Reinhard Voll

Systemic lupus erythematosus (SLE) is an autoimmune disease in which patients develop autoantibodies to DNA, histones, and often to neutrophil proteins. These form immune complexes that are pathogenic and may cause lupus nephritis. In SLE patients, infections can initiate flares and are a major cause of mortality. Neutrophils respond to infections and release extracellular traps (NETs), which are antimicrobial and are made of DNA, histones, and neutrophil proteins. The timely removal of NETs may be crucial for tissue homeostasis to avoid presentation of self-antigens. We tested the hypothesis that SLE patients cannot clear NETs, contributing to the pathogenesis of lupus nephritis. Here we show that serum endonuclease DNase1 is essential for disassembly of NETs. Interestingly, a subset of SLE patients' sera degraded NETs poorly. Two mechanisms caused this impaired NET degradation: (i) the presence of DNase1 inhibitors or (ii) anti-NET antibodies prevented DNase1 access to NETs. Impairment of DNase1 function and failure to dismantle NETs correlated with kidney involvement. Hence, identification of SLE patients who cannot dismantle NETs might be a useful indicator of renal involvement. Moreover, NETs might represent a therapeutic target in SLE.

The transcriptional activity of NF-kappa B is stimulated upon phosphorylation of its p65 subunit on serine 276 by protein kinase A (PKA). The transcriptional coactivator CPB/p300 associates with NF-kappa B p65 through two sites, an N-terminal domain that interacts with the C-terminal region of unphosphorylated p65, and a second domain that only interacts with p65 phosphorylated on serine 276. Accessibility to both sites is blocked in unphosphorylated p65 through an intramolecular masking of the N terminus by the C-terminal region of p65. Phosphorylation by PKA both weakens the interaction between the N- and C-terminal regions of p65 and creates an additional site for interaction with CBP/p300. Therefore, PKA regulates the transcriptional activity of NF-kappa B by modulating its interaction with CBP/p300.

Objective To investigate whether the established impaired phagocyte function in systemic lupus erythematosus (SLE) patients also affects apoptotic cell clearance. Accumulation of apoptotic waste as a source for autoantigens that induce and maintain autoimmune responses is discussed. Methods Apoptosis was detected by morphology and propidium iodide staining. In vitro phagocytosis of autologous apoptotic cells in cultured peripheral blood mononuclear cells was evaluated microscopically. Cross-feeding experiments were performed to investigate phagocytosis of heterologous apoptotic cells by in vitro-differentiated macrophages. Furthermore, the effect of annexin V on the phagocytosis of apoptotic cells was investigated. Results Reduced clearance of apoptotic cells in SLE patients was observed. The defective clearance appeared to reflect phagocyte dysfunction and not an abnormal execution of apoptosis. A similar picture was seen when in vitro-differentiated macrophages from control populations were treated with annexin V. Conclusion Noninflammatory engulfment phagocytosis of apoptotic cells is decreased in SLE patients. Persistently circulating apoptotic waste may encounter inflammatory removal pathways and serve as immunogen for the induction of autoreactive lymphocytes and as antigen for immune complex formation.

To investigate the fate of apoptotic cells in the germinal centers (GCs) of patients with systemic lupus erythematosus (SLE).Lymph node biopsy specimens obtained from 7 SLE patients with benign follicular hyperplasia, 5 non-SLE patients with benign follicular hyperplasia (non-SLE), 5 patients with malignant follicular lymphoma, and 3 patients with dermatopathic lymphadenitis were stained with monoclonal antibodies against macrophages (CD68) and follicular dendritic cells (CR2/CD21). TUNEL staining and transmission electron microscopy were performed to detect apoptotic cells. Confocal microscopy was used to evaluate the in vivo capacity of tingible body macrophages to remove apoptotic cell material.In a subgroup of patients with SLE, apoptotic cells accumulated in the GCs of the lymph nodes. The number of tingible body macrophages, which usually contained engulfed apoptotic nuclei, was significantly reduced in these patients. In contrast to what was observed in all controls, TUNEL-positive apoptotic material from SLE patients was observed to be directly associated with the surfaces of follicular dendritic cells (FDCs).Our findings suggest that in a sub-group of SLE patients, apoptotic cells are not properly cleared by tingible body macrophages of the GCs. Consequently, nuclear autoantigens bind to FDCs and may thus provide survival signals for autoreactive B cells. This action may override an important control mechanism for B cell development, resulting in the loss of tolerance for nuclear antigens.

Autoantibodies against double-stranded DNA (dsDNA) and nucleosomes represent a hallmark of systemic lupus erythematosus (SLE). However, the mechanisms involved in breaking the immunological tolerance against these poorly immunogenic nuclear components are not fully understood. Impaired phagocytosis of apoptotic cells with consecutive release of nuclear antigens may contribute to the immune pathogenesis. The architectural chromosomal protein and proinflammatory mediator high mobility group box protein 1 (HMGB1) is tightly attached to the chromatin of apoptotic cells. We demonstrate that HMGB1 remains bound to nucleosomes released from late apoptotic cells in vitro. HMGB1-nucleosome complexes were also detected in plasma from SLE patients. HMGB1-containing nucleosomes from apoptotic cells induced secretion of interleukin (IL) 1beta, IL-6, IL-10, and tumor necrosis factor (TNF) alpha and expression of costimulatory molecules in macrophages and dendritic cells (DC), respectively. Neither HMGB1-free nucleosomes from viable cells nor nucleosomes from apoptotic cells lacking HMGB1 induced cytokine production or DC activation. HMGB1-containing nucleosomes from apoptotic cells induced anti-dsDNA and antihistone IgG responses in a Toll-like receptor (TLR) 2-dependent manner, whereas nucleosomes from living cells did not. In conclusion, HMGB1-nucleosome complexes activate antigen presenting cells and, thereby, may crucially contribute to the pathogenesis of SLE via breaking the immunological tolerance against nucleosomes/dsDNA.

Abstract High mobility group box 1 (HMGB1) is an abundant and conserved nuclear protein that is released by necrotic cells and acts in the extracellular environment as a primary proinflammatory signal. In this study we show that human dendritic cells, which are specialized in Ag presentation to T cells, actively release their own HMGB1 into the extracellular milieu upon activation. This secreted HMGB1 is necessary for the up-regulation of CD80, CD83, and CD86 surface markers of human dendritic cells and for IL-12 production. The HMGB1 secreted by dendritic cells is also required for the clonal expansion, survival, and functional polarization of naive T cells. Using neutralizing Abs and receptor for advanced glycation end product-deficient (RAGE−/−) cells, we demonstrate that RAGE is required for the effect of HMGB1 on dendritic cells. HMGB1/RAGE interaction results in downstream activation of MAPKs and NF-κB. The use of an ancient signal of necrosis, HMGB1, by dendritic cells to sustain their own maturation and for activation of T lymphocytes represents a profitable evolutionary mechanism.

Multiple myeloma is an incurable plasma cell neoplasia characterized by the production of large amounts of monoclonal immunoglobulins. The proteasome inhibitor bortezomib (PS-341, Velcade) induces apoptosis in various malignant cells and has been approved for treatment of refractory multiple myeloma. Inhibition of the antiapoptotic transcription factor nuclear factor-kappaB (NF-kappaB) apparently contributes to the antitumor effects of bortezomib; however, this mechanism cannot fully explain the exceptional sensitivity of myeloma cells. Extensive protein synthesis as in myeloma cells is inherently accompanied by unfolded proteins, including defective ribosomal products (DRiPs), which need to be degraded by the ubiquitin-proteasome system. Therefore, we hypothesized that the proapoptotic effect of bortezomib in multiple myeloma is mainly due to the accumulation of unfolded proteins in cells with high protein biosynthesis. Using the IgG-secreting human myeloma cell line JK-6L and murine muH-chain-transfected Ag8.H myeloma cells, apoptosis induction upon proteasome inhibition was clearly correlated with the amount of immunoglobulin production. Preferentially in immunoglobulin-high myeloma cells, bortezomib triggered activation of caspases and induction of proapoptotic CHOP, a component of the terminal unfolded protein response induced by endoplasmic reticulum (ER) stress. In immunoglobulin-high cells, bortezomib increased the levels of proapoptotic Bax while reducing antiapoptotic Bcl-2. Finally, IgG-DRiPs were detected in proteasome inhibitor-treated cells. Hence, proteasome inhibitors induce apoptosis preferentially in cells with high synthesis rate of immunoglobulin associated with accumulation of unfolded proteins/DRiPs inducing ER stress. These findings further elucidate the antitumor activities of proteasome inhibitors and have important implications for optimizing clinical applications.

Objectives To investigate whether bortezomib, a proteasome inhibitor approved for treatment of multiple myeloma, induces clinically relevant plasma cell (PC) depletion in patients with active, refractory systemic lupus erythematosus (SLE). Methods Twelve patients received a median of two (range 1–4) 21-day cycles of intravenous bortezomib (1.3 mg/m 2 ) with the coadministration of dexamethasone (20 mg) for active SLE. Disease activity was assessed using the SLEDAI-2K score. Serum concentrations of anti–double-stranded DNA (anti-dsDNA) and vaccine-induced protective antibodies were monitored. Flow cytometry was performed to analyse peripheral blood B-cells, PCs and Siglec-1 expression on monocytes as surrogate marker for type-I interferon (IFN) activity. Results Upon proteasome inhibition, disease activity significantly declined and remained stable for 6 months on maintenance therapies. Nineteen treatment-emergent adverse events occurred and, although mostly mild to moderate, resulted in treatment discontinuation in seven patients. Serum antibody levels significantly declined, with greater reductions in anti-dsDNA (∼60%) than vaccine-induced protective antibody titres (∼30%). Bortezomib significantly reduced the numbers of peripheral blood and bone marrow PCs (∼50%), but their numbers increased between cycles. Siglec-1 expression on monocytes significantly declined. Conclusions These findings identify proteasome inhibitors as a putative therapeutic option for patients with refractory SLE by targeting PCs and type-I IFN activity, but our results must be confirmed in controlled trials.

Systemic lupus erythematosus (SLE; OMIM 152700) is a genetically complex autoimmune disease. Genome-wide association studies (GWASs) have identified more than 50 loci as robustly associated with the disease in single ancestries, but genome-wide transancestral studies have not been conducted. We combined three GWAS data sets from Chinese (1,659 cases and 3,398 controls) and European (4,036 cases and 6,959 controls) populations. A meta-analysis of these studies showed that over half of the published SLE genetic associations are present in both populations. A replication study in Chinese (3,043 cases and 5,074 controls) and European (2,643 cases and 9,032 controls) subjects found ten previously unreported SLE loci. Our study provides further evidence that the majority of genetic risk polymorphisms for SLE are contained within the same regions across both populations. Furthermore, a comparison of risk allele frequencies and genetic risk scores suggested that the increased prevalence of SLE in non-Europeans (including Asians) has a genetic basis.

Systemic lupus erythematosus (SLE) is a fairly heterogeneous autoimmune disease. Impaired clearance functions for dying cells may explain accumulation of nuclear autoantigens in various tissues of SLE patients. Our data show that in a subgroup of patients with SLE, apoptotic cells accumulated in the germinal centres of the lymph nodes. Apoptotic material was attached to the surfaces of follicular dendritic cells. Furthermore, we found an accumulation of apoptotic cells in the skin of patients with cutaneous lupus after UV exposure. Granulocytes and monocytes in whole blood of SLE patients showed a reduced uptake of albumin- and polyglobin-coated beads. Furthermore, we analysed sera from SLE patients in migration assays and observed that the attraction signals for macrophages were reduced by sera of approximately 25% of the SLE patients. Analyses of high-affinity DNA binding IgG autoantibodies of SLE patients revealed that those antibodies had gained their DNA reactivity in a germinal centre reaction. We suggest a stepwise maturation from a non-anti-DNA reactive B cell to an anti-dsDNA autoreactive B cell. We conclude that impaired clearance in early phases of apoptosis leads to a secondary necrotic status of the cells. Danger signals are released; modified autoantigens are accessible, favouring an autoimmune reaction.

Noninflammatory clearance of apoptotic cells (ACs) is crucial to maintain self-tolerance. Here, we have reported a role for the enzyme 12/15-lipoxygenase (12/15-LO) as a central factor governing the sorting of ACs into differentially activated monocyte subpopulations. During inflammation, uptake of ACs was confined to a population of 12/15-LO-expressing, alternatively activated resident macrophages (resMΦ), which blocked uptake of ACs into freshly recruited inflammatory Ly6C(hi) monocytes in a 12/15-LO-dependent manner. ResMΦ exposed 12/15-LO-derived oxidation products of phosphatidylethanolamine (oxPE) on their plasma membranes and thereby generated a sink for distinct soluble receptors for ACs such as milk fat globule-EGF factor 8, which were essential for the uptake of ACs into inflammatory monocytes. Loss of 12/15-LO activity, in turn, resulted in an aberrant phagocytosis of ACs by inflammatory monocytes, subsequent antigen presentation of AC-derived antigens, and a lupus-like autoimmune disease. Our data reveal an unexpected key role for enzymatic lipid oxidation during the maintenance of self-tolerance.

Antisynthetase syndrome (ASSD) is a rare clinical condition that is characterized by the occurrence of a classic clinical triad, encompassing myositis, arthritis, and interstitial lung disease (ILD), along with specific autoantibodies that are addressed to different aminoacyl tRNA synthetases (ARS). Until now, it has been unknown whether the presence of a different ARS might affect the clinical presentation, evolution, and outcome of ASSD. In this study, we retrospectively recorded the time of onset, characteristics, clustering of triad findings, and survival of 828 ASSD patients (593 anti-Jo1, 95 anti-PL7, 84 anti-PL12, 38 anti-EJ, and 18 anti-OJ), referring to AENEAS (American and European NEtwork of Antisynthetase Syndrome) collaborative group's cohort. Comparisons were performed first between all ARS cases and then, in the case of significance, while using anti-Jo1 positive patients as the reference group. The characteristics of triad findings were similar and the onset mainly began with a single triad finding in all groups despite some differences in overall prevalence. The "ex-novo" occurrence of triad findings was only reduced in the anti-PL12-positive cohort, however, it occurred in a clinically relevant percentage of patients (30%). Moreover, survival was not influenced by the underlying anti-aminoacyl tRNA synthetase antibodies' positivity, which confirmed that antisynthetase syndrome is a heterogeneous condition and that antibody specificity only partially influences the clinical presentation and evolution of this condition.

T cell–derived IFNγ and CD40L/IL-21R signals are crucial for the differentiation of human T-bet high CD21 low B cells.

Introduction Whether patients with inflammatory rheumatic and musculoskeletal diseases (RMD) are at higher risk to develop severe courses of COVID-19 has not been fully elucidated. Aim of this analysis was to describe patients with RMD according to their COVID-19 severity and to identify risk factors for hospitalisation. Methods Patients with RMD with PCR confirmed SARS-CoV-2 infection reported to the German COVID-19 registry from 30 March to 1 November 2020 were evaluated. Multivariable logistic regression was used to estimate ORs for hospitalisation due to COVID-19. Results Data from 468 patients with RMD with SARS-CoV-2 infection were reported. Most frequent diagnosis was rheumatoid arthritis, RA (48%). 29% of the patients were hospitalised, 5.5% needed ventilation. 19 patients died. Multivariable analysis showed that age >65 years (OR 2.24; 95% CI 1.12 to 4.47), but even more>75 years (OR 3.94; 95% CI 1.86 to 8.32), cardiovascular disease (CVD; OR 3.36; 95% CI 1.5 to 7.55), interstitial lung disease/chronic obstructive pulmonary disease (ILD/COPD) (OR 2.79; 95% CI 1.2 to 6.49), chronic kidney disease (OR 2.96; 95% CI 1.16 to 7.5), moderate/high RMD disease activity (OR 1.96; 95% CI 1.02 to 3.76) and treatment with glucocorticoids (GCs) in dosages >5 mg/day (OR 3.67; 95% CI 1.49 to 9.05) were associated with higher odds of hospitalisation. Spondyloarthritis patients showed a smaller risk of hospitalisation compared with RA (OR 0.46; 95% CI 0.23 to 0.91). Conclusion Age was a major risk factor for hospitalisation as well as comorbidities such as CVD, ILD/COPD, chronic kidney disease and current or prior treatment with GCs. Moderate to high RMD disease activity was also an independent risk factor for hospitalisation, underlining the importance of continuing adequate RMD treatment during the pandemic.

To determine characteristics associated with more severe outcomes in a global registry of people with systemic lupus erythematosus (SLE) and COVID-19.People with SLE and COVID-19 reported in the COVID-19 Global Rheumatology Alliance registry from March 2020 to June 2021 were included. The ordinal outcome was defined as: (1) not hospitalised, (2) hospitalised with no oxygenation, (3) hospitalised with any ventilation or oxygenation and (4) death. A multivariable ordinal logistic regression model was constructed to assess the relationship between COVID-19 severity and demographic characteristics, comorbidities, medications and disease activity.A total of 1606 people with SLE were included. In the multivariable model, older age (OR 1.03, 95% CI 1.02 to 1.04), male sex (1.50, 1.01 to 2.23), prednisone dose (1-5 mg/day 1.86, 1.20 to 2.66, 6-9 mg/day 2.47, 1.24 to 4.86 and ≥10 mg/day 1.95, 1.27 to 2.99), no current treatment (1.80, 1.17 to 2.75), comorbidities (eg, kidney disease 3.51, 2.42 to 5.09, cardiovascular disease/hypertension 1.69, 1.25 to 2.29) and moderate or high SLE disease activity (vs remission; 1.61, 1.02 to 2.54 and 3.94, 2.11 to 7.34, respectively) were associated with more severe outcomes. In age-adjusted and sex-adjusted models, mycophenolate, rituximab and cyclophosphamide were associated with worse outcomes compared with hydroxychloroquine; outcomes were more favourable with methotrexate and belimumab.More severe COVID-19 outcomes in individuals with SLE are largely driven by demographic factors, comorbidities and untreated or active SLE. Patients using glucocorticoids also experienced more severe outcomes.

Activation of the transcription factor NF-kappa B and pre-T cell receptor (pre-TCR) expression is tightly correlated during thymocyte development. Inhibition of NF-kappa B in isolated thymocytes in vitro results in spontaneous apoptosis of cells expressing the pre-TCR, whereas inhibition of NF-kappa B in transgenic mice through expression of a mutated, superrepressor form of I kappa B alpha leads to a loss of beta-selected thymocytes. In contrast, the forced activation of NF-kappa B through expression of a dominant-active I kappa B kinase allows differentiation to proceed to the CD4(+)CD8(+) stage in a Rag1(-/-) mouse that cannot assemble the pre-TCR. Therefore, signals emanating from the pre-TCR are mediated at least in part by NF-kappa B, which provides a selective survival signal for developing thymocytes with productive beta chain rearrangements.

Impaired clearance of apoptotic cell material has been implicated in the pathogenesis of systemic lupus erythematosus (SLE). Besides many other molecules, C1q and DNaseI contribute to an efficient clearance of dying cells. A frequently observed factor in SLE patients is the accumulation of unusually large amounts of apoptotic cells in various tissues. We showed that in a subgroup of patients with SLE, apoptotic cells accumulated in the germinal centers of the lymph nodes. The numbers of tingible body macrophages usually containing engulfed apoptotic nuclei were significantly reduced in these patients. Furthermore, we differentiated macrophages from CD34+ stem cells of SLE patients and NHD in vitro to analyze whether the observed clearance defects are intrinsic. Indeed, macrophages from SLE patients showed a reduced phagocytic capability. Very interestingly, those macrophages from different SLE patients, as well as granulocytes from these patients, showed in part different phagocytic defects, suggesting a heterogeneous clearance defect. We conclude that a failure of clearance in the early phase of apoptosis leads to a secondary necrotic status of the cells. Danger signals are released, modified autoantigens are accessible, and an autoimmune reaction gets started.

Systemic lupus erythematosus (SLE) is a multifactorial disease and its pathogenesis and precise aetiology remain unknown. Under physiological conditions, neither apoptotic nor necrotic cell material is easily found in tissues because of its quick removal by a highly efficient scavenger system. Autoantigens are found in apoptotic and necrotic material and they are recognized by autoimmune sera from SLE patients. The clearance of dying cells is finely regulated by a highly redundant system of receptors on phagocytic cells and bridging molecules, which detect molecules specific for dying cells. Changes on apoptotic and necrotic cell surfaces are extremely important for their recognition and further disposal. Some SLE patients seem to have an impaired ability to clear such apoptotic material from tissues, and this could cause the breakdown of central and peripheral mechanisms of tolerance against self-antigens. In this article, we address the cells, receptors and molecules involved in the clearance process and show how deficiencies in this process may contribute to the aetiopathogenesis of SLE.

To follow-up on all available infliximab-treated SLE patients for safety and long-term efficacy in order to extract information that is useful for planning appropriate controlled trials with infliximab in SLE.We analysed charts of six patients treated in an open-label safety trial and seven additional patients treated with infliximab on a compassionate care basis for uncontrolled SLE organ inflammation.Out of nine patients with lupus nephritis, six had a long-term response after four infusions of infliximab in combination with AZA, lasting for up to 5 years. All five patients with lupus arthritis responded, but this response did not last for >2 months after the last infusion. One additional patient had a long-lasting improvement in SLE interstitial lung disease. No symptoms suggestive of infliximab-induced SLE flares occurred in any patients. Short-term treatment appeared relatively safe, but one patient developed deep-vein thrombosis and several infections. Under long-term therapy, two patients had life-threatening or fatal events, namely CNS lymphoma and Legionella pneumonia. Retreatment and treatment without concomitant immunosuppression led to drug reactions.Short-term therapy with four infusions of infliximab in combination with AZA was relatively safe, and had remarkable long-term efficacy for lupus nephritis and, potentially, also interstitial lung disease. Long-term therapy with infliximab, however, was associated with severe adverse events in two out of three SLE patients, which may have been provoked by infliximab and/or by their long-standing refractory SLE and previous therapies.

The obligate intracellular pathogen Leishmania major survives and multiplies in professional phagocytes. The evasion strategy to circumvent killing by host phagocytes and establish a productive infection is poorly understood. Here we report that the virulent inoculum of Leishmania promastigotes contains a high ratio of annexin A5-binding apoptotic parasites. This subpopulation of parasites is characterized by a round body shape, a swollen kinetoplast, nuclear condensation, and a lack of multiplication and represents dying or already dead parasites. After depleting the apoptotic parasites from a virulent population, Leishmania do not survive in phagocytes in vitro and lose their disease-inducing ability in vivo. TGF-beta induced by apoptotic parasites is likely to mediate the silencing of phagocytes and lead to survival of infectious Leishmania populations. The data demonstrate that apoptotic promastigotes, in an altruistic way, enable the intracellular survival of the viable parasites.

The NALP3 inflammasome is activated by low intracellular potassium concentrations [K(+)](i), leading to the secretion of the proinflammatory cytokine IL-1β. However, the mechanism of [K(+)](i) lowering after phagocytosis of monosodium urate crystals is still elusive. Here, we propose that endosomes containing monosodium urate crystals fuse with acidic lysosomes. The low pH in the phagolysosome causes a massive release of sodium and raises the intracellular osmolarity. This process is balanced by passive water influx through aquaporins leading to cell swelling. This process dilutes [K(+)](i) to values below the threshold of 90 mm known to activate NALP3 inflammasomes without net loss of cytoplasmic potassium ions. In vitro, the inhibitors of lysosomal acidification (ammonium chloride, chloroquine) and of aquaporins (mercury chloride, phloretin) all significantly decreased the production of IL-1β. In vivo, only the pharmacological inhibitor of lysosome acidification chloroquine could be used which again significantly reduced the IL-1β production. As a translational aspect one may consider the use of chloroquine for the anti-inflammatory treatment of refractory gout.

Strategies to enhance the immunogenicity of tumors are urgently needed. Although vaccination with irradiated dying lymphoma cells recruits a tumor-specific immune response, its efficiency as immunogen is poor. Annexin V (AxV) binds with high affinity to phosphatidylserine on the surface of apoptotic and necrotic cells and thereby impairs their uptake by macrophages. Here, we report that AxV preferentially targets irradiated lymphoma cells to CD8+ dendritic cells for in vivo clearance, elicits the release of proinflammatory cytokines and dramatically enhances the protection elicited against the tumor. The response was endowed with both memory, because protected animals rejected living lymphoma cells after 72 d, and specificity, because vaccinated animals failed to reject unrelated neoplasms. Finally, AxV-coupled irradiated cells induced the regression of growing tumors. These data indicate that endogenous adjuvants that bind to dying tumor cells can be exploited to target tumors for immune rejection.

High mobility group box 1 protein (HMGB1) is a ubiquitously expressed architectural chromosomal protein. Recently, it has become obvious that HMGB1 can also act as a proinflammatory mediator when actively secreted during cell activation or passively released from necrotic cells. HMGB1 appears to play an important role in the pathogenesis of diseases, including sepsis and rheumatoid arthritis. However, easy, sensitive, and reliable detection systems are required to investigate the clinical significance of HMGB1 in clinical samples for diagnosis and prognosis of diseases. Here, we describe sensitive ELISAs for the detection of HMGB1 in cell culture medium and cell lysates. However, these assays failed to reliably quantitate HMGB1 in serum and plasma when compared with immunoblot analysis. We found that serum/plasma components bind to HMGB1 and interfere with its detection by ELISA systems. In most serum/plasma samples investigated, including those from healthy individuals, we detected IgG antibodies binding to HMGB1. The titers of these antibodies correlated with the capacity of sera to interfere with the detection of recombinant HMGB1 by ELISA. Furthermore, HMGB1 coimmunoprecipitated with several proteins including IgG1, as identified by mass spectrometry. These HMGB1 interacting proteins are currently characterized and may contribute to complex formation, masking, and possibly, modulation of cytokine activity of HMGB1.

Abstract Eicosanoids are essential mediators of the inflammatory response and contribute both to the initiation and the resolution of inflammation. Leukocyte-type 12/15-lipoxygenase (12/15-LO) represents a major enzyme involved in the generation of a subclass of eicosanoids, including the anti-inflammatory lipoxin A4 (LXA4). Nevertheless, the impact of 12/15-LO on chronic inflammatory diseases such as arthritis has remained elusive. By using two experimental models of arthritis, the K/BxN serum-transfer and a TNF transgenic mouse model, we show that deletion of 12/15-LO leads to uncontrolled inflammation and tissue damage. Consistent with these findings, 12/15-LO-deficient mice showed enhanced inflammatory gene expression and decreased levels of LXA4 within their inflamed synovia. In isolated macrophages, the addition of 12/15-LO-derived eicosanoids blocked both phosphorylation of p38MAPK and expression of a subset of proinflammatory genes. Conversely, 12/15-LO-deficient macrophages displayed significantly reduced levels of LXA4, which correlated with increased activation of p38MAPK and an enhanced inflammatory gene expression after stimulation with TNF-α. Taken together, these results support an anti-inflammatory and tissue-protective role of 12/15-LO and its products during chronic inflammatory disorders such as arthritis.

Costimulatory molecules CD80/CD86 suppress osteoclast differentiation by inducing indoleamine 2,3-dioxygenase.

Bortezomib, an inhibitor of proteasomes, has been reported to reduce autoantibody titers and to improve clinical condition in mice suffering from lupus-like disease. Bortezomib depletes both short- and long-lived plasma cells; the latter normally survive the standard immunosuppressant treatments targeting T and B cells. These findings encouraged us to test whether bortezomib is effective for alleviating the symptoms in the experimental autoimmune myasthenia gravis (EAMG) model for myasthenia gravis, a disease that is characterized by autoantibodies against the acetylcholine receptor (AChR) of skeletal muscle. Lewis rats were immunized with saline (control, n = 36) or Torpedo AChR (EAMG, n = 54) in CFA in the first week of an experimental period of 8 wk. After immunization, rats received twice a week s.c. injections of bortezomib (0.2 mg/kg in saline) or saline injections. Bortezomib induced apoptosis in bone marrow cells and reduced the amount of plasma cells in the bone marrow by up to 81%. In the EAMG animals, bortezomib efficiently reduced the rise of anti-AChR autoantibody titers, prevented ultrastructural damage of the postsynaptic membrane, improved neuromuscular transmission, and decreased myasthenic symptoms. This study thus underscores the potential of the therapeutic use of proteasome inhibitors to target plasma cells in Ab-mediated autoimmune diseases.

Objective To assess the impact of immunosuppressive therapy with cyclophosphamide (CYC) and rituximab (RTX) on serum immunoglobulin (Ig) concentrations and B lymphocyte counts in patients with ANCA-associated vasculitides (AAVs). Methods Retrospective analysis of Ig concentrations and peripheral B cell counts in 55 AAV patients. Results CYC treatment resulted in a decrease in Ig levels (median; interquartile range IQR) from IgG 12.8 g/L (8.15-15.45) to 9.17 g/L (8.04-9.90) (p = 0.002), IgM 1.05 g/L (0.70-1.41) to 0.83 g/L (0.60-1.17) (p = 0.046) and IgA 2.58 g/L (1.71-3.48) to 1.58 g/L (1-31-2.39) (p = 0.056) at a median follow-up time of 4 months. IgG remained significantly below the initial value at 14.5 months and 30 months analyses. Subsequent RTX treatment in patients that had previously received CYC resulted in a further decline in Ig levels from pre RTX IgG 9.84 g/L (8.71-11.60) to 7.11 g/L (5.75-8.77; p = 0.007), from pre RTX IgM 0.84 g/L (0.63-1.18) to 0.35 g/L (0.23-0.48; p<0.001) and from pre RTX IgA 2.03 g/L (1.37-2.50) to IgA 1.62 g/L (IQR 0.84-2.43; p = 0.365) 14 months after RTX. Treatment with RTX induced a complete depletion of B cells in all patients. After a median observation time of 20 months median B lymphocyte counts remained severely suppressed (4 B-cells/µl, 1.25-9.5, p<0.001). Seven patients (21%) that had been treated with CYC followed by RTX were started on Ig replacement because of severe bronchopulmonary infections and serum IgG concentrations below 5 g/L. Conclusions In patients with AAVs, treatment with CYC leads to a decline in immunoglobulin concentrations. A subsequent RTX therapy aggravates the decline in serum immunoglobulin concentrations and results in a profoundly delayed B cell repopulation. Surveying patients with AAVs post CYC and RTX treatment for serum immunoglobulin concentrations and persisting hypogammaglobulinemia is warranted.

Granulomas are immune cell aggregates formed in response to persistent inflammatory stimuli. Granuloma macrophage subsets are diverse and carry varying copy numbers of their genomic information. The molecular programs that control the differentiation of such macrophage populations in response to a chronic stimulus, though critical for disease outcome, have not been defined. Here, we delineate a macrophage differentiation pathway by which a persistent Toll-like receptor (TLR) 2 signal instructs polyploid macrophage fate by inducing replication stress and activating the DNA damage response. Polyploid granuloma-resident macrophages formed via modified cell divisions and mitotic defects and not, as previously thought, by cell-to-cell fusion. TLR2 signaling promoted macrophage polyploidy and suppressed genomic instability by regulating Myc and ATR. We propose that, in the presence of persistent inflammatory stimuli, pathways previously linked to oncogene-initiated carcinogenesis instruct a long-lived granuloma-resident macrophage differentiation program that regulates granulomatous tissue remodeling.

Eosinophilic granulomatosis with polyangiitis (EGPA) is part of antineutrophil cytoplasmic antibodies (ANCAs)-associated vasculitides. In EGPA small-vessel vasculitis is associated with eosinophilia and asthma. About 40% of EGPA patients are ANCA-positive, suggesting a role for B cells in the pathogenesis of EGPA. B cell-depleting therapy with rituximab (RTX) can be effective in ANCA-positive EGPA, but very few patients have been published to date. The role of RTX in the treatment of ANCA-negative EGPA is unclear. We report a single-center cohort of patients with eosinophilic granulomatosis with polyangiitis. Of these patients, nine (six ANCA-positive, three ANCA-negative) had been treated with RTX for relapsing or refractory disease on standard immunosuppressive treatment. In a retrospective analysis, data on treatment response, frequency of relapses, adverse events, and peripheral B-cell reconstitution were evaluated. Furthermore, serum immunoglobulin concentrations, ANCA status, and peripheral B cell subpopulations were assessed after RTX treatment. All patients had high disease activity before RTX treatment. At presentation 3 months after RTX therapy, all ANCA-positive and ANCA-negative patients had responded to RTX, with one patient being in complete remission, and eight patients being in partial remission. After a mean follow-up of 9 months, C-reactive protein concentrations had normalized, eosinophils had significantly decreased, and prednisone had been tapered in all patients. In all patients, RTX therapy was combined with a standard immunosuppressive therapy. Within the 9-month observation period, no relapse was recorded. Three patients were preemptively retreated with RTX, and during the median follow-up time of 3 years, no relapse occurred in these patients. During the follow-up of 13 patient-years, five minor but no major infections were recorded. In our analysis on nine patients with EGPA resistant to standard therapy, rituximab proved to be an efficient and safe treatment for ANCA-positive and ANCA-negative patients. Preemptive retreatment with RTX, combined with standard maintenance immunosuppressants, resulted in a sustained treatment response. Prospective, randomized trials evaluating the use of RTX in EGPA are warranted.

B cell depletion with rituximab (RTX) is approved for treatment of rheumatoid arthritis (RA) and ANCA-associated vasculitides (AAV). Recently, RTX has been shown to be effective in AAV maintenance therapy, but an optimal RTX treatment schedule is unknown and the time to B cell repopulation after RTX has not been studied.Retrospective single-center analysis of B cell repopulation in patients with AAV, RA or connective tissue disease (CTD) treated with RTX.Beginning B cell repopulation within the first year after RTX treatment was observed in 93% of RA and 88% of CTD patients. Only 10% of patients with granulomatosis with polyangiitis (GPA) and microscopic polyangiitis (MPA) and no patient with eosinophilic granulomatosis with polyangiitis (EGPA) showed B cell repopulation within this time. Median time of B cell depletion was 26 months in GPA/MPA, and 21 months in EGPA compared to 9 months in RA, and 8 months in CTD (p < 0.0001). In 25 AAV-patients B cell depletion lasted for at least 44 months. There was a significant decline in serum immunoglobulin concentrations in GPA/MPA patients, but not in patients with RA or CTD. Significantly more GPA/MPA patients developed hygogammaglobulinemia (IgG <7 g/L) compared to patients with RA or CTD.In contrast to RA and CTD, in AAV RTX induces long-lasting depletion of B cells that is associated with decreased antibody production. This observation points toward potential defects in the B cell compartment in AAV that are unmasked by immunosuppressive treatment and has important implications for the design of maintenance treatment schedules using RTX.

Dermatomyositis (DM) can be complicated by calcinosis and interstitial lung disease (ILD). Calcinosis can be severely debilitating or life-threatening and to date there is no treatment with proven efficacy. In DM type I interferon contributes to pathophysiology by inducing the expression of proinflammatory cytokines and the JAK-STAT (signal transducer and activator of transcription) pathway may be involved in the regulation of mitochondrial calcium store release, a process potentially important for calcification in DM. JAK-inhibition may therefore be an attractive therapy in DM complicated by calcifications. We report on the fast and persistent response of extensive and rapidly progressive DM-associated calcifications in two patients treated with the JAK-inhibitor tofacitinib. During the 28-week observation period in both patients no new calcifications formed and existing calcifications were either regressive or stable. Furthermore, concomitant life-threatening DM-associated ILD (acute fibrinous and organizing pneumonia; AFOP) in one patient rapidly responded to tofacitinib monotherapy. Both patients were able to taper concomitant glucocorticoids. Tofacitinib was well tolerated and safe. The results of our study support the role of JAK/STAT signaling in the development of calcinosis and ILD in DM. Tofacitinib may be an effective and safe treatment for calcinosis in DM and potentially for other connective tissue disease complicated by calcinosis.

Cytotoxic T lymphocyte antigen-4 (CTLA-4) limits T-cell activation and is expressed on T-regulatory cells. Human CTLA-4 deficiency results in severe immune dysregulation. Abatacept (CTLA-4 Ig) is approved for the treatment of rheumatoid arthritis (RA) and its mechanism of action is attributed to effects on T-cells. It is known that CTLA-4 modulates the expression of its ligands CD80 and CD86 on antigen presenting cells (APC) by transendocytosis. As B-cells express CD80/CD86 and function as APC, we hypothesize that B-cells are a direct target of abatacept. To investigate direct effects of abatacept on human B-lymphocytes in vitro and in RA patients. The effect of abatacept on healthy donor B-cells' phenotype, activation and CD80/CD86 expression was studied in vitro. Nine abatacept-treated RA patients were studied. Seven of these were followed up to 24 months, and two up to 12 months only and treatment response, immunoglobulins, ACPA, RF concentrations, B-cell phenotype and ACPA-specific switched memory B-cell frequency were assessed. B-cell development was unaffected by abatacept. Abatacept treatment resulted in a dose-dependent decrease of CD80/CD86 expression on B-cells in vitro, which was due to dynamin-dependent internalization. RA patients treated with abatacept showed a progressive decrease in plasmablasts and serum IgG. While ACPA-titers only moderately declined, the frequency of ACPA-specific switched memory B-cells significantly decreased. Abatacept directly targets B-cells by reducing CD80/CD86 expression. Impairment of antigen presentation and T-cell activation may result in altered B-cell selection, providing a new therapeutic mechanism and a base for abatacept use in B-cell mediated autoimmunity.

Significance Worldwide about one million patients are given anti-CD20 antibodies such as rituximab (RTX) for the treatment of B cell-associated diseases. Despite the success of this first therapeutic antibody, little is known about the function of its target. The role of CD20 only becomes clear in the context of the nanoscale compartmentalization of the B lymphocyte membrane. We found that CD20 is an organizer of the IgD-class nanocluster on the B cell membrane. The loss of CD20 on human B cells results in a dissolution of the IgD-class nanocluster and a transient B cell activation inducing a B cell-to-PC differentiation. Thus, CD20 is an essential gatekeeper of a membrane nanodomain and the resting state of naive B cells.

Individuals with anti-citrullinated protein antibodies (ACPAs) and subclinical inflammatory changes in joints are at high risk of developing rheumatoid arthritis. Treatment strategies to intercept this pre-stage clinical disease remain to be developed. We aimed to assess whether 6-month treatment with abatacept improves inflammation in preclinical rheumatoid arthritis.The abatacept reversing subclinical inflammation as measured by MRI in ACPA positive arthralgia (ARIAA) study is a randomised, international, multicentre, double-blind, placebo-controlled trial done in 14 hospitals and community centres across Europe (11 in Germany, two in Spain, and one in the Czech Republic). Adults (aged ≥18 years) with ACPA positivity, joint pain (but no swelling), and signs of osteitis, synovitis, or tenosynovitis in hand MRI were randomly assigned (1:1) to weekly subcutaneous abatacept 125 mg or placebo for 6 months followed by a double-blind, drug-free, observation phase for 12 months. The primary outcome was the proportion of participants with any reduction in inflammatory MRI lesions at 6 months. The primary efficacy analysis was done in the modified intention-to-treat population, which included participants who were randomly assigned and received study medication. Safety analyses were conducted in participants who received the study medication and had at least one post-baseline observation. The study was registered with the EUDRA-CT (2014-000555-93).Between Nov 6, 2014, and June 15, 2021, 139 participants were screened. Of 100 participants, 50 were randomly assigned to abatacept 125 mg and 50 to placebo. Two participants (one from each group) were excluded due to administration failure or refusing treatment; thus, 98 were included in the modified intention-to-treat population. 70 (71%) of 98 participants were female and 28 (29%) of 98 were male. At 6 months, 28 (57%) of 49 participants in the abatacept group and 15 (31%) of 49 participants in the placebo group showed improvement in MRI subclinical inflammation (absolute difference 26·5%, 95% CI 5·9-45·6; p=0·014). Four (8%) of 49 participants in the abatacept group and 17 (35%) of 49 participants in the placebo group developed rheumatoid arthritis (hazard ratio [HR] 0·14 [0·04-0·47]; p=0·0016). Improvement of MRI inflammation (25 [51%] of 49 participants in the abatacept group, 12 [24%] of 49 in the placebo group; p=0·012) and progression to rheumatoid arthritis (17 [35%] of 49, 28 [57%] of 49; HR 0·14 [0·04-0·47]; p=0·018) remained significantly different between the two groups after 18 months, 12 months after the end of the intervention. There were 12 serious adverse events in 11 participants (four [8%] of 48 in the abatacept group and 7 [14%] of 49 in the placebo group). No deaths occurred during the study.6-month treatment with abatacept decreases MRI inflammation, clinical symptoms, and risk of rheumatoid arthritis development in participants at high risk. The effects of the intervention persist through a 1-year drug-free observation phase.Innovative Medicine Initiative.

T helper 1 (TH1) cells mediate cellular immunity, whereas TH2 cells potentiate antiparasite and humoral immunity. We used a complementary DNA subtraction method, representational display analysis, to show that the small guanosine triphosphatase Rac2 is expressed selectively in murine TH1 cells. Rac induces the interferon-gamma (IFN-gamma) promoter through cooperative activation of the nuclear factor kappa B and p38 mitogen-activated protein kinase pathways. Tetracycline-regulated transgenic mice expressing constitutively active Rac2 in T cells exhibited enhanced IFN-gamma production. Dominant-negative Rac inhibited IFN-gamma production in murine T cells. Moreover, T cells from Rac2-/- mice showed decreased IFN-gamma production under TH1 conditions in vitro. Thus, Rac2 activates TH1-specific signaling and IFN-gamma gene expression.

Abstract Objective . To investigate whether histone‐specific T helper (Th) cells that are able to induce anti‐doublestranded DNA (anti‐dsDNA) antibodies can be isolated from patients with systemic lupus erythematosus (SLE) and to characterize the cytokine secretion pattern of such Th clones. Methods . Peripheral blood mononuclear cells from SLE patients and healthy donors were stimulated with autologous apoptotic cell material or purified histones, expanded with interleukin‐2 (IL‐2), and cloned by limiting dilution. Histone reactivity of clones was examined by histone‐specific proliferation and cytokine release. Cytokines were determined by enzyme‐linked immunosorbent assay (ELISA) and CTLL‐2 bioassay. Induction of anti‐dsDNA antibodies was measured in cocultures of autologous B cells and Th clones by ELISA. Results . Numerous histone‐specific T cell receptor (TCR) α/β+ Th clones were established from 2 of 3 patients with active SLE and from 1 of 2 healthy individuals. Most Th clones secreted IL‐2, interferon‐γ (IFNγ), and IL‐4, whereas some produced predominantly IL‐2 and lFNγ. Th clones that could stimulate the production of anti‐dsDNA antibodies were derived from SLE patients and from a healthy individual. Conclusion . Th cells specific for histones may play an important role in the pathogenesis of SLE by inducing autoantibodies to dsDNA. Both Th1 and Th2 cytokines may be involved in the pathogenesis of SLE. The presence of histone‐specific Th cells in a healthy individual indicates the importance of peripheral tolerance for preventing autoimmunity to nuclear antigens.

Martin Herrmann and colleagues briefly discuss how autoimmunity might be initiated and maintained in the systemic autoimmune disease systemic lupus erythematosus.

Abstract Objective Patients with systemic lupus erythematosus (SLE) are often characterized by cellular as well as humoral deficiencies in the recognition and phagocytosis of dead and dying cells. The aim of this study was to investigate whether the remnants of apoptotic cells are involved in the induction of inflammatory cytokines in blood‐borne phagocytes. Methods We used ex vivo phagocytosis assays comprising cellular and humoral components and phagocytosis assays with isolated granulocytes and monocytes to study the phagocytosis of secondarily necrotic cell–derived material (SNEC). Cytokines were measured by multiplex bead array technology. Results We confirmed the impaired uptake of various particulate targets, including immunoglobulin‐opsonized beads, by granulocytes and monocytes from patients with SLE compared with healthy control subjects. Surprisingly, blood‐borne phagocytes from two‐thirds of the patients with SLE took up SNEC, which was rarely phagocytosed by phagocytes from healthy control subjects or patients with rheumatoid arthritis. Supplementation of healthy donor blood with IgG fractions derived from patients with SLE transferred the capability to take up SNEC to the phagocytes of healthy donors. Phagocytosis‐promoting immune globulins also induced secretion of huge amounts of cytokines by blood‐borne phagocytes following uptake of SNEC. Conclusion Opsonization of SNEC by autoantibodies from patients with SLE fosters its uptake by blood‐borne monocytes and granulocytes. Autoantibody‐mediated phagocytosis of SNEC is accompanied by secretion of inflammatory cytokines, fueling the inflammation that contributes to the perpetuation of autoimmunity in SLE.

Therapy in rheumatoid arthritis (RA) aims forthe containment of chronic inflammation as well asstructural protection of the affected joints. Both reduc-tion of inflammation and protection of joints fromdamage are considered central therapeutic goals in RA.Virtually all therapeutic agents used and developed forthe treatment of RA have been assessed for theirpotential to reach these 2 goals and, ideally, combine anantiinflammatory effect with a structure-sparing effect.Since the molecular mechanisms of synovitis, which areresponsible for the “inflammatory” signs of disease suchas swelling, pain, and stiffness, differ from the mecha-nisms leading to structural damage, antirheumatic drugsideally have to affect both mechanisms of disease.Inflammatory signs of RA are based on a chronicinflammatory process in the synovial membrane, whichis the result of an enhanced influx of immune cells aswell as synovial hyperplasia (1,2). Physiologically, only afew cells migrate into the normal synovium through thesynovial microvessels, and few cells escape this compart-ment to move toward regional lymph nodes through thelymphoendothelial microvessels. The enhanced influx ofimmune cells in inflammatory arthritis is regulated bychemokine and adhesion molecule expression in thesynovial tissue, which is induced by inflammatory cyto-kines such as tumor necrosis factor (TNF ) andinterleukin-1 (IL-1). Thus, joints are literally flooded byimmune cells, which accumulate in the synovial spaceand overflow the efflux mechanism through the lym-phatic vessels (3). This influx of immune cells, includingmacrophages, lymphocytes, dendritic cells, neutrophils,and mast cells, is accompanied by a response of theresident synovial fibroblasts (synovial hyperplasia),which express genes rendering them resistant to apopto-tic cell death as well as angiogenesis. Importantly, how-ever, this chronic inflammatory process in the synovialmembrane leads to profound damage of the surroundingtissue, particularly cartilage and bone. These destructivemechanisms are a consequence of an imbalance betweencatabolic and anabolic pathways induced by cytokinesand mediated by matrix-degrading enzymes (aggre-canases and matrix metalloproteinases [MMPs]) pro-duced by effector cells, including osteoclasts, fibroblasts,leukocytes, and chondrocytes.It is evident that inflammation is the driving forcein RA and gives rise to structural damage during thecourse of disease. The greater the inflammatory load towhich joints are exposed, the more likely it is forstructural damage to occur and the faster such damagewill progress. Risk predictors of structural damage inRA are thus the parameters that quantify inflammatoryload, such as the number of swollen joints or the level ofC-reactive protein (CRP) (4–6). Another key link be-tween inflammation and structural damage is time. Thelonger inflammation lasts, the more likely structuraldamage is to occur. Disease duration and parametersthat predict chronicity of arthritis, such as the presenceof anti–cyclic citrullinated peptide antibodies and/orrheumatoid factor, are associated with structural dam-age in RA (3–6). It is thus the chronicity of inflamma-tion that gives rise to structural damage of joints, andthisiswellreflected,forexample,bytheobservationthata transitory decrease in the acute component ofinflammation upon treatment with nonsteroidal anti-inflammatory drugs is not sufficient to achieve jointprotection. Accumulation of joint damage during thecourse of RA requires the presence of synovitis, which

Abstract Objective Immune activation triggers bone loss. Activated T cells are the cellular link between immune activation and bone destruction. The aim of this study was to determine whether immune regulatory mechanisms, such as naturally occurring Treg cells, also extend their protective effects to bone homeostasis in vivo. Methods Bone parameters in FoxP3‐transgenic (Tg) mice were compared with those in their wild‐type (WT) littermate controls. Ovariectomy was performed in FoxP3‐Tg mice as a model of postmenopausal osteoporosis, and the bone parameters were analyzed. The bones of RAG‐1 –/– mice were analyzed following the adoptive transfer of isolated CD4+CD25+ T cells. CD4+CD25+ T cells and CD4+ T cells isolated from FoxP3‐Tg mice and WT mice were cocultured with monocytes to determine their ability to suppress osteoclastogenesis in vitro. Results FoxP3‐Tg mice developed higher bone mass and were protected from ovariectomy‐induced bone loss. The increase in bone mass was found to be the result of impaired osteoclast differentiation and bone resorption in vivo. Bone formation was not affected. Adoptive transfer of CD4+CD25+ T cells into T cell–deficient RAG‐1 –/– mice also increased the bone mass, indicating that Treg cells directly affect bone homeostasis without the need to engage other T cell lineages. Conclusion These data demonstrate that Treg cells can control bone resorption in vivo and can preserve bone mass during physiologic and pathologic bone remodeling.

<h3>Objectives</h3> In systemic lupus erythematosus (SLE) apoptotic chromatin is present extracellularly, which is most likely the result of disturbed apoptosis and/or insufficient removal. Released chromatin, modified during apoptosis, activates the immune system resulting in the formation of autoantibodies. A study was undertaken to identify apoptosis-induced histone modifications that play a role in SLE. <h3>Methods</h3> The lupus-derived monoclonal antibody BT164, recently established by selection using apoptotic nucleosomes, was analysed by ELISA, western blot analysis and immunofluorescence staining using chromatin, cells, plasma and renal sections. Random peptide phage display and peptide inhibition ELISA were used to identify precisely the epitope of BT164. The reactivity of plasma samples from lupus mice and patients with SLE with the epitope of BT164 was investigated by peptide ELISA. <h3>Results</h3> The epitope of BT164 was mapped in the N-terminal tail of histone H3 (27-KSAPAT-32) and included the apoptosis-induced trimethylation of K27. siRNA-mediated silencing of histone demethylases in cultured cells resulted in hypermethylation of H3K27 and increased nuclear reactivity of BT164. This apoptosis-induced H3K27me3 is a target for autoantibodies in patients and mice with SLE and is present in plasma and in glomerular deposits. <h3>Conclusion</h3> In addition to previously identified acetylation of histone H4, H2A and H2B, this study shows that trimethylation of histone H3 on lysine 27 is induced by apoptosis and associated with autoimmunity in SLE. This finding is important for understanding the autoimmune response in SLE and for the development of translational strategies.

High-mobility group box 1 (HMGB1) protein is a nuclear DNA-binding protein, which functions as an alarmin when released from cells. Recent studies implicate extracellular HMGB1 in the pathogenesis of systemic lupus erythematosus (SLE), a prototypical autoimmune disease characterized by the formation of multiple autoantibodies, especially those directed against nucleosomes and double-stranded (ds)DNA. Elevated concentrations of HMGB1 are observed in sera as well as in skin lesions of patients with lupus. Of importance, serum HMGB1 and anti-HMGB1 autoantibody levels correlate with disease activity. In the blood of patients with SLE, HMGB1 is complexed with nucleosomes, at least partially. Moreover, HMGB1-nucleosome complexes from apoptotic cells activate antigen-presenting cells. Injection of HMGB1-nucleosome complexes into nonautoimmune mice results in the formation of autoantibodies against dsDNA and histones in a Toll-like receptor (TLR) 2-dependent manner. Additionally, HMGB1, as a part of DNA-anti-DNA immune complexes, can interact with receptor for advanced glycation end products (RAGE) on the surface of plasmacytoid dendritic cells and B cells leading to TLR9-dependent interferon (IFN)α release and activation of autoreactive B cells, respectively. HMGB1 attached to neutrophil extracellular traps may contribute to IFNα production by facilitating the recognition of self-nucleic acids. Furthermore, HMGB1, complexed with DNA and pathogenic anti-DNA autoantibodies, activates its receptors, TLR2, TLR4 and RAGE, and may thereby be involved in anti-DNA autoantibody-induced kidney damage in lupus nephritis. Collectively, these findings suggest that HMGB1 is a potential marker of disease activity and, because of its probable involvement in the pathogenesis, a novel therapeutic target in SLE.

Common variable immunodeficiency (CVID) presents in up to 25% of patients with autoimmune (AI) manifestations. Given the frequency and early onset in patients with CVID, AI dysregulation seems to be an integral part of the immunodeficiency. Antibody-mediated AI cytopenias, most often affecting erythrocytes and platelets, make up over 50% of these patients. This seems to be distinct from mainly cell-mediated organ specific autoimmunity. Some patients present like patients with AI lymphoproliferative syndrome (ALPS). Interestingly, in the majority of patients with AI cytopenias the immunological examination reveals a dysregulated B and T cell homeostasis. These phenotypic changes are associated with altered signaling through the antigen receptor which may well be a potential risk factor for disturbed immune tolerance as has been seen in STIM1 deficiency. In addition, elevated BAFF serum levels in CVID patients may contribute to survival of autoreactive B cells. Of all genetic defects associated with CVID certain alterations in TACI, CD19 and CD81 deficiency have most often been associated with AI manifestations. In conclusion, autoimmunity in CVID offers opportunities to gain insights into general mechanisms of human autoimmunity.

Activation of the nuclear transcription factor κB (NF-κB) regulates the expression of inflammatory genes crucially involved in the pathogenesis of inflammatory diseases. NF-κB governs the expression of adhesion molecules that play a pivotal role in leukocyte-endothelium interactions. We uncovered the crucial role of NF-κB activation within endothelial cells in models of immune-mediated diseases using a "sneaking ligand construct" (SLC) selectively inhibiting NF-κB in the activated endothelium. The recombinant SLC1 consists of three modules: (i) an E-selectin targeting domain, (ii) a Pseudomonas exotoxin A translocation domain, and (iii) a NF-κB Essential Modifier-binding effector domain interfering with NF-κB activation. The E-selectin-specific SLC1 inhibited NF-κB by interfering with endothelial IκB kinase 2 activity in vitro and in vivo. In murine experimental peritonitis, the application of SLC1 drastically reduced the extravasation of inflammatory cells. Furthermore, SLC1 treatment significantly ameliorated the disease course in murine models of rheumatoid arthritis. Our data establish that endothelial NF-κB activation is critically involved in the pathogenesis of arthritis and can be selectively inhibited in a cell type- and activation stage-dependent manner by the SLC approach. Moreover, our strategy is applicable to delineating other pathogenic signaling pathways in a cell type-specific manner and enables selective targeting of distinct cell populations to improve effectiveness and risk-benefit ratios of therapeutic interventions.

Systemic lupus erythematosus (SLE) can be a severe and potentially life-threatening disease that often represents a therapeutic challenge because of its heterogeneous organ manifestations. Only glucocorticoids, chloroquine and hydroxychloroquine, azathioprine, cyclophosphamide and very recently belimumab have been approved for SLE therapy in Germany, Austria and Switzerland. Dependence on glucocorticoids and resistance to the approved therapeutic agents, as well as substantial toxicity, are frequent. Therefore, treatment considerations will include 'off-label' use of medication approved for other indications. In this consensus approach, an effort has been undertaken to delineate the limits of the current evidence on therapeutic options for SLE organ disease, and to agree on common practice. This has been based on the best available evidence obtained by a rigorous literature review and the authors' own experience with available drugs derived under very similar health care conditions. Preparation of this consensus document included an initial meeting to agree upon the core agenda, a systematic literature review with subsequent formulation of a consensus and determination of the evidence level followed by collecting the level of agreement from the panel members. In addition to overarching principles, the panel have focused on the treatment of major SLE organ manifestations (lupus nephritis, arthritis, lung disease, neuropsychiatric and haematological manifestations, antiphospholipid syndrome and serositis). This consensus report is intended to support clinicians involved in the care of patients with difficult courses of SLE not responding to standard therapies by providing up-to-date information on the best available evidence.

Rituximab (RTX) is approved for induction therapy of granulomatosis with polyangiitis and microscopic polyangiitis. In eosinophilic granulomatosis with polyangiitis (EGPA), organ-threatening manifestations are mainly treated with cyclophosphamide (CYC). RTX as treatment in EGPA has been described in small case series; however long-term data and the efficacy of RTX in EGPA refractory to CYC have not been reported yet.To investigate the efficacy and safety of RTX and conventional immunosuppressive therapy with CYC in EGPA as induction therapy and during long-term follow-up.Retrospective analysis of 28 patients with EGPA was done. Treatment response and disease activity were determined by Birmingham Vasculitis Activity Score, C-reactive protein, eosinophils, antineutrophil cytoplasmic antibody, and peripheral CD19+ B cells.Fourteen patients with EGPA treated with RTX were compared with 14 age- and sex-matched patients with EGPA treated with CYC for remission induction; 64% of the RTX-treated patients with EGPA had previously failed CYC treatment. Disease duration was longer and the number of previous immunosuppressants higher in RTX-treated patients. Five RTX-treated patients (36%) and 4 CYC-treated patients (29%) achieved complete remission. All other patients were in partial remission. There was no difference between both groups in respect to treatment response and partial and complete remission. In both treatment groups, eosinophils, C-reactive protein, and IgE levels dropped. Relapse-free survival within an observation period of 36 months was comparable between RTX- and CYC-treated patients. RTX was well tolerated, but resulted in a decline in serum immunoglobulin levels.RTX was effective in inducing remission and during long-term follow-up in patients with EGPA, even when previously refractory to standard immunosuppressive therapy including CYC. RTX-treated patients should be monitored for hypogammaglobulinemia.

Objective Colony‐stimulating factor 1 receptor (CSF‐1R) essentially modulates monocyte proliferation, migration, and activation, which are considered important for the pathogenesis of rheumatoid arthritis (RA). We undertook this study to determine CSF‐1R expression in human RA as well as the efficacy of a specific anti–CSF‐1R monoclonal antibody (AFS98) in 2 different animal models of RA. Methods CSF‐1R expression was examined in blood, synovium, and bone samples from RA patients, osteoarthritis (OA) patients, and healthy subjects. The efficacy of AFS98 was examined by clinical assessment, histology, and bone histomorphometry in collagen‐induced arthritis (CIA) and serum‐transfer arthritis. Results CSF‐1R expression was increased in the synovium of RA patients compared to OA patients and healthy controls in fibroblast‐like synoviocytes, follicular dendritic cells, macrophages, and osteoclasts. Circulating RA monocytes and neutrophils but not lymphocytes were CSF‐1R+. In mice, blockade of CSF‐1R abrogated cartilage damage, bone erosion, and systemic bone loss, and this was associated with the depletion of osteoclasts in both models. While blockade of CSF‐1R did not affect inflammation in passive serum‐transfer arthritis, it significantly reduced inflammation in CIA, and this was associated with the absence of synovial macrophages and reduced splenic CD11b+Gr‐1− monocytes. Conclusion CSF‐1R was broadly expressed in human RA. Blockade of CSF‐1R protected against bone and cartilage destruction in both mouse models and also showed significant antiinflammatory effects in the CIA model. These data provide evidence for CSF‐1R as a therapeutic target in RA.

Objectives Patients with inflammatory rheumatic diseases (IRD) infected with severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) may be at risk to develop a severe course of COVID-19. The influence of immunomodulating drugs on the course of COVID-19 is unknown. To gather knowledge about SARS-CoV-2 infections in patients with IRD, we established a registry shortly after the beginning of the pandemic in Germany. Methods Using an online questionnaire ( www.COVID19-rheuma.de ), a nationwide database was launched on 30 March 2020, with appropriate ethical and data protection approval to collect data of patients with IRD infected with SARS-CoV-2. In this registry, key clinical and epidemiological parameters—for example, diagnosis of IRD, antirheumatic therapies, comorbidities and course of the infection—are documented. Results Until 25 April 2020, data from 104 patients with IRD infected with SARS-CoV-2 were reported (40 males; 63 females; 1 diverse). Most of them (45%) were diagnosed with rheumatoid arthritis, 59% had one or more comorbidities and 42% were treated with biological disease-modifying antirheumatic drugs. Hospitalisation was reported in 32% of the patients. Two-thirds of the patients already recovered. Unfortunately, 6 patients had a fatal course. Conclusions In a short time, a national registry for SARS-CoV2-infected patients with IRD was established. Within 4 weeks, 104 cases were documented. The registry enables to generate data rapidly in this emerging situation and to gain a better understanding of the course of SARS-CoV2-infection in patients with IRD, with a distinct focus on their immunomodulatory therapies. This knowledge is valuable for timely information of physicians and patients with IRD, and shall also serve for the development of guidance for the management of patients with IRD during this pandemic.

Patients with primary systemic vasculitis or polymyalgia rheumatica might be at a high risk for poor COVID-19 outcomes due to the treatments used, the potential organ damage cause by primary systemic vasculitis, and the demographic factors associated with these conditions. We therefore aimed to investigate factors associated with COVID-19 outcomes in patients with primary systemic vasculitis or polymyalgia rheumatica.In this retrospective cohort study, adult patients (aged ≥18 years) diagnosed with COVID-19 between March 12, 2020, and April 12, 2021, who had a history of primary systemic vasculitis (antineutrophil cytoplasmic antibody [ANCA]-associated vasculitis, giant cell arteritis, Behçet's syndrome, or other vasculitis) or polymyalgia rheumatica, and were reported to the COVID-19 Global Rheumatology Alliance registry were included. To assess COVID-19 outcomes in patients, we used an ordinal COVID-19 severity scale, defined as: (1) no hospitalisation; (2) hospitalisation without supplemental oxygen; (3) hospitalisation with any supplemental oxygen or ventilation; or (4) death. Multivariable ordinal logistic regression analyses were used to estimate odds ratios (ORs), adjusting for age, sex, time period, number of comorbidities, smoking status, obesity, glucocorticoid use, disease activity, region, and medication category. Analyses were also stratified by type of rheumatic disease.Of 1202 eligible patients identified in the registry, 733 (61·0%) were women and 469 (39·0%) were men, and their mean age was 63·8 years (SD 17·1). A total of 374 (31·1%) patients had polymyalgia rheumatica, 353 (29·4%) had ANCA-associated vasculitis, 183 (15·2%) had giant cell arteritis, 112 (9·3%) had Behçet's syndrome, and 180 (15·0%) had other vasculitis. Of 1020 (84·9%) patients with outcome data, 512 (50·2%) were not hospitalised, 114 (11·2%) were hospitalised and did not receive supplemental oxygen, 239 (23·4%) were hospitalised and received ventilation or supplemental oxygen, and 155 (15·2%) died. A higher odds of poor COVID-19 outcomes were observed in patients who were older (per each additional decade of life OR 1·44 [95% CI 1·31-1·57]), were male compared with female (1·38 [1·05-1·80]), had more comorbidities (per each additional comorbidity 1·39 [1·23-1·58]), were taking 10 mg/day or more of prednisolone compared with none (2·14 [1·50-3·04]), or had moderate, or high or severe disease activity compared with those who had disease remission or low disease activity (2·12 [1·49-3·02]). Risk factors varied among different disease subtypes.Among patients with primary systemic vasculitis and polymyalgia rheumatica, severe COVID-19 outcomes were associated with variable and largely unmodifiable risk factors, such as age, sex, and number of comorbidities, as well as treatments, including high-dose glucocorticoids. Our results could be used to inform mitigation strategies for patients with these diseases.American College of Rheumatology and the European Alliance of Associations for Rheumatology.

Changed dietary habits in Western countries such as reduced fiber intake represent an important lifestyle factor contributing to the increase in inflammatory immune-mediated diseases. The mode of action of beneficial fiber effects is not fully elucidated, but short-chain fatty acids (SCFA) and gut microbiota have been implicated. The aim of this study was to explore the impact of dietary fiber on lupus pathology and to understand underlying mechanisms. Here, we show that in lupus-prone NZB/WF1 mice low fiber intake deteriorates disease progression reflected in accelerated mortality, autoantibody production and immune dysregulation. In contrast to our original assumption, microbiota suppression by antibiotics or direct SCFA feeding did not influence the course of lupus-like disease. Mechanistically, our data rather indicate that in low fiber-fed mice, an increase in white adipose tissue mass, fat-inflammation and a disrupted intestinal homeostasis go along with systemic, low-grade inflammation driving autoimmunity. The links between obesity, intestinal leakage and low-grade inflammation were confirmed in human samples, while adaptive immune activation predominantly correlated with lupus activity. We further propose that an accelerated gastro-intestinal passage along with energy dilution underlies fiber-mediated weight regulation. Thus, our data highlight the often-overlooked effects of dietary fiber on energy homeostasis and obesity prevention. Further, they provide insight into how intricately the pathologies of inflammatory immune-mediated conditions, such as obesity and autoimmunity, might be interlinked, possibly sharing common pathways.

Human plasmacytoid dendritic cells (pDCs) are interleukin-3 (IL-3)-dependent cells implicated in autoimmunity, but the role of IL-3 in pDC biology is poorly understood. We found that IL-3-induced Janus kinase 2-dependent expression of SLC7A5 and SLC3A2, which comprise the large neutral amino acid transporter, was required for mammalian target of rapamycin complex 1 (mTORC1) nutrient sensor activation in response to toll-like receptor agonists. mTORC1 facilitated increased anabolic activity resulting in type I interferon, tumor necrosis factor, and chemokine production and the expression of the cystine transporter SLC7A11. Loss of function of these amino acid transporters synergistically blocked cytokine production by pDCs. Comparison of in vitro-activated pDCs with those from lupus nephritis lesions identified not only SLC7A5, SLC3A2, and SLC7A11 but also ectonucleotide pyrophosphatase-phosphodiesterase 2 (ENPP2) as components of a shared transcriptional signature, and ENPP2 inhibition also blocked cytokine production. Our data identify additional therapeutic targets for autoimmune diseases in which pDCs are implicated.

Objective To define the clinical spectrum time-course and prognosis of non-Asian patients positive for anti-MDA5 antibodies. MethodsWe conducted a multicentre, international, retrospective cohort study. Results149 anti-MDA5 positive patients (median onset age 53 years, median disease duration 18 months), mainly females (100, 67%), were included.Dermatomyositis (64, 43%) and amyopathic dermatomyositis (47, 31%), were the main diagnosis; 15 patients (10%) were classified as interstitial pneumonia with autoimmune features (IPAF) and 7 (5%) as rheumatoid arthritis.The main clinical findings observed were myositis (84, 56%), interstitial lung disease (ILD) (108, 78%), skin lesions (111, 74%), and arthritis (76, 51%).The onset of these manifestations was not concomitant in 74 cases (50%).Of note, 32 (21.5%) patients were admitted to the intensive care unit for rapidly progressive-ILD, which occurred in median 2 months from lung involvement detection, in the majority of cases (28, 19%) despite previous immunosuppressive treatment.One-third of patients (47, 32% each) was ANA and anti-ENA antibodies negative and a similar percentage was anti-Ro52 kDa antibodies positive.Non-specific interstitial pneumonia (65, 60%), organising pneumonia (23, 21%), and usual interstitial pneumonia-like pattern (14, 13%) were the main ILD patterns observed.Twenty-six patients died (17%), 19 (13%) had a rapidly progressive-ILD. ConclusionThe clinical spectrum of the anti-MDA5 antibodies-related disease is heterogeneous.Rapidly-progressive ILD deeply impacts the prognosis also in non-Asian patients, occurring early during the disease course.Anti-MDA5 antibody positivity should be considered even when baseline autoimmune screening is negative, anti-Ro52 kDa antibodies are positive, and radiology findings show a NSIP pattern.

The role of methotrexate in combination with biological agents in patients with psoriatic arthritis remains unclear. The MUST phase 3b trial aimed to compare the efficacy of ustekinumab plus placebo with ustekinumab plus methotrexate in patients with active psoriatic arthritis.In this investigator-initiated, randomised, multicentre, placebo-controlled, phase 3b non-inferiority trial done in 22 centres in Germany, patients with active psoriatic arthritis received open-label ustekinumab and were randomly assigned (1:1) to masked concomitant therapy with placebo or methotrexate (ongoing or new). The primary outcome was non-inferiority of mean Disease Activity Score-28 joints (DAS28) at week 24 for ustekinumab monotherapy (ustekinumab plus placebo) versus ustekinumab combination therapy (ustekinumab plus methotrexate), stratified by previous methotrexate treatment. The key secondary analysis was non-inferiority of DAS28 at week 52. The primary analysis was based on a stratified van Elteren test with an α of 2·5% and a non-inferiority margin of 12·5% by Mann-Whitney estimator. Adverse events and serious adverse events were assessed. This study is registered with ClinicalTrials.gov, NCT03148860.Between Jan 24, 2017, and April 12, 2021, 186 patients with active psoriatic arthritis were screened, of whom 173 (93%) patients were enrolled and randomly assigned (1:1) to receive concomitant methotrexate therapy (n=88) or placebo (n=85). 84 patients were receiving methotrexate at baseline, and 89 patients had no previous methotrexate treatment. 166 (96%) patients (87 in the ustekinumab plus methotrexate group and 79 in the ustekinumab plus placebo group) were included in the safety and efficacy analyses at week 24 (69 [42%] female; 97 [58%] male; mean age 48·2 years [SE 1·1]). Ustekinumab plus placebo was non-inferior to ustekinumab plus methotrexate in DAS28 at week 24 (2·9 [SD 1·31] vs 3·1 [1·42]); the stratified Mann-Whitney estimator for treatment comparison was 0·5426 (95% CI 0·4545-0·6307). Non-inferiority for ustekinumab plus placebo was also observed in DAS28 at week 52. Serious adverse events occurred in seven (9%) patients in the ustekinumab plus placebo group and eight (9%) patients in the ustekinumab plus methotrexate group. No specific serious adverse events affected more than one patient, and there were no deaths.Interleukin (IL)-12 and IL-23 inhibition with ustekinumab is an effective treatment for psoriatic arthritis independent of methotrexate use; concomitant methotrexate did not increase efficacy of ustekinumab (based on DAS28). On the basis of these data, there is no evidence to support the addition or maintainance of methotrexate when initiating ustekinumab in patients with active psoriatic arthritis.Janssen Cilag.

To detail the unmet clinical and scientific needs in the field of rheumatology. After a 2-year hiatus due to the SARS-CoV-2 pandemic, the 22nd annual international Advances in Targeted Therapies meeting brought together more than 100 leading basic scientists and clinical researchers in rheumatology, immunology, epidemiology, molecular biology and other specialties. Breakout sessions were convened with experts in five rheumatological disease-specific groups including: rheumatoid arthritis (RA), psoriatic arthritis, axial spondyloarthritis, systemic lupus erythematosus and connective tissue diseases (CTDs). In each group, experts were asked to identify and prioritise current unmet needs in clinical and translational research, as well as highlight recent progress in meeting formerly identified unmet needs. Clinical trial design innovation was emphasised across all disease states. Within RA, developing therapies and trials for refractory disease patients remained among the most important identified unmet needs and within lupus and spondyloarthritis the need to account for disease endotypes was highlighted. The RA group also identified the need to better understand the natural history of RA, pre-RA states and the need ultimately for precision medicine. In CTD generally, experts focused on the need to better identify molecular, cellular and clinical signals of early and undifferentiated disease in order to identify novel drug targets. There remains a strong need to develop therapies and therapeutic strategies for those with treatment-refractory disease. Increasingly it is clear that we need to better understand the natural history of these diseases, including their 'predisease' states, and identify molecular signatures, including at a tissue level, which can facilitate disease diagnosis and treatment. As these unmet needs in the field of rheumatic diseases have been identified based on consensus of expert clinicians and scientists in the field, this document may serve individual researchers, institutions and industry to help prioritise their scientific activities.

AbstractPurpose : Low-dose radiotherapy (LD-RT) is known to exert an anti-inflammatory effect, but the underlying radiobiological and immunological mechanisms remain elusive. In recent studies, we observed a reduced adhesion of peripheral blood mononuclear cells (PBMC) to endothelial cells (EC) after LD-RT (0.3-0.7 Gy). This shows that this treatment affects the initial steps of the inflammatory response. To explore the role of inflammatory mediators in this process, we investigated the expression of Transforming growth factor β 1 (TGF- β 1) and Interleukin 6 (IL-6) after LD-RT. Materials and Methods : EC were grown to subconfluence and irradiated with single-dose LD-RT. Twenty-hours after irradiation, EC were treated with IL-1 β for 4 h and then incubated with peripheral blood mononuclear cells (PBMC). Adherent PBMC were counted when using light microscopy. Expression of the cytokines TGF- β 1 and IL-6 was measured by ELISA, and mRNA levels were analysed by the RNAse-protection assay (RPA). Surface expression of E-selectin was quantified by flow cytometry. Results : A relative minimum of adhesion was observed after LD-RT between 0.3 and 0.7 Gy. This was paralleled by an expression maximum of TGF- β 1 and IL-6, as shown by protein and mRNA levels, respectively. Neutralization of TGF- β 1 by monoclonal antibodies, but not of IL-6, increased PBMC adhesion to EC nearly to control levels. In addition, fluorescence activated cell sorter (FACS) analysis of irradiated EC demonstrated a down-regulation of E-selectin in the same dose range. Conclusion : Low-dose X-irradiation between 0.3 and 0.7 Gy induced a relative maximum of TGF- β 1 production by stimulated EC. This results in a down-regulation of leukocyte/PBMC adhesion and may contribute to the anti-inflammatory effect of LD-RT.

Abstract Objective The efficient uptake of dying cells by phagocytes is essential to the avoidance of chronic inflammation. Some human autoimmune responses are thought to be driven by autoantigens from apoptotic or necrotic cells. We analyzed the role of C1q and DNase I in the disposal of necrotic cell–derived chromatin because deficiencies in these serum factors predispose to the development of systemic autoimmune disorders, such as systemic lupus erythematosus. Methods Human necrotic peripheral blood lymphocytes were incubated in cell culture medium supplemented with various sera or serum components. Chromatin degradation was monitored by measuring the residual DNA content by flow cytometry. The uptake of necrotic cell–derived nuclei was analyzed by in vitro phagocytosis assays. Results Reconstitution of C1q‐depleted serum with C1q strongly increased its ability to degrade necrotic cell–derived chromatin. Although C1q itself displayed no DNase activity, it strongly augmented the activity of serum DNase I. Whereas an excess of recombinant DNase I degraded chromatin in the absence of C1q, efficient uptake of the predigested material by monocyte‐derived phagocytes required the presence of C1q. These data show that C1q and DNase I cooperate in the degradation of chromatin from necrotic cells. Furthermore, C1q was found to be necessary for effective uptake of degraded chromatin by monocyte‐derived phagocytes. Conclusion C1q or DNase I deficiencies may precipitate autoimmunity in humans by a mechanism similar to that of other molecules that are involved in the safe, efficient, and rapid disposal of dying cells.

Systemic lupus erythematosus (SLE) is characterized by a diverse array of autoantibodies, particularly against nuclear antigens, thought to derive from apoptotic and necrotic cells. Impaired clearance functions for dying cells may explain accumulation of apoptotic cells in SLE tissues, and secondary necrosis of these cells may contribute to the chronic inflammation in this disease. The exposure of phosphatidylserine (PS) and altered carbohydrates on dying cells are important recognition signals for macrophages. Furthermore, serum factors such as complement, DNase I, pentraxins (e.g. C-reactive protein) and IgM contribute to efficient opsonization and uptake of apoptotic and necrotic cells. Defects in these factors may impact the development of SLE in humans and mice in a variety of ways. We observed impaired clearance of apoptotic cells in lymph nodes and skin biopsies of humans with lupus, as well as intrinsic defects of macrophages differentiated in vitro from SLE patients’ CD34+ stem cells, demonstrating that apoptotic cells are not properly cleared in a subgroup of patients with SLE. This altered mechanism for the clearance of dying cells may represent a central pathogenic process in the development and acceleration of this autoimmune disease.

Small guanosine triphosphatases, typified by the mammalian Ras proteins, play major roles in the regulation of numerous cellular pathways. A subclass of evolutionarily conserved Ras-like proteins was identified, members of which differ from other Ras proteins in containing amino acids at positions 12 and 61 that are similar to those present in the oncogenic forms of Ras. These proteins, kappaB-Ras1 and kappaB-Ras2, interact with the PEST domains of IkappaBalpha and IkappaBbeta [inhibitors of the transcription factor nuclear factor kappa B (NF-kappaB)] and decrease their rate of degradation. In cells, kappaB-Ras proteins are associated only with NF-kappaB:IkappaBbeta complexes and therefore may provide an explanation for the slower rate of degradation of IkappaBbeta compared with IkappaBalpha.

Radio-frequency ablation (RFA) is used as a minimally invasive treatment for inoperable hepatic tumors. Immunological reactions secondary to RFA may play a role in the observed tumor control. In our study, the VX2 carcinoma was implanted into the liver of rabbits. After 3 weeks, tumors were treated with RFA or were left untreated. Peripheral blood lymphocytes were harvested before tumor implantation, 2 weeks postoperatively and at 2-week intervals thereafter. T cells were stimulated with lysates of either tumor tissue or nontumorous liver loaded on autologous antigen-presenting cells and their stimulation index was determined by [(3)H]thymidine incorporation. A 3-fold increase over background or controls was considered significant. Stimulation with phytohemagglutinin served as a positive control. The animals were necropsied, and liver and tumor tissue were analyzed immunohistologically for T-cell infiltration. T cells from tumor-bearing (n = 9) and RFA-treated (n = 11) animals were investigated in a follow-up study. The mean postoperative observation was 45 days. All of the 11 RFA-treated animals exhibited circulating T cells activated specifically toward tumor antigens throughout the observation period, which was accompanied by dense T-cell infiltration. In contrast, T cells of untreated tumor-bearing rabbits showed no reaction and only sparse T cell infiltration. We concluded that RFA induces a tumor-specific T-cell reaction in the otherwise unreactive tumor-bearing host, apparently overcoming immune tolerance and leading to the presentation of otherwise cryptic tumor antigens. Therefore, in addition to destroying tumor tissue, RFA induces an immune response against tumor antigens that may be exploited in multimodal antitumor strategies.

Calcitonin gene-related peptide (CGRP) is a neuropeptide produced by the central and peripheral nervous systems and by endocrine cells. CGRP exerts diverse biological effects on the cardiovascular, gastrointestinal, respiratory, central nervous and immune systems. Little is known, however, about the molecular mechanisms that mediate CGRP effects. Using the NFκB-luciferase reporter transgenic mice, here we show that CGRP selectively inhibits NF-κB-mediated transcription in thymocytes in vitro andin vivo. In contrast, CGRP does not affect transcription mediated by the AP-1 and NFAT transcription factors. CGRP inhibits the accumulation of NF-κB complexes in the nucleus by preventing phosphorylation and degradation of the NF-κB inhibitor IκB. Inhibition of NF-κB activity is associated with the induction of apoptosis by CGRP in thymocytes. Together these results demonstrate for the first time the selective implication of the NF-κB signaling pathway in the regulatory function of the neuropeptide CGRP. Our study suggests a potential molecular mechanism by which CGRP can induce cell death in thymocytes. Calcitonin gene-related peptide (CGRP) is a neuropeptide produced by the central and peripheral nervous systems and by endocrine cells. CGRP exerts diverse biological effects on the cardiovascular, gastrointestinal, respiratory, central nervous and immune systems. Little is known, however, about the molecular mechanisms that mediate CGRP effects. Using the NFκB-luciferase reporter transgenic mice, here we show that CGRP selectively inhibits NF-κB-mediated transcription in thymocytes in vitro andin vivo. In contrast, CGRP does not affect transcription mediated by the AP-1 and NFAT transcription factors. CGRP inhibits the accumulation of NF-κB complexes in the nucleus by preventing phosphorylation and degradation of the NF-κB inhibitor IκB. Inhibition of NF-κB activity is associated with the induction of apoptosis by CGRP in thymocytes. Together these results demonstrate for the first time the selective implication of the NF-κB signaling pathway in the regulatory function of the neuropeptide CGRP. Our study suggests a potential molecular mechanism by which CGRP can induce cell death in thymocytes. calcitonin gene-related peptide monoclonal antibody phorbol 12-myristate 13-acetate phosphate-buffered saline double stranded cAMP response element-binding protein electrophoretic mobility shift assay tumor necrosis factor α double positive protein kinase A Neuropeptides play an important role in mediating communications between the nervous, endocrine, and immune systems. Calcitonin gene-related peptide (CGRP),1is a 37-amino acid peptide generated by tissue-specific alternative processing of the calcitonin/CGRP gene (1.Amara S.G. Jonas V. Rosenfeld M.G. Ong E.S. Evans R.M. Nature. 1982; 298: 240-244Crossref PubMed Scopus (1724) Google Scholar, 2.Rosenfeld M.G. Mermod J.J. Amara S.G. Swanson L.W. Sawchenko P.E. Rivier J. Vale W.W. Evans R.M. Nature. 1983; 304: 129-135Crossref PubMed Scopus (1938) Google Scholar). CGRP has been identified in both the central and the peripheral nervous systems where it accumulates in sensory nerve endings enervating all the tissues that have been examined (3.Kruger L. Silverman J.D. Mantyh P.W. Sternini C. Brecha N. J. Comp. Neurol. 1989; 280: 291-302Crossref PubMed Scopus (220) Google Scholar, 4.Rosenfeld M.G. Emeson R.B. Yeakley J.M. Merillat N. Hedjran F.H. Lenz J. Delsert C. Ann. N. Y. Acad. Sci. 1991; 621: 1-17Crossref Scopus (133) Google Scholar). CGRP is also present in some endocrine cells (4.Rosenfeld M.G. Emeson R.B. Yeakley J.M. Merillat N. Hedjran F.H. Lenz J. Delsert C. Ann. N. Y. Acad. Sci. 1991; 621: 1-17Crossref Scopus (133) Google Scholar, 5.Verastegui C. Oliveira A.P. Fernadezviviero J. Romero A. Decastro J.M. Eur. J. Histochem. 1997; 41: 119-126PubMed Google Scholar). CGRP exerts multiple biological effects on the central nervous, the cardiovascular and gastrointestinal systems (6.Goodman E.C. Iversen L.L. Life Sci. 1986; 38: 2169-2178Crossref PubMed Scopus (202) Google Scholar). CGRP is largely known as one of the potent vasodilators (7.Brain S.D. Williams T.J. Tippins J.R. Morris H.R. MacIntyre I. Nature. 1985; 313: 54-56Crossref PubMed Scopus (1795) Google Scholar). CGRP also has pro-inflammatory actions and metabolic effects (regulation of calcium metabolism, and glucose metabolism) (8.Poyner D.R. Pharmacol. Ther. 1993; 56: 23-51Crossref Scopus (200) Google Scholar). CGRP stimulates osteoblast proliferation (9.Bernard G. Shih C. Peptides. 1990; 11: 625-632Crossref PubMed Scopus (92) Google Scholar), increases their production of insulin growth factor (10.Vignery A. McCarthy T.L. Bone. 1996; 18: 331-335Crossref PubMed Scopus (88) Google Scholar), decrease their production of cytokines (11.Millet I. Vignery A. Cytokine. 1997; 9: 999-1007Crossref PubMed Scopus (40) Google Scholar), and increases bone volume density in mice (12.Ballica R. Valentijn K. Khachatryan A. Guerder S. Kapadia S. Gundberg C. Gilligan J. Flavell R.A. Vignery A. J. Bone Miner. Res. 1999; 14: 1067-1074Crossref PubMed Scopus (106) Google Scholar). Interestingly, CGRP is coexpressed with Substance P in sensory neurons and it is one of the major peptide in the mammalian skin. CGRP is distributed in cells and nerve fibers of hematopoietic and lymphoid tissues including bone marrow, lymph nodes, spleen, and thymus (13.Bulloch K. Radojcic T., Yu, R. Hausman J. Lenhard L. Baird S. Prog. Neuroendocrinimmunol. 1991; 4: 186-194Google Scholar, 14.Bulloch K. Hausman J. Radojcic T. Short S. Ann. N. Y. Acad. Sci. 1991; 621: 218-228Crossref PubMed Scopus (22) Google Scholar, 15.Wang X. Xing L. Tang Y. Han C. J. Neuroimmunol. 1999; 94: 95-102Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 16.Weihe E. Muller S. Fink T. Zentel H.J. Neurosci. Lett. 1989; 100: 77-82Crossref PubMed Scopus (86) Google Scholar). Several studies have illustrated the role for this neuropeptide as a regulator of the immune response. CGRP inhibits mitogen-stimulated T lymphocyte and thymocyte proliferation and survival (13.Bulloch K. Radojcic T., Yu, R. Hausman J. Lenhard L. Baird S. Prog. Neuroendocrinimmunol. 1991; 4: 186-194Google Scholar, 17.Umeda Y. Takamiya M. Yoshizaki H. Arisawa M. Biochem Biophys. Res. Commun. 1988; 154: 227-235Crossref PubMed Scopus (118) Google Scholar, 18.Bulloch K. McEwen B.S. Diwa A. Radojcic T. Hausman J. Baird S. Ann. N. Y. Acad. Sci. 1994; 741: 129-136Crossref PubMed Scopus (15) Google Scholar, 19.Sakuta H. Inaba K. Muramatsu S. J. Neuroimmunol. 1996; 67: 103-109Abstract Full Text PDF PubMed Scopus (34) Google Scholar, 20.Bulloch K. Mc Ewen B.S. Nordberg J. Diwa A. Baird S. Ann. N. Y. Acad. Sci. 1998; 1: 551-562Crossref Scopus (45) Google Scholar). CGRP inhibits the production of interleukin-2 and other cytokines by CD4+ Th1 T cell clones (21.Wang F. Millet I. Bottomly K. Vignery A. J. Biol. Chem. 1992; 267: 21052-21057Abstract Full Text PDF PubMed Google Scholar), antigen presentation by Langerhans cells (22.Hosoi J. Murphy G.F. Egan C.L. Lerner E.A. Grabbe S. Asahina A. Granstein R.D. Nature. 1993; 363: 159-163Crossref PubMed Scopus (535) Google Scholar), and early B cell differentiation (23.McGillis J.P. Rangnekar V. Ciallella J.R. Can. J. Physiol. Pharmacol. 1995; 73: 1057-1064Crossref PubMed Scopus (15) Google Scholar). CGRP prevents diabetes in non-obese diabetic mice (24.Khachatryan A. Guerder S. Palluault F. Cote G. Solimena M. Valentijn K. Millet I. Flavell R.A. Vignery A. J. Immunol. 1997; 158: 1409-1416PubMed Google Scholar) and inhibits the induction of delayed type hypersensitivity reaction and contact hypersensitivity (25.Asahina A. Hosoi J. Beissert S. Stratigos A. Granstein R.D. J. Immunol. 1995; 154: 3056-3061PubMed Google Scholar). Within the thymus, CGRP was found present in a subpopulation of epithelial cells at the corticomedullary junction in the thymus, and in most subcapsular and trabecular mast cells (13.Bulloch K. Radojcic T., Yu, R. Hausman J. Lenhard L. Baird S. Prog. Neuroendocrinimmunol. 1991; 4: 186-194Google Scholar, 14.Bulloch K. Hausman J. Radojcic T. Short S. Ann. N. Y. Acad. Sci. 1991; 621: 218-228Crossref PubMed Scopus (22) Google Scholar, 18.Bulloch K. McEwen B.S. Diwa A. Radojcic T. Hausman J. Baird S. Ann. N. Y. Acad. Sci. 1994; 741: 129-136Crossref PubMed Scopus (15) Google Scholar, 26.Kurz B. von Gaudecker B. Kranz A. Krisch B. Mentlein R. Peptides. 1995; 16: 1497-1503Crossref PubMed Scopus (25) Google Scholar). Binding and functional studies indicate that thymocytes express functional receptors for CGRP (18.Bulloch K. McEwen B.S. Diwa A. Radojcic T. Hausman J. Baird S. Ann. N. Y. Acad. Sci. 1994; 741: 129-136Crossref PubMed Scopus (15) Google Scholar, 26.Kurz B. von Gaudecker B. Kranz A. Krisch B. Mentlein R. Peptides. 1995; 16: 1497-1503Crossref PubMed Scopus (25) Google Scholar,27.Marie J.-C. Wakkach A. Coudray A.-M. Chastre E. Berrih-Aknin S. Gespach C. J. Immunol. 1999; 162: 2103-2112PubMed Google Scholar). The distribution of CGRP within the thymus and the presence of CGRP receptors on thymocytes suggest that this neuropeptide could also regulate the maturation of T cells in the thymus. CGRP mediates its activities through interactions with specific membrane receptors. Pharmacological studies strongly suggest the existence of at least two CGRP receptors (CGRP-R). CGRP-R belongs to the superfamily of G protein-coupled receptors. Little is known about the downstream signaling pathways used by CGRP to mediate its effects. CGRP activates adenylate cyclase leading to the induction of cAMP production. Activation of phospholipase C and protein kinase C have been suggested to mediate calcium release by CGRP (8.Poyner D.R. Pharmacol. Ther. 1993; 56: 23-51Crossref Scopus (200) Google Scholar, 28.Wimalawansa S.J. Endocr. Rev. 1996; 17: 533-585Crossref PubMed Scopus (441) Google Scholar, 29.Aiyar N. Disa J. Lysko P.G. Mol. Cell. Biochem. 1999; 197: 179-185Crossref PubMed Scopus (55) Google Scholar, 30.Aiyar N. Rand K. Elshourbagy N.A. Zeng Z. Adamou J.E. Bergsma D.J. Li Y. J. Biol. Chem. 1996; 271: 11325-11329Abstract Full Text Full Text PDF PubMed Scopus (299) Google Scholar). Although CGRP has been reported to regulate thymocyte cell proliferation and cell death, no molecular mechanism has been elucidated. In this study, using the NFκB-luciferase reporter transgenic mice, we demonstrate that CGRP is a selective inhibitor of NF-κB activity in thymocytes in vitro and in vivo. In addition, our data indicate that the down-regulation of NF-κB transcriptional activity by CGRP is associated with an increase in cell death. The reporter transgenic mice expressing the luciferase gene under the control of AP-1 or NFAT-binding sites were described previously (31.Rincón M. Flavell R.A. Mol. Cell. Biol. 1996; 16: 1074-1084Crossref PubMed Scopus (74) Google Scholar, 32.Rincón M. Flavell R.A. EMBO J. 1994; 13: 4370-4381Crossref PubMed Scopus (245) Google Scholar, 33.Rincón M. Flavell M.A. Mol. Cell. Biol. 1997; 17: 1522-1534Crossref PubMed Scopus (108) Google Scholar, 34.Rincón M. Derijard B. Chow C.-W. Davis R.J. Flavell R.A. Genes and Function. 1997; 1: 51-68Crossref PubMed Scopus (102) Google Scholar, 35.Huang C. Ma W.Y. Dawson M.I. Flavell R.A. Dong Z. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5826-5830Crossref PubMed Scopus (203) Google Scholar, 36.Yang D.D. Kuan C.-Y. Whitmarsh A.J. Rincón M. Zheng T.S. Davis R.J. Rakic P. Flavell R.A. Nature. 1997; 389: 865-870Crossref PubMed Scopus (1110) Google Scholar). The NFκB-luciferase reporter mice were made using the pBIIX-luciferase construct with two copies (2x NF-κB) of the κB sequences from the Igκ enhancer. 2R. J. Phillips, manuscript in preparation. DP and mature CD4+ thymocytes were obtained by staining total thymocytes with directly fluorescein isothiocyanate-conjugated anti-CD8 monoclonal antibody (mAb) and/or phycoerythrin-conjugated anti-CD4 mAb (PharMingen, San Diego, CA) and fluorescence-activated cell sorting (Becton Dickinson FACStar Plus cell sorter). The average purity for each population was >98%. Total thymocytes or purified thymocyte populations were activated with PMA (5 ng/ml) (Sigma) and ionomycin (250 ng/ml) (Sigma) for different times. The cells were pretreated with specific concentrations of human CGRP (Peninsula, Inc., Belmomt, CA) for 30 min prior activation and remained present in the culture during the activation period. Recombinant murine TNFα (R&D systems, Minneapolis, MN) (100 ng/ml) was also used as apoptotic stimulus. Equivalent number of thymocytes (106 or 5 × 105 cells) for each condition were harvested, washed in PBS, and lysed (Luciferase assay, Roche Molecular Biochemicals, Corp.) for 30 min at room temperature. The lysates were then analyzed using a luciferase kit (Roche Molecular Biochemicals) and measured in a luminometer (Lumat LB9501) for 10 s (two measurements were made for each sample). Results are presented as the average of two measurements where background has been subtracted. Nuclear extracts were obtained from treated and untreated total thymocytes, DP or CD4+ thymocytes as described previously (37.Phillips R.J. Ghosh S. Mol. Cell. Biol. 1997; 17: 4390-4396Crossref PubMed Google Scholar). NF-κB binding reactions were carried out using 5–10 μg of nuclear proteins and a 32P double-stranded (ds) oligonucleotide containing the NF-κB consensus sequence derived from the mouse κ intronic enhancer (GATCAGAGGGGACTTTCCGAG). Supershift analysis were performed by preincubating nuclear extracts with 1 μl/reaction of an anti-p50 mAb, anti-p65 mAb, or anti-c-Rel mAb (gifts from N. Rice) for 1 h at 4 °C prior to addition of the NF-κB-labeled probe. DNA binding of the cAMP response element-binding (CREB) protein was examined by using 2 μg of nuclear extracts and a32P ds oligonucleotide containing the CRE sequence (ATCTCTCTGACGTCAGCCAAGGAGGAGGCG) (38.Montminy M.R. Bilezikijan L.M. Nature. 1986; 328: 175-178Crossref Scopus (952) Google Scholar). The samples were then electrophoresed under standard conditions. For supershift analysis, 1 μl of the appropriate antibody was preincubated with each extract at 4 °C for 1 h prior to assay by EMSA. Immunoblot analysis was performed on 30 μg of cytoplasmic extract from treated and untreated thymocytes as described previously (37.Phillips R.J. Ghosh S. Mol. Cell. Biol. 1997; 17: 4390-4396Crossref PubMed Google Scholar). Following fractionation by SDS-polyacryalmide gel electrophoresis, the proteins were electrophoretically transferred to Immobilon-P membranes (Millipore). The membranes were then incubated with the appropriate primary antibody (IκBβ antiserum at 1:1500 dilution; IκBα at 1:1500 from N. Rice, or polyclonal rabbit antibodies specific for IκBα (Santa Cruz Biotechnologies, Santa Cruz, CA), or specific for phospho-IκBα (New England Biolabs, Beverly, MA)). Proteins detected by the primary antibodies were finally visualized by enhanced chemiluminescence (ECL, Amersham Pharmacia Biotech) following the manufacturer's instructions. Freshly isolated thymocytes or thymocytes were cultured in the presence of medium, CGRP, or TNFα for 6 or 20 h at 37 °C and then analyzed for apoptosis, by TUNEL staining using the APO-direct kit (PharMingen), as recommended by the manufacturer. Samples were then analyzed by fluorescence-activated cell sorting. CGRP has been defined as an anti-proliferative agent for T lymphocytes (13.Bulloch K. Radojcic T., Yu, R. Hausman J. Lenhard L. Baird S. Prog. Neuroendocrinimmunol. 1991; 4: 186-194Google Scholar, 17.Umeda Y. Takamiya M. Yoshizaki H. Arisawa M. Biochem Biophys. Res. Commun. 1988; 154: 227-235Crossref PubMed Scopus (118) Google Scholar, 39.Boudard F. Bastide M. J. Neurosci. Res. 1991; 29: 29-41Crossref PubMed Scopus (102) Google Scholar), andin vitro treatment of thymocytes with CGRP leads to a reduced number of viable cells (19.Sakuta H. Inaba K. Muramatsu S. J. Neuroimmunol. 1996; 67: 103-109Abstract Full Text PDF PubMed Scopus (34) Google Scholar, 20.Bulloch K. Mc Ewen B.S. Nordberg J. Diwa A. Baird S. Ann. N. Y. Acad. Sci. 1998; 1: 551-562Crossref Scopus (45) Google Scholar). To determine whether CGRP may also be an apoptotic stimulus rather than an antiproliferative agent, we examined whether CGRP induced apoptosis in thymocytes. Freshly isolated thymocytes were treated with different doses of CGRP for 20 h. Apoptosis was examined by TUNEL assay to measure DNA fragmentation (a hallmark of apoptosis). Although the incubation of thymocytes with medium alone caused some levels of spontaneous apoptosis, the presence of CGRP resulted in a substantial enhancement of apoptosis in a dose-dependent manner (Fig.1 A). CGRP maximal effect was observed at the concentration range of 10−8-10−9m. TNFα has been previously reported to induce apoptosis in several cell types including thymocytes (40.Hernandez-Caselles T. Stutman O. J. Immunol. 1993; 151: 3999-4012PubMed Google Scholar). We observed that the percentage of apoptotic cells obtained after treatment with CGRP was higher than the percentage of apoptotic cells caused by TNFα treatment (Fig.1 B). CGRP was also able to augment TNFα-induced apoptosis (Fig. 1 B). Similarly, CGRP also increased Fas-mediated thymocyte apoptosis (data not shown). These results indicated that CGRP could induce thymocyte cell death in vitro and increase susceptibility of thymocytes to death triggered by thymic environmental stimuli. To address the physiologic relevance of the regulatory role of CGRP in thymocyte cell death, we examined the effect of CGRP in vivoby administering CGRP to mice. CGRP (26.5 nmol/mouse) or PBS (as a control vehicle) was injected intraperitoneally into mice. After 24 h, the administrated dose of CGRP did not cause any obvious symptoms in the mice (data not shown). However, CGRP treatment resulted in a significant loss (30–58% reduction) of the total number of thymocytes (Fig. 1 C). After 48 h the number of thymocytes in CGRP-treated mice was comparable to the number of thymocytes in PBS-injected mice (data not shown). This transient effect observed upon injection of CGRP showed the specific and non-toxic effect of CGRP on the thymus, and it is explained by the short life of this neuropeptide in the circulation. Thus, CGRP can regulate thymocyte apoptosis in vitro and in vivo. Despite the large number of studies that involve CGRP in the regulation of specific functions of the cardiovascular, gastrointestinal, respiratory, central nervous and immune systems, little is known about the molecular mechanisms that mediate these effects. To determine the signaling pathways involved in CGRP-induced cell death, we examined whether CGRP could regulate the activity of NF-κB transcription factor which has been considered as an anti-apoptotic signal in several cell types including thymocytes (41.Beg A.A. Baltimore D. Science. 1996; 274: 782-784Crossref PubMed Scopus (2919) Google Scholar, 42.van Antwerp D.J. Martin S.J. Kafri T. Green D. Verma I.M. Science. 1996; 274: 787-789Crossref PubMed Scopus (2437) Google Scholar, 43.Wang C.-Y. Mayo M.W. Baldwin Jr., A.S. Science. 1996; 274: 784-787Crossref PubMed Scopus (2499) Google Scholar, 44.Wu M. Lee H. Bellas R.B. Schquer S.L. Arsura M. Katz D. Fitzgeral M.J. Rothstein T.L. Sherr D.H. Sonnenshein G.E. EMBO J. 1996; 15: 4682-4690Crossref PubMed Scopus (553) Google Scholar, 45.Wang W. Wykrzykowska J. Johnson T. Sen R. Sen Y. J. Immunol. 1999; 162: 314-322PubMed Google Scholar, 46.Bakker T.R. Renno T. Jongeneel C.V. J. Immunol. 1999; 162: 3456-3462PubMed Google Scholar). We have generated NFκB-luciferase reporter transgenic mice2 to examine NF-κB-mediated transcription in primary cells. In these mice, the luciferase reporter gene is driven by two copies of the NF-κB regulatory element. Using these mice we found that NF-κB was constitutively activated in bone marrow and spleen as expected due to the presence of B cells, but not in kidney or liver (data not shown). Interestingly, we also observed constitutive NF-κB transcriptional activity in thymocytes (Fig.2 A). We examined AP-1 and NFAT transcriptional activity in freshly isolated thymocytes using the AP1-luciferase and NFAT-luciferase reporter transgenic mice that we have previously generated (31.Rincón M. Flavell R.A. Mol. Cell. Biol. 1996; 16: 1074-1084Crossref PubMed Scopus (74) Google Scholar, 32.Rincón M. Flavell R.A. EMBO J. 1994; 13: 4370-4381Crossref PubMed Scopus (245) Google Scholar, 33.Rincón M. Flavell M.A. Mol. Cell. Biol. 1997; 17: 1522-1534Crossref PubMed Scopus (108) Google Scholar, 34.Rincón M. Derijard B. Chow C.-W. Davis R.J. Flavell R.A. Genes and Function. 1997; 1: 51-68Crossref PubMed Scopus (102) Google Scholar, 35.Huang C. Ma W.Y. Dawson M.I. Flavell R.A. Dong Z. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5826-5830Crossref PubMed Scopus (203) Google Scholar, 36.Yang D.D. Kuan C.-Y. Whitmarsh A.J. Rincón M. Zheng T.S. Davis R.J. Rakic P. Flavell R.A. Nature. 1997; 389: 865-870Crossref PubMed Scopus (1110) Google Scholar). No AP-1 or NFAT transcriptional activity could be detected in thymocytes (Fig. 2 A) even if a large number of cells was used (data not shown). Thus, NF-κB but not AP-1 or NFAT was transcriptionally active in freshly isolated thymocytes (Fig. 2 A). CD4−CD8− double negative thymocytes are the most immature stage in thymocyte development and constitute a minor proportion (3–5%) of total thymocytes. CD4+CD8+ double positive (DP) thymocytes represent the major thymic population (Fig. 2 B). DP thymocytes differentiate into mature single CD4+ and CD8+ thymocytes that also represent small populations in the thymus. To examine whether NF-κB was constitutively active in these thymocyte subsets, we measured luciferase activity in double negative, DP, and CD4+ thymocytes purified from thymuses from the NFκB-luciferase reporter mice by fluorescence-activated cell sorting. High levels of NF-κB transcriptional activity was observed in double negative and DP thymocytes, but only very low levels were found in CD4+ thymocytes (Fig. 2 B). NF-κB therefore was constitutively active in DP thymocytes which are the predominant subset and the most susceptible to cell death. The incubation of freshly isolated thymocytes at 37 °C in the absence of stimuli resulted in a progressive decrease of the constitutive NF-κB transcriptional activity (Fig. 2 C) which correlated with a progressive increase in cell death (Fig. 2 D). The rapid decline in NF-κB activity observed in thymocytes in the absence of thymic microenvironment preceded the increase in apoptotic thymocytes (Fig. 2, C and D), consistent with an anti-apoptotic activity of this transcription factor. To examine the regulation of NF-κB by CGRP, thymocytes isolated from the NFκB-luciferase reporter transgenic mice were incubated with medium alone either in the presence or the absence of different concentrations of CGRP. We found that CGRP caused a rapid inactivation of constitutive NF-κB activity in thymocytes in a dose-dependent manner (Fig.3 A). The level of NF-κB transcriptional activity in thymocytes incubated in the presence of CGRP was substantially lower that the level observed in thymocytes incubated with medium alone. The inhibition of NF-κB by CGRP (Fig.3 A), detectable as early as 2.5 h, was observed prior to the detection of significant levels of cell death caused by the neuropeptide (Fig. 1). We examined the effect of other neuropeptides on NF-κB activity. Thymocytes from the NFκB-luciferase reporter transgenic mice were isolated and treated in vitro with vasoactive intestinal peptide, somatostatin, or Substance P. Unlike CGRP, none of these neuropeptides significantly affected NF-κB-mediated transcription (Fig. 3 B). These results showed the specific regulation of NF-κB by the neuropeptide CGRP on thymocytes. To determine whether CGRP was able to inhibit NF-κB activity in vivo, we administered CGRP or PBS intraperitoneally into the NFκB-luciferase reporter transgenic mice. After 10 h, equal numbers of freshly isolated thymocytes isolated from CGRP or PBS-injected mice were used to measure NF-κB transcriptional activity. CGRP treatment in vivo resulted in a substantial reduction of NF-κB transcriptional activity compared with the PBS control mice (Fig. 3 C). Flow cytometry analysis showed no effect of CGRP in the distribution of thymocyte populations after 10 h of treatment, indicating that the diminished NF-κB activity was not due to changes in thymocyte populations (not shown). We also examined the effect of CGRP on NF-κB DNA binding in thymocytesin vivo. Nuclear extracts were generated from thymocytes freshly isolated from mice treated with CGRP or PBS for 10 h. NF-κB DNA binding was then examined by electrophoretic mobility shift assay (EMSA) using an oligonucleotide that contains the consensus NF-κB-binding site. In correlation with the reduction in NF-κB transcriptional activity, the constitutive NF-κB DNA binding activity present in freshly isolated thymocytes was also inhibited by CGRPin vivo (Fig. 3 D). NF-κB, but not AP-1 and NFAT was constitutively activated in thymocytes (Fig. 2 A). However, both NFAT and AP-1 transcriptional activities can be induced in thymocytes upon stimulation (31.Rincón M. Flavell R.A. Mol. Cell. Biol. 1996; 16: 1074-1084Crossref PubMed Scopus (74) Google Scholar, 47.Chen D. Rothenberg E.V. Mol. Cell. Biol. 1993; 13: 228-237Crossref PubMed Scopus (88) Google Scholar, 48.Sen J. Shinkai F. Alt F.W. Sen R. Bukaroff S.J. J. Exp. Med. 1994; 180: 2321-2327Crossref PubMed Scopus (25) Google Scholar). To determine whether CGRP also inhibited transcription mediated by other nuclear factors, we examined its regulatory effects on NFAT, AP-1, and NF-κB activity in stimulated thymocytes. Total thymocytes were freshly isolated from AP1-luciferase, NFAT-luciferase, and NFκB-luciferase reporter transgenic mice and stimulated with PMA in combination with a calcium ionophore, ionomycin. The stimulation was performed in the presence or the absence of CGRP. Transcriptional activity of each factor was determined by luciferase measurements at the times indicated. AP-1, NFAT, and NF-κB transcriptional activities were induced upon activation with PMA plus ionomycin (Fig. 4, A andB). However, CGRP inhibited transcription mediated by NF-κB (Fig. 4 B), but did not affect NFAT and AP-1 transcriptional activities (Fig. 4 A). The inhibition of NF-κB transcriptional activity by CGRP in activated cells was dose-dependent (Fig. 4 C). Taken together, these results indicated that CGRP selectively induced signals that interfere with the signaling pathway involved in the activation of NF-κB in thymocytes. DP thymocytes represent the major subpopulation within the thymus, suggesting that CGRP targets primarily this population. To determine the regulation of NF-κB by CGRP in specific thymic subpopulations, we isolated DP and CD4+ thymocytes from NF-κB-luciferase reporter mice by cell sorting. Unlike DP thymocytes, only a very low level of constitutive NF-κB transcriptional activity was detected in CD4+ thymocytes. We therefore stimulated purified DP and CD4+ thymocytes with PMA plus ionomycin to induce NF-κB activity in these populations. The stimulation was performed in the absence or presence of CGRP. NF-κB transcriptional activity was highly up-regulated upon stimulation with PMA and ionomycin in both DP and CD4+ thymocytes (Fig.5 A). In correlation with the inhibition of NF-κB by CGRP observed in total thymocytes, CGRP prevented NF-κB activation in DP thymocytes (Fig. 5 A). In contrast, CGRP did not affect NF-κB mediated transcription in mature CD4+ thymocytes (Fig. 5 A). To determine whether the selective inhibition of the NF-κB transcriptional activity in DP thymocytes by CGRP was caused by blocking the translocation of NF-κB to the nucleus, we examined NF-κB DNA binding. Total thymocytes or purified DP and CD4+ thymocytes were stimulated with PMA plus ionomycin in the presence or absence of CGRP. After 4 h, nuclear extracts were isolated and NF-κB DNA binding was examined by EMSA. In correlation with the effect of CGRP on NF-κB transcriptional activity (Fig.4 A), the presence of CGRP caused a significant reduction of the level of nuclear NF-κB complexes in activated total thymocytes (Fig. 5 B). No difference was observed in the levels of the CREB nuclear factor, demonstrating the specific effect of CGRP on the accumulation of NF-κB nuclear complexes. NF-κB DNA binding was also induced in both DP and CD4+ thymocytes (Fig.5 B). However, CGRP inhibited the accumulation of NF-κB complexes in the nucleus of DP thymocytes, but did not affect the presence NF-κB complexes in CD4+ thymocytes. Together these results indicated that CGRP prevented the activation of NF-κB selectively in DP thymocytes. To determine the effect of CGRP on the composition of the NF-κB complexes, NF-κB DNA binding reactions were performed in the absence or the presence of mAb against specific NF-κB family members. NF-κB DNA binding was abrogated by an anti-p50 mAb or by a combination of both p65 and anti-c-Rel mAbs in thymocytes activated in the absence of CGRP (Fig. 5 C). These results indicated that the NF-κB complexes in thymocytes contain p50/p65 and p50/c-Rel heterodimers. Although very low levels of NF-κB DNA binding could be detected in thymocytes stimulated in the presence of CGRP, heterodimers of p50/p65 or p50/c-Rel also appeared to be the major components of the NF-κB complexes. Therefore, CGRP interfered with the nuclear accumulation of NF-κB complexes but not the composition of the complexes. The activation of NF-κB requires the degradation of IκB proteins which normally retain NF-κB in the cytoplasm preventing nuclear translocation (49.Baldwin A.S. Annu. Rev. Immunol. 1996; 14: 649-681Crossref PubMed Scopus (5515) Google Scholar). We therefore examined the effects of CGRP on the levels of both IκBα and IκBβ which are known to

Uningested dead cells may be an important source of autoantigens and may trigger autoimmune diseases such as systemic lupus erythematosus (SLE). Multiple receptors involved in the clearance of apoptotic cells have been described; however, little is known about the receptors and ligands involved in uptake of necrotic cells that release autoantigens as well.The uptake of autologous necrotic peripheral blood lymphocytes into human monocyte-derived macrophages was qualitatively and quantitatively monitored by confocal microscopy and 2-color flow cytometry, respectively. Blocking experiments were performed to examine the receptors and molecules involved in the phagocytosis of necrotic cells. Cytokine secretion by lipopolysaccharide-activated monocytes and macrophages was determined by enzyme-linked immunosorbent assay.Phosphatidylserine, which was exposed on necrotic as well as apoptotic cells, promoted the recognition and removal of primary necrotic lymphocytes. Several macrophage receptor systems, including the thrombospondin-CD36-alphavbeta3 complex, CD14, and the complement component C1q, contributed to the engulfment of necrotic cells. Necrotic peripheral blood lymphocytes slightly increased the lipopolysaccharide-induced secretion of interleukin-10 and reduced the secretion of tumor necrosis factor alpha in monocytes and macrophages.Our results indicate that at least some of the receptors and adaptors mediating the uptake of apoptotic cells are also involved in the clearance of necrotic cells. Hence, necrotic cells engage phagocyte receptors such as CD36, which mediate antiinflammatory signals from apoptotic cells. Necrotic cells consequently also have the potency to provide antiinflammatory signals to phagocytes; however, these signals may be overridden by proinflammatory factors released during necrosis. These findings have implications regarding the etiopathogenesis of autoimmune diseases such as SLE, in which impaired clearance of dead cells may foster autoimmunity by the release of potential autoantigens.

Apoptosis and phagocytosis of apoptotic cells are crucial processes. At best the phagocytic machinery detects and swallows all apoptotic cells in a way that progression to secondary necrosis is avoided. Otherwise, inflammation and autoimmune diseases may occur. Most apoptotic cells are phagocytosed instantaneously in a silent fashion; however, some dying cells escape their clearance. If the cells are not cleared early, they lose membranes due to extensive shedding of membrane surrounded vesicles (blebbing) and shrink. It is unclear how apoptotic cells compensate their massive loss of plasma membrane. Here, we demonstrate that endoplasmic reticulum- (ER) resident proteins (calnexin, the KDEL receptor and a dysfunctional immunoglobulin heavy chain) were exposed at the surfaces of shrunken late apoptotic cells. Additionally, these cells showed an increased binding of lectins, which recognize sugar structures predominantly found as moieties of incompletely processed proteins in ER and Golgi. In addition the ER resident lipophilic ER-Tracker™ Blue-White DPX, and internal GM1 were observed to translocate to the cell surfaces during late apoptosis. We conclude that during blebbing of apoptotic cells the surface membrane loss is substituted by immature membranes from internal stores. This mechanism explains the simultaneous appearance of preformed recognition structures for several adaptor proteins known to be involved in clearance of dead cells.

Abstract Autoantibodies to double‐stranded (ds) DNA represent a serological hallmark of systemic lupus erythematosus (SLE) and may critically contribute to the pathogenesis of lupus nephritis. Self‐reactive antibodies might be partially produced by long‐lived plasma cells (PCs), which mainly reside within the bone marrow and spleen. In contrast to short‐lived PCs, long‐lived PCs are extremely resistant to therapy and may sustain refractory disease courses. Recently, antibody‐secreting cells were found within the inflamed kidneys of New Zealand black/white (NZB/W) F1 lupus mice as well as of patients with SLE. To analyze the longevity of the IgG‐producing cells present in nephritic kidneys of NZB/W F1 mice we performed in vivo BrdU‐labeling. We identified a higher frequency of long‐lived than short‐lived renal PCs, indicating that survival niches for long‐lived PCs also exist within inflamed kidneys. Using ELISPOT assays, we found that on average 31% of renal IgG‐producing cells reacted with dsDNA and 24% with nucleolin. Moreover, the frequencies of IgG‐secreting cells specific for the autoantigens dsDNA and nucleolin were higher in the kidneys compared with those in the spleen and bone marrow.

B-cells are pivotal to the pathogenesis of rheumatoid arthritis and tofacitinib, a JAK inhibitor, is effective and safe in its treatment. Tofacitinib interferes with signal transduction via cytokine receptors using the common γ-chain. Despite extensive data on T-lymphocytes, the impact of tofacitinib on B-lymphocytes is poorly understood. In this study we assessed the effect of tofacitinib on B-lymphocyte differentiation and function. Tofacitinib treatment strongly impaired in vitro plasmablast development, immunoglobulin secretion and induction of B-cell fate determining transcription factors, Blimp-1, Xbp-1, and IRF-4, in naïve B-cells. Interestingly, class switch and activation-induced cytidine deaminase (AICDA) induction was only slightly reduced in activated naïve B-cells. The effect of tofacitinib on plasmablast formation, immunoglobulin secretion and proliferation was less profound, when peripheral blood B-cells, including not only naïve but also memory B-cells, were stimulated. In line with these in vitro results, the relative distribution of B-cell populations remained stable in tofacitinib treated patients. Nevertheless, a temporary increase in absolute B-cell numbers was observed 6–8 weeks after start of treatment. In addition, B-cells isolated from tofacitinib treated patients responded rapidly to in vitro activation. We demonstrate that tofacitinib has a direct impact on human naïve B-lymphocytes, independently from its effect on T-lymphocytes, by impairing their development into plasmablasts and immunoglobulin secretion. The major effect of tofacitinib on naïve B-lymphocyte development points to the potential inability of tofacitinib-treated patients to respond to novel antigens, and suggests planning vaccination strategies prior to tofacitinib treatment.

Persistent exposure of the immune system to death cell debris leads to autoantibodies against chromatin in patients with systemic lupus erythematosus (SLE). Deposition of anti-chromatin/chromatin complexes can instigate inflammation in multiple organs including the kidney. Previously we identified specific cell death-associated histone modifications as targets of autoantibodies in SLE. In this study we addressed, in a large cohort of SLE patients and controls, the question whether plasma reactivities with specific histone peptides associated with serology and clinical features. Plasma from SLE patients with and without lupus nephritis, disease controls, and healthy controls, were tested in ELISA with histone H4 peptide acetylated at lysines 8, 12 and 16 (H4pac), H2B peptide acetylated at lysine 12 (H2Bpac), H3 peptide trimethylated at lysine 27 (H3pme), and their unmodified equivalents. SLE patients displayed a higher reactivity with the modified equivalent of each peptide. Reactivity with H4pac showed both a high sensitivity (89%) and specificity (91%) for SLE, while H2Bpac exhibited a high specificity (96%) but lower sensitivity (69%). Reactivity with H3pme appeared not specific for SLE. Anti-H4pac and anti-H2Bpac reactivity demonstrated a high correlation with disease activity. Moreover, patients reacting with multiple modified histone peptides exhibited higher SLEDAI and lower C3 levels. SLE patients with renal involvement showed higher reactivity with H2B/H2Bpac and a more pronounced reactivity with the modified equivalent of H3pme and H2Bpac. In conclusion, reactivity with H4pac and H2Bpac is specific for SLE patients and correlates with disease activity, whereas reactivity with H2Bpac is in particular associated with lupus nephritis.

Deregulated NF-k activation is not only involved in cancer but also contributes to the pathogenesis of chronic inflammatory diseases like rheumatoid arthritis (RA) and multiple sclerosis (MS). Ideally, therapeutic NF-KappaB inhibition should only take place in those cell types that are involved in disease pathogenesis to maintain physiological cell functions in all other cells. In contrast, unselective NF-kappaB inhibition in all cells results in multiple adverse effects, a major hindrance in drug development. Hitherto, various substances exist to inhibit different steps of NF-kappaB signaling. However, powerful tools for cell-type specific NF-kappaB inhibition are not yet established. Here, we review the role of NF-kappaB in inflammatory diseases, current strategies for drug delivery and NF-kappaB inhibition and point out the “sneaking ligand” approach. Sneaking ligand fusion proteins (SLFPs) are recombinant proteins with modular architecture consisting of three domains. The prototype SLC1 binds specifically to the activated endothelium and blocks canonical NF-kappaB activation. In vivo, SLC1 attenuated clinical and histological signs of experimental arthritides. The SLFP architecture allows an easy exchange of binding and effector domains and represents an attractive approach to study disease-relevant biological targets in a broad range of diseases. In vivo, SLFP treatment might increase therapeutic efficacy while minimizing adverse effects.

Vegan diet (VD) has improved inflammatory activity in patients with rheumatoid arthritis (RA) in several small controlled trials. The underlying mechanism remains widely unclear. We investigated the effect of a VD in comparison to a meat-rich diet (MD) on markers of inflammation (which have been shown to be relevant in patients with RA) in healthy volunteers.53 healthy, omnivore subjects were randomized to a controlled VD (n = 26) or MD (n = 27) for 4 weeks following a pre-treatment phase of a one week controlled mixed diet. Primary parameters of interest were sialylation of immunoglobulins, percentage of regulatory T-cells and level of interleukin 10 (IL10). Usual care immune parameters used in patients with RA and amino acid serum levels as well as granulocytes and monocytes colony stimulating factor (GM-CSF) serum levels were secondary parameters.In the VD group, total leukocyte, neutrophil, monocyte and platelet counts decreased and after four weeks they were significantly lower compared to the MD group (ANCOVA: leukocytes p = 0.003, neutrophils p = 0.001, monocytes p = 0.032, platelets p = 0.004). Leukocytes, neutrophils, monocytes, and platelets correlated with each other and likewise conform with serum levels of branched-chain amino acids, which were significantly lower in the VD compared to the MD group. The primary parameters did not differ between the groups and BMI remained stable in the two groups.Four weeks of a controlled VD affected the number of neutrophils, monocytes and platelets but not the number or function of lymphocytes. The relation with branched-chain amino acids and GM-CSF suggests a mode of action via the mTOR signaling pathway. REGISTERED AT: http://www.drks.de (German Clinical Trial register) at DRKS00011963.

Abstract An expansion of CD21low B cells has been described in a variety of diseases associated with persistent immune stimulation as in chronic infection, immunodeficiency, or autoimmunity. Different developmental stages of CD21low B cells have been highlighted in specific diseases; however, a systematic comparison of distribution, phenotype, and signaling capacity of these populations has not yet been performed to delineate the pivotal character of this unusual B cell population. Screening of more than 200 patients with autoimmune disease demonstrated that the prevalence of patients with expanded CD21low B cells varies between diseases. The expansion was frequent in patients with systemic lupus erythematosus, in which it correlated to relative B cell lymphopenia and duration of disease. Different proportions of distinct developmental stages of CD21low B cells co-occur in nearly all patients with autoimmune disease. Although in most patients, naive-like and CD27− switched memory B cells were the most prominent CD21low subpopulations, there was no detectable association of the pattern with the underlying disease. Despite their distinct developmental stage, all CD21low B cells share a common core phenotype including the increased expression of inhibitory receptors, associated with an elevated constitutive phosphorylation of proximal signaling molecules downstream of the BCR but impaired Ca2+ mobilization and NF-κB activation after BCR stimulation. Further, this was accompanied by impaired upregulation of CD69, although CD86 upregulation was preserved. Beyond maturation-associated differences, the common core characteristics of all CD21low B cell populations suggests either a common ancestry or a shared sustained imprint by the environment they originated in.

Several risk factors for severe COVID-19 specific for patients with inflammatory rheumatic and musculoskeletal diseases (RMDs) have been identified so far. Evidence regarding the influence of different RMD treatments on outcomes of SARS-CoV-2 infection is still poor.Data from the German COVID-19-RMD registry collected between 30 March 2020 and 9 April 2021 were analysed. Ordinal outcome of COVID-19 severity was defined: (1) not hospitalised, (2) hospitalised/not invasively ventilated and (3) invasively ventilated/deceased. Independent associations between demographic and disease features and outcome of COVID-19 were estimated by multivariable ordinal logistic regression using proportional odds model.2274 patients were included. 83 (3.6%) patients died. Age, male sex, cardiovascular disease, hypertension, chronic lung diseases and chronic kidney disease were independently associated with worse outcome of SARS-CoV-2 infection. Compared with rheumatoid arthritis, patients with psoriatic arthritis showed a better outcome. Disease activity and glucocorticoids were associated with worse outcome. Compared with methotrexate (MTX), TNF inhibitors (TNFi) showed a significant association with better outcome of SARS-CoV-2 infection (OR 0.6, 95% CI0.4 to 0.9). Immunosuppressants (mycophenolate mofetil, azathioprine, cyclophosphamide and ciclosporin) (OR 2.2, 95% CI 1.3 to 3.9), Janus kinase inhibitor (JAKi) (OR 1.8, 95% CI 1.1 to 2.7) and rituximab (OR 5.4, 95% CI 3.3 to 8.8) were independently associated with worse outcome.General risk factors for severity of COVID-19 play a similar role in patients with RMDs as in the normal population. Influence of disease activity on COVID-19 outcome is of great importance as patients with high disease activity-even without glucocorticoids-have a worse outcome. Patients on TNFi show a better outcome of SARS-CoV-2 infection than patients on MTX. Immunosuppressants, rituximab and JAKi are associated with more severe course.

A dysregulated immune response with high levels of SARS-CoV-2 specific IgG antibodies characterizes patients with severe or critical COVID-19. Although a robust IgG response is considered to be protective, excessive triggering of activating Fc-gamma-receptors (FcγRs) could be detrimental and cause immunopathology. Here, we document excessive FcγRIIIA/CD16A activation in patients developing severe or critical COVID-19 but not in those with mild disease. We identify two independent ligands mediating extreme FcγRIIIA/CD16A activation. Soluble circulating IgG immune complexes (sICs) are detected in about 80% of patients with severe and critical COVID-19 at levels comparable to active systemic lupus erythematosus (SLE) disease. FcγRIIIA/CD16A activation is further enhanced by afucosylation of SARS-CoV-2 specific IgG. Utilizing cell-based reporter systems we provide evidence that sICs can be formed prior to a specific humoral response against SARS-CoV-2. Our data suggest a cycle of immunopathology driven by an early formation of sICs in predisposed patients. These findings suggest a reason for the seemingly paradoxical findings of high antiviral IgG responses and systemic immune dysregulation in severe COVID-19. The involvement of circulating sICs in the promotion of immunopathology in predisposed patients opens new possibilities for intervention strategies to mitigate critical COVID-19 progression.

The COVID-19 course and immunity differ in children and adults. We analyzed immune response dynamics in 28 families up to 12 months after mild or asymptomatic infection. Unlike adults, the initial response is plasmablast-driven in children. Four months after infection, children show an enhanced specific antibody response and lower but detectable spike 1 protein (S1)-specific B and T cell responses than their parents. While specific antibodies decline, neutralizing antibody activity and breadth increase in both groups. The frequencies of S1-specific B and T cell responses remain stable. However, in children, one year after infection, an increase in the S1-specific IgA class switch and the expression of CD27 on S1-specific B cells and T cell maturation are observed. These results, together with the enhanced neutralizing potential and breadth of the specific antibodies, suggest a progressive maturation of the S1-specific immune response. Hence, the immune response in children persists over 12 months but dynamically changes in quality, with progressive neutralizing, breadth, and memory maturation. This implies a benefit for booster vaccination in children to consolidate memory formation.

Exposure of phosphatidylserine on the outer leaflet of the cytoplasmic membrane is an early event during apoptotic cell death and serves as a recognition signal for phagocytes. Usually the clearance of apoptotic cells does not initiate inflammation or immune response. We investigated the immune response in Balb/c mice towards apoptotic human T-cells. Animals injected with apoptotic cells showed significantly reduced humoral immune responses, especially Th1-dependent IgG2a titres, compared to controls immunised with viable cells. However, treatment of apoptotic cells with annexin V (AxV) significantly increased the humoral immune response. AxV binds with high affinity to anionic phospholipids and as a result interferes with the phosphatidylserine recognition by phagocytes. Our results indicate that AxV treatment may be used to increase the efficiency of apoptotic cell-based vaccines, e.g. some tumour vaccines. Cell Death and Differentiation (2000) 7, 911–915

Viable, apoptotic and necrotic monocytes expose phosphatidylserine: cooperative binding of the ligand Annexin V to dying but not viable cells and implications for PS-dependent clearance

Siglec-G is a negative regulator of BCR-mediated signaling in B1a cells. This population of B cells is highly increased in Siglec-G-deficient mice, but the mechanism of this expansion is not known so far. In this study, we demonstrate that Siglecg(-/-) B1a cells show a lower level of spontaneous apoptosis and a prolonged life span. Mechanistically, the lower apoptosis could result from higher expression levels of the transcription factor NFATc1 in Siglec-G-deficient B1a cells. Interestingly, Siglecg(-/-) B1a cells display an altered BCR repertoire compared with wild-type B1a cells. As the BCR repertoire and the VDJ composition of Igs of Siglecg(-/-) B1a cells resembles more the Abs produced by adult bone marrow-derived B cells rather than canonical fetal liver-derived B1a cells, this suggest that the selection into the B1a cell population is altered in Siglec-G-deficient mice.

Inhibition of the transcription factor nuclear factor (NF)-kappaB activity leads to a reduction in numbers of CD8(+) single-positive (SP) thymocytes, suggesting a selective role for NF-kappaB in these cells. To further explore the role of NF-kappaB in SP thymocytes, we utilized transgenic models that allowed either inhibition or activation of NF-kappaB. We showed that activation of NF-kappaB played an important role in the selection of major histocompatibility complex (MHC) class I-restricted CD8(+) T cells. Surprisingly, NF-kappaB was not activated in positively selected CD4(+) thymocytes, and inhibition of NF-kappaB did not perturb positive or negative selection of CD4(+) cells. However, enforced activation of NF-kappaB via a constitutively active inhibitor of kappaB (IkappaB) kinase transgene led to a nearly complete deletion of CD4 cells by pushing positively selecting CD4(+) cells into negative selection. These studies therefore revealed a surprising difference of NF-kappaB activation in CD4(+) and CD8(+) thymocytes and suggested that NF-kappaB contributes to the establishment of thresholds of signaling that determine positive or negative selection of thymocytes.

The architectural chromosomal protein high-mobility group box 1 protein (HMGB1) acts as an alarmin when released from cells. It is involved in the pathogenesis of inflammatory and autoimmune diseases. HMGB1 can undergo post-translational modifications including oxidation. However, the mechanisms and functional relevance of HMGB1 oxidation are not yet understood. Increased concentrations of reactive oxygen species (ROS) have been reported during apoptosis and necrosis. Hence, we investigated the oxidative status of HMGB1 in dead cells. Immunoblot analyses under reducing and non-reducing conditions revealed that HMGB1 is oxidized in dead cells. Moreover, tagging of oxidized cysteine residues by a maleimide moiety linked to polyethylene glycol showed that HMGB1 passively released from primary and secondary necrotic cells was predominantly oxidized. Also HMGB1 in plasma of patients with systemic lupus was reversibly oxidized. In conclusion, HMGB1 undergoes reversible oxidative modifications at cysteine residues during cell death, which may modulate its biological properties.

To date, no effective immunosuppressive standard for the prevention or treatment of alloantibody production in acute and chronic rejection of renal transplants has been established. Alloantibody formation has been recognized in the well-established rat model of Fischer to Lewis renal transplantation. We used this renal allotransplantation model to test the effectiveness of sirolimus (SRL), bortezomib (BZ) or their combination in an already established humoral rejection situation.After 3 weeks, transplanted rats were treated either with placebo (P), SRL, BZ or combination of SRL and BZ. Rats were monitored for donor-specific alloantibodies as well as humoral responses in the spleen and bone marrow, renal function and histological changes in the graft.In all three treatment arms, glomerular, tubulointerstitial and vascular changes of chronic antibody-mediated rejection were ameliorated compared to the P group. Production of alloantibodies against components of glomerular basement membrane was reduced in all three treatment arms. The humoral response was strongly reduced, as shown by decreased numbers of IgG-secreting cells, plasma cells and partially B cells in all treatment groups with a trend of SRL/BZ combination being most effective. Infiltration of the graft with inflammatory cells like cytotoxic T cells, T helper cells, B cells and macrophages was efficiently blocked by BZ and the SRL/BZ combination and, except for B cells, by SRL.BZ and SRL represent promising drugs with anti-humoral activity in the situation of an already established chronic humoral or mixed alloimmune response after renal transplantation.

Crucial steps in the initiation of lupus nephritis are the deposition of (auto-)antibodies and consequent complement activation. In spite of aggressive treatment patients may develop terminal renal failure. Therefore, new treatment strategies are needed. In extension to our previously published data we here analyzed the potential renoprotective mechanisms of bortezomib (BZ) in experimental lupus nephritis by focusing on morphological changes.Female NZB×NZW F1 mice develop lupus-like disease with extensive nephritis that finally leads to lethal renal failure. Treatment with 0.75 mg/kg BZ i.v. or placebo (PBS) twice per week started at 18 or 24 weeks of age. Antibody production was measured with ELISA and kidney damage was determined by quantitative morphological and immunohistochemical methods.BZ treatment completely inhibited antibody production in both BZ-treated groups and prevented the development of nephritis in comparison to PBS-treated animals. Glomerular and tubulointerstitial damage scores, collagen IV expression, mean glomerular volume as well as tubulointerstitial proliferation and apoptosis were significantly lower after BZ treatment. Glomerular ultrastructure and in particular podocyte damage and loss were prevented by BZ treatment.BZ effectively prevents the development of nephritis in the NZB/W F1 mouse model. Specific protection of podocyte ultrastructure may critically contribute to renoprotection by BZ, which may also represent a potential new treatment option in human lupus nephritis.

The mechanisms involved in breaking immunologic tolerance against nuclear autoantigens in systemic lupus erythematosus (SLE) are not fully understood. Our recent studies in nonautoimmune mice provided evidence of an important role of Toll-like receptor 2 (TLR-2) in antichromatin autoantibody induction by high mobility group box chromosomal protein 1-nucleosome complexes derived from apoptotic cells. The objective of this study was to investigate whether TLR-2 signaling is required for the induction of autoantibodies and the development of SLE-like disease in murine pristane-induced lupus.Lupus-like disease in C57BL/6 and TLR-2(-/-) mice was induced by pristane injection. The numbers of immune cells and serum cytokine concentrations were determined by flow cytometry. Renal disease was assessed by quantification of proteinuria, histologic analyses, and enzyme-linked immunospot assay.Pristane-injected TLR-2(-/-) mice generated reduced numbers of splenic CD138+/cytoplasmic κL/λL chain-positive plasma cells and displayed diminished IgG responses against double-stranded DNA, histones, nucleosomes, some extractable nuclear autoantigens, and cardiolipin when compared with wild- type controls. TLR-2 deficiency prevented the pristane-induced systemic release of interleukin-6 (IL-6) and IL-10. The absence of TLR-2 attenuated peritoneal recruitment of CD11c+ cells and formation of lipogranulomas. Importantly, the renal disease that developed in pristane-treated TLR-2(-/-) mice was less severe than that in control mice, as reflected by milder proteinuria, reduced glomerular deposition of IgG and complement, and decreased renal infiltration of autoantibody-secreting cells.TLR-2 is required for the production of prototypical lupus autoantibodies and the development of renal disease in pristane-induced murine lupus. Interference with TLR-2 signaling may be a promising novel strategy for the treatment of SLE.

Human CD21low B cells are expanded in autoimmune (AI) diseases and display a unique phenotype with high expression of co-stimulatory molecules, compatible with a potential role as antigen-presenting cells (APCs). Thus, we addressed the co-stimulatory capacity of naïve-like, IgM-memory, switched memory and CD27negIgDneg memory CD21low B cells in allogenic co-cultures with CD4 T cells. CD21low B cells of patients with AI disorders expressed high levels of CD86, CD80 and HLA-DR (memory B cells), but also PD-L1 ex vivo and efficiently co-stimulated CD4 T cells of healthy donors (HD), as measured by upregulation of CD25, CD69, Inducible Co-stimulator (ICOS), programmed cell death protein 1 (PD-1) and induction of cytokines. While the co-stimulatory capacity of the different CD21low B-cell populations was over all comparable to CD21pos counterparts of patients and HD, especially switched memory CD21low B cells lacked the increased capacity of CD21pos switched memory B-cells to induce high expression of ICOS, IL-2, IL-10 and IFN-. Acknowledging the limitation of the in vitro setting, CD21low B cells do not seem to preferentially support a specific Th effector response. In summary, our data implies that CD21low B cells of patients with AI diseases can become competent APCs and may, when enriched for autoreactive B-cell receptors (BCR), potentially contribute to AI reactions as cognate interaction partners of autoreactive T cells at sites of inflammation.

Reduced clearance of dying cells by macrophages or increased apoptosis provokes accumulation of cellular fragments in various tissues. This process seems to induce the uptake of autoantigens from apoptotic nuclei or chromatin by dendritic cells (DCs). Then, the DCs present altered self-epitopes to naive T cells. Thus, autoreactive T cells are activated accidentally and may now provide T-cell help for B cells that present peptides processed from secondary necrotic/late apoptotic prey. Impaired phagocytic removal of early apoptotic cells may cause accumulation of secondary necrotic cells and debris in the germinal centers of secondary lymph organs. The latter bind complement and can, therefore, be trapped on the surfaces of follicular DCs (FDCs). B cells may get in contact with intracellular autoantigens that had been released during late stages of apoptotic cell death and are immobilized by FDCs. Consecutively, B cells that had, for example, gained specificity for nuclear auto-antigens during random somatic mutations can receive a short-term survival signal. After migration into the mantle zone, these autoreactive B cells may finally be activated by autoreactive CD4+ T helper cells. B cells then differentiate into memory or plasma cells. The plasma cells produce those pathogenic nuclear autoantibodies. Many defects are known with respect to the clearance of apoptotic cells and cell material, especially that of nuclear origin. Reflecting on the plethora of defects of clearance of apoptotic material already demonstrated in systemic lupus erythematosus, it is reasonable to argue that, for many patients, failure of clearance is at the heart of their disease.

E2A and HEB are basic helix-loop-helix transcription factors essential for T cell development. Complete inhibition of their activities through transgenic overexpression of their inhibitors Id1 and Tal1 leads to a dramatic loss of thymocytes. Here, we suggest that bHLH proteins play important roles in establishing thresholds for pre-TCR and TCR signaling. Inhibition of their function allows double-negative cells to differentiate without a functional pre-TCR, while anti-CD3 stimulation downregulates bHLH activities. We also find that the transcription factor NF-kappaB becomes activated in transgenic thymocytes. Further activation of NF-kappaB exacerbates the loss of thymocytes, whereas inhibition of NF-kappaB leads to the rescue of double-positive thymocytes. Therefore, we propose that E2A and HEB negatively regulate pre-TCR and TCR signaling and their removal causes hyperactivation and apoptosis of thymocytes.

Mechanisms governing the normal resolution processes of inflammation are poorly understood, yet their elucidation may lead to a greater understanding of the pathogenesis of chronic inflammation. The removal of apoptotic cell material and their potentially histotoxic contents is a prerequisite of resolution. Engulfment by macrophages is an important disposal route, and changes in the apoptotic cells that are associated with their recognition by macrophages are the subject of this report.Apoptosis and necrosis in primary cells and cell lines were induced by various stimuli. The binding profile of 23 different lectins for vital, apoptotic, and necrotic cells were analyzed by flow cytometry.We observed that lectins were able to attach to the cell surfaces of vital and dying cells. Some lectins exhibited membrane destructive properties and, consecutively, changed the morphology of the cells as detected by flow cytometry. Other lectins did not show differences in their binding to viable and apoptotic cells. Those lectins were, therefore, not used for analyses of surface changes. The lectins Griffonia simplificolia II (GSL II), Narcissus pseudonarcissus (NPn), and Ulex europaeus I (UEA I) showed no cytotoxic activity and bound preferentially to dying cells. Primary and secondary necrotic cells displayed an equal staining intensity, which was substantially higher than for apoptotic cells. The binding of GSL II, NPn, and UEA to dying cells increased in a time-dependent manner and was delayed to AxV positivity and the decrease in the mitochondrial membrane potential of apoptotic cells. The kinetic of the lectin staining correlated with the increase in subG1-DNA. GSL II, NPn, and UEA are specific for N-acetylglucosamine, mannose, and fucose, respectively.According to their binding specificity, we conclude that N-acetylglucosamine-, mannose-, and fucose-containing epitopes are increasingly exposed on cells undergoing apoptosis.

Abstract TNF-α plays an important role in the natural history of rheumatoid arthritis (RA), a systemic disease characterized by endothelial activation and synovial involvement with bone erosions. Neuroendocrine signals contribute as well to RA, but their role is poorly understood. We measured in 104 RA patients and in an equal number of sex- and age-matched, healthy controls the blood levels of chromogranin A (CgA), a candidate marker linking the neuroendocrine system to TNF-α-mediated vascular inflammation. CgA levels were significantly higher in patients with RA and remained stable over time. High levels of CgA were significantly associated with severe extra-articular manifestations, namely pulmonary fibrosis, rheumatoid vasculitis, serositis, and peripheral neuropathy. RA sera curbed the response of human microvascular endothelial cells to TNF-α, as assessed by the expression of ICAM-1, the release of MCP-1/CCL2, and the export of nuclear high-mobility group box 1; the effect abated in the presence of anti-CgA antibodies. The efficacy of the blockade was significantly correlated with the CgA concentration in the serum. The recombinant aminoterminal portion of CgA, corresponding to residues 1–78, had similar inhibitory effects on endothelial cells challenged with TNF-α. Our results suggest that enhanced levels of CgA identify patients with extra-articular involvement and reveal a negative feedback loop that limits the activation of endothelial cells in RA.

The proteasome inhibitor bortezomib, which induces cell death in various cancer cell lines including lymphatic neoplasias, has recently been approved for the treatment of relapsed multiple myeloma. Important mechanisms of proteasome inhibitor-mediated tumor cell death are the inhibition of NF-κB activation and induction of the terminal unfolded protein response (UPR). However, little is known about effects of bortezomib on developing and mature lymphocytes. Therefore, Balb/C mice were injected with bortezomib and lymphocyte subsets were analyzed. This treatment resulted in dramatically decreased numbers of T and B lymphocyte precursors, while mature lymphocytes were only partially affected. Thymocytes were almost depleted 3 days after a single bortezomib injection, pro-B and pre-B cells already after 2 days. Thymocytes and B cell precursors recovered within 2 weeks. The decreased numbers of developing lymphocytes were due to apoptotic cell death accompanied by strongly increased caspase 3/7 activity. Within 8 h after bortezomib injection, there was a strong induction of heat shock protein 70 and C/EBP homologous protein in bone marrow B cells, indicating endoplasmic reticulum stress and activation of the terminal UPR, respectively. Hence, induction of apoptosis by proteasome inhibition can dramatically affect lymphocyte development, a fact which has important implications for the clinical use of bortezomib, especially in situations with ongoing lymphopoiesis.

To optimize the use of the fluorochromic PicoGreen assay for the sensitive detection and quantification of double stranded (ds) DNA in plasma/serum samples of patients with systemic lupus erythematosus (SLE).Plasma/serum samples were obtained from SLE patients and normal healthy donors (NHD). Plasma/serum proteins were digested with proteinase K. DNA was subsequently purified using silica-based ion exchange micro columns and detected using the PicoGreen assay.Sensitive detection of plasma/serum DNA is impaired by proteins: (1) Proteins caused background fluorescence in the PicoGreen assay. (2) Packaging of dsDNA in nucleosomes markedly reduced PicoGreen fluorescence. Therefore, we digested proteins using proteinase K and purified DNA before detection by PicoGreen assay. This procedure resulted in a detection limit for plasma/serum dsDNA of less than 1 ng/ml, and is therefore markedly more sensitive than previously described methods. We found that DNA concentrations are higher in serum than in plasma of healthy donors, suggesting artifactual DNA release during coagulation. In addition, we found higher levels of DNA in plasma and serum of a group of SLE patients compared to NHD.We have optimized the use of the PicoGreen assay for the ultrasensitive and reliable quantification of DNA in plasma/serum samples. This new method can be used in future studies to explore a possible correlation between circulating DNA levels and disease activity in patients with SLE.

The proteasome inhibitor bortezomib is clinically approved for the treatment of multiple myeloma. However, long-term remissions are difficult to achieve, and myeloma cells often develop secondary resistance to proteasome inhibitors. We recently demonstrated that the extraordinary sensitivity of myeloma cells toward bortezomib is dependent on their extensive immunoglobulin synthesis, thereby triggering the terminal unfolded protein response (UPR). Here, we investigated whether verapamil, an inhibitor of the multidrug resistance (MDR) gene product, can enhance the cytotoxicity of bortezomib. The combination of bortezomib and verapamil synergistically decreased the viability of myeloma cells by inducing cell death. Importantly, bortezomib-mediated activation of major UPR components was enhanced by verapamil. The combination of bortezomib and verapamil resulted in caspase activation followed by poly(ADP-ribose) polymerase cleavage, whereas nuclear factor kappaB (NF-kappaB) activity declined in myeloma cells. Also, we found reduced immunoglobulin G secretion along with increased amounts of ubiquitinylated proteins within insoluble fractions of myeloma cells when using the combination treatment. Verapamil markedly induced reactive oxygen species production and autophagic-like processes. Furthermore, verapamil decreased MDR1 expression. We conclude that verapamil increased the antimyeloma effect of bortezomib by enhancing ER stress signals along with NF-kappaB inhibition, leading to cell death. Thus, the combination of bortezomib with verapamil may improve the efficacy of proteasome inhibitory therapy.

Background and purpose This study aimed to characterize a link between X-linked inhibitor of apoptosis protein (XIAP) expression, apoptosis induction, Nuclear Factor kappa B (NF-κB) activity and the anti-inflammatory properties of low-dose ionising-radiation (LD-RT). Material and methods EA.hy.926 endothelial cells (ECs) were irradiated with doses ranging from 0.3 to 3 Gy, and subsequently stimulated by TNF-α, and XIAP expression was either detected by immunoblotting or TaqMan-PCR. Apoptosis was quantified by AnnexinV staining or by caspase 3/7 activity assays. NF-κB transcriptional activity was analysed by a luciferase reporter assay, secretion of Transforming Growth Factor beta 1 (TGF-β1) and adhesion of peripheral blood mononuclear cells (PBMC) to EC were quantified using ELISA and adhesion assays. Results LD-RT of the activated EA.Hy.926 EC induces XIAP expression in a discontinuous manner with a relative maximum at 0.5 Gy and 3 Gy which parallels a discontinuity in apoptosis induction and caspase 3/7 activity. siRNA-mediated attenuation of XIAP resulted in an increased rate of apoptosis, a hampered NF-κB transcriptional activity and a diminished secretion of TGF-β1. As compared to control-siRNA treated cells, adhesion of PBMC to EC was increased in XIAP depleted EA.Hy.926 EC. Conclusion The modulation of apoptosis, NF-κB activity and TGF-β1 by XIAP in irradiated and subsequent stimulated EC contributes to an impaired PBMC/EC adhesion and to the anti-inflammatory properties of LD-RT.

Objectives. To investigate the presence of autoantibodies against mammalian chaperones of the endoplasmic reticulum (ER) in patients with RA and other immune-mediated diseases.

Most cases of systemic lupus erythematosus (SLE) are characterized by an impaired clearance of apoptotic cells in various tissues. Non-cleared apoptotic waste is considered an immunogen driving the autoimmune response in patients with SLE. During the execution of apoptosis, membrane blebs are formed and filled with cellular components. Here, we evaluate the cytoskeletal pathway(s) responsible for the loading of SLE prototypic nuclear autoantigens into the apoptotic cell-derived membranous vesicles (ACMV) generated during late phases of apoptosis. HeLa cells expressing a fusion protein of histone H2B with green fluorescent protein (GFP) were irradiated with ultraviolet (UV)-B to induce apoptosis. The appearance and trafficking of chromatin-derived material was monitored by fluorescence microscopy. Specific inhibitors of cytoskeletal pathways were employed to identify the motile elements involved in translocation and trafficking of the nuclear components. We observed that immediately after their appearance the ACMV did not contain histone H2B(GFP) ; in this phase the fluorescence was contained in the nuclear remnants and the cytoplasm. Within consecutive minutes the ACMV were loaded with chromatin-derived material, whereas the loading of simultaneously created ACMV with histone H2B(GFP) was not uniform. Some ACMV were preferentially filled and, consequently, showed a remarkably higher histone H2B(GFP) accumulation. Inhibitors of the cytoskeleton revealed that functional microtubules and myosin light chain kinase are required for nuclear shrinkage and loading of nuclear material into the ACMV, respectively.