the apex. He was discharged on medical therapy. As part of a research study he underwent a cardiac MRI, which included a standard clinical MRI assessment of viability via late gadolinium enhancement (LGE).

Pradeep Natarajan, 2012 Finalist and Presenting Author

Background: The core components of a quality improvement (QI) program focus on consistent, high-quality service delivery. We report our experience with a QI program focused on cardiac magnetic resonance (CMR) examination duration reduction. Methods: Department policy for the scan time allotment for a clinical CMR examination was reviewed. Medical records of all patients who underwent CMR examination from January 2010 to December 2010 were reviewed. Scan duration from time of the initial to the final image acquisition was recorded. An intervention was implemented from January 2011 to September 2011 to report the scan durations weekly to all CMR physicians. Monthly comparisons were performed between the 2010 and 2011 exams. No changes were made in department protocols. Results: The allotted time for a CMR examination was 90 minutes. From January to September 2010, the mean (±SD) scan duration for CMR examinations was 105 (± 32) minutes, as compared with a mean of 87 (±21) minutes for the same months in 2011. Comparison between the 2010 and 2011 scan durations using a Wilcoxon test indicated a significant difference between the two samples (p&lt;0.05; Figure 1). The percentage of all scans exceeding 120 minutes in duration decreased from 27.4% (n=529) in 2010 to 5.3% (n=451) in 2011. The indications for CMR examinations were found to be similar between 2011 and 2010 (p&lt;0.05). All exams were reported to be of diagnostic quality. Conclusions: The simple step of publicly reporting weekly scan durations to house staff and attending physicians resulted in significant reduction in CMR scan durations, with preserved diagnostic quality. We propose that increased awareness led to higher efficiency.

BACKGROUND: Current prognostic risk assessment has limited sensitivity for identification of patients at high risk for cardiac events with established CAD. We evaluated the prognostic value of stress cardiac magnetic resonance (CMR) imaging to reclassify risk in patients with established CAD. METHODS: We performed clinically indicated stress CMR imaging in 815 patients, with follow-up for cardiac death (CD) or acute myocardial infarction (AMI; primary outcome) over a median 1.9 years. Univariate and multivariate Cox regression models were used to determine clinical and imaging characteristics associated with risk. Annual event rates were calculated and stratified by presence and absence of prior CAD. Net reclassification improvement and ROC analysis were used for the addition of inducible ischemia by CMR beyond a best-overall clinical multivariate model of risk for discrimination and reclassification. RESULTS: Of the 815 patients referred for stress CMR, 13 failed to complete CMR (2%), and 97% had interpretable image quality. Inducible ischemia (ISCH) strongly independently predicted primary outcome in CAD patients (HR = 8.17, 95% CI 2.9-23.1, p = 0.0001). No ISCH was associated significantly improved event-free survival in patients with and without CAD (p&lt;0.001) and a &lt;1% annual rate of CD, with lower annual rates of CD/AMI in patients with and without CAD. ISCH improved risk discrimination over a best-overall clinical risk model (p&lt;0.0001). Addition of ISCH to the best-overall clinical model resulted in a net reclassification improvement of 0.229 (95% 0.063-0.391, p&lt;0.05). CONCLUSIONS: Inducible ischemia by stress CMR is a powerful, independent prognostic marker in patients with symptomatic, established CAD. A negative stress CMR is associated with a &lt;1% rate of CD, and reclassifies risk of future cardiac events in patients otherwise considered at moderate or high risk by clinical assessment.

Objectives: We derived and validated a parsimonious predictive rule incorporating clinical and stress CMR data in characterizing cardiac events in patients with suspected ischemia. Methods/Results: Out of 625 patients referred for CMR assessment of suspected ischemia, 19 were excluded for insufficient imaging quality. The remaining 606 patients were followed for cardiac events (100% follow-up; median of 2.9 years, IQR 2.4–6.9) including cardiac death, acute MI, cardiac hospitalization, and late coronary revascularization (>90 days). We randomized patients 1:1 into a training group (TRAIN, n=303) and a testing group (TEST, n=303). A prediction rule was built by stepwise Cox regression in the TRAIN group, considering clinical, ECG, and CMR data using P Conclusion: We derived and validated a prediction rule for cardiac events using clinical and CMR data for patients with suspected myocardial ischemia. PerfSCORE by CMR demonstrated strong prognostication to cardiac events in the prediction rule.

Background: Although indirect evidence suggests that peroxisome proliferator-activated receptor (PPAR)-γ agonists modulate atherosclerosis, their effects have not been directly imaged, tracked, or ...

There have been tremendous technological advances in noninvasive cardiovascular imaging, offering the clinician unparalleled information from a variety of modalities. Cardiovascular magnetic resonance imaging (MRI) has the advantages of superior spatial resolution, detailed tissue characterization, and accurate quantitative assessment of cardiac structure and function, without the need for radiation exposure. Recent advances in image acquisition and postimage processing have led to clinically validated protocols for myocardial perfusion, late gadolinium enhancement, and coronary angiography. The following collection of images was selected to demonstrate the typical appearance of various cardiovascular conditions using MRI. There is, of course, much heterogeneity in both the phenotypic severity of a given condition as well as its appearance on MRI. This article, while not intended to be a comprehensive collection, aims to serve as an introduction to the current applications of cardiac MRI.

Abstract Purpose Immune-checkpoint-blocker (ICB) associated myocarditis (ICB-myocarditis) may present similarly and/or overlap with other cardiac pathology including acute coronary syndrome presenting a challenge for prompt clinical diagnosis. Methods An international registry was used to retrospectively identify cases of ICB-myocarditis. Presence of coronary artery disease (CAD) was defined as coronary artery stenosis &amp;gt;70% in patients undergoing coronary angiogram. Results Among 261 patients with clinically suspected ICB-myocarditis who underwent a coronary angiography, CAD was present in 59/261 (22.6%) (Table 1). Coronary revascularization was performed during the index hospitalization in 19/59 (32.2%) patients. Patients undergoing coronary revascularization less frequently received steroids administration within 24h of admission compared to the other groups (p=0.029). Myocarditis related 90-day mortality was 9/17 (52.7%) in the revascularized cohort, compared to 5/31 (16.1%) in those not revascularized and 25/156 (16.0%) in those without CAD (p=0.001). irAE-related 90-day mortality was 9/17 (52.7%) in the revascularized cohort, compared to 6/31 (19.4%) in those not revascularized and 31/156 (19.9%) in no CAD groups (p=0.007) (Figure 1). All-cause 90-day mortality was 11/17 (64.7%) in the revascularized cohort, compared to 13/31 (41.9%) in no revascularization and 60/158 (38.0%) in no CAD groups (p=0.10). After adjustment on age and sex, coronary revascularization remained associated with ICB-myocarditis-related death at 90 days (Hazard ratio [HR]=4.03, 95%confidence interval [CI] 1.84–8.84, p&amp;lt;0.001) and was marginally associated with all-cause death (HR=1.88, 95% CI 0.98–3.61, p=0.057). Conclusion CAD may exist concomitantly with ICB-myocarditis and portend a poorer outcome when revascularization is performed. This is potentially mediated thru delayed diagnosis and treatment or more severe presentation of ICB-myocarditis. Funding Acknowledgement Type of funding sources: None.

Background Noninvasive detection of CAD in women is often limited by soft tissue attenuation and limits in spatial resolution. CMR perfusion imaging (CMRPI) may characterize evidence of flow limiti...

The traditional in-class face-to-face lectures have been the mainstay in medical education, but the major drawback of this model includes passive learning experience. A new pedagogic model, in form of flipped classroom, offers advantage of self-paced review of educational material and promotes

Sarcoidosis is an inflammatory autoimmune disease that affects many organs in the body. When sarcoidosis affects the heart, patients are often highly symptomatic and present with heart failure, symptomatic conduction abnormalities, ventricular arrhythmias, or even sudden cardiac death. Diagnosis is a combination of symptoms, the synthesis of information on disease involvement of other organ systems, electrocardiogram and echocardiogram data, and advanced imaging. In a minority of cases where the diagnosis is in doubt and extracardiac organs are not involved or cannot be biopsied, endomyocardial biopsy data may be required and would typically show noncaseating granulomas with negative staining for potentially causative organisms. The treatment of sarcoidosis involves systemic steroids with or without other immunomodulatory medications, and continued imaging follow-up to document either improvement or continued inflammatory activity. For advanced cases, therapies including heart pumps and heart transplants can be offered. This paper seeks to discuss the disease epidemiology, clinical presentation, diagnosis, and treatment.

Ventricular assist device (VAD) pump thrombosis is a known complication and while the preferred standard treatment is surgical pump exchange this procedure is not without risk and for some patients the risks are prohibitive.This is a case of a 68-year-old female with bilateral HeartWare ventricular assist devices (HVAD) implanted as destination therapy who presented with signs of recurrent pump thrombosis.Surgical pump exchange was deemed to confer prohibitive risk due to her underlying medical co-morbidities and therefore not an option for treatment.After careful consideration of possible options for treatment, she received systemic thrombolysis (Alteplase 5 mg IV bolus followed by 3 mg/hour infusion for 10 hours through a central line) which was successful.This case highlights, not only the rarity of bilateral VADs as destination therapy, but also demonstrates the safety and efficacy of using systemic thrombolytics in patients with bilateral HVADs for treatment of pump thrombosis.

S103 INTRODUCTION: Abnormal bleeding is a well known complication after cardiopulmonary bypass (CPB). Thromboelastography (TEG) and the Sonoclot analysis are established monitors of viscoelastic properties of blood, and can be predictors of postoperative bleeding. [1] Unfortunately, these monitors are not available to many institutions. The Hepcon (Medtronic Hemotec, Parker, CO) instrument, used in many clinical practices to measure activated clotting time (ACT), can also be utilized to measure platelet reactivity using the HemoSTATUS[registered sign] (Medtronic Hemotec) cartridge. The purpose of this study was to compare HemoSTATUS[registered sign] to other platelet monitors in cardiac surgical patients. METHODS: After Institutional Review Board approval, written informed consent was obtained from 58 patients scheduled to undergo cardiopulmonary bypass for cardiac re-operation, valvular, or combined procedures. Platelet count, TEG, and HemoSTATUS[registered sign] were recorded preoperatively, during CPB rawarming, and after protamine infusion. HemoSTATUS[registered sign] measurement of platelet function is the clot ratio (CR) which is a measure of ACT reduction after addition of PAF 150 nM. CR=1-(ACT of PAF activated channels/ACT of non-activated channels). TEG samples were celite activated and heparinase modified when necessary. All data were analyzed using the least square's linear regression and forward stepwise multiple linear regression. P<0.05 was considered significant. RESULTS: Significant correlations were found during CPB rewarming. The CR demonstrated a positive correlation with maximal amplitude (MA) (see Figure 1), reaction time, and platelet count (r=0.54, p<0.0001; r=0.35, p=0.01; and r=0.31, p=0.03 respectively). Using stepwise multiple regression, a positive correlation between CR and MA remained (r=0.54, p=0.0008).Figure 1CONCLUSIONS: The results of this multivariate analysis indicate that CR strongly correlates with MA independent of platelet count and is, therefore, an adequate reflection of platelet function. HemoSTATUS[registered sign] is a rapid bedside test that utilizes the Hepcon machine. Although TEG is an accepted monitor of coagulation, it's use is not universal. We propose that HemoSTATUS[registered sign] may be a useful intraoperative monitor for platelet function.

S104 INTRODUCTION: Thromboelastography (TEG) is a monitor of coagulation that has been used successfully in patients undergoing cardiopulmonary bypass (CPB) and liver transplantation. The results of TEG during CPB surgery have been shown to be better predictors of postoperative bleeding than routine coagulation studies, [1] although this is not uniformly accepted. [2] Heparinase modification has facilitated TEG in evaluation of patients while on CPB. [3] The purpose of this study was to determine the ability of routine coagulation tests and TEG, to predict postoperative blood loss in cardiac surgical patients with moderate to high risk for bleeding. METHODS: This study was approved by the institutional Review Board. Written informed consent was obtained from 58 patients scheduled to undergo cardiopulmonary bypass procedures with moderate to high risk of bleeding. Patients included those scheduled for any cardiac reoperation, valvular, and combined procedures. In all patients platelet count, PT, aPTT, fibrinogen, and activated heparinase-modified TEG were collected preoperatively, during CPB rewarming, and after infusion of protamine. TEG samples were activated with both tissue factor (TF) and celite, and were compared with respect to maximum amplitude(MA), R time, and alpha value. All results were correlated with transfusion requirements and 6 hour post operative chest tube drainage (CTD). The data were analyzed using least square's linear regression, ANOVA, and Mann-Whitney U-Test. P<0.05 was considered significant. RESULTS: Of all the coagulation tests evaluated, the only statistically significant correlation with post operative CTD was found in TF activated MA during CPB (r=-0.4; p=0.007). In comparison with celite activator, the median R (reaction time) was shorter in TF activated samples (4.5 mm (1-31 mm) versus 10.5 mm (1.5-27 mm), p<0.0001), however the MA was not statistically different. (see Table 1)Table 1: TEG MA ValuesCONCLUSIONS: In this protocol, we were able to rapidly and accurately measure MA in TF activated TEG samples during CPB using heparinase modification. Because of the short R time, TF activated TEG provides a rapid bedside test of platelet function. The significant correlation between MA on CPB and 6 hr CTD suggests that those patients with platelet dysfunction during CPB have increased blood loss. The use of TEG during CPB allows for early identification of those patients requiring platelet-directed therapy, and it reduces indiscriminate ordering and transfusion of platelets when not indicated.