Paul Säftig

All ligands of the epidermal growth factor receptor (EGFR), which has important roles in development and disease, are released from the membrane by proteases. In several instances, ectodomain release is critical for activation of EGFR ligands, highlighting the importance of identifying EGFR ligand sheddases. Here, we uncovered the sheddases for six EGFR ligands using mouse embryonic cells lacking candidate-releasing enzymes (a disintegrin and metalloprotease [ADAM] 9, 10, 12, 15, 17, and 19). ADAM10 emerged as the main sheddase of EGF and betacellulin, and ADAM17 as the major convertase of epiregulin, transforming growth factor alpha, amphiregulin, and heparin-binding EGF-like growth factor in these cells. Analysis of adam9/12/15/17-/- knockout mice corroborated the essential role of adam17-/- in activating the EGFR in vivo. This comprehensive evaluation of EGFR ligand shedding in a defined experimental system demonstrates that ADAMs have critical roles in releasing all EGFR ligands tested here. Identification of EGFR ligand sheddases is a crucial step toward understanding the mechanism underlying ectodomain release, and has implications for designing novel inhibitors of EGFR-dependent tumors.

Cathepsin K is a recently identified lysosomal cysteine proteinase. It is abundant in osteoclasts, where it is believed to play a vital role in the resorption and remodeling of bone. Pycnodysostosis is a rare inherited osteochondrodysplasia that is caused by mutations of the cathepsin-K gene, characterized by osteosclerosis, short stature, and acroosteolysis of the distal phalanges. With a view to delineating the role of cathepsin K in bone resorption, we generated mice with a targeted disruption of this proteinase. Cathepsin-K-deficient mice survive and are fertile, but display an osteopetrotic phenotype with excessive trabeculation of the bone-marrow space. Cathepsin-K-deficient osteoclasts manifested a modified ultrastructural appearance: their resorptive surface was poorly defined with a broad demineralized matrix fringe containing undigested fine collagen fibrils; their ruffled borders lacked crystal-like inclusions, and they were devoid of collagen-fibril-containing cytoplasmic vacuoles. Assaying the resorptive activity of cathepsin-K-deficient osteoclasts in vitro revealed this function to be severely impaired, which supports the contention that cathepsin K is of major importance in bone remodeling.

Lysosome-associated membrane protein-2 (LAMP-2) is a highly glycosylated protein and an important constituent of the lysosomal membrane. Here we show that LAMP-2 deficiency in mice increases mortality between 20 and 40 days of age. The surviving mice are fertile and have an almost normal life span. Ultrastructurally, there is extensive accumulation of autophagic vacuoles in many tissues including liver, pancreas, spleen, kidney and skeletal and heart muscle. In hepatocytes, the autophagic degradation of long-lived proteins is severely impaired. Cardiac myocytes are ultrastructurally abnormal and heart contractility is severely reduced. These findings indicate that LAMP-2 is critical for autophagy. This theory is further substantiated by the finding that human LAMP-2 deficiency causing Danon's disease is associated with the accumulation of autophagic material in striated myocytes.

The small GTP binding protein Rab7 has a role in the late endocytic pathway and lysosome biogenesis. The role of mammalian Rab7 in autophagy is, however, unknown. We have addressed this by inhibiting Rab7 function with RNA interference and overexpression of dominant negative Rab7. We show here that Rab7 was needed for the formation of preferably perinuclear, large aggregates, where the autophagosome marker LC3 colocalised with Rab7 and late endosomal and lysosomal markers. By electron microscopy we showed that these large aggregates corresponded to autophagic vacuoles surrounding late endosomal or lysosomal vesicles. Our experiments with quantitative electron microscopy showed that Rab7 was not needed for the initial maturation of early autophagosomes to late autophagic vacuoles, but that it participated in the final maturation of late autophagic vacuoles. Finally, we showed that the recruitment of Rab7 to autophagic vacuoles was retarded in cells deficient in the lysosomal membrane proteins Lamp1 and Lamp2, which we have recently shown to accumulate late autophagic vacuoles during starvation. In conclusion, our results showed a role for Rab7 in the final maturation of late autophagic vacuoles.

Cargo sorting to intraluminal vesicles (ILVs) of multivesicular endosomes is required for lysosome-related organelle (LRO) biogenesis. PMEL-a component of melanocyte LROs (melanosomes)-is sorted to ILVs in an ESCRT-independent manner, where it is proteolytically processed and assembled into functional amyloid fibrils during melanosome maturation. Here we show that the tetraspanin CD63 directly participates in ESCRT-independent sorting of the PMEL luminal domain, but not of traditional ESCRT-dependent cargoes, to ILVs. Inactivating CD63 in cell culture or in mice impairs amyloidogenesis and downstream melanosome morphogenesis. Whereas CD63 is required for normal PMEL luminal domain sorting, the disposal of the remaining PMEL transmembrane fragment requires functional ESCRTs but not CD63. In the absence of CD63, the PMEL luminal domain follows this fragment and is targeted for ESCRT-dependent degradation. Our data thus reveal a tight interplay regulated by CD63 between two distinct endosomal ILV sorting processes for a single cargo during LRO biogenesis.

Although BACE1 (beta-site amyloid precursor protein–cleaving enzyme 1) is essential for the generation of amyloid-b peptide in Alzheimer's disease, its physiological function is unclear. We found that very high levels of BACE1 were expressed at time points when peripheral nerves become myelinated. Deficiency of BACE1 resulted in the accumulation of unprocessed neuregulin 1 (NRG1), an axonally expressed factor required for glial cell development and myelination. BACE1 –/– mice displayed hypomyelination of peripheral nerves and aberrant axonal segregation of small-diameter afferent fibers, very similar to that seen in mice with mutations in type III NRG1 or Schwann cell–specific ErbB2 knockouts. Thus, BACE1 is required for myelination and correct bundling of axons by Schwann cells, probably through processing of type III NRG1.

Abstract The CX3C chemokine fractalkine (CX3CL1) exists as a membrane-expressed protein promoting cell-cell adhesion and as a soluble molecule inducing chemotaxis. Transmembrane CX3CL1 is converted into its soluble form by defined proteolytic cleavage (shedding), which can be enhanced by stimulation with phorbol-12-myristate-13-acetate (PMA). PMA-induced CX3CL1 shedding has been shown to involve the tumor necrosis factor-α–converting enzyme (TACE), whereas the constitutive cleavage in unstimulated cells remains elusive. Here we demonstrate a role of the closely related disintegrin-like metalloproteinase 10 (ADAM10) in the constitutive CX3CL1 cleavage. The hydroxamate GW280264X, capable of blocking TACE as well as ADAM10, proved to be an effective inhibitor of the constitutive and the PMA-inducible CX3CL1 cleavage in CX3CL1-expressing ECV-304 cells (CX3CL1–ECV-304), whereas GI254023X, preferentially blocking ADAM10 but not TACE, reduced the constitutive cleavage only. Overexpression of ADAM10 in COS-7 cells enhanced constitutive cleavage of CX3CL1 and, more importantly, in murine fibroblasts deficient of ADAM10 constitutive CX3CL1 cleavage was markedly reduced. Thus, ADAM10 contributes to the constitutive shedding of CX3CL1 in unstimulated cells. Addressing the functional role of CX3CL1 shedding for the adhesion of monocytic cells via membrane-expressed CX3CL1, we found that THP-1 cells adhere to CX3CL1–ECV-304 cells but detach in the course of vigorous washing. Inhibition of ADAM10-mediated CX3CL1 shedding not only increased adhesive properties of CX3CL1–ECV-304 cells but also prevented de-adhesion of bound THP-1 cells. Our data demonstrate that ADAM10 is involved in the constitutive cleavage of CX3CL1 and thereby may regulate the recruitment of monocytic cells to CX3CL1-expressing cell layers.

The metalloprotease ADAM 10 is an important APP alpha-secretase candidate, but in vivo proof of this is lacking. Furthermore, invertebrate models point towards a key role of the ADAM 10 orthologues Kuzbanian and sup-17 in Notch signalling. In the mouse, this function is, however, currently attributed to ADAM 17/TACE, while the role of ADAM 10 remains unknown. We have created ADAM 10-deficient mice. They die at day 9.5 of embryogenesis with multiple defects of the developing central nervous system, somites, and cardiovascular system. In situ hybridization revealed a reduced expression of the Notch target gene hes-5 in the neural tube and an increased expression of the Notch ligand dll-1, supporting an important role for ADAM 10 in Notch signalling in the vertebrates as well. Since the early lethality precluded the establishment of primary neuronal cultures, APPs alpha generation was analyzed in embryonic fibroblasts and found to be preserved in 15 out of 17 independently generated ADAM 10-deficient fibroblast cell lines, albeit at a quantitatively more variable level than in controls, whereas a severe reduction was found in only two cases. The variability was not due to differences in genetic background or to variable expression of the alternative alpha-secretase candidates ADAM 9 and ADAM 17. These results indicate, therefore, either a regulation between ADAMs on the post-translational level or that other, not yet known, proteases are able to compensate for ADAM 10 deficiency. Thus, the observed variability, together with recent reports on tissue-specific expression patterns of ADAMs 9, 10 and 17, points to the existence of tissue-specific 'teams' of different proteases exerting alpha-secretase activity.

Autophagy delivers cytoplasmic material and organelles to lysosomes for degradation. The formation of autophagosomes is controlled by a specific set of autophagy genes called atg genes. The magnitude of autophagosome formation is tightly regulated by intracellular and extracellular amino acid concentrations and ATP levels via signaling pathways that include the nutrient sensing kinase TOR. Autophagy functions as a stress response that is upregulated by starvation, oxidative stress, or other harmful conditions. Remarkably, autophagy has been shown to possess important housekeeping and quality control functions that contribute to health and longevity. Autophagy plays a role in innate and adaptive immunity, programmed cell death, as well as prevention of cancer, neurodegeneration and aging. In addition, impaired autophagic degradation contributes to the pathogenesis of several human diseases including lysosomal storage disorders and muscle diseases.

E-cadherin controls a wide array of cellular behaviors, including cell-cell adhesion, differentiation, and tissue development. We show here that E-cadherin is cleaved specifically by ADAM (a disintegrin and metalloprotease) 10 in its ectodomain. Analysis of ADAM10-deficient fibroblasts, inhibitor studies, and RNA interference-mediated down-regulation of ADAM10 demonstrated that ADAM10 is responsible not only for the constitutive shedding but also for the regulated shedding of this adhesion molecule in fibroblasts and keratinocytes. ADAM10-mediated E-cadherin shedding affects epithelial cell-cell adhesion as well as cell migration. Furthermore, the shedding of E-cadherin by ADAM10 modulates the beta-catenin subcellular localization and downstream signaling. ADAM10 overexpression in epithelial cells increased the expression of the beta-catenin downstream gene cyclin D1 dose-dependently and enhanced cell proliferation. In ADAM10-deficient mouse embryos, the C-terminal E-cadherin fragment is not generated, and the full-length protein accumulates, highlighting the in vivo relevance for ADAM10 in E-cadherin shedding. Our data strongly suggest that this protease constitutes a major regulatory element for the multiple functions of E-cadherin under physiological as well as pathological conditions.

It has recently become clear that lysosomes have more complex functions than simply being the end-point on a degradative pathway. Similarly, it is now emerging that there are interesting functions for the limiting membranes around these organelles and their associated proteins. Although it has been known for several decades that the lysosomal membrane contains several highly N-glycosylated proteins, including the lysosome-associated membrane proteins LAMP-1 and LAMP-2 and lysosomal integral membrane protein-2/lysosomal membrane glycoprotein-85 (LIMP-2/LGP85), specific functions of these proteins have only recently begun to be recognized. Although the normal functions of LAMP-1 can be substituted by the structurally related LAMP-2, LAMP-2 itself has more specific tasks. Knockout of LAMP-2 in mice has revealed roles for LAMP-2 in lysosomal enzyme targeting, autophagy and lysosomal biogenesis. LAMP-2 deficiency in humans leads to Danon disease, a fatal cardiomyopathy and myopathy. Furthermore, there is evidence that LAMP-2 functions in chaperone-mediated autophagy. LIMP-2/LGP85 also seems to have specific functions in maintaining endosomal transport and lysosomal biogenesis. The pivotal function of lysosomal membrane proteins is also highlighted by the recent identification of disease-causing mutations in cystine and sialic acid transporter proteins, leading to nephropathic cystinosis and Salla disease.

Lysosome-associated membrane proteins 1 and 2 (LAMP-1 and LAMP-2) are delivered to phagosomes during the maturation process. We used cells from LAMP-deficient mice to analyze the role of these proteins in phagosome maturation. Macrophages from LAMP-1- or LAMP-2-deficient mice displayed normal fusion of lysosomes with phagosomes. Because ablation of both the lamp-1 and lamp-2 genes yields an embryonic-lethal phenotype, we were unable to study macrophages from double knockouts. Instead, we reconstituted phagocytosis in murine embryonic fibroblasts (MEFs) by transfection of FcgammaIIA receptors. Phagosomes formed by FcgammaIIA-transfected MEFs obtained from LAMP-1- or LAMP-2- deficient mice acquired lysosomal markers. Remarkably, although FcgammaIIA-transfected MEFs from double-deficient mice ingested particles normally, phagosomal maturation was arrested. LAMP-1 and LAMP-2 double-deficient phagosomes acquired Rab5 and accumulated phosphatidylinositol 3-phosphate, but failed to recruit Rab7 and did not fuse with lysosomes. We attribute the deficiency to impaired organellar motility along microtubules. Time-lapse cinematography revealed that late endosomes/lysosomes as well as phagosomes lacking LAMP-1 and LAMP-2 had reduced ability to move toward the microtubule-organizing center, likely precluding their interaction with each other.

How are biological structures maintained in a cellular environment that constantly threatens protein integrity? Here we elucidate proteostasis mechanisms affecting the Z disk, a protein assembly essential for actin anchoring in striated muscles, which is subjected to mechanical, thermal, and oxidative stress during contraction [1]. Based on the characterization of the Drosophila melanogaster cochaperone Starvin (Stv), we define a conserved chaperone machinery required for Z disk maintenance. Instead of keeping Z disk proteins in a folded conformation, this machinery facilitates the degradation of damaged components, such as filamin, through chaperone-assisted selective autophagy (CASA). Stv and its mammalian ortholog BAG-3 coordinate the activity of Hsc70 and the small heat shock protein HspB8 during disposal that is initiated by the chaperone-associated ubiquitin ligase CHIP and the autophagic ubiquitin adaptor p62. CASA is thus distinct from chaperone-mediated autophagy, previously shown to facilitate the ubiquitin-independent, direct translocation of a client across the lysosomal membrane [2]. Impaired CASA results in Z disk disintegration and progressive muscle weakness in flies, mice, and men. Our findings reveal the importance of chaperone-assisted degradation for the preservation of cellular structures and identify muscle as a tissue that highly relies on an intact proteostasis network, thereby shedding light on diverse myopathies and aging.

Mutations in the homologous presenilin 1 (PS1) and presenilin 2 (PS2) genes cause the most common and aggressive form of familial Alzheimer's disease. Although PS1 function and dysfunction have been extensively studied, little is known about the function of PS2 in vivo. To delineate the relationships of PS2 and PS1 activities and whether PS2 mutations involve gain or loss of function, we generated PS2 homozygous deficient (-/-) and PS1/PS2 double homozygous deficient mice. In contrast to PS1(-/-) mice, PS2(-/-) mice are viable and fertile and develop only mild pulmonary fibrosis and hemorrhage with age. Absence of PS2 does not detectably alter processing of amyloid precursor protein and has little or no effect on physiologically important apoptotic processes, indicating that Alzheimer's disease-causing mutations in PS2, as in PS1, result in gain of function. Although PS1(+/-) PS2( -/-) mice survive in relatively good health, complete deletion of both PS2 and PS1 genes causes a phenotype closely resembling full Notch-1 deficiency. These results demonstrate in vivo that PS1 and PS2 have partially overlapping functions and that PS1 is essential and PS2 is redundant for normal Notch signaling during mammalian embryological development.

The receptor for advanced glycation endproducts (RAGE) mediates responses to cell danger and stress. When bound by its many ligands (which include advanced glycation endproducts, certain members of the S100/calgranulin family, extracellular high-mobility group box 1, the integrin Mac-1, amyloid beta-peptide and fibrils), RAGE activates programs responsible for acute and chronic inflammation. RAGE is therefore also involved in cancer progression, diabetes, atherosclerosis, and Alzheimer's disease. RAGE has several isoforms deriving from alternative splicing, including a soluble form called endogenous secretory RAGE (esRAGE). We show here that most soluble RAGE, either produced by cell lines or present in human blood, is not recognized by an anti-esRAGE antibody. Cells transfected with the cDNA for full-length RAGE, and thus not expressing esRAGE, produce a form of soluble RAGE, cleaved RAGE (cRAGE) that derives from proteolytic cleavage of the membrane-bound molecules and acts as a decoy receptor. By screening chemical inhibitors and genetically modified mouse embryonic fibroblasts (MEFs), we identify the sheddase ADAM10 as a membrane protease responsible for RAGE cleavage. Binding of its ligand HMGB1 promotes RAGE shedding. Our data do not disprove the interpretation that high levels of soluble forms of RAGE protect against chronic inflammation, but rather suggest that they correlate with high levels of ongoing inflammation.

Autophagic cell death is morphologically characterized by an accumulation of autophagic vacuoles. Here, we show that inactivation of LAMP2 by RNA interference or by homologous recombination leads to autophagic vacuolization in nutrient-depleted cells. Cells that lack LAMP2 expression showed an enhanced accumulation of vacuoles carrying the marker LC3, yet a decreased colocalization of LC3 and lysosomes, suggesting that the fusion between autophagic vacuoles and lysosomes was inhibited. While a fraction of mitochondria from starved LAMP2-expressing cells colocalized with lysosomal markers, within autophagolysosomes, no such colocalization was found on removal of LAMP2 from the experimental system. Of note, LAMP1 depletion had no such effects and did not aggravate the phenotype induced by LAMP2-specific small interfering RNA. Serum and amino acid-starved LAMP2-negative cells exhibited an accumulation of autophagic vacuoles and then succumbed to cell death with hallmarks of apoptosis such as loss of the mitochondrial transmembrane potential, caspase activation and chromatin condensation. While caspase inhibition retarded cell death, it had no protective effect on mitochondria. Stabilization of mitochondria by overexpression of Bcl-2 or the mitochondrion-targeted cytomegalovirus protein vMIA, however, blocked all signs of apoptosis. Neither caspase inhibition nor mitochondrial stabilization antagonized autophagic vacuolization in LAMP2-deficient cells. Altogether, these data indicate that accumulation of autophagic vacuoles can precede apoptotic cell death. These findings argue against the clear-cut distinction between type 1 (apoptotic) and type 2 (autophagic) cell death.

β-glucocerebrosidase, the enzyme defective in Gaucher disease, is targeted to the lysosome independently of the mannose-6-phosphate receptor. Affinity-chromatography experiments revealed that the lysosomal integral membrane protein LIMP-2 is a specific binding partner of β-glucocerebrosidase. This interaction involves a coiled-coil domain within the lumenal domain. β-glucocerebrosidase activity and protein levels were severely decreased in LIMP-2-deficient mouse tissues. Analysis of fibroblasts and macrophages isolated from these mice indicated that the majority of β-glucocerebrosidase was secreted. Missorting of β-glucocerebrosidase was also evident in vivo, as protein and activity levels were significantly higher in sera from LIMP-2-deficient mice compared to wild-type. Reconstitution of LIMP-2 in LIMP-2-deficient fibroblasts led to a rescue of β-glucocerebrosidase levels and distribution. LIMP-2 expression also led to lysosomal transport of a β-glucocerebrosidase endoplasmic reticulum retention mutant. These data support a role for LIMP-2 as the mannose-6-phosphate-independent trafficking receptor for β-glucocerebrosidase.

Cadherins are critically involved in tissue development and tissue homeostasis. We demonstrate here that neuronal cadherin (N-cadherin) is cleaved specifically by the disintegrin and metalloproteinase ADAM10 in its ectodomain. ADAM10 is not only responsible for the constitutive, but also for the regulated, shedding of this adhesion molecule in fibroblasts and neuronal cells directly regulating the overall levels of N-cadherin expression at the cell surface. The ADAM10-induced N-cadherin cleavage resulted in changes in the adhesive behaviour of cells and also in a dramatic redistribution of beta-catenin from the cell surface to the cytoplasmic pool, thereby influencing the expression of beta-catenin target genes. Our data therefore demonstrate a crucial role of ADAM10 in the regulation of cell-cell adhesion and on beta-catenin signalling, leading to the conclusion that this protease constitutes a central switch in the signalling pathway from N-cadherin at the cell surface to beta-catenin/LEF-1-regulated gene expression in the nucleus.

Mice deficient for the major lysosomal aspartic proteinase cathepsin D, generated by gene targeting, develop normally during the first 2 weeks, stop thriving in the third week and die in a state of anorexia at day 26 +/- 1. An atrophy of the ileal mucosa first observed in the third week progresses towards widespread intestinal necroses accompanied by thromboemboli. Thymus and spleen undergo massive destruction with fulminant loss of T and B cells. Lysosomal bulk proteolysis is maintained. These results suggest, that vital functions of cathepsin D are exerted by limited proteolysis of proteins regulating cell growth and/or tissue homeostasis, while its contribution to bulk proteolysis in lysosomes appears to be non-critical.

The heterotetrameric AP-1 complex is involved in the formation of clathrin-coated vesicles at the trans-Golgi network (TGN) and interacts with sorting signals in the cytoplasmic tails of cargo molecules. Targeted disruption of the mouse mu1A-adaptin gene causes embryonic lethality at day 13.5. In cells deficient in micro1A-adaptin the remaining AP-1 adaptins do not bind to the TGN. Polarized epithelial cells are the only cells of micro1A-adaptin-deficient embryos that show gamma-adaptin binding to membranes, indicating the formation of an epithelial specific AP-1B complex and demonstrating the absence of additional mu1A homologs. Mannose 6-phosphate receptors are cargo molecules that exit the TGN via AP-1-clathrin-coated vesicles. The steady-state distribution of the mannose 6-phosphate receptors MPR46 and MPR300 in mu1A-deficient cells is shifted to endosomes at the expense of the TGN. MPR46 fails to recycle back from the endosome to the TGN, indicating that AP-1 is required for retrograde endosome to TGN transport of the receptor.

The novel CXC-chemokine ligand 16 (CXCL16) functions as transmembrane adhesion molecule on the surface of APCs and as a soluble chemoattractant for activated T cells. In this study, we elucidate the mechanism responsible for the conversion of the transmembrane molecule into a soluble chemokine and provide evidence for the expression and shedding of CXCL16 by fibroblasts and vascular cells. By transfection of human and murine CXCL16 in different cell lines, we show that soluble CXCL16 is constitutively generated by proteolytic cleavage of transmembrane CXCL16 resulting in reduced surface expression of the transmembrane molecule. Inhibition experiments with selective hydroxamate inhibitors against the disintegrin-like metalloproteinases a disintegrin and metalloproteinase domain (ADAM)10 and ADAM17 suggest that ADAM10, but not ADAM17, is involved in constitutive CXCL16 cleavage. In addition, the constitutive cleavage of transfected human CXCL16 was markedly reduced in embryonic fibroblasts generated from ADAM10-deficient mice. By induction of murine CXCL16 in ADAM10-deficient fibroblasts with IFN-gamma and TNF-alpha, we show that endogenous ADAM10 is indeed involved in the release of endogenous CXCL16. Finally, the shedding of endogenous CXCL16 could be reconstituted by retransfection of ADAM10-deficient cells with ADAM10. Analyzing the expression and release of CXCXL16 by cultured vascular cells, we found that IFN-gamma and TNF-alpha synergize to induce CXCL16 mRNA. The constitutive shedding of CXCL16 from the endothelial cell surface is blocked by inhibitors of ADAM10 and is independent of additional inhibition of ADAM17. Hence, during inflammation in the vasculature, ADAM10 may act as a CXCL16 sheddase and thereby finely control the expression and function of CXCL16 in the inflamed tissue.

Cathepsin D-deficient (CD-/-) mice have been shown to manifest seizures and become blind near the terminal stage [approximately postnatal day (P) 26]. We therefore examined the morphological, immunocytochemical, and biochemical features of CNS tissues of these mice. By electron microscopy, autophagosome/autolysosome-like bodies containing part of the cytoplasm, granular osmiophilic deposits, and fingerprint profiles were demonstrated in the neuronal perikarya of CD-/- mouse brains after P20. Autophagosomes and granular osmiophilic deposits were detected in neurons at P0 but were few in number, whereas they increased in the neuronal perikarya within days after birth. Some large-sized neurons having autophagosome/autolysosome-like bodies in the perikarya appeared in the CNS tissues, especially in the thalamic region and the cerebral cortex, at P17. These lysosomal bodies occupied the perikarya of almost all neurons in CD-/- mouse brains obtained from P23 until the terminal stage. Because these neurons exhibited autofluorescence, it was considered that ceroid lipofuscin may accumulate in lysosomal structures of CD-/- neurons. Subunit c of mitochondrial ATP synthase was found to accumulate in the lysosomes of neurons, although the activity of tripeptidyl peptidase-I significantly increased in the brain. Moreover, neurons near the terminal stage were often shrunken and possessed irregular nuclei through which small dense chromatin masses were scattered. These results suggest that the CNS neurons in CD-/- mice show a new form of lysosomal accumulation disease with a phenotype resembling neuronal ceroid lipofuscinosis.

Interleukin-6 (IL-6) activates cells by binding to the membrane-bound IL-6 receptor (IL-6R) and subsequent formation of a glycoprotein 130 homodimer. Cells that express glycoprotein 130, but not the IL-6R, can be activated by IL-6 and the soluble IL-6R which is generated by shedding from the cell surface or by alternative splicing. Here we show that cholesterol depletion of cells with methyl-β-cyclodextrin increases IL-6R shedding independent of protein kinase C activation and thus differs from phorbol ester-induced shedding. Contrary to cholesterol depletion, cholesterol enrichment did not increase IL-6R shedding. Shedding of the IL-6R because of cholesterol depletion is highly dependent on the metalloproteinase ADAM17 (tumor necrosis factor-α-converting enzyme), and the related ADAM10, which is identified here for the first time as an enzyme involved in constitutive and induced shedding of the human IL-6R. When combined with protein kinase C inhibition by staurosporine or rottlerin, breakdown of plasma membrane sphingomyelin or enrichment of the plasma membrane with ceramide also increased IL-6R shedding. The effect of cholesterol depletion was confirmed in human THP-1 and Hep3B cells and in primary human peripheral blood monocytes, which naturally express the IL-6R. For decades, high cholesterol levels have been considered harmful. This study indicates that low cholesterol levels may play a role in shedding of the membrane-bound IL-6R and thereby in the immunopathogenesis of human diseases.

There is an exciting increase of evidence that members of the disintegrin and metalloprotease (ADAM) family critically regulate cell adhesion, migration, development and signalling. ADAMs are involved in "ectodomain shedding" of various cell surface proteins such as growth factors, receptors and their ligands, cytokines, and cell adhesion molecules. The regulation of these proteases is complex and still poorly understood. Studies in ADAM knockout mice revealed their partially redundant roles in angiogenesis, neurogenesis, tissue development and cancer. ADAMs usually trigger the first step in regulated intramembrane proteolysis leading to activation of intracellular signalling pathways and the release of functional soluble ectodomains.

In this study we investigated the role of bone lining cells in the coordination of bone resorption and formation. Ultrastructural analysis of mouse long bones and calvariae revealed that bone lining cells enwrap and subsequently digest collagen fibrils protruding from Howship's lacunae that are left by osteoclasts. By using selective proteinase inhibitors we show that this digestion depends on matrix metalloproteinases and, to some extent, on serine proteinases. Autoradiography revealed that after the bone lining cells have finished cleaning, they deposit a thin layer of a collagenous matrix along the Howship's lacuna, in close association with an osteopontin-rich cement line. Collagenous matrix deposition was detected only in completely cleaned pits. In bone from pycnodysostotic patients and cathepsin K-deficient mice, conditions in which osteoclastic bone matrix digestion is greatly inhibited, bone matrix leftovers proved to be degraded by bone lining cells, thus indicating that the bone lining cell "rescues" bone remodeling in these anomalies. We conclude that removal of bone collagen left by osteoclasts in Howship's lacunae is an obligatory step in the link between bone resorption and formation, and that bone lining cells and matrix metalloproteinases are essential in this process.

Emerging concepts suggest that the functional phenotype of macrophages is regulated by transcription factors that define alternative activation states. We found that RBP-J, the main nuclear transducer of signaling via Notch receptors, augmented Toll-like receptor 4 (TLR4)-induced expression of key mediators of classically activated M1 macrophages and thus of innate immune responses to Listeria monocytogenes. Notch-RBP-J signaling controlled expression of the transcription factor IRF8 that induced downstream M1 macrophage-associated genes. RBP-J promoted the synthesis of IRF8 protein by selectively augmenting kinase IRAK2-dependent signaling via TLR4 to the kinase MNK1 and downstream translation-initiation control through eIF4E. Our results define a signaling network in which signaling via Notch-RBP-J and TLRs is integrated at the level of synthesis of IRF8 protein and identify a mechanism by which heterologous signaling pathways can regulate the TLR-induced inflammatory polarization of macrophages.

The metalloproteinase and major amyloid precursor protein (APP) alpha-secretase candidate ADAM10 is responsible for the shedding of proteins important for brain development, such as cadherins, ephrins, and Notch receptors. Adam10(-/-) mice die at embryonic day 9.5, due to major defects in development of somites and vasculogenesis. To investigate the function of ADAM10 in brain, we generated Adam10 conditional knock-out (cKO) mice using a Nestin-Cre promotor, limiting ADAM10 inactivation to neural progenitor cells (NPCs) and NPC-derived neurons and glial cells. The cKO mice die perinatally with a disrupted neocortex and a severely reduced ganglionic eminence, due to precocious neuronal differentiation resulting in an early depletion of progenitor cells. Premature neuronal differentiation is associated with aberrant neuronal migration and a disorganized laminar architecture in the neocortex. Neurospheres derived from Adam10 cKO mice have a disrupted sphere organization and segregated more neurons at the expense of astrocytes. We found that Notch-1 processing was affected, leading to downregulation of several Notch-regulated genes in Adam10 cKO brains, in accordance with the central role of ADAM10 in this signaling pathway and explaining the neurogenic phenotype. Finally, we found that alpha-secretase-mediated processing of APP was largely reduced in these neurons, demonstrating that ADAM10 represents the most important APP alpha-secretase in brain. Our study reveals that ADAM10 plays a central role in the developing brain by controlling mainly Notch-dependent pathways but likely also by reducing surface shedding of other neuronal membrane proteins including APP.

In cathepsin D-deficient (CD-/-) and cathepsins B and L double-deficient (CB-/-CL-/-) mice, abnormal vacuolar structures accumulate in neurons of the brains. Many of these structures resemble autophagosomes in which part of the cytoplasm is retained but their precise nature and biogenesis remain unknown. We show here how autophagy contributes to the accumulation of these vacuolar structures in neurons deficient in cathepsin D or both cathepsins B and L by demonstrating an increased conversion of the molecular form of MAP1-LC3 for autophagosome formation from the cytosolic form (LC3-I) to the membrane-bound form (LC3-II). In both CD-/- and CB-/-CL-/- mouse brains, the membrane-bound LC3-II form predominated whereas MAP1-LC3 signals accumulated in granular structures located in neuronal perikarya and axons of these mutant brains and were localized to the membranes of autophagosomes, evidenced by immunofluorescence microscopy and freeze-fracture-replica immunoelectron microscopy. Moreover, as in CD-/- neurons, autofluorescence and subunit c of mitochondrial ATP synthase accumulated in CB-/-CL-/- neurons. This suggests that not only CD-/- but also CB-/-CL-/- mice could be useful animal models for neuronal ceroid-lipofuscinosis/Batten disease. These data strongly argue for a major involvement of autophagy in the pathogenesis of Batten disease/lysosomal storage disorders.

β-Secretase (BACE1) is the rate-limiting protease for the generation of the amyloid β-peptide (Aβ) in Alzheimer disease. Mice in which the bace1 gene is inactivated are reported to be healthy. However, the presence of a homologous gene encoding BACE2 raises the possibility of compensatory mechanisms. Therefore, we have generated bace1, bace2, and double knockout mice. We report here that BACE1 mice display a complex phenotype. A variable but significant number of BACE1 offspring died in the first weeks after birth. The surviving mice remained smaller than their littermate controls and presented a hyperactive behavior. Electrophysiologically, subtle alterations in the steady-state inactivation of voltage-gated sodium channels in BACE1-deficient neurons were observed. In contrast, bace2 knockout mice displayed an overall healthy phenotype. However, a combined deficiency of BACE2 and BACE1 enhanced the bace1–/– lethality phenotype. At the biochemical level, we have confirmed that BACE1 deficiency results in an almost complete block of Aβ generation in neurons, but not in glia. As glia are 10 times more abundant in brain compared with neurons, our data indicate that BACE2 could indeed contribute to Aβ generation in the brains of Alzheimer disease and, in particular, Down syndrome patients. In conclusion, our data challenge the general idea of BACE1 as a safe drug target and call for some caution when claiming that no major side effects should be expected from blocking BACE1 activity. β-Secretase (BACE1) is the rate-limiting protease for the generation of the amyloid β-peptide (Aβ) in Alzheimer disease. Mice in which the bace1 gene is inactivated are reported to be healthy. However, the presence of a homologous gene encoding BACE2 raises the possibility of compensatory mechanisms. Therefore, we have generated bace1, bace2, and double knockout mice. We report here that BACE1 mice display a complex phenotype. A variable but significant number of BACE1 offspring died in the first weeks after birth. The surviving mice remained smaller than their littermate controls and presented a hyperactive behavior. Electrophysiologically, subtle alterations in the steady-state inactivation of voltage-gated sodium channels in BACE1-deficient neurons were observed. In contrast, bace2 knockout mice displayed an overall healthy phenotype. However, a combined deficiency of BACE2 and BACE1 enhanced the bace1–/– lethality phenotype. At the biochemical level, we have confirmed that BACE1 deficiency results in an almost complete block of Aβ generation in neurons, but not in glia. As glia are 10 times more abundant in brain compared with neurons, our data indicate that BACE2 could indeed contribute to Aβ generation in the brains of Alzheimer disease and, in particular, Down syndrome patients. In conclusion, our data challenge the general idea of BACE1 as a safe drug target and call for some caution when claiming that no major side effects should be expected from blocking BACE1 activity. Alzheimer disease (AD) 1The abbreviations used are: AD, Alzheimer disease; Aβ, amyloid β-peptide; APP, amyloid precursor protein; SFV, Semliki Forest virus; APPwt, wild-type APP; APPsw, Swedish APP mutation; APPfl, Flemish APP mutation; MEM, minimal essential medium; VSV, vesicular stomatitis virus. is the most common cause of dementia for which neither a good diagnostic test nor an effective treatment is available yet. The most widely accepted hypothesis states that AD is initially triggered by the abnormal accumulation and possibly deposition of the small amyloid β-peptide (Aβ) in different brain regions, which in turn initiates a pathogenic cascade that ultimately leads to neuronal death, AD pathology, and dementia. Aβ is cleaved from a long membrane-bound precursor, the amyloid precursor protein (APP), by two consecutive cleavages. β- and γ-secretases are the enzymes that liberate the N and C termini of Aβ, respectively, and are the subject of intense investigation because of their relevance as candidate therapeutic targets to treat AD. BACE1 and BACE2 are two highly homologous membrane-bound aspartyl proteases that can process APP at the β-secretase site (1Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (1001) Google Scholar, 2Hussain I. Powell D.J. Howlett D.R. Chapman G.A. Gilmour L. Murdock P.R. Tew D.G. Meek T.D. Chapman C. Schneider K. Ratcliffe S.J. Tattersall D. Testa T.T. Southan C. Ryan D.M. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 2000; 16: 609-619Crossref PubMed Scopus (143) Google Scholar, 3Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1482) Google Scholar, 4Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3308) Google Scholar, 5Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1339) Google Scholar, 6Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (740) Google Scholar, 7Acquati F. Accarino M. Nucci C. Fumagalli P. Jovine L. Ottolenghi S. Taramelli R. FEBS Lett. 2000; 468: 59-64Crossref PubMed Scopus (121) Google Scholar, 8Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (347) Google Scholar). Although both enzymes exhibit many of the characteristics expected for β-secretase, it has been quite convincingly demonstrated that BACE1 is in fact the major β-secretase responsible for Aβ generation in brain (9Cai H. Wang Y. McCarthy D. Wen H. Borchelt D.R. Price D.L. Wong P.C. Nat. Neurosci. 2001; 4: 233-234Crossref PubMed Scopus (954) Google Scholar, 10Roberds S.L. Anderson J. Basi G. Bienkowski M.J. Branstetter D.G. Chen K.S. Freedman S.B. Frigon N.L. Games D. Hu K. Johnson-Wood K. Kappenman K.E. Kawabe T.T. Kola I. Kuehn R. Lee M. Liu W. Motter R. Nichols N.F. Power M. Robertson D.W. Schenk D. Schoor M. Shopp G.M. Shuck M.E. Sinha S. Svensson K.A. Tatsuno G. Tintrup H. Wijsman J. Wright S. McConlogue L. Hum. Mol. Genet. 2001; 10: 1317-1324Crossref PubMed Google Scholar, 11Luo Y. Bolon B. Kahn S. Bennett B.D. Babu-Khan S. Denis P. Fan W. Kha H. Zhang J. Gong Y. Martin L. Louis J.C. Yan Q. Richards W.G. Citron M. Vassar R. Nat. Neurosci. 2001; 4: 231-232Crossref PubMed Scopus (951) Google Scholar). Contrary to BACE1, BACE2 is more highly expressed in peripheral tissues, but also to some extent in brain (2Hussain I. Powell D.J. Howlett D.R. Chapman G.A. Gilmour L. Murdock P.R. Tew D.G. Meek T.D. Chapman C. Schneider K. Ratcliffe S.J. Tattersall D. Testa T.T. Southan C. Ryan D.M. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 2000; 16: 609-619Crossref PubMed Scopus (143) Google Scholar, 8Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (347) Google Scholar, 12Solans A. Estivill X. de La Luna S. Cytogenet. Cell Genet. 2000; 89: 177-184Crossref PubMed Scopus (82) Google Scholar, 13Bennett B.D. Babu-Khan S. Loeloff R. Louis J.C. Curran E. Citron M. Vassar R. J. Biol. Chem. 2000; 275: 20647-20651Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar), raising the question of whether BACE2 could contribute to the generation of the brain Aβ pool. Both BACE1 and BACE2 can cleave APP in vitro not only at Asp1 (numbering considering the first amino acid of Aβ as position 1), but also at internal sites within the Aβ region. BACE1 cleaves between amino acids 10 and 11 of Aβ, resulting in an N-terminally truncated peptide that is considered more amyloidogenic and more neurotoxic than full-length Aβ (14Pike C.J. Overman M.J. Cotman C.W. J. Biol. Chem. 1995; 270: 23895-23898Abstract Full Text Full Text PDF PubMed Scopus (286) Google Scholar) and that has been observed in senile plaques (15Masters C.L. Simms G. Weinman N.A. Multhaup G. McDonald B.L. Beyreuther K. Proc. Natl. Acad. Sci. U. S. A. 1985; 82: 4245-4249Crossref PubMed Scopus (3668) Google Scholar, 16Naslund J. Schierhorn A. Hellman U. Lannfelt L. Roses A.D. Tjernberg L.O. Silberring J. Gandy S.E. Winblad B. Greengard P. Nordstedt C. Terenius L. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 8378-8382Crossref PubMed Scopus (370) Google Scholar). The internal BACE2 cleavage site is between amino acids 19 and 20 (8Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (347) Google Scholar, 17Fluhrer R. Capell A. Westmeyer G. Willem M. Hartung B. Condron M.M. Teplow D.B. Haass C. Walter J. J. Neurochem. 2002; 81: 1011-1020Crossref PubMed Scopus (100) Google Scholar, 18Yan R. Munzner J.B. Shuck M.E. Bienkowski M.J. J. Biol. Chem. 2001; 276: 34019-34027Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar), and the resulting Aβ has thus far not been found in senile plaques. Moreover, BACE2-transfected cells produce reduced levels of Aβ (2Hussain I. Powell D.J. Howlett D.R. Chapman G.A. Gilmour L. Murdock P.R. Tew D.G. Meek T.D. Chapman C. Schneider K. Ratcliffe S.J. Tattersall D. Testa T.T. Southan C. Ryan D.M. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 2000; 16: 609-619Crossref PubMed Scopus (143) Google Scholar, 8Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (347) Google Scholar, 13Bennett B.D. Babu-Khan S. Loeloff R. Louis J.C. Curran E. Citron M. Vassar R. J. Biol. Chem. 2000; 275: 20647-20651Abstract Full Text Full Text PDF PubMed Scopus (257) Google Scholar, 18Yan R. Munzner J.B. Shuck M.E. Bienkowski M.J. J. Biol. Chem. 2001; 276: 34019-34027Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar), and selective knockdown of endogenous BACE2 in human embryonic kidney 293 cells by RNA interference elevates Aβ secretion (19Basi G. Frigon N. Barbour R. Doan T. Gordon G. McConlogue L. Sinha S. Zeller M. J. Biol. Chem. 2003; 278: 31512-31520Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). These observations led to the suggestion that BACE2 does not function as a β-secretase, but rather as an α-like secretase that precludes Aβ formation (17Fluhrer R. Capell A. Westmeyer G. Willem M. Hartung B. Condron M.M. Teplow D.B. Haass C. Walter J. J. Neurochem. 2002; 81: 1011-1020Crossref PubMed Scopus (100) Google Scholar, 18Yan R. Munzner J.B. Shuck M.E. Bienkowski M.J. J. Biol. Chem. 2001; 276: 34019-34027Abstract Full Text Full Text PDF PubMed Scopus (148) Google Scholar, 19Basi G. Frigon N. Barbour R. Doan T. Gordon G. McConlogue L. Sinha S. Zeller M. J. Biol. Chem. 2003; 278: 31512-31520Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 20Wong P.C. Price D.L. Cai H. Science. 2001; 293: 1434Crossref PubMed Google Scholar). However, these in vitro observations cannot rule out a possible contribution of BACE2 to the Aβ pool in brain, and it has even been suggested that BACE2-mediated APP cleavage might play a role in the development of AD in individuals carrying the Flemish familial AD mutation in APP (8Farzan M. Schnitzler C.E. Vasilieva N. Leung D. Choe H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 9712-9717Crossref PubMed Scopus (347) Google Scholar) as well as in the AD-like disease associated with Down syndrome (12Solans A. Estivill X. de La Luna S. Cytogenet. Cell Genet. 2000; 89: 177-184Crossref PubMed Scopus (82) Google Scholar, 21Motonaga K. Itoh M. Becker L.E. Goto Y. Takashima S. Neurosci. Lett. 2002; 326: 64-66Crossref PubMed Scopus (35) Google Scholar). From a therapeutic point of view, there are increasing concerns with using γ-secretase inhibitors to treat AD. γ-Secretase processes a growing number of membrane proteins, and blocking their cleavage is likely to have toxic side effects. Indeed, administration of a potent γ-secretase inhibitor to mice results in marked defects in lymphocyte development and in intestinal villi and mucosa (22Wong G.T. Manfra D. Poulet F.M. Zhang Q. Josien H. Bara T. Engstrom L. Pinzon-Ortiz M.C. Fine J.S. Lee H.J. Zhang L. Higgins G.A. Parker E.M. J. Biol. Chem. 2004; 279: 12876-12882Abstract Full Text Full Text PDF PubMed Scopus (654) Google Scholar), as was also observed in presenilin-deficient mice (23Tournoy J. Bossuyt X. Snellinx A. Regent M. Garmyn M. Serneels L. Saftig P. Craessaerts K. De Strooper B. Hartmann D. Hum. Mol. Genet. 2004; 13: 1321-1331Crossref PubMed Scopus (75) Google Scholar). In contrast, BACE1 appears to be a promising drug target because genetic ablation of the bace1 gene in mice does not seem to be associated with any gross abnormality (9Cai H. Wang Y. McCarthy D. Wen H. Borchelt D.R. Price D.L. Wong P.C. Nat. Neurosci. 2001; 4: 233-234Crossref PubMed Scopus (954) Google Scholar, 10Roberds S.L. Anderson J. Basi G. Bienkowski M.J. Branstetter D.G. Chen K.S. Freedman S.B. Frigon N.L. Games D. Hu K. Johnson-Wood K. Kappenman K.E. Kawabe T.T. Kola I. Kuehn R. Lee M. Liu W. Motter R. Nichols N.F. Power M. Robertson D.W. Schenk D. Schoor M. Shopp G.M. Shuck M.E. Sinha S. Svensson K.A. Tatsuno G. Tintrup H. Wijsman J. Wright S. McConlogue L. Hum. Mol. Genet. 2001; 10: 1317-1324Crossref PubMed Google Scholar, 11Luo Y. Bolon B. Kahn S. Bennett B.D. Babu-Khan S. Denis P. Fan W. Kha H. Zhang J. Gong Y. Martin L. Louis J.C. Yan Q. Richards W.G. Citron M. Vassar R. Nat. Neurosci. 2001; 4: 231-232Crossref PubMed Scopus (951) Google Scholar). Moreover, BACE1 deficiency could prevent the learning and memory impairments and the cholinergic dysfunction observed in a transgenic mouse model for AD (24Ohno M. Sametsky E.A. Younkin L.H. Oakley H. Younkin S.G. Citron M. Vassar R. Disterhoft J.F. Neuron. 2004; 41: 27-33Abstract Full Text Full Text PDF PubMed Scopus (459) Google Scholar). Although BACE1 function might still be required under particular conditions that may have escaped detection, these results highlight BACE1 as one of the best available drug targets for AD. At this point, however, it cannot be excluded that BACE1 has important functions in vivo and that the apparent lack of phenotype in bace1 knockout mice is due to the activation of compensatory mechanisms or to genetic redundancy. Because of their high homology, BACE2 is the best candidate protease to compensate for the absence of BACE1 function. Based on this homology, it is also likely that active-site inhibitors for BACE1 will affect, in addition, BACE2 protease activity. To better understand the biological functions of BACE1 and BACE2, to analyze possible overlapping functions of these two proteases, and to attempt to predict the consequences of blocking BACE function in vivo, we generated mice with inactivated bace1 and/or bace2 genes. Unexpectedly and in contrast to what has been published for bace1 knockout mice, we observed a phenotype associated with BACE1 deficiency, viz. a higher mortality rate early in life. bace2 knockout mice were fertile and viable, with no major phenotypic alteration. Most important, mice with inactivated bace1 and bace2 genes were fertile and viable, but presented neonatal mortality that was even higher than that of the monogenic bace1 line. These results suggest that BACE2 indeed partially compensates for the absence of BACE1 in bace1 knockout mice and that therapeutic inhibition of BACE function may result in adverse side effects. Antibodies—The C terminus-specific antibody for mouse BACE1 (B48) was raised in New Zealand White rabbits using synthetic peptide CLRHQHDDFADDISLLK. Rabbit antibodies B7/8 raised against Aβ (25De Strooper B. Simons M. Multhaup G. Van Leuven F. Beyreuther K. Dotti C.G. EMBO J. 1995; 14: 4932-4938Crossref PubMed Scopus (162) Google Scholar) and B63 raised against the C terminus of human APP (26Esselens C. Oorschot V. Baert V. Raemaekers T. Spittaels K. Serneels L. Zheng H. Saftig P. De Strooper B. Klumperman J. Annaert W. J. Cell Biol. 2004; 166: 1041-1054Crossref PubMed Scopus (152) Google Scholar) have been described. Anti-FLAG monoclonal antibody was from Sigma. The N terminus-specific antibody for human Aβ (82E1) was from IBL Co., Ltd. (Tokyo, Japan). Plasmid Construction—cDNAs to be expressed in non-neuronal cells were subcloned into a derivative of the eukaryotic expression vector pSG5 (Stratagene) that contains a larger polylinker (pSG5**; polylinker EcoRI, SpeI, SacII, HindIII, NotI, XhoI, SmaI, SacI, BamHI, and BglII). BACE1 cDNA was amplified from mouse brain RNA using primers 5′-GGATTCATGGCCCCAGCGCTGCACTGGCT-3′ and 5′-GAGCTCTCACTTGAGCAGGGAGATGTCATC-3′ (with the SacI site underlined) and directly cloned into pGEM-T (Promega). The SacI-SacII fragment was subsequently subcloned into the SacI-SacII sites of pSG5**. BACE2 cDNA was amplified from mouse pancreas cDNA using primers 5′-ATGGGCGCGCTGCTTCGAGCAC-3′ and 5′-TCATTTCCAGCGATGTCTGAC-3′ and cloned into the pGEM-T vector. The XmaIII fragment of pGEM-T-mBACE2 was subsequently subcloned into the SmaI site of pSG5**. For cloning of BACE2 cDNA containing a deletion of exon 6 (BACE2ΔE6), two subfragments of the cDNA were separately amplified using primers that contain the deletion. The 5′-fragment was amplified using T7 as the forward primer and 5′-AGAAAACTCTGGAATCTCTCTGCAGTCCAGGTTGAGGTTCTGG-3′ as the reverse primer. The 3′-fragment was amplified using primers 5′-CTGGACTGCAGAGAGATTCCAGAGTTTTCTGATGGCTTCTGGAC-3′ and 5′-GCTGCAATAAACAAGTTCTGCT-3′. The purified 5′- and 3′-subfragments were mixed together and PCR-amplified using the T7 and 5′-GCTGCAATAAACAAGTTCTGCT-3′ primers. The PCR product was digested with EcoRI and BamHI and cloned into the same sites of pSG5**. Cloning of bace2 and bace2ΔE6 containing a C-terminal FLAG epitope was done by PCR amplification on pSG5**BACE2 and pSG5**-BACE2ΔE6, respectively, using primers 5′-CGGAATTCCACCATGGGCGCGCTGCTTCGAGCA-3′ (with the EcoRI site underlined) and 5′-CGGGATCCTCATTTATCGTCGTCATCCTTGTAGTCTTTCCAGCGATGTCTGACTAGT-3′ (with the BamHI site underlined and the FLAG epitope in italics). PCR products were digested with EcoRI-BamHI and cloned into the same sites of the pSG5** vector. All constructs were verified by sequencing. For expression in neuronal and glial cells, cDNAs were cloned into Semliki Forest virus (SFV) type 1. Cloning of SFV-APPwt, SFV-APPsw, and SFV-APPfl has been described previously (27Simons M. De Strooper B. Multhaup G. Tienari P.J. Dotti C.G. Beyreuther K. J. Neurosci. 1996; 16: 899-908Crossref PubMed Google Scholar, 28Tienari P.J. De Strooper B. Ikonen E. Ida N. Simons M. Masters C.L. Dotti C.G. Beyreuther K. Cold Spring Harbor Symp. Quant. Biol. 1996; 61: 575-585Crossref PubMed Google Scholar). Primary Cultures and Cell Lines—Medium, serum, and supplements for maintenance of cells were obtained from Invitrogen. COS cells and adult mice fibroblasts were maintained in Dulbecco's modified Eagle's medium/nutrient mixture F-12 (1:1) supplemented with 10% fetal calf serum. Primary neuronal cultures were generated from trypsinized brains obtained from day 14 embryos and maintained in Neurobasal medium (Invitrogen) supplemented with B27 and 0.5 μm l-glutamine. Cytosine arabinoside (5 μm) was added 24 h after plating to prevent non-neuronal (glial) cell proliferation. For glial cell cultures, Neuro-basal medium was replaced with minimal essential medium (MEM; Invitrogen) supplemented with 10% horse serum, 0.225% NaHCO3, 2 mm l-glutamine, and 0.6% glucose (MEM-HS). Cultures were maintained at 37 °C in a humidified 5% CO2 atmosphere. DNA Transfer and Metabolic Labeling—COS cells were plated in 6-cm2 plates 1 day before transfection. Approximately 70–80% confluent cells were transfected with a total of 2 μg of DNA (1 μg of APP and 1 μg of BACE plasmids) and 6 μl of FuGene 6 (Roche Applied Science). Two days after transfection, cells were metabolically labeled with 100 μCi/ml [35S]methionine for 4 h; the conditioned medium was collected; and cells were directly lysed in double immunoprecipitation assay buffer (50 mm Tris-HCl (pH 7.8), 150 mm NaCl, 1% Triton X-100, 1% sodium deoxycholate, and 0.1% SDS). Neurons were maintained in Neurobasal medium, and ∼48 h after the addition of cytosine arabinoside, they were infected with recombinant SFV. Glial cells were maintained for ∼1 week in MEM-HS, passaged at least once, and infected with recombinant SFV ∼48 h after trypsinization. (This treatment ensured the absence of neurons in the culture.) For both neurons and glial cells, a 10-fold dilution of SFV encoding APPwt, APPsw, or APPfl was added to the cultures, and infection was allowed to proceed for 1 h. The conditioned medium containing the virus was then replaced with fresh medium, and cells were further incubated for 2 h. Cells were metabolically labeled with 100 μCi/ml [35S]methionine for 4 h; the conditioned medium was collected; and the cells were directly lysed in double immunoprecipitation assay buffer. Mouse fibroblasts were plated in 12-well plates 1 day before infection (∼300,000 cells/well). A 1:4 dilution of adenovirus encoding APPsw was added to the medium, and cells were further incubated for 48 h. Metabolic labeling was subsequently done as described above. Analysis of APP Processing—Full-length APP and C-terminal fragments were immunoprecipitated from cell extracts using antibody B63. Aβ was immunoprecipitated from the conditioned medium using antibody B7/8. Protein G-Sepharose beads (Amersham Biosciences) were added to the mixtures, followed by overnight incubation at 4 °C with rotation. The immunoprecipitates were washed five times with double immunoprecipitation assay buffer and once with 0.3× Tris-buffered saline and then solubilized with NuPAGE lithium dodecyl sulfate loading buffer. Samples were heated for 10 min at 70 °C and electrophoresed on 4–12% precast gels (Novex). Radiolabeled bands were detected using a PhosphorImager (Amersham Biosciences). Analysis of APP Processing Using Antibody 82E1—Neurons and glial cells were infected with recombinant SFV for 1 h as described above. The medium was subsequently replaced with Neurobasal medium (neurons) or MEM-HS (glial cells), and cells were further incubated for 6 h. Cells were lysed in phosphate-buffered saline containing protease inhibitors (Trasylol, 1 μg/ml pepstatin, and 5 mm EDTA) and 1% Triton X-100. Samples of cell extracts were resolved by SDS-PAGE and probed with antibody B63. Aβ was immunoprecipitated from the conditioned medium using antibody B7/8 and detected by Western blotting using antibody 82E1. Fluorescence Resonance Energy Transfer Analysis—COS cells were transfected with 2 μg of either empty vector or vector encoding BACE1-FLAG, BACE2-FLAG, or BACE2ΔE6-FLAG using 6 μl of FuGene 6. Forty-eight hours after transfection, cells were scraped in buffer containing 5 mm Tris (pH 7.4), 250 mm sucrose, 1 mm EGTA, and 1% Triton X-100, and protein concentration was determined using Bio-Rad protein assay dye reagent. Proteins (∼400 μg) were subsequently incubated overnight at 4 °C with antibody B48 (BACE1-transfected cells) or anti-FLAG antibody (BACE2-transfected cells) and protein G-Sepharose beads. The immunoprecipitates were washed three times with Tris-buffered saline containing 0.1% Triton X-100 and twice with Tris-buffered saline. BACE activity was subsequently measured in an in vitro assay (Panvera P2985) by fluorescence resonance energy transfer according to the manufacturer's instructions. Briefly, an APP-based peptide substrate carrying the Swedish mutation and containing a fluorescence donor and a quencher acceptor at each end was used. The intact substrate is weakly fluorescent and becomes highly fluorescent upon enzymatic cleavage. BACE immunoprecipitates were directly resuspended in 20 μl of assay buffer provided with the kit, and after substrate addition, excitation and emission were measured using VICTOR2 (PerkinElmer Life Sciences Model 1420 multilabel counter). Pup Exchange—A total of eight BACE1 homozygous and eight wild-type couples were used for the experiment. Coupling was synchronized, and pups were exchanged during the first day of birth. The number of pups was followed until weaning. Electrophysiological Recordings—Acutely isolated pyramidal cell somata were prepared from the sensorimotor cortex of anesthetized and then decapitated wild-type and bace1–/– mice (23–30 days of age) using an established method of combined enzymatic/mechanic dissociation (29Alzheimer C. J. Physiol. (Lond.). 1994; 479: 199-205Crossref Scopus (49) Google Scholar). Briefly, freshly prepared neocortical slices were incubated for 30 min in warmed (29 °C) artificial cerebrospinal fluid and then maintained at room temperature. Artificial cerebrospinal fluid was constantly gassed with 95% O2 and 5% CO2 and contained 125 mm NaCl, 3 mm KCl, 2 mm CaCl2, 2 mm MgCl2, 1.25 mm NaH2PO4, 25 mm NaHCO3, and 10 mm d-glucose (pH 7.4). Small pieces of sliced tissue (∼2 × 2 mm) were incubated for 45 min at 29 °C in HEPES-buffered saline (150 mm NaCl, 3 mm KCl, 2 mm CaCl2, 2 mm MgCl2, 10 mm HEPES, and 10 mm d-glucose (pH 7.4)) containing 19 units/ml papain. All recordings were made at room temperature (19–20 °C). Current signals from acutely isolated pyramidal cell somata recorded in whole cell voltage clamp mode were sampled at 20 kHz and filtered at 5 kHz (–3 dB) using an Axopatch 200B amplifier in conjunction with a Digidata 1322A interface and pClamp 9 software (all from Axon Instruments, Inc., Foster City, CA). Access resistance in the whole cell configuration was 10–15 megaohms before series resistance compensation (75–80%). To improve voltage control, Na+ currents were investigated in a low Na+ bathing solution containing 15 mm NaCl, 115 mm choline chloride, 3 mm KCl, 2 mm MgCl2, 1.6 mm CaCl2, 0.4 mm CdCl2, 10 mm HEPES, and 10 mm d-glucose (pH 7.4). Patch pipettes were filled with 105 mm CsF, 20 mm triethanolamine chloride, 3 mm KCl, 1 mm MgCl2, 8 mm HEPES, 9mm EGTA, and 2 mm Na2ATP (pH 7.2 adjusted with CsOH). Data are presented as means ± S.E. Data were statistically analyzed (Student's t test, significance set at p < 0.05) using Origin Pro7 software. Substances were purchased from Sigma. Animals—A panel of 69 male mice (25 wild-type, 23 heterozygous, and 21 bace1 knockout littermate mice, aged 3–9 months) was used to assess anxiety-related behavior in the open field test and elevated zero maze and depression-related behavior in the tail suspension test and forced swim test. Animals were individually housed and kept under a 12-h light/12-h dark cycle (lights on at 6:00 a.m.) in a temperature- and humidity-controlled room with food and water ad libitum. All experiments were conducted during the light phase of the light/dark cycle with 1 week between experiments. Open Field Test—Locomotor activity was monitored using a Truscan© system (Coulbourn Instruments Inc., Allentown, PA). The animal was placed in the center of the activity field arena, which is a transparent plexiglas cage (260 (width) × 260 (depth) × 400 (height) mm) equipped with two photo beam sensor rings to register horizontal and vertical activities. Testing lasted 30 min. Elevated Zero Maze—Elevated zero maze testing was performed as described by Crawley (30Crawley J.N. What's Wrong with My Mouse? Behavioral Phenotyping of Transgenic and Knockout Mice. John Wiley & Sons, Inc., New York2000Google Scholar). The zero maze consists of an annular platform (diameter, 50 cm; and width, 5 cm). The animals were allowed to freely explore the maze for 5 min, and their behavior was recorded and analyzed using the Ethovision Pro video tracking system (Noldus Information Technology, Wageningen, The Netherlands). Tail Suspension Test—Mice were suspended by their tail on a hook in a test chamber using adhesive tape. Total duration of immobility was measured over a period of 6 min using the VideoTrack system (Viewpoint, Champagne au Mont d'Or, France). Mice that curled up toward their tail or that fell off during testing were excluded from analysis. Forced Swim Test—A mouse was placed in a cylinder (inner diameter, 10 cm) filled with water to a height of 10 cm at a temperature of 25 ± 1 °C. The mouse was exposed to swim stress for 6 min. Total duration of immobility was measured using the VideoTrack system. One animal was excluded from analysis because it had a very high fat mass and had difficulties staying afloat. Statistical Analysis—Data were analyzed by one-way analysis of variance or by Kruskal-Wallis analysis of variance on ranks in case data were not normally distributed, followed by post hoc Tukey's test (oneway analysis of variance) or Dunn's method (Kruskal-Wallis analysis of variance on ranks) if appropriate. Lethal Phenotype in bace1 Knockout Mice—Several groups have reported the generation of bace1 knockout mice (9Cai H. Wang Y. McCarthy D. Wen H. Borchelt D.R. Price D.L. Wong P.C. Nat. Neurosci. 2001; 4: 233-234Crossref PubMed Scopus (954) Google Scholar, 10Roberds S.L. Anderson J. Basi G. Bienkowski M.J. Branstetter D.G. Chen K.S. Freedman S.B. Frigon N.L. Games D. Hu K. Johnson-Wood K. Kappenman K.E. Kawabe T.T. Kola I. Kuehn R. Lee M. Liu W. Motter R. Nichols N.F. Power M. Robertson D.W. Schenk D. Schoor M.

Signaling via the epidermal growth factor receptor (EGFR), which has critical roles in development and diseases such as cancer, is regulated by proteolytic shedding of its membrane-tethered ligands. Sheddases for EGFR-ligands are therefore key signaling switches in the EGFR pathway. Here, we determined which ADAMs (a disintegrin and metalloprotease) can shed various EGFR-ligands, and we analyzed the regulation of EGFR-ligand shedding by two commonly used stimuli, phorbol esters and calcium influx. Phorbol esters predominantly activate ADAM17, thereby triggering a burst of shedding of EGFR-ligands from a late secretory pathway compartment. Calcium influx stimulates ADAM10, requiring its cytoplasmic domain. However, calcium influx-stimulated shedding of transforming growth factor alpha and amphiregulin does not require ADAM17, even though ADAM17 is essential for phorbol ester-stimulated shedding of these EGFR-ligands. This study provides new insight into the machinery responsible for EGFR-ligand release and thus EGFR signaling and demonstrates that dysregulated EGFR-ligand shedding may be caused by increased expression of constitutively active sheddases or activation of different sheddases by distinct stimuli.

Abstract Objective: Heterozygous mutations in the GBA1 gene elevate the risk of Parkinson disease and dementia with Lewy bodies; both disorders are characterized by misprocessing of α‐synuclein (SNCA). A loss in lysosomal acid–β‐glucosidase enzyme (GCase) activity due to biallelic GBA1 mutations underlies Gaucher disease. We explored mechanisms for the gene's association with increased synucleinopathy risk. Methods: We analyzed the effects of wild‐type (WT) and several GBA mutants on SNCA in cellular and in vivo models using biochemical and immunohistochemical protocols. Results: We observed that overexpression of all GBA mutants examined (N370S, L444P, D409H, D409V, E235A, and E340A) significantly raised human SNCA levels to 121 to 248% of vector control ( p &lt; 0.029) in neural MES23.5 and PC12 cells, but without altering GCase activity. Overexpression of WT GBA in neural and HEK293‐SNCA cells increased GCase activity, as expected (ie, to 167% in MES‐SNCA, 128% in PC12‐SNCA, and 233% in HEK293‐SNCA; p &lt; 0.002), but had mixed effects on SNCA. Nevertheless, in HEK293‐SNCA cells high GCase activity was associated with SNCA reduction by ≤32% ( p = 0.009). Inhibition of cellular GCase activity (to 8–20% of WT; p &lt; 0.0017) did not detectably alter SNCA levels. Mutant GBA‐induced SNCA accumulation could be pharmacologically reversed in D409V‐expressing PC12‐SNCA cells by rapamycin, an autophagy‐inducer (≤40%; 10μM; p &lt; 0.02). Isofagomine, a GBA chaperone, showed a related trend. In mice expressing two D409V gba knockin alleles without signs of Gaucher disease (residual GCase activity, ≥20%), we recorded an age‐dependent rise of endogenous Snca in hippocampal membranes (125% vs WT at 52 weeks; p = 0.019). In young Gaucher disease mice (V394L gba +/+//prosaposin[ ps ]‐null// ps ‐transgene), which demonstrate neurological dysfunction after age 10 weeks (GCase activity, ≤10%), we recorded no significant change in endogenous Snca levels at 12 weeks of age. However, enhanced neuronal ubiquitin signals and axonal spheroid formation were already present. The latter changes were similar to those seen in three week‐old cathepsin D‐deficient mice. Interpretation: Our results demonstrate that GBA mutants promote SNCA accumulation in a dose‐ and time‐dependent manner, thereby identifying a biochemical link between GBA1 mutation carrier status and increased synucleinopathy risk. In cell culture models, this gain of toxic function effect can be mitigated by rapamycin. Loss in GCase activity did not immediately raise SNCA concentrations, but first led to neuronal ubiquitinopathy and axonal spheroids, a phenotype shared with other lysosomal storage disorders. ANN NEUROL 2011;

Cathepsin D is a ubiquitously expressed lysosomal protease that is involved in proteolytic degradation, cell invasion, and apoptosis. In mice and sheep, cathepsin D deficiency is known to cause a fatal neurodegenerative disease. Here, we report a novel disorder in a child with early blindness and progressive psychomotor disability. Two missense mutations in the CTSD gene, F229I and W383C, were identified and were found to cause markedly reduced proteolytic activity and a diminished amount of cathepsin D in patient fibroblasts. Expression of cathepsin D mutants in cathepsin D−/− mouse fibroblasts revealed disturbed posttranslational processing and intracellular targeting for W383C and diminished maximal enzyme velocity for F229I. The structural effects of cathepsin D mutants were estimated by computer modeling, which suggested larger structural alterations for W383C than for F229I. Our studies broaden the group of human neurodegenerative disorders and add new insight into the cellular functions of human cathepsin D. Cathepsin D is a ubiquitously expressed lysosomal protease that is involved in proteolytic degradation, cell invasion, and apoptosis. In mice and sheep, cathepsin D deficiency is known to cause a fatal neurodegenerative disease. Here, we report a novel disorder in a child with early blindness and progressive psychomotor disability. Two missense mutations in the CTSD gene, F229I and W383C, were identified and were found to cause markedly reduced proteolytic activity and a diminished amount of cathepsin D in patient fibroblasts. Expression of cathepsin D mutants in cathepsin D−/− mouse fibroblasts revealed disturbed posttranslational processing and intracellular targeting for W383C and diminished maximal enzyme velocity for F229I. The structural effects of cathepsin D mutants were estimated by computer modeling, which suggested larger structural alterations for W383C than for F229I. Our studies broaden the group of human neurodegenerative disorders and add new insight into the cellular functions of human cathepsin D. Cathespin D (CatD) belongs to the pepsin family of proteases and is one of the most studied aspartic proteases. It has been implicated in diverse biological processes. CatD promotes invasion and proliferation of cancer cells1Nomura T Katunuma N Involvement of cathepsins in the invasion, metastasis and proliferation of cancer cells.J Med Invest. 2005; 52: 1-9Crossref PubMed Scopus (194) Google Scholar but is also involved in caspase-independent apoptosis.2Broker LE Kruyt FA Giaccone G Cell death independent of caspases: a review.Clin Cancer Res. 2005; 11: 3155-3162Crossref PubMed Scopus (760) Google Scholar, 3Liaudet-Coopman E Beaujouin M Derocq D Garcia M Glondu-Lassis M Laurent-Matha V Prebois C Rochefort H Vignon F Cathepsin D: newly discovered functions of a long-standing aspartic protease in cancer and apoptosis.Cancer Lett. 2005; (electronically published July 18, 2005; accessed February 24, 2006)(http://www.sciencedirect.com/science/journal/03043835)PubMed Google Scholar Increased concentrations of CatD are found during ischemic, inflammatory, and regenerative processes, such as coronary heart disease,4Vivanco F Martin-Ventura JL Duran MC Barderas MG Blanco-Colio L Darde VM Mas S Meilhac O Michel JB Tunon J Egido J Quest for novel cardiovascular biomarkers by proteomic analysis.J Proteome Res. 2005; 4: 1181-1191Crossref PubMed Scopus (77) Google Scholar inflammatory bowel disease,5Hausmann M Obermeier F Schreiter K Spottl T Falk W Scholmerich J Herfarth H Saftig P Rogler G Cathepsin D is up-regulated in inflammatory bowel disease macrophages.Clin Exp Immunol. 2004; 136: 157-167Crossref PubMed Scopus (39) Google Scholar wound healing, and epidermal differentiation.6Egberts F Heinrich M Jensen JM Winoto-Morbach S Pfeiffer S Wickel M Schunck M Steude J Saftig P Proksch E Schutze S Cathepsin D is involved in the regulation of transglutaminase 1 and epidermal differentiation.J Cell Sci. 2004; 117: 2295-2307Crossref PubMed Scopus (100) Google Scholar CatD is a major component of lysosomes and functions as a highly active endopeptidase with an optimum pH between 3.0 and 5.0. CatD preferentially cleaves peptide bonds that are flanked by bulky hydrophobic amino acids and is strongly inhibited by pepstatin A (inhibition constant Ki=1–4 nM). Human CatD is synthesized and translocated into the endoplasmic reticulum (ER) as an inactive precursor proenzyme (53 kDa), processed into an enzymatically active, intermediate proenzyme (48 kDa), and finally converted in the lysosomal compartment into a noncovalently associated two-chain form with an N-terminal 15-kDa light chain and a C-terminal 33-kDa heavy chain.7Horst M Hasilik A Expression and maturation of human cathepsin D in baby-hamster kidney cells.Biochem J. 1991; 273: 355-361Crossref PubMed Scopus (24) Google Scholar, 8Baldwin ET Bhat TN Gulnik S Hosur MV Sowder 2nd, RC Cachau RE Collins J Silva AM Erickson JW Crystal structures of native and inhibited forms of human cathepsin D: implications for lysosomal targeting and drug design.Proc Natl Acad Sci USA. 1993; 90: 6796-6800Crossref PubMed Scopus (247) Google Scholar Targeted disruption of the Ctsd gene in mice leads to weight loss in the 3rd wk of life that is associated with progressive atrophy of the intestinal mucosa. Massive intestinal necrosis and profound destruction of lymphocytes in the spleen and thymus are found just before the mice die in a state of anorexia at age 4 wk.9Saftig P Hetman M Schmahl W Weber K Heine L Mossmann H Koster A Hess B Evers M von Figura K Peters C Mice deficient for the lysosomal proteinase cathepsin D exhibit progressive atrophy of the intestinal mucosa and profound destruction of lymphoid cells.EMBO J. 1995; 14: 3599-3608Crossref PubMed Scopus (344) Google Scholar In addition, CatD-deficient mice develop seizures and progressive retinal atrophy, which leads to blindness. Lysosomal storage of an autofluorescent material, ceroid lipofuscin, is found in neurons.10Koike M Nakanishi H Saftig P Ezaki J Isahara K Ohsawa Y Schulz-Schaeffer W Watanabe T Waguri S Kametaka S Shibata M Yamamoto K Kominami E Peters C von Figura K Uchiyama Y Cathepsin D deficiency induces lysosomal storage with ceroid lipofuscin in mouse CNS neurons.J Neurosci. 2000; 20: 6898-6906Crossref PubMed Google Scholar Inactivation of the Drosophila CatD homologue causes age-dependent neurodegeneration and also progressive neuronal accumulation of autofluorescent storage material.11Myllykangas L Tyynela J Page-McCaw A Rubin GM Haltia MJ Feany MB Cathepsin D-deficient Drosophila recapitulate the key features of neuronal ceroid lipofuscinoses.Neurobiol Dis. 2005; 19: 194-199Crossref PubMed Scopus (70) Google Scholar In sheep, a naturally occurring missense mutation in the active-site aspartate (D293N) of ovine Ctsd results in early neurodegeneration. Because of the autofluorescent neuronal storage material, the disease was subsequently named “congenital ovine neuronal ceroid lipofuscinosis” (CONCL [MIM *116840]).12Tyynela J Sohar I Sleat DE Gin RM Donnelly RJ Baumann M Haltia M Lobel P A mutation in the ovine cathepsin D gene causes a congenital lysosomal storage disease with profound neurodegeneration.EMBO J. 2000; 19: 2786-2792Crossref PubMed Scopus (196) Google Scholar Recently, a second natural animal model of CatD insufficiency was discovered in American bulldogs.13Awano T Katz ML O’Brien DP Taylor JF Evans J Khan S Sohar I Lobel P Johnson GS A mutation in the cathepsin D gene (CTSD) in American bulldogs with neuronal ceroid lipofuscinosis.Mol Genet Metab. 2005; (electronically published December 28, 2005; accessed February 24, 2006)(http://www.sciencedirect.com/science/journal/10967192)Google Scholar Affected dogs had 36% of the CatD-specific enzymatic activity found in control dogs, and they presented with a milder phenotype than CatD-deficient mice and sheep. Similar to these animal models, all currently known human neuronal ceroid lipofuscinosis (NCL) forms are characterized by developmental regression, visual loss, and epilepsy in addition to the name-giving accumulation of autofluorescent lysosomal storage material. At present, six different disease genes have been identified for human NCL: CLN1, CLN2, CLN3, CLN5, CLN6, and CLN8.14Hofmann SL Peltonen L The neuronal ceroid lipofuscinoses.in: Scriver CR Beaudet AL Sly WS Valle D The metabolic and molecular bases of inherited disease. 8th ed. McGraw-Hill, New York2001: 3877-3894Google Scholar, 15Mole SE The genetic spectrum of human neuronal ceroid-lipofuscinoses.Brain Pathol. 2004; 14: 70-76Crossref PubMed Scopus (77) Google Scholar We screened a group of 25 infants and children with a nonidentified genetic cause of an NCL-like disorder and found the first case of human CatD deficiency. We determined the molecular mechanisms and functional consequences of two missense mutations in the human CTSD gene, and, in doing so, have extended our understanding of the biological functions of human CatD. Cell culture medium (Dulbecco's modified Eagle medium [DMEM]), zeocin, hygromycin, Lipofectamin 2000, and Taq DNA polymerase were purchased from Invitrogen. Oligonucleotides were synthesized by MWG-Biotech. For amplification of genomic DNA fragments of CTSD, the primer combination hCDgDNA6960F (5′-GTGTAAACCGAGCCCTGATGACTT-3′) and hCDgDNA7525R (5′-CAGCAGCAGGGAGGGGGCAGCACT-3′) and the primer combination hCDgDNA10788F (5′-GGGGAGCCCCAAGGCCACCACTA-3′) and hCDgDNA11224R (5′-CTCGGCGAAGCCCACCCTGTTGTT-3′) were used. For amplification of the CTSD cDNA fragments, the primer combination hCDcDNA526F (5′-CGTGAAGAATGGTACCTCGTTTGA-3′) and hCDcDNA1319R (5′-CAGTGTAGTAGCGGCCGATGAAGAC-3′) was used. [α-32P]dCTP, [35S]methionine, and molecular-weight protein markers were obtained from Amersham Biosciences. Restriction enzymes were supplied by New England BioLabs. Goat anti-human CatD antibody and rabbit anti-mouse CatD antibody were a generous gift from Professor Kurt von Figura (University of Göttingen). Rat anti-mouse lysosomal-associated membrane protein 1 (LAMP-1) antibody was acquired from the Developmental Studies Hybridoma Bank (University of Iowa, Iowa City). Biotin SP–conjugated donkey anti-goat antibody, peroxidase-conjugated donkey anti-goat antibody, and peroxidase-conjugated streptavidin were purchased from Jackson ImmunoResearch Lab. For western blotting, peroxidase staining was done with tetramethyl benzidine (TMB) substrate (Seramun). Alexa Fluor 488 donkey anti-goat antibody and Alexa Fluor 546 goat anti-mouse and goat anti-rat antibodies were obtained from Molecular Probes. The BigDye terminator kit was used for semiautomated sequencing, in accordance with the recommendations of the manufacturer (Perkin Elmer Applied Biosystems). RNA was isolated from patient fibroblasts with the RNeasy kit as described by the manufacturer (Qiagen). Total RNA was fractionated by agarose-formaldehyde gel electrophoresis, the gel was blotted onto a Hybond-XL membrane (Amersham Biosciences), and the northern blot was hybridized in accordance with standard procedures by use of the Nick Translation System (Invitrogen) and the QuickHyb hybridization solution (Stratagene). The hybridization of RNA was performed with two independent control RNAs that showed very similar CatD expression. For cDNA synthesis, the Superscript III First-Strand Synthesis System (Invitrogen) was used. The substrate MOCAc-GKPIIFFRLK(Dnp)-R-NH2 was obtained from Calbiochem. All other reagents were purchased from Sigma-Aldrich. A patient with two heterozygous mutations in CTSD was identified from a total of 25 pediatric patients showing symptoms of an unidentified, NCL-like neurodegenerative disease including motor and visual disturbances. This group of patients was screened for possible NCL diseases. In patient fibroblasts, activities for palmitoyl protein thioesterase 1 and tripeptidyl peptidase 1 were normal, whereas CatD activity was clearly reduced. Sequencing the coding regions of CTSD resulted in the identification of the missense mutations g.6517T→A and g.10267G→C, whereas no pathogenic base alterations were revealed in the CLN3, CLN5, CLN6, and CLN8 genes. After a normal early psychomotor development, the patient first showed neurodegenerative symptoms—in particular, ataxia and visual disturbances—at early-school age. The ocular fundus was found to show retinitis pigmentosa, and cranial magnetic resonance imaging (MRI) scans revealed cerebral and cerebellar atrophy. In the course of disease, she developed progressive cognitive decline, loss of speech, retinal atrophy, and loss of motor functions. Now, at age 17 years, she is wheel-chair bound and severely mentally retarded. Until now, there has been no evidence of hematological disease, immunodeficiency, intestinal abnormalities, or dystrophia. In fact, because of immobilization, the patient has become overweight during the past few years. CTSD cDNA was received from the IMAGE consortium (RZPD clone ID IRAUp969A1048D6) and was cloned into the expression vectors pcDNA3.1/Zeo and pEF5/FRT/V5-D-TOPO (Invitrogen). Site-directed mutagenesis was performed using a QuickChange site-directed mutagenesis kit (Stratagene), in accordance with the supplier’s protocol. All final constructs were verified by semiautomated sequencing. CatD−/− mouse fibroblasts and Flp-In 3T3 cells were seeded on 35-mm plates at a density of 2×105 cells/well in DMEM supplemented with fetal calf serum (FCS) at 37°C and 5% CO2. After 24 h of culturing, the cells were transfected with 2 μg of plasmid and 5 μl of Lipofectamin 2000 in 0.5 ml of Opti-MEM. The medium was replaced with DMEM supplemented with FCS after 6 h of incubation. Selection with zeocin or hygromycin was started 48 h after transfection, and stable clones were achieved after 14 d of selection. Cellular homogenates from individual clones were assayed for CatD activity by use of the substrate MOCAc-GKPIIFFRLK(Dnp)-R-NH2, as described elsewhere.16Yasuda Y Kageyama T Akamine A Shibata M Kominami E Uchiyama Y Yamamoto K Characterization of new fluorogenic substrates for the rapid and sensitive assay of cathepsin E and cathepsin D.J Biochem (Tokyo). 1999; 125 (erratum 126:260): 1137-1143Crossref PubMed Scopus (129) Google Scholar Alternatively, cell lysates were analyzed by western blotting with anti-human CatD antibody. The western-blotting experiments (fig. 1B and 1C) were repeated twice and led to very similar results. For kinetic studies, 0.5 μg of cellular lysates were incubated with 1.3, 2, 3.3, 6.7, 10, 13.3, 23.3, 33.3, and 45 μM of substrate MOCAc-GKPIIFFRLK(Dnp)-R-NH2. Reaction velocities were measured at defined time intervals with a microplate reader (Synergy HT [BIO-TEK Instruments]). Linear phase velocities were plotted against the substrate concentrations; Km and Vmax were calculated by nonlinear regression using the equation V=Vmax×[S]/(Km+[S]), where V is linear phase velocity, Vmax is maximal enzyme velocity, [S] is the substrate concentration, and Km is the Michaelis-Menten constant. Data obtained from one of two independent experiments were measured in triplicate, and the means and SDs were plotted. CatD−/− mouse fibroblasts stably transfected with vector, wild-type CatD, and F229I or W383C mutant CatD were grown to 70% confluence and then were washed twice with methionine-free DMEM (Invitrogen); were incubated at 37°C for 1 h in the same medium, with or without proteinase inhibitor E64 (18 μM) and leupeptin (10 μM); and then were incubated again for 30 min in the same medium supplemented with 100 μCi/ml [35S]Met (Amersham Biosciences). The radioactive medium was removed. Cells were washed twice with Hank’s balanced salt solution and were chased in DMEM supplemented with FCS with or without proteinase inhibitor E64 (18 μM) and leupeptin (10 μM). At 30 min and 4 h, cells were washed three times with cold PBS and were solubilized in cold Tris-buffered saline with 0.1% TX-100 and a protease inhibitor cocktail. After precipitation of DNA with protaminsulfate (0.3 mg/ml), the supernatant was adapted to an immunoprecipitation buffer containing 150 mM NaCl, 10 mM NaH2PO4/K2HPO4 (pH 7.4), 0.5% Triton-X 100, 0.3% sodium deoxycholate, 0.2% SDS, 1% BSA, and proteinase inhibitor mix (Sigma-Aldrich). The supernatants were centrifuged at 13,000 g for 10 min and were incubated for 4 h with 1/10 volume of preimmune serum and Pansorbin cells (Calbiochem). The suspension was centrifuged at 20,000 g for 15 min, and the supernatant was incubated overnight with 1/20 volume of goat anti-human CatD antibody and with 1/2 volume of washed Pansorbin cells. The suspension was centrifuged again and washed three times with immunoprecipitation buffer. The proteins bound to the anti-CatD antibody were separated from Pansorbin cells by boiling in sample buffer containing 60 mM Tris (pH 6.8), 25% glycerol, 2% SDS, 14 mM 2-mercaptoethanol, and 0.1% bromphenol blue. The denatured proteins were subjected to SDS-PAGE by use of the Laemmli method. The gels were fixed in an aqueous solution of 10% acetic acid and 50% methanol, were soaked for 30 min in Amplify solution (Amersham Biosciences), were vacuum-dried at 60°C, and were analyzed by quantitative radioactive imaging. The pulse chase was performed four times; displayed is one representative experiment (fig. 1D). A skin biopsy specimen from the patient was taken from the axilla and was immediately fixed in 2.5% glutaraldehyde and postfixed in buffered 1% osmium tetroxide for 1 h. After two 5-min rinses in PBS, the nerve segments were dehydrated in graded concentrations of alcohol (50%, 70%, 80%, 96%, and 100%), were incubated twice for 20 min in propylene oxide, and were embedded in Araldite. Semithin sections (1 μm) were stained with toluidine blue. Thin sections, contrasted with uranylacetate and lead citrate, were examined with a Zeiss EM 10B electron microscope. Patient lymphocytes were purified from whole blood by use of Ficoll separation, were fixed in 2.5% glutaraldehyde, and then were processed as described for the skin biopsy. A total of 250 lymphocytes were examined for intracellular inclusions. Flp-In 3T3 cells and CatD−/− mouse fibroblasts stably expressing wild-type or mutant CatD were grown on coverslips to 80% confluence. The cells were washed twice with PBS and were fixed with 3% paraformaldehyde in PBS for 20 min at 37°C. Cells were washed again four times with PBS and then were permeabilized and blocked with 5 mg/ml saponin in PBS for 1 h at room temperature. Subsequently, the permeabilized cells were incubated with primary antibodies, goat anti-human CatD antibody, and rabbit anti-mouse CatD or rat anti-mouse LAMP-1 antibody for 2 h at a dilution of 1:200 in PBS containing 1 mg/ml saponin. After three washes with PBS, cells were incubated with the appropriate secondary antibodies conjugated with Alexa Fluor 488 or 546 for 1 h in the dark. Flp-In 3T3 cells were costained with anti-human CatD antibody and anti-mouse CatD antibody, and CatD−/− mouse fibroblasts were costained with anti-human CatD antibody and anti-mouse LAMP-1 antibody. Finally, coverslips were mounted on object glasses with Fluoromount medium (Polysciences). The fluorescence was viewed using a Leica NTSC laser confocal microscope (Leica) in sequential scan mode. At least 50 cells per coverslip were examined under the microscope, and representative cells were photographed. The transfection and staining experiments with the Flp-In 3T3 cells and those with the CatD−/− mouse fibroblasts gave similar results; the expression level was only slightly higher in the CatD−/− mouse fibroblasts. Amino acid sequences from members of the pepsin family of peptidases were retrieved from the MEROPS database and were aligned using the program CLUSTALW with the protein weight matrix GONNET. The crystal structure of CatD (Protein Data Bank ID 1LYA)8Baldwin ET Bhat TN Gulnik S Hosur MV Sowder 2nd, RC Cachau RE Collins J Silva AM Erickson JW Crystal structures of native and inhibited forms of human cathepsin D: implications for lysosomal targeting and drug design.Proc Natl Acad Sci USA. 1993; 90: 6796-6800Crossref PubMed Scopus (247) Google Scholar was used as a template for modeling of the described variants. Model building was done with Swiss-PdbViewer,17Guex N Peitsch MC SWISS-MODEL and the Swiss-PdbViewer: an environment for comparative protein modeling.Electrophoresis. 1997; 18: 2714-2723Crossref PubMed Scopus (9113) Google Scholar version 3.7. Energy minimizations and initial molecular dynamics simulations were performed using the AMBER 8 package.18Case DA Cheatham 3rd, TE Darden T Gohlke H Luo R Merz Jr, KM Onufriev A Simmerling C Wang B Woods RJ The Amber biomolecular simulation programs.J Comput Chem. 2005; 26: 1668-1688Crossref PubMed Scopus (5627) Google Scholar Molecular dynamics were calculated at 300 K with explicit solvent for up to 1.9 ns until the root mean SDs of coordinates remained constant. Images were created using the program PyMOL,19DeLano WL The PyMOL molecular graphics system. DeLano Scientific, San Carlos, CA2002Google Scholar version 0.98. In a group of 25 infants and childs with an unidentified, NCL-like neurodegenerative phenotype, we identified a child with two mutations (g.6517T→A and g.10267G→C) in exons 5 and 9 of the CTSD gene (fig. 2). The first mutation results in the amino acid substitution F229I of the CatD precursor proenzyme (which corresponds to F165I of the mature CatD); the second mutation causes the amino acid replacement W383C (which corresponds to W319C of the mature CatD). Mutational analyses of the parents showed that mutation F229I was derived from the mother, and mutation W383C from the father. No further genetic alterations were detected in the CTSD coding sequences of the affected child and her parents. DNA analyses of 110 controls revealed neither of the two mutations. Alignment of mature human CatD with other active peptidases from humans (pepsin A and renin), fungi (saccharopepsin, mucorpepsin, and oryzepsin), sporozoa (plasmepsin), and plants (CDR1 g.p.) demonstrated highly conserved regions within the pepsin family of peptidases (fig. 3). The residue F229 (F183 in fig. 3) belongs to a group of 15 aa (of the total 389 aa positions displayed in fig. 3) that are strictly conserved among the members of this protein family. In contrast, residue W383 (W358 in fig. 3) is conserved among all 12 human pepsin peptidases and nearly all other mammalian members of this family but is not conserved within pepsin peptidases from more distantly related species. Ultrastructural examination of the skin biopsy material from the patient revealed pathological inclusions in nonmyelinated Schwann cells. Within the cytoplasm of these Schwann cells, two main types of pathological inclusions were found—namely, granular osmiophilic-like deposits and myelin-like lamellar structures (fig. 4). In comparison with the granular deposits found in patients with infantile NCL (CLN1 defect), these granular inclusions appear more heterogeneously and are less abundant within cells. The indicated myelin-like lamellar structures are less specific for NCL diseases because these inclusions are also found in other storage diseases, such as the mucopolysaccharidoses. Inclusions were not detected in patient endothelial cells, fibroblasts, and sweat glands. In addition, no storage material was identified in peripheral lymphocytes. Northern-blot analysis of patient RNA revealed levels of CatD-specific transcription similar to those in a control sample (fig. 1A). In contrast, western-blot analyses of fibroblast cell lysates from the patient showed a markedly decreased intensity of the 33-kDa band of mature human CatD (fig. 1B). The enzymatic activity measured with a fluorogenic substrate in the patient fibroblasts was decreased to 6.7% of the mean activity of 24 controls (data not shown). To investigate the functional consequences of mutant CatD, we cloned the cDNAs of wild-type, mutant F229I, and mutant W383C CatD in expression vectors and stably expressed all three in CatD−/− mouse fibroblasts. Western-blot analyses of cell lysates from transfected cells disclosed a reduction (F229I) or absence (W383C) of mature CatD (fig. 1C). The reduced intensities of mature CatD indicate differences in processing of mutant CatD. Therefore, we metabolically labeled cells with radioactive methionine for 30 min and performed pulse-chase experiments. After the medium was exchanged with a nonradioactive one, wild-type CatD as well as mutants F229I and W383C were harvested after chase times of 30 min and 4 h, respectively. Wild-type and mutant CatD were immunoprecipitated from homogenates of transfected cells with anti-human CatD antibodies. The intensity of the 53-kDa precursor proenzyme CatD signal decreased with the length of chase time (fig. 1D). After 4 h of chase, all wild-type precursor CatD was processed to the 33-kDa heavy chain of mature CatD, ∼96% of mutant F229I precursor, but only ∼7% of mutant W383C precursor. The addition of inhibitors of thiol and serine proteases (E64 and leupeptin) resulted in increased intensity of the 53-kDa precursor and slightly decreased intensity of the 33-kDa form. The data thus indicate that the maturation of mutant F229I is slightly delayed, whereas the processing of mutant W383C is severely disturbed. Furthermore, they suggest that the stability of the mature 33-kDa CatD protein is not dependent on thiol or serine proteases. The kinetic properties of CatD were determined for patient and control fibroblasts as well as for CatD−/− mouse fibroblasts transfected with wild-type CatD, F229I and W383C mutant CatD, and the vector. Increasing concentrations of the fluorogenic substrate MOCAc-GKPIIFFRLK(Dnp)-R-NH2 were incubated with equal amounts of cell lysates derived from the fibroblasts. The measured reaction velocity was plotted in relation to the concentration of substrate; Km and Vmax were determined by nonlinear curve fitting (fig. 5). The Km value for patient fibroblast lysates was comparable to that of control lysates; however, Vmax for patient lysates was only 7.7% of that measured for control lysates (fig. 5A). Lysates derived from CatD−/− mouse fibroblasts transfected with wild-type CatD or mutant F229I had comparable Km values as well, but Vmax for mutant F229I was only 26% of that for wild-type CatD (fig. 5B). For mutant W383C, only negligible substrate turnover could be detected, and the estimated Vmax was 0.3% of that for wild-type CatD. No substrate cleavage was detected for vector-transfected CatD−/− mouse fibroblasts (data not shown). Since both missense mutations were associated with a significant decrease in enzymatic activity, we compared intracellular trafficking of these human CatD mutants with endogenous mouse CatD. We transfected 3T3 fibroblasts with the cDNA of wild-type CatD, of mutant F229I, and of mutant W383C. Single stable integration of the expression cassettes was achieved using Flp-In technology (Invitrogen). Human and mouse CatD were immunolabeled with specific antibodies and were double-stained with different secondary antibodies (fig. 6). We observed colocalization of anti-human CatD immunostaining with the anti-mouse CatD immunoreactivity in the wild-type CatD and the F229I mutant. However, the W383C mutant showed a distinct staining pattern. Only a small amount of mutant protein colocalized with mouse CatD, whereas most of the protein was detected in nonlysosomal compartments, in particular within the ER (fig. 6). Corresponding experiments were performed with CatD−/− fibroblasts transfected with wild-type or mutant CatD. In this case, double-labeling was done with anti-CatD antibody and anti–LAMP-2 antibody. These studies confirmed the results obtained with transfected 3T3 fibroblasts, showing lysosomal targeting of mutant F229I but almost complete missorting of mutant W383C (fig. 6; data shown only for mutant W383C). We report, for the first time, that human CatD deficiency is responsible for an autosomal recessive neurodegenerative disease that can manifest in early childhood. We elucidated the underlying pathogenetic mechanisms leading to functional loss of CatD. We studied protein stability, posttranslational processing, enzymatic activity, and intracellular trafficking of mutant CatD in heterologous expression systems. CatD belongs to the pepsin family of peptidases that presently comprises 442 known members from various species. The strict conservation of F229 (F183 in fig. 3) underlines the crucial role of this residue in protease function. Although residue W383 (W358 in fig. 3) is only conserved among human and mammalian pepsin peptidases, it also must have a central role in CatD function, because mutant W383C leads to disturbed posttranslational processing, intracellular mistargeting, and complete loss of proteolytic activity. The results obtained by kinetic analyses of the human CatD mutants were consistent with and complementary to our findings from western blotting and pulse-chase experiments. Almost none of the 53-kDa precursor proenzyme of mutant W383C was processed to the mature 33-kDa peptidase, and hardly any enzymatic activity was detectable (fig. 1C and 1D). In contrast, mutant F229I was correctly processed, although with some delay, to an active peptidase. However, for mutant F229I, the maximal enzyme velocity, Vmax, was only 26% the amount for wild-type CatD (fig. 5B). Since Vmax=kcat×[E]total (where kcat is the catalytic rate and [E]total is the total enzyme concentration), a smaller catalytic rate as well as a diminished concentration of active enzyme may contribute to a decreased Vmax. The substantially lower relative Vmax (7.7% of control) for the patient fibroblasts can be explained by the more profoundly reduced concentration of active enzyme (figs. 1B and 5A). The second patient allele, W383C, had no significant residual enzymatic activity. These findings were extended by experiments to investigate the subcellular localization of human wild-type and mutant CatD. Heterologous expression of human wild-type CatD, F229I mutant, and W383C mutant demonstrated colocalization with mouse CatD for the wild-type and F229I mutant CatD but major mistargeting for the W383C mutant. Together with the results obtained from western blotting, pulse-chase experiments, and kinetic studies, these data indicate a partial loss of function for mutant F229I but an almost complete loss of function for mutant W383C. To further explain our experimental results, we predicted the conformational effects of F229I and W383C mutations on wild-type CatD by computer modeling based on the published x-ray structure of CatD8Baldwin ET Bhat TN Gulnik S Hosur MV Sowder 2nd, RC Cachau RE Collins J Silva AM Erickson JW Crystal structures of native and inhibited forms of human cathepsin D: implications for lysosomal targeting and drug design.Proc Natl Acad Sci USA. 1993; 90: 6796-6800Crossref PubMed Scopus (247) Google Scholar (fig. 7). Preliminary molecular dynamics modeling suggested larger structural alterations for the W383C mutant than for the F229I mutant when compared with the wild-type CatD structure (fig. 7B). The first 11 N-terminal aa of mature CatD were shown to play a key role in pH-dependent enzymatic activation of CatD.20Lee AY Gulnik SV Erickson JW Conformational switching in an aspartic proteinase.Nat Struct Biol. 1998; 5: 866-871Crossref PubMed Scopus (94) Google Scholar In the active form of CatD, these amino acids build the first strand of the interdomain β-sheet. For neutral pH values, a translocation of this strand inserting into the active-site cleft is reported. Since F229 is located in the third strand of the interdomain β-sheet, the reduced enzymatic activity of mutant F229I might be explained by conformational destabilization of the interdomain β-sheet (fig. 7A). In addition to spatial changes, the mutation W383C may induce an alternative disulfide bond formation because it is in close proximity to residue C290, which forms a disulfide bond with C286. Several animal models indicate that CatD deficiency leads to fatal neurodegeneration. CatD-deficient mice and sheep exhibit cerebral atrophy and show neuronal accumulation of autofluorescent storage material—mainly granular osmiophilic deposits.10Koike M Nakanishi H Saftig P Ezaki J Isahara K Ohsawa Y Schulz-Schaeffer W Watanabe T Waguri S Kametaka S Shibata M Yamamoto K Kominami E Peters C von Figura K Uchiyama Y Cathepsin D deficiency induces lysosomal storage with ceroid lipofuscin in mouse CNS neurons.J Neurosci. 2000; 20: 6898-6906Crossref PubMed Google Scholar, 12Tyynela J Sohar I Sleat DE Gin RM Donnelly RJ Baumann M Haltia M Lobel P A mutation in the ovine cathepsin D gene causes a congenital lysosomal storage disease with profound neurodegeneration.EMBO J. 2000; 19: 2786-2792Crossref PubMed Scopus (196) Google Scholar Our findings are in agreement with these observations. The CatD-deficient patient described here has similar granular deposits in Schwann cells derived from skin biopsy material and shows cerebral and cerebellar atrophy on cranial MRI scans. However, whereas CatD-deficient mice and sheep die very early in the course of disease, this patient presents a slower progress of disease, as does the recently described bulldogs homozygous for the missense mutation M199I.13Awano T Katz ML O’Brien DP Taylor JF Evans J Khan S Sohar I Lobel P Johnson GS A mutation in the cathepsin D gene (CTSD) in American bulldogs with neuronal ceroid lipofuscinosis.Mol Genet Metab. 2005; (electronically published December 28, 2005; accessed February 24, 2006)(http://www.sciencedirect.com/science/journal/10967192)Google Scholar This might be because of significant residual enzymatic activities measured for human mutant F229I, as well as canine mutant M199I, versus a complete loss of CatD function in mice and sheep. Therefore, one may speculate about the more severe clinical phenotypes of human CatD deficiency that would be caused by a complete loss of CatD function. The level of residual proteolytic activity in distinct CatD mutants is likely to determine the clinical phenotype of this neurodegenerative disease. In summary, mutations in the human CTSD gene are associated with a novel autosomal recessive disorder, CatD-deficient NCL. CatD has comparable functions in humans and other mammals and seems to play a key role in the homeostasis of neuronal structures. However, the variation in phenotypic presentation of CatD deficiency between mice, sheep, dogs, and humans points to additional species-specific differences in CatD function and thus disease mechanism. The study of other cases of this novel human neurodegenerative disease will further elucidate the pathology in CatD-related neurodegeneration and will promote attempts to design therapeutic strategies for this devastating group of disorders. We thank K. von Figura (University of Göttingen) and T. Dierks (University of Bielefeld) for the cathepsin D antibodies. We are grateful to Dirk Isbrandt (Centre of Molecular Neurobiology Hamburg), Jozsef Dudas (Department of Gastroenterology and Endocrinology, University of Göttingen), and A. Hasilik (University of Marburg) for their support. We thank T. Wilke, E. Krämer, and S. Hagen for their technical assistance. We are thankful to R. Schuh and H. Jäckle (Max-Planck-Institute for Biophysical Chemistry) for the use of the confocal microscope.

Cathepsin K was originally identified as an osteoclast-specific lysosomal protease, the inhibitor of which has been considered might have therapeutic potential. We show that inhibition of cathepsin K could potently suppress autoimmune inflammation of the joints as well as osteoclastic bone resorption in autoimmune arthritis. Furthermore, cathepsin K –/– mice were resistant to experimental autoimmune encephalomyelitis. Pharmacological inhibition or targeted disruption of cathepsin K resulted in defective Toll-like receptor 9 signaling in dendritic cells in response to unmethylated CpG DNA, which in turn led to attenuated induction of T helper 17 cells, without affecting the antigen-presenting ability of dendritic cells. These results suggest that cathepsin K plays an important role in the immune system and may serve as a valid therapeutic target in autoimmune diseases.

Vascular endothelial (VE)-cadherin is the major adhesion molecule of endothelial adherens junctions. It plays an essential role in controlling endothelial permeability, vascular integrity, leukocyte transmigration, and angiogenesis. Elevated levels of soluble VE-cadherin are associated with diseases like coronary atherosclerosis. Previous data showed that the extracellular domain of VE-cadherin is released by an unknown metalloprotease activity during apoptosis. In this study, we used gain-of-function analyses, inhibitor studies, and RNA interference experiments to analyze the proteolytic release of VE-cadherin in human umbilical vein endothelial cells (HUVECs). We found that VE-cadherin is specifically cleaved by the disintegrin and metalloprotease ADAM10 in its ectodomain, releasing a soluble fragment and generating a carboxyl-terminal membrane-bound stub, which is a substrate for a subsequent γ-secretase cleavage. This ADAM10-mediated proteolysis could be induced by Ca 2+ influx and staurosporine treatment, indicating that ADAM10-mediated VE-cadherin cleavage contributes to the dissolution of adherens junctions during endothelial cell activation and apoptosis, respectively. In contrast, protein kinase C activation or inhibition did not modulate VE-cadherin processing. Increased ADAM10 expression was functionally associated with an increase in endothelial permeability. Remarkably, our data indicate that ADAM10 activity also contributes to the thrombin-induced decrease of endothelial cell–cell adhesion. Moreover, knockdown of ADAM10 in HUVECs as well as in T cells by small interfering RNA impaired T-cell transmigration. Taken together, our data identify ADAM10 as a novel regulator of vascular permeability and demonstrate a hitherto unknown function of ADAM10 in the regulation of VE-cadherin–dependent endothelial cell functions and leukocyte transendothelial migration.

Proteolytic ectodomain release, a process known as “shedding”, has been recognised as a key mechanism for regulating the function of a diversity of cell surface proteins. A Disintegrin And Metalloproteinases (ADAMs) have emerged as the major proteinase family that mediates ectodomain shedding. Dysregulation of ectodomain shedding is associated with autoimmune and cardiovascular diseases, neurodegeneration, infection, inflammation and cancer. Therefore, ADAMs are increasingly regarded as attractive targets for novel therapies. ADAM10 and its close relative ADAM17 (TNF-alpha converting enzyme (TACE)) have been studied in particular in the context of ectodomain shedding and have been demonstrated as key molecules in most of the shedding events characterised to date. Whereas the level of expression of ADAM10 may be of importance in cancer and neurodegenerative disorders, ADAM17 mainly coordinates pro- and anti-inflammatory activities during immune response. Despite the high therapeutical potential of ADAM inhibition, all clinical trials using broad-spectrum metalloprotease inhibitors have failed so far. This review will cover the emerging roles of both ADAM10 and ADAM17 in the regulation of major physiological and developmental pathways and will discuss the suitability of specifically modulating the activities of both proteases as a feasible way to inhibit inflammatory states, cancer and neurodegeneration.

The protease a disintegrin and metalloprotease (ADAM) 17 cleaves tumor necrosis factor (TNF), L-selectin, and epidermal growth factor receptor (EGF-R) ligands from the plasma membrane. ADAM17 is expressed in most tissues and is up-regulated during inflammation and cancer. ADAM17-deficient mice are not viable. Conditional ADAM17 knockout models demonstrated proinflammatory activities of ADAM17 in septic shock via shedding of TNF. We used a novel gene targeting strategy to generate mice with dramatically reduced ADAM17 levels in all tissues. The resulting mice called ADAM17(ex/ex) were viable, showed compromised shedding of ADAM17 substrates from the cell surface, and developed eye, heart, and skin defects as a consequence of impaired EGF-R signaling caused by failure of shedding of EGF-R ligands. Unexpectedly, although the intestine of unchallenged homozygous ADAM17(ex/ex) mice was normal, ADAM17(ex/ex) mice showed substantially increased susceptibility to inflammation in dextran sulfate sodium colitis. This was a result of impaired shedding of EGF-R ligands resulting in failure to phosphorylate STAT3 via the EGF-R and, consequently, in defective regeneration of epithelial cells and breakdown of the intestinal barrier. Besides regulating the systemic availability of the proinflammatory cytokine TNF, our results demonstrate that ADAM17 is needed for vital regenerative activities during the immune response. Thus, our mouse model will help investigate ADAM17 as a potential drug target.

Lassa virus spreads from a rodent to humans and can lead to lethal hemorrhagic fever. Despite its broad tropism, chicken cells were reported 30 years ago to resist infection. We found that Lassa virus readily engaged its cell-surface receptor α-dystroglycan in avian cells, but virus entry in susceptible species involved a pH-dependent switch to an intracellular receptor, the lysosome-resident protein LAMP1. Iterative haploid screens revealed that the sialyltransferase ST3GAL4 was required for the interaction of the virus glycoprotein with LAMP1. A single glycosylated residue in LAMP1, present in susceptible species but absent in birds, was essential for interaction with the Lassa virus envelope protein and subsequent infection. The resistance of Lamp1-deficient mice to Lassa virus highlights the relevance of this receptor switch in vivo.

Mechanical tension is an ever-present physiological stimulus essential for the development and homeostasis of locomotory, cardiovascular, respiratory, and urogenital systems [1Eyckmans J. Boudou T. Yu X. Chen C.S. A hitchhiker’s guide to mechanobiology.Dev. Cell. 2011; 21: 35-47Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar, 2Discher D.E. Janmey P. Wang Y.L. Tissue cells feel and respond to the stiffness of their substrate.Science. 2005; 310: 1139-1143Crossref PubMed Scopus (4806) Google Scholar]. Tension sensing contributes to stem cell differentiation, immune cell recruitment, and tumorigenesis [3Hoffman B.D. Grashoff C. Schwartz M.A. Dynamic molecular processes mediate cellular mechanotransduction.Nature. 2011; 475: 316-323Crossref PubMed Scopus (677) Google Scholar, 4Alon R. Dustin M.L. Force as a facilitator of integrin conformational changes during leukocyte arrest on blood vessels and antigen-presenting cells.Immunity. 2007; 26: 17-27Abstract Full Text Full Text PDF PubMed Scopus (229) Google Scholar]. Yet, how mechanical signals are transduced inside cells remains poorly understood. Here, we identify chaperone-assisted selective autophagy (CASA) as a tension-induced autophagy pathway essential for mechanotransduction in muscle and immune cells. The CASA complex, comprised of the molecular chaperones Hsc70 and HspB8 and the cochaperone BAG3, senses the mechanical unfolding of the actin-crosslinking protein filamin. Together with the chaperone-associated ubiquitin ligase CHIP, the complex initiates the ubiquitin-dependent autophagic sorting of damaged filamin to lysosomes for degradation. Autophagosome formation during CASA depends on an interaction of BAG3 with synaptopodin-2 (SYNPO2). This interaction is mediated by the BAG3 WW domain and facilitates cooperation with an autophagosome membrane fusion complex. BAG3 also utilizes its WW domain to engage in YAP/TAZ signaling. Via this pathway, BAG3 stimulates filamin transcription to maintain actin anchoring and crosslinking under mechanical tension. By integrating tension sensing, autophagosome formation, and transcription regulation during mechanotransduction, the CASA machinery ensures tissue homeostasis and regulates fundamental cellular processes such as adhesion, migration, and proliferation.

Elevated SNCA gene expression and intracellular accumulation of the encoded alpha-synuclein (aSyn) protein are associated with the development of Parkinson disease (PD). To date, few enzymes have been examined for their ability to degrade aSyn. Here, we explore the effects of CTSD gene expression, which encodes the lysosomal protease cathepsin D (CathD), on aSyn processing.Over-expression of human CTSD cDNA in dopaminergic MES23.5 cell cultures induced the marked proteolysis of exogenously expressed aSyn proteins in a dose-dependent manner. Unexpectedly, brain extractions, Western blotting and ELISA quantification revealed evidence for reduced levels of soluble endogenous aSyn in ctsd knock-out mice. However, these CathD-deficient mice also contained elevated levels of insoluble, oligomeric aSyn species, as detected by formic acid extraction. In accordance, immunohistochemical studies of ctsd-mutant brain from mice, sheep and humans revealed selective synucleinopathy-like changes that varied slightly among the three species. These changes included intracellular aSyn accumulation and formation of ubiquitin-positive inclusions. Furthermore, using an established Drosophila model of human synucleinopathy, we observed markedly enhanced retinal toxicity in ctsd-null flies.We conclude from these complementary investigations that: one, CathD can effectively degrade excess aSyn in dopaminergic cells; two, ctsd gene mutations result in a lysosomal storage disorder that includes microscopic and biochemical evidence of aSyn misprocessing; and three, CathD deficiency facilitates aSyn toxicity. We therefore postulate that CathD promotes 'synucleinase' activity, and that enhancing its function may lower aSyn concentrations in vivo.

Protein ectodomain shedding is a critical regulator of many membrane proteins, including epidermal growth factor receptor-ligands and tumor necrosis factor (TNF)-α, providing a strong incentive to define the responsible sheddases. Previous studies identified ADAM17 as principal sheddase for transforming growth factor (TGF)-α and heparin-binding epidermal growth factor, but Ca ++ influx activated an additional sheddase for these epidermal growth factor receptor ligands in Adam17−/− cells. Here, we show that Ca ++ influx and stimulation of the P2X7R signaling pathway activate ADAM10 as sheddase of many ADAM17 substrates in Adam17−/− fibroblasts and primary B cells. Importantly, although ADAM10 can shed all substrates of ADAM17 tested here in Adam17−/− cells, acute treatment of wild-type cells with a highly selective ADAM17 inhibitor (SP26) showed that ADAM17 is nevertheless the principal sheddase when both ADAMs 10 and 17 are present. However, chronic treatment of wild-type cells with SP26 promoted processing of ADAM17 substrates by ADAM10, thus generating conditions such as in Adam17−/− cells. These results have general implications for understanding the substrate selectivity of two major cellular sheddases, ADAMs 10 and 17.

Proteolytic enzymes belonging to the A Disintegin And Metalloproteinase (ADAM) family are able to cleave transmembrane proteins close to the cell surface, in a process referred to as ectodomain shedding. Substrates for ADAMs include growth factors, cytokines, chemokines and adhesion molecules, and, as such, many ADAM proteins play crucial roles in cell-cell adhesion, extracellular and intracellular signaling, cell differentiation and cell proliferation. In this Review, we summarize the fascinating roles of ADAMs in embryonic and adult tissue development in both vertebrates and invertebrates.

The lysosomal membrane was thought for a long time to primarily act as a physical barrier separating the luminal acidic milieu from the cytoplasmic environment. Meanwhile, it has been realized that unique lysosomal membranes play essential roles in a number of cellular events ranging from phagocytosis, autophagy, cell death, virus infection to membrane repair. This review provides an overview about the most interesting emerging functions of lysosomal membrane proteins and how they contribute to health and disease. Their importance is exemplified by their role in acidification, transport of metabolites and ions across the membrane, intracellular transport of hydrolases and the regulation of membrane fusion events. Studies in patient cells, non-mammalian model organisms and knockout mice contributed to our understanding of how the different lysosomal membrane proteins affect cellular homeostasis, developmental processes as well as tissue functions. Because these proteins are central for the biogenesis of this compartment they are also considered as attractive targets to modulate the lysosomal machinery in cases where impaired lysosomal degradation leads to cellular pathologies. We are only beginning to understand the complex composition and function of these proteins which are tightly linked to processes occurring throughout the endocytic and biosynthetic pathways.

Neuroligin (NLG), a postsynaptic adhesion molecule, is involved in the formation of synapses by binding to a cognate presynaptic ligand, neurexin. Here we report that neuroligin-1 (NLG1) undergoes ectodomain shedding at the juxtamembrane stalk region to generate a secreted form of NLG1 and a membrane-tethered C-terminal fragment (CTF) in adult rat brains in vivo as well as in neuronal cultures. Pharmacological and genetic studies identified ADAM10 as the major protease responsible for NLG1 shedding, the latter being augmented by synaptic NMDA receptor activation or interaction with soluble neurexin ligands. NLG1-CTF was subsequently cleaved by presenilin/γ-secretase. Secretion of soluble NLG1 was significantly upregulated under a prolonged epileptic seizure condition, and inhibition of NLG1 shedding led to an increase in numbers of dendritic spines in neuronal cultures. Collectively, neuronal activity-dependent proteolytic processing of NLG1 may negatively regulate the remodeling of spines at excitatory synapses.

Proteins belonging to the ‘A Disintegrin And Metalloproteinase’ (ADAM) family are membrane-anchored proteases that are able to cleave the extracellular domains of several membrane-bound proteins in a process known as ‘ectodomain shedding’. In the central nervous system, ADAM10 has attracted the most attention, since it was described as the amyloid precursor protein α-secretase over ten years ago. Despite the excitement over the potential of ADAM10 as a novel drug target in Alzheimer disease, the physiological functions of ADAM10 in the brain are not yet well understood. This is largely because of the embryonic lethality of ADAM10-deficient mice, which results from the loss of cleavage and signaling of the Notch receptor, another ADAM10 substrate. However, the recent generation of conditional ADAM10-deficient mice and the identification of further ADAM10 substrates in the brain has revealed surprisingly numerous and fundamental functions of ADAM10 in the development of the embryonic brain and also in the homeostasis of adult neuronal networks. Mechanistically, ADAM10 controls these functions by utilizing unique postsynaptic substrates in the central nervous system, in particular synaptic cell adhesion molecules, such as neuroligin-1, N-cadherin, NCAM, Ephrin A2 and A5. Consequently, a dysregulation of ADAM10 activity is linked to psychiatric and neurological diseases, such as epilepsy, fragile X syndrome and Huntington disease. This review highlights the recent progress in understanding the substrates and function as well as the regulation and cell biology of ADAM10 in the central nervous system and discusses the value of ADAM10 as a drug target in brain diseases.

Endolysosomal organelles play a key role in trafficking, breakdown and receptor-mediated recycling of different macromolecules such as low-density lipoprotein (LDL)-cholesterol, epithelial growth factor (EGF) or transferrin. Here we examine the role of two-pore channel (TPC) 2, an endolysosomal cation channel, in these processes. Embryonic mouse fibroblasts and hepatocytes lacking TPC2 display a profound impairment of LDL-cholesterol and EGF/EGF-receptor trafficking. Mechanistically, both defects can be attributed to a dysfunction of the endolysosomal degradation pathway most likely on the level of late endosome to lysosome fusion. Importantly, endolysosomal acidification or lysosomal enzyme function are normal in TPC2-deficient cells. TPC2-deficient mice are highly susceptible to hepatic cholesterol overload and liver damage consistent with non-alcoholic fatty liver hepatitis. These findings indicate reduced metabolic reserve of hepatic cholesterol handling. Our results suggest that TPC2 plays a crucial role in trafficking in the endolysosomal degradation pathway and, thus, is potentially involved in the homoeostatic control of many macromolecules and cell metabolites.

Hypomorphic mutations in the DNA repair enzyme RNase H2 cause the neuroinflammatory autoimmune disorder Aicardi-Goutières syndrome (AGS). Endogenous nucleic acids are believed to accumulate in patient cells and instigate pathogenic type I interferon expression. However, the underlying nucleic acid species amassing in the absence of RNase H2 has not been established yet. Here, we report that murine RNase H2 knockout cells accumulated cytosolic DNA aggregates virtually indistinguishable from micronuclei. RNase H2-dependent micronuclei were surrounded by nuclear lamina and most of them contained damaged DNA. Importantly, they induced expression of interferon-stimulated genes (ISGs) and co-localized with the nucleic acid sensor cGAS. Moreover, micronuclei associated with RNase H2 deficiency were cleared by autophagy. Consequently, induction of autophagy by pharmacological mTOR inhibition resulted in a significant reduction of cytosolic DNA and the accompanied interferon signature. Autophagy induction might therefore represent a viable therapeutic option for RNase H2-dependent disease. Endogenous retroelements have previously been proposed as a source of self-nucleic acids triggering inappropriate activation of the immune system in AGS. We used human RNase H2-knockout cells generated by CRISPR/Cas9 to investigate the impact of RNase H2 on retroelement propagation. Surprisingly, replication of LINE-1 and Alu elements was blunted in cells lacking RNase H2, establishing RNase H2 as essential host factor for the mobilisation of endogenous retrotransposons.

Autophagy, a lysosomal degradative pathway, is potently stimulated in the myocardium by fasting and is essential for maintaining cardiac function during prolonged starvation. We tested the hypothesis that intermittent fasting protects against myocardial ischemia-reperfusion injury via transcriptional stimulation of the autophagy-lysosome machinery. Adult C57BL/6 mice subjected to 24-h periods of fasting, every other day, for 6 wk were protected from in-vivo ischemia-reperfusion injury on a fed day, with marked reduction in infarct size in both sexes as compared with nonfasted controls. This protection was lost in mice heterozygous null for Lamp2 (coding for lysosomal-associated membrane protein 2), which demonstrate impaired autophagy in response to fasting with accumulation of autophagosomes and SQSTM1, an autophagy substrate, in the heart. In lamp2 null mice, intermittent fasting provoked progressive left ventricular dilation, systolic dysfunction and hypertrophy; worsening cardiomyocyte autophagosome accumulation and lack of protection to ischemia-reperfusion injury, suggesting that intact autophagy-lysosome machinery is essential for myocardial homeostasis during intermittent fasting and consequent ischemic cardioprotection. Fasting and refeeding cycles resulted in transcriptional induction followed by downregulation of autophagy-lysosome genes in the myocardium. This was coupled with fasting-induced nuclear translocation of TFEB (transcription factor EB), a master regulator of autophagy-lysosome machinery; followed by rapid decline in nuclear TFEB levels with refeeding. Endogenous TFEB was essential for attenuation of hypoxia-reoxygenation-induced cell death by repetitive starvation, in neonatal rat cardiomyocytes, in-vitro. Taken together, these data suggest that TFEB-mediated transcriptional priming of the autophagy-lysosome machinery mediates the beneficial effects of fasting-induced autophagy in myocardial ischemia-reperfusion injury.

The pivotal role of lysosomes in cellular processes is increasingly appreciated. An understanding of the balanced interplay between the activity of acidic hydrolases, lysosomal membrane proteins and cytosolic proteins is required. Lysosomal storage diseases (LSDs) are characterized by disturbances in this network and by intralysosomal accumulation of substrates, often only in certain cell types. Even though our knowledge of these diseases has increased and therapies have been established, many aspects of the molecular pathology of LSDs remain obscure. This Review aims to discuss how lysosomal storage affects functions linked to lysosomes, such as membrane repair, autophagy, exocytosis, lipid homeostasis, signalling cascades and cell viability. Therapies must aim to correct lysosomal storage not only morphologically, but reverse its (patho)biochemical consequences. As different LSDs have different molecular causes, this requires custom tailoring of therapies. We will discuss the major advantages and drawbacks of current and possible future therapies for LSDs. Study of the pathological molecular mechanisms underlying these 'experiments of nature' often yields information that is relevant for other conditions found in the general population. Therefore, more common diseases may profit from a correction of impaired lysosomal function.

Lysosomes are in the center of the cellular control of catabolic and anabolic processes. These membrane-surrounded acidic organelles contain around 70 hydrolases, 200 membrane proteins, and numerous accessory proteins associated with the cytosolic surface of lysosomes. Accessory and transmembrane proteins assemble in signaling complexes that sense and integrate multiple signals and transmit the information to the nucleus. This communication allows cells to respond to changes in multiple environmental conditions, including nutrient levels, pathogens, energy availability, and lysosomal damage, with the goal of restoring cellular homeostasis. This review summarizes our current understanding of the major molecular players and known pathways that are involved in control of metabolic and stress responses that either originate from lysosomes or regulate lysosomal functions.

In LAMP-2-deficient mice autophagic vacuoles accumulate in many tissues, including liver, pancreas, muscle, and heart. Here we extend the phenotype analysis using cultured hepatocytes. In LAMP-2-deficient hepatocytes the half-life of both early and late autophagic vacuoles was prolonged as evaluated by quantitative electron microscopy. However, an endocytic tracer reached the autophagic vacuoles, indicating delivery of endo/lysosomal constituents to autophagic vacuoles. Enzyme activity measurements showed that the trafficking of some lysosomal enzymes to lysosomes was impaired. Immunoprecipitation of metabolically labeled cathepsin D indicated reduced intracellular retention and processing in the knockout cells. The steady-state level of 300-kDa mannose 6-phosphate receptor was slightly lower in LAMP-2-deficient hepatocytes, whereas that of 46-kDa mannose 6-phosphate receptor was decreased to 30% of controls due to a shorter half-life. Less receptor was found in the Golgi region and in vesicles and tubules surrounding multivesicular endosomes, suggesting impaired recycling from endosomes to the Golgi. More receptor was found in autophagic vacuoles, which may explain its shorter half-life. Our data indicate that in hepatocytes LAMP-2 deficiency either directly or indirectly leads to impaired recycling of 46-kDa mannose 6-phosphate receptors and partial mistargeting of a subset of lysosomal enzymes. Autophagic vacuoles may accumulate due to impaired capacity for lysosomal degradation.

Lysosomal cysteine proteinases of the papain family are involved in lysosomal bulk proteolysis, major histocompatibility complex class II mediated antigen presentation, prohormone processing, and extracellular matrix remodeling. Cathepsin L (CTSL) is a ubiquitously expressed major representative of the papain-like family of cysteine proteinases. To investigate CTSL in vivo functions, the gene was inactivated by gene targeting in embryonic stem cells. CTSL-deficient mice develop periodic hair loss and epidermal hyperplasia, acanthosis, and hyperkeratosis. The hair loss is due to alterations of hair follicle morphogenesis and cycling, dilatation of hair follicle canals, and disturbed club hair formation. Hyperproliferation of hair follicle epithelial cells and basal epidermal keratinocytes-both of ectodermal origin-are the primary characteristics underlying the mutant phenotype. Pathological inflammatory responses have been excluded as a putative cause of the skin and hair disorder. The phenotype of CTSL-deficient mice is reminiscent of the spontaneous mouse mutant furless (fs). Analyses of the ctsl gene of fs mice revealed a G149R mutation inactivating the proteinase activity. CTSL is the first lysosomal proteinase shown to be essential for epidermal homeostasis and regular hair follicle morphogenesis and cycling.

CD44 is an adhesion molecule that interacts with hyaluronic acid (HA) and undergoes sequential proteolytic cleavages in its ectodomain and intramembranous domain. The ectodomain cleavage is triggered by extracellular Ca(2+) influx or the activation of protein kinase C. Here we show that CD44-mediated cell-matrix adhesion is terminated by two independent ADAM family metalloproteinases, ADAM10 and ADAM17, differentially regulated in response to those stimuli. Ca(2+) influx activates ADAM10 by regulating the association between calmodulin and ADAM10, leading to CD44 ectodomain cleavage. Depletion of ADAM10 strongly inhibits the Ca(2+) influx-induced cell detachment from matrix. On the other hand, phorbol ester stimulation activates ADAM17 through the activation of PKC and small GTPase Rac, inducing proteolysis of CD44. Furthermore, depletion of ADAM10 or ADAM17 markedly suppressed CD44-dependent cancer cell migration on HA, but not on fibronectin. The spatio-temporal regulation of two independent signaling pathways for CD44 cleavage plays a crucial role in cell-matrix interaction and cell migration.

Sequential processing of amyloid precursor protein (APP) by membrane-bound proteases, BACE1 and γ-secretase, plays a crucial role in the pathogenesis of Alzheimer disease. Much has been discovered on the properties of these proteases; however, regulatory mechanisms of enzyme-substrate interaction in neurons and their involvement in pathological changes are still not fully understood. It is mainly because of the membrane-associated cleavage of these proteases and the lack of information on new substrates processed in a similar way to APP. Here, using RNA interference-mediated BACE1 knockdown, mouse embryonic fibroblasts that are deficient in either BACE1 or presenilins, and BACE1-deficient mouse brain, we show clear evidence that β subunits of voltage-gated sodium channels are sequentially processed by BACE1 and γ-secretase. These results may provide new insights into the underlying pathology of Alzheimer disease.

Presenilin-1 (PS1), a polytopic membrane protein primarily localized to the endoplasmic reticulum, is required for efficient proteolysis of both Notch and β-amyloid precursor protein (APP) within their trans- membrane domains. The activity that cleaves APP (called γ-secretase) has properties of an aspartyl protease, and mutation of either of the two aspartate residues located in adjacent transmembrane domains of PS1 inhibits γ-secretase processing of APP. We show here that these aspartates are required for Notch processing, since mutation of these residues prevents PS1 from inducing the γ-secretase-like proteolysis of a Notch1 derivative. Thus PS1 might function in Notch cleavage as an aspartyl protease or di-aspartyl protease cofactor. However, the ER localization of PS1 is inconsistent with that hypothesis, since Notch cleavage occurs near the cell surface. Using pulse-chase and biotinylation assays, we provide evidence that PS1 binds Notch in the ER/Golgi and is then co-transported to the plasma membrane as a complex. PS1 aspartate mutants were indistinguishable from wild-type PS1 in their ability to bind Notch or traffic with it to the cell surface, and did not alter the secretion of Notch. Thus, PS1 appears to function specifically in Notch proteolysis near the plasma membrane as an aspartyl protease or cofactor.

Presenilins mediate an unusual intramembranous proteolytic activity known as gamma-secretase, two substrates of which are the Notch receptor (Notch) and the beta-amyloid precursor protein (APP). Gamma-secretase-mediated cleavage of APP, like that of Notch, yields an intracellular fragment [APP intracellular domain (AICD)] that forms a transcriptively active complex. We now demonstrate a functional role for AICD in regulating phosphoinositide-mediated calcium signaling. Genetic ablation of the presenilins or pharmacological inhibition of gamma-secretase activity (and thereby AICD production) attenuated calcium signaling in a dose-dependent and reversible manner through a mechanism involving the modulation of endoplasmic reticulum calcium stores. Cells lacking APP (and hence AICD) exhibited similar calcium signaling deficits, and-notably-these disturbances could be reversed by transfection with APP constructs containing an intact AICD, but not by constructs lacking this domain. Our findings indicate that the AICD regulates phosphoinositide-mediated calcium signaling through a gamma-secretase-dependent signaling pathway, suggesting that the intramembranous proteolysis of APP may play a signaling role analogous to that of Notch.

Antigen presentation by major histocompatibility complex (MHC) class II molecules requires the participation of different proteases in the endocytic route to degrade endocytosed antigens as well as the MHC class II-associated invariant chain (Ii). Thus far, only the cysteine protease cathepsin (Cat) S appears essential for complete destruction of Ii. The enzymes involved in degradation of the antigens themselves remain to be identified. Degradation of antigens in vitro and experiments using protease inhibitors have suggested that Cat B and Cat D, two major aspartyl and cysteine proteases, respectively, are involved in antigen degradation. We have analyzed the antigen-presenting properties of cells derived from mice deficient in either Cat B or Cat D. Although the absence of these proteases provoked a modest shift in the efficiency of presentation of some antigenic determinants, the overall capacity of Cat B −/− or Cat D −/− antigen-presenting cells was unaffected. Degradation of Ii proceeded normally in Cat B −/− splenocytes, as it did in Cat D −/− cells. We conclude that neither Cat B nor Cat D are essential for MHC class II-mediated antigen presentation.

The aspartyl protease BACE1 cleaves the amyloid precursor protein and the sialyltransferase ST6Gal I and is important in the pathogenesis of Alzheimer's disease. The normal function of BACE1 and additional physiological substrates have not been identified. Here we show that BACE1 acts on the P-selectin glycoprotein ligand 1 (PSGL-1), which mediates leukocyte adhesion in inflammatory reactions. In human monocytic U937 and human embryonic kidney 293 cells expressing endogenous or transfected BACE1, PSGL-1 was cleaved by BACE1 to generate a soluble ectodomain and a C-terminal transmembrane fragment. No evidence of the cleavage fragment was seen in primary cells derived from mice deficient in BACE1. By using deletion constructs and enzymatic deglycosylation of the C-terminal PSGL-1 fragments, the cleavage site in PSGL-1 was mapped to the juxtamembrane region within the ectodomain. In an in vitro assay BACE1 catalyzed the formation of the PSGL-1 products seen in vivo. The cleavage occurred at a Leu—Ser peptide bond as identified by mass spectrometry using a synthetic peptide. We conclude that PSGL-1 is an additional substrate for BACE1. The aspartyl protease BACE1 cleaves the amyloid precursor protein and the sialyltransferase ST6Gal I and is important in the pathogenesis of Alzheimer's disease. The normal function of BACE1 and additional physiological substrates have not been identified. Here we show that BACE1 acts on the P-selectin glycoprotein ligand 1 (PSGL-1), which mediates leukocyte adhesion in inflammatory reactions. In human monocytic U937 and human embryonic kidney 293 cells expressing endogenous or transfected BACE1, PSGL-1 was cleaved by BACE1 to generate a soluble ectodomain and a C-terminal transmembrane fragment. No evidence of the cleavage fragment was seen in primary cells derived from mice deficient in BACE1. By using deletion constructs and enzymatic deglycosylation of the C-terminal PSGL-1 fragments, the cleavage site in PSGL-1 was mapped to the juxtamembrane region within the ectodomain. In an in vitro assay BACE1 catalyzed the formation of the PSGL-1 products seen in vivo. The cleavage occurred at a Leu—Ser peptide bond as identified by mass spectrometry using a synthetic peptide. We conclude that PSGL-1 is an additional substrate for BACE1. The amyloid hypothesis of Alzheimer's disease attributes the pathogenesis of the disease to accumulation of amyloid β-peptide (Aβ), 1The abbreviations used are: Aβamyloid β-peptidePSGL-1P-selectin glycoprotein ligand 1APPamyloid precursor proteinBACE1β-site APP-cleaving enzymeAPalkaline phosphatasePMAphorbol 12-myristate 13-acetateTNFtumor necrosis factorTNFRTNF receptorHAhemagglutininCTFsC-terminal fragmentsGFPgreen fluorescent protein. a fragment of the amyloid precursor protein (APP) (1.Selkoe D.J. Physiol. Rev. 2001; 81: 741-766Crossref PubMed Scopus (5166) Google Scholar). APP is one of a large number of membrane proteins that are proteolytically converted to their soluble counterparts. This process is referred to as ectodomain shedding and is an important way of regulating the biological activity of membrane proteins (2.Hooper N.M. Karran E.H. Turner A.J. Biochem. J. 1997; 321: 265-279Crossref PubMed Scopus (560) Google Scholar, 3.Blobel C.P. Curr. Opin. Cell Biol. 2000; 12: 606-612Crossref PubMed Scopus (226) Google Scholar). Ectodomain shedding has been described in many multicellular organisms, such as Caenorhabditis elegans, Drosophila melanogaster, mice, and humans and is important in embryonic development, the inflammatory response, and other biological processes (3.Blobel C.P. Curr. Opin. Cell Biol. 2000; 12: 606-612Crossref PubMed Scopus (226) Google Scholar, 4.Schlondorff J. Blobel C.P. J. Cell Sci. 1999; 112: 3603-3617Crossref PubMed Google Scholar, 5.Peschon J.J. Slack J.L. Reddy P. Stocking K.L. Sunnarborg S. Lee D.C. Russell W.E. Castner B.J. Johnson R.S. Fitzner J.N. Boyce R.W. Nelson N. Kozlosky C.J. Wolfson M.F. Rauch C.T. Cerretti D.P. Paxton R.J. March C.J. Black R.A. Science. 1998; 282: 1281-1284Crossref PubMed Scopus (1363) Google Scholar). amyloid β-peptide P-selectin glycoprotein ligand 1 amyloid precursor protein β-site APP-cleaving enzyme alkaline phosphatase phorbol 12-myristate 13-acetate tumor necrosis factor TNF receptor hemagglutinin C-terminal fragments green fluorescent protein. The shedding of APP may occur through two different protease activities termed α- and β-secretase, which cleave APP within its ectodomain close to its transmembrane domain (1.Selkoe D.J. Physiol. Rev. 2001; 81: 741-766Crossref PubMed Scopus (5166) Google Scholar). α-Secretase is a member of the ADAM family of proteases (ADisintegrin And Metalloprotease), which typically carry out the ectodomain shedding of numerous proteins (2.Hooper N.M. Karran E.H. Turner A.J. Biochem. J. 1997; 321: 265-279Crossref PubMed Scopus (560) Google Scholar, 3.Blobel C.P. Curr. Opin. Cell Biol. 2000; 12: 606-612Crossref PubMed Scopus (226) Google Scholar). Because the ADAM proteases cleave within the Aβ-sequence, they preclude the generation of the Aβ-peptide. In contrast, the β-secretase activity cleaves at the N terminus of the Aβ-peptide domain, thereby catalyzing the first step in Aβ-peptide generation. The β-secretase has recently been identified and is a novel aspartyl protease called BACE1 (β-site APP-cleaving enzyme) (6.Vassar R. Bennett B.D. Babu-Khan S. Kahn S. Mendiaz E.A. Denis P. Teplow D.B. Ross S. Amarante P. Loeloff R. Luo Y. Fisher S. Fuller J. Edenson S. Lile J. Jarosinski M.A. Biere A.L. Curran E. Burgess T. Louis J.C. Collins F. Treanor J. Rogers G. Citron M. Science. 1999; 286: 735-741Crossref PubMed Scopus (3307) Google Scholar, 7.Yan R. Bienkowski M.J. Shuck M.E. Miao H. Tory M.C. Pauley A.M. Brashier J.R. Stratman N.C. Mathews W.R. Buhl A.E. Carter D.B. Tomasselli A.G. Parodi L.A. Heinrikson R.L. Gurney M.E. Nature. 1999; 402: 533-537Crossref PubMed Scopus (1339) Google Scholar, 8.Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. Zhao J. McConlogue L. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1482) Google Scholar, 9.Hussain I. Powell D. Howlett D.R. Tew D.G. Meek T.D. Chapman C. Gloger I.S. Murphy K.E. Southan C.D. Ryan D.M. Smith T.S. Simmons D.L. Walsh F.S. Dingwall C. Christie G. Mol. Cell. Neurosci. 1999; 14: 419-427Crossref PubMed Scopus (1001) Google Scholar, 10.Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (740) Google Scholar). Once APP is cleaved by BACE1, the remaining C-terminal APP fragment may be cleaved by the so-called γ-secretase within its transmembrane domain at the C terminus of Aβ, leading to the secretion of the Aβ-peptide (11.Haass C. Steiner H. Trends Cell Biol. 2002; 12: 556-562Abstract Full Text Full Text PDF PubMed Scopus (159) Google Scholar). Because the ectodomain shedding of APP by BACE1, but not by ADAM proteases, is the first step of Aβ-peptide generation, inhibition of BACE1 activity is considered to be a highly promising approach to treat Alzheimer's disease (1.Selkoe D.J. Physiol. Rev. 2001; 81: 741-766Crossref PubMed Scopus (5166) Google Scholar, 12.Vassar R. J. Mol. Neurosci. 2001; 17: 157-170Crossref PubMed Scopus (170) Google Scholar, 13.Citron M. Nat. Neurosci. 2002; 5: 1055-1057Crossref PubMed Scopus (158) Google Scholar). However, it remains unclear whether BACE1 predominantly cleaves APP and a recently identified sialyltransferase (14.Kitazume S. Tachida Y. Oka R. Shirotani K. Saido T.C. Hashimoto Y. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 13554-13559Crossref PubMed Scopus (232) Google Scholar) or also additional proteins. In the latter case, like the ADAM metalloproteases, BACE1 could be a basic cellular mediator of the ectodomain shedding of membrane proteins. Because APP is mainly cleaved by a metalloprotease of the ADAM family and only to a smaller extent by BACE1 (1.Selkoe D.J. Physiol. Rev. 2001; 81: 741-766Crossref PubMed Scopus (5166) Google Scholar), we reasoned that additional membrane proteins known to undergo ectodomain shedding by a metalloprotease might also be cleaved to a smaller extent by BACE1. By testing selected candidate proteins, we found that the P-selectin glycoprotein ligand-1 (PSGL-1) is a novel substrate for BACE1. PSGL-1, which is expressed as a homodimer, mediates leukocyte adhesion to endothelial cells and is critically involved in the inflammatory response both in brain and in peripheral tissues (15.McEver R.P. Cummings R.D. J. Clin. Investig. 1997; 100: 485-491Crossref PubMed Google Scholar). Similar to APP, PSGL-1 is a type I membrane protein. It consists of a signal peptide, a prodomain, which is presumably removed by furin or one of its homologues upon maturation of the protein, a receptor binding domain, 15 to 16 repeats of 10 amino acids (decamer repeats), which are highly O-glycosylated, a juxtamembrane domain, a transmembrane, and a cytoplasmic domain (15.McEver R.P. Cummings R.D. J. Clin. Investig. 1997; 100: 485-491Crossref PubMed Google Scholar). Reagents—Antibodies and reagents were purchased from the indicated companies: HA.11 (Covance), AU1 (Covance), FLAG M2 (Sigma), PL1 (Immunotech Coulter), BACE1 (ProSci) with blocking peptide (ProSci), IgG1 control antibody (Pharmingen), phycoerythrin-conjugated goat anti-mouse (Jackson ImmunoResearch), horseradish peroxidase-conjugated goat anti-mouse immunoglobulins (Dako), PMA (Sigma), and PSGL-1 peptide (Peptide Specialty Laboratories). The deglycosylation with peptide N-glycosidase F (Prozyme) was carried out according to the manufacturer's instructions. The antibody 6687 against the C terminus of APP was described earlier (16.Sastre M. Steiner H. Fuchs K. Capell A. Multhaup G. Condron M.M. Teplow D.B. Haass C. EMBO Rep. 2001; 2: 835-841Crossref PubMed Scopus (429) Google Scholar). Cell Culture, Transfections, Retroviral Transductions, and Flow Cytometric Analysis—293-EBNA cells were cultured in Dulbecco's modified Eagle's medium (Invitrogen) containing 10% fetal bovine serum (Hyclone). Human monocytic U937 cells and the human T cell clone Jurkat 10104 were cultured in Iscove's modified Dulbecco's medium (Invitrogen) containing 10% lipopolysaccharide-free fetal bovine serum (Hyclone) and 50 μm β-mercaptoethanol. 293 cells stably expressing AP-TNFR2 or AP-PSGL-1 were selected in 0.5 μg/ml puromycin. Clonal 293 cells expressing AP-APP and Bcl-XL/CrmA were selected in 0.3 μg/ml puromycin and 40 μg/ml hygromycin. Transfections were carried out using LipofectAMINE 2000 (Invitrogen). In the transient transfections, the medium was replaced with fresh medium 1 day after transfection. After another overnight incubation, the conditioned medium and the cell lysate were collected. For the alkaline phosphatase measurements, aliquots of the conditioned medium were treated for 30 min at 65 °C to heat-inactivate the endogenous alkaline phosphatase activity. In transient transfections, where multiple plasmids were cotransfected, luciferase or alkaline phosphatase was included to normalize the expression levels for transfection efficiencies. To produce retroviral supernatants, plasmids encoding VSV-G, gagpol, and either P12/MMP-GFP or P12/MMP-BACE were transfected into 293 cells. The retroviral transductions were carried out using Polybrene (Sigma). Flow cytometric analysis was carried out on a BD Biosciences FACSCalibur using the indicated antibody. To analyze the effect of PMA on shedding, the cells were incubated in fresh medium for 3 h with the addition of 1 μm PMA in ethanol or with ethanol alone. For treatment with the metalloprotease inhibitor TAPI (25 μm), the cells were pretreated for 45 min with inhibitor. Next the medium was replaced with fresh medium for 3 h containing the inhibitor dissolved in Me2SO or with Me2SO alone. To detect secreted and cellular PSGL-1, aliquots of lysate or conditioned medium were directly loaded onto an electrophoresis gel. The concentration of β-mercaptoethanol in the sample buffer was 10%. At lower concentrations PSGL-1 and its C-terminal fragments were detected not only at the monomeric but also at the dimeric apparent molecular weight. Western blot detection was carried out by using the indicated antibodies. To study the effect of γ-secretase inhibition on the amount of C-terminal fragments, 293 cells were transiently transfected with PSGL-1 or as a control with APP. Two days after transfection the cells were preincubated for 45 min in the presence of the inhibitor and then incubated for additional 8 h with fresh medium containing the inhibitor. The specific γ-secretase inhibitors DAPT (1 μm; kindly provided by Dr. Boris Schmidt, Darmstadt, Germany) or L-685,458 (5 μm; Bachem) were dissolved in Me2SO. Control cells were treated with Me2SO alone. Aliquots of the cell lysate were analyzed by blot analysis. Plasmid Construction—All cDNAs (PSGL-1, BACE1, BACE2, ADAM10, APP, luciferase, L-selectin, TNFR2, and mutants and fusion proteins thereof) were cloned into the expression vector peak 12. The cDNA of ADAM10 was amplified by PCR from an activated T cell library; the cDNAs of secretory alkaline phosphatase was kindly provided by Michael Brown, and the cDNA of BACE2 was kindly provided by Hyeryun Choe and Mike Farzan. The identity of all constructs obtained by PCR was confirmed by DNA sequencing. The plasmid encoding Bcl-XL and CrmA was described previously (17.Pimentel-Muinos F.X. Seed B. Immunity. 1999; 11: 783-793Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar). Phosphatase Assay—For alkaline phosphatase activity measurements, 200 μl of reaction solution (0.1 m glycine, pH 10.4, 1 mm MgCl2, 1 mm ZnCl2 containing 1 mg/ml 4-nitrophenyl phosphate disodium salt hexahydrate, Sigma) were added to 20 μl of the conditioned medium. The absorbance was read at 405 nm. Infection of Primary Neurons with Semliki Forest Virus—Cortical neurons were prepared from E14 mice embryos from BACE1 heterozygote crosses as described (18.De Strooper B. Saftig P. Craessaerts K. Vanderstichele H. Guhde G. Annaert W. Von Figura K. Van Leuven F. Nature. 1998; 391: 387-390Crossref PubMed Scopus (1552) Google Scholar). Embryo tails were used for the genotyping. The BACE knock out was verified by Northern and Western blot detection and by functional analysis demonstrating that APP cleavage by BACE was virtually eliminated in the neurons. 2P. Saftig, D.-i. Dominguez, and B. De Strooper, unpublished results. Preparation of recombinant Semliki Forest virus stocks has been described previously (19.De Strooper B. Simons M. Multhaup G. Van Leuven F. Beyreuther K. Dotti C.G. EMBO J. 1995; 14: 4932-4938Crossref PubMed Scopus (162) Google Scholar). Virus was diluted 1:100 in conditioned culture medium and added to 4-day-old neurons. Three hours post-infection, cells were labeled with 100 μCi/ml [35S]methionine for 4 h and lysed in immunoprecipitation buffer (1% Triton X-100, 1% sodium deoxycholate, 0.1% SDS in TBS buffer). PSGL-1 full-length and CTFs were immunoprecipitated using anti-FLAG antibody. Immunoprecipitated material was separated by SDS-PAGE, and dried gels were exposed to PhosphorImager (Amersham Biosciences). In Vitro BACE1 Cleavage Assay and Mass Spectrometry—Cell lysates from PSGL-1-expressing 293 cells were incubated overnight at 37 °C with or without BACE1-containing membrane preparations in 50 mm sodium acetate, pH 4.4. Membranes from BACE1-transfected and non-transfected 293 cells were extracted according to a previously published protocol (20.Steiner H. Winkler E. Edbauer D. Prokop S. Basset G. Yamasaki A. Kostka M. Haass C. J. Biol. Chem. 2002; 277: 39062-39065Abstract Full Text Full Text PDF PubMed Scopus (249) Google Scholar) using 1% Triton X-100 and STE buffer instead of DDM lysis buffer. The following protease inhibitors were included where indicated. The BACE1 inhibitor (GL189) H-EVNstatineVAEF-NH2 was synthesized by K. Maskos and W. Bode and used at 2 μm. Pepstatin A was used at 2 μg/ml. and the complete protease inhibitor mixture (Roche Applied Science) was used according to the manufacturer's instructions. 20 μg of the synthetic peptide AASNLSVNYPVGAPDHISVKQCONH2 were incubated for 1 h at 37 °C with or without the purified, soluble BACE1 ectodomain in 50 mm sodium acetate, pH 4.4. The reaction mixture was purified using ZipTips (Millipore) according to the manufacturer's protocol and was directly eluted from the ZipTips with a saturated solution of α-cinnamic acid in 50% acetonitrile, 0.3% trifluoroacetic acid onto a stainless steel matrix-assisted laser desorption ionization target plate. Mass spectra were recorded on a Voyager DESTR matrix-assisted laser desorption ionization-mass spectrometer. Alkaline Phosphatase Fusion Protein Assay Identifies PSGL-1 as a New BACE1 Substrate—To identify new BACE1 substrates, alkaline phosphatase (AP) fusion proteins of L-selectin, TNF-receptor 2, and P-selectin glycoprotein ligand-1 (PSGL-1) were generated. Like APP, the three proteins are known to undergo ectodomain shedding in a metalloprotease-dependent manner. As a control an AP fusion protein of APP was included. All four proteins were stably expressed in human embryonic kidney 293 cells, which are widely used for studying APP processing and BACE activity. The AP activity was measured in the conditioned medium. The AP fusion proteins were shed in the same manner as the corresponding wild-type proteins (5.Peschon J.J. Slack J.L. Reddy P. Stocking K.L. Sunnarborg S. Lee D.C. Russell W.E. Castner B.J. Johnson R.S. Fitzner J.N. Boyce R.W. Nelson N. Kozlosky C.J. Wolfson M.F. Rauch C.T. Cerretti D.P. Paxton R.J. March C.J. Black R.A. Science. 1998; 282: 1281-1284Crossref PubMed Scopus (1363) Google Scholar, 21.Davenpeck K.L. Brummet M.E. Hudson S.A. Mayer R.J. Bochner B.S. J. Immunol. 2000; 165: 2764-2772Crossref PubMed Scopus (109) Google Scholar, 22.Herman C. Chernajovsky Y. J. Immunol. 1998; 160: 2478-2487PubMed Google Scholar); shedding was stimulated by the phorbol ester PMA and inhibited by the metalloprotease inhibitor TAPI (data not shown), as expected for the cleavage by a metalloprotease of the ADAM family. Next, the cells were transfected with vectors encoding either BACE1, a catalytically inactive BACE1 mutant (BACE1 D93A) (23.Bennett B.D. Denis P. Haniu M. Teplow D.B. Kahn S. Louis J.C. Citron M. Vassar R. J. Biol. Chem. 2000; 275: 37712-37717Abstract Full Text Full Text PDF PubMed Scopus (240) Google Scholar), the BACE1 homologue BACE2, a catalytically inactive BACE2 mutant (BACE2 D110N) (24.Hussain I. Christie G. Schneider K. Moore S. Dingwall C. J. Biol. Chem. 2001; 276: 23322-23328Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar), the metalloprotease ADAM10, which is able to cleave APP (25.Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (985) Google Scholar), or with the empty vector alone (Con, Fig. 1). Transfection of BACE1 strongly induced the shedding of the AP fusion proteins of APP and PSGL-1 but not of L-selectin and TNF receptor 2 (Fig. 1). This result suggests that PSGL-1, but not L-selectin and TNFR2, could be a novel substrate for the protease BACE1. A catalytically inactive mutant of BACE1 (BACE D93A) (23.Bennett B.D. Denis P. Haniu M. Teplow D.B. Kahn S. Louis J.C. Citron M. Vassar R. J. Biol. Chem. 2000; 275: 37712-37717Abstract Full Text Full Text PDF PubMed Scopus (240) Google Scholar) had no effect on the shedding of AP-APP and AP-PSGL-1, showing that the proteolytic activity of BACE1 is required for the shedding of both proteins. Interestingly, ADAM10 and BACE2 showed the same cleavage pattern as BACE1 by stimulating the shedding of APP and PSGL-1 but not of L-selectin and TNFR2 (Fig. 1). Proteolytic Processing of PSGL-1 by BACE1—To analyze in more detail the cleavage of PSGL-1 by BACE1, we used blot analysis to study the proteolytic processing of PSGL-1 in the human monocytic cell line U937, which expresses endogenous PSGL-1, as well as in the human embryonic kidney cell line 293, which has been used for several studies of BACE1 activity. To facilitate detection of the proteolytic fragments, PSGL-1 was tagged with three small epitope tags at the N terminus of the immature protein (HA), in the ectodomain of the mature protein (AU1), and in the cytoplasmic domain (FLAG; Fig. 2A). PSGL-1 was transfected into 293 cells, where it could be detected on the cell surface by flow cytometry using an antibody against PSGL-1 (PL1) or against the AU1 tag (data not shown). In the cell lysate, the immature form and the mature, fully O-glycosylated form of PSGL-1 showed the expected molecular masses of ∼85 and ∼120 kDa, respectively (Fig. 2B, lane 2, FLAG blot), and were not visible in control cells not transfected with PSGL-1 (lane 1). Two types of C-terminal fragments (CTFs) of PSGL-1 were observed in the lysate (Fig. 2B, lane 2 Flag blots): two fragments with a molecular mass of ∼20 kDa and three fragments with a molecular mass of around ∼30 kDa. The fragments of ∼20 kDa were dramatically enriched in a dose-dependent manner when BACE1 was overexpressed (Fig. 2B, lanes 3 and 4), suggesting that they arise through cleavage of PSGL-1 by the endogenous BACE1 of the 293 cells. Upon BACE1 overexpression a third C-terminal fragment of a slightly lower molecular weight was detected. This fragment was not detected in cells expressing endogenous BACE1, presumably because its amount was below the detection limit. The apparent molecular weight of these C-terminal fragments is nearly identical to the molecular weight of a PSGL-1 deletion mutant (PSGL-1 noecto) in which the ectodomain was replaced by the short HA epitope tag (Fig. 2C), suggesting that BACE1 cleavage occurs close to the transmembrane domain. Interestingly, similar to the PSGL-1 C-terminal fragments, PSGL-1 noecto was present as three different bands. At present it is unknown whether the three bands represent three conformations with differing electrophoretic mobility or might differ by post-translational modifications. However, the three bands have the same N terminus, since they could be detected with an antibody against their N-terminal HA tag (Fig. 2C). The C-terminal PSGL-1 fragments of ∼30 kDa were enriched when the metalloprotease ADAM10 was overexpressed (Fig. 2B, lane 5), and therefore most likely represent the CTFs generated by ADAM protease cleavage of PSGL-1 in the 293 cells. Thus, like those of APP, PSGL-1 CTFs of different length seem to be generated by BACE1 or by metalloproteases of the ADAM family. Overexpression of BACE1 not only led to the increased generation of PSGL-1 CTFs but also to a reduction in quantity of mature, full-length PSGL-1. This was particularly apparent when more BACE1 plasmid was used for transfection (Fig. 2B, FLAG blot; high BACE and low BACE), suggesting that BACE1 very efficiently cleaves the mature PSGL-1. The reduction of mature, full-length PSGL-1 was accompanied by a reduction of PSGL-1 detected on the surface of 293 cells using flow cytometry (data not shown). In the conditioned medium, the secreted ectodomain of PSGL-1 was detected with a molecular mass of ∼120 kDa (Fig. 2B, lane 2, top panel). Additionally, smaller fragments of 80–100 kDa were observed (Fig. 2B, top panel, PSGL-1 short), suggesting that the soluble form of PSGL-1 is subject to further proteolytic cleavage. This was particularly visible upon BACE1 transfection, where the full-length ectodomain could barely be detected (Fig. 2B, top panel, lanes 3 and 4, secreted PSGL-1), but instead an increased amount of the apparent degradation products was visible. After the initial ectodomain cleavage the C-terminal fragments of APP and other type I membrane proteins may undergo regulated intramembrane proteolysis by γ-secretase. For example, treatment of APP-expressing 293 cells with the two specific γ-secretase inhibitors DAPT (26.Dovey H.F. John V. Anderson J.P. Chen L.Z. de Saint Andrieu P. Fang L.Y. Freedman S.B. Folmer B. Goldbach E. Holsztynska E.J. Hu K.L. Johnson-Wood K.L. Kennedy S.L. Kholodenko D. Knops J.E. Latimer L.H. Lee M. Liao Z. Lieberburg I.M. Motter R.N. Mutter L.C. Nietz J. Quinn K.P. Sacchi K.L. Seubert P.A. Shopp G.M. Thorsett E.D. Tung J.S. Wu J. Yang S. Yin C.T. Schenk D.B. May P.C. Altstiel L.D. Bender M.H. Boggs L.N. Britton T.C. Clemens J.C. Czilli D.L. Dieckman-McGinty D.K. Droste J.J. Fuson K.S. Gitter B.D. Hyslop P.A. Johnstone E.M. Li W.Y. Little S.P. Mabry T.E. Miller F.D. Audia J.E. J. Neurochem. 2001; 76: 173-181Crossref PubMed Scopus (797) Google Scholar) and L-685,458 (27.Shearman M.S. Beher D. Clarke E.E. Lewis H.D. Harrison T. Hunt P. Nadin A. Smith A.L. Stevenson G. Castro J.L. Biochemistry. 2000; 39: 8698-8704Crossref PubMed Scopus (367) Google Scholar) strongly increases the amount of APP C-terminal fragments in the cell lysate (Fig. 2D), resulting from the inhibited turn over by γ-secretase. In contrast, no accumulation of PSGL-1 C-terminal fragments was observed in PSGL-1-expressing 293 cells (Fig. 2D), suggesting that PSGL-1 is not a substrate for γ-secretase. Proteolytic Processing of PSGL-1 in U937 Cells—The monocytic U937 cell line showed essentially the same proteolytic processing of PSGL-1 (Fig. 3) as the 293 cells (Fig. 2B), including the strong reduction of full-length PSGL-1 from the cell surface of U937 cells upon transduction of BACE1 (Fig. 4). The U937 cells were retrovirally transduced with PSGL-1 and additionally with a retrovirus encoding BACE1 or GFP as a control. In a control experiment, the U937 cells were stimulated with the phorbol ester PMA, which induced the secretion of PSGL-1 (not shown), as reported previously (21.Davenpeck K.L. Brummet M.E. Hudson S.A. Mayer R.J. Bochner B.S. J. Immunol. 2000; 165: 2764-2772Crossref PubMed Scopus (109) Google Scholar) for human neutrophils.Fig. 4Flow cytometric analysis of the endogenous PSGL-1 in monocytic U937 cells. U937 cells were retrovirally transduced with GFP as a control (Con) or with BACE1 and stained with antibody PL-1 against the N terminus of PSGL-1. The dotted line represents the isotype control.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In contrast to the findings from 293 cells, only one C-terminal fragment was visible in the lysate of U937 cells overexpressing BACE1 (Fig. 3, lane 3, Flag blot). In control cells transduced with GFP instead of BACE1, the C-terminal fragment was detected after longer exposure of the film (see Fig. 3, bottom panel), similar to the results from 293 cells (Fig. 2B, lane 2, Flag blot), suggesting that this C-terminal fragment resulted from cleavage induced by the endogenous BACE1 of the U937 cells. Similar results were observed in the human Jurkat T cell line (data not shown), which also expresses endogenous PSGL-1. The nature and the position of the C-terminal epitope tag of PSGL-1 did not influence its proteolytic processing (data not shown). C-terminal Fragments of PSGL-1 Are Not Generated in BACE1-deficient Cells—Next we analyzed whether the PSGL-1 CTFs were absent in BACE1-deficient cells. To this aim, we made use of BACE1 knock-out mice.2 Although BACE1 is expressed in most tissues and cell lines including leukocytes (8.Sinha S. Anderson J.P. Barbour R. Basi G.S. Caccavello R. Davis D. Doan M. Dovey H.F. Frigon N. Hong J. Jacobson-Croak K. Jewett N. Keim P. Knops J. Lieberburg I. Power M. Tan H. Tatsuno G. Tung J. Schenk D. Seubert P. Suomensaari S.M. Wang S. Walker D. Zhao J. McConlogue L. John V. Nature. 1999; 402: 537-540Crossref PubMed Scopus (1482) Google Scholar, 10.Lin X. Koelsch G. Wu S. Downs D. Dashti A. Tang J. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 1456-1460Crossref PubMed Scopus (740) Google Scholar), its highest expression is in neurons, where its detection is relatively easy. Thus, primary neuronal cultures were used for the subsequent experiments. The neurons were infected with Semliki Forest virus encoding the epitope-tagged PSGL-1. Full-length PSGL-1 and its CTFs were detected by [35S]methionine labeling and immunoprecipitation with an anti-FLAG tag antibody. In neurons of wild-type mice, PSGL-1 was processed to the same C-terminal fragment as detected in U937 and 293 cells (Fig. 5, lane 5). Coinfection of the neurons with virus encoding BACE1 led to an increased generation of the PSGL-1 CTF (Fig. 5, lane 6). In contrast, in neurons of BACE1–/– mice, no CTF of PSGL-1 could be detected (Fig. 5, lane 2). Virally induced expression of BACE1 restored the generation of the C-terminal fragment in the BACE1–/– neurons (Fig. 5, lane 3), showing that BACE1 is required for the generation of the PSGL-1 C-terminal fragment of ∼20 kDa. In Vitro, BACE1 Induces the Cleavage of PSGL-1—To analyze whether PSGL-1 is directly cleaved by BACE1, the following in vitro assay was used. Cell lysates of 293 cells expressing full-length PSGL-1 were incubated with membrane extracts from control 293 cells (Fig. 6, lane 3) or from 293 cells overexpressing BACE1 (Fig. 6, lanes 4–7). In the presence (Fig. 6, lane 4) but not the absence (Fig. 6, lane 3) of the BACE1 extract, the same PSGL-1 CTFs were generated as in vivo (Fig. 6, lane 2). The addition of a specific BACE1 inhibitor (GL189) (28.Capell A. Meyn L. Fluhrer R. Teplow D.B. Walter J. Haass C. J. Biol. Chem. 2002; 277: 5637-5643Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar) suppressed the generation of the PSGL-1 CTFs (Fig. 6, lane 5), whereas the aspartyl protease inhibitor pepstatin A (Fig. 6,

Mice double deficient in LAMP-1 and -2 were generated. The embryos died between embryonic days 14.5 and 16.5. An accumulation of autophagic vacuoles was detected in many tissues including endothelial cells and Schwann cells. Fibroblast cell lines derived from the double-deficient embryos accumulated autophagic vacuoles and the autophagy protein LC3II after amino acid starvation. Lysosomal vesicles were larger and more peripherally distributed and showed a lower specific density in Percoll gradients in double deficient when compared with control cells. Lysosomal enzyme activities, cathepsin D processing and mannose-6-phosphate receptor expression levels were not affected by the deficiency of both LAMPs. Surprisingly, LAMP-1 and -2 deficiencies did not affect long-lived protein degradation rates, including proteolysis due to chaperone-mediated autophagy. The LAMP-1/2 double-deficient cells and, to a lesser extent, LAMP-2 single-deficient cells showed an accumulation of unesterified cholesterol in endo/lysosomal, rab7, and NPC1 positive compartments as well as reduced amounts of lipid droplets. The cholesterol accumulation in LAMP-1/2 double-deficient cells could be rescued by overexpression of murine LAMP-2a, but not by LAMP-1, highlighting the more prominent role of LAMP-2. Taken together these findings indicate partially overlapping functions for LAMP-1 and -2 in lysosome biogenesis, autophagy, and cholesterol homeostasis.

Epilepsy is caused by an electrical hyperexcitability in the CNS. Because K+ channels are critical for establishing and stabilizing the resting potential of neurons, a loss of K+ channels could support neuronal hyperexcitability. Indeed, benign familial neonatal convulsions, an autosomal dominant epilepsy of infancy, is caused by mutations in KCNQ2 or KCNQ3 K+ channel genes. Because these channels contribute to the native muscarinic-sensitive K+ current (M current) that regulates excitability of numerous types of neurons, KCNQ (Kv7) channel activators would be effective in epilepsy treatment. A compound exhibiting anticonvulsant activity in animal seizure models is retigabine. It specifically acts on the neuronally expressed KCNQ2-KCNQ5 (Kv7.2-Kv7.5) channels, whereas KCNQ1 (Kv7.1) is not affected. Using the differential sensitivity of KCNQ3 and KCNQ1 to retigabine, we constructed chimeras to identify minimal segments required for sensitivity to the drug. We identified a single tryptophan residue within the S5 segment of KCNQ3 and also KCNQ2, KCNQ4, and KCNQ5 as crucial for the effect of retigabine. Furthermore, heteromeric KCNQ channels comprising KCNQ2 and KCNQ1 transmembrane domains (attributable to transfer of assembly properties from KCNQ3 to KCNQ1) are retigabine insensitive. Transfer of the tryptophan into the KCNQ1 scaffold resulted in retigabine-sensitive heteromers, suggesting that the tryptophan is necessary in all KCNQ subunits forming a functional tetramer to confer drug sensitivity.

Metachromatic leukodystrophy is a lysosomal sphingolipid storage disorder caused by the deficiency of arylsulfatase A. The disease is characterized by progressive demyelination, causing various neurologic symptoms. Since no naturally occurring animal model of the disease is available, we have generated arylsulfatase A-deficient mice. Deficient animals store the sphingolipid cerebroside-3-sulfate in various neuronal and nonneuronal tissues. The storage pattern is comparable to that of affected humans, but gross defects of white matter were not observed up to the age of 2 years. A reduction of axonal cross-sectional area and an astrogliosis were observed in 1-year-old mice; activation of microglia started at 1 year and was generalized at 2 years. Purkinje cell dendrites show an altered morphology. In the acoustic ganglion numbers of neurons and myelinated fibers are severely decreased, which is accompanied by a loss of brainstem auditory-evoked potentials. Neurologic examination reveals significant impairment of neuromotor coordination.

Action myoclonus-renal failure syndrome (AMRF) is an autosomal-recessive disorder with the remarkable combination of focal glomerulosclerosis, frequently with glomerular collapse, and progressive myoclonus epilepsy associated with storage material in the brain. Here, we employed a novel combination of molecular strategies to find the responsible gene and show its effects in an animal model. Utilizing only three unrelated affected individuals and their relatives, we used homozygosity mapping with single-nucleotide polymorphism chips to localize AMRF. We then used microarray-expression analysis to prioritize candidates prior to sequencing. The disorder was mapped to 4q13-21, and microarray-expression analysis identified SCARB2/Limp2, which encodes a lysosomal-membrane protein, as the likely candidate. Mutations in SCARB2/Limp2 were found in all three families used for mapping and subsequently confirmed in two other unrelated AMRF families. The mutations were associated with lack of SCARB2 protein. Reanalysis of an existing Limp2 knockout mouse showed intracellular inclusions in cerebral and cerebellar cortex, and the kidneys showed subtle glomerular changes. This study highlights that recessive genes can be identified with a very small number of subjects. The ancestral lysosomal-membrane protein SCARB2/LIMP-2 is responsible for AMRF. The heterogeneous pathology in the kidney and brain suggests that SCARB2/Limp2 has pleiotropic effects that may be relevant to understanding the pathogenesis of other forms of glomerulosclerosis or collapse and myoclonic epilepsies. Action myoclonus-renal failure syndrome (AMRF) is an autosomal-recessive disorder with the remarkable combination of focal glomerulosclerosis, frequently with glomerular collapse, and progressive myoclonus epilepsy associated with storage material in the brain. Here, we employed a novel combination of molecular strategies to find the responsible gene and show its effects in an animal model. Utilizing only three unrelated affected individuals and their relatives, we used homozygosity mapping with single-nucleotide polymorphism chips to localize AMRF. We then used microarray-expression analysis to prioritize candidates prior to sequencing. The disorder was mapped to 4q13-21, and microarray-expression analysis identified SCARB2/Limp2, which encodes a lysosomal-membrane protein, as the likely candidate. Mutations in SCARB2/Limp2 were found in all three families used for mapping and subsequently confirmed in two other unrelated AMRF families. The mutations were associated with lack of SCARB2 protein. Reanalysis of an existing Limp2 knockout mouse showed intracellular inclusions in cerebral and cerebellar cortex, and the kidneys showed subtle glomerular changes. This study highlights that recessive genes can be identified with a very small number of subjects. The ancestral lysosomal-membrane protein SCARB2/LIMP-2 is responsible for AMRF. The heterogeneous pathology in the kidney and brain suggests that SCARB2/Limp2 has pleiotropic effects that may be relevant to understanding the pathogenesis of other forms of glomerulosclerosis or collapse and myoclonic epilepsies.

Major histocompatibility complex class II antigen presentation requires the participation of lysosomal proteases in two convergent processes. First, the antigens endocytosed by the antigen-presenting cells must be broken down into antigenic peptides. Second, class II molecules are synthesized with their peptide-binding site blocked by invariant chain (Ii), and they acquire the capacity to bind antigens only after Ii has been degraded in the compartments where peptides reside. The study of genetically modified mice deficient in single lysosomal proteases has allowed us to determine their role in these processes. Cathepsins (Cat) B and D, previously considered major players in MHC class II antigen presentation, are dispensable for degradation of Ii and for generation of several antigenic determinants. By contrast, Cat S plays an essential role in removal of Ii in B cells and dendritic cells, whereas Cat L apparently does so in thymic epithelial cells. Accordingly, the absence of Cat S and L have major consequences for the onset of humoral immune responses and for T-cell selection, respectively. It is likely that other as yet uncharacterized lysosomal enzymes also play a role in Ii degradation and in generation of antigenic determinants. Experiments involving drugs that interfere with protein traffic suggest that more than one mechanism for Ii removal, probably involving different proteases, can co-exist in the same antigen-presenting cell. These findings may allow the development of protease inhibitors with possible therapeutic applications.

We showed previously that PrPc undergoes constitutive and phorbol ester-regulated cleavage inside the 106–126 toxic domain of the protein, leading to the production of a fragment referred to as N1. Here we show by a pharmacological approach thato-phenanthroline, a general zinc-metalloprotease inhibitors, as well as BB3103 and TAPI, the inhibitors of metalloenzymes ADAM10 (Adisintegrinand metalloprotease); and TACE,tumor necrosis factorα-converting enzyme; ADAM17), respectively, drastically reduce N1 formation. We set up stable human embryonic kidney 293 transfectants overexpressing human ADAM10 and TACE, and we demonstrate that ADAM10 contributes to constitutive N1 production whereas TACE mainly participates in regulated N1 formation. Furthermore, constitutive N1 secretion is drastically reduced in fibroblasts deficient for ADAM10 whereas phorbol 12,13-dibutyrate-regulated N1 production is fully abolished in TACE-deficient cells. Altogether, our data demonstrate for the first time that disintegrins could participate in the catabolism of glycosyl phosphoinositide-anchored proteins such as PrPc. Second, our study identifies ADAM10 and ADAM17 as the protease candidates responsible for normal cleavage of PrPc. Therefore, these disintegrins could be seen as putative cellular targets of a therapeutic strategy aimed at increasing normal PrPcbreakdown and thereby depleting cells of the putative 106–126 "toxic" domain of PrPc. We showed previously that PrPc undergoes constitutive and phorbol ester-regulated cleavage inside the 106–126 toxic domain of the protein, leading to the production of a fragment referred to as N1. Here we show by a pharmacological approach thato-phenanthroline, a general zinc-metalloprotease inhibitors, as well as BB3103 and TAPI, the inhibitors of metalloenzymes ADAM10 (Adisintegrinand metalloprotease); and TACE,tumor necrosis factorα-converting enzyme; ADAM17), respectively, drastically reduce N1 formation. We set up stable human embryonic kidney 293 transfectants overexpressing human ADAM10 and TACE, and we demonstrate that ADAM10 contributes to constitutive N1 production whereas TACE mainly participates in regulated N1 formation. Furthermore, constitutive N1 secretion is drastically reduced in fibroblasts deficient for ADAM10 whereas phorbol 12,13-dibutyrate-regulated N1 production is fully abolished in TACE-deficient cells. Altogether, our data demonstrate for the first time that disintegrins could participate in the catabolism of glycosyl phosphoinositide-anchored proteins such as PrPc. Second, our study identifies ADAM10 and ADAM17 as the protease candidates responsible for normal cleavage of PrPc. Therefore, these disintegrins could be seen as putative cellular targets of a therapeutic strategy aimed at increasing normal PrPcbreakdown and thereby depleting cells of the putative 106–126 "toxic" domain of PrPc. human embryonic kidney phorbol 12,13-dibutyrate β-amyloid precursor protein secreted α-secretase-derived βAPP Spongiform encephalopathies are neurodegenerative diseases that are characterized by the cerebral deposition of a 33–35-kDa protein called prion (1Prusiner S.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13363-13383Crossref PubMed Scopus (5130) Google Scholar). It is thought that the prion-associated pathology occurs when normal prion, referred to as cellular prion or PrPc, is converted into an insoluble and highly protease-resistant protein particle called PrPres or scrapie (PrPsc) (2Ghetti B. Piccardo P. Frangione B. Bugiani O. Giaccone G. Young K. Prelli F. Farlow M.R. Dlouhy S.R. Tagliavini F. Brain Pathol. 1996; 6: 127-145Crossref PubMed Scopus (172) Google Scholar). Prion diseases, which can be of sporadic or genetic origins, all led to fatal issues (1Prusiner S.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13363-13383Crossref PubMed Scopus (5130) Google Scholar). Although normal and pathogenic PrP have the same primary structures, it appears that they could undergo distinct post-transductional events (2Ghetti B. Piccardo P. Frangione B. Bugiani O. Giaccone G. Young K. Prelli F. Farlow M.R. Dlouhy S.R. Tagliavini F. Brain Pathol. 1996; 6: 127-145Crossref PubMed Scopus (172) Google Scholar). Among them, several lines of evidence indicate that PrP is targeted by distinct proteolytic activities as was shown in normal and Creutzfeldt-Jakob-affected brains (3Chen S.G. Teplow D.B. Parchi P. Teller J.K. Gambetti P. Autilio-Gambetti L. J. Biol. Chem. 1995; 270: 19173-19180Abstract Full Text Full Text PDF PubMed Scopus (453) Google Scholar). Thus, the normal cleavage appears to occur at the 110/111–112 peptide bond (leading to a fragment referred to as N1; see Fig. 1A) whereas the pathological breakdown is located more N-terminally at the 90–91 site (3Chen S.G. Teplow D.B. Parchi P. Teller J.K. Gambetti P. Autilio-Gambetti L. J. Biol. Chem. 1995; 270: 19173-19180Abstract Full Text Full Text PDF PubMed Scopus (453) Google Scholar). This leftward shift leads to the preservation of the 106–126 sequence domain of PrP, which behaves as the toxic "core" of the protein (4Forloni G. Angeretti N. Chiesa R. Monzani E. Salmona M. Bugiani O. Tagliavini F. Nature. 1993; 362: 543-546Crossref PubMed Scopus (896) Google Scholar, 5Brown D.R. Trends Neurosci. 2001; 24: 85-90Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar). Normal cleavage could be seen as a means to deplete the protein of its potential pathogenicity. Thus, the nature of the proteases involved in the "normal" cleavage of PrPc and the putative up-regulators of such a process are of considerable interest. We demonstrated recently that in human HEK2931 cells, as well as in murine TSM1 neurons, normal PrPc was cleaved constitutively (6Vincent B. Paitel E. Frobert Y. Lehmann S. Grassi J. Checler F. J. Biol. Chem. 2000; 275: 35612-35616Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). As reported previously, the secreted fragment has a molecular mass of about 11.5 kDa and is labeled by SAF32 and 8G8 but not by PRI308 (see Fig. 1B), which recognizes an epitope overlapping the 111–112 bond (see "Materials and Methods"). Therefore, both molecular mass and immunological characterization indicate that the secreted fragment corresponds to the N1 product generated upon proteolytic attack of PrPc at the 111–112 peptide bond. This hydrolysis could be up-regulated by several effectors of the protein kinase C pathway but not by protein kinase A agonists (6Vincent B. Paitel E. Frobert Y. Lehmann S. Grassi J. Checler F. J. Biol. Chem. 2000; 275: 35612-35616Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Here we identified the proteases involved in both constitutive and regulated hydrolytic pathways by combined pharmacological, transfection, and knockout analyses. SAF32 raised against the 79–92 residues of PrP and all other monoclonal antibodies appearing in Fig. 1 have been characterized previously (7Demart S. Fournier J.G. Creminon C. Frobert Y. Lamoury F. Marce D. Lasmezas C. Dormont D. Grassi J. Deslys J.P. Biochem. Biophys. Res. Commun. 1999; 265: 652-657Crossref PubMed Scopus (126) Google Scholar). The rabbit polyclonal AL45 directed against TACE was described previously (8Zhang Y. Jiang J. Black R.A. Baumann G. Frank S.J. Endocrinology. 2000; 141: 4342-4348Crossref PubMed Scopus (117) Google Scholar). ADAM10 was detected with a polyclonal antibody from Euromedex. Phorbol 12,13-dibutyrate (PDBu),o-phenanthroline, pepstatin, E64, and 4-(2-Aminoethyl)benzenesulfonyl-fluoride were from Sigma. BB3103 (hydroxamic acid-based zinc metalloprotease inhibitor) was kindly provided by British Biotech, and TAPI (a tumor necrosis factor α-converting enzyme inhibitor) was kindly supplied by Immunex. HEK293 cells were cultured as described previously (6Vincent B. Paitel E. Frobert Y. Lehmann S. Grassi J. Checler F. J. Biol. Chem. 2000; 275: 35612-35616Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). HEK293 cells overexpressing ADAM10 or TACE were obtained after transfection of 2 μg of ADAM10 and TACE cDNA with DAC30 reagent (Eurogentec). Positive clones were identified by Western blot analysis by means of the above anti-TACE- and -ADAM10-specific polyclonal antibodies. Cells were maintained at 37 °C in 5% CO2 in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum containing penicillin (100 units/ml−1), streptomycin (50 mg/ml−1), and geneticin (0.5 mg/ml−1). Mouse embryonic fibroblasts (wild-type, ADAM10−/−, and TACE−/−) were cultured at 37 °C in 5% CO2 in 50% Dulbecco's modified Eagle's medium/50% Ham's F-12 containing 5% fetal calf serum containing penicillin (100 units/ml−1) and streptomycin (50 mg/ml−1). HEK293 cells grown in 35-mm dishes were washed twice with phosphate-buffered saline and resuspended in 500 μl of lysis buffer (10 mm Tris/HCl, pH 7.5, 150 mm NaCl, 0.5% Triton X-100, 0.5% deoxycholate, 5 mm EDTA) in the presence of a protease inhibitor mixture (Sigma) and then 50 μg of protein were subjected to SDS-polyacrylamide gel electrophoresis on an 8% Tris/glycine gel. Proteins were transferred onto nitrocellulose membrane (2 h, 100 V) and incubated overnight at 4 °C with AL45 or anti-ADAM10 antibodies (dilution 1/1000 in phosphate-buffered saline/0.05% Tween/5% milk). Bound antibodies were detected using a goat anti-rabbit peroxydase-conjugated secondary antibody (dilution 1/5000) (Amersham Pharmacia Biotech), and immunological complexes were revealed with enhanced chemiluminescence as described (6Vincent B. Paitel E. Frobert Y. Lehmann S. Grassi J. Checler F. J. Biol. Chem. 2000; 275: 35612-35616Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Identification and immunological characterization of N1 was reported previously (6Vincent B. Paitel E. Frobert Y. Lehmann S. Grassi J. Checler F. J. Biol. Chem. 2000; 275: 35612-35616Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Briefly, cells cultured in 35-mm dishes were washed twice with phosphate-buffered saline and incubated for 8 h at 37 °C in the absence (control) or in the presence of various pharmacological agents in 1 ml of serum-depleted Dulbecco's modified Eagle's medium. Media were collected, immunoprecipitated, and identified by Western blot analysis with SAF32 (see Ref. 6Vincent B. Paitel E. Frobert Y. Lehmann S. Grassi J. Checler F. J. Biol. Chem. 2000; 275: 35612-35616Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar for details). Corresponding cells were lysed, and PrPc was detected by Western blot analysis as reported (6Vincent B. Paitel E. Frobert Y. Lehmann S. Grassi J. Checler F. J. Biol. Chem. 2000; 275: 35612-35616Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). Statistical analyses were performed with Prism software (Graphpad Software, San Diego, CA) using the unpaired t test for pairwise comparisons. All results are expressed as means ± S.E. values, and statistical significance corresponds to a p value <0.05. We established that among a series of classical inhibitors that target distinct classes of proteases, only o-phenanthroline, a zinc-metalloprotease-blocking agent, was able to drastically (and to a similar extent) reduce N1 production by TSM1 and HEK293 cells whereas serine, thiol, and acidic protease inhibitors were ineffective (Fig.2A). To identify putative metalloenzymes involved in N1 production, we examined the effect of TAPI and BB3103. These inhibitors have been shown to block ADAM10 (adisintegrin andmetalloprotease) and TACE (9Middelhoven P.J. Ager A. Roos D. Verhoeven A.J. FEBS Lett. 1997; 414: 14-18Crossref PubMed Scopus (54) Google Scholar, 10Black R.A. Rauch C.T. Kozlosky C.J. Peschon J. Slack J.L. Wolfson M.F. Castner B.J. Stocking K.L. Reddy P. Srinivasan S. Nelson N. Boiani N. Schosley K.A. Gerhart M. Davis R. Fitzner J.N. Johnson R.S. Paxton R.S. March C.J. Cerretti D.P. Nature. 1997; 385: 729-733Crossref PubMed Scopus (2705) Google Scholar). These metalloenzymes are responsible for the "shedding" of various transmembrane proteins (11Massague J. Pandiella A. Annu. Rev. Biochem. 1993; 62: 515-541Crossref PubMed Scopus (600) Google Scholar, 12Hooper N.M. Karran E.H. Turner A.J. Biochem. J. 1997; 321: 265-279Crossref PubMed Scopus (560) Google Scholar) and have been shown to contribute to the constitutive and protein kinase C-regulated α-secretase cleavage of the β-amyloid precursor protein in various cell lines including HEK293 cells (13Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (983) Google Scholar, 14Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (837) Google Scholar, 15Lopez-Perez E. Zhang Y. Frank S.J. Creemers J. Seidah N. Checler F. J. Neurochem. 2001; 76: 1532-1539Crossref PubMed Scopus (120) Google Scholar). Both TAPI and BB3103 significantly reduce the production of N1 in TSM1 and HEK293 cells (Fig. 2B). It is noteworthy that a 10 μm concentration of TAPI and BB3103 diminishes constitutive N1 production to a same extent but does not totally abolish its formation (Fig. 2C, from four independent experiments). Furthermore, we established that TAPI and BB3103 did not produce an additive effect on constitutive N1 production, indicating that the two inhibitors likely block an identical protease involved in basal N1 production (not shown). Interestingly, TAPI-and BB3103-mediated reduction of N1 is very similar to that achieved by means of o-phenanthroline (Fig. 2, A–C). To delineate the respective contribution of ADAM10 and TACE in N1 formation, we set up stably transfected HEK293 cells overexpressing these enzymes (Fig. 3A). The PDBu-sensitive N1 formation was drastically enhanced in TACE-expressing cells but not in ADAM10 transfectants (Fig. 3, B andC). By contrast, ADAM 10 slightly increases constitutive production of N1 (not shown). The contribution of ADAM10 and TACE in the constitutive and PDBu-regulated N1 formation, respectively, was further examined by the selective depletion of their genes. First, we verified that wild-type mice embryonic fibroblasts also exhibit both constitutive and protein kinase C-regulated N1 formation (Fig.4A). As expected, TACE−/− and ADAM10−/− fibroblasts did not display TACE and ADAM10 immunoreactivities (Fig. 4B). The deficiency of ADAM10 gene led to a mean 51% reduction of constitutive N1 formation without altering the extent of the responsiveness to phorbol esters (Fig. 4,C and E). This reduction was consistently observed with three distinct clones (clone 3, 44 ± 7% of inhibition, n = 4; clone 7, 70 ± 4,n = 4; clone 40, 48 ± 11, n = 6). Conversely, TACE gene disruption fully abolishes the phorbol ester-stimulated N1 production without significantly affecting N1 constitutive production (Fig. 4, D and F). Transfection analysis and gene disruption clearly demonstrated that the PDBu-regulated pathway of normal PrPc is fully ascribable to TACE. By contrast, it appears that ADAM10 only partially contributes to the constitutive N1 formation as underlined by the 50% inhibition of N1 recovery observed in ADAM10−/− fibroblasts. This extent of inhibition (about 50%) matches that observed with the disintegrin inhibitors TAPI and BB3103 (Fig. 2). That TAPI- and BB3103-sensitive constitutive N1 formation is because of ADAM10 appears likely, but one cannot exclude the possibility that another disintegrin(s) also contribute to residual N1 production. In this context, it should be noted that Schlöndorff et al. (16Schlöndorff J. Lum L. Blobel C.P. J. Biol. Chem. 2001; 276: 14665-14674Abstract Full Text Full Text PDF PubMed Scopus (115) Google Scholar) described recently two shedding proteases that, based on pharmacological and biochemical properties, appear distinct from TACE and ADAM10 and that could be detected in mouse embryonic fibroblasts. It is noticeable that shedding enzymes have been characterized as proteolytic activities involved in the release of extracellular domains of various transmembrane proteins (11Massague J. Pandiella A. Annu. Rev. Biochem. 1993; 62: 515-541Crossref PubMed Scopus (600) Google Scholar, 12Hooper N.M. Karran E.H. Turner A.J. Biochem. J. 1997; 321: 265-279Crossref PubMed Scopus (560) Google Scholar). Our study is, to our knowledge, the first demonstration of the involvement of disintegrins in the cleavage of a glycosylphosphatidylinositol-anchored proteins. The parallel between the physiological cleavage occurring on the β-amyloid precursor protein (βAPP) and PrPc is extremely interesting. Thus, βAPP undergoes a normal cleavage by an activity referred to as α-secretase (for review see Ref. 17Checler F. J. Neurochem. 1995; 65: 1431-1444Crossref PubMed Scopus (421) Google Scholar). This processing leads to the secretion of sAPPα, an N-terminal fragment exhibiting neuroprotective and cytotrophic properties (18Mattson M.P. Physiol. Rev. 1997; 77: 1081-1132Crossref PubMed Scopus (877) Google Scholar). Several studies indicated that sAPPα production could also be constitutive or regulated in a protein kinase C-dependent manner (for review see Ref. 17Checler F. J. Neurochem. 1995; 65: 1431-1444Crossref PubMed Scopus (421) Google Scholar). Interestingly, several studies reported on a major involvement of disintegrins in the α-secretase cleavage of βAPP. Thus, ADAM10 appears to contribute to the constitutive sAPPα production in various cell lines (13Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (983) Google Scholar, 14Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (837) Google Scholar, 15Lopez-Perez E. Zhang Y. Frank S.J. Creemers J. Seidah N. Checler F. J. Neurochem. 2001; 76: 1532-1539Crossref PubMed Scopus (120) Google Scholar) whereas TACE is predominantly responsible for PDBu-regulated α-secretase cleavage (14Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (837) Google Scholar). In both βAPP and PrPc catabolisms, it appears that an additional and yet unidentified activity also participates to the constitutive production of either sAPPα (15Lopez-Perez E. Zhang Y. Frank S.J. Creemers J. Seidah N. Checler F. J. Neurochem. 2001; 76: 1532-1539Crossref PubMed Scopus (120) Google Scholar) or N1 (present work). Overall, the above observations indicate that both βAPP and PrPc undergo constitutive and protein kinase C-dependent normal cleavage because of two disintegrins, ADAM10 and TACE, mainly responsible for the basal and regulated breakdowns, respectively. ADAM10 and TACE cleavages occur at the 110–111/112 bond,i.e. inside the 106–126 domain that has been suggested to bear the toxic potential of the protein. Here again, it is striking to note that α-secretase, when targeting βAPP, cleaves inside a sequence domain corresponding to the β-amyloid peptide, the "pathogenic" component of senile plaques invading the cortical areas of Alzheimer's disease-affected brains (19Selkoe D.J. Annu. Rev. Neurosci. 1994; 17: 489-517Crossref PubMed Scopus (828) Google Scholar). Interestingly, it was shown that the enhancement of α-secretase cleavage by protein kinase C activation in mice engineered to overproduce the Aβ peptide led to a 50% inhibition of Aβ load in mouse brain (20Savage M. Trusko S.P. Howland D.S. Pinsker L.R. Mistretta S. Reaume A.G. Greenberg B.D. Siman R. Scott R.W. J. Neurosci. 1998; 18: 1743-1752Crossref PubMed Google Scholar). Therefore, ADAM10 and TACE could theoretically be seen as potential therapeutic targets, and increasing their activity could be seen as a means to deplete cells from the 106–126 toxic core borne by PrPc. Endogenous PrPc is thought to be necessary for infectivity of pathogenic inoculates in mice (1Prusiner S.B. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13363-13383Crossref PubMed Scopus (5130) Google Scholar, 21Blättler T. Brandner S. Raeber A.J. Klein M.A. Volgtländer T. Weissmann C. Aguzzi A. Nature. 1997; 389: 69-73Crossref PubMed Scopus (244) Google Scholar). Infectious inoculates are innocuous in mice in which the PrP gene has been knocked out. Whether infectivity is also reduced in mice overexpressing ADAM10 or TACE because of reduced endogenous content of PrPc is currently being examined. TAPI, TACE cDNA, and TACE−/− fibroblasts were generously provided by Dr. R. Black (Immunex), and BB3103 was a kind gift from British Biotech. ADAM10 cDNA was a kind gift from Dr. C. Lunn (Sherring Plough). We are indebted to Drs. Y. Zhang and S. Franck for providing anti-TACE antibodies.

Klotho is an anti-aging protein with different functions of the full-length membrane protein and the secreted hormone-like form. Using overexpression and knock-down approaches as well as embryonic fibroblasts of knock-out mice we present evidence that Klotho is shedded by the alpha-secretases ADAM10 and 17 as well as by the beta-secretase beta-APP cleaving enzyme 1. The remaining membrane-bound fragment is a substrate for regulated intramembrane proteolysis by gamma-secretase. Our data suggest that therapeutic approaches targeting these proteases should be carefully analyzed for potential side effects on Klotho-mediated physiological processes.

The immunoglobulin superfamily recognition molecule L1 plays important functional roles in the developing and adult nervous system. Metalloprotease-mediated cleavage of this adhesion molecule has been shown to stimulate cellular migration and neurite outgrowth. We demonstrate here that L1 cleavage is mediated by two distinct members of the disintegrin and metalloprotease family, ADAM10 and ADAM17. This cleavage is differently regulated and leads to the generation of a membrane bound C-terminal fragment, which is further processed through gamma-secretase activity. Pharmacological approaches with two hydroxamate-based inhibitors with different preferences in blocking ADAM10 and ADAM17, as well as loss of function and gain of function studies in murine embryonic fibroblasts, showed that constitutive shedding of L1 is mediated by ADAM10 while phorbol ester stimulation or cholesterol depletion led to ADAM17-mediated L1 cleavage. In contrast, N-methyl-d-aspartate treatment of primary neurons stimulated ADAM10-mediated L1 shedding. Both proteases were able to affect L1-mediated adhesion and haptotactic migration of neuronal cells. In particular, both proteases were involved in L1-dependent neurite outgrowth of cerebellar neurons. Thus, our data identify ADAM10 and ADAM17 as differentially regulated L1 membrane sheddases, both critically affecting the physiological functions of this adhesion protein.

Tight control of T-cell proliferation and effector function is essential to ensure an effective but appropriate immune response. Here, we reveal that this is controlled by the metalloprotease-mediated cleavage of LAG-3, a negative regulatory protein expressed by all activated T cells. We show that LAG-3 cleavage is mediated by two transmembrane metalloproteases, ADAM10 and ADAM17, with the activity of both modulated by two distinct T-cell receptor (TCR) signaling-dependent mechanisms. ADAM10 mediates constitutive LAG-3 cleavage but increases approximately 12-fold following T-cell activation, whereas LAG-3 shedding by ADAM17 is induced by TCR signaling in a PKCtheta-dependent manner. LAG-3 must be cleaved from the cell surface to allow for normal T-cell activation as noncleavable LAG-3 mutants prevented proliferation and cytokine production. Lastly, ADAM10 knockdown reduced wild-type but not LAG-3(-/-) T-cell proliferation. These data demonstrate that LAG-3 must be cleaved to allow efficient T-cell proliferation and cytokine production and establish a novel paradigm in which T-cell expansion and function are regulated by metalloprotease cleavage with LAG-3 as its sole molecular target.

Cathepsin K (catK), a lysosomal cysteine protease, was identified in a gene-profiling experiment that compared human early plaques, advanced stable plaques, and advanced atherosclerotic plaques containing a thrombus, where it was highly upregulated in advanced stable plaques.To assess the function of catK in atherosclerosis, catK(-/-)/apolipoprotein (apo) E(-/-) mice were generated. At 26 weeks of age, plaque area in the catK(-/-)/apoE(-/-) mice was reduced (41.8%) owing to a decrease in the number of advanced lesions as well as a decrease in individual advanced plaque area. This suggests an important role for catK in atherosclerosis progression. Advanced plaques of catK(-/-)/apoE(-/-) mice showed an increase in collagen content. Medial elastin fibers were less prone to rupture than those of apoE(-/-) mice. Although the relative macrophage content did not differ, individual macrophage size increased. In vitro studies of bone marrow derived-macrophages confirmed this observation. Scavenger receptor-mediated uptake (particularly by CD36) of modified LDL increased in the absence of catK, resulting in an increased macrophage size because of increased cellular storage of cholesterol esters, thereby enlarging the lysosomes.A deficiency of catK reduces plaque progression and induces plaque fibrosis but aggravates macrophage foam cell formation in atherosclerosis.

The two structurally related, major lysosomal membrane proteins LAMP-1 and LAMP-2 were for a long time regarded as crucial for the protection of the lysosomal membrane from the hostile lumenal environment. However, recent studies on the effects of single and combined LAMP-deficiency in mice reveal alternative functions. LAMP proteins, but especially LAMP-2, are important regulators in successful maturation of both autophagosomes and phagosomes. LAMP-2 deficiency causes an accumulation of autophagosomes in many tissues leading to cardiomyopathy and myopathy in mice and patients suffering from Danon Disease. The central role of LAMP-2 is also underlined by a recent study where LAMP-2 knockout mice are shown to have an impaired phagosomal maturation in neutrophils. The impairment of this important innate immune defense process in these mice leads to periodontitis, one of the most widespread infectious diseases worldwide. The retarded clearance of bacterial pathogens was probably due to an inefficient fusion capacity between lysosomes and phagosomes. Recent studies in LAMP double-knockout fibroblasts suggests that LAMP-deficiency impairs the dynein-mediated transport of lysosomes to perinuclear regions where fusion with (auto)phagosomes occurs.Addendum to: Beertsen W, Willenborg M, Everts V, Zirogianni A, Podschun R, Schroder B, Eskelinen EL, Saftig P. Impaired phagosomal maturation in neutrophils leads to periodontitis in lysosomal- associated membrane protein-2 knockout mice. J Immunol 2008; 180:475-82.

Lysosomes are organelles of eukaryotic cells that are critically involved in the degradation of macromolecules mainly delivered by endocytosis and autophagocytosis. Degradation is achieved by more than 60 hydrolases sequestered by a single phospholipid bilayer. The lysosomal membrane facilitates interaction and fusion with other compartments and harbours transport proteins catalysing the export of catabolites, thereby allowing their recycling. Lysosomal proteins have been addressed in various proteomic studies that are compared in this review regarding the source of material, the organelle/protein purification scheme, the proteomic methodology applied and the proteins identified. Distinguishing true constituents of an organelle from co-purifying contaminants is a central issue in subcellular proteomics, with additional implications for lysosomes as being the site of degradation of many cellular and extracellular proteins. Although many of the lysosomal hydrolases were identified by classical biochemical approaches, the knowledge about the protein composition of the lysosomal membrane has remained fragmentary for a long time. Using proteomics many novel lysosomal candidate proteins have been discovered and it can be expected that their functional characterisation will help to understand functions of lysosomes at a molecular level that have been characterised only phenomenologically so far and to generally deepen our understanding of this indispensable organelle.

Thyroid function depends on processing of the prohormone thyroglobulin by sequential proteolytic events.From in vitro analysis it is known that cysteine proteinases mediate proteolytic processing of thyroglobulin.Here, we have analyzed mice with deficiencies in cathepsins B, K, L, B and K, or K and L in order to investigate which of the cysteine proteinases is most important for proteolytic processing of thyroglobulin in vivo.Immunolabeling demonstrated a rearrangement of the endocytic system and a redistribution of extracellularly located enzymes in thyroids of cathepsin-deficient mice.Cathepsin L was upregulated in thyroids of cathepsin K -/-or B -/-/K -/-mice, suggesting a compensation of cathepsin L for cathepsin K deficiency.Impaired proteolysis resulted in the persistence of thyroglobulin in the thyroids of mice with deficiencies in cathepsin B or L. The typical multilayered appearance of extracellularly stored thyroglobulin was retained in cathepsin K -/-mice only.These results suggest that cathepsins B and L are involved in the solubilization of thyroglobulin from its covalently cross-linked storage form.Cathepsin K -/-/L -/-mice had significantly reduced levels of free thyroxine, indicating that utilization of luminal thyroglobulin for thyroxine liberation is mediated by a combinatory action of cathepsins K and L.

Cathepsin K is responsible for the degradation of type I collagen in osteoclast-mediated bone resorption. Collagen fragments are known to be biologically active in a number of cell types. Here, we investigate their potential to regulate osteoclast activity. Mature murine osteoclasts were seeded on type I collagen for actin ring assays or dentine discs for resorption assays. Cells were treated with cathepsins K-, L-, or MMP-1-predigested type I collagen or soluble bone fragments for 24 h. The presence of actin rings was determined fluorescently by staining for actin. We found that the percentage of osteoclasts displaying actin rings and the area of resorbed dentine decreased significantly on addition of cathepsin K-digested type I collagen or bone fragments, but not with cathepsin L or MMP-1 digests. Counterintuitively, actin ring formation was found to decrease in the presence of the cysteine proteinase inhibitor LHVS and in cathepsin K-deficient osteoclasts. However, cathepsin L deficiency or the general MMP inhibitor GM6001 had no effect on the presence of actin rings. Predigestion of the collagen matrix with cathepsin K, but not by cathepsin L or MMP-1 resulted in an increased actin ring presence in cathepsin K-deficient osteoclasts. These studies suggest that cathepsin K interaction with type I collagen is required for 1) the release of cryptic Arg-Gly-Asp motifs during the initial attachment of osteoclasts and 2) termination of resorption via the creation of autocrine signals originating from type I collagen degradation.

ADAM10 is involved in the proteolytic processing and shedding of proteins such as the amyloid precursor protein (APP), cadherins, and the Notch receptors, thereby initiating the regulated intramembrane proteolysis (RIP) of these proteins. Here, we demonstrate that the sheddase ADAM10 is also subject to RIP. We identify ADAM9 and -15 as the proteases responsible for releasing the ADAM10 ectodomain, and Presenilin/γ-Secretase as the protease responsible for the release of the ADAM10 intracellular domain (ICD). This domain then translocates to the nucleus and localizes to nuclear speckles, thought to be involved in gene regulation. Thus, ADAM10 performs a dual role in cells, as a metalloprotease when it is membrane-bound, and as a potential signaling protein once cleaved by ADAM9/15 and the γ-Secretase. ADAM10 is involved in the proteolytic processing and shedding of proteins such as the amyloid precursor protein (APP), cadherins, and the Notch receptors, thereby initiating the regulated intramembrane proteolysis (RIP) of these proteins. Here, we demonstrate that the sheddase ADAM10 is also subject to RIP. We identify ADAM9 and -15 as the proteases responsible for releasing the ADAM10 ectodomain, and Presenilin/γ-Secretase as the protease responsible for the release of the ADAM10 intracellular domain (ICD). This domain then translocates to the nucleus and localizes to nuclear speckles, thought to be involved in gene regulation. Thus, ADAM10 performs a dual role in cells, as a metalloprotease when it is membrane-bound, and as a potential signaling protein once cleaved by ADAM9/15 and the γ-Secretase. ADAMs 8The abbreviations used are: ADAM, A disintegrin and metalloprotease; ICD, intracellular domains; APP, amyloid precursor protein; CTF, C-terminal fragment; PS, presenilin; WT, wild type; PML, promyelocytic leukemia; MEF, mouse embryonic fibroblast; RIP, regulated intramembrane proteolysis. (A disintegrin and metalloprotease) are type 1 transmembrane proteins related to snake venom integrin ligands and metalloproteases. All 38 different family members feature a common modular ectodomain structure (1.Black R.A. White J.M. Curr. Opin. Cell Biol. 1998; 10: 654-659Crossref PubMed Scopus (428) Google Scholar, 2.Moss M.L. Lambert M.H. Essays Biochem. 2002; 38: 141-153Crossref PubMed Scopus (73) Google Scholar, 3.Primakoff P. Myles D.G. Trends Genet. 2000; 16: 83-87Abstract Full Text Full Text PDF PubMed Scopus (514) Google Scholar, 4.Wolfsberg T.G. Primakoff P. Myles D.G. White J.M. J. Cell Biol. 1995; 131: 275-278Crossref PubMed Scopus (441) Google Scholar) (Fig. 1A). In addition to the membrane-bound, full-length prototype, soluble ADAM variants have also been identified, consisting of only the ectodomain or fragments thereof that are released into the intercellular space. Such variants are generated by partial gene duplication (ADAM9) (5.Hotoda N. Koike H. Sasagawa N. Ishiura S. Biochem. Biophys. Res. Commun. 2002; 293: 800-805Crossref PubMed Scopus (79) Google Scholar), alternative splicing (ADAM12) (6.Gilpin B.J. Loechel F. Mattei M.G. Engvall E. Albrechtsen R. Wewer U.M. J. Biol. Chem. 1998; 273: 157-166Abstract Full Text Full Text PDF PubMed Scopus (284) Google Scholar, 7.Shi Z. Xu W. Loechel F. Wewer U.M. Murphy L.J. J. Biol. Chem. 2000; 275: 18574-18580Abstract Full Text Full Text PDF PubMed Scopus (168) Google Scholar), or proteolysis (ADAMs 8, 13, and 19) (8.Gaultier A. Cousin H. Darribere T. Alfandari D. J. Biol. Chem. 2002; 277: 23336-23344Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar, 9.Kang T. Park H.I. Suh Y. Zhao Y.G. Tschesche H. Sang Q.X. J. Biol. Chem. 2002; 277: 48514-48522Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar, 10.Schlomann U. Wildeboer D. Webster A. Antropova O. Zeuschner D. Knight C.G. Docherty A.J. Lambert M. Skelton L. Jockusch H. Bartsch J.W. J. Biol. Chem. 2002; 277: 48210-48219Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar). ADAMs can be grouped either by their tissue distribution and/or functional properties. One major group (ADAMs 2, 3, 5, 6, 16, 18, 20, 21, 24, 25, 26, 29, and 30) is expressed exclusively in the male gonad, with an emerging role in sperm maturation. A second group (ADAMs 2, 7, 11, 18, 22, 23, and 29) is characterized by an inactive protease domain, and they seem to be mainly important for cell adhesion and fusion. A large third group of ADAMs displays a broad expression profile and has demonstrated (ADAMs 8, 9, 10, 12, 17, 19, and 28) or predicted (ADAMs 15, 20, 21, 30, and 33) proteolytic activity. These proteases play a major role in the ectodomain shedding of proteins involved in paracrine signaling, cell adhesion, and intracellular signaling (reviewed in Refs. 11.Blobel C.P. Nat. Rev. 2005; 6: 32-43Crossref Scopus (923) Google Scholar and 12.Tousseyn T. Jorissen E. Reiss K. Hartmann D. Birth Defects Res. C Embryo Today. 2006; 78: 24-46Crossref PubMed Scopus (49) Google Scholar). The site specificity of the cleavage of these substrates is rather relaxed, and apparently different family members can mutually compensate for each other. This has been illustrated particularly well for the amyloid precursor protein (APP) (13.Asai M. Hattori C. Szabo B. Sasagawa N. Maruyama K. Tanuma S. Ishiura S. Biochem. Biophys. Res. Commun. 2003; 301: 231-235Crossref PubMed Scopus (255) Google Scholar, 14.Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J.J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (838) Google Scholar, 15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar, 16.Koike H. Tomioka S. Sorimachi H. Saido T.C. Maruyama K. Okuyama A. Fujisawa-Sehara A. Ohno S. Suzuki K. Ishiura S. Biochem. J. 1999; 343: 371-375Crossref PubMed Scopus (232) Google Scholar, 17.Weskamp G. Cai H. Brodie T.A. Higashyama S. Manova K. Ludwig T. Blobel C.P. Mol. Cell. Biol. 2002; 22: 1537-1544Crossref PubMed Scopus (175) Google Scholar). ADAM10 is one of the proteolytically active ADAM members (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar, 18.Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (985) Google Scholar, 19.Maretzky T. Reiss K. Ludwig A. Buchholz J. Scholz F. Proksch E. de Strooper B. Hartmann D. Saftig P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9182-9187Crossref PubMed Scopus (536) Google Scholar, 20.Postina R. Schroeder A. Dewachter I. Bohl J. Schmitt U. Kojro E. Prinzen C. Endres K. Hiemke C. Blessing M. Flamez P. Dequenne A. Godaux E. van Leuven F. Fahrenholz F. J. Clin. Investig. 2004; 113: 1456-1464Crossref PubMed Scopus (528) Google Scholar, 21.Reiss K. Maretzky T. Ludwig A. Tousseyn T. de Strooper B. Hartmann D. Saftig P. EMBO J. 2005; 24: 742-752Crossref PubMed Scopus (398) Google Scholar). The list of ADAM10 substrates is still growing, confirming the central role of ADAM10 in many important biological processes, such as cell migration and axonal navigation (robo receptors and ephrins (22.Janes P.W. Saha N. Barton W.A. Kolev M.V. Wimmer-Kleikamp S.H. Nievergall E. Blobel C.P. Himanen J.P. Lackmann M. Nikolov D.B. Cell. 2005; 123: 291-304Abstract Full Text Full Text PDF PubMed Scopus (365) Google Scholar, 23.Mancia F. Shapiro L. Cell. 2005; 123: 185-187Abstract Full Text Full Text PDF PubMed Scopus (17) Google Scholar), cell adhesion (cadherins (19.Maretzky T. Reiss K. Ludwig A. Buchholz J. Scholz F. Proksch E. de Strooper B. Hartmann D. Saftig P. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 9182-9187Crossref PubMed Scopus (536) Google Scholar, 21.Reiss K. Maretzky T. Ludwig A. Tousseyn T. de Strooper B. Hartmann D. Saftig P. EMBO J. 2005; 24: 742-752Crossref PubMed Scopus (398) Google Scholar), CD44 and L1 (24.Mechtersheimer S. Gutwein P. Agmon-Levin N. Stoeck A. Oleszewski M. Riedle S. Postina R. Fahrenholz F. Fogel M. Lemmon V. Altevogt P. J. Cell Biol. 2001; 155: 661-673Crossref PubMed Scopus (28) Google Scholar)), and regulation of immune reactions, and control of apoptosis (FasL) (25.Schulte M. Reiss K. Lettau M. Maretzky T. Ludwig A. Hartmann D. de Strooper B. Janssen O. Saftig P. Cell Death & Differ. 2007; 14: 1040-1049Crossref PubMed Scopus (149) Google Scholar). Importantly, genetic ablation of ADAM10 in vertebrates (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar) and invertebrates (26.Lieber T. Kidd S. Young M.W. Genes Dev. 2002; 16: 209-221Crossref PubMed Scopus (191) Google Scholar, 27.Pan D. Rubin G.M. Cell. 1997; 90: 271-280Abstract Full Text Full Text PDF PubMed Scopus (361) Google Scholar, 28.Sotillos S. Roch F. Campuzano S. Development (Camb.). 1997; 124: 4769-4779PubMed Google Scholar, 29.Wen C. Metzstein M.M. Greenwald I. Development (Camb.). 1997; 124: 4759-4767PubMed Google Scholar) mainly results in loss of Notch phenotypes, indicating the crucial role for this protease in the Notch signaling pathway (30.Hattori M. Osterfield M. Flanagan J.G. Science. 2000; 289: 1360-1365Crossref PubMed Scopus (462) Google Scholar, 31.Rooke J. Pan D. Xu T. Rubin G.M. Science. 1996; 273: 1227-1231Crossref PubMed Scopus (301) Google Scholar). Finally, ADAM10 is emerging as a major player in human disease. It is up-regulated in several tumors (32.McCulloch D.R. Akl P. Samaratunga H. Herington A.C. Odorico D.M. Clin. Cancer Res. 2004; 10: 314-323Crossref PubMed Scopus (82) Google Scholar), and it is also considered to be protective in Alzheimer disease as it is one of the major α-secretases, cleaving APP within the amyloid-β (Aβ) peptide sequence, which thus precludes amyloid plaque formation (13.Asai M. Hattori C. Szabo B. Sasagawa N. Maruyama K. Tanuma S. Ishiura S. Biochem. Biophys. Res. Commun. 2003; 301: 231-235Crossref PubMed Scopus (255) Google Scholar, 18.Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (985) Google Scholar, 20.Postina R. Schroeder A. Dewachter I. Bohl J. Schmitt U. Kojro E. Prinzen C. Endres K. Hiemke C. Blessing M. Flamez P. Dequenne A. Godaux E. van Leuven F. Fahrenholz F. J. Clin. Investig. 2004; 113: 1456-1464Crossref PubMed Scopus (528) Google Scholar, 33.Deuss M. Reiss K. Hartmann D. Curr. Alzheimer Res. 2008; 5: 187-201Crossref PubMed Scopus (89) Google Scholar). Interestingly, two other ADAMs (9.Kang T. Park H.I. Suh Y. Zhao Y.G. Tschesche H. Sang Q.X. J. Biol. Chem. 2002; 277: 48514-48522Abstract Full Text Full Text PDF PubMed Scopus (27) Google Scholar and 17.Weskamp G. Cai H. Brodie T.A. Higashyama S. Manova K. Ludwig T. Blobel C.P. Mol. Cell. Biol. 2002; 22: 1537-1544Crossref PubMed Scopus (175) Google Scholar) have also demonstrated α-secretase activity in vitro (13.Asai M. Hattori C. Szabo B. Sasagawa N. Maruyama K. Tanuma S. Ishiura S. Biochem. Biophys. Res. Commun. 2003; 301: 231-235Crossref PubMed Scopus (255) Google Scholar, 14.Buxbaum J.D. Liu K.N. Luo Y. Slack J.L. Stocking K.L. Peschon J.J. Johnson R.S. Castner B.J. Cerretti D.P. Black R.A. J. Biol. Chem. 1998; 273: 27765-27767Abstract Full Text Full Text PDF PubMed Scopus (838) Google Scholar, 16.Koike H. Tomioka S. Sorimachi H. Saido T.C. Maruyama K. Okuyama A. Fujisawa-Sehara A. Ohno S. Suzuki K. Ishiura S. Biochem. J. 1999; 343: 371-375Crossref PubMed Scopus (232) Google Scholar, 18.Lammich S. Kojro E. Postina R. Gilbert S. Pfeiffer R. Jasionowski M. Haass C. Fahrenholz F. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 3922-3927Crossref PubMed Scopus (985) Google Scholar). Thus, stimulating α-secretase cleavage is an interesting therapeutic option for Alzheimer disease (20.Postina R. Schroeder A. Dewachter I. Bohl J. Schmitt U. Kojro E. Prinzen C. Endres K. Hiemke C. Blessing M. Flamez P. Dequenne A. Godaux E. van Leuven F. Fahrenholz F. J. Clin. Investig. 2004; 113: 1456-1464Crossref PubMed Scopus (528) Google Scholar). A fascinating aspect of ADAM10-mediated proteolysis is the initiation of regulated intramembrane proteolysis (RIP), which is characterized by two consecutive cleavage steps. First, the ectodomain is shed to generate a soluble ectodomain (11.Blobel C.P. Nat. Rev. 2005; 6: 32-43Crossref Scopus (923) Google Scholar, 34.Sahin U. Weskamp G. Kelly K. Zhou H.M. Higashiyama S. Peschon J. Hartmann D. Saftig P. Blobel C.P. J. Cell Biol. 2004; 164: 769-779Crossref PubMed Scopus (785) Google Scholar). Then, the remaining transmembrane C-terminal fragment (CTFs) becomes a substrate for intramembrane cleaving proteases such as Presenilin/γ-Secretase (35.Kopan R. Ilagan M.X. Nat. Rev. 2004; 5: 499-504Crossref Scopus (498) Google Scholar). The fragments generated by this cleavage are released both externally and internally from the membrane and are, in many instances, involved in cell signaling pathways. Notch signaling has been particularly well investigated and it is well known that the Notch intracellular domain, upon release by Presenilin/γ-Secretase, translocates to the cell nucleus and regulates transcription of a series of Notch target genes in so-called transcription factories (36.Brou C. Logeat F. Gupta N. Bessia C. LeBail O. Doedens J.R. Cumano A. Roux P. Black R.A. Israel A. Mol. Cell. 2000; 5: 207-216Abstract Full Text Full Text PDF PubMed Scopus (895) Google Scholar, 37.De Strooper B. Annaert W. Cupers P. Saftig P. Craessaerts K. Mumm J.S. Schroeter E.H. Schrijvers V. Wolfe M.S. Ray W.J. Goate A. Kopan R. Nature. 1999; 398: 518-522Crossref PubMed Scopus (1800) Google Scholar, 38.Mumm J.S. Schroeter E.H. Saxena M.T. Griesemer A. Tian X. Pan D.J. Ray W.J. Kopan R. Mol. Cell. 2000; 5: 197-206Abstract Full Text Full Text PDF PubMed Scopus (700) Google Scholar, 39.Struhl G. Greenwald I. Nature. 1999; 398: 522-525Crossref PubMed Scopus (702) Google Scholar, 40.Konietzko, U., Goodger, Z. V., Meyer, M., Kohli, B. M., Bosset, J., Lahiri, D. K., and Nitsch, R. M. (2008) Neurobiol. Aging, in pressGoogle Scholar, 41.Xu M. Cook P.R. J. Cell Biol. 2008; 181: 615-623Crossref PubMed Scopus (114) Google Scholar). Presenilin (PS), an aspartyl protease, is the catalytic subunit of the γ-Secretase complex (42.De Strooper B. Saftig P. Craessaerts K. Vanderstichele H. Guhde G. Annaert W. Von Figura K. Van Leuven F. Nature. 1998; 391: 387-390Crossref PubMed Scopus (1552) Google Scholar, 43.Wolfe M.S. Xia W. Ostaszewski B.L. Diehl T.S. Kimberly W.T. Selkoe D.J. Nature. 1999; 398: 513-517Crossref PubMed Scopus (1692) Google Scholar). Two different genes encode PS1 and PS2, respectively, which each integrate into different γ-Secretase complexes (44.De Strooper B. Neuron. 2003; 38: 9-12Abstract Full Text Full Text PDF PubMed Scopus (838) Google Scholar). Although many γ-Secretase substrates have been discovered (reviewed by Kopan (35.Kopan R. Ilagan M.X. Nat. Rev. 2004; 5: 499-504Crossref Scopus (498) Google Scholar)), the extent to which the released intracellular domain fragments are important for signaling is not completely clear as most of the work is based on in vitro experiments. Thus, the possibility exists that, in many cases, the γ-Secretase could act as an “intramembrane proteasome,” removing residual transmembrane protein fragments that were generated by for instance, ectodomain shedding mediated by ADAM members, to avoid creating a bottleneck in the plasma membrane (35.Kopan R. Ilagan M.X. Nat. Rev. 2004; 5: 499-504Crossref Scopus (498) Google Scholar). Here we demonstrate the surprising finding that ADAM10, apart from its central role in protein shedding and the initiation of regulated intramembrane proteolysis of several substrates, is itself subject to a similar proteolytic cascade. This suggests that ADAM10 has, in addition to its important function as a membrane-tethered sheddase, also the potential to be a signal transducing protein itself. Animals, Cell Cultures, and Tissues—Mice and derived cell lines and the technique used for their derivation and maintenance were as published (17.Weskamp G. Cai H. Brodie T.A. Higashyama S. Manova K. Ludwig T. Blobel C.P. Mol. Cell. Biol. 2002; 22: 1537-1544Crossref PubMed Scopus (175) Google Scholar, 45.Hartmann D. Tournoy J. Saftig P. Annaert W. De Strooper B. J. Mol. Neurosci. 2001; 17: 171-181Crossref PubMed Scopus (64) Google Scholar, 46.Nyabi O. Bentahir M. Horre K. Herreman A. Gottardi-Littell N. Van Broeckhoven C. Merchiers P. Spittaels K. Annaert W. De Strooper B. J. Biol. Chem. 2003; 278: 43430-43436Abstract Full Text Full Text PDF PubMed Scopus (96) Google Scholar). Primary murine glial and cortical neuronal cultures were established from brains of embryonic day 14.5 mice, as described previously (47.Cai D. Qiu J. Cao Z. McAtee M. Bregman B.S. Filbin M.T. J. Neurosci. 2001; 21: 4731-4739Crossref PubMed Google Scholar). cDNA Constructs—Full-length murine ADAM9 and ADAM15 as well as ADAM9EA and ADAM15EA catalytically inactive mutant constructs were kind gifts from C. P. Blobel (48.Kratzschmar J. Lum L. Blobel C.P. J. Biol. Chem. 1996; 271: 4593-4596Abstract Full Text Full Text PDF PubMed Scopus (155) Google Scholar, 49.Weskamp G. Kratzschmar J. Reid M.S. Blobel C.P. J. Cell Biol. 1996; 132: 717-726Crossref PubMed Scopus (184) Google Scholar). ADAM10 cDNA (complete cds of GenBank™ sequence AF011379) was obtained by PCR from a murine 129/SvJ cDNA library and was recloned into a modified PSG5 expression vector (Stratagene). A VP16-Gal4 sequence (50.Annaert W.G. Esselens C. Baert V. Boeve C. Snellings G. Cupers P. Craessaerts K. De Strooper B. Neuron. 2001; 32: 579-589Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar) was subcloned into mADAM10 cDNA after introduction of an HpaI restriction site in the ADAM10 C terminus via site-directed mutagenesis (Stratagene) at positions G745V,H746N. A mADAM10 construct lacking the ectodomain (containing a signal peptide sequence (amino acids 1-19) joined to amino acids 669-749) was FLAG-tagged (CTTGTCATCGTCGTCCTTGTAGTC) before the stop codon at the C terminus. The PCR product was ligated into a pcDNA3.1 vector (ADAM10ΔE-flag). All constructs were sequenced and contained no errors. For COS and HEK293 cell transfections we used FuGENE 6 (Roche) or Genejuice (Merck Biosciences), according to the manufacturer's protocol. Sample Preparation—Cell extracts were obtained as described before (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar). Phenanthroline was added to the protease inhibitor mixture to prevent autocleavage during the extraction procedure, as previously described for TACE (51.Schlondorff J. Becherer J.D. Blobel C.P. Biochem. J. 2000; 347: 131-138Crossref PubMed Scopus (312) Google Scholar). The γ-Secretase inhibitor X (carbamic acid tert-butyl ester L-685,458, Calbiochem) was used at 0.1 μm in medium with 2% fetal calf serum, unless otherwise specified (52.Shearman M.S. Beher D. Clarke E.E. Lewis H.D. Harrison T. Hunt P. Nadin A. Smith A.L. Stevenson G. Castro J.L. Biochemistry. 2000; 39: 8698-8704Crossref PubMed Scopus (367) Google Scholar). Membrane extracts and whole protein extracts were prepared as described previously (53.Serneels L. Dejaegere T. Craessaerts K. Horre K. Jorissen E. Tousseyn T. Hebert S. Coolen M. Martens G. Zwijsen A. Annaert W. Hartmann D. De Strooper B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1719-1724Crossref PubMed Scopus (159) Google Scholar). Shedding Assay—After 24 h of serum starvation (53.Serneels L. Dejaegere T. Craessaerts K. Horre K. Jorissen E. Tousseyn T. Hebert S. Coolen M. Martens G. Zwijsen A. Annaert W. Hartmann D. De Strooper B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1719-1724Crossref PubMed Scopus (159) Google Scholar) culture medium was replaced with fresh serum-free medium containing one of the following protease inhibitors (Calbiochem): TAPI-1 (25 μm), TAPI-2 (25 μm), GM6001 (50 μm), or the appropriate vehicle control. Following 24 h incubation cell viability was checked, cell extracts were obtained, and cell culture supernatants were concentrated ×20 by ultrafiltration (Centricon-10/Millipore). α-Secretase Fluorescence Resonance Energy Transfer Assay—Cell extracts and concentrated supernatant of ADAM10-/- and WT MEFs, after overnight conditioning in serum-free medium, were incubated with a fluorogenic substrate peptide mimicking the APP α-secretase cleavage site as indicated by the manufacturer (R&D Systems). Fluorogenic emission was measured by Victor2 (PerkinElmer Life Sciences) at 495 nm. Subcellular Fractionation—Postnuclear supernatants were prepared using a sucrose step gradient protocol (adapted from Fleischer and Kervina (54.Fleischer S. Kervina M. Methods Enzymol. 1974; 31: 6-41Crossref PubMed Scopus (362) Google Scholar)). Pooled cells from five 10-cm culture dishes, after 1.5 h treatment with 20 ng/ml leptomycin B (Sigma) (52.Shearman M.S. Beher D. Clarke E.E. Lewis H.D. Harrison T. Hunt P. Nadin A. Smith A.L. Stevenson G. Castro J.L. Biochemistry. 2000; 39: 8698-8704Crossref PubMed Scopus (367) Google Scholar), were harvested and homogenized in ice-cold buffer (20 mm Hepes-NaOH, pH 7.4, 5 mm MgCl2, 0.25 m sucrose with 0.2 m dithiothreitol, protease inhibitors, without EDTA) using a glass Dounce homogenizer (type S). Cell disruption and integrity of nuclei were checked. SHM2.1 (20 mm Hepes-NaOH, pH 7.4, 5 mm MgCl2, 2.1 m sucrose) was added to the homogenate to obtain a final sucrose concentration of 1.5 m and after centrifugation at 29,000 × g (TST41), the pellet was resuspended in SHM 0.25 (20 mm Hepes-NaOH, pH 7.4, 5 mm MgCl2, 0.25 m sucrose). Fractions were collected and analyzed by Western blotting. SDS-PAGE proteins were separated and transferred as described before (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar). Primary antibodies (overnight at 4 °C) and horseradish peroxidase-tagged (Dako) secondary antibodies (1 h at room temperature) were applied. ADAM10 was detected using the polyclonal antiserum (B42.1), generated against the 17 C-terminal amino acid residues (15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar). N-terminal-specific antibody MAB946 (R&D Systems) only detected ADAM10 when sample buffer contained 1 μm N-ethylmaleimide (Pierce) instead of β-mercaptoethanol (55.Partis M.D. J. Prot. Chem. 1983; 2: 263-277Crossref Scopus (147) Google Scholar). APP fragments, PS1, PS2, and ADAM15 were detected, respectively, using antibodies B63.1, B19.3, B22.4, and SM86-2, as described previously (56.Herreman A. Hartmann D. Annaert W. Saftig P. Craessaerts K. Serneels L. Umans L. Schrijvers V. Checler F. Vanderstichele H. Baekelandt V. Dressel R. Cupers P. Huylebroeck D. Zwijsen A. Van Leuven F. De Strooper B. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11872-11877Crossref PubMed Scopus (436) Google Scholar, 57.Horiuchi K. Weskamp G. Lum L. Hammes H.P. Cai H. Brodie T.A. Ludwig T. Chiusaroli R. Baron R. Preissner K.T. Manova K. Blobel C.P. Mol. Cell. Biol. 2003; 23: 5614-5624Crossref PubMed Scopus (154) Google Scholar). ADAM9 and Sp1 (Santa Cruz) and β-actin (Sigma) were detected by commercial antisera. Blots were developed using the ECL Detection System (Amersham Biosciences) or SuperSignal (Pierce). Signal densities were quantified (in the linear range) with Totallab version 2.01 (GE Healthcare). Luciferase Assay—COS cells were transfected with 200 ng of pFRluc plasmid (Promega) DNA and 200 ng of inducer plasmid DNA: ADAM10-VP16-GAL4, APP-C99-GAL4-VP16, GAL-VP16, or empty vector. The GAL4-VP16 construct without a membrane anchor was used as a γ-Secretase independent positive control. After 24 h, cells were incubated with or without inhibitor X, and after 16 h were lysed and assayed (Victor2; PerkinElmer Life Sciences) (53.Serneels L. Dejaegere T. Craessaerts K. Horre K. Jorissen E. Tousseyn T. Hebert S. Coolen M. Martens G. Zwijsen A. Annaert W. Hartmann D. De Strooper B. Proc. Natl. Acad. Sci. U. S. A. 2005; 102: 1719-1724Crossref PubMed Scopus (159) Google Scholar). Confocal Laser Scanning Microscopy—HEK293 cells transfected with ADAM10ΔE-flag were fixed after 24 h in 1% paraformaldehyde (10 min at room temperature), permeabilized by methanol (-20 °C) or 0.5% Triton X-100/phosphate-buffered saline (5 min), and processed for indirect immunofluorescence (50.Annaert W.G. Esselens C. Baert V. Boeve C. Snellings G. Cupers P. Craessaerts K. De Strooper B. Neuron. 2001; 32: 579-589Abstract Full Text Full Text PDF PubMed Scopus (184) Google Scholar). Primary antibodies (overnight at 4 °C) and Alexa 488- or 568-conjugated (Molecular Probes, Inc) or Cy3-(shown in red) or Cy2-conjugated (shown in green) (Jackson ImmunoResearch) secondary antibodies (1 h at room temperature) were applied and nuclei were counterstained using Hoechst Bisbenzimid H33342 (Sigma) (10 min at room temperature). Monoclonal M2 and polyclonal anti-FLAG antibodies, as well as antibodies detecting PML, coilin, bromodeoxyuridine, and nucleophosmin/B23 were purchased from Sigma. Antibodies against lamin B and sc-35 were purchased from Santa Cruz and BD Transduction Laboratories, respectively. Coverslips were mounted using Mowiol (Calbiochem). After staining, cells were examined using an inverted microscope (Eclipse E800, Nikon; Plan Apo ×60/1.40 oil) connected to a confocal microscope (Radiance 2100; Zeiss or Leica SP2) and images were acquired using LaserSharp 2000 software. Images were processed in Adobe Photoshop CS. Speckled nuclei were defined as cells containing 3 or more large or 5 or more small granular “speckle-like” structures in their nucleus. 100 FLAG-positive cells were counted manually in a blind fashion to quantify the effect of γ-secretase inhibition (overnight at 37 °C). The number of speckled cells (mean of three experiments) is indicated as a percentage of the amount of ADAM10ΔE-flag-transfected cells. Statistical Analysis—Data were subjected to statistical analysis (one-way analysis of variance with a Bonferroni correction) to determine their significance. p values are demonstrated in the figures using asterisks (*, p < 0.05; **, p < 0.01; ***, p < 0.001). The ADAM10 Ectodomain Is Shed from Fibroblasts in Vitro—In Western blots of whole cell homogenates, ADAM10 appears as a doublet band of ∼85 and 65 kDa, corresponding to the unprocessed pro-form and the mature enzyme, respectively (58.Anders A. Gilbert S. Garten W. Postina R. Fahrenholz F. FASEB J. 2001; 15: 1837-1839Crossref PubMed Scopus (187) Google Scholar). In addition a band at ∼10 kDa is observed that reacts exclusively with C terminus-specific antibodies (ADAM10 CTF, Fig. 1, A and B). It is noteworthy that in some experiments the ADAM10 CTF appears as a doublet band (e.g. Fig. 2B, fourth panel). In the culture supernatant samples of the cells, we also observed a soluble protein at ∼55 kDa that was immunoreactive with antibodies against the ADAM10 N terminus but not C terminus (soluble = sADAM10, Fig. 1B). These bands were undetectable in cell extracts and supernatants from ADAM10-/- MEFs (Fig. 1B). Thus, ADAM10 is apparently processed by an unknown protease generating a membrane-bound C-terminal fragment and a secreted, soluble ectodomain. We checked whether the ADAM10 ectofragment shed in the medium retained its proteolytic activity. The supernatant of wild-type MEFs cleaves a synthetic peptide containing the α-secretase cleavage site of APP in a fluorescence resonance energy transfer assay. This activity is strongly reduced in supernatant of MEFs lacking ADAM10 (Fig. 1C). In separate experiments we could demonstrate that removal of ADAM10 from the supernatant by immunoprecipitation also reduces significantly proteolytic activity (data not shown). ADAM10 CTFs were also observed in cell lysates of cultured neurons and astrocytes (Fig. 1D) and in vivo in brain, liver, lung, heart, and kidney tissue from both embryo (Fig. 1E) and adult mice (data not shown). As shown in Fig. 1E, considerable differences in ADAM10 processing are observed in different tissues. In particular the heart (which is strongly affected by ADAM10 deficiency, see Ref. 15.Hartmann D. de Strooper B. Serneels L. Craessaerts K. Herreman A. Annaert W. Umans L. Lubke T. Lena Illert A. von Figura K. Saftig P. Hum. Mol. Genet. 2002; 11: 2615-2624Crossref PubMed Google Scholar) displays an abundant accumulation of the ADAM10 CTF. ADAM10 Shedding Depends on ADAMs 9 and 15—To identify the proteases responsible for ADAM10 shedding, we screened wild-type MEF cultures with a panel of inhibitors against all major classes of proteases, but only the metalloprotease inhibitors GM6001, TAPI1, and TAPI2 reduced ADAM10 CTF and sADAM10 accumulation in MEFs, suggesting that the ADAM10 sheddase(s) belong(s) to the metalloprotease family (Fig. 2A). Members of the ADAM family are known to be important ectodomain shedding metalloproteases. So far, only 12 of the 38 ADAMs have demonstrated (ADAMs 8, 9, 10, 12, 17, 19, and 28) or predicted (ADAMs 15, 20, 21, 30, and 33) active MP domains. Consequently, we investigated ADAM10 shedding in MEF cell lines deficient in expression of ADAMs 9, 15, and 19 and cell lines deficie

The paramount importance of the homeostasis of the extracellular matrix for pulmonary function is exemplified by two opposing extremes: emphysema and pulmonary fibrosis. This study examined the putative role of cathepsin K (catK) in the pathology of lung fibrosis in mice and its relevance to the human disease activity. We compared the induction of lung fibrosis by administration of bleomycin. CTSK(-/-) mice deposited significantly more extracellular matrix than control mice. Primary lung fibroblasts derived from CTSK(-/-) mice showed a decreased collagenolytic activity indicating the role of catK in collagen degradation. Interestingly, CTSK(+/+) control mice revealed an increased expression of catK in fibrotic lung regions suggesting a protective role of catK to counter the excessive deposition of collagen matrix in the diseased lung. Similarly, in lung specimens obtained from patients with lung fibrosis fibroblasts expressed larger amounts of catK than those obtained from normal lungs. Activation of human pulmonary fibroblasts in primary cell cultures led to an increased activity of catK through enhanced gene transcription and protein expression and to increased intracellular collagenolytic activity. We believe that this is the first study to show that catK plays a pivotal role in lung matrix homeostasis under physiological and pathological conditions.

Lysosomal membranes contain two highly glycosylated proteins, designated LAMP-1 and LAMP-2, as major components. LAMP-1 and LAMP-2 are structurally related. To investigate the physiological role of LAMP-1, we have generated mice deficient for this protein. LAMP-1-deficient mice are viable and fertile. In LAMP-1-deficient brain, a mild regional astrogliosis and altered immunoreactivity against cathepsin-D was observed. Histological and ultrastructural analyses of all other tissues did not reveal abnormalities. Lysosomal properties, such as enzyme activities, lysosomal pH, osmotic stability, density, shape, and subcellular distribution were not changed in comparison with controls. Western blot analyses of LAMP-1-deficient and heterozygote tissues revealed an up-regulation of the LAMP-2 protein pointing to a compensatory effect of LAMP-2 in response to the LAMP-1 deficiency. The increase of LAMP-2 was neither correlated with an increase in the level of<i>lamp-2</i> mRNAs nor with increased half-life time of LAMP-2. This findings suggest a translational regulation of LAMP-2 expression.

Osteoclastic bone degradation involves the activity of cathepsin K. We found that in addition to this enzyme other, yet unknown, cysteine proteinases participate in digestion. The results support the notion that osteoclasts from different bone sites use different enzymes to degrade the collagenous bone matrix.The osteoclast resorbs bone by lowering the pH in the resorption lacuna, which is followed by secretion of proteolytic enzymes. One of the enzymes taken to be essential in resorption is the cysteine proteinase, cathepsin K. Some immunolabeling and enzyme inhibitor data, however, suggest that other cysteine proteinases and/or proteolytic enzymes belonging to the group of matrix metalloproteinases (MMPs) may participate in the degradation. In this study, we investigated whether, in addition to cathepsin K, other enzymes participate in osteoclastic bone degradation.In bones obtained from mice deficient for cathepsin K, B, or L or a combination of K and L, the bone-resorbing activity of osteoclasts was analyzed at the electron microscopic level. In addition, bone explants were cultured in the presence of different selective cysteine proteinase inhibitors and an MMP inhibitor, and the effect on resorption was assessed. Because previous studies showed differences in resorption by calvarial osteoclasts compared with those present in long bones, in all experiments, the two types of bone were compared. Finally, bone extracts were analyzed for the level of activity of cysteine proteinases and the effect of inhibitors hereupon.The analyses of the cathepsin-deficient bone explants showed that, in addition to cathepsin K, calvarial osteoclasts use other cysteine proteinases to degrade bone matrix. It was also shown that, in the absence of cathepsin K, long bone osteoclasts use MMPs for resorption. Cathepsin L proved to be involved in the MMP-mediated resorption of bone by calvarial osteoclasts; in the absence of this cathepsin, calvarial osteoclasts do not use MMPs for resorption. Selective inhibitors of cathepsin K and other cysteine proteinases showed a stronger effect on calvarial resorption than on long bone resorption.Our findings suggest that (1) cathepsin K-deficient long bone osteoclasts compensate the lack of this enzyme by using MMPs in the resorption of bone matrix; (2) cathepsin L is involved in MMP-mediated resorption by calvarial osteoclasts; (3) in addition to cathepsin K, other, yet unknown, cysteine proteinases are likely to participate in skull bone degradation; and finally, (4) the data provide strong additional support for the existence of functionally different bone-site specific osteoclasts.

Protein ectodomain shedding is crucial for cell-cell interactions because it controls the bioavailability of soluble tumor necrosis factor-α (TNFα) and ligands of the epidermal growth factor (EGF) receptor, and the release of many other membrane proteins. Various stimuli can rapidly trigger ectodomain shedding, yet much remains to be learned about the identity of the enzymes that respond to these stimuli and the mechanisms underlying their activation. Here, we demonstrate that the membrane-anchored metalloproteinase ADAM17, but not ADAM10, is the sheddase that rapidly responds to the physiological signaling pathways stimulated by thrombin, EGF, lysophosphatidic acid and TNFα. Stimulation of ADAM17 is swift and quickly reversible, and does not depend on removal of its inhibitory pro-domain by pro-protein convertases, or on dissociation of an endogenous inhibitor, TIMP3. Moreover, activation of ADAM17 by physiological stimuli requires its transmembrane domain, but not its cytoplasmic domain, arguing against inside-out signaling via cytoplasmic phosphorylation as the underlying mechanism. Finally, experiments with the tight binding hydroxamate inhibitor DPC333, used here to probe the accessibility of the active site of ADAM17, demonstrate that this inhibitor can quickly bind to ADAM17 in stimulated, but not quiescent cells. These findings support the concept that activation of ADAM17 involves a rapid and reversible exposure of its catalytic site.

The apoptosis-inducing Fas ligand (FasL) is a type II transmembrane protein that is involved in the downregulation of immune reactions by activation-induced cell death (AICD) as well as in T cell-mediated cytotoxicity. Proteolytic cleavage leads to the generation of membrane-bound N-terminal fragments and a soluble FasL (sFasL) ectodomain. sFasL can be detected in the serum of patients with dysregulated inflammatory diseases and is discussed to affect Fas-FasL-mediated apoptosis. Using pharmacological approaches in 293T cells, in vitro cleavage assays as well as loss and gain of function studies in murine embryonic fibroblasts (MEFs), we demonstrate that the disintegrin and metalloprotease ADAM10 is critically involved in the shedding of FasL. In primary human T cells, FasL shedding is significantly reduced after inhibition of ADAM10. The resulting elevated FasL surface expression is associated with increased killing capacity and an increase of T cells undergoing AICD. Overall, our findings suggest that ADAM10 represents an important molecular modulator of FasL-mediated cell death.

Presenilin 1 (PS1) interacts with telencephalin (TLN) and the amyloid precursor protein via their transmembrane domain (Annaert, W.G., C. Esselens, V. Baert, C. Boeve, G. Snellings, P. Cupers, K. Craessaerts, and B. De Strooper. 2001. Neuron. 32:579–589). Here, we demonstrate that TLN is not a substrate for γ-secretase cleavage, but displays a prolonged half-life in PS1−/− hippocampal neurons. TLN accumulates in intracellular structures bearing characteristics of autophagic vacuoles including the presence of Apg12p and LC3. Importantly, the TLN accumulations are suppressed by adenoviral expression of wild-type, FAD-linked and D257A mutant PS1, indicating that this phenotype is independent from γ-secretase activity. Cathepsin D deficiency also results in the localization of TLN to autophagic vacuoles. TLN mediates the uptake of microbeads concomitant with actin and PIP2 recruitment, indicating a phagocytic origin of TLN accumulations. Absence of endosomal/lysosomal proteins suggests that the TLN-positive vacuoles fail to fuse with endosomes/lysosomes, preventing their acidification and further degradation. Collectively, PS1 deficiency affects in a γ-secretase–independent fashion the turnover of TLN through autophagic vacuoles, most likely by an impaired capability to fuse with lysosomes.

CX3CL1 (fractalkine) and CXCL16 are unique members of the chemokine family because they occur not only as soluble, but also as membrane-bound molecules. Expressed as type I transmembrane proteins, the ectodomain of both chemokines can be proteolytically cleaved from the cell surface, a process known as shedding. Our previous studies showed that the disintegrin and metalloproteinase 10 (ADAM10) mediates the largest proportion of constitutive CX3CL1 and CXCL16 shedding, but is not involved in the phorbolester-induced release of the soluble chemokines (inducible shedding). In this study, we introduce the calcium-ionophore ionomycin as a novel, very rapid, and efficient inducer of CX3CL1 and CXCL16 shedding. By transfection in COS-7 cells and ADAM10-deficient murine embryonic fibroblasts combined with the use of selective metalloproteinase inhibitors, we demonstrate that the inducible generation of soluble forms of these chemokines is dependent on ADAM10 activity. Analysis of the C-terminal cleavage fragments remaining in the cell membrane reveals multiple cleavage sites used by ADAM10, one of which is preferentially used upon stimulation with ionomycin. In adhesion studies with CX3CL1-expressing ECV-304 cells and cytokine-stimulated endothelial cells, we demonstrate that induced CX3CL1 shedding leads to the release of bound monocytic cell lines and PBMC from their cellular substrate. These data provide evidence for an inducible release mechanism via ADAM10 potentially important for leukocyte diapedesis.

Presenilin, the catalytic component of the γ-secretase complex, type IV prepilin peptidases, and signal peptide peptidase (SPP) are the founding members of the family of intramembrane-cleaving GXGD aspartyl proteases. SPP-like (SPPL) proteases, such as SPPL2a, SPPL2b, SPPL2c, and SPPL3, also belong to the GXGD family. In contrast to γ-secretase, for which numerous substrates have been identified, very few in vivo substrates are known for SPP and SPPLs. Here we demonstrate that Bri2 (Itm2b), a type II-oriented transmembrane protein associated with familial British and Danish dementia, undergoes regulated intramembrane proteolysis. In addition to the previously described ectodomain processing by furin and related proteases, we now describe that the Bri2 protein, similar to γ-secretase substrates, undergoes an additional cleavage by ADAM10 in its ectodomain. This cleavage releases a soluble variant of Bri2, the BRICHOS domain, which is secreted into the extracellular space. Upon this shedding event, a membrane-bound Bri2 N-terminal fragment remains, which undergoes intramembrane proteolysis to produce an intracellular domain as well as a secreted low molecular weight C-terminal peptide. By expressing all known SPP/SPPL family members as well as their loss of function variants, we demonstrate that selectively SPPL2a and SPPL2b mediate the intramembrane cleavage, whereas neither SPP nor SPPL3 is capable of processing the Bri2 N-terminal fragment. Presenilin, the catalytic component of the γ-secretase complex, type IV prepilin peptidases, and signal peptide peptidase (SPP) are the founding members of the family of intramembrane-cleaving GXGD aspartyl proteases. SPP-like (SPPL) proteases, such as SPPL2a, SPPL2b, SPPL2c, and SPPL3, also belong to the GXGD family. In contrast to γ-secretase, for which numerous substrates have been identified, very few in vivo substrates are known for SPP and SPPLs. Here we demonstrate that Bri2 (Itm2b), a type II-oriented transmembrane protein associated with familial British and Danish dementia, undergoes regulated intramembrane proteolysis. In addition to the previously described ectodomain processing by furin and related proteases, we now describe that the Bri2 protein, similar to γ-secretase substrates, undergoes an additional cleavage by ADAM10 in its ectodomain. This cleavage releases a soluble variant of Bri2, the BRICHOS domain, which is secreted into the extracellular space. Upon this shedding event, a membrane-bound Bri2 N-terminal fragment remains, which undergoes intramembrane proteolysis to produce an intracellular domain as well as a secreted low molecular weight C-terminal peptide. By expressing all known SPP/SPPL family members as well as their loss of function variants, we demonstrate that selectively SPPL2a and SPPL2b mediate the intramembrane cleavage, whereas neither SPP nor SPPL3 is capable of processing the Bri2 N-terminal fragment. Regulated intramembrane proteolysis (RIP) 4The abbreviations used are: RIPregulated intramembrane proteolysisBri2British dementia protein-2Itm2bintegral membrane protein 2bABriamyloid British dementia proteinICDintracellular domainNTFN-terminal fragmentADAMa disintegrin and metalloprotease(Z-LL)2-ketone1, 3-di-(N-benzyloxycarbonyl-l-leucyl-l-leucyl)aminoacetoneDAPTN-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl esterSPPsignal peptide peptidaseSPPLSPP-likeERendoplasmic reticulumTNFαtumor necrosis factor αsiRNAsmall interfering RNAHEKhuman embryonic kidneyBFAbrefeldin AHAhemagglutinin. 4The abbreviations used are: RIPregulated intramembrane proteolysisBri2British dementia protein-2Itm2bintegral membrane protein 2bABriamyloid British dementia proteinICDintracellular domainNTFN-terminal fragmentADAMa disintegrin and metalloprotease(Z-LL)2-ketone1, 3-di-(N-benzyloxycarbonyl-l-leucyl-l-leucyl)aminoacetoneDAPTN-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl esterSPPsignal peptide peptidaseSPPLSPP-likeERendoplasmic reticulumTNFαtumor necrosis factor αsiRNAsmall interfering RNAHEKhuman embryonic kidneyBFAbrefeldin AHAhemagglutinin. describes a novel cellular mechanism that explains how type I or type II transmembrane proteins are proteolytically processed (1Weihofen A. Martoglio B. Trends Cell Biol. 2003; 13: 71-78Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 2Brown M.S. Ye J. Rawson R.B. Goldstein J.L. Cell. 2000; 100: 391-398Abstract Full Text Full Text PDF PubMed Scopus (1135) Google Scholar). RIP is required for reverse signaling and degradation of membrane-retained stubs of certain substrates (1Weihofen A. Martoglio B. Trends Cell Biol. 2003; 13: 71-78Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). In a typical example, RIP describes two proteolytic processing steps. First, a large part of the ectodomain is shed and secreted. Subsequently, intramembrane proteolysis cleaves the remaining membrane-bound fragment into two peptides, the intracellular domain (ICD) and a small peptide, which is secreted. Until recently, proteolysis within the membrane was believed to be rather impossible because water molecules, known to be required for hydrolysis of peptide bonds, may have difficulties to penetrate the hydrophobic membrane. However, currently members of three different intramembrane-cleaving protease families are known. All are polytopic proteins with their catalytic sites most likely embedded within their transmembrane domains (1Weihofen A. Martoglio B. Trends Cell Biol. 2003; 13: 71-78Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). Intramembrane-cleaving metalloproteases are represented by the site-2 protease (3Sakai J. Duncan E.A. Rawson R.B. Hua X. Brown M.S. Goldstein J.L. Cell. 1996; 85: 1037-1046Abstract Full Text Full Text PDF PubMed Scopus (426) Google Scholar, 4Wang X. Sato R. Brown M.S. Hua X. Goldstein J.L. Cell. 1994; 77: 53-62Abstract Full Text PDF PubMed Scopus (849) Google Scholar, 5Rawson R.B. Zelenski N.G. Nijhawan D. Ye J. Sakai J. Hasan M.T. Chang T.Y. Brown M.S. Goldstein J.L. Mol. Cell. 1997; 1: 47-57Abstract Full Text Full Text PDF PubMed Scopus (389) Google Scholar). Site-2 protease (S2P) is required for the regulation of cholesterol and fatty acid biosynthesis via the liberation of the membrane-bound transcription factor sterol regulatory element-binding protein (SREBP) by intramembrane proteolysis. In addition, site-2 protease is also involved in intramembrane processing of ATF6, a protein required for chaperone expression during unfolded protein response. Prior to intramembrane cleavage, both substrates are first shed by a luminal cleavage via site-1 protease (6Ye J. Rawson R.B. Komuro R. Chen X. Dave U.P. Prywes R. Brown M.S. Goldstein J.L. Mol. Cell. 2000; 6: 1355-1364Abstract Full Text Full Text PDF PubMed Scopus (1311) Google Scholar). regulated intramembrane proteolysis British dementia protein-2 integral membrane protein 2b amyloid British dementia protein intracellular domain N-terminal fragment a disintegrin and metalloprotease 1, 3-di-(N-benzyloxycarbonyl-l-leucyl-l-leucyl)aminoacetone N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester signal peptide peptidase SPP-like endoplasmic reticulum tumor necrosis factor α small interfering RNA human embryonic kidney brefeldin A hemagglutinin. regulated intramembrane proteolysis British dementia protein-2 integral membrane protein 2b amyloid British dementia protein intracellular domain N-terminal fragment a disintegrin and metalloprotease 1, 3-di-(N-benzyloxycarbonyl-l-leucyl-l-leucyl)aminoacetone N-[N-(3,5-difluorophenacetyl)-l-alanyl]-S-phenylglycine t-butyl ester signal peptide peptidase SPP-like endoplasmic reticulum tumor necrosis factor α small interfering RNA human embryonic kidney brefeldin A hemagglutinin. Intramembrane-cleaving serine proteases are represented by the growing family of rhomboids. At least Drosophila rhomboids are known to be involved in intramembrane proteolysis of Spitz, Gurken, and Keren. Their cleavage is required for epidermal growth factor receptor signaling (7Lee J.R. Urban S. Garvey C.F. Freeman M. Cell. 2001; 107: 161-171Abstract Full Text Full Text PDF PubMed Scopus (323) Google Scholar, 8Urban S. Lee J.R. Freeman M. Cell. 2001; 107: 173-182Abstract Full Text Full Text PDF PubMed Scopus (487) Google Scholar, 9Foltenyi K. Greenspan R.J. Newport J.W. Nat. Neurosci. 2007; 10: 1160-1167Crossref PubMed Scopus (187) Google Scholar), but an initiating shedding event is apparently not required. Rhomboids are the first intramembrane-cleaving proteases for which crystal structures could be resolved (10Wang Y. Zhang Y. Ha Y. Nature. 2006; 444: 179-180Crossref PubMed Scopus (294) Google Scholar, 11Wu Z. Yan N. Feng L. Oberstein A. Yan H. Baker R.P. Gu L. Jeffrey P.D. Urban S. Shi Y. Nat. Struct. Mol. Biol. 2006; 13: 1084-1091Crossref PubMed Scopus (194) Google Scholar, 12Ben-Shem A. Fass D. Bibi E. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 462-466Crossref PubMed Scopus (146) Google Scholar, 13Lemieux M.J. Fischer S.J. Cherney M.M. Bateman K.S. James M.N. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 750-754Crossref PubMed Scopus (126) Google Scholar, 14Wang Y. Ha Y. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 2098-2102Crossref PubMed Scopus (80) Google Scholar). The crystal structures suggest that their catalytically active Ser-His dyad and water molecules are indeed embedded within the interior of the membrane. The family of intramembrane-cleaving aspartyl proteases is represented by γ-secretase, the signal peptide peptidase (SPP) (15Weihofen A. Binns K. Lemberg M.K. Ashman K. Martoglio B. Science. 2002; 296: 2215-2218Crossref PubMed Scopus (449) Google Scholar), its homologues the SPP-like (SPPL) proteases (1Weihofen A. Martoglio B. Trends Cell Biol. 2003; 13: 71-78Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar, 16Ponting C.P. Hutton M. Nyborg A. Baker M. Jansen K. Golde T.E. Hum. Mol. Genet. 2002; 11: 1037-1044Crossref PubMed Scopus (151) Google Scholar, 17Grigorenko A.P. Moliaka Y.K. Korovaitseva G.I. Rogaev E.I. Biochemistry (Mosc.). 2002; 67: 826-835Crossref PubMed Scopus (54) Google Scholar, 18Haass C. Steiner H. Trends Cell Biol. 2002; 12: 556-562Abstract Full Text Full Text PDF PubMed Scopus (158) Google Scholar), and the bacterial type IV prepilin peptidases, which cleave very close to or right at the membrane (19LaPointe C.F. Taylor R.K. J. Biol. Chem. 2000; 275: 1502-1510Abstract Full Text Full Text PDF PubMed Scopus (146) Google Scholar). γ-Secretase is a complex composed of presenilin-1 or presenilin-2, nicastrin, APH-1 (anterior pharynx defective-1), and PEN-2 (presenilin enhancer-2) (20Haass C. EMBO J. 2004; 23: 483-488Crossref PubMed Scopus (474) Google Scholar). Presenilin is the catalytically active component of the γ-secretase complex (21Wolfe M.S. Xia W. Ostaszewski B.L. Diehl T.S. Kimberly W.T. Selkoe D.J. Nature. 1999; 398: 513-517Crossref PubMed Scopus (1671) Google Scholar) and contains the GXGD protease active site motif (22Steiner H. Kostka M. Romig H. Basset G. Pesold B. Hardy J. Capell A. Meyn L. Grim M.G. Baumeister R. Fechteler K. Haass C. Nat. Cell Biol. 2000; 2: 848-851Crossref PubMed Scopus (248) Google Scholar). γ-Secretase cleaves numerous type I substrates including Notch and the β-amyloid precursor protein (20Haass C. EMBO J. 2004; 23: 483-488Crossref PubMed Scopus (474) Google Scholar, 23Mumm J.S. Kopan R. Dev. Biol. 2000; 228: 151-165Crossref PubMed Scopus (831) Google Scholar, 24Bentahir M. Nyabi O. Verhamme J. Tolia A. Horre K. Wiltfang J. Esselmann H. De Strooper B. J. Neurochem. 2006; 96: 732-742Crossref PubMed Scopus (348) Google Scholar). In both cases, the ICDs of the substrates are released to the cytosol. Although the Notch ICD is required for reverse signaling, a functional role of the β-amyloid precursor protein ICD is currently under debate (20Haass C. EMBO J. 2004; 23: 483-488Crossref PubMed Scopus (474) Google Scholar, 24Bentahir M. Nyabi O. Verhamme J. Tolia A. Horre K. Wiltfang J. Esselmann H. De Strooper B. J. Neurochem. 2006; 96: 732-742Crossref PubMed Scopus (348) Google Scholar), and for a number of other substrates the function of the ICD is unknown. Besides the ICDs, γ-secretase also liberates the amyloid β-peptide and the corresponding Notch β-peptide (25Okochi M. Steiner H. Fukumori A. Tanii H. Tomita T. Tanaka T. Iwatsubo T. Kudo T. Takeda M. Haass C. EMBO J. 2002; 21: 5408-5416Crossref PubMed Scopus (194) Google Scholar). Amyloid β-peptide accumulates in amyloid plaques and vascular deposits characteristic for Alzheimer disease. Although γ-secretase only accepts type I-oriented substrates, members of the SPP family are required for intramembrane proteolysis of type II transmembrane proteins (1Weihofen A. Martoglio B. Trends Cell Biol. 2003; 13: 71-78Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar). SPP family members are differentially located within the cells (26Krawitz P. Haffner C. Fluhrer R. Steiner H. Schmid B. Haass C. J. Biol. Chem. 2005; 280: 39515-39523Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 27Friedmann E. Hauben E. Maylandt K. Schleeger S. Vreugde S. Lichtenthaler S.F. Kuhn P.H. Stauffer D. Rovelli G. Martoglio B. Nat. Cell Biol. 2006; 8: 843-848Crossref PubMed Scopus (161) Google Scholar). SPP and SPPL3 are predominantly observed within the endoplasmic reticulum (ER)/Golgi, whereas SPPL2a and SPPL2b are additionally found in late Golgi compartments and endosomes/lysosomes (26Krawitz P. Haffner C. Fluhrer R. Steiner H. Schmid B. Haass C. J. Biol. Chem. 2005; 280: 39515-39523Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Consistent with its subcellular localization, SPP is required for the removal of signal peptides from the ER membrane (15Weihofen A. Binns K. Lemberg M.K. Ashman K. Martoglio B. Science. 2002; 296: 2215-2218Crossref PubMed Scopus (449) Google Scholar). Beside its function in removal of signal peptides, SPP is also involved in immune surveillance and intramembrane cleavage of the hepatitis C viral core protein (15Weihofen A. Binns K. Lemberg M.K. Ashman K. Martoglio B. Science. 2002; 296: 2215-2218Crossref PubMed Scopus (449) Google Scholar, 28Loureiro J. Lilley B.N. Spooner E. Noriega V. Tortorella D. Ploegh H.L. Nature. 2006; 441: 894-897Crossref PubMed Scopus (112) Google Scholar). No substrate has so far been identified for the ER/Golgi located SPPL3. For SPPL2a and SPPL2b currently two in vivo substrates, tumor necrosis factor α (TNFα) and the Fas ligand, are known (27Friedmann E. Hauben E. Maylandt K. Schleeger S. Vreugde S. Lichtenthaler S.F. Kuhn P.H. Stauffer D. Rovelli G. Martoglio B. Nat. Cell Biol. 2006; 8: 843-848Crossref PubMed Scopus (161) Google Scholar, 29Fluhrer R. Grammer G. Israel L. Condron M.M. Haffner C. Friedmann E. Bohland C. Imhof A. Martoglio B. Teplow D.B. Haass C. Nat. Cell Biol. 2006; 8: 894-896Crossref PubMed Scopus (109) Google Scholar, 30Kirkin V. Cahuzac N. Guardiola-Serrano F. Huault S. Luckerath K. Friedmann E. Novac N. Wels W.S. Martoglio B. Hueber A.O. Zornig M. Cell Death Differ. 2007; 14: 1678-1687Crossref PubMed Scopus (110) Google Scholar). The ectodomains of both substrates undergo shedding by members of the ADAM (a disintegrin and metalloprotease) family. TNFα is further processed by intramembrane cleavages of SPPL2a/SPPL2b to produce the TNFα ICD and the secreted TNFα C domain (29Fluhrer R. Grammer G. Israel L. Condron M.M. Haffner C. Friedmann E. Bohland C. Imhof A. Martoglio B. Teplow D.B. Haass C. Nat. Cell Biol. 2006; 8: 894-896Crossref PubMed Scopus (109) Google Scholar). The TNFα ICD triggers expression of the pro-inflammatory cytokine interleukin-12 in dendritic cells (27Friedmann E. Hauben E. Maylandt K. Schleeger S. Vreugde S. Lichtenthaler S.F. Kuhn P.H. Stauffer D. Rovelli G. Martoglio B. Nat. Cell Biol. 2006; 8: 843-848Crossref PubMed Scopus (161) Google Scholar). Because of the restricted cell and tissue specific expression of TNFα and FasL, additional substrates for SPPL2a/SPPL2b are to be expected. We therefore investigated the type II-oriented transmembrane protein Bri2, also known as Itm2b, which is the precursor of the ABri amyloid protein (31Vidal R. Frangione B. Rostagno A. Mead S. Revesz T. Plant G. Ghiso J. Nature. 1999; 399: 776-781Crossref PubMed Scopus (367) Google Scholar). For clarity, we will use the term Bri2 throughout the manuscript. Bri2 undergoes processing by furin and related proteases within its ectodomain (32Kim S.H. Creemers J.W. Chu S. Thinakaran G. Sisodia S.S. J. Biol. Chem. 2002; 277: 1872-1877Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 33Kim S.H. Wang R. Gordon D.J. Bass J. Steiner D.F. Lynn D.G. Thinakaran G. Meredith S.C. Sisodia S.S. Nat. Neurosci. 1999; 2: 984-988Crossref PubMed Scopus (127) Google Scholar), which leads to the release of its 4-kDa C-terminal propeptide. Mutations of the stop codon in the bri2 (itm2b) gene are responsible for the generation of a longer open reading frame, therefore causing the release of a longer propeptide by furin-mediated proteolysis (31Vidal R. Frangione B. Rostagno A. Mead S. Revesz T. Plant G. Ghiso J. Nature. 1999; 399: 776-781Crossref PubMed Scopus (367) Google Scholar, 32Kim S.H. Creemers J.W. Chu S. Thinakaran G. Sisodia S.S. J. Biol. Chem. 2002; 277: 1872-1877Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 33Kim S.H. Wang R. Gordon D.J. Bass J. Steiner D.F. Lynn D.G. Thinakaran G. Meredith S.C. Sisodia S.S. Nat. Neurosci. 1999; 2: 984-988Crossref PubMed Scopus (127) Google Scholar). The mutant Bri2 amyloid propeptides (ABri) tend to aggregate into oligomers, protofibrils, and further into amyloid deposits and cause familial British (31Vidal R. Frangione B. Rostagno A. Mead S. Revesz T. Plant G. Ghiso J. Nature. 1999; 399: 776-781Crossref PubMed Scopus (367) Google Scholar) and Danish dementia (34Vidal R. Revesz T. Rostagno A. Kim E. Holton J.L. Bek T. Bojsen-Moller M. Braendgaard H. Plant G. Ghiso J. Frangione B. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 4920-4925Crossref PubMed Scopus (259) Google Scholar), which are autosomal dominant neurodegenerative diseases characterized by amyloid angiopathy, plaques, and neurofibrillar tangles (33Kim S.H. Wang R. Gordon D.J. Bass J. Steiner D.F. Lynn D.G. Thinakaran G. Meredith S.C. Sisodia S.S. Nat. Neurosci. 1999; 2: 984-988Crossref PubMed Scopus (127) Google Scholar, 35Plant G.T. Revesz T. Barnard R.O. Harding A.E. Gautier-Smith P.C. Brain. 1990; 113: 721-747Crossref PubMed Scopus (126) Google Scholar). We have now investigated the proteolytic processing of Bri2. Surprisingly, in addition to the furin-mediated release of the C-terminal propeptide, a large part of the remaining ectodomain, the so-called BRICHOS domain, is shed by ADAM10 and released to the extracellular space. The remaining membrane-associated N-terminal fragment (NTF) undergoes intramembrane proteolysis mediated by SPPL2a or SPPL2b. This cleavage generates the Bri2 ICD, which is liberated into the cytosol and the secreted Bri2 C domain. Cell Culture, cDNAs, and Transfection—HEK293EBNA, HEK293TR, and SH-SY5Y cells were cultured in Dulbecco's modified Eagle's medium with Glutamax (Invitrogen) supplemented with 10% fetal calf serum (Invitrogen) and 1% penicillin/streptomycin (Invitrogen). SNKBE cells were cultured in Ham's F-12 medium (Cambrex Bio Science, Verviers, Belgium) supplemented with 2.5% non-essential amino acids (Invitrogen) and 10% fetal calf serum. A-431 cells were cultured in Advanced RPMI 1640 medium (Invitrogen) supplemented with 0.5% penicillin/streptomycin and 10% fetal calf serum. Using PCR, a C-terminal HA tag (AYPYDVPDYA) was added to all constructs. SPPL2a, SPPL2a D412A, SPPL2b, SPPL2b D421A, and SPPL3 D272A were subcloned into the NheI and NotI or EcoRI and XhoI sites of pcDNA 3.1. Zeo- (Invitrogen) and stably transfected into HEK293EBNA cells. SPP, SPP D265A, and SPPL3 were subcloned into the EcoRI and XhoI sites of pcDNA 4/TO A (Invitrogen) and stably transfected into HEK293 TR cells (Invitrogen). Transfection of cells was carried out using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions, and single cell clones were generated by selection in 200 μg/ml zeocine (Invitrogen). To induce expression of SPP, SPP D265A, and SPPL3, cells were incubated with 1 μg/ml doxycycline (BD Biosciences) added to the cell culture medium for at least 48 h. Bri2 cDNA was purchased from RZPD (Deutsches Ressourcezentrum für Genomforschung, Berlin, Germany). After the starting methionine an N-terminal FLAG tag (DYKDDDDK) and, at the C terminus of the protein, a V5 tag (GKPIPNPLLGLDST) were added, and the PCR product was subcloned into the HindIII and XbaI sites of pcDNA6.0-V5-His A (Invitrogen). The Bri2ΔE and the Bri2ΔFC constructs were generated by deleting the C-terminal part of the protein after amino acids 94 and 240, respectively. The Bri2 KR 243/244 AA (KR/AA) construct was generated by PCR mutagenesis. These Bri2 constructs also contain an N-terminal FLAG tag and a C-terminal V5 tag and were subcloned into the HindIII and XbaI sites of pcDNA6.0-V5-His A (Invitrogen). All cDNA constructs were sequenced for verification. Bri2 cDNAs were either transiently or stably expressed in cell lines stably expressing SPPs or SPPLs as described above. Antibodies, Immunoprecipitation, and Immunoblotting—The anti-HA peroxidase-coupled 3F10 antibody was obtained from Roche Diagnostics. The monoclonal anti-FLAG M2 and the polyclonal HA 6908 antibody were obtained from Sigma. Polyclonal and monoclonal V5 antibodies were purchased from Chemicon (Schwalbach, Germany) and Invitrogen, respectively. The polyclonal antibodies against ADAM10, Calnexin, and ADAM17 (TACE) were purchased from Calbiochem, Stressgene/Biomol (Hamburg, Germany), and Oncogene, respectively. The polyclonal anti-Bri2 antibody (ITM2b ab14307) directed against the first 60 amino acids of human Bri2 was obtained from Abcam (Cambridge, UK). The monoclonal SPPL2b-specific antibody CADG-3F9 directed against amino acids 518-535 of the protein was established by Dr. Elisabeth Kremmer (GSF-Forschungszentrum, Munich). Anti-mouse, anti-rabbit, and anti-chicken peroxidase secondary antibodies were purchased from Promega (Madison). Immunoprecipitation assays, gel electrophoresis, immunoblotting experiments, and co-immunoprecipitation assays were carried out as described previously (26Krawitz P. Haffner C. Fluhrer R. Steiner H. Schmid B. Haass C. J. Biol. Chem. 2005; 280: 39515-39523Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar, 29Fluhrer R. Grammer G. Israel L. Condron M.M. Haffner C. Friedmann E. Bohland C. Imhof A. Martoglio B. Teplow D.B. Haass C. Nat. Cell Biol. 2006; 8: 894-896Crossref PubMed Scopus (109) Google Scholar). Immunocytochemistry and Confocal Imaging—The indicated cell lines were grown on polylysine-coated glass coverslips to 50-80% confluence and processed for immunofluorescence as described before (26Krawitz P. Haffner C. Fluhrer R. Steiner H. Schmid B. Haass C. J. Biol. Chem. 2005; 280: 39515-39523Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Confocal images were obtained with Zeiss 510Meta confocal laser scanning microscope system equipped with a 100/1.3 objective described previously (36Kaether C. Capell A. Edbauer D. Winkler E. Novak B. Steiner H. Haass C. EMBO J. 2004; 23: 4738-4748Crossref PubMed Scopus (91) Google Scholar). Images were assembled and processed using Adobe Illustrator. Inhibitor Treatment and RNA Interference—To inhibit SPPL2b, cells were treated overnight with a final concentration of 15 μm (Z-LL)2-ketone (Calbiochem), a known SPP inhibitor (37Weihofen A. Lemberg M.K. Ploegh H.L. Bogyo M. Martoglio B. J. Biol. Chem. 2000; 275: 30951-30956Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar). As a control, cells were treated with 3 μm γ-secretase inhibitor DAPT (38Dovey H.F. John V. Anderson J.P. Chen L.Z. de Saint Andrieu P. Fang L.Y. Freedman S.B. Folmer B. Goldbach E. Holsztynska E.J. Hu K.L. Johnson-Wood K.L. Kennedy S.L. Kholodenko D. Knops J.E. Latimer L.H. Lee M. Liao Z. Lieberburg I.M. Motter R.N. Mutter L.C. Nietz J. Quinn K.P. Sacchi K.L. Seubert P.A. Shopp G.M. Thorsett E.D. Tung J.S. Wu J. Yang S. Yin C.T. Schenk D.B. May P.C. Altstiel L.D. Bender M.H. Boggs L.N. Britton T.C. Clemens J.C. Czilli D.L. Dieckman-McGinty D.K. Droste J.J. Fuson K.S. Gitter B.D. Hyslop P.A. Johnstone E.M. Li W.Y. Little S.P. Mabry T.E. Miller F.D. Audia J.E. J. Neurochem. 2001; 76: 173-181Crossref PubMed Scopus (787) Google Scholar) or the respective carrier. To block specific metalloprotease activities, cells were grown in a 6-well format and treated overnight with either 50 μm TAPI-1 (Peptides International) or 50 μm TAPI-2 (Peptides International). Hydroxamate-based inhibitors GW280264 (5 μm) and GI254023 (5 μm) are described elsewhere (39Hundhausen C. Misztela D. Berkhout T.A. Broadway N. Saftig P. Reiss K. Hartmann D. Fahrenholz F. Postina R. Matthews V. Kallen K.J. Rose-John S. Ludwig A. Blood. 2003; 102: 1186-1195Crossref PubMed Scopus (538) Google Scholar). For quantification, proteins were immunoblotted as described above and detected using the enhanced chemiluminescence technique (GE Healthcare). The chemiluminescence signals of at least three independent experiments were measured with a CD camera-based imaging system (Alpha-Innotec, Kasendorf, Germany). Statistical significance was determined with Student's t test. Statistically significant p values of <0.05 or <0.005 are represented by or, respectively. RNA interference experiments were carried out as follows. 1 × 106 cells/well were plated in a polylysine-coated 6-well format. After a 2-h incubation, cells were transfected with the indicated small interfering RNA (siRNA) (Dharmacon siRNA SMARTpools: catalog numbers M-0040503-01 (ADAM10), M-003453-00 (ADAM17), and D-001206-13 (non-targeting control)), using Lipofectamine 2000 (Invitrogen) according to the manufacturer's instructions. 24 h after transfection, the medium was exchanged, and cells were harvested 48 h after transfection. Five independent experiments were quantified as described above. BRICHOS and Bri2ΔFC levels were first normalized to the calnexin expression level, and then the ratio of BRICHOS to Bri2ΔFC was determined. Resulting data for control siRNA were set to 100%. Where indicated cells were treated overnight with 10 μg/ml brefeldin A (BFA; Sigma-Aldrich). As a control, cells were incubated with the respective carrier. Shedding of Bri2 by ADAM10—The Bri2 protein is a type II transmembrane protein, known to be processed within its ectodomain by furin and related proteases (Fig. 1A, proBri2) (32Kim S.H. Creemers J.W. Chu S. Thinakaran G. Sisodia S.S. J. Biol. Chem. 2002; 277: 1872-1877Abstract Full Text Full Text PDF PubMed Scopus (42) Google Scholar, 33Kim S.H. Wang R. Gordon D.J. Bass J. Steiner D.F. Lynn D.G. Thinakaran G. Meredith S.C. Sisodia S.S. Nat. Neurosci. 1999; 2: 984-988Crossref PubMed Scopus (127) Google Scholar, 40Choi S.I. Vidal R. Frangione B. Levy E. FASEB J. 2004; 18: 373-375Crossref PubMed Scopus (42) Google Scholar). Consequently, a membrane-bound fragment, containing the so-called BRICHOS domain, remains after this initial processing (Fig. 1A, Bri2). As expected, Bri2 containing the propeptide (pro-Bri2) was detected at a molecular mass of ∼50 kDa in all cell lines tested. The mature Bri2 variant lacking the propeptide (Bri2) was detected at a slightly lower molecular weight and was most prominently visible in cell lines of neuronal origin (Fig. 1B, SKNBE, SH-SY5Y). However, besides these expected Bri2 species, we additionally detected a lower molecular mass Bri2 NTF of ∼22 kDa in all cell lines investigated (Fig. 1B). We therefore assumed that Bri2 might undergo shedding because such a proteolytic processing step would result in the generation of a small membrane retained stub (Fig. 1A, NTF). If such a shedding event takes place, one would expect a secreted counterpart containing the BRICHOS domain (see Fig. 1A). To allow identification of such a secreted domain, we inserted a V5 tag directly at the C terminus of the BRICHOS domain generating Bri2ΔFC (Fig. 2A). Upon expression of this cDNA construct, we indeed detected the ∼25-kDa BRICHOS domain as a secreted species in the conditioned medium (Fig. 2B). Similar to cells expressing endogenous Bri2 (Fig. 1B), NTF was observed within the cell lysate (Fig. 2B). This suggests that the BRICHOS domain and the Bri2 NTF are generated by a novel shedding event of Bri2 and may explain the observation of a N-terminal Bri2 fragment of unknown origin by Choi et al. (40Choi S.I. Vidal R. Frangione B. Levy E. FASEB J. 2004; 18: 373-375Crossref PubMed Scopus (42) Google Scholar). In analogy to many γ-secretase substrates, which require shedding by proteases of the ADAM family, we investigated whether a member of this protease family is involved in shedding of Bri2. Broad ADAM protease inhibitors, such as TAPI-1 and TAPI-2 (41Arribas J. Coodly L. Vollmer P. Kishimoto T.K. Rose-John S. Massague J. J. Biol. Chem. 1996; 271: 11376-11382Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar), strongly reduced the secretion of the BRI-CHOS domain (Fig. 2C). The nature of the metalloprotease activity was narrowed down using two hydroxamate-based inhibitors that differ in their inhibitory profile. The inhibitor GW280264X has been shown to block ADAM17 and ADAM10, whereas the compound GI254023X preferentially blocks ADAM10 (39Hundhausen C. Misztela D. Berkhout T.A. Broadway N. Saftig P. Reiss K. Hartmann D. Fahrenholz F. Postina R. Matthews V. Kallen K.J. Rose-John S. Ludwig A. Blood. 2003; 102: 1186-1195Crossref PubMed Scopus (538) Google Scholar). Both inhibitors strongly blocked secretion of the BRICHOS domain (Fig. 2D). To

Cathepsin K (CatK) is a cysteine protease expressed predominantly in osteoclasts, that plays a prominent role in degrading Type I collagen. Growing CatK null mice have osteopetrosis associated with a reduced ability to degrade bone matrix. Bone strength and histomorphometric endpoints in young adult CatK null mice aged more than 10 weeks have not been studied. The purpose of this paper is to describe bone mass, strength, resorption, and formation in young adult CatK null mice. In male and female wild-type (WT), heterozygous, and homozygous CatK null mice (total N=50) aged 19 weeks, in-life double fluorochrome labeling was performed. Right femurs and lumbar vertebral bodies 1-3 (LV) were evaluated by dual-energy X-ray absorptiometry (DXA) for bone mineral content (BMC) and bone mineral density (BMD). The trabecular region of the femur and the cortical region of the tibia were evaluated by histomorphometry. The left femur and sixth lumbar vertebral body were tested biomechanically. CatK (-/-) mice show higher BMD at the central and distal femur. Central femur ultimate load was positively influenced by genotype, and was positively correlated with both cortical area and BMC. Lumbar vertebral body ultimate load was also positively correlated to BMC. Genotype did not influence the relationship of ultimate load to BMC in either the central femur or vertebral body. CatK (-/-) mice had less lamellar cortical bone than WT mice. Higher bone volume, trabecular thickness, and trabecular number were observed at the distal femur in CatK (-/-) mice. Smaller marrow cavities were also present at the central femur of CatK (-/-) mice. CatK (-/-) mice exhibited greater trabecular mineralizing surface, associated with normal volume-based formation of trabecular bone. Adult CatK (-/-) mice have higher bone mass in both cortical and cancellous regions than WT mice. Though no direct measures of bone resorption rate were made, the higher cortical bone quantity is associated with a smaller marrow cavity and increased retention of non-lamellar bone, signs of decreased endocortical resorption. The relationship of bone strength to BMC does not differ with genotype, indicating the presence of bone tissue of normal quality in the absence of CatK.

Lysosomes are membrane-bound acidic organelles that contain hydrolases used for intracellular digestion of various macromolecules in a process generally referred to as autophagy. In normal skeletal and cardiac muscles, lysosomes usually appear morphologically unremarkable and thus are not readily visible on light microscopy. In distinct neuromuscular disorders, however, lysosomes have been shown to be structurally abnormal and functionally impaired, leading to the accumulation of autophagic vacuoles in myofibers. More specifically, there are myopathies in which buildup of these autophagic vacuoles seem to predominate the pathological picture. In such conditions, autophagy is considered not merely a secondary event, but a phenomenon that actually contributes to disease pathomechanism and/or progression. At present, there are two disorders in the muscle which are associated with primary defect in lysosomal proteins, namely Danon disease and Pompe disease. Other myopathies which have prominent autophagy in the skeletal muscle include X-linked myopathy with excessive autophagy (XMEA). In this review, these disorders are briefly characterized, and the role of autophagy in the context of the pathomechanism of these disorders is highlighted.

Obesity-induced diabetes is characterized by hyperglycemia, insulin resistance, and progressive beta cell failure. In islets of mice with obesity-induced diabetes, we observe increased beta cell death and impaired autophagic flux. We hypothesized that intermittent fasting, a clinically sustainable therapeutic strategy, stimulates autophagic flux to ameliorate obesity-induced diabetes. Our data show that despite continued high-fat intake, intermittent fasting restores autophagic flux in islets and improves glucose tolerance by enhancing glucose-stimulated insulin secretion, beta cell survival, and nuclear expression of NEUROG3, a marker of pancreatic regeneration. In contrast, intermittent fasting does not rescue beta-cell death or induce NEUROG3 expression in obese mice with lysosomal dysfunction secondary to deficiency of the lysosomal membrane protein, LAMP2 or haplo-insufficiency of BECN1/Beclin 1, a protein critical for autophagosome formation. Moreover, intermittent fasting is sufficient to provoke beta cell death in nonobese lamp2 null mice, attesting to a critical role for lysosome function in beta cell homeostasis under fasting conditions. Beta cells in intermittently-fasted LAMP2- or BECN1-deficient mice exhibit markers of autophagic failure with accumulation of damaged mitochondria and upregulation of oxidative stress. Thus, intermittent fasting preserves organelle quality via the autophagy-lysosome pathway to enhance beta cell survival and stimulates markers of regeneration in obesity-induced diabetes.

The disintegrin and metalloproteinase Adam10 has been implicated in the regulation of key signaling pathways that determine skin morphogenesis and homeostasis. To address the in vivo relevance of Adam10 in the epidermis, we have selectively disrupted Adam10 during skin morphogenesis and in adult skin. K14-Cre driven epidermal Adam10 deletion leads to perinatal lethality, barrier impairment and absence of sebaceous glands. A reduction of spinous layers, not associated with differences in either proliferation or apoptosis, indicates that loss of Adam10 triggers a premature differentiation of spinous keratinocytes. The few surviving K14-Adam10-deleted mice and mice in which Adam10 was deleted postnatally showed loss of hair, malformed vibrissae, epidermal hyperproliferation, cyst formation, thymic atrophy and upregulation of the cytokine thymic stromal lymphopoetin (TSLP), thus indicating non cell-autonomous multi-organ disease resulting from a compromised barrier. Together, these phenotypes closely resemble skin specific Notch pathway loss-of-function phenotypes. Notch processing is indeed strongly reduced resulting in decreased levels of Notch intracellular domain fragment and functional Notch signaling. The data identify Adam10 as the major Site-2 processing enzyme for Notch in the epidermis in vivo, and thus as a central regulator of skin development and maintenance.

Metzincin metalloproteases have major roles in intercellular communication by modulating the function of membrane proteins. One of the proteases is the a-disintegrin-and-metalloprotease 10 (ADAM10) which acts as alpha-secretase of the Alzheimer's disease amyloid precursor protein. ADAM10 is also required for neuronal network functions in murine brain, but neuronal ADAM10 substrates are only partly known. With a proteomic analysis of Adam10-deficient neurons we identified 91, mostly novel ADAM10 substrate candidates, making ADAM10 a major protease for membrane proteins in the nervous system. Several novel substrates, including the neuronal cell adhesion protein NrCAM, are involved in brain development. Indeed, we detected mistargeted axons in the olfactory bulb of conditional ADAM10-/- mice, which correlate with reduced cleavage of NrCAM, NCAM and other ADAM10 substrates. In summary, the novel ADAM10 substrates provide a molecular basis for neuronal network dysfunctions in conditional ADAM10-/- mice and demonstrate a fundamental function of ADAM10 in the brain.

β-Secretase (BACE1) is a major drug target for combating Alzheimer's disease (AD). Here we show that BACE1(-/-) mice develop significant retinal pathology including retinal thinning, apoptosis, reduced retinal vascular density and an increase in the age pigment, lipofuscin. BACE1 expression is highest in the neural retina while BACE2 was greatest in the retinal pigment epithelium (RPE)/choroid. Pigment epithelial-derived factor, a known regulator of γ-secretase, inhibits vascular endothelial growth factor (VEGF)-induced in vitro and in vivo angiogenesis and this is abolished by BACE1 inhibition. Moreover, intravitreal administration of BACE1 inhibitor or BACE1 small interfering RNA (siRNA) increases choroidal neovascularization in mice. BACE1 induces ectodomain shedding of vascular endothelial growth factor receptor 1 (VEGFR1) which is a prerequisite for γ-secretase release of a 100 kDa intracellular domain. The increase in lipofuscin following BACE1 inhibition and RNAI knockdown is associated with lysosomal perturbations. Taken together, our data show that BACE1 plays a critical role in retinal homeostasis and that the use of BACE inhibitors for AD should be viewed with extreme caution as they could lead to retinal pathology and exacerbate conditions such as age-related macular degeneration.

Article21 June 2013Open Access Bace1 and Neuregulin-1 cooperate to control formation and maintenance of muscle spindles Cyril Cheret Cyril Cheret Entwicklungsbiologie/Signaltransduktion, Max-Delbrück-Center for Molecular Medicine, Berlin, Germany Search for more papers by this author Michael Willem Michael Willem Adolf-Butenandt-Institute - Biochemistry, Ludwig-Maximilians-University Munich, Munich, Germany Search for more papers by this author Florence R Fricker Florence R Fricker University of Oxford, NDCN, Oxford, UK Search for more papers by this author Hagen Wende Hagen Wende Entwicklungsbiologie/Signaltransduktion, Max-Delbrück-Center for Molecular Medicine, Berlin, Germany Search for more papers by this author Annika Wulf-Goldenberg Annika Wulf-Goldenberg Experimental Pharmacology & Oncology Berlin-Buch GmbH, Berlin, Germany Search for more papers by this author Sabina Tahirovic Sabina Tahirovic German Center for Neurodegenerative Diseases (DZNE) Munich, Munich, Germany Search for more papers by this author Klaus-Armin Nave Klaus-Armin Nave Max Planck Institute of Experimental Medicine, Göttingen, Germany Search for more papers by this author Paul Saftig Paul Saftig Biochemical Institute, Christian-Albrechts University Kiel, Kiel, Germany Search for more papers by this author Christian Haass Christian Haass Adolf-Butenandt-Institute - Biochemistry, Ludwig-Maximilians-University Munich, Munich, Germany German Center for Neurodegenerative Diseases (DZNE) Munich, Munich, Germany Munich Cluster for Systems Neurology (SyNergy), Berlin, Germany Search for more papers by this author Alistair N Garratt Alistair N Garratt Center for Anatomy, Institute of Cell Biology and Neurobiology, Charité - Universitätsmedizin Berlin, Berlin, Germany Search for more papers by this author David L Bennett David L Bennett University of Oxford, NDCN, Oxford, UK Search for more papers by this author Carmen Birchmeier Corresponding Author Carmen Birchmeier Entwicklungsbiologie/Signaltransduktion, Max-Delbrück-Center for Molecular Medicine, Berlin, Germany Search for more papers by this author Cyril Cheret Cyril Cheret Entwicklungsbiologie/Signaltransduktion, Max-Delbrück-Center for Molecular Medicine, Berlin, Germany Search for more papers by this author Michael Willem Michael Willem Adolf-Butenandt-Institute - Biochemistry, Ludwig-Maximilians-University Munich, Munich, Germany Search for more papers by this author Florence R Fricker Florence R Fricker University of Oxford, NDCN, Oxford, UK Search for more papers by this author Hagen Wende Hagen Wende Entwicklungsbiologie/Signaltransduktion, Max-Delbrück-Center for Molecular Medicine, Berlin, Germany Search for more papers by this author Annika Wulf-Goldenberg Annika Wulf-Goldenberg Experimental Pharmacology & Oncology Berlin-Buch GmbH, Berlin, Germany Search for more papers by this author Sabina Tahirovic Sabina Tahirovic German Center for Neurodegenerative Diseases (DZNE) Munich, Munich, Germany Search for more papers by this author Klaus-Armin Nave Klaus-Armin Nave Max Planck Institute of Experimental Medicine, Göttingen, Germany Search for more papers by this author Paul Saftig Paul Saftig Biochemical Institute, Christian-Albrechts University Kiel, Kiel, Germany Search for more papers by this author Christian Haass Christian Haass Adolf-Butenandt-Institute - Biochemistry, Ludwig-Maximilians-University Munich, Munich, Germany German Center for Neurodegenerative Diseases (DZNE) Munich, Munich, Germany Munich Cluster for Systems Neurology (SyNergy), Berlin, Germany Search for more papers by this author Alistair N Garratt Alistair N Garratt Center for Anatomy, Institute of Cell Biology and Neurobiology, Charité - Universitätsmedizin Berlin, Berlin, Germany Search for more papers by this author David L Bennett David L Bennett University of Oxford, NDCN, Oxford, UK Search for more papers by this author Carmen Birchmeier Corresponding Author Carmen Birchmeier Entwicklungsbiologie/Signaltransduktion, Max-Delbrück-Center for Molecular Medicine, Berlin, Germany Search for more papers by this author Author Information Cyril Cheret1, Michael Willem2, Florence R Fricker3, Hagen Wende1, Annika Wulf-Goldenberg4, Sabina Tahirovic5, Klaus-Armin Nave6, Paul Saftig7, Christian Haass2,5,8, Alistair N Garratt9, David L Bennett3 and Carmen Birchmeier 1 1Entwicklungsbiologie/Signaltransduktion, Max-Delbrück-Center for Molecular Medicine, Berlin, Germany 2Adolf-Butenandt-Institute - Biochemistry, Ludwig-Maximilians-University Munich, Munich, Germany 3University of Oxford, NDCN, Oxford, UK 4Experimental Pharmacology & Oncology Berlin-Buch GmbH, Berlin, Germany 5German Center for Neurodegenerative Diseases (DZNE) Munich, Munich, Germany 6Max Planck Institute of Experimental Medicine, Göttingen, Germany 7Biochemical Institute, Christian-Albrechts University Kiel, Kiel, Germany 8Munich Cluster for Systems Neurology (SyNergy), Berlin, Germany 9Center for Anatomy, Institute of Cell Biology and Neurobiology, Charité - Universitätsmedizin Berlin, Berlin, Germany *Corresponding author. Entwicklungsbiologie/Signaltransduktion, Max-Delbrück-Center for Molecular Medicine, Robert Roessle Strasse 10, Berlin 13125, Germany. Tel.:+49 30 9406 2403; Fax:+49 30 9406 3765; E-mail: [email protected] The EMBO Journal (2013)32:2015-2028https://doi.org/10.1038/emboj.2013.146 PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info The protease β-secretase 1 (Bace1) was identified through its critical role in production of amyloid-β peptides (Aβ), the major component of amyloid plaques in Alzheimer's disease. Bace1 is considered a promising target for the treatment of this pathology, but processes additional substrates, among them Neuregulin-1 (Nrg1). Our biochemical analysis indicates that Bace1 processes the Ig-containing β1 Nrg1 (IgNrg1β1) isoform. We find that a graded reduction in IgNrg1 signal strength in vivo results in increasingly severe deficits in formation and maturation of muscle spindles, a proprioceptive organ critical for muscle coordination. Further, we show that Bace1 is required for formation and maturation of the muscle spindle. Finally, pharmacological inhibition and conditional mutagenesis in adult animals demonstrate that Bace1 and Nrg1 are essential to sustain muscle spindles and to maintain motor coordination. Our results assign to Bace1 a role in the control of coordinated movement through its regulation of muscle spindle physiology, and implicate IgNrg1-dependent processing as a molecular mechanism. Introduction Proteolysis of membrane-tethered molecules is critical for cellular communication. Sheddases, a group of membrane-bound proteases, cleave single-span membrane proteins at the extracellular surface. One of the most studied sheddases, the aspartyl protease Bace1 (β-secretase 1), is an important drug target for Alzheimer's disease. Bace1 cleaves the amyloid precursor protein (APP) and is responsible for generation of pathogenic Aβ peptides (Luo et al, 2001; Vassar et al, 2009). In addition to APP, around 20 substrates have been identified for Bace1 (Willem et al, 2006; Kandalepas and Vassar, 2012; Kuhn et al, 2012; Zhou et al, 2012). Knowledge of their physiological functions can help to monitor adverse effects caused by Bace1 inhibition in patients. One Bace1 substrate is Neuregulin-1 (Nrg1), a trophic factor that signals through ErbB tyrosine kinase receptors to regulate nervous system development and regeneration (Falls, 2003; Willem et al, 2006; Birchmeier, 2009; Fricker et al, 2011). Nrg1 is a complex gene encoding more than 15 protein isoforms that are generated by a combination of alternative mRNA splicing and the use of several promoters. All subtypes of Nrg1 proteins present an EGF-like domain required for receptor binding and signalling. Depending on the presence of either an Ig-like or a cysteine-rich domain (CRD) in their amino-terminal (N-terminal) sequences, Nrg1 variants can be classified into IgNrg1 (type I and type II) and CRD-Nrg1 (type III). Few Nrg1 variants are secreted molecules (e.g., glial growth factor, GGF), most being membrane-bound proteins that can be shed by proteases (Falls, 2003). Bace1-dependent shedding of Nrg1 has been implicated in the control of myelination in the peripheral nervous system (Hu et al, 2006; Willem et al, 2006). Coordinated body movement requires constant input of sensory information to elicit a concerted motor response. Muscle spindles are sensory organs dispersed throughout muscles of vertebrates, which detect muscle stretch, allowing thus the perception of body position (proprioception) important for coordinated movement (Maier, 1997). The muscle spindle is composed of a bundle of specialized (intrafusal) muscle fibres, and its formation is induced by contact between TrkC+ sensory axons and muscle fibres (Ernfors et al, 1994; Farinas et al, 1994; Klein et al, 1994; Tessarollo et al, 1994; Walro and Kucera, 1999; Chen et al, 2003). Further maturation takes place during late fetal and early postnatal phases when muscle spindles grow and become enclosed by the capsules (Hunt, 1990; Zelena and Soukup, 1993; Maier, 1997). Previous studies showed that the genetic deletion of neuronally produced Nrg1 or its receptor ErbB2 in muscle tissue prevent muscle spindle differentiation (Andrechek et al, 2002; Hippenmeyer et al, 2002; Leu et al, 2003). Here we show that formation, maturation and maintenance of muscle spindles depend on Bace1. We use mouse mutants to demonstrate that in the absence of Bace1, muscle spindle numbers are reduced and spindle maturation is impaired. Moreover, we find that a graded reduction in IgNrg1 signal strength results in increasingly severe deficits in the formation and maturation of muscle spindles. Conversely, we observed supernumerary muscle spindles upon overexpression of a membrane-tethered Nrg1 variant (Ig-containing β1 Nrg1 (IgNrg1β1)) in sensory neurons, an effect which strictly depended on the presence of Bace1. Strikingly, inhibition of Bace1 activity or ablation of Nrg1 expression in adult mice resulted in a massive reduction of the muscle spindle pool and impaired coordination of movement. Together, these data implicate Bace1-dependent processing of IgNrg1 in ontogenesis and long-term maintenance of muscle spindles. Results Bace1 mutant mice display coordination defects During handling of Bace1−/− mutant mice, we noted that their movement was altered. Most notably, they appeared not to be able to hang to an inverted grid, a task requiring motor coordination and/or muscle strength (Coughenour et al, 1977; Landauer et al, 2003). A quantitative assessment demonstrated that wild-type littermates did hang to the grid three times longer than Bace1−/− mice; Bace1+/− and wild-type animals performed similarly (Figure 1A). We then assessed muscle coordination using gait analysis. The walking pattern was recorded as mice freely walked on a moving belt, and gait analysis monitored movement and position of individual paws using the Treadscan system (Beare et al, 2009). The walking pattern of wild-type mice (Figure 1B and C) shows coordinated alternation of paws, i.e., opposing movements of anterior and posterior limbs on the same side (homolateral coupling value ≈0.5; Figure 1D and Supplementary Figure S1A), and opposing movements of left and right limbs of the same axial levels (homologue coupling value ≈0.5; Figure 1E and Supplementary Figure S1B and C). Homolateral coupling of Bace1−/− mutants was severely affected and deviated considerably from wild-type animals. This reflects a lack of forelimb/hindlimb coordination and resulted in a swaying walking pattern (Figure 1C; quantified in D and Supplementary Figure S1A). In contrast, homologue coupling was little disturbed at either axial level, indicating correct left/right alternation (Figure 1C; quantified in E and Supplementary Figures S1B and C). Bace1 mutant mice display peripheral hypomyelination but little Schwann cell turnover, similar to Schwann cell-specific coErbB2 (Krox20creErbB2flox/flox) mutant mice (g-ratios P180: control, Bace1−/− and coErbB2: 0.68±0.01, 0.75±0.01 and 0.80±0.01, respectively; cf. Garratt et al, 2000; Hu et al, 2006; Willem et al, 2006; Grossmann et al, 2009). In contrast to Bace1 mutants, we did not observe significant changes in motor coordination in coErbB2 mutants (Supplementary Figure S2A–D). Together, our data indicate that motor coordination is disrupted in Bace1−/− mutants, and this coordination deficit is not caused by hypomyelination. Figure 1.Bace1 is required for the correct formation of muscle spindles. (A) Performance of Bace1+/+, Bace1+/− and Bace1−/− mice (P180) in the inverted grid test. Horizontal bars show the average time the mice remain clinging to the grid. (B) Normal walking pattern of a mouse; the movement of homolateral (top) and homologous (bottom) limbs are indicated. (C) Representative walking patterns of control and Bace1−/− mice; displayed are series of four consecutive steps. (D, E) Homolateral (D) and homologue (E) coupling values for the movements of control (inner circle) and Bace1−/− mice (outer circle). A value of 0.5 defines coordinated movement of the paws. The grey area indicates the non-pathological interval (0.5±0.1). (F) Schematic representation of a muscle spindle; indicated are the central intrafusal fibres of the spindle, which are surrounded by a capsule and (extrafusal) muscle fibres. (G) Quantification of muscle spindles in hindlimbs of control, heterozygous and homozygous Bace1 mutant mice at P0. (H) Immunohistological analysis of muscle spindles from control and Bace1 mutant mice at P0. Intrafusal fibres express Egr3, the nascent outer capsule displays a pronounced collagen IV staining, and contacting sensory fibres are NF200+. Scale bar, 10 μm (H). Download figure Download PowerPoint Bace1 mutation affects formation and maintenance of muscle spindles Coordination of body movement requires functional proprioception, and muscle spindles are important proprioceptive organs governing the coupling of antagonistic muscles (the spindle structure is shown schematically in Figure 1F). We quantified the amounts of muscle spindles in lower hindlimbs of newborn control and mutant mice at P0, using a combination of morphological criteria (large nuclei, presence of a capsule) and immunohistology with antibodies against Egr3, a muscle spindle-specific transcription factor, collagen IV, a marker for muscle spindle outer capsules, and NF200, a neurofilament isoform expressed by sensory fibres contacting the spindles (Figure 1G and H; cf. Tourtellotte and Milbrandt, 1998; Tourtellotte et al, 2001; Hippenmeyer et al, 2002). Newborn Bace1−/− mice presented a pronounced reduction (45%; P<0.001) of the number of muscle spindles, and the reduction persisted until adulthood (Figure 1G, Table I). A small but significant reduction (14%, P=0.01) was observable in heterozygous Bace1+/− mutant mice. The overall morphology of persisting muscle spindles was unchanged in Bace1−/− mice at P0, but postnatal muscle spindle growth was impaired (Figure 1H, Table II, see also below). We conclude that Bace1 is required for the correct formation and maturation of muscle spindles. Table 1. Number of muscle spindles in lower hindlimbs of newborn and adult mice Control IgNrg1Δ/+ Bace1−/− Bace1−/− IgNrg1Δ/+ co-IgNrg1 IgNrg1β1Ov Bace1−/− IgNrg1β1Ov P0 8.8±0.3 6.8±0.3** 4.8±0.6*** 2.6±0.4*** 1.0±0.2*** 14.1±1.2*** 5.0±0.2*** P30 10.0±0.6 8.1±0.5* 5.6±0.5*** 3.2±0.2*** 1.8±0.3*** 18.8±0.5*** 5.9±0.2*** Values are mean±s.e.m. of 5–6 animals per genotype and age, expressed as number of muscle spindles per hindlimb section. Significance of the differences between numbers observed in control and mutants is indicated. Table 2. Diameter of muscle spindles and intrafusal content at birth and during adulthood Control Bace1−/− Bace1−/− IgNrg1Δ/+ co-IgNrg1 IgNrg1β1Ov Bace1−/− IgNrg1β1Ov Spindle diameter (μm) P0 26.5±0.9 23.7±1.4NS 23.4±0.9NS 25.9±1.1NS 26.8±1.5NS 22.7±0.5NS P30 40.6±0.6 32.5±0.8*** 33.3±0.6*** 29.4±1.0*** 42.1±0.6NS 34.6±1.2** P0 4.0±0.2 3.9±0.2NS 3.1±0.1** 2.9±0.1*** 4.3±0.2NS 4.0±0.1NS P30 3.9±0.1 3.9±0.1NS 3.4±0.1NS 3.1±0.1** 4.5±0.2*** 3.8±0.1NS Equatorial diameter and number of intrafusal fibres per muscle spindle was determined in 3–6 animals per genotype and per age and is expressed as mean±s.e.m. Asterisks indicate significance of the differences observed when mutants were compared to control littermates. Bace1 activity is required to sustain muscle spindles and to maintain motor coordination We next assessed whether Bace1 activity is needed to sustain mature muscle spindles. Adult (P180) wild type, heterozygous and homozygous Bace1 mutant mice were treated with the pharmacologic Bace1 inhibitor Ly2811376 for a period of 29 days (May et al, 2011). Ly2811376 inhibited Bace1 activity effectively in vivo, as assessed by monitoring the Nrg1 processing in the brain (Figure 2A). Ly2811376 treatment led to a regression of adult muscle spindles, notably a loss of 40% of muscle spindles in wild type and heterozygous Bace1 mutant animals, compared to corresponding vehicle-treated groups (Figure 2B; Supplementary Figure S2E). Ly2811376 treatment did not further decrease the muscle spindle pool in homozygous Bace1 mutant mice, demonstrating that this effect was mediated through specific Bace1 inhibition (Figure 2B; Supplementary Figure S2E). Together, these genetic and pharmacological data indicate that Bace1 controls the maintenance of muscle spindles during adulthood, as well as their formation during development. Figure 2.Bace1 activity regulates motor coordination and maintains muscle spindles during adulthood. (A) Western blot analysis of Bace1 expression and processing of endogenous Nrg1 in the midbrain of adult (P180) wild type (wt) or Bace1−/− (B1−/−) mice treated with vehicle (Vh) or the Bace1 inhibitor Ly2811376 (Ly). Nrg1 FL denotes the 130 kDa Nrg1 species corresponding to full-length CRD-Nrg1, detected by an antibody directed against the Nrg1 C-terminal sequence. The amount of Nrg1 FL is markedly increased upon Bace1 inhibition or ablation, indicating reduced cleavage, but Bace1 expression is unaffected by Ly2811376 treatment. Calnexin is used as internal control. (B) Quantification of muscle spindles in the tibialis anterior muscle of control, heterozygous and homozygous Bace1 mutant mice (P180) treated with the Bace1 inhibitor Ly2811376. (C) Performance of Bace1+/+, Bace1−/− and vehicle- or Ly2811376-treated wild-type mice in the inverted grid test. Note that Bace1−/− and Ly2811376-treated mice perform similarly. (D) Representative walking patterns of vehicle- and Ly2811376-treated wild-type mice. (E, F) Homolateral (E) and homologue (F) coupling values for the movements of vehicle- (inner circle) and Ly2811376-treated (outer circle) wild-type mice. Bace1−/− mice (middle circle) are included for comparison. Download figure Download PowerPoint We next tested whether Bace1 inhibition in the adult affected motor coordination. A quantitative assessment of grip ability demonstrated that animals treated with a Bace1 inhibitor lost their footing 3–4 times faster than animals treated with the vehicle (Figure 2C). Gait analysis also demonstrated that the walking pattern of the mice was aberrant after long-term inhibition with Bace1 inhibitor (Figure 2D–F). Thus, the value of homolateral coupling deviated considerably from the one observed in vehicle-treated animals. This reflects a lack of forelimb/hindlimb coordination and resulted in a swaying walking pattern (Figure 2D; quantified in E and Supplementary Figure S1A). Homologue coupling was little disturbed after Bace1 inhibition (Figure 2D; quantified in F and Supplementary Figure S1B and C). We conclude that long-term treatment of adult mice with Bace1 inhibitor disrupts motor coordination. It is noteworthy that coordination was affected to similar extents in Bace1−/− and in Bace1 inhibitor-treated animals, indicating that Bace1 activity is continuously required for motor coordination. Bace1 processes Nrg1 isoforms Various Nrg1 isoforms exist (Figure 3A) that can take over distinct functions. Nrg1 isoforms containing an Ig domain (IgNrg1) are produced by proprioceptive neurons and control the induction of the muscle spindle (Hippenmeyer et al, 2002). Bace1 is expressed broadly in sensory neurons (Willem et al, 2006). In situ hybridization combined with immunohistochemistry showed that Bace1 and IgNrg1 are co-expressed in NF200+ large diameter sensory neurons at birth; thus proprioceptive neurons co-express Bace1 and IgNrg1 (Figure 3B). Quantification demonstrated that the vast majority of sensory neurons as well as IgNrg1+ sensory neurons in dorsal root ganglia (DRG) co-expressed Bace1 (93.7±1.2% and 99.8±0.2%, respectively). Various IgNrg1 isotypes exist, called α1/2 and β1–4 that differ in the EGF-like domains and in sequences carboxy-terminal (C-terminal) thereof (Supplementary Figure S3A; Falls, 2003). We analysed their expression in DRG at P0 using semi-quantitative PCR (qPCR). This showed that among the IgNrg1 isoforms, β variants and particularly, the β1 isotype are expressed at highest levels (Figure 3C). Figure 3.Nrg1β1 is a substrate of Bace1. (A) Structure of Nrg1 isoforms containing cysteine-rich domain (CRD) or Ig-like (Ig) domains. Full-length (Nrg1 FL), N-terminal (Nrg1 NtF) and C-terminal (Nrg1 CtF) fragments analysed in (E, F, H, I) are indicated. Green arrows show the Bace1 cleavage site present in β1 isotypes, yellow star the position of the HA-tag used for biochemical analysis; C-terminal transmembrane domain TM. (B) In situ hybridization (Bace1, IgNrg1) combined with immunohistology (neurofilament 200; NF200) demonstrates co-expression of Bace1 and IgNrg1 in sensory neurons. Left: Bace1 is broadly expressed in sensory neurons. Right: IgNrg1 and Bace1 (insert) are co-expressed in NF200+ sensory neurons. (C) qPCR of DRG mRNA encoding CRD-Nrg1 and α/β IgNrg1 isoforms (P0). (D) Sequence alignment of α/β Nrg1 isotypes; predicted Bace1 cleavage sites are indicated. Asterisk indicates stop codon in β3. (E, F) Western blot analysis of Bace1-dependent processing of (E) Ig- and CRD-Nrg1β1, (F) IgNrg1β1 and IgNrg1β2 in HEK293 cells. Antibodies are indicated (αCNX: anti-calnexin). Full-length precursors (Nrg1 FL; IgNrg1: 110 kD, CRD-Nrg1: 130 kD) and processed C-terminal fragment (Nrg1 CtF: 65 kD) are detected in RIPA lysates using an antibody against the Nrg1 C-terminus; HA-tagged N-terminal fragments (Nrg1 NtF) are detected in the supernatant using anti-HA. Calnexin serves as loading control. NT, non-transfected. (G) Quantification of Bace1-dependent shedding of IgNrg1β1SEAP and IgNrg1β2SEAP. The N-terminal sequence of IgNrg1SEAP variants contains alkaline phosphatase whose enzymatic activity is detected in supernatants in the absence/presence of Bace1 cDNA, C3 or GM6001 inhibitors. (H) Western blot analysis of IgNrg1β1 cleavage in primary neurons. Detected are full-length and C-terminal IgNrg1β1 in RIPA lysates using an antibody recognizing the Nrg1 C-terminus. (I) The N-terminal fragment of IgNrg1β1 was directly detected in supernatant by western blotting using anti-HA (upper panels). Alternately, supernatant was immunoprecipitated using anti-HA (middle and lower panels), and Nrg1 NtF fragments were detected using anti-HA and 4F10 antibodies; the latter identifies a Bace1-specific Nrg1 cleavage product. Asterisks indicate cross-reactive proteins. Scale bar, 50 μm (B). Download figure Download PowerPoint IgNrg1β1 isotypes contain a predicted Bace1 cleavage site (Figure 3D and Hu et al, 2008). However, IgNrg1 isoforms are produced by few sensory neurons, whereas CRD-Nrg1 is expressed broadly in sensory neurons (Figure 3B, cf. Meyer et al, 1997; Hippenmeyer et al, 2002). This hampers a direct biochemical analysis of IgNrg1 processing in sensory ganglia in vivo. We therefore analysed processing of HA-tagged β1 isotypes in cultured HEK293 cells, and tested whether the predicted Bace1 cleavage sites present in β1 variants of Ig- or CRD-containing Nrg1 are recognized. Full-length and processed C-terminal fragment of Nrg1β1 proteins containing CRD or Ig domains were observed in the absence of transfected Bace1 cDNA, using an antibody against the C-terminus of Nrg1 (Figure 3E). In the presence of Bace1, the full-length protein almost disappeared, whereas the processed C-terminal fragment accumulated (Figure 3E). Thus, Bace1 cleaves the Nrg1β1 sequence, regardless of whether it is present in a CRD or Ig isoform. IgNrg1β2 and IgNrg1β3 represent a membrane-tethered and a secreted isoform, respectively, and are produced at lower levels than IgNrg1β1 in DRG (Figure 3A and C). We compared processing of the two membrane-tethered isoforms IgNrg1β1 and IgNrg1β2 in transfected HEK293 cells and analysed the release of their HA-tagged extracellular fragment, which contains the receptor-binding EGF domain (Figure 3F). IgNrg1β1 was constitutively processed, but co-transfection of Bace1 resulted in a further increase in the amount of the C-terminal and HA-tagged N-terminal fragments, as well as a decrease of full-length protein, indicating increased processing. In contrast, IgNrg1β2 was neither processed constitutively, nor in a Bace1-dependent manner (Figure 3F). The release of the N-terminal fragments was quantified using Nrg1 constructs carrying alkaline phosphatase in their extracellular domain (Figure 3G; secreted alkaline phosphatase or SEAP, cf. Willem et al, 2006). Co-transfection of IgNrg1β1SEAP and Bace1 increased the amount of released alkaline phosphatase six-fold, which was abolished by the Bace1 inhibitor C3 but not by the metalloproteinase inhibitor GM6001 (Figure 3G; Willem et al, 2006; Freese et al, 2009). In contrast, released alkaline phosphatase from the corresponding IgNrg1β2SEAP was low and little affected by Bace1 activity. We conclude that the major Ig variant expressed in sensory neurons, Nrg1β1, is a substrate of Bace1. We next tested whether endogenous levels of Bace1 can process IgNrg1β1. Hippocampal neurons were transfected with an IgNrg1β1 expression vector (Figure 3H and I). The majority of cellular IgNrg1β1 was processed, and only little full-length protein was observable. In the presence of the Bace1 inhibitor C3, IgNrg1β1 cleavage was reduced, resulting in accumulation of Nrg1 FL and slightly reduced levels of the 65-kDa C-terminal fragment (Figure 3H). HA-tagged Nrg1β1 in the supernatant was detected using HA-specific antibodies, which revealed mildly reduced quantities of the N-terminal fragment in case of Bace1 and metalloproteinase inhibition (Figure 3I). The combination of Bace1 and metalloproteinase inhibitors acted synergistically. In addition, the N-terminal fragment was immunoprecipitated using HA-specific antibodies and detected on western blot using HA and 4F10 antibodies. We took advantage of the 4F10 antibody, which recognizes a Nrg1β1-specific epitope only when exposed by Bace1 cleavage (Fleck et al, 2013). This revealed that the neuronal production of the Nrg1β1 4F10-specific epitope was impaired upon inhibition of Bace1, but not of metalloproteinases (Figure 3I). These data indicate that endogenous amounts of Bace1 suffice to cleave IgNrg1β1 in primary hippocampal neurons, and support the notion that in such neurons IgNrg1β1 is cleaved by Bace1 and metalloproteinases. IgNrg1 isoforms are required for motor coordination To directly define the function of IgNrg1 isoforms in motor coordination, we generated a new mutant allele in which one of the exons encoding Ig sequences is ‘floxed’ or constitutively deleted (IgNrg1flox and IgNrg1Δ; Supplementary Figure S3B). IgNrg1Δ or cre-recombined IgNrg1flox mutations specifically interfere with the production of IgNrg1, but not CRD-Nrg1 transcripts (see Materials and methods for more details). We then generated Wnt1cre/+IgNrg1flox/Δ mice; Wnt1cre is expressed in neural crest cells that give rise to sensory neurons (Danielian et al, 1998; Le Douarin and Kalcheim, 1999). Semi-quantitative RT-PCR indicated that expression of IgNrg1 and particularly IgNrg1β1 transcripts were reduced by 90 and 50% in DRG of Wnt1cre/+IgNrg1flox/Δ (hereafter called co-IgNrg1 mutants) and heterozygous IgNrg1Δ/+ newborn mice, respectively (Figure 4A; Supplementary Figure S4A). In contrast, expression of CRD-Nrg1 transcripts was unaltered in DRG of co-IgNrg1 mice (Figure 4A). Figure 4.IgNrg1 isoforms control motor coordination. (A) Quantification of the expression of CRD and Ig Nrg1 isoforms in DRG neurons from control, IgNrg1Δ/+, co-IgNrg1 and IgNrg1β1Ov newborn mice using qPCR. (B) Performance of control and co-IgNrg1 mice (P180) in the inverted grid test. (C) Representative walking pattern of control and co-IgNrg1 mice. (D, E) Homolateral (D) and homologue (E) coupling values of limbs in control (inner circle) and co-IgNrg1 (outer circle) mice (P180). Download figure Download PowerPoint Conditional IgNrg1 mutants displayed pronounced curled tails and uncoordinated tail movements, which we attributed to an almost complete depletion of the spindle pool in tail muscles (Supplementary Figure S4B). Besides, co-IgNrg1 mice lost their grip five times faster than their control littermates in the inverted grid test

Proteolytic cleavage represents a unique and irreversible posttranslational event regulating the function and half-life of many intracellular and extracellular proteins. The metalloproteinase ADAM10 has raised attention since it cleaves an increasing number of protein substrates close to the extracellular membrane leaflet. This "ectodomain shedding" regulates the turnover of a number of transmembrane proteins involved in cell adhesion and receptor signaling. It can initiate intramembrane proteolysis followed by nuclear transport and signaling of the cytoplasmic domain. ADAM10 has also been implicated in human disorders ranging from neurodegeneration to dysfunction of the immune system and cancer. Targeting proteases for therapeutic purposes remains a challenge since these enzymes including ADAM10 have a wide range of substrates. Accelerating or inhibiting a specific protease activity is in most cases associated with unwanted side effects and a therapeutic useful window of application has to be carefully defined. A better understanding of the regulatory mechanisms controlling the expression, subcellular localization and activity of ADAM10 will likely uncover suitable drug targets which will allow a more specific and fine-tuned modulation of its proteolytic activity.

Key Points CD107a protects cytotoxic lymphocytes from damage during degranulation. Interference with CD107a expression can cause the death of cytotoxic lymphocytes during degranulation.

Loss of function mutations in progranulin (GRN) cause frontotemporal dementia, but how GRN haploinsufficiency causes neuronal dysfunction remains unclear. We previously showed that GRN is neurotrophic in vitro. Here, we used an in vivo axonal outgrowth system and observed a delayed recovery in GRN−/− mice after facial nerve injury. This deficit was rescued by reintroduction of human GRN and relied on its C-terminus and on neuronal GRN production. Transcriptome analysis of the facial motor nucleus post injury identified cathepsin D (CTSD) as the most upregulated gene. In aged GRN−/− cortices, CTSD was also upregulated, but the relative CTSD activity was reduced and improved upon exogenous GRN addition. Moreover, GRN and its C-terminal granulin domain granulinE (GrnE) both stimulated the proteolytic activity of CTSD in vitro. Pull-down experiments confirmed a direct interaction between GRN and CTSD. This interaction was also observed with GrnE and stabilized the CTSD enzyme at different temperatures. Investigating the importance of this interaction for axonal regeneration in vivo we found that, although individually tolerated, a combined reduction of GRN and CTSD synergistically reduced axonal outgrowth. Our data links the neurotrophic effect of GRN and GrnE with a lysosomal chaperone function on CTSD to maintain its proteolytic capacity.

Mutations within the lysosomal enzyme β-glucocerebrosidase (GC) result in Gaucher disease and represent a major risk factor for developing Parkinson disease (PD). Loss of GC activity leads to accumulation of its substrate glucosylceramide and α-synuclein. Since lysosomal activity of GC is tightly linked to expression of its trafficking receptor, the lysosomal integral membrane protein type-2 (LIMP-2), we studied α-synuclein metabolism in LIMP-2-deficient mice. These mice showed an α-synuclein dosage-dependent phenotype, including severe neurological impairments and premature death. In LIMP-2-deficient brains a significant reduction in GC activity led to lipid storage, disturbed autophagic/lysosomal function, and α-synuclein accumulation mediating neurotoxicity of dopaminergic (DA) neurons, apoptotic cell death, and inflammation. Heterologous expression of LIMP-2 accelerated clearance of overexpressed α-synuclein, possibly through increasing lysosomal GC activity. In surviving DA neurons of human PD midbrain, LIMP-2 levels were increased, probably to compensate for lysosomal GC deficiency. Therefore, we suggest that manipulating LIMP-2 expression to increase lysosomal GC activity is a promising strategy for the treatment of synucleinopathies.

The metalloproteinase ADAM10 is of importance for Notch-dependent cortical brain development. The protease is tightly linked with α-secretase activity toward the amyloid precursor protein (APP) substrate. Increasing ADAM10 activity is suggested as a therapy to prevent the production of the neurotoxic amyloid β (Aβ) peptide in Alzheimer's disease. To investigate the function of ADAM10 in postnatal brain, we generated Adam10 conditional knock-out (A10cKO) mice using a CaMKIIα-Cre deleter strain. The lack of ADAM10 protein expression was evident in the brain cortex leading to a reduced generation of sAPPα and increased levels of sAPPβ and endogenous Aβ peptides. The A10cKO mice are characterized by weight loss and increased mortality after weaning associated with seizures. Behavioral comparison of adult mice revealed that the loss of ADAM10 in the A10cKO mice resulted in decreased neuromotor abilities and reduced learning performance, which were associated with altered in vivo network activities in the hippocampal CA1 region and impaired synaptic function. Histological and ultrastructural analysis of ADAM10-depleted brain revealed astrogliosis, microglia activation, and impaired number and altered morphology of postsynaptic spine structures. A defect in spine morphology was further supported by a reduction of the expression of NMDA receptors subunit 2A and 2B. The reduced shedding of essential postsynaptic cell adhesion proteins such as N-Cadherin, Nectin-1, and APP may explain the postsynaptic defects and the impaired learning, altered network activity, and synaptic plasticity of the A10cKO mice. Our study reveals that ADAM10 is instrumental for synaptic and neuronal network function in the adult murine brain.