Robert Ehehalt

Formation of senile plaques containing the beta-amyloid peptide (A beta) derived from the amyloid precursor protein (APP) is an invariant feature of Alzheimer's disease (AD). APP is cleaved either by beta-secretase or by alpha-secretase to initiate amyloidogenic (release of A beta) or nonamyloidogenic processing of APP, respectively. A key to understanding AD is to unravel how access of these enzymes to APP is regulated. Here, we demonstrate that lipid rafts are critically involved in regulating A beta generation. Reducing cholesterol levels in N2a cells decreased A beta production. APP and the beta-site APP cleavage enzyme (BACE1) could be induced to copatch at the plasma membrane upon cross-linking with antibodies and to segregate away from nonraft markers. Antibody cross-linking dramatically increased production of A beta in a cholesterol-dependent manner. A beta generation was dependent on endocytosis and was reduced after expression of the dynamin mutant K44A and the Rab5 GTPase-activating protein, RN-tre. This inhibition could be overcome by antibody cross-linking. These observations suggest the existence of two APP pools. Although APP inside raft clusters seems to be cleaved by beta-secretase, APP outside rafts undergoes cleavage by alpha-secretase. Thus, access of alpha- and beta-secretase to APP, and therefore A beta generation, may be determined by dynamic interactions of APP with lipid rafts.

The management of patients with IBD requires evaluation with objective tools, both at the time of diagnosis and throughout the course of the disease, to determine the location, extension, activity and severity of inflammatory lesions, as well as, the potential existence of complications. Whereas endoscopy is a well-established and uniformly performed diagnostic examination, the implementation of radiologic techniques for assessment of IBD is still heterogeneous; variations in technical aspects and the degrees of experience and preferences exist across countries in Europe. ECCO and ESGAR scientific societies jointly elaborated a consensus to establish standards for imaging in IBD using magnetic resonance imaging, computed tomography, ultrasonography, and including also other radiologic procedures such as conventional radiology or nuclear medicine examinations for different clinical situations that include general principles, upper GI tract, colon and rectum, perineum, liver and biliary tract, emergency situation, and the postoperative setting. The statements and general recommendations of this consensus are based on the highest level of evidence available, but significant gaps remain in certain areas such as the comparison of diagnostic accuracy between different techniques, the value for therapeutic monitoring, and the prognostic implications of particular findings.

Lipid rafts are dynamic assemblies of proteins and lipids that float freely within the liquid-disordered bilayer of cellular membranes but can also cluster to form larger, ordered platforms.Rafts are receiving increasing attention as devices that regulate membrane function in eukaryotic cells.In this Perspective, we briefly summarize the structure and regulation of lipid rafts before turning to their evident medical importance.Here, we will give some examples of how rafts contribute to our understanding of the pathogenesis of different diseases.For more information on rafts, the interested reader is referred to recent reviews (1, 2). Composition of lipid raftsLipid rafts have changed our view of membrane organization.Rafts are small platforms, composed of sphingolipids and cholesterol in the outer exoplasmic leaflet, connected to phospholipids and cholesterol in the inner cytoplasmic leaflet of the lipid bilayer.These assemblies are fluid but more ordered and tightly packed than the surrounding bilayer.The difference in packing is due to the saturation of the hydrocarbon chains in raft sphingolipids and phospholipids as compared with the unsaturated state of fatty acids of phospholipids in the liquid-disordered phase (3).Thus, the presence of liquid-ordered microdomains in cells transforms the classical membrane fluid mosaic model of Singer and Nicholson into a more complex system, where proteins and lipid rafts diffuse laterally within a two-dimensional liquid.Membrane proteins are assigned to three categories: those that are mainly found in the rafts, those that are present in the liquid-disordered phase, and those that represent an intermediate state, moving in and out of rafts.Constitutive raft residents include glycophos-phatidylinositol-anchored (GPI-anchored) proteins; doubly acylated proteins, such as tyrosine kinases of the Src family, Gα subunits of heterotrimeric G proteins, and endothelial nitric oxide synthase (eNOS); cholesterol-linked and palmitate-anchored proteins like Hedgehog (see Jeong and McMahon, this Perspective series, ref. 4); and transmembrane proteins, particularly palmitoylated proteins such as influenza virus hemagglutinin and β-secretase (BACE) (1).Some membrane proteins are regulated raft residents and have a weak affinity for rafts in the unliganded state.After binding to a ligand, they undergo a conformational change and/or become oligomerized.When proteins oligomerize, they increase their raft affinity (5).A peripheral membrane protein, such as a nonreceptor tyrosine kinase, can be reversibly palmitoylated and can lose its raft association after depalmitoylation (6).By these means, the partitioning of proteins in and out of rafts can be tightly regulated. Cholesterol and raft biogenesisCholesterol is thought to serve as a spacer between the hydrocarbon chains of the sphingolipids and to function as a dynamic glue that keeps the raft assembly together (1).Cholesterol partitions between the raft and the nonraft phase, having higher affinity to raft sphingolipids than to unsaturated phospholipids.Removal of raft cholesterol leads to dissociation of most proteins from rafts and renders them nonfunctional.Association with detergent-resistant membranes (DRMs) is a useful criterion to estimate whether a protein associates with lipid rafts (2).After solubilization of membranes or cells with Triton X-100 or with CHAPS at 4°C, raft-associated lipids and proteins remain insoluble and can then be floated to low density by sucrose gradient centrifugation.If cholesterol is extracted by methyl-β-cyclodextrin or complexed by saponin, the raft proteins usually, but not always, become detergent-soluble.Lipid rafts are first assembled in the Golgi complex in mammalian cells (3).Cholesterol is synthesized in the endoplasmic reticulum (ER), as is ceramide, the hydrophobic backbone of sphingolipids.However, most of the sphingolipid head groups are attached to ceramide in the Golgi complex, where raft assembly takes place (7).There is an increasing concentration of cholesterol and sphingolipids from the ER to the plas-

<h3>Background & Aims</h3> Most patients with Crohn's disease (CD) eventually require an intestinal resection. However, CD frequently recurs after resection. We performed a randomized trial to compare the ability of infliximab vs placebo to prevent CD recurrence. <h3>Methods</h3> We evaluated the efficacy of infliximab in preventing postoperative recurrence of CD in 297 patients at 104 sites worldwide from November 2010 through May 2012. All study patients had undergone ileocolonic resection within 45 days before randomization. Patients were randomly assigned (1:1) to groups given infliximab (5 mg/kg) or placebo every 8 weeks for 200 weeks. The primary end point was clinical recurrence, defined as a composite outcome consisting of a CD Activity Index score >200 and a ≥70-point increase from baseline, and endoscopic recurrence (Rutgeerts score ≥i2, determined by a central reader) or development of a new or re-draining fistula or abscess, before or at week 76. Endoscopic recurrence was a major secondary end point. <h3>Results</h3> A smaller proportion of patients in the infliximab group had a clinical recurrence before or at week 76 compared with the placebo group, but this difference was not statistically significant (12.9% vs 20.0%; absolute risk reduction [ARR] with infliximab, 7.1%; 95% confidence interval: −1.3% to 15.5%; <i>P</i> = .097). A significantly smaller proportion of patients in the infliximab group had endoscopic recurrence compared with the placebo group (30.6% vs 60.0%; ARR with infliximab, 29.4%; 95% confidence interval: 18.6% to 40.2%; <i>P</i> < .001). Additionally, a significantly smaller proportion of patients in the infliximab group had endoscopic recurrence based only on Rutgeerts scores ≥i2 (22.4% vs 51.3%; ARR with infliximab, 28.9%; 95% confidence interval: 18.4% to 39.4%; <i>P</i> < .001). Patients previously treated with anti-tumor necrosis factor agents or those with more than 1 resection were at greater risk for clinical recurrence. The safety profile of infliximab was similar to that from previous reports. <h3>Conclusions</h3> Infliximab is not superior to placebo in preventing clinical recurrence after CD-related resection. However, infliximab does reduce endoscopic recurrence. ClinicalTrials.gov ID NCT01190839.

Objective Cancer cells in the body release soluble and membranous factors that manipulate the tumor environment to facilitate growth and survival. Recent years have provided evidence that small microvesicles that are termed exosomes may play a pivotal role in this process. Exosomes are membrane vesicles with a size of 40–100 nm that are released by both tumor and normal cells and can be found in various body fluids. Tumor-derived exosomes carry functional proteins, mRNAs, and miRNAs and could serve as novel platform for tumor diagnosis and prognosis. However, marker proteins that allow enrichment of tumor-derived exosomes over normal exosomes are less well defined. Methods We used Western blot analysis and antibody coupled magnetic beads to characterize CD24 and EpCAM as markers for exosomes. We investigated ovarian carcinoma ascites, pleural effusions and serum of breast carcinoma patients. As non-tumor derived control we used exosomes from ascites of liver cirrhosis patients. Results Exosomes could be isolated from all body fluids and contained marker proteins as well as miRNAs. We observed that CD24 and EpCAM were selectively present on ascites exosomes of tumor patients and copurified together on anti-EpCAM or anti-CD24 magnetic beads. In breast cancer patients CD24 was present but EpCAM was absent from serum exosomes. Instead, the intact EpCAM ectodomain was recovered in a soluble form. We provide evidence that EpCAM can be cleaved from exosomes via serum metalloproteinase(s). Conclusion Loss of EpCAM on serum exosomes may hamper enrichment by immune-affinity isolation. We suggest that CD24 could be an additional marker for the enrichment of tumor-derived exosomes from blood.

<h3>Background & Aims</h3> We performed a multicenter study to determine whether transabdominal bowel wall ultrasonography, a noninvasive procedure that does not require radiation, can be used to monitor progression of Crohn's disease (CD). <h3>Methods</h3> We performed a 12-month prospective, noninterventional study at 47 sites in Germany, from December 2010 through September 2014. Our study included 234 adult patients with CD who experienced a flare, defined as Harvey-Bradshaw index score of ≥7. All patients received treatment intensification, most with tumor necrosis factor antagonists. Ultrasound parameters and clinical data were assessed at baseline and then after 3, 6, and 12 months. The primary endpoint was the change in ultrasound parameters within 12 months of study enrollment. <h3>Results</h3> All patients included had bowel wall alterations either within the terminal ileum and/or segments of the colon. After 3 and 12 months, ultrasonographic examination showed significant improvements of nearly all ultrasound parameters, including reductions in bowel wall thickening or stratification, decreased fibrofatty proliferation, and increased signals in color Doppler ultrasound (<i>P</i> < .01 for all parameters at months 3 and 12). Median Harvey-Bradshaw index scores decreased from 10 at baseline to 2 after 12 months. Improvement in bowel wall thickness correlated with reduced levels of C-reactive protein after 3 months (<i>P</i> ≤ .001). <h3>Conclusions</h3> In a multicenter prospective study, we found that ultrasonographic examination can be used to monitor disease activity in patients with active CD. Bowel ultrasonography seems to be an ideal follow-up method to evaluate early transmural changes in disease activity, in response to medical treatment. German Clinical Trials Register: drks.de/DRKS00010805.

Etrolizumab is a gut-targeted, anti-β7 integrin, monoclonal antibody. In an earlier phase 2 induction study, etrolizumab significantly improved clinical remission compared with placebo in patients with moderately to severely active ulcerative colitis. We aimed to evaluate the efficacy and safety of etrolizumab in patients with moderately to severely active ulcerative colitis who had been previously treated with anti-tumour necrosis factor (TNF) agents.HICKORY was a multicentre, phase 3, double-blind, placebo-controlled study in adult (18-80 years) patients with moderately to severely active ulcerative colitis (Mayo Clinic total score [MCS] of 6-12 with an endoscopic subscore of ≥2, a rectal bleeding subscore of ≥1, and a stool frequency subscore of ≥1) previously treated with TNF inhibitors. Patients were recruited from 184 treatment centres across 24 countries in North America, South America, Europe, Asia, Oceania, and the Middle East. Patients needed to have an established diagnosis of ulcerative colitis for at least 3 months, corroborated by both clinical and endoscopic evidence, and evidence of disease extending at least 20 cm from the anal verge. In cohort 1, patients received open-label etrolizumab 105 mg every 4 weeks for a 14-week induction period. In cohort 2, patients were randomly assigned (4:1) to receive subcutaneous etrolizumab 105 mg or placebo every 4 weeks for the 14-week induction phase. Patients in either cohort achieving clinical response to etrolizumab induction were eligible for the maintenance phase, in which they were randomly assigned (1:1) to receive subcutaneous etrolizumab 105 mg or placebo every 4 weeks through to week 66. Randomisation was stratified by baseline concomitant treatment with corticosteroids, concomitant treatment with immunosuppressants (induction randomisation only), baseline disease activity, week 14 MCS remission status (maintenance randomisation only), and induction cohort (maintenance randomisation only). All patients and study site personnel were masked to treatment assignment. Primary endpoints were remission (Mayo Clinic total score [MCS] ≤2, with individual subscores of ≤1 and a rectal bleeding subscore of 0) at week 14, and remission at week 66 among patients with a clinical response (MCS with ≥3-point decrease and ≥30% reduction from baseline, plus ≥1 point decrease in rectal bleeding subscore or absolute rectal bleeding score of 0 or 1) at week 14. Efficacy was analysed using a modified intent-to-treat population. Safety analyses included all patients who received at least one dose of study drug during the induction phase. This study is registered at ClinicalTrials.gov, NCT02100696.HICKORY was conducted from May 21, 2014, to April 16, 2020, during which time 1081 patients were screened, and 609 deemed eligible for inclusion. 130 patients were included in cohort 1. In cohort 2,479 patients were randomly assigned to the induction phase (etrolizumab n=384, placebo n=95). 232 patients were randomly assigned to the maintenance phase (etrolizumab to etrolizumab n=117, etrolizumab to placebo n=115). At week 14, 71 (18·5%) of 384 patients in the etrolizumab group and six (6·3%) of 95 patients in the placebo group achieved the primary induction endpoint of remission (p=0·0033). No significant difference between etrolizumab and placebo was observed for the primary maintenance endpoint of remission at week 66 among patients with a clinical response at week 14 (27 [24·1%] of 112 vs 23 [20·2%] of 114; p=0·50). Four patients in the etrolizumab group reported treatment-related adverse events leading to treatment discontinuation. The proportion of patients reporting at least adverse event was similar between treatment groups for induction (etrolizumab 253 [66%] of 384; placebo 63 [66%] of 95) and maintenance (etrolizumab to etrolizumab 98 [88%] of 112; etrolizumab to placebo 97 [85%] of 114). The most common adverse event in both groups was ulcerative colitis flare. Most adverse events were mild or moderate. During induction, the most common serious adverse event was ulcerative colitis flare (etrolizumab ten [3%] of 384; placebo: two [2%] of 95). During maintenance, the most common serious adverse event in the etrolizumab to etrolizumab group was appendicitis (two [2%] of 112) and the most common serious adverse events in the etrolizumab to placebo group were ulcerative colitis flare (two [2%] of 114) and anaemia (two [2%] of 114).HICKORY demonstrated that a significantly higher proportion of patients with moderately to severely active ulcerative colitis who had been previously treated with anti-TNF agent were able to achieve remission at week 14 when treated with etrolizumab compared with placebo; however, there was no significant difference between groups in remission at week 66 among patients with a clinical response at week 14.F Hoffmann-La Roche.

Schlüsselwörter extraintestinale Manifestation - intraepitheliale Neoplasie - intestinale Komplikation - Immunsuppressiva - Primäre Sklerosierende Cholangitis

The β-secretase, BACE, is a membrane spanning aspartic protease, which cleaves the amyloid precursor protein (APP) in the first step of proteolytic processing leading to the formation of the neurotoxic β-amyloid peptide (Aβ). Previous results have suggested that the regulation of β-secretase and BACE access to APP is lipid dependent, and involves lipid rafts. Using the baculovirus expression system, we have expressed recombinant human full-length BACE in insect cells and purified milligram amounts to homogeneity. We have studied partitioning of fluorophor-conjugated BACE between the liquid ordered and disordered phases in giant (10–150 μm) unilamellar vesicles, and found ∼20% to associate with the raft-like, liquid-ordered phase; the fraction associated with liquid-ordered phase increased upon cross-linking of raft lipids. To examine involvement of individual lipid species in modulating BACE activity, we have reconstituted the purified BACE in large (∼100 nm) unilamellar vesicles, and determined its specific activity in vesicles of various lipid compositions. We have identified 3 groups of lipids that stimulate proteolytic activity of BACE: 1) neutral glycosphingolipids (cerebrosides), 2) anionic glycerophospholipids, and 3) sterols (cholesterol).

We recently showed that mucus from patients with ulcerative colitis, a chronic inflammatory disorder of the colon, is characterized by a low level of phosphatidylcholine (PC) while clinical studies reveal that therapeutic addition of PC using slow release preparations is beneficial. The positive role of PC in this disease is still elusive. Here we tested the hypothesis that exogenous application of PC has anti-inflammatory properties using three model systems. First, human Caco-2 cells were treated with tumor necrosis factor-α (TNF-α) to induce a pro-inflammatory response via activation of NF-κB. Second, latex bead phagosomes were analyzed for their ability to assemble actin <i>in vitro</i>, a process linked to pro-inflammatory signaling and correlating with the growth <i>versus</i> killing of mycobacteria in macrophages. The third system used was the rapid assembly of plasma membrane actin in macrophages in response to sphingosine 1-phosphate. TNF-α induced a pro-inflammatory response in Caco-2 cells, including 1) assembly of plasma membrane actin; 2) activation of both MAPKs ERK and p38; 3) transport of NF-κB subunits to the nucleus; and 4) subsequent up-regulation of the synthesis of pro-inflammatory gene products. Exogenous addition of most PCs tested significantly inhibited these processes. Other phospholipids like sphingomyelin or phosphatidylethanolamine showed no effects in these assays. PC also inhibited latex bead phagosome actin assembly, the killing of <i>Mycobacterium tuberculosis</i> in macrophages, and the sphingosine 1-phosphate-induced actin assembly in macrophages. TNF-α induces the activation of signaling molecules and the reorganization of the actin cytoskeleton in human intestinal cells. Exogenous application of PC blocks pro-inflammatory signaling in Caco-2 cells, in phagosomes <i>in vitro</i> and facilitates intracellular survival of <i>mycobacteria</i>. We provide further evidence that actin assembly by membranes is part of the pro-inflammatory response. Collectively, these results provide a molecular foundation for the clinical studies showing a beneficial effect of PC therapy in ulcerative colitis.

Long-chain fatty acids are important metabolites for the generation of energy and the biosynthesis of lipids. The molecular mechanism of their cellular uptake has remained controversial. The fatty acid transport protein (FATP) family has been named according to its proposed function in mediating this process at the plasma membrane. Here, we show that FATP4 is in fact localized to the endoplasmic reticulum and not the plasma membrane as reported previously. Quantitative analysis confirms the positive correlation between expression of FATP4 and uptake of fatty acids. However, this is dependent on the enzymatic activity of FATP4, catalyzing the esterification of fatty acids with CoA. Monitoring fatty acid uptake at the single-cell level demonstrates that the ER localization of FATP4 is sufficient to drive transport of fatty acids. Expression of a mitochondrial acyl-CoA synthetase also enhances fatty acid uptake, suggesting a general relevance for this mechanism. Our results imply that cellular uptake of fatty acids can be regulated by intracellular acyl-CoA synthetases. We propose that the enzyme FATP4 drives fatty acid uptake indirectly by esterification. It is not a transporter protein involved in fatty acid translocation at the plasma membrane.

We previously reported that lipid rafts are involved in long-chain fatty acid (LCFA) uptake in 3T3-L1 adipocytes. The present data show that LCFA uptake does not depend on caveolae endocytosis because expression of a dominant negative mutant of dynamin had no effect on uptake of [3H]oleic acid, whereas it effectively prevented endocytosis of cholera toxin. Isolation of detergent-resistant membranes (DRMs) from 3T3-L1 cell homogenates revealed that FAT/CD36 was expressed in both DRMs and detergent-soluble membranes (DSMs), whereas FATP1 and FATP4 were present only in DSMs but not DRMs. Disruption of lipid rafts by cyclodextrin and specific inhibition of FAT/CD36 by sulfo-N-succinimidyl oleate (SSO) significantly decreased uptake of [3H]oleic acid, but simultaneous treatment had no additional or synergistic effects, suggesting that both treatments target the same mechanism. Indeed, subcellular fractionation demonstrated that plasma membrane fatty acid translocase (FAT/CD36) is exclusively located in lipid rafts, whereas intracellular FAT/CD36 cofractionated with DSMs. Binding assays confirmed that [3H]SSO predominantly binds to FAT/CD36 within plasma membrane DRMs. In conclusion, our data strongly suggest that FAT/CD36 mediates raft-dependent LCFA uptake. Plasma membrane lipid rafts might control LCFA uptake by regulating surface availability of FAT/CD36.

Phospholipids are essential for the normal function of the intestinal mucus barrier. The objective of this study was to systematically investigate phospholipids in the intestinal mucus of humans suffering from inflammatory bowel diseases, where a barrier defect is strongly supposed to be pathogenetic.Optimal mucus recovery was first validated in healthy mice and the method was then transferred to the endoscopic acquisition of ileal and colonic mucus from 21 patients with ulcerative colitis (UC), 10 patients with Crohn's disease (CD), and 29 healthy controls. Nano-electrospray ionization tandem mass spectrometry (ESI-MS/MS) was used to determine phosphatidylcholine (PC), lysophosphatidylcholine (LPC), and sphingomyelin (SM) in lipid extracts of mucus specimens.Human and rodent mucus contained very similar phospholipid species. In the ileal and colonic mucus from patients suffering from UC, the concentration of PC was highly significantly lower (607 +/- 147 pmol/100 microg protein and 745 +/- 148 pmol/100 microg protein) compared to that of patients with CD (3223 +/- 1519 pmol/100 microg protein and 2450 +/- 431 pmol/100 microg protein) and to controls (3870 +/- 760 pmol/100 microg protein and 2790 +/- 354 pmol/100 microg protein); overall, P = 0.0002 for ileal specimens and P < 0.0001 for colonic specimens. Independent of disease activity, patients suffering from UC showed an increased saturation grade of PC fatty acid residues and a higher LPC-to-PC ratio.The intestinal mucus barrier of patients with UC is significantly altered concerning its phospholipid concentration and species composition. These alterations may be very important for the pathogenesis of this disease and underline new therapeutic strategies.

Cytosolic lipid droplets (LDs) are storage organelles for neutral lipids derived from endogenous metabolism. Acyl-CoA synthetase family proteins are essential enzymes in this biosynthetic pathway, contributing activated fatty acids. Fluorescence microscopy showed that ACSL3 is localized to the endoplasmic reticulum (ER) and LDs, with the distribution dependent on the cell type and the supply of fatty acids. The N-terminus of ACSL3 was necessary and sufficient for targeting reporter proteins correctly, as demonstrated by subcellular fractionation and confocal microscopy. The N-terminal region of ACSL3 was also found to be functionally required for the enzyme activity. Selective permeabilization and in silico analysis suggest that ACSL3 assumes a hairpin membrane topology, with the N-terminal hydrophobic amino acids forming an amphipathic helix restricted to the cytosolic leaflet of the ER membrane. ACSL3 was effectively translocated from the ER to nascent LDs when neutral lipid synthesis was stimulated by the external addition of fatty acids. Cellular fatty acid uptake was increased by overexpression and reduced by RNA interference of ACSL3. In conclusion, the structural organization of ACSL3 allows the fast and efficient movement from the ER to emerging LDs. ACSL3 not only esterifies fatty acids with CoA but is also involved in the cellular uptake of fatty acids, presumably indirectly by metabolic trapping. The unique localization of the acyl-CoA synthetase ACSL3 on LDs suggests a function in the local synthesis of lipids. Cytosolic lipid droplets (LDs) are storage organelles for neutral lipids derived from endogenous metabolism. Acyl-CoA synthetase family proteins are essential enzymes in this biosynthetic pathway, contributing activated fatty acids. Fluorescence microscopy showed that ACSL3 is localized to the endoplasmic reticulum (ER) and LDs, with the distribution dependent on the cell type and the supply of fatty acids. The N-terminus of ACSL3 was necessary and sufficient for targeting reporter proteins correctly, as demonstrated by subcellular fractionation and confocal microscopy. The N-terminal region of ACSL3 was also found to be functionally required for the enzyme activity. Selective permeabilization and in silico analysis suggest that ACSL3 assumes a hairpin membrane topology, with the N-terminal hydrophobic amino acids forming an amphipathic helix restricted to the cytosolic leaflet of the ER membrane. ACSL3 was effectively translocated from the ER to nascent LDs when neutral lipid synthesis was stimulated by the external addition of fatty acids. Cellular fatty acid uptake was increased by overexpression and reduced by RNA interference of ACSL3. In conclusion, the structural organization of ACSL3 allows the fast and efficient movement from the ER to emerging LDs. ACSL3 not only esterifies fatty acids with CoA but is also involved in the cellular uptake of fatty acids, presumably indirectly by metabolic trapping. The unique localization of the acyl-CoA synthetase ACSL3 on LDs suggests a function in the local synthesis of lipids. Lipid-containing membranes are essential for living cells, and the storage of lipids for times of need presumably developed very early during evolution. Cytosolic lipid droplets (LDs) are the main reservoir of lipids and are common to many if not all eukaryotic cells (1Murphy D.J. The biogenesis and functions of lipid bodies in animals, plants and microorganisms.Prog. Lipid Res. 2001; 40: 325-438Crossref PubMed Scopus (760) Google Scholar). LDs have gained much recent interest because of their regulatory role in lipid homeostasis and their implication in metabolic diseases such as obesity and type 2 diabetes (2Walther T.C. Farese Jr, R.V. The life of lipid droplets.Biochim Biophys Acta. 2009; 1791: 459-466Crossref PubMed Scopus (376) Google Scholar–3Ohsaki Y. Cheng J. Suzuki M. Shinohara Y. Fujita A. Fujimoto T. Biogenesis of cytoplasmic lipid droplets: from the lipid ester globule in the membrane to the visible structure.Biochim Biophys Acta Mol. Cell. Biol. 2009; 1791: 399-407Crossref PubMed Scopus (118) Google Scholar, 4Martin S. Parton R.G. Lipid droplets: a unified view of a dynamic organelle.Nat. Rev. Mol. Cell Biol. 2006; 7: 373-378Crossref PubMed Scopus (912) Google Scholar). They have a unique structure composed of a hydrophobic core surrounded by a phospholipid monolayer containing a specific protein composition. Perilipin family proteins and lipid metabolizing enzymes are the most abundant proteins (5Brasaemle D.L. Thematic review series: adipocyte biology. The perilipin family of structural lipid droplet proteins: stabilization of lipid droplets and control of lipolysis.J. Lipid Res. 2007; 48: 2547-2559Abstract Full Text Full Text PDF PubMed Scopus (757) Google Scholar, 6Bickel P.E. Tansey J.T. Welte M.A. PAT proteins, an ancient family of lipid droplet proteins that regulate cellular lipid stores.Biochim Biophys Acta. 2009; 1792: 419-440Crossref Scopus (521) Google Scholar), and proteomic studies have identified many additional constituents (7Hodges B.D.M. Wu C.C. Proteomic insights into an expanded cellular role for cytoplasmic lipid droplets.J. Lipid Res. 2010; 51: 262-273Abstract Full Text Full Text PDF PubMed Scopus (126) Google Scholar). Little is known how proteins are specifically targeted to lipid droplets (8Thiele C. Spandl J. Cell biology of lipid droplets.Curr. Opin. Cell Biol. 2008; 20: 378-385Crossref PubMed Scopus (229) Google Scholar, 9Digel M. Ehehalt R. Füllekrug J. Lipid droplets lighting up: insights from live microscopy.FEBS Lett. 2010; 584: 2168-2175Crossref PubMed Scopus (77) Google Scholar). The biogenesis of LDs likely involves the endoplasmic reticulum, but the mechanism has not been solved and is debated intensely (2Walther T.C. Farese Jr, R.V. The life of lipid droplets.Biochim Biophys Acta. 2009; 1791: 459-466Crossref PubMed Scopus (376) Google Scholar, 3Ohsaki Y. Cheng J. Suzuki M. Shinohara Y. Fujita A. Fujimoto T. Biogenesis of cytoplasmic lipid droplets: from the lipid ester globule in the membrane to the visible structure.Biochim Biophys Acta Mol. Cell. Biol. 2009; 1791: 399-407Crossref PubMed Scopus (118) Google Scholar, 10Murphy D.J. Vance J. Mechanisms of lipid-body formation.Trends Biochem. Sci. 1999; 24: 109-115Abstract Full Text Full Text PDF PubMed Scopus (478) Google Scholar). Triglycerides are the main species of neutral lipids stored within the LDs of most cell types. The predominant biosynthetic pathway requires three activated fatty acids for each triglyceride molecule. The fatty acids are taken up from the extracellular medium or are derived from endogenous metabolism by fatty acid synthase. In fact, addition of fatty acids is a very efficient way to induce the formation of LDs (4Martin S. Parton R.G. Lipid droplets: a unified view of a dynamic organelle.Nat. Rev. Mol. Cell Biol. 2006; 7: 373-378Crossref PubMed Scopus (912) Google Scholar). However, fatty acids are chemically quite inert and need to be activated by esterification with CoA (11Watkins P.A. Fatty acid activation.Prog. Lipid Res. 1997; 36: 55-83Crossref PubMed Scopus (154) Google Scholar). This activation is catalyzed by the family of acyl-CoA synthetases (12Watkins P.A. Maiguel D. Jia Z. Pevsner J. Evidence for 26 distinct acyl-coenzyme A synthetase genes in the human genome.J. Lipid Res. 2007; 48: 2736-2750Abstract Full Text Full Text PDF PubMed Scopus (236) Google Scholar); physiologically highly relevant are the long chain (ACSL1, -3, -4, -5, -6) and very long chain (ACSVL1, -2, -3, -4, -5, and -6) fatty acyl-CoA synthetase subfamilies (13Mashek D.G. Li L.O. Coleman R.A. Long-chain acyl-CoA synthetases and fatty acid channeling.Future Lipidol. 2007; 2: 465-476Crossref PubMed Scopus (170) Google Scholar). Apart from their obvious enzymatic role, additional functions have been suggested for ACS(V)L family proteins: metabolic channeling of fatty acids toward specific metabolic fates [e.g., phospholipid synthesis vs. β-oxidation (13Mashek D.G. Li L.O. Coleman R.A. Long-chain acyl-CoA synthetases and fatty acid channeling.Future Lipidol. 2007; 2: 465-476Crossref PubMed Scopus (170) Google Scholar)] and fatty acid uptake driven by vectorial acylation at the plasma membrane (14Black P.N. DiRusso C.C. Transmembrane movement of exogenous long-chain fatty acids: proteins, enzymes, and vectorial esterification.Microbiol. Mol. Biol. Rev. 2003; 67: 454-472Crossref PubMed Scopus (180) Google Scholar). Furthermore, the ACSVL proteins have also been put forward as fatty acid transporters (FATPs) at the cell surface (15Doege H. Stahl A. Protein-mediated fatty acid uptake: novel insights from in vivo models.Physiology (Bethesda). 2006; 21: 259-268Crossref PubMed Scopus (172) Google Scholar). ACSL3 was cloned initially from rat brain (16Fujino T. Kang M-J. Suzuki H. Iijima H. Yamamoto T. Molecular characterization and expression of rat Acyl-CoA synthetase 3.J. Biol. Chem. 1996; 271: 16748-16752Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar) but is ubiquitously expressed (17Mashek D.G. Li L.O. Coleman R.A. Rat long-chain acyl-CoA synthetase mRNA, protein, and activity vary in tissue distribution and in response to diet.J. Lipid Res. 2006; 47: 2004-2010Abstract Full Text Full Text PDF PubMed Scopus (152) Google Scholar) and has a substrate preference for polyunsaturated fatty acids (16Fujino T. Kang M-J. Suzuki H. Iijima H. Yamamoto T. Molecular characterization and expression of rat Acyl-CoA synthetase 3.J. Biol. Chem. 1996; 271: 16748-16752Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar, 18Van Horn C.G. Caviglia J.M. Li L.O. Wang S. Granger D.A. Coleman R.A. Characterization of recombinant long-chain rat acyl-CoA synthetase isoforms 3 and 6: identification of a novel variant of isoform 6.Biochemistry. 2005; 44: 1635-1642Crossref PubMed Scopus (119) Google Scholar). ACSL3 was found to be an abundant protein on lipid droplets prepared from Huh7 human hepatoma cells (19Fujimoto Y. Itabe H. Sakai J. Makita M. Noda J. Mori M. Higashi Y. Kojima S. Takano T. Identification of major proteins in the lipid droplet-enriched fraction isolated from the human hepatocyte cell line HuH7.Biochim. Biophys. Acta. 2004; 1644: 47-59Crossref PubMed Scopus (275) Google Scholar). Interestingly, the distribution of ACSL3 between LDs and heavier cell membrane fractions correlated with the amount of intracellular lipid droplets (20Fujimoto Y. Itabe H. Kinoshita T. Homma K.J. Onoduka J. Mori M. Yamaguchi S. Makita M. Higashi Y. Yamashita A. et al.Involvement of long chain acyl-CoA synthetase in local synthesis of neutral lipids in cytoplasmic lipid droplets in human hepatocyte HuH7.J. Lipid Res. 2007; 48: 1280-1292Abstract Full Text Full Text PDF PubMed Scopus (117) Google Scholar). Here, we present evidence that the N-terminus of ACSL3 is necessary and sufficient for the localization to lipid droplets. Our data suggest that N-terminal anchoring of ACSL3 to the cytosolic leaflet of the endoplasmic reticulum (ER) by an amphipathic helix allows efficient translocation to emerging lipid droplets. Depletion of ACSL3 by RNAi caused a significant reduction in fatty acid uptake, suggesting that the activation of fatty acids serves not only to provide reactive molecules for lipid metabolism but is also a driving force for the transport of fatty acids into the cell. Antiserum against human ACSL3 was raised in rabbits using recombinant ACSL3 comprising amino acids 504–720. For affinity purification, recombinant protein coupled to a solid support was used. Other antibodies used were: rabbit anti-GFP (21Ehehalt R. Keller P. Haass C. Thiele C. Simons K. Amyloidogenic processing of the Alzheimer beta-amyloid precursor protein depends on lipid rafts.J. Cell Biol. 2003; 160: 113-123Crossref PubMed Scopus (920) Google Scholar), rabbit anti-rat protein disulfide isomerase A6/CaBP1 (22Fullekrug J. Sonnichsen B. Wunsch U. Arseven K. Nguyen Van P. Soling H. Mieskes G. CaBP1, a calcium binding protein of the thioredoxin family, is a resident KDEL protein of the ER and not of the intermediate compartment.J. Cell Sci. 1994; 107: 2719-2727Crossref PubMed Google Scholar), mouse anti-HA (sc-7392; Santa Cruz, CA), mouse anti-β-actin (clone AC-15; Sigma, St. Louis, MO), guinea pig anti-TiP47 (gp32; PROGEN Biotechnik, Heidelberg, Germany;). Donkey anti-rabbit coupled to Cy3 and anti-mouse/rabbit-HRP were from Jackson ImmunoResearch, West Grove, PA. Human adipose differentiation-related protein (ADRP/perilipin 2) followed by mRFP (23) was used as a lipid droplet marker protein. RFP-ER contains mRFP fused to human Sec61β (24Kuerschner L. Ejsing C.S. Ekroos K. Shevchenko A. Anderson K.I. Thiele C. Polyene-lipids: a new tool to image lipids.Nat. Methods. 2005; 2: 39-45Crossref PubMed Scopus (150) Google Scholar), which is a widely used ER marker protein. CaBP1/PDI A6 is a rat liver protein disulfide isomerase (22Fullekrug J. Sonnichsen B. Wunsch U. Arseven K. Nguyen Van P. Soling H. Mieskes G. CaBP1, a calcium binding protein of the thioredoxin family, is a resident KDEL protein of the ER and not of the intermediate compartment.J. Cell Sci. 1994; 107: 2719-2727Crossref PubMed Google Scholar) and is a soluble lumenal ER protein. ACSL3HA is full-length human ACSL3, tagged at the C terminus with the hemagglutinin epitope. The full-length cDNA for human ACSL3 (clone MGC 48741) was obtained from the RZPD (Deutsches Ressourcenzentrum fuer Genomforschung; now imaGenes, Germany), and the cDNA was verified. The sequence was identical to the reference sequence (gb: NM_004457.3). PCR with primers sA3kpn (5′-ACGTGGTACCACCATGAATAACCACGTGTCTTC-3′) and aA3 (5′-A CGTCTCGAGTCAAGCGTAATCTGGAACATCGTATGGGTATTTTCTTCCATACATTCGCTCAATGTCC-3′) yielded a cDNA coding for C-terminally HA (hemagglutinin) epitope tagged ACSL3. This was digested with KpnI and XhoI and ligated into pcDNA3 (Invitrogen). GFP-ACSL3HA codes for GFP, and HA tagged full-length human ACSL3. The cDNA of ACSL3HA was moved with KpnI and ApaI into pEGFP-C1 (Clontech, Mountain View, CA). GFP-ΔNt-ACSL3HA lacks the cDNA part, which codes for amino acids 1–68 of human ACSL3. GFP-ACSL3HA was digested with BglII, the released fragment was removed by gel electrophoresis, and the remaining vector was religated. ΔNt-ACSL3HA was also cloned but did express only very poorly. A3Nt-GFP contains the amino acids 1–135 of human ACSL3 followed by GFP. The cDNA of Caco-2 cells was used as a template for PCR with primers s-H3-ACSL3 (5′-GAATTCAAGCTTACCATGAATAACCACGTGTCTTC-3′) and a-ACSL3GFP (5′-ACGTACCGGTGGATCCGCAAGCCAATTATACTGTCC-3′). The PCR product was digested with HindIII and AgeI and ligated into pEGFP-N1 (Clontech). A3Nt-RFP is comprised of amino acids 1–135 of human ACSL3 followed by mRFP. For this, the plasmid A3Nt-GFP was digested with HindIII and BamHI and ligated into Murr1-RFP.pcDNA3 (25Weiss K.H. Lozoya J.C. Tuma S. Gotthardt D. Reichert J. Ehehalt R. Stremmel W. Fullekrug J. Copper-induced translocation of the Wilson disease protein ATP7B independent of Murr1/ COMMD1 and Rab7.Am. J. Pathol. 2008; 173: 1783-1794Abstract Full Text Full Text PDF PubMed Scopus (29) Google Scholar); this replaced the Murr1 cDNA and yielded a cDNA containing monomeric RFP in frame (26Campbell R.E. Tour O. Palmer A.E. Steinbach P.A. Baird G.S. Zacharias D.A. Tsien R.Y. A monomeric red fluorescent protein.Proc. Natl. Acad. Sci. USA. 2002; 99: 7877-7882Crossref PubMed Scopus (2004) Google Scholar). Transcription of the ACSL3RNAi plasmid generates a small hairpin RNA. The target sequence of ACSL3 comprised nucleotides 1540–1558 of the human cDNA. Oligos sA3J1 (5′-GATCTCCGGTGGATACTTTAATACTGTTCAAGAGACAGTATTAAAGTATCCACCTTTTTTGGAAC-3′) and aA3J1 (5′-TCGAGTTCCAAAAAAGGTGGATACTTTAATACTGTCTCTTGAACAGTATTAAAGTATCCACCGGA-3′) were annealed and ligated into pSuper digested with BglII and XhoI (27Brummelkamp T.R. Bernards R. Agami R. A system for stable expression of short interfering RNAs in mammalian cells.Science. 2002; 296: 550-553Crossref PubMed Scopus (3963) Google Scholar). Subcloning was into the retroviral plasmid pRVH1-puro (28Schuck S. Manninen A. Honsho M. Fullekrug J. Simons K. Generation of single and double knockdowns in polarized epithelial cells by retrovirus-mediated RNA interference.Proc. Natl. Acad. Sci. USA. 2004; 101: 4912-4917Crossref PubMed Scopus (82) Google Scholar). The cDNA of RFP-FATP4 is an N-terminal mRFP followed by full-length mouse FATP4. Plasmid FATP4.pcDNA3 (29Milger K. Herrmann T. Becker C. Gotthardt D. Zickwolf J. Ehehalt R. Watkins P.A. Stremmel W. Fullekrug J. Cellular uptake of fatty acids driven by the ER-localized acyl-CoA synthetase FATP4.J. Cell Sci. 2006; 119: 4678-4688Crossref PubMed Scopus (172) Google Scholar) was digested with ApaI and HindIII and ligated into RFP-ER containing N-terminal mRFP, thereby replacing the cDNA coding for Sec61β. The dominant-negative cav1DGI-GFP has a deletion of amino acids 1–81 of canine caveolin-1. This construct was modeled after cav3DGV and has an intact scaffolding domain (30Pol A. Luetterforst R. Lindsay M. Heino S. Ikonen E. Parton R.G. A caveolin dominant negative mutant associates with lipid bodies and induces intracellular cholesterol imbalance.J. Cell Biol. 2001; 152: 1057-1070Crossref PubMed Scopus (275) Google Scholar). PCR of canine caveolin1-GFP (31Pelkmans L. Kartenbeck J. Helenius A. Caveolar endocytosis of simian virus 40 reveals a new two-step vesicular-transport pathway to the ER.Nat. Cell Biol. 2001; 3: 473-483Crossref PubMed Scopus (1049) Google Scholar) with primers s-DGI (5′-ACGTAGATCTCGAGACCATGGATGGCATCTGGAAGGCC-3′) and a-CV-GFP (5′-CCATGGTGGCGACCGG-3′) was followed by digestion with XhoI and AgeI and reinsertion into the caveolin-GFP plasmid. All cDNAs derived from PCR products were fully sequenced. All cell lines were cultivated in media supplemented with 10% FCS, glutamate and penicillin/streptomycin (all reagents from Invitrogen, Carlsbad, CA): COS-7 (ATCC CRL-1651; DMEM 4.5 g/l glucose), Vero (CCL-81; DMEM 1.0 g/l glucose), Ptk2 (CCL-56; MEM, 0.1 mM nonessential amino acids), A431 (CRL-1555; DMEM 4.5 g/l glucose), and HepG2 (HB-8065; RPMI 1640). For transient expression, cells grown to 80% confluency in a 6-well plate (10 cm2/well) were incubated for 4 h with the transfection mix consisting of 2.0 µg plasmid, 10 µl FUGENE HD (Roche, Mannheim, Germany), and 100 µl Opti-MEM (Invitrogen) in 2 ml of standard medium. After 4 h, cells were washed and incubated for a further 20 h in 2 ml of standard medium without antibiotics before analysis. Control cells for biochemical experiments were transfected with pcDNA3. Formation of lipid droplets was induced by incubation with 180 µM oleate bound to fatty acid free BSA (Sigma A-6003) with a molar ratio of 4:1 (Figs. 2B, 3, 4) or with 600 µM oleate (6:1; Figs. 1, 5B, 6A, B). Protein synthesis was inhibited by 200 µM cycloheximide, which was added 30 min before the oleate treatment and kept during the oleate incubation.Fig. 3Localization of A3Nt-GFP to emerging lipid droplets. A: Time series of the localization of A3Nt-GFP after the addition of oleic acid. A3Nt-GFP emerges in tiny puncta, which are discernible 2 min after the addition of 180 µM oleic acid. The same Ptk2 cell was imaged over 20 min. Bar, 10 µm. B: Colocalization of A3Nt-RFP with caveolin-1DGI-GFP. Transiently expressing Ptk2 cells were treated for 30 min with 180 µM oleic acid. Caveolin and ACSL3 overlap strikingly in both the tiny new and the mature lipid droplets. Confocal sections; bar, 10 µm. C: Induction of new lipid droplets by the addition of fatty acid in COS-7 cells. Localization of A3Nt-GFP under standard culture conditions (control; left) and after the addition of 180 µM oleic acid (OA) for 30 min. Bar, 10 µm. D: A3Nt-GFP and TIP47/perilipin-3 costain on emerging lipid droplets. COS-7 cells expressing A3Nt-GFP were treated for 30 min with 180 µM OA, fixed, and treated with antibodies against endogenous TIP47 (red). Confocal sections; bar, 10 µm.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 4Membrane topology of ACSL3. A: In silico analysis of the N-terminal region of ACSL3. Software prediction suggested that the hydrophobic domain at the N-terminus of ACSL3 comprises 24 amino acids (I21 to F43) and may form an integral transmembrane domain (http://www.cbs.dtu.dk/services/TMHMM/). The hydrophobic region (boxed) has a high likelihood of being α-helical (red H). The bottom row numbers indicate the reliability of the prediction (0 low, 9 high; http://www.predictprotein.org/submit.php). B, C: Selective permeabilization. COS cells were transiently cotransfected with plasmids encoding GFP-ACSL3HA and an ER marker protein located inside the ER (anti ERlumenal corresponding to rat protein disulfide isomerase A6/CaBP1). After overnight incubation with oleic acid, cells were fixed with PFA and permeabilized with 10 µM digitonin for 10 min at RT (B and C, upper panel) or with methanol (MeOH) (C, lower panel) at −20°C for 2 min. Antibodies against the N-terminally located GFP (anti-GFP) and the C-terminal HA epitope (anti-HA) stained cells permeabilized with digitonin (B). Digitonin did not allow access of the antibodies against the lumenal ER protein (C, upper panel), but methanol treatment confirmed the presence of CaBP1 (C, lower panel). Bar, 20 µm. D: Helical wheel projection of the N-terminus of ACSL3. Amino acids I21 (Ile 1) to Y38 (Tyr 18) show an exceptional sidedness between nonpolar (light brown) and polar/basic (green/blue) amino acids. All six polar amino acids (Ser, Thr, Tyr) contain a hydroxyl group in their side chain.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 1The N-terminus of ACSL3 confers localization to the ER and to lipid droplets. A: Domain organization of ACSL3 and overview of the constructs used. Wild-type human ACSL3 contains 720 amino acids, corresponding to 80.4 kDa (http://www.uniprot.org/uniprot/O95573). The AMP-binding domain spanning S136 to A612 (as defined by Pfam at http://smart.embl-heidelberg.de/) is colored in purple, and the hydrophobic domain (HD) is indicated in yellow. A3Nt-GFP contains the N-terminus of ACSL3 (M1-L135) fused to GFP (green). HA (light blue) is the hemagglutinin epitope tag. GFP-ΔNt-ACSL3HA lacks the N-terminus of ACSL3 (M1-Y68). B: Partial localization of A3Nt-GFP to the endoplasmic reticulum (ER). Transient coexpression of A3Nt-GFP and the red fluorescent membrane marker protein for the ER (RFP-ER) in COS-7 cells. Cells were fixed 24 h post transfection and analyzed by confocal laser scanning microscopy. A single representative section is shown. The colocalization is especially evident at the nuclear envelope, which is continuous with the ER. Bar, 10 µm. C: Partial localization of A3Nt-GFP to lipid droplets (LD). Transient expression of A3Nt-GFP and the LD marker protein (ADRP/perilipin 2) in COS-7 cells. The colocalization between A3Nt-GFP and ADRP-RFP is even more prominent if the culture medium (DMEM) is supplemented with oleic acid overnight (lower panel; DMEM + OA). Confocal sections; bar, 10 µm. D: Comparison of A3Nt-GFP to full length wild-type ACSL3. COS-7 cells were fixed and permeabilized 24 h after cotransfection with A3Nt-GFP and epitope-tagged human ACSL3. Indirect immunofluorescence staining of ACSL3 was achieved by sequential incubation with mouse anti-HA and donkey anti-mouse coupled to Cy3 (red). The overlap between both proteins is apparent under standard conditions (DMEM) as well as after oleic acid supplementation (DMEM + OA). Confocal sections; bar, 10 µm. E: Comparison of A3Nt-GFP to endogenous ACSL3. Left: Indirect immunofluorescence microscopy. The affinity purified antibody against ACSL3 (red) stains the same structures as A3Nt-GFP expressed transiently in COS-7 cells. Confocal sections; bar, 10 µm. Right: Subcellular fractionation. Postnuclear supernatants of homogenized COS-7 cells were applied to sucrose density gradients. Membrane (M) and cytosolic (C) proteins remain at the bottom of the gradient (fractions 3 and 4), but lipid droplet associated proteins float into the top fraction (fraction 1). Endogenous ACSL3 was detected by the antibody raised against the C-terminal half of recombinant human ACSL3. A3Nt-GFP was recognized by the GFP antiserum, and TIP47 served as a lipid droplet marker protein.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 5The expression level of ACSL3 influences fatty acid uptake. A: Expression of ACSL3 enhances fatty acid uptake. Transiently transfected COS cells were incubated for 60 s (left) or 3 h (right) with [3H]oleate bound to BSA. Results are from three independent experiments, with triplicate measurements each; ** P < 0.01 (Student's t-test). Error bars are SEM. B: Localization of A3Nt-GFP in A431 cells. Transiently expressing A431 cells were cultured under standard conditions (DMEM) or with oleic acid overnight (DMEM + OA). Confocal sections; bar, 10 µm. C: Stable knockdown of ACSL3 expression in A431 cells by RNAi. Total lysates from control cells were compared with RNAi cells. Actin served as a loading control. D: Depletion of ACSL3 by RNAi diminishes fatty acid uptake. Cells were incubated for 3 h with 200 µM [3H]labeled oleic (OA) or arachidonic (AA) acid bound to 100 µM BSA, and fatty acid uptake was quantified by scintillation counting. Results are from six independent experiments using cells with different passage numbers. * P < 0.05; *** P < 0.001. Error bars are SEM.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 6The N-terminus is required for the localization and function of ACSL3. A: Immunofluorescence localization of ACSL3 lacking the N-terminus. GFP-ΔNt-ACSL3HA localizes diffusely to the cytoplasm/cytosol (top and middle panel), reminiscent of but different from the endoplasmic reticulum (RFP-ER, top panel). It is excluded from lipid droplets marked by ADRP-RFP (middle panel). The corresponding control fusion protein GFP-ACSL3HA colocalizes with ADRP/perilipin-2 on lipid droplets like A3Nt-GFP or wild-type ACSL3. Confocal sections; bar, 10 µm. B: The N-terminus of ACSL3 is required for cofractionation with lipid droplets. Cell homogenates were fractionated on sucrose density gradients. GFP-ΔNt-ACSL3HA is present in the fractions 3 and 4, which contain membrane (M) and cytosolic (C) proteins. No significant amount is observed in the LD fraction (#1). GFP-ACSL3HA containing the hydrophobic N-terminus of ACSL3 cofractionates with lipid droplets marked by TIP47/ perilipin-3. C: Cells expressing GFP-ΔNt-ACSL3HA show no increase in enzyme activity. The oleoyl-CoA synthetase activities of cell lysates were determined in vitro. Left: Absolute values for the specific enzyme activity related to total protein amount. Error bars are SD of triplicates of a representative experiment. Right: Enzyme activities related to the amount of overexpressed GFP fusion protein (determined by Western blotting). D: GFP-ΔNt-ACSL3HA does not enhance fatty acid uptake. Left: Oleate uptake related to total protein. The amount of overexpressed ACSL3 is much lower than in Fig. 5A (data not shown; see Materials and Methods for details). Error bars are SD of triplicates of a representative experiment. Right: Oleate uptake calibrated to the amount of overexpressed ACSL3 determined by blotting.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Stable depletion of ACSL3 by RNAi was achieved by retroviral integration of the ACSL3RNAi plasmid into A431 cells. The generation of replication-deficient retrovirus pseudotyped with VSV-G from phoenix-gp cells, transduction, and antibiotic selection (2 days, 4.0 µg/ml puromycin for A431 cells) were as described earlier (28Schuck S. Manninen A. Honsho M. Fullekrug J. Simons K. Generation of single and double knockdowns in polarized epithelial cells by retrovirus-mediated RNA interference.Proc. Natl. Acad. Sci. USA. 2004; 101: 4912-4917Crossref PubMed Scopus (82) Google Scholar). Control cells were transduced with the plasmid pRVH1-puro containing no shRNA sequence. GFP-ACSL3HA was expressed more efficiently than GFP-ΔNt-ACSL3HA. To enable a better comparison, we used 0.4 µg GFP-ACSL3HA plasmid together with 1.6 µg pcDNA3 and 2.0 µg of GFP-ΔNt-ACSL3HA (Fig. 6). Cells expressing fluorescent proteins were fixed for 20 min with 4% PFA, washed, and embedded directly in mowiol (4-88; Calbiochem, San Diego, CA) containing 1 µg/ml Hoechst 33342 for staining of nuclei. For staining of endogenous ACSL3, fixed cells were permeabilized with 0.1% saponin and blocked with 0.5% gelatin and 0.5% BSA. Indirect immunofluorescence was performed as described (29Milger K. Herrmann T. Becker C. Gotthardt D. Zickwolf J. Ehehalt R. Watkins P.A. Stremmel W. Fullekrug J. Cellular uptake of fatty acids driven by the ER-localized acyl-CoA synthetase FATP4.J. Cell Sci. 2006; 119: 4678-4688Crossref PubMed Scopus (172) Google Scholar). Selective permeabilization of transiently transfected COS cells was achieved by using 10 µM digitonin for 10 min at r

The acyl-CoA synthetase 4 (ACSL4) has been implicated in carcinogenesis and neuronal development. Acyl-CoA synthetases are essential enzymes of lipid metabolism, and ACSL4 is distinguished by its preference for arachidonic acid. Two human ACSL4 isoforms arising from differential splicing were analyzed by ectopic expression in COS cells. We found that the ACSL4_v1 variant localized to the inner side of the plasma membrane including microvilli, and was also present in the cytosol. ACSL4_v2 contains an additional N-terminal hydrophobic region; this isoform was located at the endoplasmic reticulum and on lipid droplets. A third isoform was designed de novo by appending a mitochondrial targeting signal. All three ACSL4 variants showed the same specific enzyme activity. Overexpression of the isoenzymes increased cellular uptake of arachidonate to the same degree, indicating that the metabolic trapping of fatty acids is independent of the subcellular localization. Remarkably, phospholipid metabolism was changed by ACSL4 expression. Labeling with arachidonate showed that the amount of newly synthesized phosphatidylinositol was increased by all three ACSL4 isoenzymes but not by ACSL1. This was dependent on the expression level and the localization of the ACSL4 isoform. We conclude that in our model system exogenous fatty acids are channeled preferentially towards phosphatidylinositol by ACSL4 overexpression. The differential localization of the endogenous isoenzymes may provide compartment specific precursors of this anionic phospholipid important for many signaling processes.

Understanding the mechanisms of long chain fatty acid (LCFA) uptake in hepatic cells is of high medical importance to treat and to prevent fatty liver disease (FLD). ACSs (Acyl-CoA synthetases) are a family of enzymes that catalyze the esterification of fatty acids (FA) with CoA. Recent studies suggest that ACS enzymes drive the uptake of LCFA indirectly by their enzymatic activity and could promote special metabolic pathways dependent on their localization.The only protein located at the plasma membrane which has consistently been shown to enhance FA uptake is CD36.The current study investigated whether ACSs and CD36 could regulate hepatic LCFA uptake.FATP2 and FATP4 were both localized to the ER of HuH7 and HepG2 cells as shown by double immunofluorescence in comparison to marker proteins. ACSL1 was located at mitochondria in both cell lines. Overexpression of FATP2, FATP4 and ACSL1 highly increased ACS activity as well as the uptake of [3H]-oleic acid and fluorescent Bodipy-C12 (B12) fatty acid. Quantitative FACS analysis showed a correlation between ACS expression levels and B12 uptake. FATP2 had the highest effect on B12 uptake of all proteins tested. CD36 was mainly localized at the plasma membrane. Whereas [3H]-oleic acid uptake was increased after overexpression, CD36 had no effect on B12 uptake.Uptake of LCFA into hepatoma cells can be regulated by the expression levels of intracellular enzymes. We propose that ACS enzymes drive FA uptake indirectly by esterification. Therefore these molecules are potential targets for treatment of nonalcoholic fatty liver disease (NAFLD) or steatohepatitis (NASH).

Etrolizumab is a gut-targeted anti-β7 integrin monoclonal antibody. In a previous phase 2 induction study, etrolizumab significantly improved clinical remission versus placebo in patients with moderately to severely active ulcerative colitis. We aimed to evaluate the efficacy and safety of etrolizumab for maintenance of remission in patients with moderately to severely active ulcerative colitis.We conducted a randomised, placebo-controlled, double-blind, phase 3 study (LAUREL) across 111 treatment centres worldwide. We included adults (age 18-80 years) with moderately to severely active ulcerative colitis (Mayo Clinic total score [MCS] of 6-12 with an endoscopic subscore of ≥2, a rectal bleeding subscore of ≥1, and a stool frequency subscore of ≥1) who were naive to tumour necrosis factor inhibitors. Patients were required to have had an established diagnosis of ulcerative colitis for at least 3 months, corroborated by both clinical and endoscopic evidence, and evidence of disease extending at least 20 cm from the anal verge. During open-label induction, participants received subcutaneous etrolizumab 105 mg once every 4 weeks. Participants who had clinical response at week 10 (MCS with ≥3-point decrease and ≥30% reduction from baseline, plus ≥1-point decrease in rectal bleeding subscore or absolute rectal bleeding score of 0 or 1) proceeded into the double-blind maintenance phase and were randomly assigned (1:1) to receive subcutaneous etrolizumab 105 mg once every 4 weeks or matched placebo until week 62. Randomisation was stratified by baseline concomitant treatment with corticosteroids, treatment with immunosuppressants, baseline disease activity, and week 10 remission status. All participants and study site personnel were masked to treatment assignment. The primary endpoint was remission at week 62 (MCS ≤2, with individual subscores ≤1, and rectal bleeding subscore of 0) among patients with a clinical response at week 10, measured in the modified intention-to-treat population (all randomised patients who received at least one dose of study drug). This trial is registered with ClinicalTrials.gov, NCT02165215, and is now closed to recruitment.Between Aug 12, 2014, and June 4, 2020, 658 patients were screened for eligibility and 359 were enrolled into the induction phase. 214 (60%) patients had a clinical response at week 10 and were randomly assigned to receive etrolizumab (n=108) or placebo (n=106) in the maintenance phase. 80 (74%) patients in the etrolizumab group and 42 (40%) in the placebo group completed the study through week 62. Four patients in the placebo group did not receive study treatment and were excluded from the analyses. At week 62, 32 (29·6%) of 108 patients in the etrolizumab group and 21 (20·6%) of 102 in the placebo group were in remission (adjusted treatment difference 7·7% [95% CI -4·2 to 19·2]; p=0·19). A greater proportion of patients reported one or more adverse events in the placebo group (82 [80%] of 102) than in the etrolizumab group (70 [65%] of 108); the most common adverse event in both groups was ulcerative colitis (16 [15%] patients in the etrolizumab group and 37 [36%] in the placebo group). Ten (9%) patients in the etrolizumab group and eight (8%) in the placebo group reported one or more serious adverse events. No deaths were reported in either treatment group.No significant differences were observed between maintenance etrolizumab and placebo in the primary endpoint of remission at week 62 among patients who had a clinical response at week 10. Etrolizumab was well tolerated in this population and no new safety signals were identified.F Hoffmann-La Roche.

A defective mucus composition represents a key pathogenetic factor for intestinal injury. Phosphatidylcholine (PC) is an essential component contributing to formation of a hydrophobic mucus layer. For evaluation of PC in the pathogenesis of inflammatory bowel disease, the concentration and composition of PC in the rectal mucus of patients with ulcerative colitis was determined. Electrospray ionization (ESI) tandem mass spectrometry (MS/MS) allows quantification of PC species and enables analysis of crude extracts.Lipid extracts of material obtained by light scrapings of the intestinal lumen were analysed quantitatively by nanoESI MS/MS with synthetic internal PC and lysophosphatidylcholine (LPC) standards. PC and LPC species from rectoscopically acquired mucus aliquots of patients with ulcerative colitis were compared to Crohn disease and control subjects.Patients with inactive ulcerative colitis showed significantly less PC and LPC (median 346 [IQR: 230-405] pmol total PC/mg dry weight) in rectal mucus compared to Crohn disease (median 126 [IQR: 465-1941] pmol total PC/mg dry weight) and control subjects (median 1285 [IQR: 850-1639] pmol total PC/mg dry weight) (P < 0.05). The molecular species of PC and LPC were not significantly different between the groups. The most abundant species were PC 16:0/18:1; PC 16:0/18:2; PC 18:0/18:1; PC 18:0/18:2; LPC 16:0; and LPC 18:0.NanoESI MS/MS is a suitable tool for analysing and quantifying small amounts of PC in human mucus. Patients with ulcerative colitis have significant less PC in their intestinal mucus despite a comparable PC molecular species composition pattern. This suggests that a low amount of protective mucus PC is a characteristic feature in ulcerative colitis and explains an increased susceptibility to luminal contents.

Breast cancer resistance protein (BCRP/ABCG2) is an active efflux pump that belongs to the ATP-binding cassette (ABC) transporter family. It is located in various tissues involved in drug absorption, distribution, and elimination and plays an important role in multidrug resistance. For P-glycoprotein, another member of the ABC transporter family, it is well established that it is at least partly located in cholesterol and sphingolipid-enriched domains of the plasma membrane called "lipid rafts" and that the composition of the membrane lipids may modulate its efflux activity. This study addressed the compartmentalization of BCRP in the plasma membrane and the influence of membrane cholesterol on the efflux activity of BCRP. As a cell model, we used the canine kidney epithelial cell line MDCKII-BCRP transfected with the cDNA encoding human BCRP and the corresponding parental cell line MDCKII. Cholesterol depletion with methyl-beta-cyclodextrin (MbetaCD) provoked a 40% decrease in BCRP activity (p < 0.01) assessed with flow cytometry (pheophorbide A efflux assay). Cholesterol repletion with MbetaCD/cholesterol-inclusion complexes restored BCRP function, and cholesterol saturation of native cells did not further enhance BCRP activity. Coimmunoprecipitation experiments indicated a physical interaction between BCRP and caveolin-1, and Western blot analysis after density gradient ultracentrifugation demonstrated that BCRP is located in detergent-resistant membranes that also contain caveolin-1. In conclusion, our results demonstrate for the first time that BCRP is located in membrane rafts and that cholesterol has impact on its efflux activity.

Phosphatidylcholine (PC) is a major lipid of the gastrointestinal mucus layer. We recently showed that mucus from patients suffering from ulcerative colitis has low levels of PC. Clinical studies reveal that the therapeutic addition of PC to the colonic mucus using slow release preparations is beneficial. The positive role of PC in this disease is still unclear; however, we have recently shown that PC has an intrinsic anti-inflammatory property. It could be demonstrated that the exogenous application of PC inhibits membrane-dependent actin assembly and TNF-alpha-induced nuclear NF-kappaB activation. We investigate here in more detail the hypothesis that the exogenous application of PC has anti-inflammatory properties.PC species with different fatty acid side chains were applied to differentiated and non-differentiated Caco-2 cells treated with TNF-alpha to induce a pro-inflammatory response. We analysed TNF-alpha-induced NF-kappaB-activation via the transient expression of a NF-kappaB-luciferase reporter system. Pro-inflammatory gene transcription was detected with the help of a quantitative real time (RT)-PCR analysis. We assessed the binding of TNF-alpha to its receptor by FACS and analysed lipid rafts by isolating detergent resistant membranes (DRMs).The exogenous addition of all PC species tested significantly inhibited TNF-alpha-induced pro-inflammatory signalling. The expression levels of IL-8, ICAM-1, IP-10, MCP-1, TNF-alpha and MMP-1 were significantly reduced after PC pre-treatment for at least two hours. The effect was comparable to the inhibition of NF-kB by the NF-kB inhibitor SN 50 and was not due to a reduced binding of TNF-alpha to its receptor or a decreased surface expression of TNF-alpha receptors. PC was also effective when applied to the apical side of polarised Caco-2 cultures if cells were stimulated from the basolateral side. PC treatment changed the compartmentation of the TNF-alpha-receptors 1 and 2 to DRMs.PC induces a prolonged inhibition of TNF-alpha-induced pro-inflammatory signalling. This inhibition may be caused by a shift of the TNF-alpha receptors at the surface to lipid rafts. Our results may offer a potential molecular explanation for the positive role of PC seen in clinical studies for the treatment of ulcerative colitis.

Lipid droplets emerge as important intracellular organelles relevant for lipid homeostasis and the pathophysiology of metabolic diseases. Here, we present a personal view on the current knowledge about the biogenesis of mammalian cytoplasmic lipid droplets, with a focus on microscopy and especially live imaging. We also discuss difficulties related to the lipid droplet proteome, contentious views on lipid droplet growth, and last but not least the evidence for the heterogeneity of lipid droplets within a single cell. We conclude with an outline of the most important future challenges.

Long chain acyl-CoA synthetases are essential enzymes of lipid metabolism, and have also been implicated in the cellular uptake of fatty acids. It is controversial if some or all of these enzymes have an additional function as fatty acid transporters at the plasma membrane. The most abundant acyl-CoA synthetases in adipocytes are FATP1, ACSVL4/FATP4 and ACSL1. Previous studies have suggested that they increase fatty acid uptake by direct transport across the plasma membrane. Here, we used a gain-of-function approach and established FATP1, ACSVL4/FATP4 and ACSL1 stably expressing 3T3-L1 adipocytes by retroviral transduction. All overexpressing cell lines showed increased acyl-CoA synthetase activity and fatty acid uptake. FATP1 and ACSVL4/FATP4 localized to the endoplasmic reticulum by confocal microscopy and subcellular fractionation whereas ACSL1 was found on mitochondria. Insulin increased fatty acid uptake but without changing the localization of FATP1 or ACSVL4/FATP4. We conclude that overexpressed acyl-CoA synthetases are able to facilitate fatty acid uptake in 3T3-L1 adipocytes. The intracellular localization of FATP1, ACSVL4/FATP4 and ACSL1 indicates that this is an indirect effect. We suggest that metabolic trapping is the mechanism behind the influence of acyl-CoA synthetases on cellular fatty acid uptake.

This study investigates the role of lipid rafts and caveolae, a subclass of lipid raft microdomains, in the binding and uptake of long-chain fatty acids (LCFA) by 3T3-L1 cells during differentiation. Disruption of lipid rafts by β-cyclodextrin (βCD) or selective inhibition of caveolae by overexpression of a dominant-negative mutant of caveolin-3 (CavDGV) resulted in disassembly of caveolae structures at the cell surface, as assessed by electron microscopy. While in 3T3-L1 fibroblasts, which express few caveolae, CavDGV or βCD had no effect on LCFA uptake, in 3T3-L1 adipocytes the same treatments decreased the level of [3H]oleic acid uptake by up to 55 ± 8 and 49 ± 7%, respectively. In contrast, cholesterol loading of 3T3-L1 adipocytes resulted in a 4-fold increase in the extent of caveolin-1 expression and a 1.7-fold increase in the level of LCFA uptake. Both the inhibitory and enhancing effects of these treatments were constantly increasing with the [3H]oleic acid incubation time up to 5 min. Incubation of 3T3-L1 adipocytes with [3H]stearate followed by isolation of a caveolin-1 positive detergent-resistant membrane (DRM) fraction revealed that [3H]stearate binds to caveolae. Fatty acid translocase (FAT/CD36) was found to be present in this DRM fraction as well. Our data thus strongly indicate a critical involvement of lipid rafts in the binding and uptake of LCFA into 3T3-L1 adipocytes. Furthermore, our findings suggest that caveolae play a pivotal role in lipid raft-dependent LCFA uptake. This transport mechanism is induced in conjunction with cell differentiation and might be mediated by FAT/CD36.

Background: Although long-term steroid treatment is discouraged in ulcerative colitis, alternatives are lacking when therapy with immunosuppressant drugs fails. An insufficient level of phosphatidylcholine in colonic mucus is a possible pathogenetic factor for ulcerative colitis. Objective: To see whether steroid withdrawal is easier with retarded-release phosphatidylcholine or placebo in adults with chronic steroid-refractory ulcerative colitis. Design: Randomized, double-blind, placebo-controlled trial conducted from March 2003 to January 2006. Setting: University Hospital Heidelberg, a referral center for inflammatory bowel disease. Patients: 60 patients with chronic steroid-refractory ulcerative colitis and high clinical and endoscopic disease activity indexes (score ≥5). Intervention: Phosphatidylcholine or cellulose placebo was ingested 4 times daily for 12 weeks for a total dosage of 2 g/d. The follow-up rate was 97%. Measurements: The number of patients achieving complete steroid withdrawal and either a low clinical activity index (≤3) or improvement in the clinical activity index of 50% or more. Results: The primary end point was achieved in 15 of 30 (50%) phosphatidylcholine recipients and in 3 of 30 (10%) placebo recipients (difference, 40% [95% CI, 19% to 61%]; P = 0.002). Twenty-four phosphatidylcholine recipients (80%) and 3 (10%) placebo recipients discontinued steroid therapy without disease exacerbation (difference, 70% [CI, 52% to 88%]; P <0.001). Mild bloating was a common adverse event. Limitations: The sample size was small, and the study was of short duration. Conclusion: Phosphatidylcholine reduced corticosteroid dependence more than placebo in patients with chronic steroid-refractory ulcerative colitis. The next step is long-term trials to evaluate the sustainability of steroid withdrawal in these patients. ClinicalTrials.gov registration number: NCT00259545.

Phosphatidylcholine (PC) is an important constituent of the gastrointestinal tract. PC molecules are not only important in intestinal cell membranes but also receiving increasing attention as protective agents in the gastrointestinal barrier. They are largely responsible for establishing the hydrophobic surface of the colon. Decreased phospholipids in colonic mucus could be linked to the pathogenesis of ulcerative colitis, a chronic inflammatory bowel disease. Clinical studies revealed that therapeutic addition of PC to the colonic mucus of these patients alleviated the inflammatory activity. This positive role is still elusive, however, we hypothesized that luminal PC has two possible functions: first, it is essential for surface hydrophobicity, and second, it is integrated into the plasma membrane of enterocytes and it modulates the signaling state of the mucosa. The membrane structure and lipid composition of cells is a regulatory component of the inflammatory signaling pathways. In this perspective, we will shortly summarize what is known about the localization and protective properties of PC in the colonic mucosa before turning to its evident medical importance. We will discuss how PC contributes to our understanding of the pathogenesis of ulcerative colitis and how reinforcing the luminal phospholipid monolayer can be used as a therapeutic concept in humans.

Mechanisms of long chain fatty acid uptake across the plasma membrane are important targets in treatment of many human diseases like obesity or hepatic steatosis. Long chain fatty acid translocation is achieved by a concert of co-existing mechanisms. These lipids can passively diffuse, but certain membrane proteins can also accelerate the transport. However, we now can provide further evidence that not only proteins but also lipid microdomains play an important part in the regulation of the facilitated uptake process. Dynamic association of FAT/CD36 a candidate fatty acid transporter with lipid rafts was analysed by isolation of detergent resistant membranes (DRMs) and by clustering of lipid rafts with antibodies on living cells. Lipid raft integrity was modulated by cholesterol depletion using methyl-β-cyclodextrin and sphingolipid depletion using myriocin and sphingomyelinase. Functional analyses were performed using an [3H]-oleate uptake assay. Overexpression of FAT/CD36 and FATP4 increased long chain fatty acid uptake. The uptake of long chain fatty acids was cholesterol and sphingolipid dependent. Floating experiments showed that there are two pools of FAT/CD36, one found in DRMs and another outside of these domains. FAT/CD36 co-localized with the lipid raft marker PLAP in antibody-clustered domains at the plasma membrane and segregated away from the non-raft marker GFP-TMD. Antibody cross-linking increased DRM association of FAT/CD36 and accelerated the overall fatty acid uptake in a cholesterol dependent manner. Another candidate transporter, FATP4, was neither present in DRMs nor co-localized with FAT/CD36 at the plasma membrane. Our observations suggest the existence of two pools of FAT/CD36 within cellular membranes. As increased raft association of FAT/CD36 leads to an increased fatty acid uptake, dynamic association of FAT/CD36 with lipid rafts might regulate the process. There is no direct interaction of FATP4 with lipid rafts or raft associated FAT/CD36. Thus, lipid rafts have to be considered as targets for the treatment of lipid disorders.

Ulcerative colitis (UC) is the result of an inappropriate colonic inflammatory response triggered by environmental and genetic factors. We have recently shown that mucus from UC patients has a decreased phosphatidylcholine (PC) content, while clinical trials revealed that therapeutic addition of PC to the colonic mucus alleviated the inflammatory activity. The mechanisms behind this are still unclear. We hypothesized that PC has at least two possible functions in the intestine: First, it establishes the surface hydrophobicity of the mucus and therefore protects the underlying tissue against intraluminal aggressors; recent experiments on surgical specimens revealed reduced surface tension and hydrophobicity in UC patients. Second, mucus phospholipids might also be integrated into the plasma membranes of enterocytes and thereby influence the signaling state of the mucosa. PC has been shown to inhibit TNF-α induced pro-inflammatory responses including: (1) assembly of plasma membrane actin; (2) activation of MAP kinases ERK and p38; and (3) activation of NF-κB and synthesis of pro-inflammatory gene products. Other phospholipids like phosphatidylethanolamine or sphingomyelin had no effect. PC also inhibited latex bead phagosome actin assembly, killing of M. tuberculosis in macrophages, and sphingosine-1-phosphate induced actin assembly in macrophages. Collectively, these results provide a molecular foundation that shows PC, firstly, as an anti-inflammatory, and secondly, as a surface hydrophobicity increasing compound with promising therapeutic potential in the treatment of inflammatory bowel disease.

Aims Impaired liver function often necessitates drug dose adjustment to avoid excessive drug accumulation and adverse events, but a marker for the extent of the required adjustment is lacking. The aim of this study was to investigate whether C hild– P ugh ( CP ) and model for end‐stage liver disease ( MELD ) scores correlate with drug clearance. Methods Midazolam was used as a CYP3A probe and its pharmacokinetics were analyzed in 24 patients with mild to severe liver cirrhosis ( n = 4, 10 and 10 with CP class A , B and C , respectively) and six patients without liver disease. Results Both scores correlated well with unbound midazolam clearance ( CL u ), unbound midazolam fraction and half‐life (all P &lt; 0.01), whereas the unbound steady‐state volume of distribution was not significantly changed. In patients with severe liver cirrhosis unbound midazolam clearance was only 14% of controls ( CP C : CL u = 843 ± 346 l h −1 , MELD ≥ 15: CL u = 805 ± 474 l h −1 , controls: CL u = 5815 ± 2649 l h −1 , P &lt; 0.01). Conclusion The correlation with unbound midazolam clearance suggests that either score predicts the metabolic capacity of CYP3A , the most relevant drug metabolizing enzyme subfamily in humans.

The colonic mucus serves a first barrier towards invasion of commensal bacteria in stools to prevent inflammation. One essential component of intestinal mucus is phosphatidylcholine (PC) which represents more than 90% of the phospholipids in mucus indicative for a selective transport of PC into this compartment. It is arranged in lamellar structures as surfactant-like particles which provide a hydrophobic surface on top of the hydrated mucus gel to prevent the invasion of bacteria from intestinal lumen. In ulcerative colitis (UC), the mucus PC content is reduced by 70%, irrespective of the state of inflammation. Thus, it could represent an intrinsic primary pathogenetic condition predisposing to bacterial invasion and the precipitation of inflammation. Since PC was shown to be mainly secreted by the ileal mucosa from where it is assumed to move distally to the colon, the PC content along the colonic wall towards the rectum gradually thins, with the least PC content in the rectum. This explains the start of the clinical manifestation of UC in the rectum and the expansion from there to the upper parts of the colon. In three clinical trials, when missing mucus PC in UC was supplemented by an oral, delayed release PC preparation, the inflammation improved and even resolved after a 3-month treatment course. The data indicate the essential role of the mucus PC content for protection against inflammation in colon.

The second scientific workshop of the European Crohn's and Colitis Organization (ECCO) focused on the relevance of intestinal healing for the disease course of inflammatory bowel disease (IBD). The objective was to better understand basic mechanisms, markers for disease prediction, detection and monitoring of intestinal healing, impact of intestinal healing on the disease course of IBD as well as therapeutic strategies. The results of this workshop are presented in four separate manuscripts. This section describes basic mechanisms of intestinal healing, identifies open questions in the field and provides a framework for future studies.

Mammalian formation of methane (methanogenesis) is widely considered to occur exclusively by anaerobic microbial activity in the gastrointestinal tract. Approximately one third of humans, depending on colonization of the gut by methanogenic archaea, are considered methane producers based on the classification terminology of high and low emitters. In this study laser absorption spectroscopy was used to precisely measure concentrations and stable carbon isotope signatures of exhaled methane in breath samples from 112 volunteers with an age range from 1 to 80 years. Here we provide analytical evidence that volunteers exhaled methane levels were significantly above background (inhaled) air. Furthermore, stable carbon isotope values of the exhaled methane unambiguously confirmed that this gas was produced by all of the human subjects studied. Based on the emission and stable carbon isotope patterns of various age groups we hypothesize that next to microbial sources in the gastrointestinal tracts there might be other, as yet unidentified, processes involved in methane formation supporting the idea that humans might also produce methane endogenously in cells. Finally we suggest that stable isotope measurements of volatile organic compounds such as methane might become a useful tool in future medical research diagnostic programs.

Lipid rafts are dynamic assemblies of proteins and lipids that float freely within the liquid-disordered bilayer of cellular membranes but can also cluster to form larger, ordered platforms.Rafts are receiving increasing attention as devices that regulate membrane function in eukaryotic cells.In this Perspective, we briefly summarize the structure and regulation of lipid rafts before turning to their evident medical importance.Here, we will give some examples of how rafts contribute to our understanding of the pathogenesis of different diseases.For more information on rafts, the interested reader is referred to recent reviews (1, 2). Composition of lipid raftsLipid rafts have changed our view of membrane organization.Rafts are small platforms, composed of sphingolipids and cholesterol in the outer exoplasmic leaflet, connected to phospholipids and cholesterol in the inner cytoplasmic leaflet of the lipid bilayer.These assemblies are fluid but more ordered and tightly packed than the surrounding bilayer.The difference in packing is due to the saturation of the hydrocarbon chains in raft sphingolipids and phospholipids as compared with the unsaturated state of fatty acids of phospholipids in the liquid-disordered phase (3).Thus, the presence of liquid-ordered microdomains in cells transforms the classical membrane fluid mosaic model of Singer and Nicholson into a more complex system, where proteins and lipid rafts diffuse laterally within a two-dimensional liquid.Membrane proteins are assigned to three categories: those that are mainly found in the rafts, those that are present in the liquid-disordered phase, and those that represent an intermediate state, moving in and out of rafts.Constitutive raft residents include glycophos-phatidylinositol-anchored (GPI-anchored) proteins; doubly acylated proteins, such as tyrosine kinases of the Src family, Gα subunits of heterotrimeric G proteins, and endothelial nitric oxide synthase (eNOS); cholesterol-linked and palmitate-anchored proteins like Hedgehog (see Jeong and McMahon, this Perspective series, ref. 4); and transmembrane proteins, particularly palmitoylated proteins such as influenza virus hemagglutinin and β-secretase (BACE) (1).Some membrane proteins are regulated raft residents and have a weak affinity for rafts in the unliganded state.After binding to a ligand, they undergo a conformational change and/or become oligomerized.When proteins oligomerize, they increase their raft affinity (5).A peripheral membrane protein, such as a nonreceptor tyrosine kinase, can be reversibly palmitoylated and can lose its raft association after depalmitoylation (6).By these means, the partitioning of proteins in and out of rafts can be tightly regulated. Cholesterol and raft biogenesisCholesterol is thought to serve as a spacer between the hydrocarbon chains of the sphingolipids and to function as a dynamic glue that keeps the raft assembly together (1).Cholesterol partitions between the raft and the nonraft phase, having higher affinity to raft sphingolipids than to unsaturated phospholipids.Removal of raft cholesterol leads to dissociation of most proteins from rafts and renders them nonfunctional.Association with detergent-resistant membranes (DRMs) is a useful criterion to estimate whether a protein associates with lipid rafts (2).After solubilization of membranes or cells with Triton X-100 or with CHAPS at 4°C, raft-associated lipids and proteins remain insoluble and can then be floated to low density by sucrose gradient centrifugation.If cholesterol is extracted by methyl-β-cyclodextrin or complexed by saponin, the raft proteins usually, but not always, become detergent-soluble.Lipid rafts are first assembled in the Golgi complex in mammalian cells (3).Cholesterol is synthesized in the endoplasmic reticulum (ER), as is ceramide, the hydrophobic backbone of sphingolipids.However, most of the sphingolipid head groups are attached to ceramide in the Golgi complex, where raft assembly takes place (7).There is an increasing concentration of cholesterol and sphingolipids from the ER to the plas-

The Chinese medicine Rhizoma coptidis (RC) is well established in the treatment of common dermatological disorders although the mechanism of its’ anti-inflammatory effects have previously remained elusive. We stimulated an inflammatory state in human keratinocyte cultures using TNF-α in the presence of RC extract (RCE) and berberine, to identify the dose-dependent anti-inflammatory role of these compounds. Control data demonstrates significant translocation of NFκB into the nucleus after stimulation with TNF-α. This translocation can be inhibited, and hence anti-inflammatory effects inferred, by RCE but not by berberine. We conclude that in dermatological disorders berberine exerts its anti-inflammatory effects by inhibiting signal transduction pathways other than the NFκB dependent pathway, while the RCE complex acts partially by blocking the NFκB dependent pathway. Rhizoma coptidis extract therefore appears to be a potent inhibitor of TNF-α induced inflammation in dermatological conditions.

The Chinese extract Rhizoma coptidis is well known for its anti-inflammatory, antioxidative, antiviral, and antimicrobial activity. The exact mechanisms of action are not fully understood.We examined the effect of the extract and its main compound, berberine, on LPS-induced inflammatory activity in a murine macrophage cell line. RAW 264.7 cells were stimulated with LPS and incubated with either Rhizoma coptidis extract or berberine. Activation of AP-1 and NFkappaB was analyzed in nuclear extracts, secretion of MCP-1/CCL2 was measured in supernatants.Incubation with Rhizoma coptidis and berberine strongly inhibited LPS-induced monocyte chemoattractant protein (MCP)-1 production in RAW cells. Activation of the transcription factors AP-1 and NFkappaB was inhibited by Rhizoma coptidis in a dose- and time-dependent fashion.Rhizoma coptidis extract inhibits LPS-induced MCP-1/CCL2 production in vitro via an AP-1 and NFkappaB-dependent pathway. Anti-inflammatory action of the extract is mediated mainly by its alkaloid compound berberine.

Protein distribution profiles along the human intestinal tract of transporters involved in the absorption of cholesterol and long-chain fatty acids (LCFA) have been scarcely evaluated.In post-mortem samples from 11 subjects, intestinal transporter distribution profiles were determined via Western Blot. Differences in transporter protein levels were statistically tested using ANOVA and Tukey's Post Hoc comparisons. Levels in all segments were expressed relative to those in duodenum. Except for ABCG5 and FATP4, levels (mean+/-SEM) were the highest in the ileum. For ABCA1, ileal levels (1.80+/-0.26) differed significantly from those in duodenum (P = 0.049) and proximal colon (0.92+/-0.14; P = 0.029). ABCG8 levels in ileum (1.91+/-0.30) differed from those in duodenum (P = 0.041) and distal colon (0.84+/-0.22; P = 0.010) and jejunum (1.64+/-0.26) tended to be higher than distal colon (0.84+/-0.22; P = 0.087). Ileal NPC1L1 levels (2.56+/-0.51) differed from duodenum levels (P = 0.019) and from distal colon (1.09+/-0.22; P = 0.030). There was also a trend (P = 0.098) for higher jejunal (2.23+/-0.37) than duodenal NPC1L1 levels. The levels of ABCG5 did not correlate with those of ABCG8. FAT/CD36 levels in ileum (2.03+/-0.42) differed from those in duodenum (P = 0.017), and proximal and distal colon (0.89+/-0.13 and 0.97+/-0.15 respectively; P = 0.011 and P = 0.014). FABPpm levels in ileum (1.04+/-0.13) differed from proximal (0.64+/-0.07; P = 0.026) and distal colon (0.66+/-0.09; P = 0.037).The distribution profiles showed a bell-shape pattern along the GI-tract with the highest levels in ileum for ABCA1, ABCG8, NPC1L1, FATCD36 and FABPm, suggesting a prominent role for ileum in transporter-mediated uptake of cholesterol and LCFAs.

Background/Aims: To retrospectively evaluate the morphologic characteristics of autoimmune pancreatitis (AIP) using MRI and CT. Methods: 86 dynamic contrast-enhanced CT and MRI scans in 36 AIP patients were evaluated regarding: different enlargement types, abnormalities of the main pancreatic duct (MPD), morphology of the parenchyma and other associated findings. Results: 3 types of enlargement were found: (1) a focal type (28%), (2) a diffuse type (involving the entire pancreas, 11%) and (3) a combined type (56%). The MPD was usually dilated together with focal or diffuse narrowing in 67% (24/36). Unenhanced MRI showed AIP area in 56% (mostly T1 hypo- and T2 hyperattenuating), and CT in 10% (hypoattenuating). The arterial phase depicted similar patterns for CT and MRI (hypoattenuating in 58 and 52%, respectively). Venous and late venous phase patterns were usually hyperattenuating in MRI (65 and 74%, late enhancement), while CT mostly showed no signal differences (isoattenuating in 57 and 75%), yielding significant differences between CT and MRI for the venous (p ! 0.0001) and the late phase (p = 0.025). Miscellaneous findings were: rim sign (25%), pseudocysts (8%) and infiltration of large vessels (11%). Conclusions: The ‘late-enhancement’ sign seems to be a key feature and is best detectable with MRI. MRI may be recommended in the diagnostic workup of AIP patients.

This 10-year retrospective cohort study aims to determine the prevalence and risk factors of cytomegalovirus (CMV) infection in inpatients with exacerbated inflammatory bowel disease (IBD).All patients admitted to the Department of Gastroenterology of the University Hospital Heidelberg for IBD exacerbation between January 2004 and June 2013 were enrolled. To identify the risk factors of CMV infection, infected individuals were compared with those with excluded infection.Among 297 patients with exacerbated IBD, 21 had confirmed CMV infection and 79 had excluded CMV infection, whereas the remaining patients had not been sufficiently tested for CMV. Taking into account only sufficiently tested individuals, the prevalence of CMV infection was 22.7% in ulcerative colitis and 16.0% in Crohn's disease. The occurrence of CMV infection was associated with the following variables at admission: age of 30 years or more [odds ratio (OR) 14.29; P=0.004], disease duration less than 60 months (OR 7.69; P=0.011), a blood leukocyte count less than 11/nl (OR 4.49; P=0.041), and immunosuppressive therapy (OR 6.73; P=0.0129). CMV-positive patients remained in the hospital longer than noninfected patients (P=0.0009). In the CMV-positive cohort, a 66-year-old woman died of CMV pneumonia and sepsis, whereas there was no death in the CMV-negative cohort.Immunuosuppressive therapy and age older than 30 years were identified as the main risk factors for the development of CMV infection in exacerbated IBD. Because of the risk of death, diagnostics of CMV infection should especially be initiated in older patients on immunosuppressive therapy.

Abstract Background Real-world comparisons of biologic treatment outcomes for ulcerative colitis (UC) or Crohn’s disease (CD) patients are limited. We sought to evaluate the real-world effectiveness of vedolizumab (VDZ) and anti-tumor necrosis factor alpha (anti-TNFα) in UC and CD patients in Germany. Methods A retrospective chart review (15 sites) investigated UC and CD patients who were biologic-treatment naïve (biologic-naïve) or had received no more than one prior anti-TNFα before initiating treatment with VDZ or anti-TNFα between 15 July 2014 and 20 October 2015. Kaplan-Meier analyses assessed time to first chart-documented clinical remission (CR) and symptom resolution (UC: rectal bleeding [RB], stool frequency [SF]; CD: abdominal pain [AP], liquid stools [LS]) and outcome duration. Results A total of 133 UC (76 VDZ; 57 anti-TNFα) and 174 CD (69 VDZ; 105 anti-TNFα) patients were included. By Week 26, estimated cumulative rates of patients achieving CR or symptom resolution with VDZ vs anti-TNFα treatment were for UC: CR, 53.7% vs 31.7%; RB, 66.8% vs 55.8%; and SF, 59.8% vs 50.7%, respectively; and for CD: CR, 14.4% vs 32.8%; AP, 62.5% vs 56.0%; and LS, 29.9% vs 50.3%, respectively. Outcomes were sustained similarly between treatments, except RB (VDZ vs anti-TNFα: median 38.1 vs 15.1 weeks, P = 0.03). Treatment-related adverse events occurred in 5.3% vs 7.0% (UC) and 8.7% vs 19.0% (CD) of VDZ vs anti-TNFα patients, respectively. Conclusions Although there were differences in CR, symptom resolution, and safety profiles, real-world data support both VDZ and anti-TNFα as effective treatment options in UC and CD.

This observational real-world evidence (RWE) study is based on prospectively collected data from the VEDOIBD registry study.To compare the effectiveness of vedolizumab and anti-TNF agents in biologic-naïve patients with ulcerative colitis (UC) at the end of induction and during maintenance treatment.Between 2017 and 2020, we enrolled 512 patients with UC starting therapy with vedolizumab or an anti-TNF agent in 45 IBD centres across Germany. We excluded biologic-experienced patients and those with missing partial Mayo (pMayo) outcomes; this resulted in a final sample of 314 (182 on vedolizumab and 132 on an anti-TNF agent). The primary outcome was clinical remission measured using pMayo score; any switch to a different biologic agent was considered an outcome failure (modified ITT analysis). We used propensity score adjustment with inverse probability of treatment weighting to correct for confounding.During induction therapy, clinical remission was relatively low and similar in vedolizumab- and anti-TNF-treated patients (23% vs. 30.4%, p = 0.204). However, clinical remission rates after two years were significantly higher for vedolizumab-treated patients than those treated with an anti-TNF agent (43.2% vs. 25.8%, p < 0.011). Among patients treated with vedolzumab, 29% switched to other biologics, versus 54% who had received an anti-TNF agent.After two years of treatment, vedolizumab resulted in higher remission rates than anti-TNF agents.

BACE is the beta-secretase responsible for the first step in amyloidogenic processing of the amyloid precursor protein APP. We have identified two BACE isoforms, BACE1B and BACE1C, lacking 25 and 44 amino acids, respectively. Whereas the BACE1B transcript is present in human pancreas and brain, the BACE1C transcript is found in pancreas only. In transfected cells both BACE1A, which encodes the originally described full-length BACE1 protein and the close homolog BACE2 localized mainly to post-Golgi membranes. In contrast, the two shorter isoforms were found in the endoplasmic reticulum only, and they did not display beta-secretase activity. Using RNase protection we in addition show that the major pancreatic transcript is BACE1A. This suggests that the known absence of beta-secretase activity in the pancreas is not due to a missing BACE1A transcript.

Colonic mucus protects against attacks from bacteria in stool. One component of mucus is phosphatidylcholine (PC) which is thought to be arranged as continuous lamellar layer in the apical mucus and to be responsible for establishing a protective hydrophobic surface. This 'intestinal surfactant' plays a key role in mucosal defense. Thus, a defective PC layer contributes to the development of inflammation. Analysis of rectoscopically acquired mucus aliquots revealed a 70% decrease in PC content in ulcerative colitis (UC) compared to Crohn's disease (CD) and healthy controls - independent of disease activity. Accordingly, we propose that lack of mucus PC is a key pathogenetic factor in UC. In clinical studies a delayed-release oral PC preparation (rPC) was found to substitute the lack of PC in rectal mucus. Indeed, in non-steroid-treated active UC, 53% of rPC patients reached remission [clinical activity index (CAI) ≤3] compared to 10% of placebo patients (p ≤ 0.001). Endoscopic and histologic findings improved concomitantly. A second trial with 60 chronic-active, steroid-dependent UC patients was conducted to test for steroid-sparing effects. Complete steroid withdrawal with a concomitant achievement of remission (CAI ≤3) or clinical response (≥50% CAI improvement) was reached in 15 PC-treated patients (50%) but only in 3 (10%) placebo patients (p = 0.002). In conclusion, intrinsic reduction of PC (lecithin) in colonic mucus may be a key pathogenetic feature of UC. Topical supplement of PC by a delayed-released oral PC preparation is effective in resolving inflammatory activity of UC and may develop to a first-choice therapy for this disease.

In 2 preceding studies, delayed release phosphatidylcholine (rPC) was found to (a) improve disease activity and (b) withdraw steroids in patients with chronic-active ulcerative colitis.Objective of the study was to determine the most effective rPC dose with least adverse events.A randomized, dose-controlled, double-blinded study. Four groups of 10 patients each with nonsteroid-treated, chronic-active ulcerative pancolitis with a clinical activity index (CAI) and endoscopic activity index (EAI) >or=7. Patients were treated with oral rPC at doses of 0.5, 1, 3, and 4 g daily over 12 weeks.The CAI changes from baseline to the end of the study were 2.5 (0.5 g), 7.0 (1 g), 5.5 (3 g), and 6.0 (4 g dose arm). Significant improvement of the CAI was registered between the lowest rPC dose of 0.5 g (control group) and all higher doses of 1.0, 3.0, and 4.0-g rPC (P<or=0.05). Remission (CAI <or=3) was reached in 5/10 and 6/10 patients in the 3 and 4-g dose groups compared with no patients in the 0.5-g arm (P=0.033). In the 1-g dose group only 3/10 patients reached remission (P=0.21). The rates of clinical response (>or=50% CAI improvement) were 70% in all of the effective dose groups (1 to 4 g, P=0.003). This was paralleled by the EAI improvement and by the rates of mucosal healing. Median time to clinical response was 5 (IQR 2 to 8) weeks. Bloating was registered in 40% of the patients irrespective of the treatment dose. Three of the 10 patients in the 4 g dose group reported nausea.We found a saturable dose response of rPC in the treatment of chronic-active ulcerative colitis with effective doses >or=1 g per day; doses of 3 and 4 g seem to be superior in achieving remission.

The mechanism of cellular fatty acid uptake is highly relevant for basic and clinical research. Previous work has demonstrated that fatty acid uptake is facilitated by cell surface membrane proteins as well as by intracellularly localized enzymes. Here, the exogenous expression of the CD36/FAT glycoprotein and the acyl-CoA synthetases FATP4 and ACSL1 in MDCK cells was quantified by comparison to recombinant proteins, and related to the corresponding increases of fatty acid uptake. At the molecular level, CD36/FAT was 30-fold more efficient than either FATP4 or ACSL1 in enhancing fatty acid uptake. Remarkably, co-expression of CD36/FAT with FATP4 or ACSL1 led to a higher increase of fatty acid uptake than expected from the combined individual contributions, whereas co-expression of FATP4 and ACSL1 did not. Immunofluorescence microscopy confirmed the plasma membrane localization of CD36/FAT and the intracellular localization of FATP4 to the endoplasmic reticulum, and of ACSL1 to mitochondria. Concluding, we suggest that fatty acid uptake in our model system is organized by two spatially distinct but synergistic mechanisms: the cell surface protein CD36/FAT directly facilitates fatty acid transport across the plasma membrane, whereas the intracellular acyl-CoA synthetases FATP4 and ACSL1 enhance fatty acid uptake indirectly by metabolic trapping.

Inflammatory bowel disease (IBD) impairs health-related quality of life (HRQOL). Our aim was to investigate whether the improvement in the Clinical Activity Index (CAI) and Endoscopic Activity Index (EAI) is significantly correlated with the advancement of HRQOL and its dimensions in ulcerative colitis (UC) and to assess whether demographic and disease-related factors influence patients' experience of HRQOL. This examination was performed in the context of our recently published study of the anti-inflammatory effect of phosphatidylcholine in UC.Sixty patients with chronic active UC were treated with phosphatidylcholine or placebo over 3 months. They were asked to complete the Inflammatory Bowel Disease Questionnaire-Deutschland (IBDQ-D) before and after the study. The correlations between CAI and EAI and IBDQ-D scores were calculated. Demographic and disease-related factors were obtained.A statistically significant lowering of CAI and EAI after treatment in the phosphatidylcholine group led to a statistically significant improvement in HRQOL (r = -0.623, P = 0.0003 for CAI; r = -0.511, P = 0.005 for EAI). Constant disease activity indexes in the placebo group accompanied constant HRQOL (r = -0.747, P < 0.0001 for CAI; r = -0.634, P = 0.0002 for EAI). Furthermore, besides a few exceptions, significant correlations between CAI and EAI and the 4 dimensions of the IBDQ-D could be shown. Demographic parameters did not significantly influence the IBDQ-D scores.This study points out the strong relationship between CAI and EAI and all domains of HRQOL in patients with UC. Therefore, the IBDQ-D is a valid and reliable assessment tool that reflects changes in the health status of UC patients. It is a useful measure of therapeutic efficacy and should be used in clinical trials in IBD.

Despite the high impact of the antimicrobial peptide hepcidin in iron homeostasis, the regulation of this hormone is still not completely understood. Studies concerning hepcidin regulation are performed at the mRNA level. For the first time we analyzed the regulation of hepcidin not only at mRNA, but also at protein level in a hepatoma and a pancreatic beta cell line using quantitative RT-PCR and immunoblot analysis. Our data show, that hepcidin is present in HepG2 and RINm5F cells. A significant up-regulation of hepcidin was observed in both cell lines by the inflammatory cytokine interleukin-6, lipopolysaccharide, and a slight upregulation by deferoxamine. A down-regulation was detected after stimulation with erythropoietin. Hepcidin was regulated by iron in a dose dependent manner: low doses up to 3 microM increased hepcidin expression, high doses of iron (65 microM) revealed a switch-over to down-regulation of hepcidin expression. Regulation of hepcidin in HepG2 and RINm5F cells at mRNA and protein level by these substances indicates its involvement in inflammation and iron metabolism.

The function of membrane proteins in long-chain fatty acid transport is controversial. The acyl-CoA synthetase fatty acid transport protein-4 (FATP4) has been suggested to facilitate fatty acid uptake indirectly by its enzymatic activity, or directly by transport across the plasma membrane. Here, we investigated the function of FATP4 in basal and insulin mediated fatty acid uptake in C 2 C 12 muscle cells, a model system relevant for fatty acid metabolism. Stable expression of exogenous FATP4 resulted in a twofold higher fatty acyl-CoA synthetase activity, and cellular uptake of oleate was enhanced similarly. Kinetic analysis demonstrated that FATP4 allowed the cells to reach apparent saturation of fatty acid uptake at a twofold higher level compared with control. Short-term treatment with insulin increased fatty acid uptake in line with previous reports. Surprisingly, insulin increased the acyl-CoA synthetase activity of C 2 C 12 cells within minutes. This effect was sensitive to inhibition of insulin signaling by wortmannin. Affinity purified FATP4 prepared from insulin-treated cells showed an enhanced enzyme activity, suggesting it constitutes a novel target of short-term metabolic regulation by insulin. This offers a new mechanistic explanation for the concomitantly observed enhanced fatty acid uptake. FATP4 was colocalized to the endoplasmic reticulum by double immunofluorescence and subcellular fractionation, clearly distinct from the plasma membrane. Importantly, neither differentiation into myotubes nor insulin treatment changed the localization of FATP4. We conclude that FATP4 functions by its intrinsic enzymatic activity. This is in line with the concept that intracellular metabolism plays a significant role in cellular fatty acid uptake.

ACSL3 is the only long chain fatty acyl-CoA synthetase consistently found on growing and mature lipid droplets (LDs), suggesting that this specific localization has biological relevance. Current models for LD growth propose that triglycerides are synthesized by enzymes at the LD surface, with activated fatty acids provided by LD localized ACSL3, thus allowing growth independent of the ER. Here, we tested this hypothesis by quantifying ACSL3 on LDs from human A431 cells. RNAi of ACSL3 reduced the oleoyl-CoA synthetase activity by 83%, suggesting that ACSL3 is by far the dominant enzyme of A431 cells. Molar quantification revealed that there are 1.4 million ACSL3 molecules within a single cell. Metabolic labeling indicated that each ACSL3 molecule contributed a net gain of 3.1 oleoyl-CoA/s. 3D reconstruction of confocal images demonstrated that 530 individual lipid droplets were present in an average oleate fed A431 cell. A representative single lipid droplet with a diameter of 0.66 μm contained 680 ACSL3 molecules on the surface. Subcellular fractionation showed that at least 68% of ACSL3 remain at the ER even during extensive fatty acid supplementation. High resolution single molecule microscopy confirmed the abundance of cytoplasmic ACSL3 outside of LDs. Model calculations for triglyceride synthesis using only LD localized ACSL3 gave significant slower growth of LDs as observed experimentally. In conclusion, although ACSL3 is an abundant enzyme on A431 LDs, the metabolic capacity is not sufficient to account for LD growth solely by the local synthesis of triglycerides.

Wilson disease is a genetic disorder of copper metabolism. Impaired biliary excretion results in a gradual accumulation of copper, which leads to severe disease. The specific gene defect lies in the Wilson disease protein, ATP7B, a copper-transporting ATPase that is highly active in hepatocytes. The two major functions of ATP7B in the liver are the copper loading of ceruloplasmin in the Golgi apparatus, and the excretion of excess copper into the bile. In response to elevated copper levels, ATP7B shows a unique intracellular trafficking pattern that is required for copper excretion from the Golgi apparatus into dispersed vesicles. We analyzed the translocation of ATP7B by both confocal microscopy and RNA interference, testing current models that suggest the involvement of Murr1/COMMD1 and Rab7 in this pathway. We found that although the ATP7B translocation is conserved among nonhepatic cell lines, there is no co-localization with Murr1/COMMD1 or the Rab marker proteins of the endolysosomal system. Consistent with this finding, the translocation of ATP7B was not impaired by the depletion of either Murr1/COMMD1 or Rab7, or by a dominant-negative Rab7 mutant. In conclusion, our data suggest that the translocation of ATP7B takes place independently of Rab7-regulated endosomal traffic events. Murr1/COMMD1 plays a role in a later step of the copper excretion pathway but is not involved in the translocation of the Wilson disease protein. Wilson disease is a genetic disorder of copper metabolism. Impaired biliary excretion results in a gradual accumulation of copper, which leads to severe disease. The specific gene defect lies in the Wilson disease protein, ATP7B, a copper-transporting ATPase that is highly active in hepatocytes. The two major functions of ATP7B in the liver are the copper loading of ceruloplasmin in the Golgi apparatus, and the excretion of excess copper into the bile. In response to elevated copper levels, ATP7B shows a unique intracellular trafficking pattern that is required for copper excretion from the Golgi apparatus into dispersed vesicles. We analyzed the translocation of ATP7B by both confocal microscopy and RNA interference, testing current models that suggest the involvement of Murr1/COMMD1 and Rab7 in this pathway. We found that although the ATP7B translocation is conserved among nonhepatic cell lines, there is no co-localization with Murr1/COMMD1 or the Rab marker proteins of the endolysosomal system. Consistent with this finding, the translocation of ATP7B was not impaired by the depletion of either Murr1/COMMD1 or Rab7, or by a dominant-negative Rab7 mutant. In conclusion, our data suggest that the translocation of ATP7B takes place independently of Rab7-regulated endosomal traffic events. Murr1/COMMD1 plays a role in a later step of the copper excretion pathway but is not involved in the translocation of the Wilson disease protein. Copper is a trace element in the diet, but is required as a protein co-factor for basic cellular processes and therefore essential for all living organisms. However, too much intracellular copper is cytotoxic, leading to the formation of reactive oxygen species. In mammals, intestinal copper uptake does not seem to be regulated, and homeostasis is achieved primarily by adjusting biliary excretion of copper.1Wijmenga C Klomp LW Molecular regulation of copper excretion in the liver.Proc Nutr Soc. 2004; 63: 31-39Crossref PubMed Scopus (70) Google Scholar, 2Prohaska JR Gybina AA Intracellular copper transport in mammals.J Nutr. 2004; 134: 1003-1006Crossref PubMed Scopus (237) Google ScholarWilson disease is characterized by gradual accumulation of copper in tissues, manifested by liver disease and/or neurological symptoms.3Gitlin JD Wilson disease.Gastroenterology. 2003; 125: 1868-1877Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar, 4Ala A Walker AP Ashkan K Dooley JS Schilsky ML Wilson's disease.Lancet. 2007; 369: 397-408Abstract Full Text Full Text PDF PubMed Scopus (831) Google Scholar This autosomal recessive disorder of copper homeostasis in humans is caused by a functional deficiency of ATP7B, the Wilson disease protein (WDP).5Bull PC Thomas GR Rommens JM Forbes JR Cox DW The Wilson disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene.Nat Genet. 1993; 5: 327-337Crossref PubMed Scopus (1686) Google Scholar, 6Tanzi RE Petrukhin K Chernov I Pellequer JL Wasco W Ross B Romano DM Parano E Pavone L Brzustowicz LM The Wilson disease gene is a copper transporting ATPase with homology to the Menkes disease gene.Nat Genet. 1993; 5: 344-350Crossref PubMed Scopus (1174) Google Scholar Many different mutations distributed along the whole ATP7B gene lead to Wilson disease.7Thomas GR Forbes JR Roberts EA Walshe JM Cox DW The Wilson disease gene: spectrum of mutations and their consequences.Nat Genet. 1995; 9: 210-217Crossref PubMed Scopus (487) Google Scholar, 8Ferenci P Caca K Loudianos G Mieli-Vergani G Tanner S Sternlieb I Schilsky M Cox D Berr F Diagnosis and phenotypic classification of Wilson disease.Liver Int. 2003; 23: 139-142Crossref PubMed Scopus (654) Google Scholar The WDP is critical for biliary excretion of copper9Terada K Aiba N Yang XL Iida M Nakai M Miura N Sugiyama T Biliary excretion of copper in LEC rat after introduction of copper transporting P-type ATPase, ATP7B.FEBS Lett. 1999; 448: 53-56Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar but also supplies copper ions for the ferroxidase ceruloplasmin,10Terada K Nakako T Yang X-L Iida M Aiba N Minamiya Y Nakai M Sakaki T Miura N Sugiyama T Restoration of holoceruloplasmin synthesis in LEC rat after infusion of recombinant adenovirus bearing WND cDNA.J Biol Chem. 1998; 273: 1815-1820Crossref PubMed Scopus (151) Google Scholar which is the main copper containing protein of serum.11Hellman NE Gitlin JD Ceruloplasmin metabolism and function.Annu Rev Nutr. 2002; 22: 439-458Crossref PubMed Scopus (659) Google Scholar Copper transport defects may also lead to systemic copper deficiency when ATP7A, a related intestinal P-type ATPase, is mutated.12Cox DW Moore SD Copper transporting P-type ATPases and human disease.J Bioenerg Biomembr. 2002; 34: 333-338Crossref PubMed Scopus (101) Google Scholar, 13Mercer JF Llanos RM Molecular and cellular aspects of copper transport in developing mammals.J Nutr. 2003; 133: 1481S-1484SPubMed Google Scholar, 14Lutsenko S Barnes NL Bartee MY Dmitriev OY Function and regulation of human copper-transporting ATPases.Physiol Rev. 2007; 87: 1011-1046Crossref PubMed Scopus (553) Google ScholarThe WDP is a copper-translocating ATPase highly expressed in hepatocytes. ATP7B features eight transmembrane domains forming a channel, and shows unidirectional ATP-dependent transport of cytoplasmic copper ions across lipid bilayers. In hepatocytes, translocated copper is secreted on the apical side into the bile or is transferred to the ferroxidase ceruloplasmin at a late Golgi compartment,3Gitlin JD Wilson disease.Gastroenterology. 2003; 125: 1868-1877Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar, 10Terada K Nakako T Yang X-L Iida M Aiba N Minamiya Y Nakai M Sakaki T Miura N Sugiyama T Restoration of holoceruloplasmin synthesis in LEC rat after infusion of recombinant adenovirus bearing WND cDNA.J Biol Chem. 1998; 273: 1815-1820Crossref PubMed Scopus (151) Google Scholar and is then secreted to the basolateral side (serum).ATP7B shows striking changes in its subcellular localization when copper concentrations are manipulated. At low copper levels, ATP7B is localized to the late Golgi compartment15Huster D Hoppert M Lutsenko S Zinke J Lehmann C Mossner J Berr F Caca K Defective cellular localization of mutant ATP7B in Wilson's disease patients and hepatoma cell lines.Gastroenterology. 2003; 124: 335-345Abstract Full Text PDF PubMed Scopus (121) Google Scholar, 16Roelofsen H Wolters H Van Luyn M Miura N Kuipers F Vonk R Copper-induced apical trafficking of ATP7B in polarized hepatoma cells provides a mechanism for biliary copper excretion.Gastroenterology. 2000; 119: 782-793Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar where presumably copper loading of ceruloplasmin takes place. However, when copper levels are high, ATP7B shifts away from the Golgi apparatus to cytoplasmically dispersed vesicles, which in polarized liver cells accumulate subapically.16Roelofsen H Wolters H Van Luyn M Miura N Kuipers F Vonk R Copper-induced apical trafficking of ATP7B in polarized hepatoma cells provides a mechanism for biliary copper excretion.Gastroenterology. 2000; 119: 782-793Abstract Full Text Full Text PDF PubMed Scopus (223) Google Scholar, 17Schaefer M Hopkins RG Failla ML Gitlin JD Hepatocyte-specific localization and copper-dependent trafficking of the Wilson's disease protein in the liver.Am J Physiol. 1999; 276: G639-G646PubMed Google Scholar, 18Hung IH Suzuki M Yamaguchi Y Yuan DS Klausner RD Gitlin JD Biochemical characterization of the Wilson disease protein and functional expression in the yeast Saccharomyces cerevisiae.J Biol Chem. 1997; 272: 21461-21466Crossref PubMed Scopus (287) Google Scholar, 19Guo Y Nyasae L Braiterman LT Hubbard AL N-terminal signals in ATP7B Cu-ATPase mediate its Cu-dependent anterograde traffic in polarized hepatic cells.Am J Physiol. 2005; 289: G904-G916Crossref Scopus (14) Google Scholar, 20Cater MA La Fontaine S Shield K Deal Y Mercer JF ATP7B mediates vesicular sequestration of copper: insight into biliary copper excretion.Gastroenterology. 2006; 130: 493-506Abstract Full Text Full Text PDF PubMed Scopus (105) Google Scholar It is not clear how copper transported into these vesicles would finally reach the bile, but it is generally assumed that the translocation of ATP7B is a necessary precondition for copper excretion.3Gitlin JD Wilson disease.Gastroenterology. 2003; 125: 1868-1877Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar, 21Forbes JR Cox DW Copper-dependent trafficking of Wilson disease mutant ATP7B proteins.Hum Mol Genet. 2000; 9: 1927-1935Crossref PubMed Scopus (136) Google Scholar, 22Cater MA La Fontaine S Mercer JF Copper binding to the N-terminal metal-binding sites or the CPC motif is not essential for copper-induced trafficking of the human Wilson protein (ATP7B).Biochem J. 2007; 401: 143-153Crossref PubMed Scopus (49) Google ScholarCertainly other proteins than ATP7B contribute to the molecular mechanism of copper excretion, and mutations or polymorphisms of these proteins might contribute to Wilson disease, maybe explaining the highly variable clinical presentation23Riordan SM Williams R The Wilson's disease gene and phenotypic diversity.J Hepatol. 2001; 34: 165-171Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar, 24Steindl P Ferenci P Dienes HP Grimm G Pabinger I Madl C Maier-Dobersberger T Herneth A Dragosics B Meryn S Knoflach P Granditsch G Gangl A Wilson's disease in patients presenting with liver disease: a diagnostic challenge.Gastroenterology. 1997; 113: 212-218Abstract Full Text PDF PubMed Scopus (321) Google Scholar, 25Ala A Borjigin J Rochwarger A Schilsky M Wilson disease in septuagenarian siblings: raising the bar for diagnosis.Hepatology. 2005; 41: 668-670Crossref PubMed Scopus (157) Google Scholar and course of this disease. Canine copper toxicosis of Bedlington terriers26Twedt DC Sternlieb I Gilbertson SR Clinical, morphologic, and chemical studies on copper toxicosis of Bedlington terriers.J Am Vet Med Assoc. 1979; 175: 269-275PubMed Google Scholar is caused by a deficiency of Murr1/COMMD127van De Sluis B Rothuizen J Pearson PL van Oost BA Wijmenga C Identification of a new copper metabolism gene by positional cloning in a purebred dog population.Hum Mol Genet. 2002; 11: 165-173Crossref PubMed Scopus (304) Google Scholar, 28Klomp AE van de Sluis B Klomp LW Wijmenga C The ubiquitously expressed MURR1 protein is absent in canine copper toxicosis.J Hepatol. 2003; 39: 703-709Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar and resembles Wilson disease, although ceruloplasmin levels are not decreased29Su LC Ravanshad S Owen Jr, CA McCall JT Zollman PE Hardy RM A comparison of copper-loading disease in Bedlington terriers and Wilson's disease in humans.Am J Physiol. 1982; 243: G226-G230PubMed Google Scholar and there are no evident neurological symptoms. Murr1/COMMD1 has been reported to interact physically with ATP7B.30Tao TY Liu F Klomp L Wijmenga C Gitlin JD The copper toxicosis gene product Murr1 directly interacts with the Wilson disease protein.J Biol Chem. 2003; 278: 41593-41596Crossref PubMed Scopus (159) Google Scholar, 31de Bie P Burstein E van De Sluis B Berger R Wijmenga C Duckett CS Klomp LWJ Several COMMD proteins interact with ATP7B; possible candidate genes for hepatic copper overload disorders with unknown etiology.Eur J Gastroenterol Hepatol. 2006; 18: A52Crossref Google Scholar, 32Donadio S De Keukeleire J Micoud J Piccarreta F Benharouga M Cellular localization and trafficking of endogenous ATP7B and COMMD1 proteins.FEBS J. 2007; 274 (106 Abstract): B1-B40Google Scholar Based on these observations, a role of Murr1/COMMD1 in the biliary excretion of copper downstream of Golgi-localized ATP7B has been suggested.2Prohaska JR Gybina AA Intracellular copper transport in mammals.J Nutr. 2004; 134: 1003-1006Crossref PubMed Scopus (237) Google Scholar, 3Gitlin JD Wilson disease.Gastroenterology. 2003; 125: 1868-1877Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar, 33de Bie P van de Sluis B Klomp L Wijmenga C The many faces of the copper metabolism protein MURR1/COMMD1.J Hered. 2005; 96: 803-811Crossref PubMed Scopus (65) Google Scholar Consistent with this, Murr1/COMMD1 was found on endolysosomal membranes but also in the cytosol28Klomp AE van de Sluis B Klomp LW Wijmenga C The ubiquitously expressed MURR1 protein is absent in canine copper toxicosis.J Hepatol. 2003; 39: 703-709Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar and in the nucleus.34Burstein E Hoberg JE Wilkinson AS Rumble JM Csomos RA Komarck CM Maine GN Wilkinson JC Mayo MW Duckett CS COMMD proteins: a novel family of structural and functional homologs of MURR1.J Biol Chem. 2005; 280: 22222-22232Crossref PubMed Scopus (204) Google Scholar Depletion of Murr1/COMMD1 by RNA interference results in an intracellular copper accumulation.35Burstein E Ganesh L Dick RD van De Sluis B Wilkinson JC Klomp LW Wijmenga C Brewer GJ Nabel GJ Duckett CS A novel role for XIAP in copper homeostasis through regulation of MURR1.EMBO J. 2004; 23: 244-254Crossref PubMed Scopus (178) Google Scholar, 36Spee B Arends B van Wees AM Bode P Penning LC Rothuizen J Functional consequences of RNA interference targeting COMMD1 in a canine hepatic cell line in relation to copper toxicosis.Anim Genet. 2007; 38: 168-170Crossref PubMed Scopus (21) Google Scholar The lack of exon 2 of the Murr1 gene leads to copper toxicosis in dogs, but the same deletion is embryonically lethal in mice.37van de Sluis B Muller P Duran K Chen A Groot AJ Klomp LW Liu PP Wijmenga C Increased activity of hypoxia-inducible factor 1 is associated with early embryonic lethality in Commd1 null mice.Mol Cell Biol. 2007; 27: 4142-4156Crossref PubMed Scopus (93) Google Scholar Murr1 is part of a larger protein family sharing a C-terminal leucine-rich domain termed the copper metabolism Murr1 domain (COMMD),34Burstein E Hoberg JE Wilkinson AS Rumble JM Csomos RA Komarck CM Maine GN Wilkinson JC Mayo MW Duckett CS COMMD proteins: a novel family of structural and functional homologs of MURR1.J Biol Chem. 2005; 280: 22222-22232Crossref PubMed Scopus (204) Google Scholar, 38Maine GN Burstein E COMMD proteins: COMMing to the scene.Cell Mol Life Sci. 2007; 64: 1997-2005Crossref PubMed Scopus (79) Google Scholar and there is evidence that the other members of this family also bind to ATP7B.31de Bie P Burstein E van De Sluis B Berger R Wijmenga C Duckett CS Klomp LWJ Several COMMD proteins interact with ATP7B; possible candidate genes for hepatic copper overload disorders with unknown etiology.Eur J Gastroenterol Hepatol. 2006; 18: A52Crossref Google Scholar Murr1 is involved in NF-κB-mediated regulation of gene transcription,39Ganesh L Burstein E Guha-Niyogi A Louder MK Mascola JR Klomp LW Wijmenga C Duckett CS Nabel GJ The gene product Murr1 restricts HIV-1 replication in resting CD4+ lymphocytes.Nature. 2003; 426: 853-857Crossref PubMed Scopus (189) Google Scholar, 40Maine GN Mao X Komarck CM Burstein E COMMD1 promotes the ubiquitination of NF-kappaB subunits through a cullin-containing ubiquitin ligase.EMBO J. 2007; 26: 436-447Crossref PubMed Scopus (207) Google Scholar which has been recently reviewed together with other possible functions of the COMMD family.38Maine GN Burstein E COMMD proteins: COMMing to the scene.Cell Mol Life Sci. 2007; 64: 1997-2005Crossref PubMed Scopus (79) Google Scholar XIAP is another protein interacting with Murr1, and enhanced degradation of XIAP mediated by copper binding sensitizes hepatocytes for apoptosis,41Mufti AR Burstein E Csomos RA Graf PCF Wilkinson JC Dick RD Challa M Son J-K Bratton SB Su GL XIAP is a copper binding protein deregulated in Wilson's disease and other copper toxicosis disorders.Mol Cell. 2006; 21: 775-785Abstract Full Text Full Text PDF PubMed Scopus (145) Google Scholar providing an unexpected new angle for copper-induced cell damage.Here, we applied confocal microscopy and RNA interference to investigate the copper-induced translocation of the WDP, testing current models2Prohaska JR Gybina AA Intracellular copper transport in mammals.J Nutr. 2004; 134: 1003-1006Crossref PubMed Scopus (237) Google Scholar, 3Gitlin JD Wilson disease.Gastroenterology. 2003; 125: 1868-1877Abstract Full Text Full Text PDF PubMed Scopus (304) Google Scholar, 33de Bie P van de Sluis B Klomp L Wijmenga C The many faces of the copper metabolism protein MURR1/COMMD1.J Hered. 2005; 96: 803-811Crossref PubMed Scopus (65) Google Scholar that hypothesize an interaction of Murr1 and ATP7B during this intracellular trafficking step. We found no evidence for a role of Murr1, suggesting that this protein is involved in a different step of copper excretion. Furthermore, we analyzed the reported relationship between ATP7B and Rab7-positive endosomes.42Harada M Kawaguchi T Kumemura H Terada K Ninomiya H Taniguchi E Hanada S Baba S Maeyama M Koga H Ueno T Furuta K Suganuma T Sugiyama T Sata M The Wilson disease protein ATP7B resides in the late endosomes with Rab7 and the Niemann-Pick C1 protein.Am J Pathol. 2005; 166: 499-510Abstract Full Text Full Text PDF PubMed Scopus (37) Google Scholar Although we could document a partial co-localization between Murr1 and Rab7, the WDP was not observed in Rab7-positive endosomes, even after copper-induced translocation to cytoplasmically dispersed vesicles.Materials and MethodsAntibodiesThe antibody against ATP7B was essentially prepared as described.18Hung IH Suzuki M Yamaguchi Y Yuan DS Klausner RD Gitlin JD Biochemical characterization of the Wilson disease protein and functional expression in the yeast Saccharomyces cerevisiae.J Biol Chem. 1997; 272: 21461-21466Crossref PubMed Scopus (287) Google Scholar Oligonucleotides were designed and used to amplify the region of the Wilson protein encoding amino acids 325 to 635. This region was amplified by polymerase chain reaction (PCR) and subcloned in the pGEX-2T vector (Amersham Pharmacia Biotech, Uppsala, Sweden). Escherichia coli BL21 cells harboring the expression plasmid were grown to an optical density of 1.5 at 600 nm at 31°C and induced with isopropyl 1-thio-β-d-galactopyranoside. Cultures were harvested by centrifugation, resuspended in phosphate-buffered saline (PBS) containing 1% Triton X-100, and lysed using a high-pressure cell crusher. The supernatant was incubated with glutathione-agarose beads. Bound glutathione S-transferase (GST) fusion protein was thrombin-cleaved to obtain the ATP7B-fragment. New Zealand White rabbits were immunized with 4 × 100 mg of this recombinant protein (immunization was performed according to standard procedures by EuroGentec, Seraing, Belgium).Affinity purification of the antiserum was performed using AminoLink Plus columns as recommended by the manufacturer (Pierce, Rockford, IL). Recombinant protein was coupled to the columns using 0.1 mol/L sodium citrate, 0.05 mol/L sodium carbonate, pH 10. Remaining active sites were blocked by sodium cyanoborohydride solution (5 mol/L NaCNBH3 in 0.01 mol/L NaOH). An additional pre-elution step using elution buffer (0.2 mol/L glycine-HCl, pH 2.6) was performed to remove noncovalently bound recombinant protein. After washing the column with PBS (pH 7.2), the antiserum was loaded to the column. After repeated washing, the bound antibodies were eluted from the column using the elution buffer. Protein concentration of the eluate was determined using a mini Bradford assay. The eluted antibody solution was rebuffered in PBS and 5% bovine serum albumin using PD-10 columns. For long-term storage 50% glycerol was added to the rebuffered antibody solution. The monoclonal COMMD1/Murr1 antibody (M01, clone 2A12) was obtained from Abnova Corporation (Jhongli City, Taiwan). The goat anti-Rab7 antibody (Sc6563) was obtained from Santa Cruz Biotechnology Inc. (Santa Cruz, CA). Monoclonal anti β-actin antibody (clone AC-15) was obtained from Sigma (St. Louis, MO).Cell CultureHeLa [American Type Culture Collection (ATCC) no.: CCL-2], Ptk2 (ATCC no.: CCL-56; derived from normal kidney of Potorous tridactylis), CaCo-2 (ATCC no.: HTB-37), MDCK (ATCC no.: CCL-34) cells were cultured according to the ATCC protocols. The immortalized human keratinocyte cell line, HaCaT, and the human hepatoma cell line, HuH7, were cultured in Dulbecco's modified Eagle's medium (high glucose 4.5 g/L), supplemented with glutamine (2 mmol/L), penicillin (400 U/ml), streptomycin (50 ng/ml), and 10% fetal bovine serum in a humidified 5% CO2 atmosphere at 37°C. The phoenix-gp packaging cell line was cultured as previously described.43Schuck S Manninen A Honsho M Fullekrug J Simons K Generation of single and double knockdowns in polarized epithelial cells by retrovirus-mediated RNA interference.Proc Natl Acad Sci USA. 2004; 101: 4912-4917Crossref PubMed Scopus (82) Google ScholarExpression PlasmidsRab7-GFP,44Bucci C Thomsen P Nicoziani P McCarthy J van Deurs B Rab7: a key to lysosome biogenesis.Mol Biol Cell. 2000; 11: 467-480Crossref PubMed Scopus (788) Google Scholar GFP-Rab7-DN(T22N),44Bucci C Thomsen P Nicoziani P McCarthy J van Deurs B Rab7: a key to lysosome biogenesis.Mol Biol Cell. 2000; 11: 467-480Crossref PubMed Scopus (788) Google Scholar Rab11-GFP,45Sönnichsen B De Renzis S Nielsen E Rietdorf J Zerial M Distinct membrane domains on endosomes in the recycling pathway visualized by multicolor imaging of Rab4, Rab5, and Rab11.J Cell Biol. 2000; 149: 901-914Crossref PubMed Scopus (797) Google Scholar Rab9-YFP,46Barbero P Bittova L Pfeffer SR Visualization of Rab9-mediated vesicle transport from endosomes to the trans-Golgi in living cells.J Cell Biol. 2002; 156: 511-518Crossref PubMed Scopus (232) Google Scholar and caveolin-1-GFP47Pelkmans L Kartenbeck J Helenius A Caveolar endocytosis of simian virus 40 reveals a new two-step vesicular-transport pathway to the ER.Nat Cell Biol. 2001; 3: 473-483Crossref PubMed Scopus (1041) Google Scholar were provided by Marino Zerial (MPI Molecular Cell Biology and Genetics, Dresden, Germany) and Lucas Pelkmans (ETH, Zurich, Switzerland), respectively. The T2-GFP plasmid48Storrie B White J Rottger S Stelzer EH Suganuma T Nilsson T Recycling of Golgi-resident glycosyltransferases through the ER reveals a novel pathway and provides an explanation for nocodazole-induced Golgi scattering.J Cell Biol. 1998; 143: 1505-1521Crossref PubMed Scopus (292) Google Scholar was supplied by Jamie White (EMBL, Heidelberg, Germany). The full-length ATP7B-cDNA5Bull PC Thomas GR Rommens JM Forbes JR Cox DW The Wilson disease gene is a putative copper transporting P-type ATPase similar to the Menkes gene.Nat Genet. 1993; 5: 327-337Crossref PubMed Scopus (1686) Google Scholar was provided by John R. Forbes (Department of Medical Genetics, University of Alberta, Edmonton, Canada) in a yeast vector. ATP7B-cDNA was subcloned using BamHI into pcDNA3 (Invitrogen, Carlsbad, CA), resulting in a mammalian expression vector. Generation of fluorescent protein-MURR1 fusion constructs was performed as follows: the complete coding region of human MURR1 was amplified from the total cDNA of the human CaCo-2 cells by PCR using sense primer (5′-ACGTAAGCTTACCATGGCGGCGGGCGAGCTTG-3′) and antisense primer (5′-CAC TGATCAGCCAGCCTAACGCGGATCCACGT-3′). The sense primer introduced a HindIII site and the consensus Kozak sequence ACC in front of the starter ATG, the antisense primer covered a BamHI restriction site and the stop codon. The HindIII to BamHI fragment of whole-length Murr1 cDNA was cloned upstream of green fluorescent protein (GFP) cDNA in the mammalian expression vector pEGFP-N1 (BD Biosciences Clontech, Mountain View, CA). The correct sequence was confirmed by bidirectional sequencing. Murr1-RFP was derived from the Murr1-GFP plasmid by replacing GFP (BamHI, NotI) with PCR-modified monomeric RFP.49Campbell RE Tour O Palmer AE Steinbach PA Baird GS Zacharias DA Tsien RY A monomeric red fluorescent protein.Proc Natl Acad Sci USA. 2002; 99: 7877-7882Crossref PubMed Scopus (1987) Google Scholar Murr1-GFP and Murr1-mRFP had identical localizations when co-expressed (see Supplemental Figure 1 at http://ajp.amjpathol.org).ImmunoblottingEqual amounts of protein (50 μg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis in 10% gels followed by electrophoretic transfer to nitrocellulose membranes, incubated with the primary antibody and visualized using enhanced chemiluminescence detection. Immunostaining of β-actin served as a further loading control.Transfection, Copper Exposure, and ImmunofluorescenceFor transient transfection cells were grown on coverslips in a six-well plate (10 cm2/well) to a density of ∼80% and transfected using 4 μg of plasmid DNA and 10 μl of Lipofectamine 2000 reagent (Invitrogen) per well according to the manufacturer's protocol. Six hours after transfection, cells were washed in prewarmed PBS (pH 7.2) and normal culture medium was added to the cells. Copper exposure experiments were started 46 hours after transfection. Before copper exposure, cells were washed twice in prewarmed PBS (pH 7.2) to remove culture medium. Cells were then either incubated with prewarmed Dulbecco's modified Eagle's medium containing 100 μmol/L of the copper chelator bathocuproinedisulfonic acid (BCS) or 100 μmol/L copper sulfate (CuSO4) for 2 hours.After repeated washing in PBS, cells grown on coverslips were fixed with methanol (−20°C) for 3 minutes. With this fixation procedure Murr1-GFP and Murr1-RFP showed a clean vesicular distribution. Use of paraformaldehyde emphasized the cytosolic and nuclear localization of Murr1 (see Supplemental Figure 1, a and b, at http://ajp.amjpathol.org). Antibodies were incubated in PBS containing 0.1% saponin (Sigma), 0.5% gelatin (Teleostan gelatin, Sigma), and 5 mg/ml bovine serum albumin. Corresponding secondary antibodies (donkey anti-rabbit/mouse; Dianova, Hamburg, Germany) were used conjugated to Cy3 or fluorescein isothiocyanate. Coverslips were mounted in Prolong Gold antifade mounting medium (Molecular Probes, Leiden, The Netherlands) and confocal images were taken on a TCS SP2 microscope (objective: ×63 magnification, oil immersion, NA 1.32; Leica Microsystems, Wetzlar, Germany). Double-immunofluorescence images were taken sequentially, and parameters were adjusted so that all light intensities were in the recording range. Intensity of the laser beam and photo multiplier levels were adjusted for each slide and each fluorophore (Cy3, fluorescein isothiocyanate, GFP, RFP, YFP, lysotracker); line averaging was set to 4 to optimize signal to noise ratio. Images shown were derived from representative single confocal planes and arranged with Adobe Photoshop and Adobe Illustrator (Adobe, San Jose, CA).RNA InterferenceTarget sequences for human Murr1/COMMD139Ganesh L Burstein E Guha-Niyogi A Louder MK Mascola JR Klomp LW Wijmenga C Duckett CS Nabel GJ The gene product Murr1 restricts HIV-1 replication in resting CD4+ lymphocytes.Nature. 2003; 426: 853-857Crossref PubMed Scopus (189) Google Scholar and Rab750Jäger S Bucci C Tanida I Ueno T Kominami E Saftig P Eskelinen EL Role for Rab7 in maturation of late autophagic vacuoles.J Cell Sci. 2004; 117: 4837-4848Crossref PubMed Scopus (680) Google Scholar were 5′-AAGUCUAUUGCGUCUGCAGAC-3′ and 5′-CGGUUCCAGUCUCUCGGUG-3′, respectively. Oligonucleotides encoding the corresponding shRNAs were designed and cloned into pSuper as described51Brummelkamp TR Bernards R Agami R A system for stable expression of short interfering RNAs in mammalian cells.Science. 2002; 296: 550-553Crossref PubMed Scopus (3942) Google Scholar except that BglII and XhoI were used. For confirmation, plasmids were sequenced in both directions.Cloning of the retroviral plasmids, transfection of the packaging cell line, collection of pseudotyped retrovirus particles, and transduction of HuH7 cells were as published.43Schuck S Manninen A Honsho M Fullekrug J Simons K Generation of single and double knockdowns in polarized epithelial cells by retrovirus-mediated RNA interference.Proc Natl Acad Sci USA. 2004; 101: 4912-4917Crossref PubMed Scopus (82) Google Scholar Briefly, the shRNA expression cassette was transferred by subcloning into the XhoI/EcoRI site of pRVH1-puro. Cells of the human phoenix gag-pol packaging cell line were grown in 10-cm dishes to near confluence. Using Lipofecta

The mechanism of fatty acid uptake is of high interest for basic research and clinical interventions. Recently, we showed that mammalian long chain fatty acyl-CoA synthetases (ACS) are not only essential enzymes for lipid metabolism but are also involved in cellular fatty acid uptake. Overexpression, RNAi depletion or hormonal stimulation of ACS enzymes lead to corresponding changes of fatty acid uptake. Remarkably, ACS are not localized to the plasma membrane where fatty acids are entering the cell, but are found instead at the endoplasmic reticulum (ER) or other intracellular organelles like mitochondria and lipid droplets. This is in contrast to current models suggesting that ACS enzymes function in complex with transporters at the cell surface. Drawing on recent insights into non-vesicular lipid transport, we suggest a revised model for the cellular fatty acid uptake of mammalian cells which incorporates trafficking of fatty acids across membrane junctions. Intracellular ACS enzymes are then metabolically trapping fatty acids as acyl-CoA derivatives. These local decreases in fatty acid concentration will unbalance the equilibrium of fatty acids across the plasma membrane, and thus provide a driving force for fatty acid uptake.

Sustaining clinical remission is an important treatment goal in moderate-to-severe UC. This post hoc exploratory analysis assessed the long-term efficacy of vedolizumab in the subset of patients with UC in the GEMINI 1 study who were in clinical remission by week 14 after 3 induction doses, administered at weeks 0, 2, and 6.Sustained clinical remission (primary endpoint) was evaluated using 2 definitions: (1) a partial Mayo Score (pMS) of ≤2 with no subscore >1 and (2) a rectal bleeding subscore (RBS) of 0 throughout weeks 14, 26, 38, and 52.The proportion of patients in clinical remission at week 14 was significantly higher in patients receiving vedolizumab (n = 620) compared with placebo (n = 149) (pMS: 32.7% vs 20.1% [percentage-point difference (∆) 12.6%; 95% confidence interval [CI], 5.2-20.0]; RBS: 47.3% vs 28.9% [∆18.4%; 95% CI, 10.1-26.7]). Of patients in clinical remission at week 14, a significantly higher proportion of vedolizumab-treated patients achieved sustained clinical remission compared with placebo (pMS: 66.5% vs 26.7%; ∆39.8%; 95% CI, 22.7-56.9; RBS: 56.7% vs 20.9%; ∆35.7%; 95% CI, 22.3-49.1). Findings were consistent in tumor necrosis factor (TNF) antagonist-naive and antagonist-failure patients.Compared with placebo, 35%-40% more patients receiving a full induction course of vedolizumab had sustained clinical remission after 52 weeks of therapy. This result was observed irrespective of TNF antagonist treatment history. Clinical remission at week 14 may therefore be a predictor for sustained clinical remission with vedolizumab.

To evaluate the outcome of anti-tumor necrosis factor alpha (anti-TNFα) therapy in outpatients with ulcerative colitis at a tertiary referral center.All patients with a confirmed diagnosis of ulcerative colitis undergoing therapy with infliximab and/or adalimumab at the outpatient clinic for inflammatory bowel diseases at the University Hospital Heidelberg between January 2011 and February 2014 were retrospectively enrolled. Patients with a follow-up period of less than 6 mo from start of anti-TNFα therapy were excluded. Medical records of all eligible individuals were carefully reviewed. Steroid-free clinical remission of a duration of at least 3 mo, colectomy rate, duration of anti-TNFα therapy, need for anti-TNFα dose escalation, and the occurrence of adverse events were evaluated as the main outcome parameters.Seventy-two patients were included (35 treated with infliximab, 17 with adalimumab, 20 with both consecutively). Median follow-up was 27 mo (range: 6-87 mo). Steroid-free clinical remission was achieved by 22.2% of the patients (median duration: 21 mo until end of follow-up; range: 3-66 mo). Patients attaining steroid-free clinical remission displayed lower hemoglobin and albumin blood levels at the start of treatment than those who did not achieve remission. The overall colectomy rate was 20.8%. Nearly 50% of the patients underwent anti-TNFα dose escalation during the follow-up period. For both the infliximab and the adalimumab treated patients, non-response to anti-TNFα therapy was the major reason for treatment discontinuation. 18.2% of the infliximab-treated patients and 13.5% of the adalimumab-treated patients had to discontinue their therapy due to adverse events.Real-life remission rates of ulcerative colitis under anti-TNFα are overall low, but some patients have a clear long-term benefit.

Intestinal mucus not only facilitates substrate absorption, but also forms a hydrophobic, phosphatidylcholine (PC) enriched, barrier against luminal gut contents.For evaluation of the origin of PC in intestinal mucus, we first analyzed the mucus PC in mice with absent biliary phospholipid secretion (mdr2 (-/-) mice) using electrospray ionization (ESI) tandem mass spectroscopy (MS/MS). Second, in situ perfused rat jejunum, ileum and colon were analyzed after i.v. bolus injections of 155 pmol [(3)H]-PC. Additional in vitro experiments were performed with isolated mucosal cells after incubation with the PC precursor [(3)H]-choline.In mdr2 (-/-) mice and control animals no significant quantitative difference in mucus PC was found, indicating that mucus PC is of intestinal and not biliary origin. In situ perfusion studies detected intestinal secretion of [(3)H]-PC, which was stimulated in presence of 2 mM taurocholate (TC). Secretion rates of [(3)H]-PC were highest in ileum (9.0+/-0.8 fmol h(-1)xcm(-1)), lower in jejunum (4.3+/-0.5) and minimal in colon (0.8+/-0.2). It compares to an intestinal secretion of native PC originating to 64% from bile, 9% from jejunum, 28% from ileum, and 1% from colon. Complementary in vitro studies showed 30-min secretion rates for [(3)H]-PC to be highest in enterocytes from ileum (26.5+/-5.3% of intracellular [(3)H]-PC) and jejunum (19.8+/-2.9%), and significantly lower in colonocytes (8.4+/-1.3%).PC in the intestinal mucus originates from secretion by ileal and jejunal enterocytes.

A definition of disease activity in ulcerative colitis (UC) is difficult. The clinical activity index (CAI) is only an indirect assessment tool of bowel inflammation and the endoscopic activity index (EAI) sometimes cannot reflect the severity of disease to the full extent. Therefore, there is a need for an objective means to quantify inflammatory activity in mucosal biopsies. In our study, we wanted to examine the correlation between transcript levels of interleukin 8 (CXCL8), interferon γ inducible protein 10 (CXCL10), myeloid-related protein 14 (calgranulin B), macrophage inflammatory protein 2 α (CXCL2) with CAI and EAI in UC. Cytokine and chemokine transcripts were quantified using real-time PCR in 49 mucosal biopsies from 27 different patients with UC. Cytokine transcript levels were correlated with CAI and EAI. There was a statistically significant positive correlation between CXCL8 (r = 0.30; p < 0.05), CXCL10 (r = 0.40; p < 0.02), calgranulin B (r = 0.36; p < 0.03), CXCL2 (r = 0.31; p < 0.05) and CAI. Concerning EAI significant positive correlations for CXCL8 (r = 0.37; p < 0.02), CXCL10 (r = 0.33; p < 0.04), calgranulin B (r = 0.31; p < 0.05) and CXCL2 (r = 0.44; p < 0.05) were found. Low clinical and endoscopic activity was accompanied by low cytokine levels whereas high CAI and EAI were associated with high cytokine levels. From our data, we conclude that real-time PCR quantification of CXCL8, CXCL10, calgranulin B and CXCL2 in colonic biopsies is a simple and objective method for grading inflammation of intestinal mucosa in UC. CXCL8, CXCL10, calgranulin B and CXCL2 might be used as biomarkers and thus as an objective tool especially in clinical trials to evaluate anti-inflammatory and immunomodulatory regimens.

Importance of the field: As the pathogenesis of ulcerative colitis (UC) is unknown, a causative therapy is lacking. Therefore, some UC patients suffer from disease activity despite symptomatic anti-inflammatory treatment strategies. We claim that reduction of phosphatidylcholine (PC) in colonic mucus impairs the mucosal barrier and, thus, causes attacks of the commensal bacterial flora to induce colitis. Thus, mucus PC substitution could provide a causal therapy for UC.Areas covered in this review: A delayed released oral PC preparation (rPC) was found to substitute for the lack of PC in rectal mucus. In non-steroid-treated active UC, 53% of rPC-treated patients reached remission compared with 10% of placebo patients (p < 0.001). In a second trial with chronic-active, steroid-dependent UC patients, steroid withdrawal with a concomitant achievement of remission (CAI ≤ 3) or clinical response (≥ 50% CAI improvement) was reached in 15 rPC-treated patients (50%) but only in 3 (10%) placebo patients (p = 0.002).What the reader will gain: The concept that missing PC in colonic mucus is the main pathogenetic factor for development of UC. PC can be substituted by rPC, which cures the disease in the majority of patients.Take home message: rPC is, to our knowledge, the first causative therapeutic option for patients with UC.

Hepcidin (gene name HAMP), an IL-6-inducible acute phase peptide with antimicrobial properties, is the key negative regulator of iron metabolism. Liver is the primary source of HAMP synthesis, but it is also produced by other tissues such as kidney or heart and is found in body fluids such as urine or cerebrospinal fluid. While the role of hepcidin in biliary system is unknown, a recent study demonstrated that conditional gp130-knockout mice display diminished hepcidin levels and increased rate of biliary infections.Expression and localization of HAMP in biliary system was analyzed by real time RT-PCR, in-situ hybridization, immunostaining and -blotting, while prohepcidin levels in human bile were determined by ELISA.Hepcidin was detected in mouse/human gallbladder and bile duct epithelia. Biliary HAMP is stress-inducible, in that it is increased in biliary cell lines upon IL-6 stimulation and in gallbladder mucosa of patients with acute cholecystitis. Hepcidin is also present in the bile and elevated prohepcidin levels were observed in bile of primary sclerosing cholangitis (PSC) patients with concurrent bacterial cholangitis compared to PSC subjects without bacterial infection (median values 22.3 vs. 8.9; p = 0.03). In PSC-cholangitis subjects, bile prohepcidin levels positively correlated with C-reactive protein and bilirubin levels (r = 0.48 and r = 0.71, respectively). In vitro, hepcidin enhanced the antimicrobial capacity of human bile (p<0.05).Hepcidin is a stress-inducible peptide of the biliary epithelia and a potential marker of biliary stress. In the bile, hepcidin may serve local functions such as protection from bacterial infections.

This study examined differences in personality, psychological distress, and stress coping in inflammatory bowel disease (IBD) depending on type of disease and disease activity. We compared patients suffering from Crohn's disease (CD) and ulcerative colitis (UC) with controls. While the literature is replete with distinctive features of the pathogenesis of IBD, the specific differences in psychological impairments are not well studied. In this German national multicenter study, participants were recruited from 32 centers. Two hundred ninety-seven questionnaires were included, delivering vast information on disease status and psychological well-being based on validated instruments with a total of 285 variables. CD patients were more affected by psychological impairments than patients suffering from UC or controls. Importantly, patients with active CD scored higher in neuroticism (p < 0.01), psychological distress (p < 0.001) and maladaptive stress coping (escape, p = 0.03; rumination, p < 0.03), but less need for social support (p = 0.001) than controls. In contrast, patients suffering from active UC showed psychological distress (p < 0.04) and maladaptive coping (avoidance, p < 0.03; escape, p = 0.01). Patients in remission seemed to be less affected. In particular, patients with UC in remission were not inflicted by psychological impairments. The group of CD patients in remission however, showed insecurity (p < 0.01) and paranoid ideation (p = 0.04). We identified specific aspects of psychological impairment in IBD depending on disease and disease activity. Our results underscore the need for psychological support and treatment particularly in active CD. Diese Studie untersuchte Unterschiede in der Persönlichkeit, psychische Belastung und Stressbewältigung bei chronisch-entzündlichen Darmerkrankungen (CED) in Abhängigkeit von der Art der Erkrankung und der Krankheitsaktivität. Wir verglichen Patienten mit Morbus Crohn (CD) und Colitis ulcerosa (UC) mit Kontrollgruppen. Während die Literatur zu charakteristischen Merkmalen der Pathogenese von IBD zahlreich ist, sind die spezifischen Unterschiede in den psychischen Beeinträchtigungen nicht ausreichend untersucht. In dieser deutschen nationalen Multicenterstudie wurden Teilnehmer aus 32 Zentren rekrutiert. Es wurden 297 Fragebögen mit umfassenden Informationen über den Krankheitsstatus und das psychische Wohlbefinden auf der Grundlage validierter psychosozialer Instrumente mit insgesamt 285 Items evaluiert. CD-Patienten waren stärker von psychischen Beeinträchtigungen betroffen als Patienten mit UC oder Kontrollen. Wichtig ist, dass Patienten mit aktiver CD in den Bereichen Neurotizismus (p < 0,01), psychische Belastung (p < 0,001) und maladaptive Stressbewältigung (p < 0,03) höhere Werte, aber weniger Bedarf für soziale Unterstützung (p = 0,001) als Kontrollen aufwiesen. Im Gegensatz dazu zeigten Patienten, die an aktiver UC litten, psychische Belastung (p < 0,04) und maladaptive Coping (Vermeidung, p < 0,03; Flucht, p = 0,01). Patienten in Remission schienen weniger betroffen zu sein. Die Gruppe der CD-Patienten in Remission zeigte jedoch Unsicherheit (p < 0,01). Wir identifizierten spezifische Aspekte der psychischen Beeinträchtigung bei IBD abhängig von Krankheit und Krankheitsaktivität. Unsere Ergebnisse untermauern den Bedarf an psychologischer Unterstützung und Behandlung, insbesondere bei aktiver CD.

A young pregnant woman (32nd week of gestation) presented with acute chest pain due to right coronary artery dissection (CAD) in a pre-hospital setting. The pre-hospital diagnosis by the ambulance staff of an acute myocardial infarction in the antenatal period based on a 12-lead ECG combined with successful treatment by percutaneous coronary intervention with stenting is novel.

AIM:To investigate a possible increase of basolateral expression of carcinoembryonic antigen (CEA) by interfering with the apical transport machinery, we studied the effect of cholesterol depletion on CEA sorting and secretion. METHODS:Cholesterol depletion was performed in polarized Caco-2 cells using lovastatin and methyl-bcyclodextrin. RESULTS:We show that CEA is predominantly expressed and secreted at the apical surface.Reduction of the cholesterol level of the cell by 40%-50% with lovastatin and methyl-b-cyclodextrin led to a significant change of the apical-to-basolateral transport ratio towards the basolateral membrane. CONCLUSION:As basolateral expression of CEA has been suggested to have anti-inflammatory properties, Cholesterol depletion of enterocytes might be a potential approach to influence the course of inflammatory bowel disease.

Hepcidin, a cysteine-rich peptide hormone with antimicrobial and iron-regulatory activity, plays a central role in regulating iron metabolism during inflammation, hypoxia, iron deficiency, and iron overload. The aim of this study was to isolate and sequence the guinea pig hepcidin gene and show peptide's tissue distribution to identify the guinea pig as good animal model to study the regulation and function of hepcidin. The guinea pig hepcidin cDNA contains a 252 bp open reading frame encoding for an 83 amino acid protein with eight highly conserved cysteine residues. Phylogenetic analyses showed that guinea pig hepcidin was more related to human and chimpanzee than to rodents like mouse or rat. RT-PCR studies revealed that hepcidin mRNA was most abundant in liver, less ample in pancreas, heart, and kidney and not detectable in lung and biliary system. Western blot analyses showed a distinct immunoreactive band of approximately 8 kDa, consistent with the predicted size of prohepcidin, and revealed that guinea pig hepcidin protein is synthesized predominantly in the liver, and with lower expression in kidney, heart, and pancreas. Immunohistochemical studies showed hepcidin predominantly at the basolateral membrane domain of hepatocytes in periportal regions. In pancreas, hepcidin immunoreactivity was confined to endocrine islets of Langerhans, while hepcidin was seen in tubules, but not in the glomeruli in the kidney. Our data identify guinea pig as a convenient model organism to study the role of hepcidin, given the remarkable sequence similarity and tissue distribution pattern largely identical to human.

Crohn's disease (CD) and ulcerative colitis (UC) commonly affect women in their childbearing years. Vedolizumab (VDZ) is approved for treatment of moderate-to-severe CD and UC, but there is a knowledge gap regarding its use during pregnancy. This targeted literature review describes available evidence on safety of VDZ in pregnant patients in order to offer physicians a detailed and balanced view on persistent data during their decision-making process for an individualized treatment concept.The search included literature from the MEDLINE database and abstracts of five gastroenterological conferences published until November 2019. Publications were included if pregnancy outcomes in women receiving VDZ or neonatal outcomes in newborns of women previously exposed to VDZ were reported.Out of 196 initially identified records, 18 publications reporting results of five different studies were identified. In total, for 213 of 284 VDZ-exposed documented pregnancies the following pregnancy outcomes were reported: 167 live births (172 infants due to twin births), 1 stillbirth, 35 miscarriages, 10 elective terminations (1 due to detected Down syndrome). Furthermore, during pregnancy, the following complications were observed: seven cases of (pre) eclampsia, three cases of premature rupture of membranes and one case each of placenta previa, chorioamnionitis, pneumonia, first-trimester bleeding, cholestasis, sepsis, or neonatal intraventricular hemorrhage. Based on 172 infants, 30 preterm deliveries (17.4%), 9 cases of low birth weight (5.2%), 5 infections (2.9%), and 6 cases (3.8%) with congenital anomalies were reported.There was no evidence for safety concerns regarding pregnancy outcomes associated with VDZ therapy. Due to the limited scope of included records, further research is needed to understand the safety profile regarding the use of VDZ during pregnancy.

Background and aims:The etiopathogenesis of inflammatory bowel diseases (IBD) remains largely unexplained.Flotillins (flotillin-1 and flotillin-2) are ubiquitous proteins which have been linked to inflammation and regeneration.We hypothesized that alterations in the expression of flotillin-2 in enterocytes may be related to the pathogenesis of IBD as a classical example of an inflammatory disorder of mostly unknown origin.Methods: Cell and tissue localization of flotillin-2 (and -1) were investigated by immunofluorescent staining in 1. polarized and unpolarized CaCo-2w cells as a model of human enterocytes (native and after TNFα stimulation) and 2. intestinal biopsies from controls, patients with ulcerative colitis (UC) and patients with Crohn's disease (CD).For quantification of flotillin-2, we analyzed its expression in ileal and colonic biopsies from controls, UC patients and CD patients using real-time RT-PCR, Western blot and indirect immunofluorescence.Results: In polarized CaCo-2w cells and human enterocytes in biopsies, flotillins were localized at the basolateral membrane and on subapical vesicles, but not in the apical membrane.Flotillin-2 expression did not differ between UC patients, CD patients and controls.However, it was significantly higher in colonic biopsies compared to ileal biopsies in all groups.Conclusions: By virtue of its abundant expression in enterocytes, flotillin-2 must have an essential function in intestinal physiology, especially in the colon.Yet our data could not link flotillin-2 to the pathogenesis of IBD.

Abstract Background In this real-world-evidence (RWE) study we aimed to analyse the persistence of biologic therapy in biologic-naïve ulcerative colitis (UC) patients and to compare 1-year effectiveness of vedolizumab (VDZ) and anti-TNF. Methods Between 2017 and 2020, 1200 consecutively enrolled biologic-naïve and biologic- experienced patients with UC and Crohn′s disease (CD) were prospectively included in the VEDOIBD-Registry from 45 IBD-experienced centres across Germany. After exclusion of bio-experienced patients, CD and missing outcomes, the final sample consisted of 274 biologic-naïve UC-patients with 1-year follow-up data. Switchers of a drug were considered as treatment failure (modified intention-to-treat analysis; mITT) while switchers were excluded from per protocol analysis (PP). Clinical response modified (reduction of partial Mayo score (pMayo) from baseline to 1-year by &amp;gt;3 points or a reduction of at least 30% compared to baseline or reaching remission at 1-year) and (steroid-free) remission rates (pMayo ≤1 plus a bleeding subscore=0 (and no systemic use of steroids or budesonide at 1-year)) were predefined as outcomes. To reduce the effect of confounders, PS adjustment with inverse probability of treatment weighting (IPTW) was implemented. A weighted logistic regression was used, and the results were reported as odds ratio (OR) and 95% confidence interval (CI). Results 158 VDZ and 116 anti-TNF (ADA: 27.6%, IFX: 57.8%, GOL: 14.7%) biologic-naïve UC-patients were included in this prospective RWE comparing the effectiveness of VDZ vs anti-TNF. Until week 52 significantly more patients switched to another biologic-drug in the anti-TNF group than in the VDZ group (40.5% vs 16.5%; p&amp;lt;0.001) (Fig. 1). In mITT, clinical response at 1-year was significantly higher in VDZ than in anti-TNF treated patients (61.7% vs. 40.3%; OR 2.39 (95% CI 1.39–4.10)). VDZ also tended to be superior to anti-TNF for (steroid-free) remission (Tab. 1; p=0.058 (p=0.051)). In the PP-analysis, VDZ showed numerically higher 1-year effectiveness, but this did not reach statistical significance (Tab. 1). Analysing week-14 induction phase responders (Tab. 2), VDZ had numerically higher effectiveness rates compared to anti-TNF but without significant difference. Conclusion The 1-year maintenance findings suggested, in line with our previous induction phase data, only moderate long-term effectiveness in both groups. However, besides the significant response data, VDZ showed numerically higher remission rates compared to anti-TNF though only borderline significant. The higher treatment persistence of VDZ vs anti-TNF, along with the higher effectiveness, may suggest VDZ as a first-line biologic therapy option in UC patients.

In September 2009, the German "Standing Committee for Vaccination" (STIKO) recommended the H1N1 influenza vaccination to all patients with chronic diseases. We investigated the adherence to this recommendation in patients with the inflammatory bowel diseases (IBD) Crohn's disease or ulcerative colitis. Special attention was paid to arguments for vaccination refusal.In an explorative multicenter study we asked adult patients to answer a questionnaire about their participation in the H1N1 vaccination campaign, their arguments for and against this vaccination and disease specific parameters.Out of 1389 participating patients, 226 (16 %) received the H1N1 vaccination. Among patients who were vaccinated against the seasonal flu as well as patients who were treated with anti-TNF-treatment and members of the German Crohn's and Colitis Association, the participation rates were significantly higher (32 %, 26 %, 25 %, respectively). The main argument against the H1N1 vaccination was fear of side effects (59 %). However, 77 % of all vaccinated patients judged the vaccine as very well tolerated. The non-adherence to general vaccination recommendations against tetanus and seasonal flu was also high (25 % and 66 %, respectively).Only a minority of patients with Crohn's disease or ulcerative colitis had adhered to the official recommendation concerning vaccination against H1N1. In order to reach higher acceptance, further vaccination campaigns must focus on the safety of the recommended vaccine.

The aim of this observational, real-world evidence, modified intention-to-treat (mITT) study based on prospectively collected data from the VEDOIBD registry was to compare the effectiveness of vedolizumab (VEDO) vs antitumor necrosis factor (anti-TNF) in biologic-naïve Crohn's disease (CD) patients.Between 2017 and 2020, 557 CD patients starting therapy with VEDO or anti-TNF were consecutively enrolled in 45 IBD centers across Germany. Per study protocol, the analysis excluded biologic-experienced patients and those with a missing Harvey-Bradshaw Index score, resulting in a final sample of 327 biologic-naïve CD patients. Clinical remission was measured using the Harvey-Bradshaw Index at the end of induction therapy and after 1 and 2 years. Switching to a different therapy was considered an outcome failure. Propensity score adjustment with inverse probability of treatment weighting was used to correct for confounding.The effectiveness of both VEDO (n = 86) and anti-TNF (n = 241) was remarkably high for induction treatment, but VEDO performed significantly less well than anti-TNF (clinical remission: 56.3% vs 73.9%, P < .05). In contrast, clinical remission after 2 years was significantly better for VEDO compared with anti-TNF (74.2% vs 44.7%; P < .05; odds ratio, 0.45; 95% CI, 0.22-0.94). Remarkably, only 17% of patients switched from VEDO to another biologic vs 44% who received anti-TNF.The results of this prospective, 2-year, real-world evidence study suggest that the choice of VEDO led to higher remission rates after 2 years compared with anti-TNF. This could support the role of VEDO as a first-line biologic therapy in CD.

Background: Sustained remission is a key therapeutic goal in ulcerative colitis (UC). Vedolizumab (VDZ) was more effective than placebo as induction and maintenance therapy in patients (pts) with moderately to severely active UC in the GEMINI 1 study (NCT00783718). This post hoc analysis assessed sustained remission during the maintenance phase of GEMINI 1. Methods: Analyses included pts enrolled in GEMINI 1, who received 6 weeks (wks) of induction with placebo or VDZ and entered 46 wks of maintenance continuing placebo or VDZ, respectively; eligible pts could then enrol into an open-label extension (OLE) to receive VDZ every 4 wks. The primary aim was to assess sustained remission (remission at Wks 26, 38 and 52) in pts who achieved remission at Wk 14. Remission was defined as 1) clinical remission (partial Mayo Score [PMS] ≤2 points with no individual subscore >1 point) or 2) rectal bleeding subscore =0. For the analyses, pts who received VDZ maintenance, discontinued before Wk 52 and then entered the OLE had missing maintenance data imputed using OLE data. Results: In total, 620 pts received VDZ (Wk 6 responders and non-responders) and 149 received placebo throughout GEMINI 1. Patient characteristics were broadly similar between treatment groups. From Wk 4 onwards, a significantly higher proportion of pts receiving VDZ were in clinical remission versus placebo in the overall and anti-TNF-naïve populations; significance was achieved at Wk 26 in the anti-TNF failure population. At Wk 14, 203 (33%) pts receiving VDZ and 30 (20%) pts receiving placebo were in clinical remission based on PMS, and 293 (47%) pts receiving VDZ and 43 (29%) pts receiving placebo were in remission based on rectal bleeding subscore. Of pts in remission at Wk 14, the VDZ group had a higher proportion of pts with sustained remission versus placebo according to both PMS and rectal bleeding definitions (Table); significance was reached in both the overall and anti-TNF-naïve populations, and a similar nominal trend was observed in the anti-TNF failure population. Table 1. Patients with remission at Week 14 that was sustained for all visits at Weeks 26, 38 and 52 Conclusions: Wk 6 is most likely too early to ascertain the full clinical benefit of VDZ. VDZ showed a significant difference versus placebo in the proportion of pts achieving clinical remission as early as Wk 4 for the overall and anti-TNF naïve populations. However, as per label, assessment of the clinical benefit should be made after 10–14 wks. In pts with remission at Wk 14 in GEMINI 1, continued VDZ treatment resulted in ∼60% of pts maintaining sustained remission based on PMS and rectal bleeding subscore.

worsening UC symptoms that necessitated colectomy.Three patients in the 1.0 mg/kg and 2 patients in the 3.0 mg/kg cohorts had clinical responses; however, the clinical response of one patient in the 1.0 mg/kg cohort was confounded by the initiation of concomitant immunomodulator therapy 2 months prior to MDX-1100 administration.Three responding patients relapsed after 50, 85 and 93 days, respectively and have been administered additional MDX-1100 doses; 2 patients responded to re-treatment.Pharmacodynamic and pharmacokinetic analyses were performed.Conclusion: This pilot study demonstrated that single doses of up to 10 mg/kg of a fully human anti-CXCL10 monoclonal antibody in patients with active ulcerative colitis was safe.Clinical responses were seen at dose levels at or above 1.0 mg/kg.These data support further studies of MDX-1100 in ulcerative colitis.

Abstract Background To gain insight into vedolizumab (VDZ) use as a first-line biologic in Crohn′s Disease (CD), this real-world study aimed to assess, within the maintenance phase, the 1-year comparative effectiveness and persistence of VDZ vs anti-TNF therapy in biologic-naïve CD-patients. Methods Between 2017–2020, 1200 consecutively enrolled biologic-naïve and biologic-experienced patients with ulcerative colitis (UC) and CD were prospectively included in the VEDOIBD-Registry from 45 IBD-experienced centres across Germany. 294 biologic-naïve CD-patients starting a new therapy with VDZ or anti-TNF (adalimumab: ADA or infliximab: IFX) were included in this real-world evidence (RWE) study. The Kaplan-Meier was used to summarize the treatment persistence from the start of therapy through week-52. The primary outcome was week-52 clinical remission (HBI ≤ 4). Patients were analyzed on a modified intent-to-treat basis (mITT; switchers considered as outcome failure) and on a per-protocol (PP) basis (excluding switchers). To reduce selection bias in the estimation of treatment effects, the inverse probability of treatment weighting propensity score (PS) was implemented. A weighted logistic regression was used to evaluate the effectiveness. The results were reported as odds ratio (OR) and 95% confidence interval (CI). Results 71 VDZ and 223 anti-TNF (ADA: 59.6%, IFX: 40.4%) biologic-naïve CD-patients were evaluated. 52-weeks after treatment initiation approximately 94% of VDZ patients were still in continuous treatment vs 75% of ADA and 78% of IFX (Figure 1). The mITT 1-year clinical remission rate was 76.1% for VDZ vs 63.8% for anti-TNF (OR: 1.80, 95% CI: 0.86–3.76). Similar results were observed for VDZ vs IFX (Table 1). In contrast, the clinical remission was significantly higher in the VDZ group than in the ADA group (OR: 2.24, 95% CI: 1.04–4.85). The PP analysis suggested comparative effectiveness, having excluded more anti-TNF switchers. 91.7% of week-14 responders VDZ patients were in clinical remission from week 14 through 52 vs 66.1% of anti-TNF patients (OR: 5.69, 95% CI: 1.66–19.5). Similar, significant, results were observed for VDZ vs ADA and for VDZ vs IFX (Table 2). Conclusion In this real-world setting comparing VDZ and anti-TNF in biologic-naïve patients via PS weighted analysis, VDZ showed especially in week-14 responders higher clinical remission rates in comparison to anti-TNF. The higher treatment persistence observed for VDZ, perhaps due to a more favourable safety profile vs anti-TNF, may be considered the main driver for the better effectiveness of VDZ at one year. These findings may aid physicians’ decision-making on the choice of VDZ as the first-line biologic for CD.

To investigate whether the secretion of phosphatidylcholine (PC) in intestinal mucus occurs by apical secretion or via basolateral excretion and to determine its subsequent passage across the tight junctions to the apical mucus.We addressed this question using the polarized intestinally differentiated tumor cell line CaCo-2 grown on filters to confluence in Transwell culture chambers. The released PC and sphingomyelin (Sph) from apical and basolateral media were analyzed by mass spectrometry.The secreted PC species were identical in both compartments indicating the same intracellular origin of PC. However, PC secretion into the basolateral compartment was more effective, and the PC:Sph ratio in the basolateral compartment was significantly higher than that in the apical compartment (8.18 +/- 1.84 vs 4.31 +/- 1.22, P = 0.01). Both pathways were temperature sensitive and were unaltered in the presence of cyclosporine.The data demonstrate the PC secretion capacity of CaCo-2 cells and indicate two separated apical and basolateral release mechanisms.

Einleitung: Phosphatidylcholin (PC) ist ein wichtiger Bestandteil der intestinalen Mucusbarriere. Aufgrund seiner besonderen biophysikalischen Eigenschaften erhöht es deren Hydrophobizität und damit die Stabilität gegenüber intraluminalen Noxen.

Background: Intestinal mucus not only facilitates substrate absorption, but also forms a hydrophobic, phosphatidylcholine (PC) enriched, barrier against luminal gut contents. Methods: For evaluation of the origin of PC in intestinal mucus, we first analyzed the mucus PC in mice with absent biliary phospholipid secretion (mdr2 (−/−) mice) using electrospray ionization (ESI) tandem mass spectroscopy (MS/MS). Second, in situ perfused rat jejunum, ileum and colon were analyzed after i.v. bolus injections of 155 pmol [3H]-PC. Additional in vitro experiments were performed with isolated mucosal cells after incubation with the PC precursor [3H]-choline. Results: In mdr2 (−/−) mice and control animals no significant quantitative difference in mucus PC was found, indicating that mucus PC is of intestinal and not biliary origin. In situ perfusion studies detected intestinal secretion of [3H]-PC, which was stimulated in presence of 2 mM taurocholate (TC). Secretion rates of [3H]-PC were highest in ileum (9.0±0.8 fmol h−1×cm−1), lower in jejunum (4.3±0.5) and minimal in colon (0.8±0.2). It compares to an intestinal secretion of native PC originating to 64% from bile, 9% from jejunum, 28% from ileum, and 1% from colon. Complementary in vitro studies showed 30-min secretion rates for [3H]-PC to be highest in enterocytes from ileum (26.5±5.3% of intracellular [3H]-PC) and jejunum (19.8±2.9%), and significantly lower in colonocytes (8.4±1.3%). Conclusion: PC in the intestinal mucus originates from secretion by ileal and jejunal enterocytes.

Die Therapie der Colitis ulcerosa erfolgt heutzutage in den meisten Fällen ambulant. Trotzdem ist bei schwersten Schüben mit systemischen Begleitsymptomen eine stationäre Therapie erforderlich. In diesem Fall ist ein intensiver interdisziplinärer Austausch zwischen Chirurgen und Internisten erforderlich, um eine konservative Therapie gegenüber einer Operation (Kolektomie) abzuwägen. Bei stationärer Aufnahme werden in der Regel, neben einer empirischen Antibiose als Primärtherapie, intravenöse Steroide eingesetzt. Sprechen diese nicht schnell genug an (nach 3–5 Tagen), sollte auf eine Zweitlinientherapie mit einem Calcineurininhibitor oder einem TNFα-Antagonisten eskaliert werden. Ob ein Calcineurininhibitor oder ein TNFα-Antagonist in der Zweitlinie bevorzugt zum Einsatz kommt, muss im Einzelfall unter Beachtung der Vor- und Nachteile sowie der persönlichen Erfahrungen mit den Substanzen abgewogen werden. Die Indikation für einen sequenziellen Einsatz dieser Substanzen in Drittlinie ist in der Regel nicht indiziert und sollte nur sehr zurückhaltend gestellt werden. Eine Kolektomie sollte insbesondere dann erwogen werden, wenn die Erstlinientherapie mit Steroiden nicht erfolgreich ist, wenn die Zweitlinientherapie versagt oder wenn Komplikationen auftreten. Der überwiegende Teil der Patienten (> 70 %) zeigt bei einer konservativen Therapie ein Ansprechen, sodass eine Proktokolektomie und Pouchanlage im gebesserten Allgemeinzustand im Intervall erfolgen oder sogar langfristig vermieden werden kann.

Einleitung: Papillen-Karzinome werden entsprechend ihres epithelialen Ursprungs in pankreato-biliäre und intestinale Subtypen eingeteilt.

Phospholipids are an important functional constituent of the intestinal mucosal barrier. They are not only essential for the cell membranes of intestinal epithelial cells, but are also abundant within the intestinal mucus layer which coats the gastrointestinal tract continually with a thickness of up to about 800 µm [1]. This layer is the very first line of defense of the host against potential luminal aggressors like the trillions of bacteria inhabiting the colon [2,3]. Apart from water, it is predominantly composed of glycoproteins, lipids, other proteins and nucleic acids [1,4].

rats fed with HFD and it was suggested that a reduced activity of intestinal nutrient receptors for fatty acids as well as the restoration of the satiating peptide CCK might play a role on this effect.

Einleitung: Die Ätiopathogenese chronisch-entzündlicher Darmerkrankungen ist weiterhin zu einem großen Teil ungeklärt. Flotilline (Flotillin-1 und Flotillin-2) sind ubiquitär vorkommende Proteine, welche bei Prozessen der Entzündung und der Regeneration eine wesentliche Rolle spielen. Die Hypothese war, dass Veränderungen der Expression von Flotillin-2 in Enterozyten in der Pathogenese chronisch-entzündlicher Darmerkrankungen relevant sein könnten.

Clinical: Diagnosis and outcome S131 8.4±6.7 yr., and the mean follow-up time for fistulae being 31±27 months.14/39 (36%) patients had one fistulae the remaining multiple, with maximum four.24 patients (62%) were complicated by abscesses and loose seton placement was applied to 22 (56%), four of them had permanent setons for repeating abscesses.Ileostomy was performed in seven (18%) patients and fistula closure was achieved in only 3/7 (42%) between 2 5 months.29 out of 39 (75%) had triple and the remaining 10 double Tx.14/29 (48%) under triple and 7/10 (70%) under double Tx had a clinical fistula response, so 21/39 (54%) patients were in clinical remission but only four (10%) with radiological closure.No correlation was identified between disease location, duration, number of fistulas, and Tx modality and fistulae response.Conclusions: This study stresses on anti-TNFs necessity for even small success of complex fistula closure.Clinical response was just 54%, and only 10% had radiological tract closure reaching our ultimate aim.Even in patients with an ileostomy on top of this Tx regimens only a minority could achieve this goal.

Lipid droplets are intracellular storage organelles which are implicated in obesity and the pathogenesis of metabolic diseases like atherosclerosis and diabetes type 2. They consist of a neutral lipid core surrounded by a phospholipid membrane containing specific proteins. Biosynthesis of neutral and membrane lipids as well as energy generation by ß-oxidation is enabled by the fatty acyl-CoA synthetase (ACS), a family of essential enzymes which activate fatty acids by esterification with coenzyme A. ACS enzymes are expressed simultaneously in a given cell type or tissue, but differences in expression, nutritional regulation, substrate specificity and subcellular localization suggest individual functions which however remain currently mostly undefined.

BACKGROUND: Protein distribution profiles along the human intestinal tract of transporters involved in the absorption of cholesterol and long-chain fatty acids (LCFA) have been scarcely evaluated. METHODOLOGY/PRINCIPAL FINDINGS: In post-mortem samples from 11 subjects, intestinal transporter distribution profiles were determined via Western Blot. Differences in transporter protein levels were statistically tested using ANOVA and Tukey's Post Hoc comparisons. Levels in all segments were expressed relative to those in duodenum. Except for ABCG5 and FATP4, levels (mean+/-SEM) were the highest in the ileum. For ABCA1, ileal levels (1.80+/-0.26) differed significantly from those in duodenum (P = 0.049) and proximal colon (0.92+/-0.14; P = 0.029). ABCG8 levels in ileum (1.91+/-0.30) differed from those in duodenum (P = 0.041) and distal colon (0.84+/-0.22; P = 0.010) and jejunum (1.64+/-0.26) tended to be higher than distal colon (0.84+/-0.22; P = 0.087). Ileal NPC1L1 levels (2.56+/-0.51) differed from duodenum levels (P = 0.019) and from distal colon (1.09+/-0.22; P = 0.030). There was also a trend (P = 0.098) for higher jejunal (2.23+/-0.37) than duodenal NPC1L1 levels. The levels of ABCG5 did not correlate with those of ABCG8. FAT/CD36 levels in ileum (2.03+/-0.42) differed from those in duodenum (P = 0.017), and proximal and distal colon (0.89+/-0.13 and 0.97+/-0.15 respectively; P = 0.011 and P = 0.014). FABPpm levels in ileum (1.04+/-0.13) differed from proximal (0.64+/-0.07; P = 0.026) and distal colon (0.66+/-0.09; P = 0.037). CONCLUSIONS/SIGNIFICANCE: The distribution profiles showed a bell-shape pattern along the GI-tract with the highest levels in ileum for ABCA1, ABCG8, NPC1L1, FATCD36 and FABPm, suggesting a prominent role for ileum in transporter-mediated uptake of cholesterol and LCFAs.