Salem Chouaı̈b

Tumor-infiltrating myeloid cells such as myeloid-derived suppressor cells (MDSCs) and tumor-associated macrophages (TAMs) form an important component of the hypoxic tumor microenvironment. Here, we investigated the influence of hypoxia on immune checkpoint receptors (programmed death [PD]-1 and CTLA-4) and their respective ligands (PD-1 ligand 1 [PD-L1], PD-L2, CD80, and CD86) on MDSCs. We demonstrate that MDSCs at the tumor site show a differential expression of PD-L1 as compared with MDSCs from peripheral lymphoid organ (spleen). Hypoxia caused a rapid, dramatic, and selective up-regulation of PD-L1 on splenic MDSCs in tumor-bearing mice. This was not limited to MDSCs, as hypoxia also significantly increased the expression of PD-L1 on macrophages, dendritic cells, and tumor cells. Furthermore, PD-L1 up-regulation under hypoxia was dependent on hypoxia-inducible factor-1α (HIF-1α) but not HIF-2α. Chromatin immunoprecipitation and luciferase reporter assay revealed direct binding of HIF-1α to a transcriptionally active hypoxia-response element (HRE) in the PD-L1 proximal promoter. Blockade of PD-L1 under hypoxia enhanced MDSC-mediated T cell activation and was accompanied by the down-regulation of MDSCs IL-6 and IL-10. Finally, neutralizing antibodies against IL-10 under hypoxia significantly abrogated the suppressive activity of MDSCs. Simultaneous blockade of PD-L1 along with inhibition of HIF-1α may thus represent a novel approach for cancer immunotherapy.

A successful immune response against a tumor is dependent on the cytokine repertoire present at the tumor site. Salem Chouaib and colleagues discuss evidence that, to escape the immune system, tumor cells not only produce immunosuppressive cytokines but also employ strategies involving altered susceptibility to tumor necrosis factor and Fas cytotoxic pathways and, in some circumstances, use of the Fas ligand to neutralize effector cells.

Novel immunotherapy approaches have provided durable remission in a significant number of cancer patients with cancers previously considered rapidly lethal. Nonetheless, the high degree of nonresponders, and in some cases the emergence of resistance in patients who do initially respond, represents a significant challenge in the field of cancer immunotherapy. These issues prompt much more extensive studies to better understand how cancer cells escape immune surveillance and resist immune attacks. Here, we review the current knowledge of how cellular heterogeneity and plasticity could be involved in shaping the tumor microenvironment (TME) and in controlling antitumor immunity. Indeed, recent findings have led to increased interest in the mechanisms by which cancer cells undergoing epithelial‐mesenchymal transition ( EMT ), or oscillating within the EMT spectrum, might contribute to immune escape through multiple routes. This includes shaping of the TME and decreased susceptibility to immune effector cells. Although much remains to be learned on the mechanisms at play, cancer cell clones with mesenchymal features emerging from the TME seem to be primed to face immune attacks by specialized killer cells of the immune system, the natural killer cells, and the cytotoxic T lymphocytes. Recent studies investigating patient tumors have suggested EMT as a candidate predictive marker to be explored for immunotherapy outcome. Promising data also exist on the potential utility of targeting these cancer cell populations to at least partly overcome such resistance. Research is now underway which may lead to considerable progress in optimization of treatments.

The tumor microenvironment is a complex system, playing an important role in tumor development and progression. Besides cellular stromal components, extracellular matrix fibers, cytokines, and other metabolic mediators are also involved. In this review we outline the potential role of hypoxia, a major feature of most solid tumors, within the tumor microenvironment and how it contributes to immune resistance and immune suppression/tolerance and can be detrimental to antitumor effector cell functions. We also outline how hypoxic stress influences immunosuppressive pathways involving macrophages, myeloid-derived suppressor cells, T regulatory cells, and immune checkpoints and how it may confer tumor resistance. Finally, we discuss how microenvironmental hypoxia poses both obstacles and opportunities for new therapeutic immune interventions.

Tumors use several strategies to evade the host immune response, including creation of an immune-suppressive and hostile tumor environment. Tissue hypoxia due to inadequate blood supply is reported to develop very early during tumor establishment. Hypoxic stress has a strong impact on tumor cell biology. In particular, tissue hypoxia contributes to therapeutic resistance, heterogeneity and progression. It also interferes with immune plasticity, promotes the differentiation and expansion of immune-suppressive stromal cells, and remodels the metabolic landscape to support immune privilege. Therefore, tissue hypoxia has been regarded as a central factor for tumor aggressiveness and metastasis. In this regard, manipulating host-tumor interactions in the context of the hypoxic tumor microenvironment may be important in preventing or reverting malignant conversion. We will discuss how tumor microenvironment-driven transient compositional tumor heterogeneity involves hypoxic stress. Tumor hypoxia is a therapeutic concern since it can reduce the effectiveness of conventional therapies as well as cancer immunotherapy. Thus, understanding how tumor and stromal cells respond to hypoxia will allow for the design of innovative cancer therapies that can overcome these barriers. A better understanding of hypoxia-dependent mechanisms involved in the regulation of immune tolerance could lead to new strategies to enhance antitumor immunity. Therefore, discovery and validation of therapeutic targets derived from the hypoxic tumor microenvironment is of major importance. In this context, critical hypoxia-associated pathways are attractive targets for immunotherapy of cancer. In this review, we summarize current knowledge regarding the molecular mechanisms induced by tumor cell hypoxia with a special emphasis on therapeutic resistance and immune suppression. We emphasize mechanisms of manipulating hypoxic stress and its associated pathways, which may support the development of more durable and successful cancer immunotherapy approaches in the future.

Among cells present in the tumor microenvironment, activated fibroblasts termed cancer-associated fibroblasts (CAFs), play a critical role in the complex process of tumor-stroma interaction. CAFs, one of the prominent stromal cell populations in most types of human carcinomas, have been involved in tumor growth, angiogenesis, cancer stemness, extracellular matrix remodeling, tissue invasion, metastasis, and even chemoresistance. During the past decade, these activated tumor-associated fibroblasts have also been involved in the modulation of the anti-tumor immune response on various levels. In this review, we describe our current understanding of how CAFs accomplish this task as well as their potential therapeutic implications.

Significance Natural killer (NK) cells are effectors of the antitumor immunity, able to kill cancer cells through the release of the cytotoxic protease granzyme B. NK-based therapies have recently emerged as promising anticancer strategies. It is well established that hypoxic microenvironment interferes with the function of antitumor immune cells and constitutes a major obstacle for cancer immunotherapies. We showed that breast cancer cells evade effective NK-mediated killing under hypoxia by activating autophagy that we have identified to be responsible for the degradation of NK-derived granzyme B. We demonstrated that blocking autophagy restored NK-mediated lysis in vitro, and facilitated breast tumor elimination by NK cells in mice. We provided evidence that targeting autophagy may pave the way to achieve more effective NK-based anticancer immunotherapy.

Epithelial-to-mesenchymal transition (EMT) mediates cancer cell invasion, metastasis, and drug resistance, but its impact on immune surveillance has not been explored. In this study, we investigated the functional consequences of this mode of epithelial cell plasticity on targeted cell lysis by cytotoxic T lymphocytes (CTL). Acquisition of the EMT phenotype in various derivatives of MCF-7 human breast cancer cells was associated with dramatic morphologic changes and actin cytoskeleton remodeling, with CD24(-)/CD44(+)/ALDH(+) stem cell populations present exhibiting a higher degree of EMT relative to parental cells. Strikingly, acquisition of this phenotype also associated with an inhibition of CTL-mediated tumor cell lysis. Resistant cells exhibited attenuation in the formation of an immunologic synapse with CTLs along with the induction of autophagy in the target cells. This response was critical for susceptibility to CTL-mediated lysis because siRNA-mediated silencing of beclin1 to inhibit autophagy in target cells restored their susceptibility to CTL-induced lysis. Our results argue that in addition to promoting invasion and metastasis EMT also profoundly alters the susceptibility of cancer cells to T-cell-mediated immune surveillance. Furthermore, they reveal EMT and autophagy as conceptual realms for immunotherapeutic strategies to block immune escape.

Tumor-derived microvesicles (TD-MVs) are key mediators which are shed by cancer cells and can sensitize neighboring cells in the tumor microenvironment. TD-MVs are extracellular vesicles composed of exosomes and MVs and promote cancer invasion and metastasis. Intratumoral hypoxia is an integral component of all solid tumors. The relationship between hypoxic tumor-shed MVs and NK-mediated cytotoxicity remains unknown. In this paper, we reported that MVs derived from hypoxic tumor cells qualitatively differ from those derived from normoxic tumor cells. Using multiple tumor models, we showed that hypoxic MVs inhibit more NK cell function as compared to normoxic MVs. Hypoxic TD-MVs package two immunosuppressive factors involved in the impairment of natural killer (NK) cell cytotoxicity against different tumor cells in vitro and in vivo. We showed that following their uptake by NK cells, hypoxic TD-MVs transfer TGF-β1 to NK cells, decreasing the cell surface expression of the activating receptor NKG2D, thereby inhibiting NK cell function. MicroRNA profiling revealed the presence of high levels of miR-210 and miR-23a in hypoxic TD-MVs. We demonstrated that miR-23a in hypoxic TD-MVs operates as an additional immunomosuppressive factor, since it directly targets the expression of CD107a in NK cells. To our knowledge, this is the first study to show that hypoxic tumor cells by secreting MVs can educate NK cells and decrease their antitumor immune response. This study highlights the existence of a novel mechanism of immune suppression mediated by hypoxic TD-MVs and further improves our understanding of the immunosuppressive mechanisms prevailing in the hypoxic tumor microenvironment.

Abstract The relationship between hypoxic stress, autophagy, and specific cell-mediated cytotoxicity remains unknown. This study shows that hypoxia-induced resistance of lung tumor to cytolytic T lymphocyte (CTL)–mediated lysis is associated with autophagy induction in target cells. In turn, this correlates with STAT3 phosphorylation on tyrosine 705 residue (pSTAT3) and HIF-1α accumulation. Inhibition of autophagy by siRNA targeting of either beclin1 or Atg5 resulted in impairment of pSTAT3 and restoration of hypoxic tumor cell susceptibility to CTL-mediated lysis. Furthermore, inhibition of pSTAT3 in hypoxic Atg5 or beclin1-targeted tumor cells was found to be associated with the inhibition Src kinase (pSrc). Autophagy-induced pSTAT3 and pSrc regulation seemed to involve the ubiquitin proteasome system and p62/SQSTM1. In vivo experiments using B16-F10 melanoma tumor cells indicated that depletion of beclin1 resulted in an inhibition of B16-F10 tumor growth and increased tumor apoptosis. Moreover, in vivo inhibition of autophagy by hydroxychloroquine in B16-F10 tumor-bearing mice and mice vaccinated with tyrosinase-related protein-2 peptide dramatically increased tumor growth inhibition. Collectively, this study establishes a novel functional link between hypoxia-induced autophagy and the regulation of antigen-specific T-cell lysis and points to a major role of autophagy in the control of in vivo tumor growth. Cancer Res; 71(18); 5976–86. ©2011 AACR.

PD-L1 expression and regulation by mesenchymal tumor cells remain largely undefined. Here, we report that among different EMT-activated MCF7 human breast cancer cell clones, PD-L1 was differentially upregulated in MCF7 sh-WISP2, MCF7–1001/2101, and MDA-MB-231 cells but not in MCF7 SNAI1 and MCF7 SNAI1–6SA cells. Mechanistic investigations revealed that siRNA silencing of ZEB-1, but not SNAI1, TWIST, or SLUG and overexpression of miR200 family members in MCF7 sh-WISP2 cells strongly decreased PD-L1 expression. Thus, we propose that PD-L1 expression in EMT-activated breast cancer cells depends on the EMT-TF involved in EMT activation. Interestingly, siRNA-mediated targeting of PD-L1 or antibody-mediated PD-L1 block restored the susceptibility of highly resistant MCF7 sh-WISP2 and MCF7–2101 cells to CTL-mediated killing. Additionally, these results provide a novel preclinical rationale to explore EMT inhibitors as adjuvants to boost immunotherapeutic responses in subgroups of patients in whom malignant progression is driven by different EMT-TFs.

Significance The failure in achieving a durable clinical immune response against cancer cells depends on the ability of cancer cells to establish a microenvironment that prevent cytotoxic immune cells to infiltrate tumors and kill cancer cells. Therefore, the key approach to achieving successful antitumor immune response is to harness strategies allowing the reorientation of immune cells to the tumor. Herein we reveal that inhibiting autophagy induces a massive infiltration of natural killer immune cells into the tumor bed, and a subsequent dramatic decrease in the tumor volume of melanomas. These results highlight the role of targeting autophagy in breaking the immunosuppressive tumor microenvironment barrier, thus allowing the infiltration of natural killer cells into the tumor to kill cancer cells.

Initially believed to be a disease of deregulated cellular and genetic expression, cancer is now also considered a disease of the tumor microenvironment. Over the past two decades, significant and rapid progress has been made to understand the complexity of the tumor microenvironment and its contribution to shaping the response to various anti-cancer therapies, including immunotherapy. Nevertheless, it has become clear that the tumor microenvironment is one of the main hallmarks of cancer. Therefore, a major challenge is to identify key druggable factors and pathways in the tumor microenvironment that can be manipulated to improve the efficacy of current cancer therapies. Among the different tumor microenvironmental factors, this review will focus on hypoxia as a key process that evolved in the tumor microenvironment. We will briefly describe our current understanding of the molecular mechanisms by which hypoxia negatively affects tumor immunity and shapes the anti-tumor immune response. We believe that such understanding will provide insight into the therapeutic value of targeting hypoxia and assist in the design of innovative combination approaches to improve the efficacy of current cancer therapies, including immunotherapy.

The environmental and metabolic pressures in the tumor microenvironment (TME) play a key role in molding tumor development by impacting the stromal and immune cell fractions, TME composition and activation. Hypoxia triggers a cascade of events that promote tumor growth, enhance resistance to the anti-tumor immune response and instigate tumor angiogenesis. During growth, the developing angiogenesis is pathological and gives rise to a haphazardly shaped and leaky tumor vasculature with abnormal properties. Accordingly, aberrantly vascularized TME induces immunosuppression and maintains a continuous hypoxic state. Normalizing the tumor vasculature to restore its vascular integrity, should hence enhance tumor perfusion, relieving hypoxia, and reshaping anti-tumor immunity. Emerging vascular normalization strategies have a great potential in achieving a stable normalization, resulting in mature and functional blood vessels that alleviate tumor hypoxia. Biomarkers enabling the detection and monitoring of tumor hypoxia could be highly advantageous in aiding the translation of novel normalization strategies to clinical application, alone, or in combination with other treatment modalities, such as immunotherapy.

The mechanism by which prostaglandin E2 (PGE2) inhibits human T lymphocyte activation and proliferation was studied. We analyzed the effect of physiologic concentrations of PGE2 on interleukin 2 (IL 2) production, expression of IL 2 receptor (Tac antigen), and expression of the transferrin receptor after in vitro activation with phytohemagglutinin. PGE2 inhibited T lymphocyte proliferation by 80 to 90% of control values. This was associated with a similar degree of inhibition of IL 2 production while the expression of IL 2 receptor was not affected. This was in marked contrast to the expression of the transferrin receptor, which was inhibited 65% after 72 hr of in vitro activation. The addition of exogenous, purified IL 2 reconstituted lymphocyte proliferation to 50% of control values, but had no effect on transferrin receptor expression. Because PGE2 is known to increase the intracellular concentration of 3',5' cyclic adenosine monophosphate (cAMP), we investigated the effect of another adenylate cyclase activator, i.e., isoproterenol, as well as the effect of extracellular administration of the cAMP derivative dibutyryl cAMP (dBcAMP) on IL 2 production, Tac antigen expression, and transferrin receptor expression. It was demonstrated that isoproterenol, as well as dBcAMP, inhibited transferrin receptor expression on PHA-activated T lymphocytes to the same extent as PGE2, and exogenous IL 2 could not counteract the down-regulation of the receptor expression. In contrast, neither isoproterenol nor dBcAMP had any significant effect on IL 2 receptor expression. Prostaglandin F2 alpha (PGF2 alpha), which has been reported to elevate intracellular cyclic GMP levels, had no effect on lymphocyte activation and proliferation, and did not counteract the PGE2-induced depression in IL 2 production. In contrast to its effect on peripheral blood lymphocytes, PGE2 had no effect on transferrin receptor expression or cell proliferation by IL 2-dependent T cell clones and IL 2-independent T cell lines. These studies demonstrate that PGE2 exerts its inhibitory effects on T cell activation and proliferation via two distinct pathways: inhibition of IL 2 production and inhibition of transferrin receptor expression. The transferrin receptor inhibition is mediated via the cAMP pathway and is IL 2-independent.

Various T cell adhesion molecules and their cognate receptors on target cells promote T cell receptor (TCR)-mediated cell killing. In this report, we demonstrate that the interaction of epithelial cell marker E-cadherin with integrin alpha(E)(CD103)beta(7), often expressed by tumor-infiltrating lymphocytes (TILs), plays a major role in effective tumor cell lysis. Indeed, we found that although tumor-specific CD103(+) TIL-derived cytotoxic T lymphocyte (CTL) clones are able to kill E-cadherin(+)/intercellular adhesion molecule 1(-) autologous tumor cells, CD103(-) peripheral blood lymphocyte (PBL)-derived counterparts are inefficient. This cell killing is abrogated after treatment of the TIL clones with a blocking anti-CD103 monoclonal antibody or after targeting E-cadherin in the tumor using ribonucleic acid interference. Confocal microscopy analysis also demonstrated that alpha(E)beta(7) is recruited at the immunological synapse and that its interaction with E-cadherin is required for cytolytic granule polarization and subsequent exocytosis. Moreover, we report that the CD103(-) profile, frequently observed in PBL-derived CTL clones and associated with poor cytotoxicity against the cognate tumor, is up-regulated upon TCR engagement and transforming growth factor beta1 treatment, resulting in strong potentiation of antitumor lytic function. Thus, CD8(+)/CD103(+) tumor-reactive T lymphocytes infiltrating epithelial tumors most likely play a major role in antitumor cytotoxic response through alpha(E)beta(7)-E-cadherin interactions.

Metastatic renal cell carcinoma, inherently resistant to conventional treatments, is considered immunogenic. Indeed, partial responses are obtained after treatment with cytokines such as IL-2 or IFN-alpha, suggesting that the immune system may control the tumor growth. In this study, we have investigated the ability of the main subset of peripheral gammadelta lymphocytes, the Vgamma9Vdelta2-TCR T lymphocytes, to induce an effective cytotoxic response against autologous primary renal cell carcinoma lines. These gammadelta T cells were expanded ex vivo using a Vgamma9Vdelta2 agonist, a synthetic phosphoantigen called Phosphostim. From 11 of 15 patients, the peripheral Vgamma9Vdelta2 T cells were amplified in vitro by stimulating PBMCs with IL-2 and Phosphostim molecule. These expanded Vgamma9Vdelta2 T cells express activation markers and exhibit an effector/memory phenotype. They display a selective lytic potential toward autologous primary renal tumor cells and not against renal NC. The lytic activity involves the perforin-granzyme pathway and is mainly TCR and NKG2D receptor dependent. Furthermore, an increased expression of MHC class I-related molecule A or B proteins, known ligands of NKG2D, are detected on primary renal tumor cells. Interestingly, from 2 of the 11 positive cultures in response to Phosphostim, expanded-Vgamma9Vdelta2 T cells present an expression of killer cell Ig-like receptors, suggesting their prior recruitment in vivo. Unexpectedly, on serial frozen sections from three tumors, we observe a gammadelta lymphocyte infiltrate that was mainly composed of Vgamma9Vdelta2 T cells. These results outline that Vgamma9Vdelta2-TCR effectors may represent a promising approach for the treatment of metastatic renal cell carcinoma.

Hypoxia is an essential component of tumor microenvironment. In this study, we investigated the influence of hypoxia (1% PO(2)) on CTL-mediated tumor cell lysis. We demonstrate that exposure of target tumor cells to hypoxia has an inhibitory effect on the CTL clone (Heu171)-induced autologous target cell lysis. Such inhibition correlates with hypoxia-inducible factor-1alpha (HIF-1alpha) induction but is not associated with an alteration of CTL reactivity as revealed by granzyme B polarization or morphological change. Western blot analysis indicates that although hypoxia had no effect on p53 accumulation, it induced the phosphorylation of STAT3 in tumor cells by a mechanism at least in part involving vascular endothelial growth factor secretion. We additionally show that a simultaneous nuclear translocation of HIF-1alpha and phospho-STAT3 was observed. Interestingly, gene silencing of STAT3 by small interfering RNA resulted in HIF-1alpha inhibition and a significant restoration of target cell susceptibility to CTL-induced killing under hypoxic conditions by a mechanism involving at least in part down-regulation of AKT phosphorylation. Moreover, knockdown of HIF-1alpha resulted in the restoration of target cell lysis under hypoxic conditions. This was further supported by DNA microarray analysis where STAT3 inhibition resulted in a partly reversal of the hypoxia-induced gene expression profile. The present study demonstrates that the concomitant hypoxic induction of phospho-STAT3 and HIF-1alpha are functionally linked to the alteration of non-small cell lung carcinoma target susceptibility to CTL-mediated killing. Considering the eminent functions of STAT3 and HIF-1alpha in the tumor microenvironment, their targeting may represent novel strategies for immunotherapeutic intervention.

Abstract Hypoxia in the tumor microenvironment plays a central role in the evolution of immune escape mechanisms by tumor cells. In this study, we report the definition of miR-210 as a miRNA regulated by hypoxia in lung cancer and melanoma, documenting its involvement in blunting the susceptibility of tumor cells to lysis by antigen-specific cytotoxic T lymphocytes (CTL). miR-210 was induced in hypoxic zones of human tumor tissues. Its attenuation in hypoxic cells significantly restored susceptibility to autologous CTL-mediated lysis, independent of tumor cell recognition and CTL reactivity. A comprehensive approach using transcriptome analysis, argonaute protein immunoprecipitation, and luciferase reporter assay revealed that the genes PTPN1, HOXA1, and TP53I11 were miR-210 target genes regulated in hypoxic cells. In support of their primary importance in mediating the immunosuppressive effects of miR-210, coordinate silencing of PTPN1, HOXA1, and TP53I11 dramatically decreased tumor cell susceptibility to CTL-mediated lysis. Our findings show how miR-210 induction links hypoxia to immune escape from CTL-mediated lysis, by providing a mechanistic understanding of how this miRNA mediates immunosuppression in oxygen-deprived regions of tumors where cancer stem-like cells and metastatic cellular behaviors are known to evolve. Cancer Res; 72(18); 4629–41. ©2012 AACR.

A relationship between the increased density of tumor-associated macrophages (TAMs) and decreased survival was recently reported in thyroid cancer patients. Among these tumors, anaplastic thyroid cancer (ATC) is one of the most aggressive solid tumors in humans. TAMs (type M2) have been recognized as promoting tumor growth. The purpose of our study was to analyze with immunohistochemistry the presence of TAMs in a series of 27 ATC.Several macrophages markers such as NADPH oxidase complex NOX2-p22phox, CD163 and CD 68 were used. Immunostainings showed that TAMs represent more than 50% of nucleated cells in all ATCs. Moreover, these markers allowed the identification of elongated thin ramified cytoplasmic extensions, bestowing a "microglia-like" appearance on these cells which we termed "Ramified TAMs" (RTAMs). In contrast, cancer cells were totally negative. Cellular stroma was highly simplified since apart from cancer cells and blood vessels, RTAMs were the only other cellular component. RTAMs were evenly distributed and intermingled with cancer cells, and were in direct contact with other RTAMs via their ramifications. Moreover, RTAMs displayed strong immunostaining for connexin Cx43. Long chains of interconnected RTAMs arose from perivascular clusters and were dispersed within the tumor parenchyma. When expressed, the glucose transporter Glut1 was found in RTAMs and blood vessels, but rarely in cancer cells.ATCs display a very dense network of interconnected RTAMs in direct contact with intermingled cancer cells. To our knowledge this is the first time that such a network is described in a malignant tumor. This network was found in all our studied cases and appeared specific to ATC, since it was not found in differentiated thyroid cancers specimens. Taken together, these results suggest that RTAMs network is directly related to the aggressiveness of the disease via metabolic and trophic functions which remain to be determined.

Despite the impressive progress over the past decade, in the field of tumor immunology, such as the identification of tumor antigens and antigenic peptides, there are still many obstacles in eliciting an effective immune response to eradicate cancer. It has become increasingly clear that tumor microenvironment plays a crucial role in the control of immune protection. Tumors have evolved to utilize hypoxic stress to their own advantage by activating key biochemical and cellular pathways that are important in progression, survival, and metastasis. Hypoxia-inducible factor (HIF-1) and vascular endothelial growth factor (VEGF) play a determinant role in promoting tumor cell growth and survival. Hypoxia contributes to immune suppression by activating HIF-1 and VEGF pathways. Accumulating evidence suggests a link between hypoxia and tumor tolerance to immune surveillance through the recruitment of regulatory cells (regulatory T cells and myeloid derived suppressor cells). In this regard, hypoxia (HIF-1α and VEGF) is emerging as an attractive target for cancer therapy. How the microenvironmental hypoxia poses both obstacles and opportunities for new therapeutic immune interventions will be discussed.

Abstract T lymphocyte activation with monoclonal antibodies directed against the CD2 (T,p50) sheep red blood cell receptor antigen and against CD3 (T,p19,29) has been investigated. Co-stimulation of purified T lymphocytes with anti-CD3 (SP34) and anti-CD2 (9-1), which detects a unique epitope on the CD2 molecule, results in T cell activation and cell proliferation. Each antibody alone is unable to mediate this effect. Co-stimulation of purified T cells with two different anti-CD2 antibodies, 9-1 and 9.6, which detect two different epitopes on the CD2 molecule, are also mitogenic. In contrast, the combination of anti-CD3 (SP34) and anti-CD2 (9.6) cannot induce T cell activation. These data suggest that the CD2 epitope defined by the 9-1 antibody is functionally important for T cell activation via the CD3/Ti complex. Furthermore, it is demonstrated that anti-CD3 (SP34) induces epitopic modulation of the CD2 molecule, resulting in enhanced expression of the CD2, 9-1 epitope. This epitope modulation of the CD2 (9-1) epitope by anti-CD3 (SP34) occurs instantaneously at 4 degrees C and in the presence of NaN3. The functional interaction between CD3 and CD2 occurs in spite of any evidence of complex formation between these two molecules. These data suggest that the T cell differentiation antigens CD3 and CD2 are jointly involved in antigen-specific T cell activation. The data are consistent with a model for antigen-specific T cell activation involving both the CD3/Ti complex and subsequent activation of the CD2 complex T cell activation by co-stimulation with anti-CD3 (SP34) and anti-CD2 (9-1) is substantially enhanced by the addition of exogenous, purified interleukin 1 (IL 1). These data would suggest that the CD2 complex, as well as the putative IL 1 receptor, are involved in separate and complementary receptor-ligand interactions, resulting in the amplification of antigen-specific T cell responses.

In vitro and in vivo experiments indicate that the production of interleukin 2 (IL 2) by T lymphocytes is critical for the development of the effector phase of immunity. Complex cellular interactions are involved for the induction of IL 2 production. We have shown in a previous study that in humans monocytes can transmit opposite signals to the IL 2-producing cells. In addition to the positive signal delivered through the release of interleukin 1, human monocytes can deliver a negative signal through the release of prostaglandin E2 (PGE2). This monokine, known to activate suppressor mechanisms in several systems, was shown to inhibit IL 2 production. The data presented in this paper show that this PGE2-dependent inhibition is strictly dependent upon the presence of radiosensitive T cells in the culture, suggesting that PGE2 induces the activation of suppressor T cells modulating IL 2 production. Kinetics experiments indicate that these suppressor cells are radiosensitive during their induction phase but become radioresistant after 18 hr of incubation in the presence of PGE2. Successful in vitro induction of suppressor cells by incubation of enriched T cells with PGE2 was decisive for the analysis of the phenomenon. The induced suppressors were capable of inhibiting IL 2 production by fresh autologous T cells as well as inhibiting PHA proliferative response by these cells. A quantitative evaluation of IL 2 receptors on PGE2-treated cells has indicated that this absorption capacity was similar to the capacity of PBL known to express a low number of IL 2 receptors, thus excluding a suppression via absorption or competition for IL 2. No detectable killing of IL 2-producing cells by PGE2-induced suppressors was observed. The OKT4 and OKT8 phenotype of suppressor cells was examined. T cells were purified at two stages of differentiation before or after induction by PGE2 in vitro treatment. We conclude from these experiments that PGE2 activates suppressor cells among precursors segregating predominantly with the OKT8 subset and fewer cells with the OKT4 subset. After differentiation, however, the suppressor cells segregate with the OKT8 subset only. Such results were obtained by using positive selection (cellular affinity columns) and negative selection (monoclonal antibodies plus complement).

The cytotoxic T lymphocyte antigen-4 (CTLA-4)-blocking antibody ipilimumab induces immune-mediated long-term control of metastatic melanoma in a fraction of patients. Although ipilimumab undoubtedly exerts its therapeutic effects via immunostimulation, thus far clinically useful, immunologically relevant biomarkers that predict treatment efficiency have been elusive. Here, we show that neutralization of IL-2 or blocking the α and β subunits of the IL-2 receptor (CD25 and CD122, respectively) abolished the antitumor effects and the accompanying improvement of the ratio of intratumoral T effector versus regulatory cells (Tregs), which were otherwise induced by CTLA-4 blockade in preclinical mouse models. CTLA-4 blockade led to the reduction of a suppressive CD4(+) T cell subset expressing Lag3, ICOS, IL-10 and Egr2 with a concomitant rise in IL-2-producing effector cells that lost FoxP3 expression and accumulated in regressing tumors. While recombinant IL-2 improved the therapeutic efficacy of CTLA-4 blockade, the decoy IL-2 receptor α (IL-2Rα, sCD25) inhibited the anticancer effects of CTLA-4 blockade. In 262 metastatic melanoma patients receiving ipilimumab, baseline serum concentrations of sCD25 represented an independent indicator of overall survival, with high levels predicting resistance to therapy. Altogether, these results unravel a role for IL-2 and IL-2 receptors in the anticancer activity of CTLA-4 blockade. Importantly, our study provides the first immunologically relevant biomarker, namely elevated serum sCD25, that predicts resistance to CTLA-4 blockade in patients with melanoma.

Abstract A major issue in immunosuppressive biotherapy is the use of mesenchymal stem cells (MSCs) that harbor regulatory capacity. However, currently used bone marrow-derived MSCs (BM-MSCs) are short-lived and cannot assure long lasting immunoregulatory function both in vitro and in vivo. Consequently, we have generated MSCs from human induced pluripotent stem (IPS-MSCs) cells that share similar properties with embryonic stem cells (ES-MSCs). Herein, we compared the immunoregulatory properties of ES/IPS-MSCs with those of BM-MSCs and showed, for the first time, that IPS-derived MSCs display remarkable inhibition of NK-cell proliferation and cytolytic function in a similar way to ES-MSCs. Both MSCs disrupt NK-cell cytolytic machinery in the same fashion that BM-MSCs, by down-regulating the expression of different activation markers and ERK1/2 signaling, leading to an impairment to form immunologic synapses with target cells and, therefore, secretion of cytotoxic granules. In addition, they are more resistant than adult BM-MSCs to preactivated NK cells. IPS-MSCs could represent an attractive alternative source of immunoregulatory cells, and their capacity to impair NK-cell cytotoxicity constitutes a complex mechanism to prevent allograft rejection.

Clear cell renal cell carcinomas (ccRCC) frequently display a loss of function of the von Hippel-Lindau (VHL) gene.To elucidate the putative relationship between VHL mutation status and immune checkpoint ligand programmed death-ligand 1 (PD-L1) expression.A series of 32 renal tumors composed of 11 VHL tumor-associated and 21 sporadic RCCs were used to evaluate PD-L1 expression levels after sequencing of the three exons and exon-intron junctions of the VHL gene. The 786-O, A498, and RCC4 cell lines were used to investigate the mechanisms of PD-L1 regulation.Fisher's exact test was used for VHL mutation and Kruskal-Wallis test for PD-L1 expression. If no covariate accounted for the association of VHL and PD-L1, then a Kruskal-Wallis test was used; otherwise Cochran-Mantel-Haenzsel test was used. We also used the Fligner-Policello test to compare two medians when the distributions had different dispersions.We demonstrated that tumors from ccRCC patients with VHL biallelic inactivation (ie, loss of function) display a significant increase in PD-L1 expression compared with ccRCC tumors carrying one VHL wild-type allele. Using the inducible VHL 786-O-derived cell lines with varying hypoxia-inducible factor-2 alpha (HIF-2α) stabilization levels, we showed that PD-L1 expression levels positively correlate with VHL mutation and HIF-2α expression. Targeting HIF-2α decreased PD-L1, while HIF-2α overexpression increased PD-L1 mRNA and protein levels in ccRCC cells. Interestingly, chromatin immunoprecipitation and luciferase assays revealed a direct binding of HIF-2α to a transcriptionally active hypoxia-response element in the human PD-L1 proximal promoter in 786-O cells.Our work provides the first evidence that VHL mutations positively correlate with PD-L1 expression in ccRCC and may influence the response to ccRCC anti-PD-L1/PD-1 immunotherapy.We investigated the relationship between von Hippel-Lindau mutations and programmed death-ligand 1 expression. We demonstrated that von Hippel-Lindau mutation status significantly correlated with programmed death-ligand 1 expression in clear cell renal cell carcinomas.

Myeloid-derived suppressor cells (MDSC) contribute significantly to the malignant characters conferred by hypoxic tumor microenvironments. However, selective biomarkers of MDSC function in this critical setting have not been defined. Here, we report that miR-210 expression is elevated by hypoxia-inducible factor-1α (HIF1α) in MDSC localized to tumors, compared with splenic MDSC from tumor-bearing mice. In tumor MDSC, we determined that HIF1α was bound directly to a transcriptionally active hypoxia-response element in the miR-210 proximal promoter. miR-210 overexpression was sufficient to enhance MDSC-mediated T-cell suppression under normoxic conditions, while targeting hypoxia-induced miR-210 was sufficient to decrease MDSC function against T cells. Mechanistic investigations revealed that miR-210 modulated MDSC function by increasing arginase activity and nitric oxide production, without affecting reactive oxygen species, IL6, or IL10 production or expression of PD-L1. In splenic MDSC, miR-210 regulated Arg1, Cxcl12, and IL16 at the levels of both mRNA and protein, the reversal of which under normoxic conditions decreased T-cell-suppressive effects and IFNγ production. Interestingly, miR-210 overexpression or targeting IL16 or CXCL12 enhanced the immunosuppressive activity of MDSC in vivo, resulting in increased tumor growth. Taken together, these results provide a preclinical rationale to explore miR-210 inhibitory oligonucleotides as adjuvants to boost immunotherapeutic responses in cancer patients.

Blurring the boundary between innate and adaptive immune system, natural killer (NK) cells, a key component of the innate immunity, are recognized as potent anticancer mediators. Extensive studies have been detailed on how NK cells get activated and recognize cancer cells. In contrast, few studies have been focused on how tumor microenvironment-mediated immunosubversion and immunoselection of tumor-resistant variants may impair NK cell function. Accumulating evidences indicate that several cell subsets (macrophages, myeloid-derived suppressive cells, T regulatory cells, dendritic cells, cancer-associated fibroblasts, and tumor cells), their secreted factors, as well as metabolic components (i.e., hypoxia) have immunosuppressive roles in the tumor microenvironment and are able to condition NK cells to become anergic. In this review, we will describe how NK cells react with different stromal cells in the tumor microenvironment. This will be followed by a discussion on the role of hypoxic stress in the regulation of NK cell functions. The aim of this review is to provide a better understanding of how the tumor microenvironment impairs NK cell functions, thereby limiting the use of NK cell-based therapy, and we will attempt to suggest more efficient tools to establish a more favorable tumor microenvironment to boost NK cell cytotoxicity and control tumor progression.

The immune system and metabolism are highly integrated and multilevel interactions between metabolic system and T lymphocyte signaling and fate exist. Accumulating evidence indicate that the regulation of nutrient uptake and utilization in T cells is critically important for the control of their differentiation, and manipulating metabolic pathways in these cells can shape their function and survival. This review will discuss some potential cell metabolism pathways involved in shaping T lymphocyte function and differentiation. It will also describes how subsets of T cells have specific metabolic requirements and signalling pathways that contribute to their respective function. Examples showing the apparent similarity between cancer cell metabolism and T cells during activation are illustrated and finally some mechanisms being used by tumour microenvironment to orchestrate T-cell metabolic dysregulation and the subsequent emergence of immune suppression are discussed. We believe that targeting T cell metabolism may provide an additional opportunity to manipulate T cell function in the development of novel therapeutics.

Pancreatic ductal adenocarcinoma (PDAC) is one of the most aggressive and lethal cancers with very few available treatments. For many decades, gemcitabine was the only treatment for patients with PDAC. A recent attempt to improve patient survival by combining this chemotherapy with FOLFIRINOX and nab-paclitaxel failed and instead resulted in increased toxicity. Novel therapies are urgently required to improve PDAC patient survival. New treatments in other cancers such as melanoma, non-small cell lung cancer and renal cancer have emerged, based on immunotherapy targeting the immune checkpoints cytotoxic T-lymphocyte–associated antigen 4 (CTLA4) or programmed death 1 ligand (PDL1). However, the first clinical trials using such immune checkpoint inhibitors in PDAC have had limited success. Resistance to immunotherapy in PDAC remains unclear but could be due to tissue components (cancer-associated fibroblasts, desmoplasia, hypoxia) and to the imbalance between immunosuppressive and effector immune populations in the tumor microenvironment. In this review we analyzed the presence of “good and bad immunological cops” in PDAC, and discussed the significance of changes in their balance.

While the autophagic process is mainly regulated at the post-translational level, a growing body of evidence suggests that autophagy might also be regulated at the transcriptional level. The identification of transcription factors involved in the regulation of autophagy genes has provided compelling evidence for such regulation. In this context, a powerful high throughput analysis tool to simultaneously monitor the expression level of autophagy genes is urgently needed. Here we describe setting up the first comprehensive human autophagy database (HADb, available at www.autophagy.lu) and the development of a companion Human Autophagy-dedicated cDNA Microarray which comprises 234 genes involved in or related to autophagy. The autophagy microarray tool used on breast adenocarcinoma MCF-7 cell line allowed the identification of 47 differentially expressed autophagy genes associated with the acquisition of resistance to the cytotoxic effect of TNFα. The autophagy-core machinery genes DRAM (Damage-Regulated Autophagy Modulator), BNIP3L (BCL2/adenovirus E1B 19 kDa interacting protein 3-like), BECN1 (Beclin 1), GABARAP (Gamma-AminoButyric Acid Receptor-Associated Protein) and UVRAG (UV radiation resistance associated gene) were found upregulated in TNF-resistant cells, suggesting a constitutive activation of the autophagy machinery in these cells. More interestingly, we identified NPC1 as the most upregulated genes in TNF-resistant compared to TNF-sensitive MCF-7 cells, suggesting a relation between the intracellular transport of cholesterol, the regulation of autophagy and NPC1 expression in TNF-resistant tumor cells. In conclusion, we describe here new tools that may help investigating autophagy gene regulation in various cellular models and diseases.

Elucidation of the underlying molecular mechanisms of immune evasion in cancer is critical for the development of immunotherapies aimed to restore and stimulate effective antitumor immunity. Here, we evaluate the role of the actin cytoskeleton in breast cancer cell resistance to cytotoxic natural killer (NK) cells. A significant fraction of breast cancer cells responded to NK-cell attack via a surprisingly rapid and massive accumulation of F-actin near the immunologic synapse, a process we termed "actin response." Live-cell imaging provided direct evidence that the actin response is associated with tumor cell resistance to NK-cell-mediated cell death. High-throughput imaging flow cytometry analyses showed that breast cancer cell lines highly resistant to NK cells were significantly enriched in actin response-competent cells as compared with susceptible cell lines. The actin response was not associated with a defect in NK-cell activation but correlated with reduced intracellular levels of the cytotoxic protease granzyme B and a lower rate of apoptosis in target cells. Inhibition of the actin response by knocking down CDC42 or N-WASP led to a significant increase in granzyme B levels in target cells and was sufficient to convert resistant breast cancer cell lines into a highly susceptible phenotype. The actin response and its protective effects were fully recapitulated using donor-derived primary NK cells as effector cells. Together, these findings establish the pivotal role of actin remodeling in breast cancer cell resistance to NK-cell-mediated killing.Significance: These findings establish the pivotal role of the actin cytoskeleton in driving breast cancer cell resistance to natural killer cells, a subset of cytotoxic lymphocytes with important roles in innate antitumor immunity. Cancer Res; 78(19); 5631-43. ©2018 AACR.

Abstract Emerging evidence suggests a link between tumor hypoxia and immune suppression. In this study, we investigated the role of hypoxia-induced Nanog, a stemness-associated transcription factor, in immune suppression. We observed that hypoxia-induced Nanog correlated with the acquisition of stem cell–like properties in B16-F10 cells. We further show that Nanog was selectively induced in hypoxic areas of B16-F10 tumors. Stable short hairpin RNA–mediated depletion of Nanog, combined with melanocyte differentiation Ag tyrosinase-related protein-2 peptide-based vaccination, resulted in complete inhibition of B16-F10 tumor growth. Nanog targeting significantly reduced immunosuppressive cells (regulatory T cells and macrophages) and increased CD8+ T effector cells in tumor bed in part by modulating TGF-β1 production. Additionally, Nanog regulated TGF-β1 under hypoxia by directly binding the TGF-β1 proximal promoter. Collectively, our data establish a novel functional link between hypoxia-induced Nanog and TGF-β1 regulation and point to a major role of Nanog in hypoxia-driven immunosuppression.

Clear cell renal cell carcinomas (RCC) frequently display inactivation of von Hippel-Lindau (VHL) gene leading to increased level of hypoxia-inducible factors (HIF). In this study, we investigated the potential role of HIF2α in regulating RCC susceptibility to natural killer (NK) cell-mediated killing. We demonstrated that the RCC cell line 786-0 with mutated VHL was resistant to NK-mediated lysis as compared with the VHL-corrected cell line (WT7). This resistance was found to require HIF2α stabilization. On the basis of global gene expression profiling and chromatin immunoprecipitation assay, we found ITPR1 (inositol 1,4,5-trisphosphate receptor, type 1) as a direct novel target of HIF2α and that targeting ITPR1 significantly increased susceptibility of 786-0 cells to NK-mediated lysis. Mechanistically, HIF2α in 786-0 cells lead to overexpression of ITPR1, which subsequently regulated the NK-mediated killing through the activation of autophagy in target cells by NK-derived signal. Interestingly, both ITPR1 and Beclin-1 silencing in 786-0 cells inhibited NK-induced autophagy and subsequently increased granzyme B activity in target cells. Finally, in vivo ITPR1 targeting significantly enhanced the NK-mediated tumor regression. Our data provide insight into the link between HIF2α, the ITPR1-related pathway, and natural immunity and strongly suggest a role for the HIF2α/ITPR1 axis in regulating RCC cell survival.

Cancer-associated fibroblasts (CAFs) play a central role in the complex process of tumor-stroma interaction and promote tumor growth. Emerging evidences also suggest that these fibroblasts are involved in the alteration of the anti-tumor immune response by impacting several immune cell populations, especially through their secretion of pro-inflammatory and immunosuppressive factors in the tumor microenvironment. However, the underlying immuno-modulating mechanisms triggered by these fibroblasts are still only partially defined. In this study, we provide evidence that melanoma-associated fibroblasts decrease the susceptibility of melanoma tumor cells to NK-mediated lysis through the secretion of active matrix metalloproteinases. This secretion reduces the expression of the two NKG2D ligands, MICA/B, at the surface of tumor cells and consequently decreases the NKG2D-dependent cytotoxic activity of NK cells against melanoma tumor cells. Together, our data demonstrate that the modification of tumor cell susceptibility to killer cells is an important determinant of the anti-tumor immune response alteration triggered by CAFs.

Accumulation of CD103+CD8+ resident memory T (TRM) cells in human lung tumors has been associated with a favorable prognosis. However, the contribution of TRM to anti-tumor immunity and to the response to immune checkpoint blockade has not been clearly established. Using quantitative multiplex immunofluorescence on cohorts of non-small cell lung cancer patients treated with anti-PD-(L)1, we show that an increased density of CD103+CD8+ lymphocytes in immunotherapy-naive tumors is associated with greatly improved outcomes. The density of CD103+CD8+ cells increases during immunotherapy in most responder, but not in non-responder, patients. CD103+CD8+ cells co-express CD49a and CD69 and display a molecular profile characterized by the expression of PD-1 and CD39. CD103+CD8+ tumor TRM, but not CD103−CD8+ tumor-infiltrating counterparts, express Aiolos, phosphorylated STAT-3, and IL-17; demonstrate enhanced proliferation and cytotoxicity toward autologous cancer cells; and frequently display oligoclonal expansion of TCR-β clonotypes. These results explain why CD103+CD8+ TRM are associated with better outcomes in anti-PD-(L)1-treated patients.

Although natural killer (NK) cells play an important role in the control of melanoma, hypoxic stress in the tumor microenvironment may impair NK-mediated tumor cell killing by mechanisms that are not fully understood. In this study, we investigated the effect of hypoxia on the expression and channel activity of connexin 43 (Cx43) in melanoma cells and its impact on their susceptibility to NK cell-mediated lysis. Our results demonstrated that hypoxic stress increases Cx43 expression in melanoma cells via hypoxia-inducible factor-1α (HIF-1α) transcriptional activity. Hypoxic cells displaying increased Cx43 expression were less susceptible to NK cell-mediated lysis compared with normoxic cells expressing a moderate level of Cx43. Conversely, when overexpressed in normoxic tumor cells, Cx43 improves their susceptibility to N cell-mediated killing. We show that the NK cell immune synapse formed with normoxic melanoma cells is more stable and contains a high level of gap-junctional Cx43 whereas that formed with hypoxic cells is less stable and contains a significant lower level of gap-junctional Cx43. We provide evidence that the activation of autophagy in hypoxic melanoma cells selectively degrades gap-junctional Cx43, leading to the destabilization of the immune synapse and the impairment of NK cell-mediated killing. Inhibition of autophagy by genetic or pharmacological approaches as well as expression of the non-degradable form of Cx43 significantly restore its accumulation at the immune synapse and improves N cell-mediated lysis of hypoxic melanoma cells. This study provides the first evidence that the hypoxic microenvironment negatively affects the immune surveillance of tumors by NK cells through the modulation of Cx43-mediated intercellular communications. Although natural killer (NK) cells play an important role in the control of melanoma, hypoxic stress in the tumor microenvironment may impair NK-mediated tumor cell killing by mechanisms that are not fully understood. In this study, we investigated the effect of hypoxia on the expression and channel activity of connexin 43 (Cx43) in melanoma cells and its impact on their susceptibility to NK cell-mediated lysis. Our results demonstrated that hypoxic stress increases Cx43 expression in melanoma cells via hypoxia-inducible factor-1α (HIF-1α) transcriptional activity. Hypoxic cells displaying increased Cx43 expression were less susceptible to NK cell-mediated lysis compared with normoxic cells expressing a moderate level of Cx43. Conversely, when overexpressed in normoxic tumor cells, Cx43 improves their susceptibility to N cell-mediated killing. We show that the NK cell immune synapse formed with normoxic melanoma cells is more stable and contains a high level of gap-junctional Cx43 whereas that formed with hypoxic cells is less stable and contains a significant lower level of gap-junctional Cx43. We provide evidence that the activation of autophagy in hypoxic melanoma cells selectively degrades gap-junctional Cx43, leading to the destabilization of the immune synapse and the impairment of NK cell-mediated killing. Inhibition of autophagy by genetic or pharmacological approaches as well as expression of the non-degradable form of Cx43 significantly restore its accumulation at the immune synapse and improves N cell-mediated lysis of hypoxic melanoma cells. This study provides the first evidence that the hypoxic microenvironment negatively affects the immune surveillance of tumors by NK cells through the modulation of Cx43-mediated intercellular communications.

The microenvironment of a developing tumor is composed of proliferating cancer cells, blood vessels, stromal cells, infiltrating inflammatory cells, and a variety of associated tissue cells. The crosstalk between stromal cells and malignant cells within this environment crucially determines the fate of tumor progression, its hostility, and heterogeneity. It is widely accepted that hypoxic stresses occur in most solid tumors. Moreover, cancer cells found within hypoxic regions are presumed to represent the most aggressive and therapy-resistant fractions of the tumor. Here, we review evidence that hypoxia regulates cell plasticity, resistance to cell-mediated cytotoxicity, and immune suppression. Exposure to hypoxia occurs as a consequence of insufficient blood supply. Hypoxic cells activate a number of adaptive responses coordinated by various cellular pathways. Accumulating data also suggest that hypoxic stress in the tumor microenvironment promotes tumor escape mechanisms through the emergence of immune-resistant tumor variants and immune suppression. Thus, solid tumors seem to build up a hostile hypoxic microenvironment that hampers cell-mediated immunity and dampen the efficacy of the immune response.

Hypoxia is a key factor responsible for the failure of therapeutic response in most solid tumors and promotes the acquisition of tumor resistance to various antitumor immune effectors. Reshaping the hypoxic immune suppressive tumor microenvironment to improve cancer immunotherapy is still a relevant challenge. We investigated the impact of inhibiting HIF-1α transcriptional activity on cytotoxic immune cell infiltration into B16-F10 melanoma. We showed that tumors expressing a deleted form of HIF-1α displayed increased levels of NK and CD8+ effector T cells in the tumor microenvironment, which was associated with high levels of CCL2 and CCL5 chemokines. We showed that combining acriflavine, reported as a pharmacological agent preventing HIF-1α/HIF-1β dimerization, dramatically improved the benefit of cancer immunotherapy based on TRP-2 peptide vaccination and anti-PD-1 blocking antibody. In melanoma patients, we revealed that tumors exhibiting high CCL5 are less hypoxic, and displayed high NK, CD3+, CD4+ and CD8+ T cell markers than those having low CCL5. In addition, melanoma patients with high CCL5 in their tumors survive better than those having low CCL5. This study provides the pre-clinical proof of concept for a novel triple combination strategy including blocking HIF-1α transcription activity along vaccination and PD-1 blocking immunotherapy.

<h2>Abstract</h2><h3>Introduction</h3> Acquired cancer therapy resistance evolves under selection pressure of immune surveillance and favors mechanisms that promote drug resistance through cell survival and immune evasion. AXL receptor tyrosine kinase is a mediator of cancer cell phenotypic plasticity and suppression of tumor immunity, and AXL expression is associated with drug resistance and diminished long-term survival in a wide range of malignancies, including NSCLC. <h3>Methods</h3> We aimed to investigate the mechanisms underlying AXL-mediated acquired resistance to first- and third-generation small molecule EGFR tyrosine kinase inhibitors (EGFRi) in NSCLC. <h3>Results</h3> We found that EGFRi resistance was mediated by up-regulation of AXL, and targeting AXL reduced reactivation of the MAPK pathway and blocked onset of acquired resistance to long-term EGFRi treatment in vivo. AXL-expressing EGFRi-resistant cells revealed phenotypic and cell signaling heterogeneity incompatible with a simple bypass signaling mechanism, and were characterized by an increased autophagic flux. AXL kinase inhibition by the small molecule inhibitor bemcentinib or siRNA mediated <i>AXL</i> gene silencing was reported to inhibit the autophagic flux in vitro, bemcentinib treatment blocked clonogenicity and induced immunogenic cell death in drug-resistant NSCLC in vitro, and abrogated the transcription of autophagy-associated genes in vivo. Furthermore, we found a positive correlation between <i>AXL</i> expression and autophagy-associated gene signatures in a large cohort of human NSCLC (n = 1018). <h3>Conclusion</h3> Our results indicate that AXL signaling supports a drug-resistant persister cell phenotype through a novel autophagy-dependent mechanism and reveals a unique immunogenic effect of AXL inhibition on drug-resistant NSCLC cells.

Immunotherapy is poised to become an increasingly utilized therapy in the treatment of cancer. However, several abnormalities in the tumor microenvironment (TME) that can thwart the efficacy of immunotherapies have been established. Microenvironmental hypoxia is a determining factor in shaping aggressiveness, metastatic potential and treatment resistance of solid tumors. The characterization of this phenomenon could prove beneficial for determining a patient's treatment path and for the introduction of novel targetable factors that can enhance therapeutic outcome. Indeed, the ablation of hypoxia has the potential to sensitize tumors to immunotherapy by metabolically remodeling their microenvironment. In this review, we discuss the intrinsic contributions of hypoxia to cellular plasticity, heterogeneity, stemness and genetic instability in the context of immune escape. In addition, we will shed light on how managing hypoxia can ameliorate response to immunotherapy and how integrating hypoxia gene signatures could play a role in this pursuit.

The combination of cancer immunotherapy with efficient functionalized nanosystems has emerged as a beneficial treatment strategy and its use has increased rapidly. The roles of stimuli-responsive nanosystems and nanomedicine-based cancer immunotherapy, a subsidiary discipline in the field of immunology, are pivotal. The present era is witnessing rapid advancements in the use of nanomedicine as a platform for investigating novel therapeutic applications and modern intelligent healthcare management strategies. The development of cancer nanomedicine has posthaste ratified the outcomes of immunotherapy to the subsequent stage in the current era of medical research. This review focuses on key findings with respect to the effectiveness of nanomedicine-based cancer immunotherapies and their applications, which include i) immune checkpoint inhibitors and nanomedicine, ii) CRISPR-Cas nanoparticles (NPs) in cancer immunotherapy, iii) combination cancer immunotherapy with core-shell nanoparticles, iv) biomimetic NPs for cancer immunotherapy, and v) CAR-T cells and cancer nanoimmunotherapy. By evaluating the state-of-the-art tools and taking the challenges involved into consideration, various aspects of the proposed nano-enabled therapeutic approaches have been discussed in this review.

A minority of patients currently respond to single-agent immune-checkpoint blockade (ICB), and strategies to increase response rates are urgently needed. AXL is a receptor tyrosine kinase commonly associated with drug resistance and poor prognosis in many cancer types, including in clear-cell renal cell carcinoma (ccRCC). Recent experimental cues in breast, pancreatic, and lung cancer models have linked AXL with immune suppression and resistance to antitumor immunity. However, its role in intrinsic and acquired resistance to ICB remains largely unexplored.In this study, tumoral expression of AXL was examined in ccRCC specimens from 316 patients who were metastatic receiving the PD-1 inhibitor nivolumab in the GETUG AFU 26 NIVOREN trial after failure of antiangiogenic therapy. We assessed associations between AXL and patient outcomes following PD-1 blockade, as well as the relationship with various markers, including PD-L1; VEGFA; the immune markers CD3, CD8, CD163, and CD20; and the mutational status of the tumor-suppressor gene von Hippel-Lindau (VHL).Our results show that high AXL-expression level in tumor cells is associated with lower response rates and a trend to shorter progression-free survival following anti-PD-1 treatment. AXL expression was strongly associated with tumor-PD-L1 expression, especially in tumors with VHL inactivation. Moreover, patients with tumors displaying concomitant PD-L1 expression and high AXL expression had the worst overall survival.Our findings propose AXL as candidate factor of resistance to PD-1 blockade, and provide compelling support for screening both AXL and PD-L1 expression in the management of advanced ccRCC.See related commentary by Hahn et al., p. 6619.

Programmed cell death or type I apoptosis has been extensively studied and its contribution to the pathogenesis of disease is well established. However, autophagy functions together with apoptosis to determine the overall fate of the cell. The cross talk between this active self-destruction process and apoptosis is quite complex and contradictory as well, but it is unquestionably decisive for cell survival or cell death. Autophagy can promote tumor suppression but also tumor growth by inducing cancer-cell development and proliferation. In this review, we will discuss how autophagy reprograms tumor cells in the context of tumor hypoxic stress. We will illustrate how autophagy acts as both a suppressor and a driver of tumorigenesis through tuning survival in a context dependent manner. We also shed light on the relationship between autophagy and immune response in this complex regulation. A better understanding of the autophagy mechanisms and pathways will undoubtedly ameliorate the design of therapeutics aimed at targeting autophagy for future cancer immunotherapies.

Cancer-associated fibroblasts (CAFs) and hypoxia are central players in the complex process of tumor cell-stroma interaction and are involved in the alteration of the anti-tumor immune response by impacting both cancer and immune cell populations. However, even if their independent immunomodulatory properties are now well documented, whether the interaction between these two components of the tumor microenvironment can affect CAFs ability to alter the anti-tumor immune response is still poorly defined. In this study, we provide evidence that hypoxia increases melanoma-associated fibroblasts expression and/or secretion of several immunosuppressive factors (including TGF-β, IL6, IL10, VEGF and PD-L1). Moreover, we demonstrate that hypoxic CAF secretome exerts a more profound effect on T cell-mediated cytotoxicity than its normoxic counterpart. Together, our data suggest that the crosstalk between hypoxia and CAFs is probably an important determinant in the complex immunosuppressive tumor microenvironment.

Tumor-associated macrophages (TAM) plasticity and diversity are both essential hallmarks of the monocyte-macrophage lineage and the tumor-derived inflammation. TAM exemplify the perfect adaptable cell with dynamic phenotypic modifications that reflect changes in their functional polarization status. Under several tumor microenvironment (TME)-related cues, TAM shift their polarization, hence promoting or halting cancer progression. Immune checkpoint inhibitors (ICI) displayed unprecedented clinical responses in various refractory cancers; but only approximately a third of patients experienced durable responses. It is, therefore, crucial to enhance the response rate of immunotherapy. Several mechanisms of resistance to ICI have been elucidated including TAM role with its essential immunosuppressive functions that reduce both anti-tumor immunity and the subsequent ICI efficacy. In the past few years, thorough research has led to a better understanding of TAM biology and innovative approaches can now be adapted through targeting macrophages' recruitment axis as well as TAM activation and polarization status within the TME. Some of these therapeutic strategies are currently being evaluated in several clinical trials in association with ICI agents. This combination between TAM modulation and ICI allows targeting TAM intrinsic immunosuppressive functions and tumor-promoting factors as well as overcoming ICI resistance. Hence, such strategies, with a better understanding of the mechanisms driving TAM modulation, may have the potential to optimize ICI efficacy.

Hypoxia is an environmental stressor that is instigated by low oxygen availability. It fuels the progression of solid tumors by driving tumor plasticity, heterogeneity, stemness and genomic instability. Hypoxia metabolically reprograms the tumor microenvironment (TME), adding insult to injury to the acidic, nutrient deprived and poorly vascularized conditions that act to dampen immune cell function. Through its impact on key cancer hallmarks and by creating a physical barrier conducive to tumor survival, hypoxia modulates tumor cell escape from the mounted immune response. The tumor cell-immune cell crosstalk in the context of a hypoxic TME tips the balance towards a cold and immunosuppressed microenvironment that is resistant to immune checkpoint inhibitors (ICI). Nonetheless, evidence is emerging that could make hypoxia an asset for improving response to ICI. Tackling the tumor immune contexture has taken on an in silico, digitalized approach with an increasing number of studies applying bioinformatics to deconvolute the cellular and non-cellular elements of the TME. Such approaches have additionally been combined with signature-based proxies of hypoxia to further dissect the turbulent hypoxia-immune relationship. In this review we will be highlighting the mechanisms by which hypoxia impacts immune cell functions and how that could translate to predicting response to immunotherapy in an era of machine learning and computational biology.

The development and implementation of Immune Checkpoint Inhibitors (ICI) in clinical oncology have significantly improved the survival of a subset of cancer patients with metastatic disease previously considered uniformly lethal. However, the low response rates and the low number of patients with durable clinical responses remain major concerns and underscore the limited understanding of mechanisms regulating anti-tumor immunity and tumor immune resistance. There is an urgent unmet need for novel approaches to enhance the efficacy of ICI in the clinic, and for predictive tools that can accurately predict ICI responders based on the composition of their tumor microenvironment. The receptor tyrosine kinase (RTK) AXL has been associated with poor prognosis in numerous malignancies and the emergence of therapy resistance. AXL is a member of the TYRO3-AXL-MERTK (TAM) kinase family. Upon binding to its ligand GAS6, AXL regulates cell signaling cascades and cellular communication between various components of the tumor microenvironment, including cancer cells, endothelial cells, and immune cells. Converging evidence points to AXL as an attractive molecular target to overcome therapy resistance and immunosuppression, supported by the potential of AXL inhibitors to improve ICI efficacy. Here, we review the current literature on the prominent role of AXL in regulating cancer progression, with particular attention to its effects on anti-tumor immune response and resistance to ICI. We discuss future directions with the aim to understand better the complex role of AXL and TAM receptors in cancer and the potential value of this knowledge and targeted inhibition for the benefit of cancer patients.

For understanding the local immune response in human non-small cell lung cancer (NSCLC), we investigated both Th1 and Th2-type as well as TGF-beta1 cytokine mRNA expression in 10 fresh tumor biopsies, the corresponding tumor and short term TIL cell lines as well as patient PBMC. A methodology based on a highly sensitive quantitative RT-PCR was used. We found that IL-6 mRNA was highly expressed in all tumor biopsy samples analyzed (4 LLC, 3 ADC and 3 SCC). IL-10 mRNA was expressed in 7 of 10 biopsies whereas IL-4 mRNA expression was moderate. Analysis of type I cytokines revealed a low expression level of IL-2 mRNA, while IFNgamma and GM-CSF expression was high in the majority of the tumor lesions studied. Quantitatively, high amounts of Th2-type cytokine mRNA were detected at the tumor site with IL-6 as the predominant lymphokine. A high mRNA expression level of the immunosuppressive cytokine TGF-beta1 was observed in all NSCLC. To identify the cell types responsible for the production of TGF-beta1, IL-6, IL-10 and GM-CSF at the tumor site, tumor and TIL cell lines were derived from the corresponding biopsies. All the 3 tumor cell lines analysed were found to express high amount of TGF-beta1 but not IL-10 mRNA, 2 expressing IL-6 and GM-CSF. Five short term TIL cell lines established in the presence of IL-2 expressed high level of IL-10, IL-4 and IFNgamma but not IL-2 mRNA. Strikingly, high expression of IL-10 mRNA was also observed in all 6 patient PBMC analyzed as compared to controls. Together, our results indicate the existence of a local and peripheral Th-2-type cytokine pattern in patients bearing NSCLC.

Abstract We have isolated several T-cell clones from lymphocytes infiltrating a human major histocompatibility class (MHC) II negative cutaneous T-cell lymphoma (CTCL). We describe here two of these clones, TC5 and TC7, with, respectively, a CD4+CD8dim+ and CD4+CD8− phenotype. Both clones mediated a specific MHC class I–restricted cytotoxic activity toward the fresh autologous tumor cells, and autologous tumor cell lines previously established with interleukin-2 (IL-2) and IL-7 from the skin and from the blood. Analysis of the T-cell receptor (TCR) Vβ gene expression showed that the tumor cells, which were shown to have a trisomy 7 by fluorescent in situ hybridization, expressed Vβ7/Jβ2.3, Vβ13/Jβ2.5, and Vβ22/Jβ2.5 rearrangements. Phenotypic analysis using specific anti-Vβ monoclonal antibodies indicated that only Vβ13 could be detected on the cell membrane of the tumor cells. Analysis of the TCR Vβ gene expression of the clones showed that TC5 and TC7 expressed a unique TCR-Vβ transcript, corresponding, respectively, to Vβ5/Jβ2.3 and Vβ17/Jβ2.7 gene segments. To determine whether these reactive T lymphocytes were present in vivo, we used specific primers corresponding to TC5- and TC7-Vβ TCR transcripts. The results showed that both cytotoxic T-cell clones were present at the lesional skin site and amplified in vitro. TC7 was found in the patient peripheral blood invaded by tumoral cells, whereas TC5 was not, indicating that the repertoire of the reactional lymphocytes differs in the blood and at the tumor site. These results show for the first time the presence of reactive T lymphocytes with CD4 or double-positive phenotype infiltrating a CTCL. These findings raise the question of the role of these antitumoral effector T cells in the tumor growth.

Abstract IL-15, a new cytokine primarily produced by macrophages, has been shown to exhibit several functional properties shared with IL-2. Treatment of PBMC from HIV-infected patients with IL-15 resulted in an increase in NK cell cytotoxicity to levels similar to those of untreated PBMC from healthy donors. This effect is independent of several well-characterized regulatory cytokines, as it is not prevented by Abs that neutralize IFNs, TNF-alpha, IL-2, or IL-12. Enhanced cytotoxicity was accompanied by a significant increase in expression of cytotoxic granules. IL-15 enhanced the proliferative ability in both controls and HIV-seropositive in response to mitogen and recall Ags. Although the addition of IL-15 has a preventive effect on the appearance of spontaneous cell death, this effect was not seen during mitogen-induced apoptosis. The production of IL-15 by PBMC from patients in response to Staphylococcus aureus Cowan strain 1 appeared heterogeneous and was not negatively regulated by cytokines that inhibited IL-12 production. No correlation was found between in vitro HIV infection and IL-15 production, as viral infection had no effect on the ability of monocytes to produce IL-15 in response to S. aureus. Interestingly IL-15 restored the deficient production of IL-12 by PBMC from HIV+ people and had no major effect on modulating viral expression in latently infected cell lines or PBMC from naturally infected people. Taken together, these results suggest a potent immunoregulatory role of IL-15 during HIV infection.

Tolerance to tumor-nonmutated self proteins represents a major obstacle for successful cancer immunotherapy. Since this tolerance primarily concerns dominant epitopes, we hypothesized that targeting cryptic epitopes that have a low affinity for HLA could be an efficient strategy to breach the tolerance to tumor Ags. Using the P1Y heteroclitic peptide approach, we identified low affinity cryptic HLA-A*0201-restricted epitopes derived from two widely expressed tumor Ags, HER-2/neu and hTERT. The P1Y variants of four HER-2/neu (neu(391), neu(402), neu(466), neu(650))- and two hTERT (hTERT(572) and hTERT(988))-derived low affinity peptides exhibited strong affinity for HLA-A*0201 and stimulated specific CTL from healthy donor PBMCs. These CTL specifically recognized HER-2/neu- and hTERT-expressing tumor cells of various histological origins. In vivo studies showed that HLA-A*0201 transgenic HHD mice vaccinated with the P1Y variant peptides generated CTL that specifically lysed Ag-expressing tumor cells, thus recognizing the cognate endogenous Ags. These results suggest that heteroclitic variants of low affinity, cryptic epitopes of widely expressed tumor Ags may serve as valid tools for tumor immunotherapy.

Nuclear factor-κB (NF-κB) is one of major component induced by tumor necrosis factor-α (TNF), and its role in the signaling of TNF-induced cell death remains controversial. In order to delineate whether the involvement of NF-κB activation is required for triggering of the apoptotic signal of TNF, we inhibited the nuclear translocation of this transcription factor in TNF-sensitive MCF7 cells by introducing a human MAD-3 mutant cDNA coding for a mutated IκBα that is resistant to both phosphorylation and proteolytic degradation and that behaves as a potent dominant negative IκBα protein. Our results demonstrated that the mutated IκBα was stably expressed in the transfected MCF7 cells and blocked the TNF-induced NF-κB nuclear translocation. Indeed, TNF treatment of these cells induced the proteolysis of only the endogenous IκBα but not the mutated IκBα. The nuclear NF-κB released from the endogenous IκBα within 30 min of TNF treatment was rapidly inhibited by the mutated IκBα. There was no significant difference either in cell viability or in the kinetics of cell death between control cells and the mutated IκBα transfected cells. Furthermore, electron microscopic analysis showed that the cell death induced by TNF in both control and mutated IκBα transfected cells was apoptotic. The inhibition of NF-κB translocation in mutated IκBα-transfected cells persisted throughout the same time course that apoptosis was occurring. Our data provide direct evidence that the inhibition of NF-κB did not alter TNF-induced apoptosis in MCF7 cells and support the view that TNF-mediated apoptosis is NF-κB independent.

To define genetic determinants of tumor cell resistance to the cytotoxic action of tumor necrosis factor alpha (TNF), we have applied cDNA microarrays to a human breast carcinoma TNF-sensitive MCF7 cell line and its established TNF-resistant clone. Of a total of 5760 samples of cDNA examined, 3.6% were found to be differentially expressed in TNF-resistant 1001 cells as compared with TNF-sensitive MCF7 cells. On the basis of available literature data, the striking finding is the association of some differentially expressed genes involved in the phosphatidylinositol-3-kinase/Akt signaling pathway. More notably, we found that the PRNP gene coding for the cellular prion protein (PrP(c)), was 17-fold overexpressed in the 1001 cell line as compared with the MCF7 cell line. This differential expression was confirmed at the cell surface by immunostaining that indicated that PrP(c) is overexpressed at both mRNA and protein levels in the TNF-resistant derivative. Using recombinant adenoviruses expressing the human PrP(c,) our data demonstrate that PrP(c) overexpression converted TNF-sensitive MCF7 cells into TNF-resistant cells, at least in part, by a mechanism involving alteration of cytochrome c release from mitochondria and nuclear condensation.

Tumor necrosis factor (TNF)-α is initially synthesized as a membrane-bound, cell-associated 26-kDa protein that is further cleaved to yield the soluble 17-kDa form. By using a radiolabeled <i>in vitro</i> translated TNF-α precursor we detected a serine proteinase processing activity present in crude membrane preparations of monocytic cells able to generate a 17-kDa active protein. A similar processing pattern was obtained using purified neutral serine proteinase proteinase-3 (PR-3). Moreover, while a secretory leukocyte proteinase inhibitor (a natural serine anti-proteinase) did not affect the <i>in vitro</i> TNF-α processing, IgG preparations containing high titers of anti-PR-3 autoantibodies completely blocked this activity. The NH²-terminal sequencing of the reaction products obtained with either membrane preparations or PR-3 showed that cleavage occurs in both cases between Val⁷⁷ and Arg⁷⁸. These results together with cellular expression and localization of PR-3 suggest a potential role for this enzyme as an accessory TNF-α processing enzyme.

Natural Killer (NK) cells are critical in host defense against malignant transformation and are potent antileukemic cytotoxic effectors. In the present study, we investigated the peripheral NK function in patients with myelodysplastic syndromes (MDS). We demonstrated that the peripheral NK cell population was quantitatively normal in MDS patients. Furthermore, NK cells displayed an expression of the activating natural cytotoxicity receptors (NCR) NKp46 and NKp30 as well as NKG2D similar to that observed in donors, but exert a highly decreased constitutive cytolytic activity compared to resting normal NK cells. Although activation with IL-2 resulted in the upregulation of NKp46 expression by MDS-NK cells, their cytolytic function remained deeply altered as compared to activated donor NK cells. In addition, MDS NK cells did not proliferate in vitro, and displayed an increased rate of apoptosis in response to IL-2 stimulation although the spontaneous apoptosis was not significantly increased. Interestingly, a proportion of peripheral MDS-NK cells were derived from the MDS clone as the cytogenetic anomaly found in bone marrow karyotype was also detected in 20–50% of circulating NK cells. In conclusion, NK cells' cytolytic function and proliferative capacities in response to activation by cytokines are profoundly altered in MDS.

Most of the human tumor-associated antigens (TAAs) characterized thus far are derived from nonmutated "self"-proteins.Numerous strategies have been developed to break tolerance to TAAs, combining various forms of antigens with different vectors and adjuvants.However, no study has yet determined how to select epitopes within a given TAA to induce the highest antitumor effector response.We addressed this question by evaluating in HLA-A*0201-transgenic HHD mice the antitumor vaccination efficacy of high-and low-affinity epitopes from the naturally expressed murine telomerase reverse transcriptase (mTERT).Immunity against low-affinity epitopes was induced with heteroclitical variants.We show here that the CTL repertoire against high-affinity epitopes is partially tolerized, while that against low-affinity epitopes is composed of frequent CTLs with high avidity.The highaffinity p797 and p545 mTERT epitopes are not able to protect mice from a lethal challenge with the mTERT-expressing EL4-HHD tumor.In contrast, mice developing CTL responses against the p572 and p988 low-affinity epitopes exhibit potent antitumor immunity and no sign of autoimmune reactivity against TERT-expressing normal tissues.Our results strongly argue for new TAA epitope selection and modification strategies in antitumor immunotherapy applications in humans.

Besides tumor cells, the tumor microenvironment harbors a variety of host-derived cells, such as endothelial cells, fibroblasts, innate and adaptive immune cells. It is a complex and highly dynamic environment, providing very important cues to tumor development and progression. Tumor-associated endothelial cells play a key role in this process. On the one hand, they form tumor-associated (angiogenic) vessels through sprouting from locally preexisting vessels or recruitment of bone marrow-derived endothelial progenitor cells, to provide nutritional support to the growing tumor. On the other hand, they are the interface between circulating blood cells, tumor cells and the extracellular matrix, thereby playing a central role in controlling leukocyte recruitment, tumor cell behavior and metastasis formation. Hypoxia is a critical parameter modulating the tumor microenvironment and endothelial/tumor cell interactions. Under hypoxic stress, tumor cells produce factors that promote tumor angiogenesis, tumor cell motility and metastasis. Among these factors, VEGF, a main angiogenesis modulator, can also play a critical role in the control of immune tolerance. This review discusses some aspects of the role of endothelial cells within tumor microenvironment and emphasizes their interaction with tumor cells, the extracellular matrix and with immune killer cells. We will also address the role played by circulating endothelial progenitor cells and illustrate their features and mechanism of recruitment to the tumor microenvironment and their role in tumor angiogenesis.

Salmonella enterica serovar Typhimurium (hereafter S. typhimurium) stains have been shown to exert a potent inhibitory effect on the growth of human and mouse tumors in experimental models. Our laboratory has previously demonstrated that an attenuated strain of S. typhimurium engineered to express IL2 (designated strain GIDIL2) has demonstrable immunopotentiating properties, particularly affecting the innate arm of the immune system. In the present study, we wished to explore the properties of IL2-expressing Salmonella as an oncolytic agent in the highly tumorigenic B16F1 melanoma mouse model and shed light on its mechanism of action. Our data demonstrate that the systemic administration of a single dose of GIDIL2, two weeks post B16F1 implantation, had a significantly superior effect than its parental, non cytokine-expressing, strain (known as BRD509E). The improved response, which was dependent on the bacterial dose used, was observed in terms of stronger inhibition of tumor growth as well as enhanced host survival. The GIDIL2-induced anti-tumor response was correlated with decreased angiogenesis and increased necrosis within the tumor tissue. A treatment regimen involving multiple low doses of GIDIL2 was more efficacious than a single high dose regimen, resulting in extension of animal survival well beyond the normal 30 day post implantation period typically observed in this aggressive melanoma tumor model. This supports the notion of using cytokine-expressing attenuated Salmonella organisms in cancer therapy.

Hypoxia, a common feature of solid tumors and one of the hallmarks of tumor microenvironment, favors tumor survival and progression. Although hypoxia has been reported to play a major role in the acquisition of tumor resistance to cell death, the molecular mechanisms that control the survival of hypoxic cancer cells and the role of hypoxic stress in shaping the cross talk between immune cells and stroma components are not fully elucidated. Recently, several lines of investigation are pointing to yet another ominous outcome of hypoxia in the tumor microenvironment involving suppression of antitumor immune effector cells and enhancement of tumor escape from immune surveillance. Although the identification of tumor-associated antigens provided a new arsenal of approaches to enhance antigen-specific response, the immunotherapy approaches that are currently used in the clinic have only limited success. In fact, tumor stroma components including hypoxia are engaged in an active molecular cross talk that has serious implications for immunological recognition of tumor in shaping the microenvironment. In this review, we will focus on the impact of hypoxia on the regulation of the antitumor response and the subsequent tumor progression. We will also in particular discuss data that indicate that manipulation of hypoxic stress may represent an innovative strategy for a better immunotherapy of cancer.

Mesenchymal stem cells (MSCs) play a fundamental role in allograft rejection and graft-versus-host disease through their immunosuppressive abilities. Recently, Toll-like receptors (TLR) have been shown to modulate MSC functions. The aim of this study was to investigate the effects of several TLR ligands on the interaction between MSC and natural killer (NK) cells. Our results show that TLR-primed adult bone marrow and embryonic MSC are more resistant than unprimed MSC to IL-2-activated NK-induced killing. Such protection can be explained by the modulation of Natural Killer group 2D ligands major histocompatibility complex class I chain A and ULBP3 and DNAM-1 ligands by TLR-primed MSC. These results indicate that MSCs are able to adapt their immuno-behavior in an inflammatory context, decreasing their susceptibility to NK killing. In addition, TLR3 but not TLR4-primed MSC enhance their suppressive functions against NK cells. However, the efficiency of this response is heterogeneous, even if the phenotypes of different analyzed MSC are rather homogeneous. The consequences could be important in MSC-mediated cell therapy, since the heterogeneity of adult MSC responders may be explored in order to select the more efficient responders.

The cytotoxic T lymphocyte antigen-4 (CTLA-4)-blocking antibody ipilimumab induces immune-mediated long-term control of metastatic melanoma in a fraction of patients. Although ipilimumab undoubtedly exerts its therapeutic effects via immunostimulation, thus far clinically useful, immunologically relevant biomarkers that predict treatment efficiency have been elusive. Here, we show that neutralization of IL-2 or blocking the α and β subunits of the IL-2 receptor (CD25 and CD122, respectively) abolished the antitumor effects and the accompanying improvement of the ratio of intratumoral T effector versus regulatory cells (Tregs), which were otherwise induced by CTLA-4 blockade in preclinical mouse models. CTLA-4 blockade led to the reduction of a suppressive CD4+ T cell subset expressing Lag3, ICOS, IL-10 and Egr2 with a concomitant rise in IL-2-producing effector cells that lost FoxP3 expression and accumulated in regressing tumors. While recombinant IL-2 improved the therapeutic efficacy of CTLA-4 blockade, the decoy IL-2 receptor α (IL-2Rα, sCD25) inhibited the anticancer effects of CTLA-4 blockade. In 262 metastatic melanoma patients receiving ipilimumab, baseline serum concentrations of sCD25 represented an independent indicator of overall survival, with high levels predicting resistance to therapy. Altogether, these results unravel a role for IL-2 and IL-2 receptors in the anticancer activity of CTLA-4 blockade. Importantly, our study provides the first immunologically relevant biomarker, namely elevated serum sCD25, that predicts resistance to CTLA-4 blockade in patients with melanoma.

Many renal cancer patients experience disease recurrence after immunotherapy or combined treatments due to persistence of cancer stem cells (CSCs). The identification of reliable inducers of CSC differentiation may facilitate the development of efficient strategies for eliminating CSCs. We investigated whether interleukin 15 (IL-15), a regulator of kidney homeostasis, induces the differentiation of CD105-positive (CD105(+)) CSCs from human renal cancers.CD105(+) CSCs were cultured to preserve their stem cell properties and treated with recombinant human IL-15 (rhIL-15) to evaluate their ability to differentiate, to acquire sensitivity to chemotherapeutic drugs, and to form spheroids in vitro and tumors in vivo. Expression of stem cell and epithelial markers were studied by flow cytometry, immunocytochemistry, and immunoblotting. Identification of a CSC side population fraction and its sensitivity to chemotherapy drugs and expression of ATP-binding cassette (ABC) transporters and aldehyde dehydrogenase (ALDH) activities were determined by flow cytometry. Spheroid formation was determined in limiting dilution assay. Xenograft tumors were generated in severe combined immunodeficient mice (n = 12-18 mice per group). All statistical tests were two-sided.CD105(+) CSCs treated with rhIL-15 at 10 pg/mL differentiated into cells expressing epithelial markers. rhIL-15 induced epithelial differentiation of all CD105(+) CSCs subsets and blocked CSC self-renewal (sphere-forming ability) and their tumorigenic properties in severe combined immunodeficient mice. Vinblastine and paclitaxel induced statistically significant higher levels of apoptosis in rhIL-15-differentiated epithelial cells compared with CD105(+) CSCs (mean percentage of apoptotic cells, vinblastine: 33% vs 16.5%, difference = 16.5%, 95% confidence interval = 12.25% to 20.74%, P = .0025; paclitaxel: 35% vs 11.6%, difference = 23.4%, 95% confidence interval = 22.5% to 24.24%, P = .0015). The higher sensitivity of rhIL-15-differentiated epithelial cells to chemotherapeutic drugs was associated with loss of detoxifying mechanisms such as ALDH and ABC transporter activities.IL-15 directs the epithelial differentiation of renal CSCs and meets the criteria for a treatment strategy: CSC pool depletion and generation of differentiated nontumorigenic cells that are sensitive to chemotherapeutic agents.

The crucial issue for defining successful natural killer (NK)-based anticancer therapy is the ability of tumor cells to activate resistance mechanisms leading to escape from NK-mediated killing. It is now well established that such mechanisms are likely evolved under hypoxia in the tumor microenvironment. Here, we show that hypoxia-induced autophagy impairs breast cancer cell susceptibility to NK-mediated lysis and that this impairment is reverted by targeting autophagy. We provide evidence that activation of autophagy in hypoxic cells is involved in selective degradation of the pro-apoptotic NK-derived serine protease GZMB/granzyme B, thereby blocking NK-mediated target cell apoptosis. Our in vivo data validate the concept that targeting autophagy in cancer cells promotes tumor regression by facilitating their elimination by NK cells. This study provides a cutting-edge advance in our understanding of how hypoxia-induced autophagy impairs NK-mediated lysis and might pave the way for formulating more effective NK-based antitumor therapy by combining autophagy inhibitors.

Epithelial to mesenchymal transition (EMT) has become one of the most exciting fields in cancer biology. While its role in cancer cell invasion, metastasis and drug resistance is well established, the molecular basis of EMT-induced immune escape remains unknown. We recently reported that EMT coordinately regulates target cell recognition and sensitivity to specific lysis. In addition to the well-characterized role for EMT in tumor phenotypic change including a tumor-initiating cell phenotype, we provided evidence indicating that EMT-induced tumor cell resistance to cytotoxic T-lymphocytes (CTLs) also correlates with autophagy induction. Silencing of BECN1 in target cells that have gone through the EMT restored CTL susceptibility to CTL-induced lysis. Although EMT may represent a critical target for the development of novel immunotherapy approaches, a more detailed understanding of the inter-relationship between EMT and autophagy and their reciprocal regulation will be a key determinant in the rational approach to future tumor immunotherapy design.

Hypoxia, or gradients of hypoxia, occurs in most growing solid tumors and may result in pleotropic effects contributing significantly to tumor aggressiveness and therapy resistance. Indeed, the generated hypoxic stress has a strong impact on tumor cell biology. For example, it may contribute to increasing tumor heterogeneity, help cells gain new functional properties and/or select certain cell subpopulations, facilitating the emergence of therapeutic resistant cancer clones, including cancer stem cells coincident with tumor relapse and progression. It controls tumor immunogenicity, immune plasticity, and promotes the differentiation and expansion of immune-suppressive stromal cells. In this context, manipulation of the hypoxic microenvironment may be considered for preventing or reverting the malignant transformation. Here, we review the current knowledge on how hypoxic stress in tumor microenvironments impacts on tumor heterogeneity, plasticity and resistance, with a special interest in the impact on immune resistance and tumor immunogenicity.

Adoptive transfer of T cells gene-engineered with T cell receptors (TCRs) has proven its feasibility and therapeutic potential in the treatment of malignant tumors. To ensure further clinical development of TCR gene therapy, it is necessary to accurately select TCRs that demonstrate antigen-selective responses that are restricted to tumor cells and, at the same time, include strategies that restore or enhance the entry, migration and local accumulation of T cells in tumor tissues. Here, we present the current standing of TCR-engineered T cell therapy, discuss and propose procedures to select TCRs as well as strategies to sensitize the tumor to T cell trafficking, and provide a rationale for combination therapies with TCR-engineered T cells.

Cancer cells evolve in the tumor microenvironment which is now well established as an integral part of the tumor and a determinant player in cancer cell adaptation and resistance to anti-cancer therapies. Despite the remarkable and fairly rapid progress over the past two decades regarding our understanding of the role of the tumor microenvironment in cancer development, its precise contribution to cancer resistance is still fragmented. This is mainly related to the complexity of the "tumor ecosystem" and the diversity of the stromal cell types that constitute the tumor microenvironment. Emerging data indicate that several factors, such as hypoxic stress, activate a plethora of resistance mechanisms, including autophagy, in tumor cells. Hypoxia-induced autophagy in the tumor microenvironment also activates several tumor escape mechanisms which effectively counteract anti-tumor immune responses mediated by natural killer (NK) and cytotoxic T-lymphocytes (CTL). Therefore, strategies aiming at targeting autophagy in cancer cells in combination with other therapeutic strategies have inspired significant interest to overcome immunological tolerance and promote tumor regression. However, a number of obstacles still hamper the application of autophagy inhibitors in clinics. First, the lack of selectivity of the current pharmacological inhibitors of autophagy makes difficult to draw a clear statement about its effective contribution in cancer. Second, autophagy has been also described as an important mechanism in tumor cells involved in presentation of antigens to T cells. Third, there is circumstantial evidence that autophagy activation in some innate immune cells may support the maturation of these cells and is required for their anti-tumor activity. In this review, we will address these aspects and discuss our current knowledge on the benefits and the drawbacks of targeting autophagy in the context of anti-tumor immunity. We believe that it is important to resolve these issues in order to predict the use of autophagy inhibitors in combination with immunotherapies in clinical settings.

Tumor escape to immunosurveillance and resistance to immune attacks present a major hurdle in cancer therapy, especially in the current era of new cancer immunotherapies. We report here that hypoxia, a hallmark of most solid tumors, orchestrates carcinoma cell heterogeneity through the induction of phenotypic diversity and the acquisition of distinct epithelial–mesenchymal transition (EMT) states. Using lung adenocarcinoma cells derived from a non-metastatic patient, we demonstrated that hypoxic stress induced phenotypic diversity along the EMT spectrum, with induction of EMT transcription factors (EMT-TFs) SNAI1, SNAI2, TWIST1, and ZEB2 in a hypoxia-inducible factor-1α (HIF1A)-dependent or -independent manner. Analysis of hypoxia-exposed tumor subclones, with pronounced epithelial or mesenchymal phenotypes, revealed that mesenchymal subclones exhibited an increased propensity to resist cytotoxic T lymphocytes (CTL), and natural killer (NK) cell-mediated lysis by a mechanism involving defective immune synapse signaling. Additionally, targeting EMT-TFs, or inhibition of TGF-β signaling, attenuated mesenchymal subclone susceptibility to immune attack. Together, these findings uncover hypoxia-induced EMT and heterogeneity as a novel driving escape mechanism to lymphocyte-mediated cytotoxicity, with the potential to provide new therapeutic opportunities for cancer patients.

We report that CD47 was upregulated in different EMT-activated human breast cancer cells versus epithelial MCF7 cells. Overexpression of SNAI1 or ZEB1 in epithelial MCF7 cells activated EMT and upregulated CD47 while siRNA-mediated targeting of SNAI1 or ZEB1 in mesenchymal MDA-MB-231 cells reversed EMT and strongly decreased CD47. Mechanistically, SNAI1 and ZEB1 upregulated CD47 by binding directly to E-boxes in the human CD47 promoter. TCGA and METABRIC data sets from breast cancer patients revealed that CD47 correlated with SNAI1 and Vimentin. At functional level, different EMT-activated breast cancer cells were less efficiently phagocytosed by macrophages vs. MCF7 cells. The phagocytosis of EMT-activated cells was rescued by using CD47 blocking antibody or by genetic targeting of SNAI1, ZEB1 or CD47. These results provide a rationale for an innovative preclinical combination immunotherapy based on PD-1/PD-L1 and CD47 blockade along with EMT inhibitors in patients with highly aggressive, mesenchymal, and metastatic breast cancer.

Tumor-associated macrophages (TAMs) play an important role in cancer cell survival, however, the mechanism of which remains elusive.In this study, we found that COX-2 was abundantly expressed in breast TAMs, which was correlated to poor prognosis in breast cancer patients.Ectopic over-expression of COX-2 in TAMs enhanced breast cancer cell survival both in vitro and in vivo.COX-2 in TAMs was determined to be essential for the induction and maintenance of M2-phenotype macrophage polarity.COX-2 + TAMs promoted breast cancer cell proliferation and survival by increasing Bcl-2 and P-gp and decreasing Bax in cancer cells.Furthermore, COX-2 in TAMs induced the expression of COX-2 in breast cancer cells, which in turn promoted M2 macrophage polarization.Inhibiting PI3K/Akt pathway in cancer cells suppressed COX-2 + TAMs-induced cancer cell survival.These findings suggest that COX-2, functions as a key cancer promoting factor by triggering a positive-feedback loop between macrophages and cancer cells, which could be exploited for breast cancer prevention and therapy.

The molecular basis for the resistance of tumor cells to cell-mediated cytotoxicity remains poorly understood and thus poses a major challenge for cancer immunotherapy. The present study was designed to determine whether the WNT1-inducible signaling pathway protein 2 (WISP2, also referred to as CCN5), a key regulator of tumor cell plasticity, interferes with tumor susceptibility to cytotoxic T-lymphocyte (CTL)-mediated lysis. We found that silencing WISP2 signaling in human breast adenocarcinoma MCF7 cells impairs CTL-mediated cell killing by a mechanism involving stem cell marker Kruppel-like factor-4 (KLF-4) induction and microRNA-7 (miR-7) downregulation. Inhibition of transforming growth factor beta (TGF-β) signaling using the A83-01 inhibitor in MCF7-shWISP2 cells resulted in a significant reversal of the epithelial-to-mesenchymal-transitioned (EMT) phenotype, the expression of KLF-4 and a partial recovery of target susceptibility to CTLs. More importantly, we showed that silencing KLF-4 was accompanied by a reduction in MCF7-shWISP2 resistance to CTLs. Using human breast cancer tissues, we demonstrated the coexpression of KLF-4 with EMT markers and TGF-β pathway signaling components. More importantly, we found that KLF-4 expression was accompanied by miR-7 inhibition, which is partly responsible for impairing CTL-mediated lysis. Thus, our data indicate that WISP2 has a role in regulating tumor cell susceptibility through EMT by inducing the TGF-β signaling pathway, KLF-4 expression and miR-7 inhibition. These studies indicate for the first time that WISP2 acts as an activator of CTL-induced killing and suggests that the loss of its function promotes evasion of immunosurveillance and the ensuing progression of the tumor.

While autophagy is constitutively executed at basal level in all cells, it is activated in cancer cells in response to various microenvironmental stresses including hypoxia. It is now well established that autophagy can act both as tumor suppressor or tumor promoter. In this regard, several reports indicate that the tumor suppressor function of autophagy is associated with its ability to scavenge damaged oxidative organelles, thereby preventing the accumulation of toxic oxygen radicals and limiting the genome instability. Paradoxically, in developed tumors, autophagy can promote the survival of cancer cells and therefore operates as a cell resistance mechanism. The consensus appears to be that autophagy has a dual role in suppressing tumor initiation and in promoting the survival of established tumors. This has inspired significant interest in applying anti-autophagy therapies as an entirely new approach to cancer treatment. While much remains to be learned about the regulation and context-dependent biological role of autophagy, it is now well established that modulation of this process could be an attractive approach for the development of novel anticancer therapeutic strategies. In this review, we will summarize recent reports describing how tumor cells, by activating autophagy, manage to resist the immune cell attack. Data described in this review strongly argue that targeting autophagy may represent a conceptual realm for new immunotherapeutic strategies aiming to block the immune escape and therefore providing rational approach to future tumor immunotherapy design.

Abstract Immune resistance may arise from both genetic instability and tumor heterogeneity. Microenvironmental stresses such as hypoxia and various resistance mechanisms promote carcinoma cell plasticity. AXL, a member of the TAM (Tyro3, Axl, and Mer) receptor tyrosine kinase family, is widely expressed in human cancers and increasingly recognized for its role in cell plasticity and drug resistance. To investigate mechanisms of immune resistance, we studied multiple human lung cancer clones derived from a model of hypoxia-induced tumor plasticity that exhibited mesenchymal or epithelial features. We demonstrate that AXL expression is increased in mesenchymal lung cancer clones. Expression of AXL in the cells correlated with increased cancer cell–intrinsic resistance to both natural killer (NK)– and cytotoxic T lymphocyte (CTL)–mediated killing. A small-molecule targeting AXL sensitized mesenchymal lung cancer cells to cytotoxic lymphocyte–mediated killing. Mechanistically, we showed that attenuation of AXL-dependent immune resistance involved a molecular network comprising NF-κB activation, increased ICAM1 expression, and upregulation of ULBP1 expression coupled with MAPK inhibition. Higher ICAM1 and ULBP1 tumor expression correlated with improved patient survival in two non–small cell lung cancer (NSCLC) cohorts. These results reveal an AXL-mediated immune-escape regulatory pathway, suggest AXL as a candidate biomarker for tumor resistance to NK and CTL immunity, and support AXL targeting to optimize immune response in NSCLC.

While it is widely accepted that high intratumoral heterogeneity confers serious challenges in the emerging resistance and the subsequent effective therapeutic targeting of cancer, the underlying biology of intratumoral heterogeneity remains elusive. In particular, it remains to be fully elucidated how microenvironmental factors shape genetic and non-genetic heterogeneity, which in turn determine the course of tumor evolution and clinical progression. In this context, hypoxia, a hallmark of most growing cancers, characterized by decreased O2 partial pressure is a key player of the tumor microenvironment. Despite extensive data indicating that hypoxia promotes cellular metabolic adaptation, immune suppression and various steps of tumor progression via hypoxia regulated gene transcription, much less is known about the role of hypoxia in mediating therapy resistance as a driver of tumor evolution through genetic and non-genetic mechanisms. In this review, we will discuss recent evidence supporting a prominent role of hypoxia as a driver of tumor heterogeneity and highlight the multifaceted manner by which this in turn could impact cancer evolution, reprogramming and immune escape. Finally, we will discuss how detailed knowledge of the hypoxic footprint may open up new therapeutic avenues for the management of cancer.

Intratumoral hypoxia is a widely established element of the pancreatic tumor microenvironment (TME) promoting immune escape, tumor invasion, and progression, while contributing to treatment resistance and poor survival. Despite this critical role, hypoxia is underrepresented in molecular signatures of pancreatic ductal adenocarcinoma (PDA) and concurrent investigations into the hypoxia-immune status are lacking. In this work a literature-based approach was applied to derive an eight-gene hypoxia signature that was validated in fourteen cancer cell lines and in a cohort of PDA. The eight-gene hypoxia signature was significantly associated with overall survival in two distinct PDA datasets and showed independent prognostic value in multivariate analysis. Comparative analysis of tumors according to their hypoxia score (high versus low) determined that tumors with high hypoxia were significantly less enriched in cytotoxic T-cells, and cytolytic activity. In addition, they had lower expression of cytokines and tumor inflammatory markers, pointing to the signature's ability to discern an immune "cold", hypoxic TME. Combining the signature with an immune metric highlighted a worse survival probability in patients with high hypoxia and low immune reactivity, indicating that this approach could further refine survival estimates. Hypoxia as determined by our signature, was significantly associated with certain immune checkpoint inhibitors (ICI) biomarkers, suggesting that the signature reflects an aspect of the TME that is worth pursuing in future clinical trials. This is the first work of its kind in PDA, and our findings on the hypoxia-immune tumor contexture are not only relevant for ICI but could also guide combinatorial hypoxia-mediated therapeutic strategies in this cancer type.

Pancreatic ductal adenocarcinoma (PDAC) is the most common type of pancreatic cancer, and it is a disease of dismal prognosis. While immunotherapy has revolutionized the treatment of various solid tumors, it has achieved little success in PDAC. Hypoxia within the stroma-rich tumor microenvironment is associated with resistance to therapies and promotes angiogenesis, giving rise to a chaotic and leaky vasculature that is inefficient at shuttling oxygen and nutrients. Hypoxia and its downstream effectors have been implicated in immune resistance and could be contributing to the lack of response to immunotherapy experienced by patients with PDAC. Paradoxically, increasing evidence has shown hypoxia to augment genomic instability and mutagenesis in cancer, suggesting that hypoxic tumor cells could have increased production of neoantigens that can potentially enable their clearance by cytotoxic immune cells. Strategies aimed at relieving this condition have been on the rise, and one such approach opts for normalizing the tumor vasculature to reverse hypoxia and its downstream support of tumor pathogenesis. An important consideration for the successful implementation of such strategies in the clinic is that not all PDACs are equally hypoxic, therefore hypoxia-detection approaches should be integrated to enable optimal patient selection for achieving improved patient outcomes.

Abstract The p53 protein is accumulated in tumor cells of many human cancers and can elicit in vivo humoral and proliferative responses. Rare reports about p53-mediated tumor recognition by CTLs have remained questioned. We therefore studied a panel of breast tumor and melanoma cell lines that we assayed for the presence of accumulated p53 and surface HLA-A2 and for the presentation of p53 epitopes. From PBMC of a healthy donor, we have generated a CTL line, D5/L9V, directed against HLA-A2-restricted peptide 264–272 from wild-type p53. It efficiently lysed breast adenocarcinomas MCF-7, MCF7/RA1, and MDA-MB-231, and melanoma M8, which all accumulate the p53 protein. Using competition assays, we made sure that tumor lysis by D5/L9V was due to recognition of endogenously produced p53 peptide 264–272 associated with the HLA-A2.1 molecule on the surface of these tumor cells. Cells with undetectable levels of wild-type p53, such as lymphoblastoid cells and melanoma M74, were not recognized by D5/L9V. Neither were breast tumor cell line MCF7/ADR nor melanoma line M44 because of HLA loss. This study therefore shows that it is possible to obtain in vitro CTL lines that specifically recognize a p53 epitope spontaneously presented by a variety of HLA-A2+ transformed cell lines provided they display abnormal patterns of p53 expression. This work points out that breast tumors and melanomas share a p53 epitope, and raises hopes for future immunotherapeutic approaches.

The interference of tumor necrosis factor-α (TNF) signaling processes with the acquisition of tumor resistance to TNF was investigated using the TNF-sensitive human breast carcinoma MCF7 cell line and its established TNF-resistant variant (R-A1). The resistance of R-A1 cells to TNF correlated with a low level of p55 TNF receptor expression and an absence of TNF signaling through TNF receptors. Stable transfection of wild-type p55 receptor in R-A1 resulted in enhancement of p55 expression and in partial restoration of TNF signaling, including nuclear factor-κB (NF-κB) activation. However, the transfected cells remained resistant to TNF-induced apoptosis. Northern blot analysis revealed a comparable induction of manganous superoxide dismutase and A20 mRNA expression in p55-transfected cells and in sensitive MCF7 cells, making it unlikely that these genes are involved in the resistance to TNF-mediated cytotoxicity. While TNF significantly stimulated both neutral and acidic sphingomyelinase (SMase) activities with concomitant sphingomyelin (SM) hydrolysis and ceramide generation in MCF7, it failed to trigger these events in TNF-resistant p55-transfected cells. In addition, the basal SM content was significantly higher in sensitive MCF7 as compared to the resistant counterparts. Furthermore, the TNF-resistant cells tested could be induced to undergo cell death after exposure to exogenous SMase or cell-permeable C6-ceramide. This study also shows that TNF failed to induce arachidonic acid release in p55-transfected resistant cells, suggesting that an alteration of phospholipase A2 activation may be associated with MCF7 cell resistance to TNF. Our findings strongly suggest a role of ceramide in the mechanism of cell resistance to TNF-mediated cell death and may be relevant in elucidating the biochemical nature of intracellular messengers leading to such resistance. The interference of tumor necrosis factor-α (TNF) signaling processes with the acquisition of tumor resistance to TNF was investigated using the TNF-sensitive human breast carcinoma MCF7 cell line and its established TNF-resistant variant (R-A1). The resistance of R-A1 cells to TNF correlated with a low level of p55 TNF receptor expression and an absence of TNF signaling through TNF receptors. Stable transfection of wild-type p55 receptor in R-A1 resulted in enhancement of p55 expression and in partial restoration of TNF signaling, including nuclear factor-κB (NF-κB) activation. However, the transfected cells remained resistant to TNF-induced apoptosis. Northern blot analysis revealed a comparable induction of manganous superoxide dismutase and A20 mRNA expression in p55-transfected cells and in sensitive MCF7 cells, making it unlikely that these genes are involved in the resistance to TNF-mediated cytotoxicity. While TNF significantly stimulated both neutral and acidic sphingomyelinase (SMase) activities with concomitant sphingomyelin (SM) hydrolysis and ceramide generation in MCF7, it failed to trigger these events in TNF-resistant p55-transfected cells. In addition, the basal SM content was significantly higher in sensitive MCF7 as compared to the resistant counterparts. Furthermore, the TNF-resistant cells tested could be induced to undergo cell death after exposure to exogenous SMase or cell-permeable C6-ceramide. This study also shows that TNF failed to induce arachidonic acid release in p55-transfected resistant cells, suggesting that an alteration of phospholipase A2 activation may be associated with MCF7 cell resistance to TNF. Our findings strongly suggest a role of ceramide in the mechanism of cell resistance to TNF-mediated cell death and may be relevant in elucidating the biochemical nature of intracellular messengers leading to such resistance.

The production of interleukin 12 (IL-12) following allogeneic stimulation and its involvement in the differentiation of allospecific cytotoxic T lymphocytes (CTLs) have been investigated. Supernatants of mixed lymphocyte cultures had detectable levels of IL-12 p40 which were completely abrogated after depletion of responder cells from monocytes. While addition to the culture of anti-IL-12 neutralizing antibodies partially inhibited the allogeneic proliferative response and the subsequent CTL activity, addition of IL-12 stimulated both responses, suggesting that endogenously produced IL-12 plays a role in the development of alloreactivity. Furthermore, using primary mixed cultures of lymphocytes from major histocompatibility complex-recombinant siblings identical for class II antigens and displaying class I disparity, we demonstrated that addition of recombinant IL-12 at the sensitizing phase of the primary mixed lymphocyte culture induced CTL activity. Under these stimulation conditions, addition of recombinant IL-12 also triggered cell proliferation, indicating that IL-12 provides both growth and differentiation signals. The mechanism underlying this process does not appear to require IL-2, since IL-12-mediated CTL generation was not abrogated by anti-IL-2 alpha-chain antibodies. IL-12 increased granzyme B and perforin mRNA accumulation in major histocompatibility complex class I-primed lymphocytes, suggesting that this cytokine activates these two genes in CTL precursors. We conclude that IL-12 can stimulate the generation of alloreactive CTLs. We suggest that IL-12 may play a role in helper cell-independent CTL generation.

Previous studies have shown that cytokine-dependent eosinophils undergo apoptosis, yet the mechanisms governing this phenomenon remain obscure. Fas antigen is a transmembrane glycoprotein belonging to the tumor necrosis factor receptor family. Cross-linking of Fas antigen in numerous cell types leads to apoptosis. In the present study, we examined the potential role of Fas antigen in the apoptosis of purified blood eosinophils from healthy donors. Cytokine-deprived eosinophils exhibited a time-dependent loss in viability, accompanied by an increase in the number of apoptotic nuclei and in the expression of Fas antigen and its mRNA, as shown by flow cytometry and reverse transcriptase-polymerase chain reaction, respectively. Cross-linking of Fas antigen with an agonistic anti-Fas monoclonal antibody (MoAb) induced a dose- and time-dependent increase in the number of apoptotic nuclei. Furthermore, using an in vitro coculture system, we showed engulfment of anti-Fas MoAb-treated eosinophils by monocyte-derived macrophages. Finally, incubation of eosinophils with the corticosteroid, dexamethasone, induced apoptosis and augmented that triggered by anti-Fas MoAb. Together, these observations suggest that Fas antigen expression and activation is involved in the apoptosis of human eosinophils and may contribute to the resolution of inflammatory allergic reactions in which eosinophil accumulation is a prominent feature.

We have previously described two cytotoxic T lymphocyte clones isolated from lymphocytes infiltrating a human major histocompatibility complex class II–/class I+, CD4+ cutaneous T cell lymphoma. These clones displayed a CD4+CD8dim+ (TC5) and CD4+ CD8– (TC7) phenotype and mediated a specific major histocompatibility complex class I-restricted cytotoxic activity toward Cou-LB autologous tumor cell line. Our studies were performed to elucidate the mechanism involved in T-cell-clone-mediated cytotoxicity and to determine the cytokine profile of both the lymphoma cell line and specific cytotoxic T lymphocyte clones. The results indicate that, despite surface expression of Fas receptor on Cou-LB and Fas ligand induction on TC5 and TC7 cell membranes, the CD4+ cytotoxic T lymphocyte clones do not use this cytotoxic mechanism to lyse their specific target. The TC7 clone uses instead a granzyme–perforin-dependent pathway. Furthermore, quantitative analysis of Th1 and Th2 cytokine mRNA expression in the cutaneous T cell lymphoma cell line as well as in TC5 and TC7 clones indicated that, whereas the tumor cells display a Th2-type profile (interleukin-4, interleukin-6, and interleukin-10), the cytotoxic T lymphocyte clones express Th1-type cytokines (interferon-γ, granulocyte macrophage colony stimulating factor, and interleukin-2). In addition, preincubation of the tumor-infiltrating lymphocyte clones with autologous tumor cells induced their activation and subsequent amplification of the Th1-type response. These results indicate a direct contribution of the malignant cells in the Th1/Th2 imbalance observed frequently in cutaneous T cell lymphoma patients and suggest their potential role in depressed cell-mediated immunity. Identification of CD4+ Th1-type cytotoxic T lymphocyte clones, the tumor antigen they recognize, and optimization of their cytokine expression profile should be useful for the design of new immunotherapy protocols in cutaneous T cell lymphoma. We have previously described two cytotoxic T lymphocyte clones isolated from lymphocytes infiltrating a human major histocompatibility complex class II–/class I+, CD4+ cutaneous T cell lymphoma. These clones displayed a CD4+CD8dim+ (TC5) and CD4+ CD8– (TC7) phenotype and mediated a specific major histocompatibility complex class I-restricted cytotoxic activity toward Cou-LB autologous tumor cell line. Our studies were performed to elucidate the mechanism involved in T-cell-clone-mediated cytotoxicity and to determine the cytokine profile of both the lymphoma cell line and specific cytotoxic T lymphocyte clones. The results indicate that, despite surface expression of Fas receptor on Cou-LB and Fas ligand induction on TC5 and TC7 cell membranes, the CD4+ cytotoxic T lymphocyte clones do not use this cytotoxic mechanism to lyse their specific target. The TC7 clone uses instead a granzyme–perforin-dependent pathway. Furthermore, quantitative analysis of Th1 and Th2 cytokine mRNA expression in the cutaneous T cell lymphoma cell line as well as in TC5 and TC7 clones indicated that, whereas the tumor cells display a Th2-type profile (interleukin-4, interleukin-6, and interleukin-10), the cytotoxic T lymphocyte clones express Th1-type cytokines (interferon-γ, granulocyte macrophage colony stimulating factor, and interleukin-2). In addition, preincubation of the tumor-infiltrating lymphocyte clones with autologous tumor cells induced their activation and subsequent amplification of the Th1-type response. These results indicate a direct contribution of the malignant cells in the Th1/Th2 imbalance observed frequently in cutaneous T cell lymphoma patients and suggest their potential role in depressed cell-mediated immunity. Identification of CD4+ Th1-type cytotoxic T lymphocyte clones, the tumor antigen they recognize, and optimization of their cytokine expression profile should be useful for the design of new immunotherapy protocols in cutaneous T cell lymphoma. cytotoxic T lymphocyte Fas ligand tumor growth factor 1 tumor infiltrating lymphocyte Cutaneous T cell lymphomas (CTCLs) are a heterogeneous group of lymphoproliferative diseases with skin-homing properties (Willemze et al., 1997Willemze R. Kerl H. Sterry W. et al.EORTC classification for primary cutaneous lymphomas: a proposal from the Cutaneous Lymphoma Study Group of the European Organization for Research and Treatment of Cancer.Blood. 1997; 90: 354-371PubMed Google Scholar). Mycosis fungoides is characterized by skin invasion of clonally derived malignant CD4+ T lymphocytes that resemble phenotypically mature T helper cells. Sezary syndrome is a leukemic form of CTCL characterized by erythroderma and invasion of patient peripheral blood by the malignant T cell population. It has been reported that skin lesions in CTCL contain heterogeneous cell infiltrates, including tumor cells and reactive non-neoplastic T cells with CD4+ and CD8+ lymphocytes (Wood et al., 1994Wood G.S. Ediner A. Hoppe R.T. Warnke R.A. Mycosis fungoides skin lesions contain CD8+ tumor-infiltrating lymphocytes expressing an activated, MHC-restricted cytotoxic T-lymphocyte phenotype.J Cutan Pathol. 1994; 21: 151-165Crossref PubMed Scopus (50) Google Scholar). Therefore, CTCL represents a unique tumor model where both the neoplastic and the reactive cells are T lymphocytes. Previous studies have demonstrated that skin biopsies of patients with different stages of CTCL express variable levels of Th1- and Th2-type cytokines (Saed et al., 1994Saed G. Fivenson D.P. Naidu Y. Nickoloff B.J. Mycosis fungoides exhibits a Th1-type cell-mediated cytokine profile whereas Sezary syndrome expresses a Th2-type profile.J Invest Dermatol. 1994; 103: 29-33Abstract Full Text PDF PubMed Google Scholar;Vowels et al., 1994Vowels B.R. Lessin S.R. Cassin M. Jaworsky C. Benoit B. Wolfe J.T. Rook A.H. Th2 cytokine mRNA expression in skin in cutaneous T-cell lymphoma.J Invest Dermatol. 1994; 103: 669-673Crossref PubMed Scopus (208) Google Scholar). Sezary skin and blood specimens were found to express a Th2-type cytokine mRNA pattern, with increased production of interleukin-4 (IL-4), IL-5, and IL-10, and deficient production of IL-2, IL-12, and interferon-γ (IFN-γ) (Vowels et al., 1992Vowels B.R. Cassin M. Vonderheid E.C. Rook A.H. Aberrant cytokine production by Sezary syndrome patients; cytokine secretion pattern resembles murine Th2 cells.J Invest Dermatol. 1992; 99: 90-94Crossref PubMed Scopus (212) Google Scholar;Saed et al., 1994Saed G. Fivenson D.P. Naidu Y. Nickoloff B.J. Mycosis fungoides exhibits a Th1-type cell-mediated cytokine profile whereas Sezary syndrome expresses a Th2-type profile.J Invest Dermatol. 1994; 103: 29-33Abstract Full Text PDF PubMed Google Scholar;Rook et al., 1997Rook A.H. Gottlieb S.L. Wolfe J.T. et al.Pathogenesis of cutaneous T-cell lymphoma: implications for the use of recombinant cytokines and photopheresis.Clin Exp Immunol. 1997; 107: 16-20PubMed Google Scholar). Furthermore, clonal T lymphocytes isolated from the blood of patients with Sezary syndrome were described to display a Th2-type cytokine production pattern (Dummer et al., 1996Dummer R. Heald P.W. Nestle F.O. Ludwig E. Laine E. Hemmi S. Burg G. Sezary syndrome T-cell clones display T-helper 2 cytokines and express the accessory factor-1 (interferon-gamma receptor beta-chain).Blood. 1996; 88: 1383-1389PubMed Google Scholar). Sezary syndrome with a Th1 cytokine profile, however, has also been reported (Yagi et al., 1996Yagi H. Tokura Y. Furukawa F. Takigawa M. CD7-positive Sezary syndrome with a Th1 cytokine profile.J Am Acad Dermatol. 1996; 34: 368-374Abstract Full Text PDF PubMed Google Scholar). It should be noted that most of these studies were performed on a mixture of reactive and neoplastic T cells, particularly when studies were performed on skin lesions. Thus, the contributions of the reactive and the malignant T cells in the observed Th2 cytokine pattern are not clearly determined. Furthermore, the interactions of tumor-infiltrating lymphocyte (TIL) effector cells and tumor T cells as well as the mechanisms underlying the cytotoxic T lymphocyte (CTL) lysis of the CTCL tumor remain to be determined. These issues are of great interest for the development of specific cellular immune therapy for CTCL. We have previously isolated, from lymphocytes infiltrating a CTCL, two CD4+ CTL clones (TC5 and TC7) recognizing the autologous tumor cells in a major histocompatibility complex (MHC) class I restricted manner (Bagot et al., 1998Bagot M. Echchakir H. Mami-Chouaib F. et al.Isolation of tumor-specific cytokine CD4+ and CD4+CD8dim+ T-cell clones infiltrating a cutaneous T-cell lymphoma.Blood. 1998; 91: 4331-4341PubMed Google Scholar). To further study the interactions of these peculiar effector T lymphocytes and the specific tumor cells, we have investigated the mechanisms underlying specific CTL clone lysis and the cytokine profile of both malignant and reactive T lymphocyte populations. Our results indicate that the cytotoxic activity of TC5 and TC7 does not involve tumor necrosis factor (TNF)/TNF receptor (TNF-R) and Fas (CD95, Apo-1)/Fas ligand (FasL) pathways and that TC7 instead uses a granzyme–perforin-dependent pathway. In addition, while the tumor cells produced a Th2-type cytokine profile (IL-4, IL-6, and IL-10), both CTL clones expressed a Th1 cytokine profile [IL-2, granulocyte macrophage colony stimulating factor (GM-CSF) and IFN-γ] as well as tumor growth factor 1 (TGF-β1). Cou was an 82-y-old man with a mycosis fungoides initially presenting as disseminated infiltrated patches and plaques with no extra-cutaneous involvement (T2N0M0, Ib). At a 5 y follow-up, this mycosis fungoides had evolved into a pleomorphic large T cell lymphoma presenting as disseminated cutaneous tumors and 30% atypical lymphocytes in the peripheral blood (T3N3M1, IVb,Lamberg et al., 1984Lamberg S.I. Green S.B. Byar D.P. et al.Clinical staging for cutaneous T-cell lymphoma.Ann Intern Med. 1984; 100: 187-192Crossref PubMed Scopus (93) Google Scholar). Cou-LB [T cell receptor (TCR) Vβ13+] was established in vitro from Cou patient peripheral blood as described previously (Bagot et al., 1998Bagot M. Echchakir H. Mami-Chouaib F. et al.Isolation of tumor-specific cytokine CD4+ and CD4+CD8dim+ T-cell clones infiltrating a cutaneous T-cell lymphoma.Blood. 1998; 91: 4331-4341PubMed Google Scholar). TC5 and TC7 were isolated from TILs and cultured in the presence of IL-2 and IL-7 (Bagot et al., 1998Bagot M. Echchakir H. Mami-Chouaib F. et al.Isolation of tumor-specific cytokine CD4+ and CD4+CD8dim+ T-cell clones infiltrating a cutaneous T-cell lymphoma.Blood. 1998; 91: 4331-4341PubMed Google Scholar). Anti-TNF-R MoAbs (htr-9 and utr-1) were generously provided by Dr. M. Brokhaus (Hoffman-La Roche, Basel, Switzerland). CH-11 (anti-Fas apoptosis inducing IgM MoAb), UB2 (anti-Fas, IgG MoAb used for cell surface staining), ZB4 (anti-Fas apoptosis blocking IgG MoAb), and 4H9 (anti-FasL) were provided from Immunotech (Marseille, France). Indirect immunofluorescence analysis was performed by incubating 3 × 105 cells with each MoAb (at 10 μg per ml) for 30 min at 4°C. Cells were then washed three times with phosphate-buffered saline (PBS) supplemented with 1% bovine serum albumin (BSA) and incubated with biotinylated affinity-purified goat antimouse IgG for an additional 30 min at 4°C. After three washings, cells were resuspended in 50 μl of streptavidin–phycoerythrin solution for 30 min at 4°C. Cells were then extensively washed before flow cytometric analysis using an EPICS profile II Coulter (Coultronics, Margency, France). FasL expression was performed on CTL clones activated for 2 h in the presence of Cou-LB cells or phorbol 12β-myristate 13α-acetate (PMA; Sigma Biochemicals, St. Quentin, France) and Ca2+ ionophore (ionomycin; Calbiochem, La Jolla, CA) as described previously (Mami-Chouaib et al., 1996Mami-Chouaib F. Flament C. Asselin-Paturel C. Gaudin C. Chouaib S. TCR alpha/beta and TCR gamma/delta CD4–/CD8– HLA-DR alloreactive CTL clones do not use Fas/Fas ligand pathway to lyse their specific target cells.Hum Immunol. 1996; 51: 13-22Crossref PubMed Scopus (10) Google Scholar). Cytotoxic assays were performed according to a standard 51Cr-release method. Target cells were labeled with 100 μCi sodium chromate (51Cr; Amersham, France) for 1 h at 37°C, washed twice in Dulbecco's modified Eagle's medium supplemented with 10% fetal bovine serum, and then incubated at 37°C for 2 h to minimize spontaneous release. After a final wash, labeled cells were aliquoted at 2000 cells per well in 96 well U-bottomed microtiter plates in the presence of TC5 and TC7 effector cells. After incubation for 4 h at 37°C in 5% CO2 incubator, supernatants were assayed for radioactivity using a γ-counter. Percent specific cytotoxicity was calculated conventionally; SD <5%. The functional effect of the antibodies on target cells (anti-Fas neutralizing ZB4 MoAb, NKTa control MoAb) was tested by preincubating them for 1 h at 37°C before the assay at the predetermined saturat- ing concentration. Ethyleneglycol-bis(β-aminoethyl ether)-N,N,N′,N′-tetraacetic acid (EGTA) (4 mM) and MgCl2 (3 mM) added during the assay were used to inhibit the Ca2+-dependent perforin–granzyme-mediated lysis. K562 (derived from a patient with chronic myelogenous leukemia), E418 (an Epstein–Barr-transformed B cell line;Mami-Chouaib et al., 1990Mami-Chouaib F. Miossec C. Del Porto P. Flament C. Triebel F. Hercend T. T.C.T. 1, a novel target molecule for human non-MHC restricted T lymphocytes.J Exp Med. 1990; 172: 1071-1082Crossref PubMed Scopus (29) Google Scholar), Jurkat (TCR-α/β leukemia), CEM (T lymphoblastoid line obtained from a patient with acute lymphoblastoid leukemia), and P815 (mouse DBA/2 mastocytoma) were used as targets in cytotoxicity assays. Cell viability to TNF was determined using crystal violet staining as previously described (Zyad et al., 1994Zyad A. Benard J. Tursz T. Clarke R. Chouaib S. Resistance to TNF-alpha and adriamycin in the human breast cancer MCF-7 cell line: relationship to MDR1, MnSOD, and TNF gene expression.Cancer Res. 1994; 54: 825-831PubMed Google Scholar). Briefly, cells were seeded in flat-bottomed 96 well plates (7500 cells per well) and human recombinant TNF-α was added. After 72 h incubation at 37°C, the medium was replaced with 100 μl of 0.5% crystal violet solution. After 10 min incubation at room temperature, the plates were washed and viable crystal-violet-stained cells were lysed with 1% sodium dodecyl sulfate solution. The absorbance, which is proportional to cell viability, was measured at 540 nm. Total RNA was extracted from the Cou-LB tumor cell line and the TC5 and TC7 T cell clones by an RNA-zol method (bioprobe system, Montreuil sous Bois, France) and reverse transcribed using a cDNA synthesis kit (Boehringer Mannheim, Meylan, France). cDNA was amplified by PCR as follows: 94°C for 90 s (94°C for 15 s, 55°C for 30 s, and 72°C for 50 s) for 25 cycles for β-actin or 30 cycles for FasL, perforin and granzyme B on a Perkin Elmer/Cetus DNA thermocycler. After amplification, PCR products were separated by electrophoresis on 1.5% agarose gel containing ethidium bromide and visualized under ultraviolet light illumination. Primer pairs used for the amplification of actin, IL-4, IL-6, IL-10, and IFN-γ cDNA have been described previously (Carayol et al., 1997Carayol G. Bourhis J.H. Guillard M. et al.Quantitative analysis of T helper 1, T helper 2, and inflammatory cytokine expression in patients after allogeneic bone marrow transplantation: relationship with the occurrence of acute graft-versus-host disease.Transplantation. 1997; 63: 1307-1313Crossref PubMed Scopus (32) Google Scholar). GM-CSF and TGF-β1 primers have been described previously (Asselin-Paturel et al., 1998Asselin-Paturel C. Echchakir H. Carayol G. et al.Quantitative analysis of Th1, Th2 and TGF-beta1 cytokine expression in tumor, TIL and PBL of non-small cell lung cancer patients.Int J Cancer. 1998; 77 (10.1002/(sici)1097-0215(19980703)77:1&#60;7::aid-ijc2>3.0.co;2-y\): 7-12Crossref PubMed Scopus (133) Google Scholar). For IL-2 cDNA amplification, the 5′ primer was TAGAAGAAGAAC TCAAACCTCTG and the 3′ primer GTGAAACCATTTTAGAGCCCCT; for FasL the 5′ primer was ATAGGATCCATGTTTCTGCTCTTCCACCTACAGAAGGA and the 3′ primer ATAGAATTCTGACCAAGAGAGAGCTCAGATAC-GTTGAC; for perforin the 5′ primer was CGGCTCACACTCACAGG and the 3′ primer CTGCCGT-GGATGCCTATG; for granzyme B the 5′ primer was GGGGA-AGCTCCATAAATGTCACCT and the 3′ primer TACACACAAGAGGGCCCCCAGAGT. To quantify the cytokine transcripts expressed in the tumor cell line and the T cell clones, a previously described methodology was used (Carayol et al., 1997Carayol G. Bourhis J.H. Guillard M. et al.Quantitative analysis of T helper 1, T helper 2, and inflammatory cytokine expression in patients after allogeneic bone marrow transplantation: relationship with the occurrence of acute graft-versus-host disease.Transplantation. 1997; 63: 1307-1313Crossref PubMed Scopus (32) Google Scholar). Briefly, a constant amount of cDNA corresponding to the reverse transcription of 50 ng of total RNA was mixed with 108, 107, 106, 105, 104, 103, 102, or 10 copies of the cytokine standard cDNA and then amplified to saturation (40 cycles) in 15 μl final volume. Aliquots (2 μl) of amplified material were copied in a one cycle runoff reaction (10 μl) primed with Fam fluorescent-labeled oligonucleotide specific for each cytokine gene. Runoff products were then subjected to electrophoresis on an ABI sequencer (Applied Biosystems, Foster City, CA). The software was devised to measure, for each detected DNA peak, both its length and its area. The ratio of the standard and wild type cDNA peaks provides a measurement of the ratios of the two initial molecular species, from which the number of cDNA copies in the sample can be calculated. The concentration of cDNA present in the original sample was obtained by determining the equivalent concentration of internal standard (Carayol et al., 1997Carayol G. Bourhis J.H. Guillard M. et al.Quantitative analysis of T helper 1, T helper 2, and inflammatory cytokine expression in patients after allogeneic bone marrow transplantation: relationship with the occurrence of acute graft-versus-host disease.Transplantation. 1997; 63: 1307-1313Crossref PubMed Scopus (32) Google Scholar). Elispot assay was performed as described previously (Schmittel et al., 1997Schmittel A. Keilholz U. Scheibenbogen C. Evaluation of the interferon-gamma ELISPOT-assay for quantification of peptide specific T lymphocytes from peripheral blood.J Immunol Methods. 1997; 210: 167-174Crossref PubMed Scopus (123) Google Scholar). Briefly, 96 well nitrocellulose-backed microtiter plates (Millipore, Vaucresson, France) were coated with 50 μl of mouse antihuman IFN-γ MoAb (4 mg per ml; Genzyme, Germany) and incubated overnight at 4°C. Wells were then washed with PBS and incubated with 200 μl of RPMI-1640 supplemented with 10% human AB serum for 2 h at 37°C. T cell clones were then added to the wells in triplicate at 2 × 105 cells per well in the presence or absence of irradiated Cou-LB T cell line (2 × 104 cells per well) and 100 U per ml of IL-2. Blocking experiments were performed in the presence of W6/32, anti-class I, MoAb at 30 μg per ml. After 24 h incubation at 37°C, plates were washed three times with PBS 0.05%, Tween 20 and wells were incubated overnight at 4°C with 100 μl of rabbit antihuman IFN-γ polyclonal antibodies (IP-500, 1:250 dilution; Genzyme, Germany). Plates were then washed with PBS, and 100 μl of alkaline phosphatase conjugate substrate (Bio-rad Laboratories, CA) were added. After 30 min incubation, the substrate solution was discarded and plates were washed under running water and air dried. Colored spots were counted using a dissecting microscope. TC5 and TC7 T cell clones were isolated from lymphocytes infiltrating a human MHC class II– T cell lymphoma (Bagot et al., 1998Bagot M. Echchakir H. Mami-Chouaib F. et al.Isolation of tumor-specific cytokine CD4+ and CD4+CD8dim+ T-cell clones infiltrating a cutaneous T-cell lymphoma.Blood. 1998; 91: 4331-4341PubMed Google Scholar). They displayed a CD4+CD8dim+ (TC5) and CD4+CD8– (TC7) phenotype and mediated a specific MHC class I restricted cytotoxic activity (Bagot et al., 1998Bagot M. Echchakir H. Mami-Chouaib F. et al.Isolation of tumor-specific cytokine CD4+ and CD4+CD8dim+ T-cell clones infiltrating a cutaneous T-cell lymphoma.Blood. 1998; 91: 4331-4341PubMed Google Scholar) toward the autologous tumor cell line, Cou-LB, established from patient peripheral blood (Figure 1a). This cytotoxicity was inhibited by anti-CD3 (OKT3; data not shown) and anti-class I (W6/32) MoAbs but not by anti-CD4 (OKT4) and anti-CD8 (OKT8) MoAbs (Bagot et al., 1998Bagot M. Echchakir H. Mami-Chouaib F. et al.Isolation of tumor-specific cytokine CD4+ and CD4+CD8dim+ T-cell clones infiltrating a cutaneous T-cell lymphoma.Blood. 1998; 91: 4331-4341PubMed Google Scholar). TC5 and TC7 clones were unable to kill K562, the Fas-sensitive Jurkat cell line (Figure 1a) and the murine Fas– mastocytoma cell line P815 (Figure 1b). In contrast, both CTL clones kill P815 in the presence of anti-CD3 (OKT3) MoAb, indicating that they are able to mediate a high redirected cytotoxic activity in the absence of Fas expression on target cells (Bensussan et al., 1994Bensussan A. Gluckman E. el Marsafy S. et al.BY55 monoclonal antibody delineates within human cord blood and bone marrow lymphocytes distinct cell subsets mediating cytokine activity.Proc Natl Acad Sci USA. 1994; 91: 9136-9140Crossref PubMed Scopus (49) Google Scholar). Immunofluorescence analysis, performed to further characterize Cou-LB tumor cells, indicated that they surface expressed Fas as well as p55 and p75 TNF-R (Figure 2a). A significant FasL expression was also observed on the tumor cell membrane (data not shown). To determine whether Cou-LB lymphoma cell line was sensitive to Fas- and TNF-mediated cytotoxicity, cells were incubated in the presence of anti-Fas IgM MoAbs (CH11) or recombinant TNF (50 ng per ml). As shown in Figure 2(b), the tumor cell line was sensitive to Fas-induced (left panel) but not to TNF-induced (right panel) lysis, indicating that the Fas/FasL alternative cytotoxic pathway was functional and that the T cell lymphoma was resistant to TNF. CTL clones use two distinct mechanisms to kill target cells, the calcium-dependent, perforin–granzyme-mediated pathway and the calcium-independent Fas/FasL-mediated pathway. Initial immuno-fluorescence experiments were performed to analyse FasL expression on TC5 and TC7. Both CTL clones were found to surface express FasL, following stimulation with Cou-LB autologous tumor cells or in the presence of PMA+ ionomycin (Figure 3a and data not shown). RT-PCR analyses, undertaken with the use of specific primer pairs, confirmed FasL expression in the CTL clones and, as expected from functional studies presented in Figure 1(b), revealed intense bands corresponding to perforin and granzyme B mRNA expression (Figure 3b). In order to determine the mechanisms implicated in TC5 and TC7 CD4+ T cell clone-mediated lysis toward autologous tumor cells, cytotoxic experiments were performed in the presence of anti-Fas IgG-1 blocking MoAbs (ZB4) or MgCl2 and EGTA. No inhibition of TC5 and TC7 cytotoxicity was observed when target cells were preincubated with ZB4 MoAbs (Figure 4a). In contrast, EGTA blocked TC7-mediated lysis toward Cou-LB tumor cells. A slight inhibition was observed when TC5 was used as effector cells (Figure 4a). The control experiment indicated that soluble FasL (sFasL) induced a high lysis of Cou-LB target which was blocked in the presence of ZB4 MoAb, confirming its inhibitory potential (Figure 4b). These results indicate that despite FasL expression on TC5 and TC7 and Fas on Cou-LB cells, this cytotoxic pathway is not implicated in CTL clone lysis of autologous target. Therefore, TC7 clone most probably uses a perforin–granzyme-mediated cytotoxic pathway. The basis of cellular and molecular cross-talk between tumor cells and immune cells remains a crucial issue for an effective use of cytokines in the biotherapy of cancer. Immunosuppression at the tumor site appears to be one of the major obstacles in cancer immunotherapy. Therefore, identifying the factor secreted by lymphoma T cells in order to overcome such immunosuppression may be of great interest. For this purpose, we have investigated, using a highly sensitive quantitative RT-PCR analysis (Carayol et al., 1997Carayol G. Bourhis J.H. Guillard M. et al.Quantitative analysis of T helper 1, T helper 2, and inflammatory cytokine expression in patients after allogeneic bone marrow transplantation: relationship with the occurrence of acute graft-versus-host disease.Transplantation. 1997; 63: 1307-1313Crossref PubMed Scopus (32) Google Scholar), both Th1, Th2 and TGF-β1 cytokine mRNA expression in Cou-LB T cell lymphoma. This tumor cell line was found to express IL-4, IL-6, IL-10, and TGF-β1 mRNA (Table 1). TGF-β1 protein expression was also observed in Cou-LB before and after stimulation with PMA (36 pg per ml versus 400 pg per ml in supernatant from 106 cells per ml cultured for 24 h). In contrast, no IFN-γ, IL-2, and GM-CSF mRNA was detected. These results indicate that Cou-LB lymphoma possesses a Th2-type cytokine pattern.Table IQuantification of cytokine mRNA by RT-PCR aTh cytokine mRNA pattern in Cou-LB tumor cell line and CTL clones before and after coculture, at 1:1 ratio, with the autologous tumor cells for 12 h and removal of Cou-LB cells using an anti-TCRVβ13-specific MoAb and magnetic beads. Cytokine mRNA expression was measured by quantitative PCR (see Materials and Methods). Results are expressed as copy numbers of cytokine transcripts, determined with a fragment size analysis software after migration of the PCR products on a DNA sequencer (Applied Biosystems).Th1Th2IL-2IFN-γGM-CSFIL-4IL-6IL-10TGF-β1Cou-LB<10<101010002,3706092,000TC52307,120340<10ND<10527,000TC766061,480350<1010<10832,000TC5+Cou-LB3,13071,1502,310270ND907,440,000TC7+Cou-LB1,100320,0001,39020ND406,600,000a Th cytokine mRNA pattern in Cou-LB tumor cell line and CTL clones before and after coculture, at 1:1 ratio, with the autologous tumor cells for 12 h and removal of Cou-LB cells using an anti-TCRVβ13-specific MoAb and magnetic beads. Cytokine mRNA expression was measured by quantitative PCR (see Materials and Methods). Results are expressed as copy numbers of cytokine transcripts, determined with a fragment size analysis software after migration of the PCR products on a DNA sequencer (Applied Biosystems). Open table in a new tab To investigate whether TC5 and TC7 express a Th1- or a Th2-type cytokine and whether the tumor cells may alter their lymphokine secretion profile, we have investigated IL-2, IFN-γ, GM-CSF, IL-4, IL-6, IL-10, as well as TGF-β1 mRNA expression in TIL clones before or after coculture with Cou-LB cells. In contrast with the tumor cell line, no Th2-type cytokine mRNA (i.e. IL-4, IL-6, and IL-10) was detected in the two CTL clones (Table 1). mRNA encoding for IL-2, IFN-γ, and GM-CSF, however, was expressed in both clones with a high expression level of IFN-γ in TC7 clone (Table 1). Surprisingly, a high copy number of TGF-β1 mRNA was expressed in both clones. We then tested IFN-γ protein secretion in the supernatant of TC5 clone cultured at 106 cells per ml in the absence or presence of Cou-LB. Our results indicated a significant enhancement of IFN-γ production when the T cell clone was cocultured with the autologous tumor cells (1.5 pg per ml versus 75 pg per ml). As expected from RT-PCR analysis no IFN-γ protein was detected in the supernatant of the Cou-LB cell line. To determine whether tumor cells may activate CTL clones and induce an alteration of their cytokine expression profile, we incubated TC5 and TC7 in the presence of Cou-LB for 12 h, and Th1 and Th2 cytokine mRNA expression was determined after removal of tumor cells with anti-TCRVβ13 MoAb and magnetic beads. Table 1 shows that CTL clone activation with specific tumor target enhances IFN-γ, GM-CSF, and IL-2 expression levels. A dramatic increase in TGF-β1 mRNA expression was also detected in both CTL clones. In contrast, a weak increase in IL-4 and IL-10 mRNA expression was observed following stimulation with autologous tumor cells (Table 1). Activation of TC5 and TC7 lymphocytes by specific target was confirmed by Elispot analysis demonstrating an increase in IFN-γ spot number following preincubation of the CTL clones with Cou-LB (Figure 5). This IFN-γ secretion was inhibited by W6/32 anti-class I MoAbs in a similar manner as described previously in cytotoxic activity experiments (Bagot et al., 1998Bagot M. Echchakir H. Mami-Chouaib F. et al.Isolation of tumor-specific cytokine CD4+ and CD4+CD8dim+ T-cell clones infiltrating a cutaneous T-cell lymphoma.Blood. 1998; 91: 4331-4341PubMed Google Scholar). These results indicate that the MHC class I restricted CTL clones express a Th1-type cytokine mRNA profile with an expression level sensitively increased in the presence of the specific Th2-type autologous T cell lymphoma. TC5 (CD4+CD8dim+) and TC7 (CD4+) CTL clones mediate a specific cytotoxic activity toward an autologous MHC class II–/class+, CD4+ CTCL (Bagot et al., 1998Bagot M. Echchakir H. Mami-Chouaib F. et al.Isolation of tumor-specific cytokine CD4+ and CD4+CD8dim+ T-cell clones infiltrating a cutaneous T-cell lymphoma.Blood. 1998; 91: 4331-4341PubMed Google Scholar). In this study we investigated the cytotoxic mechanisms involved in autologous tumor cell lysis by the two CD4+ TIL clones. We showed that, despite Cou-LB surface expression of p55 and p75 TNF-R, the tumor cell line was resistant to TNF-induced l

To elucidate further the potential of a Semliki Forest virus (SFV) vector in vivo for gene therapy, we constructed a vector, SFV-IL12, to transfer murine IL-12 genes into tumors. A single intratumoral injection of established B16 murine melanoma with SFV-IL12 resulted in a significant inhibition of tumor growth, while injection with SFV-LacZ had no effect. This antitumoral activity correlated with an increase of IFNγ production, MIG and IP-10 mRNA expression, both at the tumor site and at the periphery. In contrast, no increase in CTL- or NK cell-mediated cytotoxic response could be detected, ruling out the involvement of T and NK cell cytotoxicity. To determine how the transfer of IL-12 genes induced tumor regression, the antiangiogenicactivity of SFV-IL12 was investigated using Doppler ultrasonography (DUS). SFV-IL12 inhibited in situ neovascularization within the tumor, without affecting the resistance index of pre-existing intratumoral blood flows. In addition, histological analysis of SFV-IL12-treated tumors showed massive tumor necrosis induced by SFV-IL12 treatment. These data indicate that SFV-IL12 inhibits tumor growth through its antiangiogenic activity, demonstrated for the first time in vivo by DUS, and suggest that the SFV vector may be a novel valuable tool in tumor gene transfer.

In the present study, we investigated the differentiation of human NK cells from bone marrow, cord blood and mobilized peripheral blood purified CD34+ stem cells using a potent culture system. Elutriated CD34+ stem cells were grown for several weeks in medium supplemented with stem cell factor (SCF) and IL-15 in the presence or absence of a murine stromal cell line (MS-5). Our data indicate that IL-15 induced the proliferation and maturation of highly positive CD56+ NK cells in both types of culture, although murine stromal cells slightly increased the proliferation of NK cells. NK cells differentiated in the presence of MS-5 were mostly CD56+ CD7− and a small subset expressed CD16. These in vitro differentiated CD56+ NK cells displayed cytolytic activity against the HLA class I − target K562. The CD56+ CD16+ subset also lysed NK-resistant Daudi cells. Neither of these NK subsets were shown to express Fas ligand. Total CD56+ cells expressed high amounts of transforming growth factor-β and granulocyte-macrophage colony-stimulating factor, but no IFN-γ. Investigation of NK receptor expression showed that most CD56+ cells expressed membrane CD94 and NKG2-A mRNA. PCR analysis revealed that p58 was also expressed in these cells. The role of CD94 in NK cell-mediated cytotoxicity was assessed on human HLA-B7-transfected murine L cells. While a low cytotoxic activity towards HLA-B7 cells was observed, the HLA-DR4 control cells were killed with high efficiency. These studies demonstrate that cytolytic and cytokine-producing NK cells may be derived from adult and fetal precursors by IL-15 and that these cells express a CD94 receptor which may influence their lytic potential.

We have investigated the inhibitory potential of prostaglandin E2 (PGE2) with respect to intracellular messengers implicated in the signaling system of T-lymphocyte activation pathway. Using the fluorescent indicator Quin 2, it is demonstrated that PGE2 inhibits the increase in cytosolic-free calcium concentration [Ca2+]i. Reconstitution of calcium mobilization in the presence of PGE2 by the calcium ionophore A23187 results in a partial restoration of both interleukin 2 (IL2) production and cell proliferation and has no effect on the inhibition of transferrin receptor expression. In contrast, the treatment of cell cultures with the tumor promotor 12.0 tetra decanoyl phorbol-13-acetate (TPA) abrogates the suppressor activity of PGE2. When T lymphocyte stimulation is provided by the combination of A23187 and TPA, the PGE2 inhibitory effect does not occur. These data also indicate that the down regulation of transferrin receptor by PGE2 is proximal to protein kinase C activation and is not associated with decreased expression of the functional IL2 receptor.

Large granular lymphocytes (LGL) can be activated by interleukin 2 (IL-2) to lymphokine-activated killers (LAK). The effect of tumor necrosis factor (TNF) on LAK generation was investigated. TNF was found to act synergistically with low concentrations of IL-2 (0.10-0.25 ng/ml), which were ineffective by themselves in inducing LAK activity, to promote the differentiation of LGL into non-major histocompatibility complex-restricted killers. When IL-2 was used at concentrations optimal for LAK generation, TNF did not further enhance this phenomenon. Specific binding of 125I-labeled TNF to LGL was increased by IL-2 stimulation. Scatchard analysis of TNF binding revealed the existence of two classes of binding sites with markedly different affinities (Kd values of 57 and 600 pM). We also demonstrated that the IL-2/TNF synergistic induction of LAK activity did not involve either IL-1 or interferon-gamma. This IL-2/TNF synergistic effect was blocked by anti-Tac antibodies. Immunofluorescence analysis revealed that IL-2/TNF selectively up-regulated Tac antigen expression on LAK precursors. Our results suggest a functional interaction between IL-2 and TNF on LAK precursors, which results in a reduction of the IL-2 concentration required for differentiation of LGL into LAK killers.

We have reported previously that the interaction of alpha(E)(CD103)beta(7) integrin, expressed on a CD8(+) tumor-infiltrating lymphocyte (TIL) clone but not on a peripheral blood lymphocyte (PBL) counterpart, with the epithelial marker E-cadherin on human lung tumor cells plays a crucial role in T-cell receptor-mediated cytotoxicity. We show here that both TIL and PBL clones are able to migrate toward autologous tumor cells and that chemokine receptor CCR5 is involved in this process. Adoptive transfer of the PBL clone in the cognate tumor engrafted in nonobese diabetic/severe combined immunodeficient mice and subsequent coengagement of T-cell receptor and transforming growth factor-beta1 receptor triggers CD103 expression on T-cell surface resulting in strong potentiation of antitumor lytic function. Moreover, interaction of alpha(E)beta(7) integrin with E-cadherin, but not lymphocyte function-associated antigen-1 with intercellular adhesion molecule-1, promotes CCR5 recruitment at the immunologic synapse formed between TIL and tumor cells, leading to inhibition of T-cell sensitivity to CCL5 chemotactic gradient. These results provide evidence for a role of tumor microenvironment, namely MHC class I-restricted antigen presentation and transforming growth factor-beta1 secretion, in regulating the effector phase of tumor-specific CTL response. They also suggest a unique role of CD103 in T-cell retention at the tumor site by a CCR5-dependent mechanism.

We identified an antigen recognized on a human non-small-cell lung carcinoma by a cytotoxic T lymphocyte clone derived from autologous tumor-infiltrating lymphocytes. The antigenic peptide is presented by HLA-A2 and is encoded by the CALCA gene, which codes for calcitonin and for the alpha-calcitonin gene-related peptide. The peptide is derived from the carboxy-terminal region of the preprocalcitonin signal peptide and is processed independently of proteasomes and the transporter associated with antigen processing. Processing occurs within the endoplasmic reticulum of all tumoral and normal cells tested, including dendritic cells, and it involves signal peptidase and the aspartic protease, signal peptide peptidase. The CALCA gene is overexpressed in medullary thyroid carcinomas and in several lung carcinomas compared with normal tissues, leading to recognition by the T cell clone. This new epitope is, therefore, a promising candidate for cancer immunotherapy.

Hypoxia is a major feature of the solid tumor microenvironment and is known to be associated with tumor progression and poor clinical outcome. Recently, we reported that hypoxia protects human non-small cell lung tumor cells from specific lysis by stabilizing hypoxia-inducible factor-1α and inducing STAT3 phosphorylation. In this study, we show that NANOG, a transcription factor associated with stem cell self renewal, is a new mediator of hypoxia-induced resistance to specific lysis. Our data indicate that under hypoxic conditions, NANOG is induced at both transcriptional and translational levels. Knockdown of the NANOG gene in hypoxic tumor cells is able to significantly attenuate hypoxia-induced tumor resistance to CTL-dependent killing. Such knockdown correlates with an increase of target cell death and an inhibition of hypoxia-induced delay of DNA replication in these cells. Interestingly, NANOG depletion results in inhibition of STAT3 phosphorylation and nuclear translocation. To our knowledge, this study is the first to show that hypoxia-induced NANOG plays a critical role in tumor cell response to hypoxia and promotes tumor cell resistance to Ag-specific lysis.

Hypoxia influences immune checkpoint receptors and their respective ligands. In support, we recently demonstrated that hypoxia selectively upregulates programmed cell death ligand 1 (PD-L1) on myeloid-derived suppressor cells (MDSCs) via hypoxia inducible factor 1 α (HIF-1α) binding to a hypoxia-response element (HRE) in the PD-L1 proximal promoter. Furthermore, blockade of PD-L1 under hypoxic conditions enhanced MDSC-mediated T-cell activation by attenuating MDSC secretion of IL-6 and IL-10.

A major challenge in formulating an effective immunotherapy is to overcome the mechanisms of tumor escape from immunosurveillance. We showed that hypoxia-induced autophagy impairs cytotoxic T-lymphocyte (CTL)-mediated tumor cell lysis by regulating phospho-STAT3 in target cells. Autophagy inhibition in hypoxic cells decreases phospho-STAT3 and restores CTL-mediated tumor cell killing by a mechanism involving the ubiquitin proteasome system and SQSTM1/p62. Simultaneously boosting the CTL-response, using a TRP-peptide vaccination strategy, and targeting autophagy in hypoxic tumors, improves the efficacy of cancer vaccines and promotes tumor regression in vivo. Overall, in addition to its immunosuppressive effect, the hypoxic microenvironment also contributes to immunoresistance and can be detrimental to antitumor effector cell functions.

Angiogenesis is essential for tumour growth and metastasis. There are conflicting reports as to whether microvessel density (MVD) using the endothelial marker CD105 (cluster of differentiation molecule 105) in clear-cell renal cell carcinomas (ccRCC) is associated with prognosis. Recently, CD105 has been described as a RCC cancer stem cell marker. A total of 102 ccRCC were analysed. Representative tumour sections were stained for CD105. Vascularity (endothelial CD105) was quantified by MVD. The immunohistochemistry analysis detected positive (if present) or negative (if absent) CD105 tumoral staining. This retrospective population-based study was evaluated using Kaplan–Meier method, t-test and Cox proportional hazard model. We found that the expression of endothelial CD105 (MVD) negatively correlated with nuclear grade (P<0.001), tumour stage (P<0.001) and Leibovitch score (P<0.001), whereas the expression of tumoral CD105 positively correlated with these three clinicopathological factors (P<0.001). In multivariate analysis, tumoral CD105 was found to be an independent predictor of poor overall survival (P=0.002). We have shown for the first time that tumoral CD105 is an independent predictive marker for death risk and unfavourable prognosis in patients with ccRCC after curative resection.

Accumulating evidence indicate that the behavior of tumorigenic cells is highly influenced by their microenvironment. In this regard, microenvironmental hypoxia plays a determinant role in the emergence of CTC (circulating tumor cells) and CSC (cancer stem cells). CTCs are believed to be indicators of residual disease and thus pose an increased risk of metastasis. In spite of being rare and exposed to immune attack, these cells are capable to escape the immune system of the host. Although CTC play a pivotal role in the metastatic cascade and their prognostic impact has been repeatedly demonstrated, little is known about their escape mechanisms to immune system of the host. Therefore a better knowledge of the immunogenicity of these cells and their cross talk with immune killer cells as well as with tumor microenvironment may represent an exciting new immunotherapy opportunity. In this chapter, we will discuss how hypoxia is involved in the regulation of tumor progression and induction of EMT and cancer stem cell like features. We will also illustrate the relationship between hypoxia and CTC and review how CTC interact with the cells of immune system (both innate and adaptive) in terms of their survival and EMT phenotype. We will attempt to outline how hypoxic stress may confer resistance to CTC by giving them EMT and CSC like phenotype. Finally we will discuss whether the inhibition of hypoxic signaling pathways in different compartments of the solid tumor microenvironment will have an impact on CTC number, resistant phenotype and CTC lysis by immune effectors.

Cytarabine (cytosine arabinoside) is one of the most effective drugs for the treatment of patients diagnosed with acute myeloid leukemia (AML). Despite its efficiency against AML cells, the emergence of drug resistance due to prolonged chemotherapy in most patients is still a major obstacle. Several studies have shown that drug resistance mechanisms alter the sensitivity of leukemia cells to immune system effector cells. To investigate this phenomenon, parental acute myeloid cell lines, HL-60 and KG-1, were continuously exposed to increasing doses of cytarabine in order to establish equivalent resistant cell lines, HL-60(R) and KG-1(R). Our data indicate that cytarabine-resistant cells are more susceptible to natural killer (NK)-mediated cell lysis as compared with parental cytarabine-sensitive cells. The increased susceptibility correlates with the induction of UL-16 binding proteins (ULBP) 1/2/3 and NK group 2, member D (NKG2D) ligands on target cells by a mechanism involving c-Myc induction. More importantly, chromatin immunoprecipitation assay revealed that ULBP1/3 are direct targets of c-Myc. Using drug-resistant primary AML blasts as target cells, inhibition of c-Myc resulted in decreased expression of NKG2D ligands and the subsequent impairment of NK cell lysis. This study provides for the first time, the c-Myc dependent regulation of NKG2D ligands in AML.

Since tumor cell plasticity was first shown to be crucial in tumor promotion and immune surveillance evasion, it has become an issue of intense investigation. Several mechanisms are associated with the acquisition of tumor cell plasticity and immune evasion, including loss of epithelial phenotype through epithelial-to-mesenchymal transition (EMT). We discuss recent evidence revealing that tumor cell plasticity may lead to the emergence of immunoresistant variants and how the tumor microenvironment evolves to shape this plasticity. We argue that targeting carcinoma cell plasticity represents a novel strategy to better control the emergence of resistant variants and to ensure more effective cancer therapies. In this context, the design of innovative integrative immunotherapy approaches is warranted.

Clear cell renal cell carcinoma (ccRCC) is an aggressive tumor that is characterized in most cases by inactivation of the tumor suppressor gene VHL. The VHL/HIF/VEGF pathway thus plays a major role in angiogenesis and is currently targeted by anti-angiogenic therapy. The emergence of resistance is leading to the use of targeted immunotherapy against immune checkpoint PD1/PDL1 that restores antitumor immune response. The correlation between VHL status and PD-L1 expression has been little investigated. In this study, we retrospectively reviewed 98 consecutive cases of ccRCC and correlated PD-L1 expression by immunohistochemistry (IHC) with clinical data (up to 10-year follow-up), pathological criteria, VEGF, PAR-3, CAIX and PD-1 expressions by IHC and complete VHL status (deletion, mutation and promoter hypermethylation). PD-L1 expression was observed in 69 ccRCC (70.4%) and the corresponding patients had a worse prognosis, with a median specific survival of 52 months (p = 0.03). PD-L1 expression was significantly associated with poor prognostic factors such as a higher ISUP nucleolar grade (p = 0.01), metastases at diagnosis (p = 0.01), a sarcomatoid component (p = 0.04), overexpression of VEGF (p = 0.006), and cytoplasmic PAR-3 expression (p = 0.01). PD-L1 expression was also associated with dense PD-1 expression (p = 0.007) and with ccRCC with 0 or 1 alteration(s) (non-inactivated VHL tumors; p = 0.007) that remained significant after multivariate analysis (p = 0.004 and p = 0.024, respectively). Interestingly, all wild-type VHL tumors (no VHL gene alteration, 11.2%) expressed PD-L1. In this study, we found PD-L1 expression to be associated with noninactivated VHL tumors and in particular wild-type VHL ccRCC, which may benefit from therapies inhibiting PD-L1/PD-1.