Pascal Genschik

The plant hormone ethylene regulates a wide range of developmental processes and the response of plants to stress and pathogens. Genetic studies in Arabidopsis led to a partial elucidation of the mechanisms of ethylene action. Ethylene signal transduction initiates with ethylene binding at a family of ethylene receptors and terminates in a transcription cascade involving the EIN3/EIL and ERF families of plant-specific transcription factors. Here, we identify two Arabidopsis F box proteins called EBF1 and EBF2 that interact physically with EIN3/EIL transcription factors. EBF1 overexpression results in plants insensitive to ethylene. In contrast, plants carrying the ebf1 and ebf2 mutations display a constitutive ethylene response and accumulate the EIN3 protein in the absence of the hormone. Our work places EBF1 and EBF2 within the genetic framework of the ethylene-response pathway and supports a model in which ethylene action depends on EIN3 protein stabilization.

Plants have evolved robust mechanisms to respond and adapt to unfavorable environmental conditions, such as low temperature. The C-repeat/drought-responsive element binding factor CBF1/DREB1b gene encodes a transcriptional activator transiently induced by cold that controls the expression of a set of genes responding to low temperature (the CBF regulon). Constitutive expression of CBF1 confers freezing tolerance but also slows growth. Here, we propose that low temperature-induced CBF1 expression restrains growth at least in part by allowing the accumulation of DELLAs, a family of nuclear growth-repressing proteins, the degradation of which is stimulated by gibberellin (GA). We show that cold/CBF1 enhances the accumulation of a green fluorescent protein (GFP)-tagged DELLA protein (GFP-RGA) by reducing GA content through stimulating expression of GA-inactivating GA 2-oxidase genes. Accordingly, transgenic plants that constitutively express CBF1 accumulate less bioactive GA and as a consequence exhibit dwarfism and late flowering. Both phenotypes are suppressed when CBF1 is expressed in a line lacking two DELLA proteins, GA-INSENSITIVE and REPRESSOR OF GA1-3. In addition, we show that DELLAs contribute significantly to CBF1-induced cold acclimation and freezing tolerance by a mechanism that is distinct from the CBF regulon. We conclude that DELLAs are components of the CBF1-mediated cold stress response.

Xie and colleagues previously isolated the Arabidopsis COI1 gene that is required for response to jasmonates (JAs), which regulate root growth, pollen fertility, wound healing, and defense against insects and pathogens. In this study, we demonstrate that COI1 associates physically with AtCUL1, AtRbx1, and either of the Arabidopsis Skp1-like proteins ASK1 or ASK2 to assemble ubiquitin-ligase complexes, which we have designated SCF(COI1). COI1(E22A), a single amino acid substitution in the F-box motif of COI1, abolishes the formation of the SCF(COI1) complexes and results in loss of the JA response. AtRbx1 double-stranded RNA-mediated genetic interference reduces AtRbx1 expression and affects JA-inducible gene expression. Furthermore, we show that the AtCUL1 component of SCF(COI1) complexes is modified in planta, where mutations in AXR1 decrease the abundance of the modified AtCUL1 of SCF(COI1) and lead to a reduction in JA response. Finally, we demonstrate that the axr1 and coi1 mutations display a synergistic genetic interaction in the double mutant. These results suggest that the COI1-mediated JA response is dependent on the SCF(COI1) complexes in Arabidopsis and that the AXR1-dependent modification of the AtCUL1 subunit of SCF(COI1) complexes is important for JA signaling.

Systemic acquired resistance (SAR) is a broad-spectrum plant immune response involving profound transcriptional changes that are regulated by the coactivator NPR1. Nuclear translocation of NPR1 is a critical regulatory step, but how the protein is regulated in the nucleus is unknown. Here, we show that turnover of nuclear NPR1 protein plays an important role in modulating transcription of its target genes. In the absence of pathogen challenge, NPR1 is continuously cleared from the nucleus by the proteasome, which restricts its coactivator activity to prevent untimely activation of SAR. Surprisingly, inducers of SAR promote NPR1 phosphorylation at residues Ser11/Ser15, and then facilitate its recruitment to a Cullin3-based ubiquitin ligase. Turnover of phosphorylated NPR1 is required for full induction of target genes and establishment of SAR. These in vivo data demonstrate dual roles for coactivator turnover in both preventing and stimulating gene transcription to regulate plant immunity.

Plant growth is adaptively modulated in response to environmental change. The phytohormone gibberellin (GA) promotes growth by stimulating destruction of the nuclear growth-repressing DELLA proteins [1-7], thus providing a mechanism for environmentally responsive growth regulation [8, 9]. Furthermore, DELLAs promote survival of adverse environments [8]. However, the relationship between these survival and growth-regulatory mechanisms was previously unknown. Here, we show that both mechanisms are dependent upon control of the accumulation of reactive oxygen species (ROS). ROS are small molecules generated during development and in response to stress that play diverse roles as eukaryotic intracellular second messengers [10]. We show that Arabidopsis DELLAs cause ROS levels to remain low after either biotic or abiotic stress, thus delaying cell death and promoting tolerance. In essence, stress-induced DELLA accumulation elevates the expression of genes encoding ROS-detoxification enzymes, thus reducing ROS levels. In accord with recent demonstrations that ROS control root cell expansion [11, 12], we also show that DELLAs regulate root-hair growth via a ROS-dependent mechanism. We therefore propose that environmental variability regulates DELLA activity [8] and that DELLAs in turn couple the downstream regulation of plant growth and stress tolerance through modulation of ROS levels.

The length of the Arabidopsis thaliana life cycle depends on the timing of the floral transition. Here, we define the relationship between the plant stress hormone ethylene and the timing of floral initiation. Ethylene signaling is activated by diverse environmental stresses, but it was not previously clear how ethylene regulates flowering. First, we show that ethylene delays flowering in Arabidopsis , and that this delay is partly rescued by loss-of-function mutations in genes encoding the DELLAs, a family of nuclear gibberellin (GA)-regulated growth-repressing proteins. This finding suggests that ethylene may act in part by modulating DELLA activity. We also show that activated ethylene signaling reduces bioactive GA levels, thus enhancing the accumulation of DELLAs. Next, we show that ethylene acts on DELLAs via the CTR1-dependent ethylene response pathway, most likely downstream of the transcriptional regulator EIN3. Ethylene-enhanced DELLA accumulation in turn delays flowering via repression of the floral meristem-identity genes LEAFY ( LFY ) and SUPPRESSOR OF OVEREXPRESSION OF CONSTANS 1 ( SOC1 ). Our findings establish a link between the CTR1/EIN3-dependent ethylene and GA–DELLA signaling pathways that enables adaptively significant regulation of plant life cycle progression in response to environmental adversity.

The ubiquitin proteasome system is a key regulator of many biological processes in all eukaryotes. This mechanism employs several types of enzymes, the most important of which are the ubiquitin E3 ligases that catalyse the attachment of polyubiquitin chains to target proteins for their subsequent degradation by the 26S proteasome. Among the E3 families, the SCF is the best understood; it consists of a multi-protein complex in which the F-box protein plays a crucial role by recruiting the target substrate. Strikingly, nearly 700 F-box proteins have been predicted in Arabidopsis, suggesting that plants have the capacity to assemble a multitude of SCF complexes, possibly controlling the stability of hundreds of substrates involved in a plethora of biological processes. Interestingly, viruses and even pathogenic bacteria have also found ways to hijack the plant SCF and to reprogram it for their own purposes.

Bioactive gibberellins (GAs) are tetracyclic diterpenoid plant hormones that promote important processes of plant growth and development, such as seed germination, growth through elongation, and floral transition. Thus, mutant plants that are affected in GA biosynthesis or signalling exhibit altered seed germination and, at the adult stage, are dwarf and dark green and also show delayed flowering. The components of the GA metabolism and signalling pathways are reviewed here and recent findings regarding the regulation and possible mode of action of DELLA proteins are discussed.

Gibberellins (GAs) are plant hormones involved in the regulation of plant growth in response to endogenous and environmental signals. GA promotes growth by stimulating the degradation of nuclear growth-repressing DELLA proteins. In Arabidopsis thaliana, DELLAs consist of a small family of five proteins that display distinct but also overlapping functions in repressing GA responses. This study reveals that DELLA RGA-LIKE3 (RGL3) protein is essential to fully enhance the jasmonate (JA)-mediated responses. We show that JA rapidly induces RGL3 expression in a CORONATINE INSENSITIVE1 (COI1)- and JASMONATE INSENSITIVE1 (JIN1/MYC2)-dependent manner. In addition, we demonstrate that MYC2 binds directly to RGL3 promoter. Furthermore, we show that RGL3 (like the other DELLAs) interacts with JA ZIM-domain (JAZ) proteins, key repressors of JA signaling. These findings suggest that JA/MYC2-dependent accumulation of RGL3 represses JAZ activity, which in turn enhances the expression of JA-responsive genes. Accordingly, we show that induction of primary JA-responsive genes is reduced in the rgl3-5 mutant and enhanced in transgenic lines overexpressing RGL3. Hence, RGL3 positively regulates JA-mediated resistance to the necrotroph Botrytis cinerea and susceptibility to the hemibiotroph Pseudomonas syringae. We propose that JA-mediated induction of RGL3 expression is of adaptive significance and might represent a recent functional diversification of the DELLAs.

Abstract Understanding the regulation of key genes involved in plant iron acquisition is of crucial importance for breeding of micronutrient-enriched crops. The basic helix-loop-helix protein FER-LIKE FE DEFICIENCY-INDUCED TRANSCRIPTION FACTOR (FIT), a central regulator of Fe acquisition in roots, is regulated by environmental cues and internal requirements for iron at the transcriptional and posttranscriptional levels. The plant stress hormone ethylene promotes iron acquisition, but the molecular basis for this remained unknown. Here, we demonstrate a direct molecular link between ethylene signaling and FIT. We identified ETHYLENE INSENSITIVE3 (EIN3) and ETHYLENE INSENSITIVE3-LIKE1 (EIL1) in a screen for direct FIT interaction partners and validated their physical interaction in planta. We demonstrate that the ein3 eil1 transcriptome was affected to a greater extent upon iron deficiency than normal iron compared with the wild type. Ethylene signaling by way of EIN3/EIL1 was required for full-level FIT accumulation. FIT levels were reduced upon application of aminoethoxyvinylglycine and in the ein3 eil1 background. MG132 could restore FIT levels. We propose that upon ethylene signaling, FIT is less susceptible to proteasomal degradation, presumably due to a physical interaction between FIT and EIN3/EIL1. Increased FIT abundance then leads to the high level of expression of genes required for Fe acquisition. This way, ethylene is one of the signals that triggers Fe deficiency responses at the transcriptional and posttranscriptional levels.

Posttranscriptional gene silencing (PTGS) mediated by siRNAs is an evolutionarily conserved antiviral defense mechanism in higher plants and invertebrates. In this mechanism, viral-derived siRNAs are incorporated into the RNA-induced silencing complex (RISC) to guide degradation of the corresponding viral RNAs. In Arabidopsis, a key component of RISC is ARGONAUTE1 (AGO1), which not only binds to siRNAs but also carries the RNA slicer activity. At present little is known about posttranslational mechanisms regulating AGO1 turnover. Here we report that the viral suppressor of RNA silencing protein P0 triggers AGO1 degradation by the autophagy pathway. Using a P0-inducible transgenic line, we observed that AGO1 degradation is blocked by inhibition of autophagy. The engineering of a functional AGO1 fluorescent reporter protein further indicated that AGO1 colocalizes with autophagy-related (ATG) protein 8a (ATG8a) positive bodies when degradation is impaired. Moreover, this pathway also degrades AGO1 in a nonviral context, especially when the production of miRNAs is impaired. Our results demonstrate that a selective process such as ubiquitylation can lead to the degradation of a key regulatory protein such as AGO1 by a degradation process generally believed to be unspecific. We anticipate that this mechanism will not only lead to degradation of AGO1 but also of its associated proteins and eventually small RNAs.

Review2 August 2013free access The emerging family of CULLIN3-RING ubiquitin ligases (CRL3s): cellular functions and disease implications Pascal Genschik Corresponding Author Pascal Genschik Unité Propre de Recherche 2357, Centre National de la Recherche Scientifique, Institut de Biologie Moléculaire des Plantes, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Izabela Sumara Izabela Sumara Institute of Genetics and Molecular and Cellular Biology (IGBMC), Illkirch, France Search for more papers by this author Esther Lechner Esther Lechner Unité Propre de Recherche 2357, Centre National de la Recherche Scientifique, Institut de Biologie Moléculaire des Plantes, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Pascal Genschik Corresponding Author Pascal Genschik Unité Propre de Recherche 2357, Centre National de la Recherche Scientifique, Institut de Biologie Moléculaire des Plantes, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Izabela Sumara Izabela Sumara Institute of Genetics and Molecular and Cellular Biology (IGBMC), Illkirch, France Search for more papers by this author Esther Lechner Esther Lechner Unité Propre de Recherche 2357, Centre National de la Recherche Scientifique, Institut de Biologie Moléculaire des Plantes, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Author Information Pascal Genschik 1, Izabela Sumara2 and Esther Lechner1 1Unité Propre de Recherche 2357, Centre National de la Recherche Scientifique, Institut de Biologie Moléculaire des Plantes, Conventionné avec l'Université de Strasbourg, Strasbourg, France 2Institute of Genetics and Molecular and Cellular Biology (IGBMC), Illkirch, France *Corresponding author. Institut de Biologie Moléculaire des Plantes (CNRS), 12 rue du Général Zimmer, 67084 Strasbourg, France. Tel.:+33 3 67 15 53 96; Fax:+33 3 88 61 44 42; E-mail: [email protected] The EMBO Journal (2013)32:2307-2320https://doi.org/10.1038/emboj.2013.173 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Protein ubiquitylation is a post-translational modification that controls all aspects of eukaryotic cell functionality, and its defective regulation is manifested in various human diseases. The ubiquitylation process requires a set of enzymes, of which the ubiquitin ligases (E3s) are the substrate recognition components. Modular CULLIN-RING ubiquitin ligases (CRLs) are the most prevalent class of E3s, comprising hundreds of distinct CRL complexes with the potential to recruit as many and even more protein substrates. Best understood at both structural and functional levels are CRL1 or SCF (SKP1/CUL1/F-box protein) complexes, representing the founding member of this class of multimeric E3s. Another CRL subfamily, called CRL3, is composed of the molecular scaffold CULLIN3 and the RING protein RBX1, in combination with one of numerous BTB domain proteins acting as substrate adaptors. Recent work has firmly established CRL3s as major regulators of different cellular and developmental processes as well as stress responses in both metazoans and higher plants. In humans, functional alterations of CRL3s have been associated with various pathologies, including metabolic disorders, muscle, and nerve degeneration, as well as cancer. In this review, we summarize recent discoveries on the function of CRL3s in both metazoans and plants, and discuss their mode of regulation and specificities. Glossary ABA abscisic acid adRP autosomal dominant Retinitis Pigmentosa BTB/POZ Bric-a-brac, Tramtrack and Broad Complex/Pox virus and Zinc finger CAND1 Cullin-Associated and Neddylation-Disassociated 1 Ci Cubitus Interruptus CPC Chromosomal Passenger Complex CRL CULLIN-RING Ubiquitin Ligase DCN1 Defective in Cullin Neddylation 1 E2 ubiquitin-conjugating enzyme E3 ubiquitin ligase FBP F-box protein IFN Interferon MATH Meprin and TRAF homology NAE Nedd8-Activating Enzyme NPH3 Nonphototropic Hypocotyl 3 Nrf2 NF-E2-related factor 2 PID protein interaction domain PLK1 Polo-Like Kinase 1 SA Salicylic Acid SAC Spindle Assembly Checkpoint SAR Systemic Acquired Resistance SCF SKP1/CUL1/F-box protein TPR Tetratrico Peptide Repeat UPS Ubiquitin/Proteasome System Introduction Regulation of protein stability by the ubiquitin/proteasome system (UPS) participates in a broad range of physiologically and developmentally controlled processes in all eukaryotes (Ciechanover et al, 2000; Smalle and Vierstra, 2004). A critical step in this pathway involves ubiquitin ligases (also known as E3 enzymes or E3s), which facilitate the transfer of ubiquitin moieties to substrate proteins, as a preparative step for their degradation by the 26S proteasome. Several hundred different E3s have been identified in metazoan and plant genomes, based on specific, commonly shared structural motifs. Among them, CULLIN-RING ubiquitin ligases (CRLs) are the most prevalent class (Petroski and Deshaies, 2005; Hua and Vierstra, 2011). CRLs are multimeric E3s, in which one particular CULLIN protein serves as a molecular scaffold linking up the catalytic module, composed of a RING finger domain protein and a ubiquitin-conjugating (or E2) enzyme, to a specific substrate recognition module, which physically interacts with target proteins. Among the CRL family, the founding member is the SCF (SKP1/CUL1/F-box protein (FBP)) complex (Figure 1A), which employs one of 68 (human) or 700 (Arabidopsis thaliana) FBPs for substrate recognition (Gagne et al, 2002; Jin et al, 2004). Beside CUL1, eukaryotic genomes encode additional cullins (CUL2, CUL3, CUL4, CUL5, and CUL7) (Gieffers et al, 2000; Sarikas et al, 2008) that have likewise been found to form protein complexes with E3 activities, modifying a variety of substrates by using distinct sets of adaptor modules. Figure 1.Structural organization of SCF/CRL1 and the CRL3 complexes. (A) The SCF/CRL1 and the CRL3 complexes share a similar catalytic core module composed of the scaffold proteins CUL1 and CUL3, respectively, and the RING finger protein RBX1 (also known as Hrt1 or ROC1). Single-subunit BTB domain proteins bridge CUL3-RBX1 to substrates, while this function requires an SKP1/FBP heterodimer in SCF/CRL1. Substrate recognition is governed by an independent protein–protein interaction domain (PID) found in most of the FBPs and CUL3-interacting BTB domain proteins. (B) Non-exhaustive list of protein domains is commonly found associated with the BTB domain in CRL3 adaptors. MATH and Ankyrin domains occur in both metazoans and higher plants, while other domains are specific to either kingdom. BTB-KELCH; BTB-WD40; BTB-T1-Kv (voltage-gated potassium channel T1); BTB-Rho (Ras homology); BTB-bZip (basic leucine Zipper); BTB-MATH (Meprin and TRAF homology); BTB-ANKYRIN repeat; BTB-NPH3 (non-phototropic hypocotyl 3); BTB-TPR (Tetratrico Peptide Repeat); BTB-ARM (Armadillo); BTB-TAZ (Transcriptional Adaptor Zinc finger); BTB-PENT (Pentapeptide). Download figure Download PowerPoint Recent research has firmly established CUL3 as the molecular scaffold of a major class of CRLs controlling different developmental and stress responses (Table I) as well as human pathologies (Table II). CUL3 is a highly conserved CULLIN family member present in the genomes of all eukaryotes. In C. elegans, CUL3 loss-of-function leads to a defect of cytokinesis in single-cell embryos (Kurz et al, 2002), and the deletion of this gene in mouse produces an arrest during early embryogenesis (Singer et al, 1999). In the model plant Arabidopsis thaliana, disruption of the two related CUL3A and CUL3B genes also causes embryo lethality, affecting both embryo pattern formation and endosperm development (Figueroa et al, 2005; Thomann et al, 2005; Gingerich et al, 2007). In contrast to this situation in multicellular organisms, the function of CUL3 orthologues is not essential in either budding or fission yeasts (Geyer et al, 2003; Michel et al, 2003). Table 1. List of functional CUL3-based ubiquitin ligases and their substrates in different organisms Organisms Name Protein domains Substrates Function Reference Mammals KLHL9/13/21 BTB-Kelch Aurora Ba Mitotic progression Sumara et al (2007) and Maerki et al (2009) KLHDC5 BTB-Kelch p60/katanin Mitotic spindle formation Cummings et al (2009) BACURD BTBb RhoA Actin cytoskeleton structure Chen et al (2009b) KLHL12 BTB-Kelch Dsh Wnt/β-catenin signalling Angers et al (2006) Sec31a Collagen secretion Jin et al (2012) KEAP1/KLHL19 BTB-Kelch Nrf2 Oxidative stress response Cullinan et al (2004), Kobayashi et al (2004) and Zhang et al (2004) IKKβ NF-κB signalling Lee et al (2009) KLHL20 BTB-Kelch PML Hypoxia response Yuan et al (2011) DAPK IFN-induced cell death Lee et al (2010) KLHL22 BTB-Kelch PLK1a Chromosome segregation Beck et al (2013) KLHL25 BTB-Kelch 4E-BP1 Translational homeostasis Yanagiya et al (2012) KLHL8 BTB-Kelch Rapsyn Neurotransmitter signalling Nam et al (2009) KLHL3 BTB-Kelch WNK1, WNK4 Blood pressure regulation Ohta et al (2013) and Wakabayashi et al (2013) SPOP MATH-BTB Gli2/Gli3 Hedgehog signalling Chen et al (2009a) Daxx Transcription, apoptosis Kwon et al (2006) SRC-3 Transcription by nuclear receptors Li et al (2011) PIPKIIβa Phosphoinositide signalling Bunce et al (2008) BMI1aMacroH2Aa Epigenetic silencing Hernandez-Munoz et al (2005) D. rerio Btbd6a BTB-PHR Plzf Neurogenesis Sobieszczuk et al (2010) D. melanogaster HIB/SPOP MATH-BTB Ci/Gli Hedgehog signalling Zhang et al (2006) Puckered TNF-mediated JNK signalling Liu et al (2009) C. elegans KEL-8 BTB-Kelch RPY-1 Neurotransmitter signalling Schaefer and Rongo (2006) and Nam et al (2009) MEL-26 MATH-BTB MEI-1 Microtubule reorganization Pintard et al (2003b) A. thaliana ETO1/EOL1/EOL2 BTB-TPR Type-2 ACSs Ethylene biosynthesis Christians et al (2009), Wang et al (2004) and Thomann et al (2009) NPH3 BTB-NPH3 PHOT1 Phototropism Roberts et al (2011) NPR3/NPR4 BTB-Ank-repeat NPR1 Systemic acquired resistance (SAR) Fu et al (2012) BPM1-6 MATH-BTB AtHB6 ABA response Lechner et al (2011) WRI1 Fatty acid metabolism Chen et al (2013) a BTB-associated domains and substrates supported by strong in vivo evidence are also given. a Substrates that may not be degraded and whose ubiquitylation may serve non-proteolytic functions. b BACURD contains 180 C-terminal residues with no recognizable sequence motif. Table 2. List of mutations detected in CUL3 and BTB substrate-specific adaptors in patients suffering from indicated diseases Name Disease Mutation Domain Effect Reference CUL3 Pseudohypoaldosteronism type II (PHAII)/Gordon's syndrome/hypertension Delection aa 403–459 Segment between BTB-binding and RING binding domains Loss of KLHL3 binding Boyden et al (2012) and Wakabayashi et al (2013) KLHL3 PHAII/Gordon's syndrome/hypertension Numerous recessive and dominant mutationsaA77EM78VE85AC164FQ309RR384QL387PS410LS432NR528HR528CN529K BTBBACKKelch Loss of CUL3 bindingLoss of CUL3 bindingLoss of substrate binding Boyden et al (2012), Louis-Dit-Picard et al (2012), Ohta et al (2013) and Wakabayashi et al (2013) KLHL7 Autosomal dominant Retinitis Pigmentosa (adRP)/Blindness A153TA153V BACK Loss of CUL3 bindingLower E3 ligase activity Kigoshi et al (2011) KLHL9 Distal myopathy/skeletal muscle atrophy L95F BTB Reduction in CUL3 binding Cirak et al (2010) KBTBD13 Nemaline myopathy (NEM) R248SaK390Na R408Ca Kelch Predicted disruption of β propeller structure Sambuughin et al (2012) Gigaxonin Giant axonal neuropathy GAN/neuropathy of peripheral nerves and central nervous system R15SaS52GaS79LaV82FaR138HaR269QaR293XL309RaC393XaW401XaQ483Xa E486KaR545CaC570Ya BTBBACKKelch Predicted loss of CUL3 bindingLoss of substrate binding Bomont et al (2000) and Ding et al (2002) KCTD7 Epilepsy, progressive myoclonic 3 (EPM3)Neuronal ceroid lipofuscinosis (NCL) R99XaR184C BTB Protein truncationLoss of CUL3 binding Van Bogaert et al (2007) and Staropoli et al (2012) Keap1 Lung cancer R272CG333SG364CL413RR415GG430C BACKKelch Inhibition of E3 ligase activity but not binding to CUL3Loss of substrate binding Padmanabhan et al (2006), Singh et al (2006) and Ohta et al (2008) a Detected mutations, of which predicted effects were not confirmed experimentally. At the structural level, CUL3 interacts with BTB/POZ (for ‘Bric-a-brac, Tramtrack and Broad Complex/Pox virus and Zinc finger’, hereafter referred to simply as BTB) domain proteins, which function as substrate-specific adaptors (Furukawa et al, 2003; Xu et al, 2003; Pintard et al, 2003b). They bind CUL3 via the BTB domain, and commonly direct substrate specificity through an independent additional protein–protein interaction domain (PID) (Figure 1A), thus uniting the functions of the SKP1/FBP heterodimer in SCF/CRL1 complexes in a single polypeptide. Sequence analyses have so far identified over a dozen different protein domains that are associated, sometimes in combinations, with the BTB domain (Stogios et al, 2005). Some of these are widely distributed throughout eukaryotic genomes (such as the Meprin and TRAF homology (MATH) domain), while others are specific to either metazoans (e.g., the Kelch domain) or plants (e.g., the BTB-non-phototropic hypocotyl 3 (NPH3) domain; Figure 1B). It should be noted that only a subset of all BTB domain proteins actually serve as CRL3 adaptors, and they are set apart from the large fraction of zinc-finger BTB proteins by the presence of an additional paired helical structure (called 3-box motif) positioned C-terminal to the BTB domain, which fulfils an important function in CRL3s assembly analogous to the F-box and SOCS box motifs of other Cullin-based E3s (Zhuang et al, 2009). It is noteworthy that the number of BTB proteins—and thus potential CRL3s—varies a lot between organisms. The human genome encodes nearly 200 BTB domain proteins, (Stogios et al, 2005), although those lacking the 3-box structures may not be engaged in functional CRL3 complexes, while about 80 BTB proteins have been identified in A. thaliana (Dieterle et al, 2005; Figueroa et al, 2005; Gingerich et al, 2005) and even fewer in D. melanogaster. This contrasts the situation for the SCF/CRL1 complexes, where the large number of FBPs in plants indicates increased versatility (Gagne et al, 2002). However, as will be illustrated below, recent research indicates that this does not mean that CRL3s are of minor importance in plants. Biological processes involving CRL3s in metazoans A key regulator of basic cellular functions in metazoans The ubiquitin/proteasome system is a major regulator of the cell cycle in all eukaryotes, targeting dozens of regulatory proteins for degradation and thus ensuring irreversible cell-cycle stage transitions (Mocciaro and Rape, 2012). While the key E3s for this are the anaphase promoting complex/cyclosome (APC/C) and SCF complexes, more recently CRL3s also entered into the game. In mammalian cells, CRL3s play an essential function in the progression of mitosis and completion of cytokinesis via ubiquitination of Aurora B kinase and thereby preventing chromosomal passenger complex (CPC) accumulation on mitotic chromosomes (Sumara et al, 2007). Aurora B is poly-ubiquitylated on mitotic chromosomes during prometaphase, in a manner dependent on the Kelch-BTB proteins KLHL9 and KLHL13. Rather than triggering its degradation by the proteasome, Aurora B polyubiquitylation during mitosis however seems to serve as a signal for its extraction from chromosomes. During anaphase, another BTB protein, KLHL21, was shown to mono-ubiquitylate Aurora B on microtubules of the spindle midzone (Maerki et al, 2009). Similarly, a CUL3-KLHL22 E3 ligase complex mono-ubiquitylates Polo-like kinase 1 (PLK1) to remove it from kinetochores after chromosomes have achieved bi-orientiation in metaphase (Beck et al, 2013), with this non-degradative PLK1 ubiquitylation being necessary for spindle assembly checkpoint (SAC) silencing and mitotic chromosome segregation. Thus, CUL3 recruits various BTB-containing proteins to target cell-cycle kinases, and possibly also other cell-cycle regulators, at distinct subcellular localizations and at different steps of mitosis. Moreover, the fact that CRL3s not only target substrates for proteasomal degradation, but also reversibly regulate processes by controlling subcellular localization and possibly even the activity and/or interactions of substrates in space and time, significantly expands the versatility and potential roles of CRL3s. One of the first identified CRL3 substrate adaptors is the well-characterized nematode MATH-BTB protein MEL-26 (reviewed in Pintard et al, 2004). MEL-26 recruits the microtubule-severing katanin protein MEI-1, which is required for meiotic spindle formation but thereafter undergoes rapid CRL3-dependent degradation prior to the onset of mitotic divisions, when its persistence would lead to small and misoriented mitotic spindles. This mechanism appears to be conserved in metazoans, as the mammalian katanin catalytic subunit is also degraded via CRL3-mediated ubiquitylation, involving the Kelch repeat-containing BTB adaptor protein KLHDC5 (Cummings et al, 2009). In addition to microtubule dynamics, CRL3 regulation also affects the actin cytoskeleton (Chen et al, 2009b). Here, the BTB protein BACURD, which does not contain a known recognizable substrate recognition motif in its C-terminal region, mediates the turnover of the small GTPase RhoA that controls the organization of actin cytoskeleton structure. Failure to degrade RhoA leads to abnormal stress fibres and inhibits the migration capabilities of mammalian cells. Protein trafficking pathways CUL3 and its BTB adaptor protein KLHL12 are important regulators of embryonic stem (ES) cell morphology, by affecting the deposition of the extracellular matrix component collagen, which is essential in all metazoans and important for ES cell division (Jin et al, 2012). Similarly to KLHL22, KLHL12 promotes mono-ubiquitylation of its target SEC31, a coat protein of COPII vesicles, and this allows the formation of enlarged COPII vesicle structures required for exocytosis and deposition of rigid, rod-shaped collagen molecules. In addition to secretion, CUL3 has also been implicated in the regulation of late endosome maturation, although the BTB adaptor proteins and their substrates involved in this process remain to be identified (Huotari et al, 2012). Transcription in developmental signalling In Drosophila, morphogens such as Hedgehog (Hh) have key roles in developmental processes. A pivotal mediator of Hh signalling, the transcription factor Cubitus Interruptus (Ci), needs to be specifically expressed in and sometimes restricted to specific tissues during development. One way to achieve this is targeted proteolysis, as illustrated by the MATH-BTB protein HIB/SPOP, which is expressed in the Drosophila eye disc posterior to the morphogenic furrow and that promotes Ci degradation to ensure normal eye development (Zhang et al, 2006). This process appears to be conserved in metazoans, as the mammalian SPOP homologue serves as a CRL3 adaptor for degradation of Gli2 and Gli3, two Gli transcription factors homologous to Drosophila Ci (Chen et al, 2009a). Importantly, the work on SPOP CRL3s defines mechanistically how SPOP interacts with its substrates to control transcriptional outputs (Chen et al, 2009a; Zhuang et al, 2009). In vertebrates, another important signalling protein targeted by a CRL3 complex is Dishevelled (Dsh) (Angers et al, 2006), which constitutes a critical node in cell differentiation/proliferation decisions via the Wnt/β-catenin signalling pathway. Therefore, Dsh protein levels need to be tightly regulated for normal embryonic development, and this is achieved through Wnt signal-dependent Dsh interaction with the BTB-Kelch protein KLHL12, leading to Dsh degradation. Transcription in stress responses One of the best-understood CRL3 roles in mammalian cells lies in the Keap1-Nrf2 (NF-E2-related factor 2) stress response pathway (for a recent in-depth review, see Taguchi et al, 2011). Nrf2 is a major transcriptional activator that induces expression of numerous protective genes in response to oxidative stress. Under normal growth conditions (i.e., in the absence of cellular stress), the BTB-Kelch substrate adaptor Keap1 triggers Nrf2 ubiquitin-dependent degradation by the proteasome in the cytoplasm (Cullinan et al, 2004; Kobayashi et al, 2004; Zhang et al, 2004). However, several cysteine residues in Keap1 can react with electrophiles produced during stress, which negatively affects CUL3-Keap1 ubiquitin E3 ligase activity (Dinkova-Kostova et al, 2002; Wakabayashi et al, 2004) (Figure 2). Upon oxidative stress, Nrf2 is therefore free to translocate into the nucleus and bind to the anti-oxidant responsive elements (AREs) in the promoter regions of its target genes. Besides Nrf2, Keap1 also recognizes other target proteins, such as the oncogenic kinase IKKβ (Lee et al, 2009) (discussed in more detail below). Figure 2.Mode of regulation of CRL3 activity and substrate recognition. (A) Nrf2 is constitutively targeted for Keap1-dependent degradation under normal conditions. In response to oxidative stress, oxidative modifications (denoted as (e), electrophile) on Keap1 impair its activity and result in Nrf2 stabilization. (B) In plant immunity, the transcription coactivator NPR1 is regulated at several levels. In unchallenged cells, NPR1 is predominantly sequestered in the cytoplasm in an oligomeric form through redox-sensitive intermolecular disulphide bonds. Upon pathogen infection, salicylic acid (SA) signals lead to alterations in reduction potential and partially relieves NPR1 to enter the nucleus. High SA concentrations immediately at sites of infection promote its binding to the BTB protein NPR3 and enhance NPR3–NPR1 interaction and subsequent NPR1 degradation, thereby favouring programmed cell death. Lower SA levels in neighbouring cells are insufficient to trigger NPR3-mediated NPR1 ubiquitylation, enabling NPR1 to accumulate and establish systemic acquired resistance (SAR). See text for details. Download figure Download PowerPoint Other levels of gene expression control CRL3s can also control gene expression at other levels than transcriptional activation. In mammalian cells, the CRL3 adaptor SPOP mediates ubiquitylation of the Polycomb group protein BMI1 and the variant histone MacroH2A1 (Hernandez-Munoz et al, 2005), apparently affecting their function in a non-proteolytic fashion. CRL3-SPOP function is required for proper MacroH2A1 localization to the inactive X chromosome, and might thus be actively involved in the epigenetic silencing process that leads to X inactivation. Further downstream in the process of gene expression, CRL3 was recently implicated in the control of translational homeostasis in mammals (Yanagiya et al, 2012). Here, the BTB adaptor KLHL25 promotes degradation of 4E-BP1, a protein that acts as a repressor of translation initiation. 4E-BP1 is only targeted when it is hypophosphorylated and therefore unable to interact with the mRNA cap-binding protein eIF4E, providing a means to control the levels of translation to maintain cellular homeostasis. Cell death In mammalian cells, CUL3 and the adaptor KLHL20 ubiquitylate the death-associated protein kinase (DAPK), an apoptosis mediator involved in interferon (IFN)-induced cell death as well as in response to a variety of other stimuli (Lee et al, 2010). Interestingly, this process is controlled at the level of sequestration of the CRL3 adaptor, whereby IFN induction leads to KLHL20 sequestration in promyelocytic leukaemia (PML) nuclear bodies, thus disrupting its interaction with DAPK and stabilizing the kinase (Lee et al, 2010). The MATH-BTB protein SPOP is also involved in various apoptotic pathways. In Drosophila, SPOP mediates degradation of the Jun kinase phosphatase Puckered (Puc), which is required for apoptosis depending on the tumour necrosis factor (TNF) Eiger during embryonic segmentation (Liu et al, 2009). Human SPOP is involved in the turnover of the death-associated protein DAXX, an anti-apoptotic regulator (Kwon et al, 2006). An unexpected mechanism of CUL3 action is exemplified by its role in vertebrate caspase activation (Jin et al, 2009). CUL3-dependent ubiquitylation of caspase-8 does not lead to its degradation, but instead promotes its stabilization and thus apoptosis induction. Moreover, CUL3 directly associates with caspase-8 and may not require a BTB-domain adaptor protein, although the presence of an as-yet unidentified copurified adaptor protein cannot fully be ruled out at this stage. Caspase-8 can also be targeted by an unrelated E3, TRAF2, for polyubiquitylation and proteasomal degradation, in this case to shut off cell-extrinsic apoptosis (Gonzalvez et al, 2012). CULLIN3-RING ligases in human disease Given the importance of CRL3s in controlling different cellular and developmental processes, it is perhaps of little surprise that they are also linked to the pathology of various human diseases, including metabolic disorders, muscle and nerve degeneration, but also neoplastic diseases. In this regard, gene dosage alterations and expression regulation of CRL3 complex components appear to be the major underlying pathophysiological mechanisms. In addition, elaborate sequencing approaches and database-mining efforts identified a number of specific mutations in patients suffering from several diseases (Table II). This information helps to understand CRL3 pathways at the molecular level and may in the future even allow their targeting via new therapeutic approaches. Metabolic diseases Recent exome sequencing approaches identified numerous recessive and dominant mutations in CUL3 and KLHL3 genes in patients suffering from type II pseudohypoaldosteronism (PHAII) or Gordon's syndrome, a rare disease featuring hypertension due to misbalance between renal salt reabsorption and electrolyte excretion (Boyden et al, 2012; Louis-Dit-Picard et al, 2012). Previously, mutations in WNK (‘with no lysine’) kinases have been correlated with this pathological condition (Wilson et al, 2003). Interestingly, 9 of 16 dominant mutations were found to cluster within the Kelch propeller of KLHL3 and in the vicinity of the other sites implicated in direct substrate binding, suggesting that KLHL3 mutations may abrogate binding and ubiquitylation of targets normally required for modulation of renal salt K+ and H+ handling in response to physiological challenge (Boyden et al, 2012). This notion gains support from recent studies presenting evidence that WNK kinase isoforms may be the critical CUL3-KLHL3 ubiquitylation targets (Ohta et al, 2013; Shibata et al, 2013; Wakabayashi et al, 2013). Disease-causing mutations in KLHL3 abolish interactions with either CUL3 or WNK kinases, and conversely disease mutations within acidic motifs in WNK1 and WNK4 disrupt interaction with KLHL3 (Ohta et al, 2013; Wakabayashi et al, 2013). The CUL3-RhoBTB1 E3 ligase has also been implicated in hypertension and vascular smooth muscle function, via its regulation of PPARγ and RhoA/Rho-kinase pathways (Pelham et al, 2012), and further support for the importance of CUL3 in blood vessel homeostasis comes from the role of the CUL3–BAZF complex in regulating angiogenesis via Notch signalling (Ohnuki et al, 2012). Finally, CUL3-SPOP controls the stability of the pancreatic duodenal homeobox 1 (Pdx1) transcription factor, and thereby affects pancreatic β cell function in glucose homeostasis (Claiborn et al, 2010). Thus, the CRL3 system emerges as an important regulator of metabolic homeostasis, perhaps by regulating responses to specific stress signals. Dystrophies Causative mutations for autosomal dominant Retinitis Pigmentosa (adRP), a heritable form of progressive retinal dystrophy that results in blindness and visual field loss, have been identified in the KLHL7 gene (Kigoshi et al, 2011). While not affecting KLHL7 dimerization, the resulting substitutions of a conserved alanine residue (A153T and A153V) in the KLHL7 BACK domain disrupt interaction with CUL3, consistent with the recently established structural requirement for the BACK domain in CUL3 complex assembly (Canning et al, 2013). As E3 ligase activity was strongly reduced upon mutation of this residue (Kigoshi et al, 2011), adaptor protein interaction with CUL3 but not adaptor protein dimerization status appears to determine CUL3 activity (see below). Similarly, Leucine 95 mutation (L95F) of KLHL9, found in patients suffering from a form of distal myopathy of skeletal muscles, results in reduced interaction with CUL3, although with less pronounced effects (Cirak et al, 2010). In Nemaline myopathy (NEM), one of the most common congenital myopathies, dominant mutations have been identified in the KBTBD13 protein (Sambuughin et al, 2010), later found to be a component of a functional CRL3 complex (Sambuughin et al, 2012). The substitutions R248S, K390N, and R408C are located within the β-sheets of the highly conserved second and fifth Kelch repeats and are predicted to disrupt th

Autophagy is a major cellular degradation pathway in eukaryotes. Recent studies have revealed the importance of autophagy in many aspects of plant life, including seedling establishment, plant development, stress resistance, metabolism, and reproduction. This is manifested by the dual ability of autophagy to execute bulk degradation under severe environmental conditions, while simultaneously to be highly selective in targeting specific compartments and protein complexes to regulate key cellular processes, even during favorable growth conditions. Delivery of cellular components to the vacuole enables their recycling, affecting the plant metabolome, especially under stress. Recent research in Arabidopsis has further unveiled fundamental mechanistic aspects in autophagy which may have relevance in non-plant systems. We review the most recent discoveries concerning autophagy in plants, touching upon all these aspects.

Regulation of plant height, one of the most important agronomic traits, is the focus of intensive research for improving crop performance. Stem elongation takes place as a result of repeated cell divisions and subsequent elongation of cells produced by apical and intercalary meristems. The gibberellin (GA) phytohormones have long been known to control stem and internodal elongation by stimulating the degradation of nuclear growth-repressing DELLA proteins; however, the mechanism allowing GA-responsive growth is only slowly emerging. Here, we show that DELLAs directly regulate the activity of the plant-specific class I TCP transcription factor family, key regulators of cell proliferation. Our results demonstrate that class I TCP factors directly bind the promoters of core cell-cycle genes in Arabidopsis inflorescence shoot apices while DELLAs block TCP function by binding to their DNA-recognition domain. GAs antagonize such repression by promoting DELLA destruction and therefore cause a concomitant accumulation of TCP factors on promoters of cell-cycle genes. Consistent with this model, the quadruple mutant tcp8 tcp14 tcp15 tcp22 exhibits severe dwarfism and reduced responsiveness to GA action. Altogether, we conclude that GA-regulated DELLA-TCP interactions in inflorescence shoot apex provide a novel mechanism to control plant height.

Plants employ small RNA-mediated posttranscriptional gene silencing as a virus defense mechanism. In response, plant viruses encode proteins that can suppress RNA silencing, but the mode of action of most such proteins is poorly understood. Here, we show that the silencing suppressor protein P0 of two Arabidopsis -infecting poleroviruses interacts by means of a conserved minimal F-box motif with Arabidopsis thaliana orthologs of S-phase kinase-related protein 1 (SKP1), a component of the SCF family of ubiquitin E3 ligases. Point mutations in the F-box-like motif abolished the P0–SKP1 ortholog interaction, diminished virus pathogenicity, and inhibited the silencing suppressor activity of P0. Knockdown of expression of a SKP1 ortholog in Nicotiana benthamiana rendered the plants resistant to polerovirus infection. Together, the results support a model in which P0 acts as an F-box protein that targets an essential component of the host posttranscriptional gene silencing machinery.

Exit from the mitotic cell cycle and initiation of cell differentiation frequently coincides with the onset of endoreduplication, a modified cell cycle during which DNA continues to be duplicated in the absence of mitosis. Although the mitotic cell cycle and the endoreduplication cycle share much of the same machinery, the regulatory mechanisms controlling the transition between both cycles remain poorly understood. We show that the A-type cyclin-dependent kinase CDKA;1 and its specific inhibitor, the Kip-related protein, KRP2 regulate the mitosis-to-endocycle transition during Arabidopsis thaliana leaf development. Constitutive overexpression of KRP2 slightly above its endogenous level only inhibited the mitotic cell cycle-specific CDKA;1 kinase complexes, whereas the endoreduplication cycle-specific CDKA;1 complexes were unaffected, resulting in an increase in the DNA ploidy level. An identical effect on the endoreduplication cycle could be observed by overexpressing KRP2 exclusively in mitotically dividing cells. In agreement with a role for KRP2 as activator of the mitosis-to-endocycle transition, KRP2 protein levels were more abundant in endoreduplicating than in mitotically dividing tissues. We illustrate that KRP2 protein abundance is regulated posttranscriptionally through CDK phosphorylation and proteasomal degradation. KRP2 phosphorylation by the mitotic cell cycle-specific CDKB1;1 kinase suggests a mechanism in which CDKB1;1 controls the level of CDKA;1 activity through regulating KRP2 protein abundance. In accordance with this model, KRP2 protein levels increased in plants with reduced CDKB1;1 activity. Moreover, the proposed model allowed a dynamical simulation of the in vivo observations, validating the sufficiency of the regulatory interactions between CDKA;1, KRP2, and CDKB1;1 in fine-tuning the mitosis-to-endocycle transition.

The phytopathogenic bacterium Ralstonia solanacearum encodes a family of seven type III secretion system (T3SS) effectors that contain both a leucine-rich repeat and an F-box domain. This structure is reminiscent of a class of typical eukaryotic proteins called F-box proteins. The latter, together with Skp1 and Cullin1 subunits, constitute the SCF-type E3 ubiquitin ligase complex and control specific protein ubiquitinylation. In the eukaryotic cell, depending on the nature of the polyubiquitin chain, the ubiquitin-tagged proteins either see their properties modified or are doomed for degradation by the 26S proteasome. This pathway is essential to many developmental processes in plants, ranging from hormone signaling and flower development to stress responses. Here, we show that these previously undescribed T3SS effectors are putative bacterial F-box proteins capable of interacting with a subset of the 19 different Arabidopsis Skp1-like proteins like bona fide Arabidopsis F-box proteins. A R. solanacearum strain in which all of the seven GALA effector genes have been deleted or mutated was no longer pathogenic on Arabidopsis and less virulent on tomato. Furthermore, we found that GALA7 is a host-specificity factor, required for disease on Medicago truncatula plants. Our results indicate that the GALA T3SS effectors are essential to R. solanacearum to control disease. Because the F-box domain is essential to the virulence function of GALA7, we hypothesize that these effectors act by hijacking their host SCF-type E3 ubiquitin ligases to interfere with their host ubiquitin/proteasome pathway to promote disease.

Flowering at the right time is crucial to ensure successful plant reproduction and seed yield and is dependent on both environmental and endogenous parameters. Among the different pathways that impinge on flowering, the autonomous pathway promotes floral transition independently of day length through the repression of the central flowering repressor flowering locus C (FLC). FLC blocks floral transition by repressing flowering time integrators such as flowering locus T (FT). MSI4/FVE is a key regulator of the autonomous pathway that reduces FLC expression. Here we report that the MSI4 protein is a DDB1 and CUL4-associated factor that represses FLC expression through its association with a CLF-Polycomb Repressive Complex 2 (PRC2) in Arabidopsis. Thus, the lack of MSI4 or decreased CUL4 activity reduces H3K27 trimethylation on FLC, but also on its downstream target FT, resulting in increased expression of both genes. Moreover, CUL4 interacts with FLC chromatin in an MSI4-dependant manner, and the interaction between MSI4 and CUL4-DDB1 is necessary for the epigenetic repression of FLC. Overall our work provides evidence for a unique functional interaction between the cullin-RING ubiquitin ligase (CUL4-DDB1(MSI4)) and a CLF-PRC2 complex in the regulation of flowering timing in Arabidopsis.

In plants, light represents an important environmental signal that triggers the production of photosynthetically active chloroplasts. This developmental switch is critical for plant survival because chlorophyll precursors that accumulate in darkness can be extremely destructive when illuminated. Thus, plants have evolved mechanisms to adaptively control plastid development during the transition into light. Here, we report that the gibberellin (GA)-regulated DELLA proteins play a crucial role in the formation of functional chloroplasts during deetiolation. We show that Arabidopsis thaliana DELLAs accumulating in etiolated cotyledons derepress chlorophyll and carotenoid biosynthetic pathways in the dark by repressing the transcriptional activity of the phytochrome-interacting factor proteins. Accordingly, dark-grown GA-deficient ga1-3 mutants (that accumulate DELLAs) display a similar gene expression pattern to wild-type seedlings grown in the light. Consistent with this, ga1-3 seedlings accumulate higher amounts of protochlorophyllide (a phototoxic chlorophyll precursor) in darkness but, surprisingly, are substantially more resistant to photooxidative damage following transfer into light. This is due to the DELLA-dependent upregulation of the photoprotective enzyme protochlorophyllide oxidoreductase (POR) in the dark. Our results emphasize the role of DELLAs in regulating the levels of POR, protochlorophyllide, and carotenoids in the dark and in protecting etiolated seedlings against photooxidative damage during initial light exposure.

Being sessile organisms, plants need rapid and finely tuned signaling pathways to adapt their growth and survival over their immediate and often adverse environment. Abscisic acid (ABA) is a plant hormone crucial for both biotic and abiotic stress responses. In this study, we highlight a function of six Arabidopsis MATH-BTB proteins in ABA signaling. MATH-BTB proteins act as substrate-binding adaptors for the Cullin3-based ubiquitin E3 ligase. Our genetic and biochemical experiments demonstrate that the MATH-BTB proteins directly interact with and target for proteasomal degradation the class I homeobox-leucine zipper (HD-ZIP) transcription factor ATHB6, which was previously identified as a negative regulator of ABA responses. Reducing CUL3(BPM) function leads to higher ATHB6 protein accumulation, reducing plant growth and fertility, and affects stomatal behavior and responses to ABA. We further demonstrate that ABA negatively regulates ATHB6 protein turnover, a situation reminiscent to ABI5, another transcription factor involved in ABA signaling.

In fungi and metazoans, the SCF-type Ubiquitin protein ligases (E3s) play a critical role in cell cycle regulation by degrading negative regulators, such as cell cycle-dependent kinase inhibitors (CKIs) at the G1-to-S-phase checkpoint. Here we report that FBL17, an Arabidopsis thaliana F-box protein, is involved in cell cycle regulation during male gametogenesis. FBL17 expression is strongly enhanced in plants co-expressing E2Fa and DPa, transcription factors that promote S-phase entry. FBL17 loss-of-function mutants fail to undergo pollen mitosis II, which generates the two sperm cells in mature A. thaliana pollen. Nonetheless, the single sperm cell-like cell in fbl17 mutants is functional but will exclusively fertilize the egg cell of the female gametophyte, giving rise to an embryo that will later abort, most likely due to the lack of functional endosperm. Seed abortion can, however, be overcome by mutations in FIE, a component of the Polycomb group complex, overall resembling loss-of-function mutations in the A. thaliana cyclin-dependent kinase CDKA;1. Finally we identified ASK11, as an SKP1-like partner protein of FBL17 and discuss a possible mechanism how SCF(FBL17) may regulate cell division during male gametogenesis.

Significance Ethylene is a gaseous hormone that controls plant life throughout development. Being a simple hydrophobic molecule, it can freely enter cells; therefore, the cell type specificity of its action is challenging. By means of tissue-specific expression of two negative regulators of the signaling cascade, we selectively disrupted the ethylene signal in different cell types without affecting its biosynthesis. We demonstrate that ethylene restricts plant growth by dampening the effect of auxins in the outermost cell layer. We further show that this epidermis-specific signaling has an impact on the growth of neighboring cells, suggesting that the master controller of cell expansion resides in the epidermis, where it senses the environment and, subsequently drives growth, of the inner tissues.

Plant phototropism is an adaptive response to changes in light direction, quantity, and quality that results in optimization of photosynthetic light harvesting, as well as water and nutrient acquisition. Though several components of the phototropic signal response pathway have been identified in recent years, including the blue light (BL) receptors phototropin1 (phot1) and phot2, much remains unknown. Here, we show that the phot1-interacting protein NONPHOTOTROPIC HYPOCOTYL3 (NPH3) functions as a substrate adapter in a CULLIN3-based E3 ubiquitin ligase, CRL3(NPH3). Under low-intensity BL, CRL3(NPH3) mediates the mono/multiubiquitination of phot1, likely marking it for clathrin-dependent internalization from the plasma membrane. In high-intensity BL, phot1 is both mono/multi- and polyubiquitinated by CRL3(NPH3), with the latter event targeting phot1 for 26S proteasome-mediated degradation. Polyubiquitination and subsequent degradation of phot1 under high-intensity BL likely represent means of receptor desensitization, while mono/multiubiquitination-stimulated internalization of phot1 may be coupled to BL-induced relocalization of hormone (auxin) transporters.

Increased cellular ploidy is widespread during developmental processes of multicellular organisms, especially in plants. Elevated ploidy levels are typically achieved either by endoreplication or endomitosis, which are often regarded as modified cell cycles that lack an M phase either entirely or partially. We identified GIGAS CELL1 (GIG1)/OMISSION OF SECOND DIVISION1 (OSD1) and established that mutation of this gene triggered ectopic endomitosis. On the other hand, it has been reported that a paralog of GIG1/OSD1, UV-INSENSITIVE4 (UVI4), negatively regulates endoreplication onset in Arabidopsis thaliana. We showed that GIG1/OSD1 and UVI4 encode novel plant-specific inhibitors of the anaphase-promoting complex/cyclosome (APC/C) ubiquitin ligase. These proteins physically interact with APC/C activators, CDC20/FZY and CDH1/FZR, in yeast two-hybrid assays. Overexpression of CDC20.1 and CCS52B/FZR3 differentially promoted ectopic endomitosis in gig1/osd1 and premature occurrence of endoreplication in uvi4. Our data suggest that GIG1/OSD1 and UVI4 may prevent an unscheduled increase in cellular ploidy by preferentially inhibiting APC/C(CDC20) and APC/C(FZR), respectively. Generation of cells with a mixed identity in gig1/osd1 further suggested that the APC/C may have an unexpected role for cell fate determination in addition to its role for proper mitotic progression.

RNA silencing is a major antiviral defense mechanism in plants and invertebrates. Plant ARGONAUTE1 (AGO1) is pivotal in RNA silencing, and hence is a major target for counteracting viral suppressors of RNA-silencing proteins (VSRs). P0 from Turnip yellows virus (TuYV) is a VSR that was previously shown to trigger AGO1 degradation via an autophagy-like process. However, the identity of host proteins involved and the cellular site at which AGO1 and P0 interact were unknown. Here we report that P0 and AGO1 associate on the endoplasmic reticulum (ER), resulting in their loading into ER-associated vesicles that are mobilized to the vacuole in an ATG5- and ATG7-dependent manner. We further identified ATG8-Interacting proteins 1 and 2 (ATI1 and ATI2) as proteins that associate with P0 and interact with AGO1 on the ER up to the vacuole. Notably, ATI1 and ATI2 belong to an endogenous degradation pathway of ER-associated AGO1 that is significantly induced following P0 expression. Accordingly, ATI1 and ATI2 deficiency causes a significant increase in posttranscriptional gene silencing (PTGS) activity. Collectively, we identify ATI1 and ATI2 as components of an ER-associated AGO1 turnover and proper PTGS maintenance and further show how the VSR P0 manipulates this pathway.

The jasmonate (JA)-pathway regulators MYC2, MYC3, and MYC4 are central nodes in plant signaling networks integrating environmental and developmental signals to fine-tune JA defenses and plant growth. Continuous activation of MYC activity is potentially lethal. Hence, MYCs need to be tightly regulated in order to optimize plant fitness. Among the increasing number of mechanisms regulating MYC activity, protein stability is arising as a major player. However, how the levels of MYC proteins are modulated is still poorly understood. Here, we report that MYC2, MYC3, and MYC4 are targets of BPM (BTB/POZ-MATH) proteins, which act as substrate adaptors of CUL3-based E3 ubiquitin ligases. Reduction of function of CUL3BPM in amiR-bpm lines, bpm235 triple mutants, and cul3ab double mutants enhances MYC2 and MYC3 stability and accumulation and potentiates plant responses to JA such as root-growth inhibition and MYC-regulated gene expression. Moreover, MYC3 polyubiquitination levels are reduced in amiR-bpm lines. BPM3 protein is stabilized by JA, suggesting a negative feedback regulatory mechanism to control MYC activity, avoiding harmful runaway responses. Our results uncover a layer for JA-pathway regulation by CUL3BPM-mediated degradation of MYC transcription factors.

It is widely assumed that mitotic cyclins are rapidly degraded during anaphase, leading to the inactivation of the cell cycle–dependent protein kinase Cdc2 and allowing exit from mitosis. The proteolysis of mitotic cyclins is ubiquitin/26S proteasome mediated and requires the presence of the destruction box motif at the N terminus of the proteins. As a first attempt to study cyclin proteolysis during the plant cell cycle, we investigated the stability of fusion proteins in which the N-terminal domains of an A-type and a B-type tobacco mitotic cyclin were fused in frame with the chloramphenicol acetyltransferase (CAT) reporter gene and constitutively expressed in transformed tobacco BY2 cells. For both cyclin types, the N-terminal domains led the chimeric cyclin–CAT fusion proteins to oscillate in a cell cycle–specific manner. Mutations within the destruction box abolished cell cycle–specific proteolysis. Although both fusion proteins were degraded after metaphase, cyclin A–CAT proteolysis was turned off during S phase, whereas that of cyclin B–CAT was turned off only during the late G2 phase. Thus, we demonstrated that mitotic cyclins in plants are subjected to post-translational control (e.g., proteolysis). Moreover, we showed that the proteasome inhibitor MG132 blocks BY2 cells during metaphase in a reversible way. During this mitotic arrest, both cyclin–CAT fusion proteins remained stable.

The SCF (for SKP1, Cullin/CDC53, F-box protein) ubiquitin ligase targets a number of cell cycle regulators, transcription factors, and other proteins for degradation in yeast and mammalian cells. Recent genetic studies demonstrate that plant F-box proteins are involved in auxin responses, jasmonate signaling, flower morphogenesis, photocontrol of circadian clocks, and leaf senescence, implying a large spectrum of functions for the SCF pathway in plant development. Here, we present a molecular and functional characterization of plant cullins. The Arabidopsis genome contains 11 cullin-related genes. Complementation assays revealed that AtCUL1 but not AtCUL4 can functionally complement the yeast cdc53 mutant. Arabidopsis mutants containing transfer DNA (T-DNA) insertions in the AtCUL1 gene were shown to display an arrest in early embryogenesis. Consistently, both the transcript and the protein of the AtCUL1 gene were found to accumulate in embryos. The AtCUL1 protein localized mainly in the nucleus but also weakly in the cytoplasm during interphase and colocalized with the mitotic spindle in metaphase. Our results demonstrate a critical role for the SCF ubiquitin ligase in Arabidopsis embryogenesis.

Cullins are central scaffolding subunits in eukaryotic E3 ligases that facilitate the ubiquitination of target proteins. Arabidopsis contains at least 11 cullin proteins but only a few of them have been assigned biological roles. In this work Arabidopsis cullin 4 is shown to assemble with DDB1, RBX1, DET1 and DDB2 in vitro and in planta. In addition, by using T-DNA insertion and CUL4 antisense lines we demonstrate that corresponding mutants are severely affected in different aspects of development. Reduced CUL4 expression leads to a reduced number of lateral roots, and to abnormal vascular tissue and stomatal development. Furthermore, cul4 mutants display a weak constitutive photomorphogenic phenotype. These results therefore assign an important function to CUL4 during plant development and provide strong evidence that CUL4 assembles together with RBX1 and DDB1 proteins to form a functional E3 ligase in Arabidopsis.

EXORIBONUCLEASE4 (XRN4), the Arabidopsis thaliana homolog of yeast XRN1, is involved in the degradation of several unstable mRNAs. Although a role for XRN4 in RNA silencing of certain transgenes has been reported, xrn4 mutant plants were found to lack any apparent visible phenotype. Here, we show that XRN4 is allelic to the unidentified components of the ethylene response pathway ETHYLENE-INSENSITIVE5/ACC-INSENSITIVE1 (EIN5/AIN1) and EIN7. xrn4 mutant seedlings are ethylene-insensitive as a consequence of the upregulation of EIN3 BINDING F-BOX PROTEIN1 (EBF1) and EBF2 mRNA levels, which encode related F-box proteins involved in the turnover of EIN3 protein, a crucial transcriptional regulator of the ethylene response pathway. Epistasis analysis placed XRN4/EIN5/AIN1 downstream of CTR1 and upstream of EBF1/2. XRN4 does not appear to regulate ethylene signaling via an RNA-INDUCED SILENCING COMPLEX-based RNA silencing mechanism but acts by independent means. The identification of XRN4 as an integral new component in ethylene signaling adds RNA degradation as another posttranscriptional process that modulates the perception of this plant hormone.

The ubiquitin proteasome pathway in plants has been shown to be important for many developmental processes. The E3 ubiquitin-protein ligases facilitate transfer of the ubiquitin moiety to substrate proteins. Many E3 ligases contain cullin proteins as core subunits. Here, we show that Arabidopsis (Arabidopsis thaliana) AtCUL3 proteins interact in yeast two-hybrid and in vitro pull-down assays with proteins containing a BTB/POZ (broad complex, tramtrack, bric-a-brac/pox virus and zinc finger) motif. By changing specific amino acid residues within the proteins, critical parts of the cullin and BTB/POZ proteins are defined that are required for these kinds of interactions. In addition, we show that AtCUL3 proteins assemble with the RING-finger protein AtRBX1 and are targets for the RUB-conjugation pathway. The analysis of AtCUL3a and AtCUL3b expression as well as several BTB/POZ-MATH genes indicates that these genes are expressed in all parts of the plant. The results presented here provide strong evidence that AtCUL3a and AtCUL3b can assemble in Arabidopsis with BTB/POZ-MATH and AtRBX1 proteins to form functional E3 ligases.

In plants after the disassembly of mitotic spindle, a specific cytokinetic structure called the phragmoplast is built, and after cytokinesis, microtubules populate the cell cortex in an organized orientation that determines cell elongation and shape. Here, we show that impaired cyclin B1 degradation, resulting from a mutation within its destruction box, leads to an isodiametric shape of epidermal cells in leaves, stems, and roots and retarded growth of seedlings. Microtubules in these misshaped cells are grossly disorganized, focused around the nucleus, whereas they were entirely missing or abnormally organized along the cell cortex. A high percentage of cells expressing nondestructible cyclin B1 had doubled DNA content as a result of undergoing endomitosis. During anaphase the cytokinesis-specific syntaxin KNOLLE could still localize to the midplane of cell division, whereas NPK1-activating kinesin-like protein 1, a cytokinetic kinesin-related protein, was unable to do so, and instead of the formation of a phragmoplast, the midzone microtubules persisted between the separated nuclei, which eventually fused. In summary, our results show that the timely degradation of mitotic cyclins in plants is required for the reorganization of mitotic microtubules to the phragmoplast and for proper cytokinesis. Subsequently, the presence of nondegradable cyclin B1 leads to a failure in organizing properly the cortical microtubules that determine cell elongation and shape.

In yeast and animals, the anaphase-promoting complex or cyclosome (APC/C) is an essential ubiquitin protein ligase that regulates mitotic progression and exit by controlling the stability of cell cycle regulatory proteins, such as securin and the mitotic cyclins. In plants, the function, regulation, and substrates of the APC/C are poorly understood. To gain more insight into the roles of the plant APC/C, we characterized at the molecular level one of its subunits, APC2, which is encoded by a single-copy gene in Arabidopsis. We show that the Arabidopsis gene is able to partially complement a budding yeast apc2 ts mutant. By yeast two-hybrid assays, we demonstrate an interaction of APC2 with two other APC/C subunits: APC11 and APC8/CDC23. A reverse-genetic approach identified Arabidopsis plants carrying T-DNA insertions in the APC2 gene. apc2 null mutants are impaired in female megagametogenesis and accumulate a cyclin-beta-glucuronidase reporter protein but do not display metaphase arrest, as observed in other systems. The APC2 gene is expressed in various plant organs and does not seem to be cell cycle regulated. Finally, we report intriguing differences in APC2 protein subcellular localization compared with that in other systems. Our observations support a conserved function of the APC/C in plants but a different mode of regulation.

Plants use the energy in sunlight for photosynthesis, but as a consequence are exposed to the toxic effect of UV radiation especially on DNA. The UV-induced lesions on DNA affect both transcription and replication and can also have mutagenic consequences. Here we investigated the regulation and the function of the recently described CUL4-DDB1-DDB2 E3 ligase in the maintenance of genome integrity upon UV-stress using the model plant Arabidopsis. Physiological, biochemical, and genetic evidences indicate that this protein complex is involved in global genome repair (GGR) of UV-induced DNA lesions. Moreover, we provide evidences for crosstalks between GGR, the plant-specific photo reactivation pathway and the RAD1-RAD10 endonucleases upon UV exposure. Finally, we report that DDB2 degradation upon UV stress depends not only on CUL4, but also on the checkpoint protein kinase Ataxia telangiectasia and Rad3-related (ATR). Interestingly, we found that DDB1A shuttles from the cytoplasm to the nucleus in an ATR-dependent manner, highlighting an upstream level of control and a novel mechanism of regulation of this E3 ligase.

CULLIN3 (CUL3) together with BTB-domain proteins form a class of Cullin-RING ubiquitin ligases (called CRL3s) that control the rapid and selective degradation of important regulatory proteins in all eukaryotes. Here, we report that in the model plant Arabidopsis thaliana, CUL3 regulates plant growth and development, not only during embryogenesis but also at post-embryonic stages. First, we show that CUL3 modulates the emission of ethylene, a gaseous plant hormone that is an important growth regulator. A CUL3 hypomorphic mutant accumulates ACS5, the rate-limiting enzyme in ethylene biosynthesis and as a consequence exhibits a constitutive ethylene response. Second, we provide evidence that CUL3 regulates primary root growth by a novel ethylene-dependant pathway. In particular, we show that CUL3 knockdown inhibits primary root growth by reducing root meristem size and cell number. This phenotype is suppressed by ethylene-insensitive or resistant mutations. Finally, we identify a function of CUL3 in distal root patterning, by a mechanism that is independent of ethylene. Thus, our work highlights that CUL3 is essential for the normal division and organisation of the root stem cell niche and columella root cap cells.

Auxin is a major plant hormone that controls most aspects of plant growth and development. Auxin is perceived by two distinct classes of receptors: transport inhibitor response 1 (TIR1, or auxin-related F-box (AFB)) and auxin/indole-3-acetic acid (AUX/IAA) coreceptors, that control transcriptional responses to auxin, and the auxin-binding protein 1 (ABP1), that controls a wide variety of growth and developmental processes. To date, the mode of action of ABP1 is still poorly understood and its functional interaction with TIR1/AFB-AUX/IAA coreceptors remains elusive. Here we combine genetic and biochemical approaches to gain insight into the integration of these two pathways. We find that ABP1 is genetically upstream of TIR1/AFBs; ABP1 knockdown leads to an enhanced degradation of AUX/IAA repressors, independently of its effects on endocytosis, through the SCF(TIR1/AFB) E3 ubiquitin ligase pathway. Combining positive and negative regulation of SCF ubiquitin-dependent pathways might be a common mechanism conferring tight control of hormone-mediated responses.

Early abscisic acid signaling involves degradation of clade A protein phosphatases type 2C (PP2Cs) as a complementary mechanism to PYR/PYL/RCAR-mediated inhibition of PP2C activity. At later steps, ABA induces up-regulation of PP2C transcripts and protein levels as a negative feedback mechanism. Therefore, resetting of ABA signaling also requires PP2C degradation to avoid excessive ABA-induced accumulation of PP2Cs. It has been demonstrated that ABA induces the degradation of existing ABI1 and PP2CA through the PUB12/13 and RGLG1/5 E3 ligases, respectively. However, other unidentified E3 ligases are predicted to regulate protein stability of clade A PP2Cs as well. In this work, we identified BTB/POZ AND MATH DOMAIN proteins (BPMs), substrate adaptors of the multimeric cullin3 (CUL3)-RING-based E3 ligases (CRL3s), as PP2CA-interacting proteins. BPM3 and BPM5 interact in the nucleus with PP2CA as well as with ABI1, ABI2, and HAB1. BPM3 and BPM5 accelerate the turnover of PP2Cs in an ABA-dependent manner and their overexpression leads to enhanced ABA sensitivity, whereas bpm3 bpm5 plants show increased accumulation of PP2CA, ABI1 and HAB1, which leads to global diminished ABA sensitivity. Using biochemical and genetic assays, we demonstrated that ubiquitination of PP2CA depends on BPM function. Given the formation of receptor-ABA-phosphatase ternary complexes is markedly affected by the abundance of protein components and ABA concentration, we reveal that BPMs and multimeric CRL3 E3 ligases are important modulators of PP2C coreceptor levels to regulate early ABA signaling as well as the later desensitizing-resetting steps.

A key step of the cell cycle is the entry into the DNA replication phase that typically commits cells to divide. However, little is known about the molecular mechanisms regulating this transition in plants. Here, we investigated the function of FBL17 (F BOX-LIKE17), an Arabidopsis thaliana F-box protein previously shown to govern the progression through the second mitosis during pollen development. Our work reveals that FBL17 function is not restricted to gametogenesis. FBL17 transcripts accumulate in both proliferating and postmitotic cell types of Arabidopsis plants. Loss of FBL17 function drastically reduces plant growth by altering cell division activity in both shoot and root apical meristems. In fbl17 mutant plants, DNA replication is severely impaired and endoreplication is fully suppressed. At the molecular level, lack of FBL17 increases the stability of the CDK (CYCLIN-DEPENDENT KINASE) inhibitor KIP-RELATED PROTEIN2 known to switch off CDKA;1 kinase activity. Despite the strong inhibition of cell proliferation in fbl17, some cells are still able to enter S phase and eventually to divide, but they exhibit a strong DNA damage response and often missegregate chromosomes. Altogether, these data indicate that the F-box protein FBL17 acts as a master cell cycle regulator during the diploid sporophyte phase of the plant.

RNA silencing is a conserved mechanism in eukaryotes involved in development and defense against viruses. In plants, ARGONAUTE1 (AGO1) protein plays a central role in both microRNA- and small interfering RNA-directed silencing, and its expression is regulated at multiple levels. Here, we report that the F-box protein FBW2 assembles an SCF complex that selectively targets for proteolysis AGO1 when it is unloaded and mutated. Although FBW2 loss of function does not lead to strong growth or developmental defects, it significantly increases RNA-silencing activity. Interestingly, under conditions in which small-RNA accumulation is affected, the failure to degrade AGO1 in fbw2 mutants becomes more deleterious for the plant. Accordingly, the non-degradable AGO1 protein assembles high-molecular-weight complexes and binds illegitimate small RNA, leading to off-target cleavage. Therefore, control of AGO1 homeostasis by FBW2 plays an important role in quality control of RNA silencing.

Summary Activation of cyclin B/Cdc2 kinase complex triggers entry into mitosis in all eukaryotic cells. Although cyclin gene expression has been extensively studied in plants, not much is known at the level of the protein stability and function. Here, we demonstrated by using the highly synchronizable tobacco BY2 cell culture, that endogenous cyclin B1 protein undergoes cell cycle‐dependent proteolysis and is stabilized when the spindle checkpoint has been activated. Furthermore, we established transgenic tobacco BY2 cell cultures expressing under the control of an inducible promoter, cyclin B1 protein as well as its non‐degradable form as fusion proteins with GFP and found that the ectopic expression of these proteins did not dramatically disturb the cell cycle progression. These results indicate that, to a certain extent, cell cycle exit is possible without cyclin B1 proteolysis.

The SKP1-Cullin/Cdc53-F-box protein ubiquitin ligases (SCF) target many important regulatory proteins for degradation and play vital roles in diverse cellular processes. In Arabidopsis there are 11 Cullin members (AtCUL). AtCUL1 was demonstrated to assemble into SCF complexes containing COI1, an F-box protein required for response to jasmonates (JA) that regulate plant fertility and defense responses. It is not clear whether other Cullins also associate with COI1 to form SCF complexes, thus, it is unknown whether AtCUL1, or another Cullin that assembles into SCF(COI1) (even perhaps two or more functionally redundant Cullins), plays a major role in JA signaling. We present genetic and physiological data to directly demonstrate that AtCUL1 is necessary for normal JA responses. The homozygous AtCUL1 mutants axr6-1 and axr6-2, the heterozygous mutants axr6/AXR6, and transgenic plants expressing mutant AtCUL1 proteins containing a single amino acid substitution from phenylalanine-111 to valine, all exhibit reduced responses to JA. We also demonstrate that ax6 enhances the effect of coi1 on JA responses, implying a genetic interaction between COI1 and AtCUL1 in JA signaling. Furthermore, we show that the point mutations in AtCUL1 affect the assembly of COI1 into SCF, thus attenuating SCF(COI1) formation.

Cullin proteins, which belong to multigenic families in all eukaryotes, associate with other proteins to form ubiquitin protein ligases (E3s) that target substrates for proteolysis by the 26S proteasome. Here, we present the molecular and genetic characterization of a plant Cullin3. In contrast to fungi and animals, the genome of the model plant Arabidopsis thaliana contains two related CUL3 genes, called CUL3A and CUL3B. We found that CUL3A is ubiquitously expressed in plants and is able to interact with the ring-finger protein RBX1. A genomic search revealed the existence of at least 76 BTB-domain proteins in Arabidopsis belonging to 11 major families. Yeast two-hybrid experiments indicate that representative members of certain families are able to physically interact with both CUL3A and CUL3B, suggesting that Arabidopsis CUL3 forms E3 protein complexes with certain BTB domain proteins. In order to determine the function of CUL3A, we used a reverse genetic approach. The cul3a null mutant flowers slightly later than the control plants. Furthermore, this mutant exhibits a reduced sensitivity of the inhibition of hypocotyl growth in far-red light and miss-expresses COP1. The viability of the mutant plants suggests functional redundancy between the two CUL3 genes in Arabidopsis.

The RNA 3′-terminal phosphate cyclase catalyzes the ATP-dependent conversion of the 3′-phosphate to the 2′,3′-cyclic phosphodiester at the end of various RNA substrates. Recent cloning of a cDNA encoding the human cyclase indicated that genes encoding cyclase-like proteins are conserved among Eucarya, Bacteria, and Archaea. The protein encoded by the <i>Escherichia coli</i> gene was overexpressed and shown to have the RNA 3′-phosphate cyclase activity (Genschik, P., Billy, E., Swianiewicz, M., and Filipowicz, W. (1997) <i>EMBO J.</i> 16, 2955–2967). Analysis of the requirements and substrate specificity of the <i>E. coli</i> protein, presented in this work, demonstrates that properties of the bacterial and human enzymes are similar. ATP is the best cofactor (<i>K</i> _m = 20 μm), whereas GTP (<i>K</i> _m = 100 μm) and other nucleoside triphosphates (NTPs) act less efficiently. The enzyme undergoes nucleotidylation in the presence of [α-³²P]ATP and, to a lesser extent, also in the presence of other NTPs. Comparison of 3′-phosphorylated oligoribonucleotides and oligodeoxyribonucleotides of identical sequence demonstrated that the latter are at least 300-fold poorer substrates for the enzyme. The <i>E. coli</i> cyclase gene, named<i>rtcA</i>, forms part of an uncharacterized operon containing two additional open reading frames (ORFs). The ORF positioned immediately upstream, named <i>rtcB</i>, encodes a protein that is also highly conserved between Eucarya, Bacteria, and Archaea. Another ORF, called <i>rtcR</i>, is positioned upstream of the<i>rtcA/rtcB</i> unit and is transcribed in the opposite direction. It encodes a protein having features of ς⁵⁴-dependent regulators. By overexpressing the N-terminally truncated form of RtcR, we demonstrate that this regulator indeed controls expression of <i>rtcA</i> and <i>rtcB</i> in a ς⁵⁴-dependent manner. Also consistent with the involvement of ς⁵⁴, the region upstream of the transcription start site of the <i>rtcA/rtcB</i>mRNA contains the −12 and −24 elements, TTGCA and TGGCA, respectively, characteristic of ς⁵⁴-dependent promoters. The cyclase gene is nonessential as demonstrated by knockout experiments. Possible functions of the cyclase in RNA metabolism are discussed.

Summary Empfindlicher im Dunkelroten Licht 1 (EID1) is an F‐box protein that functions as a negative regulator in phytochrome A (phyA)‐specific light signalling. F‐box proteins are components of SCF ubiquitin ligase complexes that target proteins for degradation in the proteasome. Here we present further characterization of EID1 at the expression level, and show that it regulates photomorphogenesis in seedlings, rosette leaf development and flowering. Data on transcript expression patterns indicate that EID1 is expressed during all stages of Arabidopsis development and exhibits no light response. Microscope studies demonstrate that EID1 is localized to the nucleus, where it can form speckles under continuous far‐red light that resemble clastosomes. To characterize the composition and formation of SCF EID1 complexes further, we used two‐hybrid and bridge assays in yeast and in planta . EID1 interacts specifically with several Arabidopsis Skp1‐like (ASK) proteins and Cullin1 to form stable dimeric and trimeric complexes. Our results support a two‐step association process in which the F‐box protein binds first to the ASK adaptor, forming a unit which then associates with the catalytic core of the SCF complex. Finally, our data indicate that the EID1 target interaction domain is composed of two independent modules.

To investigate the specialization of the two Arabidopsis CDC27 subunits in the anaphase-promoting complex (APC/C), we analyzed novel alleles of HBT/CDC27B and CDC27A, and characterized the expression of complementing HOBBIT (HBT) protein fusions in plant meristems and during the cell cycle. In contrast to other APC/C mutants, which are gametophytic lethal, phenotypes of weak and null hbt alleles indicate a primary role in the control of post-embryonic cell division and cell elongation, whereas cdc27a nulls are phenotypically indistinguishable from the wild type. However, cdc27a hbt double-mutant gametes are non-viable, indicating a redundant requirement for both CDC27 subunits during gametogenesis. Yeast-two-hybrid and pulldown studies with APC/C components suggest that the two Arabidopsis CDC27 subunits participate in several complexes that are differentially required during plant development. Loss-of-function analysis, as well as cyclin B reporter protein accumulation, indicates a conserved role for the plant APC/C in controlling mitotic progression and cell differentiation during the entire life cycle.

Selective protein degradation via the ubiquitin-26S proteasome is a major mechanism underlying DNA replication and cell division in all eukaryotes. In particular, the APC/C (anaphase promoting complex or cyclosome) is a master ubiquitin protein ligase (E3) that targets PDS1/SECURIN and cyclin B for degradation allowing sister chromatid separation and exit from mitosis, respectively. Interestingly, it has been found that the APC/C remains active in differentiated neurons in which the E3 ligase regulates axon growth, neuronal survival and synaptic functions. However, despite these recent findings, the role of APC/C in differentiated cells and the regulation of its activity beyond cell division is still poorly understood. Here, we investigate the activity and function of APC/C in the model plant Arabidopsis thaliana. We used cyclin reporter constructs to follow APC/C activity during plant development and found that this E3 ligase remains active in most post-mitotic plant cells. Strikingly, hypomorphic mutant lines, in which the APC/C activity is reduced, exhibited several developmental abnormalities, including defects in cotyledon vein patterning and internode elongation leading to a characteristic broomhead-like phenotype. Histological analyses revealed an increased amount of vascular tissue, most notably xylem and lignified sclerenchyma, indicating a role for APC/C in plant vasculature development and organization.

Ubiquitin-mediated proteolysis is one of the key mechanisms underlying cell cycle control in all eukaryotes. This is achieved by the action of ubiquitin ligases (E3s), which remove both negative and positive regulators of the cell cycle. Though our current understanding of the plant cell cycle has improved a lot these recent years, the identity of the E3s regulating it and their mode of action is still in its infancy. Nevertheless, recent research in Arabidopsis revealed some novel findings in this area. Thus the anaphase promoting complex/cyclosome (APC/C) not only controls mitotic events, but is also important in post-mitotic cells for normal plant development and cell differentiation. Moreover conserved and novel E3s were identified that target cyclin-dependent kinase inhibitors at different plant developmental stages. Finally, environmental constrains and stress hormones negatively impact on the cell cycle by processes that also include E3s.

Article14 January 2011free access The Arabidopsis CUL4–DDB1 complex interacts with MSI1 and is required to maintain MEDEA parental imprinting Eva Dumbliauskas Eva Dumbliauskas Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Esther Lechner Esther Lechner Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Miłosława Jaciubek Miłosława Jaciubek Institute of Plant Biology and Zürich-Basel Plant Science Center, University of Zürich, Zollikerstrasse, Zürich, Switzerland Search for more papers by this author Alexandre Berr Alexandre Berr Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Maghsoud Pazhouhandeh Maghsoud Pazhouhandeh Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Malek Alioua Malek Alioua Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Valerie Cognat Valerie Cognat Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Vladimir Brukhin Vladimir Brukhin Institute of Plant Biology and Zürich-Basel Plant Science Center, University of Zürich, Zollikerstrasse, Zürich, SwitzerlandPresent address: Aberystwyth University, IBERS, Edward Llwyd Building, Penglais, Aberystwyth, Ceredigion SY23 3DA, UK Search for more papers by this author Csaba Koncz Csaba Koncz Max Planck Institute for Plant Breeding Research, Carl-von-Linné-Weg, Köln, Germany Search for more papers by this author Ueli Grossniklaus Ueli Grossniklaus Institute of Plant Biology and Zürich-Basel Plant Science Center, University of Zürich, Zollikerstrasse, Zürich, Switzerland Search for more papers by this author Jean Molinier Jean Molinier Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Pascal Genschik Corresponding Author Pascal Genschik Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Eva Dumbliauskas Eva Dumbliauskas Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Esther Lechner Esther Lechner Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Miłosława Jaciubek Miłosława Jaciubek Institute of Plant Biology and Zürich-Basel Plant Science Center, University of Zürich, Zollikerstrasse, Zürich, Switzerland Search for more papers by this author Alexandre Berr Alexandre Berr Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Maghsoud Pazhouhandeh Maghsoud Pazhouhandeh Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Malek Alioua Malek Alioua Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Valerie Cognat Valerie Cognat Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Vladimir Brukhin Vladimir Brukhin Institute of Plant Biology and Zürich-Basel Plant Science Center, University of Zürich, Zollikerstrasse, Zürich, SwitzerlandPresent address: Aberystwyth University, IBERS, Edward Llwyd Building, Penglais, Aberystwyth, Ceredigion SY23 3DA, UK Search for more papers by this author Csaba Koncz Csaba Koncz Max Planck Institute for Plant Breeding Research, Carl-von-Linné-Weg, Köln, Germany Search for more papers by this author Ueli Grossniklaus Ueli Grossniklaus Institute of Plant Biology and Zürich-Basel Plant Science Center, University of Zürich, Zollikerstrasse, Zürich, Switzerland Search for more papers by this author Jean Molinier Jean Molinier Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Pascal Genschik Corresponding Author Pascal Genschik Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Author Information Eva Dumbliauskas1, Esther Lechner1, Miłosława Jaciubek2, Alexandre Berr1, Maghsoud Pazhouhandeh1, Malek Alioua1, Valerie Cognat1, Vladimir Brukhin2, Csaba Koncz3, Ueli Grossniklaus2, Jean Molinier1 and Pascal Genschik 1 1Institut de Biologie Moléculaire des Plantes, Centre National de la Recherche Scientifique, Unité Propre de Recherche, Conventionné avec l'Université de Strasbourg, Strasbourg, France 2Institute of Plant Biology and Zürich-Basel Plant Science Center, University of Zürich, Zollikerstrasse, Zürich, Switzerland 3Max Planck Institute for Plant Breeding Research, Carl-von-Linné-Weg, Köln, Germany *Corresponding author. Institut de Biologie Moléculaire des Plantes (CNRS), 12, rue du Général Zimmer 67084 Strasbourg, France. Tel.: +33 3 88 41 72 78; Fax: +33 3 88 61 44 42; E-mail: [email protected] The EMBO Journal (2011)30:731-743https://doi.org/10.1038/emboj.2010.359 PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Protein ubiquitylation regulates a broad variety of biological processes in all eukaryotes. Recent work identified a novel class of cullin-containing ubiquitin ligases (E3s) composed of CUL4, DDB1, and one WD40 protein, believed to act as a substrate receptor. Strikingly, CUL4-based E3 ligases (CRL4s) have important functions at the chromatin level, including responses to DNA damage in metazoans and plants and, in fission yeast, in heterochromatin silencing. Among putative CRL4 receptors we identified MULTICOPY SUPPRESSOR OF IRA1 (MSI1), which belongs to an evolutionary conserved protein family. MSI1-like proteins contribute to different protein complexes, including the epigenetic regulatory Polycomb repressive complex 2 (PRC2). Here, we provide evidence that Arabidopsis MSI1 physically interacts with DDB1A and is part of a multimeric protein complex including CUL4. CUL4 and DDB1 loss-of-function lead to embryo lethality. Interestingly, as in fis class mutants, cul4 mutants exhibit autonomous endosperm initiation and loss of parental imprinting of MEDEA, a target gene of the Arabidopsis PRC2 complex. In addition, after pollination both MEDEA transcript and protein accumulate in a cul4 mutant background. Overall, our work provides the first evidence of a physical and functional link between a CRL4 E3 ligase and a PRC2 complex, thus indicating a novel role of ubiquitylation in the repression of gene expression. Introduction Regulation of protein stability by the ubiquitin/proteasome system participates in a broad variety of physiologically and developmentally controlled processes in all eukaryotes (Ciechanover et al, 2000; Smalle and Vierstra, 2004). In this pathway, a critical step involves ubiquitin ligases (E3s), which facilitate the transfer of ubiquitin moieties to a substrate protein, the preparative step for degradation via the 26S proteasome. Among the different E3 enzymes, the composition of CUL4-based E3 ligases (CRL4s) was only recently identified (Higa and Zhang, 2007). CUL4 binds RBX1 to recruit a specific E2 ubiquitin-conjugating enzyme, and also binds DDB1, an adaptor protein, which itself associates with a substrate receptor. Affinity purification of CLR4s from mammalian cells identified various WD40 proteins as possible substrate receptors (Angers et al, 2006; He et al, 2006; Higa et al, 2006; Jin et al, 2006). Many of these proteins, also called DDB1 and CUL4-associated factors (DCAFs), contain WDxR motifs that are required for efficient DDB1 binding. However, for most of them, their roles and substrates remain unknown. In humans, about 90 different DCAFs have been predicted (He et al, 2006), suggesting the existence of a large number of CRL4s. A similar number of WD40 repeat proteins harbouring at least one WDxR motif have been identified in the model plant Arabidopsis thaliana (Lee et al, 2008). One of the predicted Arabidopsis DCAFs is MULTICOPY SUPPRESSOR OF IRA1 (MSI1), which belongs to an evolutionary conserved protein family (reviewed in Hennig et al, 2005), whose founding member is MSI1 from yeast (Ruggieri et al, 1989). In both metazoans and plants, MSI1-like proteins are part of several protein complexes involved in diverse chromatin functions (reviewed in Hennig et al, 2005). In particular, MSI1 has been proposed to maintain epigenetic memory during development by targeting silencing complexes to chromatin. In Arabidopsis, MSI1 is essential for plant reproductive development (Köhler et al, 2003; Guitton et al, 2004). In msi1 mutants, seeds abort when the mutant allele is inherited from the mother regardless of the paternal contribution. In such seeds, the endosperm (an embryo nourishing tissue) does not cellularize, whereas the embryo exhibits cell-cycle and developmental defects. msi1 mutants have a strong penetrance of autonomous endosperm development in the absence of fertilization and form rare parthenogenetic embryos (Köhler et al, 2003; Guitton and Berger, 2005). MSI1 is part of the FIS–PRC2 complex together with at least three other proteins, MEDEA (MEA), FERTILIZATION-INDEPENDENT SEED2 (FIS2) and FERTILIZATION-INDEPENDENT ENDOSPERM (FIE), which is required for normal seed development (Köhler et al, 2003). MEA encodes a SET-domain-containing histone methyltransferase homologous to Drosophila Enhancer of Zeste (Grossniklaus et al, 1998) and regulates the imprinted expression of itself, as well as of its target gene PHERES1 (PHE1), encoding a MADS-domain transcription factor (Köhler et al, 2005). Imprinting regulation by FIS–PRC2 involves the silencing of the paternal allele of MEA and the maternal allele of PHE1, respectively (Köhler et al, 2005; Baroux et al, 2006; Gehring et al, 2006; Jullien et al, 2006). In contrast, auto-repression of the maternal MEA allele is FIS–PRC2 independent (Baroux et al, 2006). Here, we report that all WD40 repeat MSI1-like proteins from various organisms carry at least one conserved WDxR motif, a signature of DCAFs. Arabidopsis MSI1 physically interacts with DDB1A and is part of a CUL4–DDB1A–MSI1 protein complex. Functional analysis revealed that CUL4, as well as the Arabidopsis DDB1 homologs, are essential for seed production. Importantly, the cul4 mutation leads to autonomous endosperm development and loss of parental MEA imprinting, that is reactivation of the paternal MEA allele, supporting a functional link of this E3 ligase and the FIS–PRC2 complex. Results MSI-like proteins are evolutionary conserved WD40 proteins that carry WDxR motifs Recent work identified DDB1 and DCAFs as possible substrate receptors of CRL4 E3 ligases (reviewed in Lee and Zhou, 2007). The largest class of DCAFs are WD40 repeat proteins, which interact with DDB1 via one or several conserved WDxR motifs. The Arabidopsis genome encodes 237 WD40 repeat proteins; however, only a subset of them (∼80 proteins) carry one or more WDxR motif(s) (Lee et al, 2008 and our unpublished data). Among these proteins we identified MSI1 and four other Arabidopsis MSI1-related proteins, named MSI2–MSI5 (reviewed in Hennig et al, 2005). When all MSI1-like proteins from plant and non-plant organisms were compared, it appeared that most of them share a highly conserved WDxR motif (Figure 1). In metazoans, MSI1-like proteins exhibit also a second WDxR motif, which is less conserved in plants, but is also present in fungi. Therefore, most if not all MSI1-like proteins are structurally related to DCAFs. Figure 1.Alignments of MSI1-like proteins and WDxR motifs. All five Arabidopsis MSI1-like protein sequences (MSI1, AT5G58230; MSI2, AT2G16780; MSI3, AT4G35050; MSI4, AT2G19520 and MSI5, AT4G29730) were used to identify MSI1-like proteins by BLAST (Altschul et al, 1990). We used the following databases: for Oryza sativa (http://rice.plantbiology.msu.edu/; Os03g43890; Os09g36900; Os01g51300); Vitis vinifera (http://www.genoscope.cns.fr/spip/Vitis-vinifera-whole-genome.html; Vv-1 GSVIVP00030810001; Vv-2 GSVIVP00036121001; Vv-3 GSVIVP00016560001; Vv-4 GSVIVP00034167001); Lycopersicon esculentum (NCBI; http://www.ncbi.nlm.nih.gov/; Le-MSI1 O22466.1); Nicotiana tabacum (NCBI; Nt-MSI1 ABY84675.1); Homo sapiens (NCBI; Hs-RBBP4 NP_005601.1; Hs-RBBP7 NP_002884.1); Mus musculus (NCBI; Mm-RBBP4 NP_033056.2; Mm-RBBP7 NP_033057.3); Gallus gallus (NCBI; Gg-RBBP4 Q9W7I5.3; Gg-RBBP7 Q9I8G9.1); Drosophila melanogaster (NCBI; Dm-CAF-1 NP_524354.1); Caenorhabditis elegans (NCBI; Ce-lin53 NP_492552.1; Ce-Rba1 NP_492551.1); Xenopus laevis (NCBI; Xl-RBBP4B Q6INH0.3; Xl-RBBP4A O93377.3; Xl-RBBP7 Q8AVH1.1); Chlamydomonas reinhardtii (http://genome.jgi-psf.org/Chlre3/Chlre3.home.html; Cr-NRF XP_001696907.1); Populus trichocarpa (http://genome.jgi-psf.org/Poptr1_1/Poptr1_1.home.html; Pt-1 estExt_fgenesh4_pg.C_LG_II1945; Pt-2 estExt_fgenesh4_pg.C_LG_XIV1179; Pt-3 gw1.IX.1159.1; Pt-4 estExt_fgenesh4_pg.C_LG_IV1464; Pt-5 eugene3.00440093; Ptr-6 gw1.145.113.1; Pt-7 eugene3.02850001); Schizosaccharomyces pombe (NCBI; Sp-RbAp48 O14021.1; Sp-YEC6 Q9Y825.1; Sp-Mis16 NP_587881.1); Saccharomyces cerevisiae (NCBI; Sc-HAT2 P39984.1; Sc-MSI1 P13712.1; Sc-RBP 1919423A), and Neurospora crassa (NCBI; Nc-HAT2 Q7S7N3.2). All proteins identified were aligned using the program Muscle v3.6 (Edgar, 2004). Non-conserved protein regions were removed by GBlocks v0.91b using the following settings: minimum number of sequences for a conserved position: 21; minimum number of sequences for a flanking position: 34; maximum number of contiguous non-conserved positions: 8; minimum length of a block: 5; allowed gap positions: with half. The positions of two conserved WDxR motifs are indicated (Box1 and Box2). Download figure Download PowerPoint MSI1 associates with DDB1A and CUL4 in Arabidopsis We first investigated whether MSI1 interacts with DDB1A in a yeast two-hybrid assay. Similarly to DDB2 (Molinier et al, 2008), which served as a positive control, MSI1 and DDB1A interacted, although the interaction was weak as yeast growth was only detected on (-LWH) medium (Figure 2A). We further confirmed this interaction by an in vitro pull-down assay. In this experiment, a fusion protein between glutathionine-S-transferase (GST) and DDB1A, GST-DDB1A, was incubated with in vitro translated, 35S-methionine-labelled MSI1 or DDB2. Consistently, MSI1 and DDB2 co-precipitated with GST-DDB1A, but not with GST alone (Figure 2B). To provide evidence for a physical interaction between both proteins in plant cells, we carried out bimolecular fluorescence complementation (BiFC) experiments. Plasmids YC-MSI1 and YN-DDB1A were co-bombarded into etiolated mustard hypocotyls. A strong YFP signal was observed in the nucleus of 81% examined cells (35/43; Figure 2C). These data are similar to those obtained with cells transformed with the positive control YN-DDB1A+YC-DDB2 (43/46). Only a weak fluorescence signal was observed after bombardment with the following plasmid combinations YN-DDB1A+YC-BPM3 (9/35) and YN-BPM3+YC-MSI1 (2/27), where BPM3 (BTB/POZ-MATH3 protein encoded by At2g39760) is a nuclear cullin-ring ubiquitin ligase3 (CLR3) receptor, used here as a negative control. Taken together, our data clearly demonstrate a physical interaction between DDB1A and MSI1. Figure 2.MSI1 forms a complex with DDB1A and CUL4. (A) Yeast two-hybrid experiments showing MSI1 interaction with DDB1A. Dilution series of yeast cells co-expressing the indicated proteins were grown for 3 days at 28°C on LWH (low-stringency selection) and on LWA (high-stringency selection). As a positive control, we used DDB2. (B) The interactions from the Y2H assay were confirmed by using bacterially expressed GST or GST-DDB1A proteins in pull down in vitro assays. Upper panel shows GST-DDB1A protein (left) and 5 μl of in vitro translated 35S-Met-labelled MSI1 and DDB2 proteins (right) used for pull downs (lower panels). (C) BiFC of YN-DDB1A/YC-MSI1. Different combinations of plasmids expressing the indicated YN- and YC-fusion proteins were bombarded into hypocotyls of dark-grown mustard seedling. The nuclear-localized CUL3 receptor BPM3 protein was used here as a negative control. A transfection control CPRF2 expressing a fused CFP targeted to the nucleus (nu) was systematically included to identify transformed cells. Images were recorded 5 h after bombardment via CFP- (left panels) and YFP-specific filters (right panels). Differential interference contrast (DIC) images are shown (middle panels). Reconstitution of functional YFP as detected by YFP fluorescence occurs only in the nucleus with both MSI1 and DDB2. Scale bars=20 μm. (D) In vivo pull down with CUL4 and MSI1. MSI1–RFP expressing and control wild-type plants were used for immunoprecipitation (IP) assays using anti-CUL4 antibody. Both CUL4 (upper right panel) and MSI1–RFP (lower right panel) were detected in the IPs, using anti-CUL4 and anti-RFP antibodies, respectively. An asterisk indicates the MSI1–RFP protein band. A full-colour version of this figure is available at The EMBO Journal Online. Download figure Download PowerPoint Next, we tested whether MSI1 is also part of a protein complex containing Arabidopsis CUL4. Thus, we immunoprecipitated Arabidopsis CUL4 from plants expressing the MSI1–RFP fusion protein under the control of its own promoter (Chen et al, 2008). Hence, MSI1 was successfully co-immunoprecipitated in this assay (Figure 2D). Since CUL4 interacts with DDB1A (Bernhardt et al, 2006) our results, collectively, support the existence of a CUL4–DDB1A–MSI1 protein complex in Arabidopsis. CUL4 and its adaptors DDB1A and DDB1B are required for embryogenesis In Arabidopsis, loss-of-function of MSI1 causes maternal effect embryo lethality leading to seed abortion early in development (Köhler et al, 2003). We have previously isolated a T-DNA mutant, cul4-1 (Bernhardt et al, 2006), in which CUL4 expression was severely downregulated. Although viable cul4-1 homozygous mutants were obtained, these plants showed various developmental abnormalities (Bernhardt et al, 2006). When selfed, we noticed that cul4-1 homozygous plants exhibited altered seed development leading eventually to seed abortion (Supplementary Figure S1). Thus, we examined cul4-1 homozygous mutant seeds at different developmental stages (Figure 3). Already at the octant stage, we observed a lower proliferation of the endosperm (Figure 3B) while at later seed developmental stages we scored abnormally large endosperm nuclei and delayed embryo development (Figure 3D and F). Because of the pleiotropic and hypomorphic nature of the cul4-1 allele, we aimed to identify amorphic CUL4 loss-of-function mutants. As no such mutants were available in public collections, we screened a collection of Arabidopsis T-DNA insertion lines (Ríos et al, 2002). Two T-DNA insertions were identified within the coding region of CUL4, called cul4-2 and cul4-3 (Supplementary Figure S2A). Both cul4-2 and cul4-3 mutants were backcrossed to the wild type and Southern blots confirmed single T-DNA insertions. Although we genotyped 137 and 72 progeny from selfed cul4-2 and cul4-3 mutant plants, respectively, we were unable to identify homozygous mutants, suggesting that CUL4 is an essential gene in Arabidopsis. Figure 3.Embryo and endosperm development is affected in cul4 mutant seeds. (A) Cleared seed with an embryo at the octant stage from the same cul4-1 homozygous mutant silique as the seed shown in (B). (B) Mutant embryo and endosperm with reduced proliferation and large nuclei. (C) Cleared seed with an embryo at the globular stage from the same cul4-1 homozygous mutant silique as the seed shown in (D). (D) Delayed mutant with large endosperm nuclei. (E) Cleared seed with an embryo at the heart stage from the same cul4-1 homozygous mutant silique as the seed shown in (F). (F) Delayed mutant with reduced proliferation and enlarged endosperm nuclei. (G) Cleared seed with an embryo at the octant stage from the same silique as the seed shown in (H). (H) cul4-2 homozygous mutant with a reduced number of large endosperm nuclei. (I) Cleared seed with an embryo at the globular stage from the same silique as the seed shown in (J). (J) Delayed cul4-2 homozygous mutant with enlarged and aggregated endosperm nuclei. (K) Cleared seed with an embryo at the heart stage from the same silique as the seed shown in (L). (L) Delayed cul4-2 homozygous mutant with a reduced number of enlarged endosperm nuclei. Bars=50 μm (A–B, G–H); 100 μm (C–F, I–L). Download figure Download PowerPoint As both lines contained single T-DNA insertions with integral hygromycin selection markers, we self-pollinated cul4-2 and cul4-3 heterozygous plants and analysed the segregation of this marker among their progeny (Table I). This genetic analysis revealed a segregation ratio close to 2:1 consistent with nearly fully penetrant zygotic embryo lethality. Because the segregation ratio of the marker was slightly below 2:1 for the cul4-2 allele, suggesting a weak defect in gametophytic transmission, we performed reciprocal crosses with wild-type plants. The transmission efficiency of the marker was slightly reduced through both male and female gametophytes (Table I). Table 1. Genetic analysis of cul4 mutant plants Parental genotype (female × male) HygR Hygs n P-value TEF (%) TEM (%) cul4-2 (selfed) 470 296 766 0.002 NA NA cul4-3 (selfed) 474 236 710 0.936 NA NA Col-0 × cul4-2 213 251 464 0.077 NA 84.9% cul4-2 × Col-0 198 236 434 0.068 83.9% NA Col-0 × cul4-3 229 256 485 0.220 NA 89.4% cul4-3 × Col-0 221 254 475 0.130 87.0% NA Resistance to Hygromycin (HygR, Hygromycin resistant seedlings; HygS, Hygromycin sensitive seedlings) was used as a marker for the cul4-2 and cul4-3 insertions. Transmission efficiencies were calculated according to Howden et al. (1998): TE = HygR/HygS × 100%. P-value, based on a 2:1 segregation ratio as expected for a zygotic embryo lethal mutation and 1:1 for the reciprocal crosses as expected for normal transmission; TEF, female transmission efficiency; TEM, male transmission efficiency; NA, not applicable. At a P-value of <0.05 the null hypothesis is rejected. Next, we examined mature siliques for the presence of aborted seeds. The number of aborted seeds was consistent with zygotic embryo lethality, where a segregation of aborted:normal seeds of 1:3 is expected (Table II; Supplementary Figure S1). To further investigate at which developmental stage embryogenesis is arrested, we analysed cleared seed specimens from siliques of selfed cul4-2 mutant plants at different developmental stages. At the octant stage, the mutant seeds exhibited a low number of large nuclei in the endosperm (Figure 3H). At later stages, embryos arrested their development at the globular stage with abnormal shapes and cell division defects in both the suspensor and the embryo proper (Figure 3J and L). Moreover, in cul4-2 homozygous mutant seeds, the endosperm was always severely underdeveloped with a dozen fewer enlarged, abnormal nuclei. When siliques were analysed at later stages, harbouring bent-cotyledon stage or mature wild-type sibling embryos, the arrested seeds had degenerated (not shown), indicating a strict arrest and not only a delay in seed development. Similar results were obtained with the cul4-3 mutant allele (Supplementary Figure S3B). Table 2. Analysis of mature siliques Parental genotype (female × male) Normal seeds Aborted seeds Seeds scored P-value Col-0 × Col-0 512 8 (1.5%) 520 NA cul4-2+/− (selfed) 1129 444 (28.2%) 1573 0.003 cul4-3+/− (selfed) 1030 383 (27.1%) 1413 0.065 ddb1a-2 DDB1B/ddb1b-1 (selfed) 215 81 (27.4%) 296 0.347 Mature siliques were analysed for the presence of aborted seeds. P-value, based on a 3:1 ratio as expected for zygotic embryo lethality. NA, not applicable. At a P-value of <0.05 the null hypothesis is rejected. Because CUL4 interacts with DDB1 to form CRL4 E3 complexes, we also investigated whether DDB1 is required for embryogenesis. The Arabidopsis genome encodes two expressed DDB1-related proteins, named DDB1A (At4g05420) and DDB1B (At4g21100), exhibiting 89% sequence identity at the amino-acid level (Schroeder et al, 2002). DDB1A loss-of-function mutants are viable (Molinier et al, 2008). Therefore, we searched for T-DNA insertion mutants in the related DDB1B gene and identified one mutant, named ddb1b-1, from the SALK collection (SALK 061944) (Alonso et al, 2003). In the dbb1b-1 allele, the T-DNA interrupts the coding sequence in the last exon (Supplementary Figure S2B). Homozygous ddb1b-1 mutant plants developed normally and were fully fertile. To test whether DDB1A and DDB1B act redundantly during embryogenesis, the ddb1a-2 mutant was used to pollinate a homozygous ddb1b-1 mutant plant. Among the progeny of this cross, we selected F2 plants that were DDB1A/ddb1a-2 ddb1b-1/ddb1b-1 (referred as DDB1A/ddb1a ddb1b) and ddb1a-2/ddb1a-2 DDB1B/ddb1b-1 (referred as ddb1a DDB1B/ddb1b). Because both ddb1a-2 and ddb1b-1 mutants carry the same selection marker, we used PCR-based genotyping for further genetic analyses. Among the progeny of self-pollinated DDB1A/ddb1a ddb1b and ddb1a DDB1B/ddb1b plants, no double mutant were identified, despite the analysis of ∼60 plants for each genotype (Table III). Table 3. Genetic analysis of ddb1a ddb1b mutant plants Genotyping Doubly homozygous (−/−; −/−) Heterozygous for one allele (+/−; −/−) WT allele (+/+; −/−) n P-value TEF (%) TEM (%) DDB1A/ddb1a-2 ddb1b-1 (selfed) 0 36 20 56 0.567 NA NA ddb1a-2 DDB1B/ddb1b-1 (selfed) 0 38 25 63 0.285 NA NA ddb1b-1 × DDB1A/ddb1a-2 ddb1b-1 0 26 68 94 <0.0001 NA 38.2% DDB1A/ddb1a-2 ddb1b-1 × ddb1b-1 0 44 45 89 0.9156 97.8% NA ddb1a-2 × ddb1a-2 DDB1B/ddb1b-1 0 43 41 84 0.8273 NA 104.8% ddb1a-2 DDB1B/ddb1b-1 × ddb1a-2 0 20 66 86 <0.0001 30.3% NA TEF, female transmission efficiency; TEM, male transmission efficiency; NA, not applicable. The progeny of DDB1A/ddb1a ddb1b and ddb1a DDB1B/ddb1b plants were genotyped. No double mutant was identified. P-value, based on a 2:1 segregation ratio as expected for a zygotic embryo lethal mutation and 1:1 for the reciprocal crosses as expected for normal transmission. At a P-value of <0.05 the null hypothesis is rejected. Next, we evaluated the effect of both DDB1-related genes on male and female gametophytic transmission (Table III). Reciprocal crosses between the different genotypes revealed that the two genes do not contribute equally to gametophyte development and/or function as indicated by unequal transmission defects: while in the absence of DDB1B, DDB1A is required for normal transmission through the male, the converse is true for the female gametophyte. The number of aborted seeds was consistent with zygotic embryo lethality in self-pollinated ddb1a DDB1B/ddb1b plants (Table II). Light microscopic observations of cleared seeds revealed that double homozygous ddb1a dbb1b embryos derived from selfed DDB1A/ddb1a ddb1b (not shown) or ddb1a DDB1B/ddb1b (Supplementary Figure S3D)) mutants arrest at the globular stage, with a phenotype reminiscent of that of the cul4 mutants. Thus, both CUL4 and DDB1A/B functions are required for normal development of embryo and endosperm. CUL4 is expressed during embryogenesis To determine the expression pattern of CUL4 in reproductive tissues and during embryogenesis, we performed mRNA in situ hybridization experiments on sections of flower buds and developing siliques using CUL4-sp

Cytokinesis in eukaryotes involves specific arrays of microtubules (MTs), which are known as the “central spindle” in animals, the “anaphase spindle” in yeasts, and the “phragmoplast” in plants. Control of these arrays, which are composed mainly of bundled nonkinetochore MTs, is critically important during cytokinesis. In plants, an MAPK cascade stimulates the turnover of phragmoplast MTs, and a crucial aspect of the activation of this cascade is the interaction between the MAPKKK, nucleus- and phragmoplast-localized protein kinase 1 (NPK1) and the NPK1-activating kinesin-like protein 1 (NACK1), a key regulator of plant cytokinesis. However, little is known about the control of this interaction at the molecular level during progression through the M phase. We demonstrated that cyclin-dependent kinases (CDKs) phosphorylate both NPK1 and NACK1 before metaphase in tobacco cells, thereby inhibiting the interaction between these proteins, suggesting that such phosphorylation prevents the transition to cytokinesis. Failure to inactivate CDKs after metaphase prevents dephosphorylation of these two proteins, causing incomplete mitosis. Experiments with Arabidopsis NACK1 (AtNACK1/HINKEL) revealed that phosphorylated NACK1 fails to mediate cytokinesis. Thus, timely and coordinated phosphorylation by CDKs and dephosphorylation of cytokinetic regulators from prophase to anaphase appear to be critical for the appropriate onset and/or progression of cytokinesis.

In Arabidopsis thaliana, ARGONAUTE1 (AGO1) plays a central role in microRNA (miRNA) and small interfering RNA (siRNA)-mediated silencing and is a key component in antiviral responses. The polerovirus F-box P0 protein triggers AGO1 degradation as a viral counterdefense. Here, we identified a motif in AGO1 that is required for its interaction with the S phase kinase-associated protein1-cullin 1-F-box protein (SCF) P0 (SCFP0) complex and subsequent degradation. The AGO1 P0 degron is conserved and confers P0-mediated degradation to other AGO proteins. Interestingly, the degron motif is localized in the DUF1785 domain of AGO1, in which a single point mutation (ago1-57, obtained by forward genetic screening) compromises recognition by SCFP0. Recapitulating formation of the RNA-induced silencing complex in a cell-free system revealed that this mutation impairs RNA unwinding, leading to stalled forms of AGO1 still bound to double-stranded RNAs. In vivo, the DUF1785 is required for unwinding perfectly matched siRNA duplexes, but is mostly dispensable for unwinding imperfectly matched miRNA duplexes. Consequently, its mutation nearly abolishes phased siRNA production and sense transgene posttranscriptional gene silencing. Overall, our work sheds new light on the mode of AGO1 recognition by P0 and the in vivo function of DUF1785 in RNA silencing.

<h2>Summary</h2> In <i>Arabidopsis thaliana</i>, ARGONAUTE1 (AGO1) plays a central role in microRNA (miRNA) and small interfering RNA (siRNA)-mediated silencing. AGO1 associates to the rough endoplasmic reticulum to conduct miRNA-mediated translational repression, mRNA cleavage, and biogenesis of phased siRNAs. Here, we show that a 37°C heat stress (HS) promotes AGO1 protein accumulation in cytosolic condensates where it colocalizes with components of siRNA bodies and of stress granules. AGO1 contains a prion-like domain in its poorly characterized N-terminal Poly-Q domain, which is sufficient to undergo phase separation independently of the presence of SGS3. HS only moderately affects the small RNA repertoire, the loading of AGO1 by miRNAs, and the signatures of target cleavage, suggesting that its localization in condensates protects AGO1 rather than promoting or impairing its activity in reprogramming gene expression during stress. Collectively, our work sheds new light on the impact of high temperature on a main effector of RNA silencing in plants.

The 26S proteasome plays a central role in the degradation of regulatory proteins involved in a variety of developmental processes. It consists of two multisubunit protein complexes: the proteolytic core protease and the regulatory particle (RP). The function of most RP subunits is poorly understood. Here, we describe mutants in the Arabidopsis thaliana RPN1 subunit, which is encoded by two paralogous genes, RPN1a and RPN1b. Disruption of RPN1a caused embryo lethality, while RPN1b mutants showed no obvious abnormal phenotype. Embryos homozygous for rpn1a arrested at the globular stage with defects in the formation of the embryonic root, the protoderm, and procambium. Cyclin B1 protein was not degraded in these embryos, consistent with cell division defects. Double mutant plants (rpn1a/RPN1a rpn1b/rpn1b) produced embryos with a phenotype indistinguishable from that of the rpn1a single mutant. Thus, despite their largely overlapping expression patterns in flowers and developing seeds, the two isoforms do not share redundant functions during gametogenesis and embryogenesis. However, complementation of the rpn1a mutation with the coding region of RPN1b expressed under the control of the RPN1a promoter indicates that the two RPN1 isoforms are functionally equivalent. Overall, our data indicate that RPN1 activity is essential during embryogenesis, where it might participate in the destruction of a specific set of protein substrates.

Ubiquitination and proteasome-mediated degradation of proteins are crucial for eukaryotic physiology and development. The largest class of E3 ubiquitin ligases is made up of the cullin-RING ligases (CRLs), which themselves are positively regulated through conjugation of the ubiquitin-like peptide RUB/NEDD8 to cullins. RUB modification is antagonized by the COP9 signalosome (CSN), an evolutionarily conserved eight-subunit complex that is essential in most eukaryotes and cleaves RUB from cullins. The CSN behaves genetically as an activator of CRLs, although it abolishes CRL activity in vitro. This apparent paradox was recently reconciled in different organisms, as the CSN was shown to prevent autocatalytic degradation of several CRL substrate adaptors. We tested for such a mechanism in the model plant Arabidopsis by measuring the impact of a newly identified viable csn2 mutant on the activity and stability of SCFTIR1, a receptor to the phytohormone auxin and probably the best characterized plant CRL. Our analysis reveals that not only the F-box protein TIR1 but also relevant cullins are destabilized in csn2 and other Arabidopsis csn mutants. These results provide an explanation for the auxin resistance of csn mutants. We further observed in vivo a post-translational modification of TIR1 dependent on the proteasome inhibitor MG-132 and provide evidence for proteasome-mediated degradation of TIR1, CUL1, and ASK1 (Arabidopsis SKP1 homolog). These results are consistent with CSN-dependent protection of Arabidopsis CRLs from autocatalytic degradation, as observed in other eukaryotes, and provide evidence for antagonist roles of the CSN and 26S proteasome in modulating accumulation of the plant CRL SCFTIR1. Ubiquitination and proteasome-mediated degradation of proteins are crucial for eukaryotic physiology and development. The largest class of E3 ubiquitin ligases is made up of the cullin-RING ligases (CRLs), which themselves are positively regulated through conjugation of the ubiquitin-like peptide RUB/NEDD8 to cullins. RUB modification is antagonized by the COP9 signalosome (CSN), an evolutionarily conserved eight-subunit complex that is essential in most eukaryotes and cleaves RUB from cullins. The CSN behaves genetically as an activator of CRLs, although it abolishes CRL activity in vitro. This apparent paradox was recently reconciled in different organisms, as the CSN was shown to prevent autocatalytic degradation of several CRL substrate adaptors. We tested for such a mechanism in the model plant Arabidopsis by measuring the impact of a newly identified viable csn2 mutant on the activity and stability of SCFTIR1, a receptor to the phytohormone auxin and probably the best characterized plant CRL. Our analysis reveals that not only the F-box protein TIR1 but also relevant cullins are destabilized in csn2 and other Arabidopsis csn mutants. These results provide an explanation for the auxin resistance of csn mutants. We further observed in vivo a post-translational modification of TIR1 dependent on the proteasome inhibitor MG-132 and provide evidence for proteasome-mediated degradation of TIR1, CUL1, and ASK1 (Arabidopsis SKP1 homolog). These results are consistent with CSN-dependent protection of Arabidopsis CRLs from autocatalytic degradation, as observed in other eukaryotes, and provide evidence for antagonist roles of the CSN and 26S proteasome in modulating accumulation of the plant CRL SCFTIR1. Post-translational control of protein turnover by ubiquitination and degradation by the 26S proteasome is a highly regulated process essential for all eukaryotes. In plants, it regulates many developmental and physiological responses such as hormone signaling, cell division, floral development, and maintenance of circadian rhythm (1Smalle J. Vierstra R.D. Annu. Rev. Plant Biol. 2004; 55: 555-590Crossref PubMed Scopus (1035) Google Scholar, 2Moon J. Parry G. Estelle M. Plant Cell. 2004; 16: 3181-3195Crossref PubMed Scopus (450) Google Scholar). Ubiquitin is a small peptide that can be covalently transferred to specific target proteins through dedicated enzymatic machinery. Polyubiquitinated substrates are then normally targeted for proteasome-dependent degradation (3Hershko A. Ciechanover A. Annu. Rev. Biochem. 1998; 67: 425-479Crossref PubMed Scopus (6902) Google Scholar). E3 ubiquitin ligases confer substrate specificity to the ubiquitination machinery and are subdivided into different groups based on their mechanistic and structural characteristics (4Pickart C.M. Annu. Rev. Biochem. 2001; 70: 503-533Crossref PubMed Scopus (2920) Google Scholar). Cullin-RING (really interesting new gene) E3 ligases (CRLs) 3The abbreviations used are: CRL, cullin-RING ligase; SCF, SKP1-cullin-F-box; Aux, auxin; CSN, COP9 signalosome; GUS, β-glucuronidase; RT, reverse transcription; CHX, cycloheximide; HA, hemagglutinin; 2,4-D, 2,4-dichlorphenoxyacetic acid; IAA, indoleacetic acid. are composed of a cullin subunit, a RING protein (RBX1/Hrt1/Roc1), which recruits the E2 ubiquitin-conjugating enzymes, and a substrate receptor that specifically binds proteins to be ubiquitinated. Arabidopsis expresses four functionally relevant cullins giving rise to three distinct classes of CRLs. The functionally redundant cullins CUL3A and CUL3B associate with BTB/POZ (Bric-a-brac, Tramtrack, and broad complex/Pox virus and zinc finger) domain-containing substrate adaptors (5Dieterle M. Thomann A. Renou J.P. Parmentier Y. Cognat V. Lemonnier G. Muller R. Shen W.H. Kretsch T. Genschik P. Plant J. 2005; 41: 386-399Crossref PubMed Scopus (76) Google Scholar, 6Figueroa P. Gusmaroli G. Serino G. Habashi J. Ma L. Shen Y. Feng S. Bostick M. Callis J. Hellmann H. Deng X.W. Plant Cell. 2005; 17: 1180-1195Crossref PubMed Scopus (131) Google Scholar, 7Gingerich D.J. Gagne J.M. Salter D.W. Hellmann H. Estelle M. Ma L. Vierstra R.D. J. Biol. Chem. 2005; 280: 18810-18821Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). CUL4 associates with a subgroup of WD40 repeat-containing proteins called DWD proteins via the DDB1 adaptor (8Lee J. Zhou P. Mol. Cell. 2007; 26: 775-780Abstract Full Text Full Text PDF PubMed Scopus (326) Google Scholar, 9Lee J.H. Terzaghi W. Gusmaroli G. Charron J.B. Yoon H.J. Chen H. He Y.J. Xiong Y. Deng X.W. Plant Cell. 2008; 20: 152-167Crossref PubMed Scopus (190) Google Scholar). The best characterized SCF (SKP1-cullin-F-box)-type CRLs incorporate CUL1 (10Lechner E. Achard P. Vansiri A. Potuschak T. Genschik P. Curr. Opin. Plant Biol. 2006; 9: 631-638Crossref PubMed Scopus (281) Google Scholar). Substrate specificity of SCF complexes is conferred by F-box proteins, which associate with CUL1 via a SKP1 adaptor protein. Although these different classes of CRLs are important for development in Arabidopsis (6Figueroa P. Gusmaroli G. Serino G. Habashi J. Ma L. Shen Y. Feng S. Bostick M. Callis J. Hellmann H. Deng X.W. Plant Cell. 2005; 17: 1180-1195Crossref PubMed Scopus (131) Google Scholar, 11Shen W.H. Parmentier Y. Hellmann H. Lechner E. Dong A. Masson J. Granier F. Lepiniec L. Estelle M. Genschik P. Mol. Biol. Cell. 2002; 13: 1916-1928Crossref PubMed Scopus (140) Google Scholar, 12Thomann A. Brukhin V. Dieterle M. Gheyeselinck J. Vantard M. Grossniklaus U. Genschik P. Plant J. 2005; 43: 437-448Crossref PubMed Scopus (48) Google Scholar, 13Bernhardt A. Lechner E. Hano P. Schade V. Dieterle M. Anders M. Dubin M.J. Benvenuto G. Bowler C. Genschik P. Hellmann H. Plant J. 2006; 47: 591-603Crossref PubMed Scopus (111) Google Scholar, 14Chen H. Shen Y. Tang X. Yu L. Wang J. Guo L. Zhang Y. Zhang H. Feng S. Strickland E. Zheng N. Deng X.W. Plant Cell. 2006; 18: 1991-2004Crossref PubMed Scopus (173) Google Scholar), our knowledge of the precise functions and substrates of individual CRLs is limited. A CUL3-ETO1 complex is involved in ethylene biosynthesis (15Wang K.L. Yoshida H. Lurin C. Ecker J.R. Nature. 2004; 428: 945-950Crossref PubMed Scopus (312) Google Scholar), and CUL4-based complexes are important for development and photomorphogenesis (9Lee J.H. Terzaghi W. Gusmaroli G. Charron J.B. Yoon H.J. Chen H. He Y.J. Xiong Y. Deng X.W. Plant Cell. 2008; 20: 152-167Crossref PubMed Scopus (190) Google Scholar, 13Bernhardt A. Lechner E. Hano P. Schade V. Dieterle M. Anders M. Dubin M.J. Benvenuto G. Bowler C. Genschik P. Hellmann H. Plant J. 2006; 47: 591-603Crossref PubMed Scopus (111) Google Scholar, 14Chen H. Shen Y. Tang X. Yu L. Wang J. Guo L. Zhang Y. Zhang H. Feng S. Strickland E. Zheng N. Deng X.W. Plant Cell. 2006; 18: 1991-2004Crossref PubMed Scopus (173) Google Scholar). By contrast, the activities and substrates of several SCFs are known. The best characterized SCFs are the SCFTIR1/AFB complexes, which function as receptors for the plant hormone auxin (16Kepinski S. Leyser O. Nature. 2005; 435: 446-451Crossref PubMed Scopus (1295) Google Scholar, 17Dharmasiri N. Dharmasiri S. Estelle M. Nature. 2005; 435: 441-445Crossref PubMed Scopus (1551) Google Scholar). Auxins regulate many aspects of plant growth and development (18Teale W.D. Paponov I.A. Palme K. Nat. Rev. Mol. Cell Biol. 2006; 7: 847-859Crossref PubMed Scopus (858) Google Scholar) and have been shown to directly bind to the F-box protein TIR1 (transport inhibitor response) and the homologous AFB1–3 proteins inside the cell (16Kepinski S. Leyser O. Nature. 2005; 435: 446-451Crossref PubMed Scopus (1295) Google Scholar, 17Dharmasiri N. Dharmasiri S. Estelle M. Nature. 2005; 435: 441-445Crossref PubMed Scopus (1551) Google Scholar, 19Dharmasiri N. Dharmasiri S. Weijers D. Lechner E. Yamada M. Hobbie L. Ehrismann J.S. Jurgens G. Estelle M. Dev. Cell. 2005; 9: 109-119Abstract Full Text Full Text PDF PubMed Scopus (768) Google Scholar). Auxin binding increases the affinity of SCFTIR1/AFB for its substrates, the Aux/IAA proteins, leading to their increased ubiquitination and turnover. As a result, auxin response factors (ARFs), in which activities are normally repressed through dimerization with Aux/IAAs, are liberated and can thus function as transcriptional regulators of auxin responsive genes (18Teale W.D. Paponov I.A. Palme K. Nat. Rev. Mol. Cell Biol. 2006; 7: 847-859Crossref PubMed Scopus (858) Google Scholar). Suppression of ARF5-dependent transcription by IAA12 was recently shown to depend on the co-repressor TPL (TOPLESS), which binds to IAA12 (20Szemenyei H. Hannon M. Long J.A. Science. 2008; 319: 1384-1386Crossref PubMed Scopus (536) Google Scholar), and the repressor function of other Aux/IAA proteins might also depend on other TPL-related co-factors (21Lau S. Jurgens G. De Smet I. Plant Cell. 2008; 20: 1738-1746Crossref PubMed Scopus (115) Google Scholar). Mutations affecting SCFTIR1/AFB activity result in the stabilization of Aux/IAA proteins, decreased induction of auxin-regulated genes, and reduced sensitivity to exogenous auxin. The latter phenotype was used extensively for genetic screens leading to the identification of SCF components and regulators. Several auxin-resistant mutants are defective in the conjugation of the ubiquitin-like protein RUB/NEDD8 (related to ubiquitin/neural precursor cell expressed, developmentally down-regulated 8) to cullins. Although the molecular role of RUB modification is not fully understood, it is essential for CRL activity and promotes E3 ligase function both in vivo and in vitro (reviewed in Ref. 22Parry G. Estelle M. Semin. Cell Dev. Biol. 2004; 15: 221-229Crossref PubMed Scopus (72) Google Scholar). The COP9 signalosome (CSN) cleaves RUB/NEDD8 from cullins (23Lyapina S. Cope G. Shevchenko A. Serino G. Tsuge T. Zhou C.S. Wolf D.A. Wei N. Deshaies R.J. Science. 2001; 292: 1382-1385Crossref PubMed Scopus (558) Google Scholar, 24Cope G.A. Suh G.S. Aravind L. Schwarz S.E. Zipursky S.L. Koonin E.V. Deshaies R.J. Science. 2002; 298: 608-611Crossref PubMed Scopus (583) Google Scholar) and is biochemically antagonist to the RUB conjugation machinery. The CSN is conserved in eukaryotes, is structurally related to the 19S lid complex of the 26S proteasome, and is composed of six PCI (proteasome, COP9, eIF3; CSN1–4 and CSN7–8) and two MPN (Mov34, Pad1 N-terminal; CSN5 and CSN6) domain-containing subunits (25Serino G. Su H. Peng Z. Tsuge T. Wei N. Gu H. Deng X.W. Plant Cell. 2003; 15: 719-731Crossref PubMed Scopus (52) Google Scholar). Although the derubylation activity of CSN resides in the JAMM domain of CSN5 (24Cope G.A. Suh G.S. Aravind L. Schwarz S.E. Zipursky S.L. Koonin E.V. Deshaies R.J. Science. 2002; 298: 608-611Crossref PubMed Scopus (583) Google Scholar), Arabidopsis mutants deficient in any subunit share a common derubylation defect, reflected in the accumulation of RUB-modified cullins, and show the severe cop/det/fus phenotype of constitutive photomorphogenesis (cop/det) and accumulation of anthocyanins (fusca), culminating in early seedling lethality (26Serino G. Deng X.W. Annu. Rev. Plant Biol. 2003; 54: 165-182Crossref PubMed Scopus (126) Google Scholar, 27Gusmaroli G. Figueroa P. Serino G. Deng X.W. Plant Cell. 2007; 19: 564-581Crossref PubMed Scopus (109) Google Scholar). This common phenotype is explained by the dissociation of the holocomplex in all csn mutants, accompanied by partial or complete destabilization of all other subunits with the exception of CSN5 (27Gusmaroli G. Figueroa P. Serino G. Deng X.W. Plant Cell. 2007; 19: 564-581Crossref PubMed Scopus (109) Google Scholar). Although loss of CSN function is tolerated in some fungi (28Mundt K.E. Liu C. Carr A.M. Mol. Biol. Cell. 2002; 13: 493-502Crossref PubMed Scopus (99) Google Scholar, 29He Q. Cheng P. He Q. Liu Y. Genes Dev. 2005; 19: 1518-1531Crossref PubMed Scopus (147) Google Scholar, 30Busch S. Schwier E.U. Nahlik K. Bayram O. Helmstaedt K. Draht O.W. Krappmann S. Valerius O. Lipscomb W.N. Braus G.H. Proc. Natl. Acad. Sci. U. S. A. 2007; 104: 8089-8094Crossref PubMed Scopus (73) Google Scholar), CSN is essential for all animal and plant systems studied thus far. Because RUB conjugation promotes E3 ligase activity, RUB cleavage by the CSN is expected to act as a negative regulator of CRL activity. Although this holds true in vitro, genetic studies show that the CSN acts as a promoter of E3 ligase activity in vivo. This apparent paradox was first reconciled in fission yeast, as CSN was shown to protect CRL substrate adaptors from autocatalytic degradation through both its derubylation activity and a CSN-associated deubiquitinating enzyme (31Wee S. Geyer R.K. Toda T. Wolf D.A. Nat. Cell Biol. 2005; 7: 387-391Crossref PubMed Scopus (148) Google Scholar). Similar observations were subsequently made in other systems (29He Q. Cheng P. He Q. Liu Y. Genes Dev. 2005; 19: 1518-1531Crossref PubMed Scopus (147) Google Scholar, 32Denti S. Fernandez-Sanchez M.E. Rogge L. Bianchi E. J. Biol. Chem. 2006; 281: 32188-32196Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 33Cope G.A. Deshaies R.J. BMC Biochem. 2006; 7: 1Crossref PubMed Scopus (116) Google Scholar, 34Luke-Glaser S. Roy M. Larsen B. Le Bihan T. Metalnikov P. Tyers M. Peter M. Pintard L. Mol. Cell. Biol. 2007; 27: 4526-4540Crossref PubMed Scopus (48) Google Scholar). Additionally, destabilization of cullins upon reduction of CSN function has been reported in some but not all model systems (29He Q. Cheng P. He Q. Liu Y. Genes Dev. 2005; 19: 1518-1531Crossref PubMed Scopus (147) Google Scholar, 35Wu J.T. Lin H.C. Hu Y.C. Chien C.T. Nat. Cell Biol. 2005; 7: 1014-1020Crossref PubMed Scopus (139) Google Scholar, 36Schweitzer K. Bozko P.M. Dubiel W. Naumann M. EMBO J. 2007; 26: 1532-1541Crossref PubMed Scopus (169) Google Scholar). Thus, fundamental differences may occur as manifested by the differential impact of CSN on cullin stability in yeast and Drosophila (31Wee S. Geyer R.K. Toda T. Wolf D.A. Nat. Cell Biol. 2005; 7: 387-391Crossref PubMed Scopus (148) Google Scholar, 35Wu J.T. Lin H.C. Hu Y.C. Chien C.T. Nat. Cell Biol. 2005; 7: 1014-1020Crossref PubMed Scopus (139) Google Scholar). In Arabidopsis, the characterization of csn mutants has been limited by their early seedling lethality. Using a viable/partial csn mutant, we have provided novel insights into CRL assembly and recycling in plant cells. Plant Material and Growth Conditions-Wild-type Arabidopsis thaliana accessions used were Columbia (Col-0) and Landsberg erecta (Ler). The Ler sgt1b-3 (37Austin M.J. Muskett P. Kahn K. Feys B.J. Jones J.D. Parker J.E. Science. 2002; 295: 2077-2080Crossref PubMed Scopus (348) Google Scholar), Ler csn2fus12 (line U228 (38Kwok S.F. Solano R. Tsuge T. Chamovitz D.A. Ecker J.R. Matsui M. Deng X.W. Plant Cell. 1998; 10: 1779-1790Crossref PubMed Scopus (145) Google Scholar)), Col-0 tir1-1 (39Ruegger M. Dewey E. Gray W.M. Hobbie L. Turner J. Estelle M. Genes Dev. 1998; 12: 198-207Crossref PubMed Scopus (505) Google Scholar), Col-0 csn5a-1 (40Dohmann E.M. Kuhnle C. Schwechheimer C. Plant Cell. 2005; 17: 1967-1978Crossref PubMed Scopus (80) Google Scholar), and Col-0 sgt1beta3 (41Gray W.M. Muskett P.R. Chuang H.W. Parker J.E. Plant Cell. 2003; 15: 1310-1319Crossref PubMed Scopus (162) Google Scholar) mutants are published. Plants were grown with a light intensity of ∼200 μm photons·m-2·s-1 (16 h light/8 h darkness) at 24 °C/21 °C (light/dark) in soil or sterile conditions: solid 1/10 Murashige and Skoog basal medium (MS medium, Sigma) complemented with Gamborgs vitamins, 0.8% agar, and 0.5% sucrose or liquid MS medium complemented with 1% sucrose and Gamborgs vitamins under shaking. Seeds were stratified for 48 h at 4 °C prior to transfer to growth chambers. Ethyl Methane Sulfonate Mutagenesis and the eba Mutant Screen-Ler sgt1b-3 seeds were mutagenized as described (42Weigel D. Glazebrook J. Arabidopsis: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY2002: 24-25Google Scholar). 3100 individual M2 families were harvested and tested in the root growth inhibition assay on 0.2 μm 2,4-dichlorphenoxyacetic acid (2,4-D; Sigma) as described below. Candidate mutant lines were back-crossed at least three times prior to physiological analyses. Hormone Treatments and Photomorphogenesis Test-Root growth inhibition assays were performed with methyl jasmonate (Duchefa) or 2,4-D as described (43Noël L.D. Cagna G. Stuttmann J. Wirthmuller L. Betsuyaku S. Witte C.P. Bhat R. Pochon N. Colby T. Parker J.E. Plant Cell. 2007; 19: 4061-4076Crossref PubMed Scopus (167) Google Scholar). For ethylene tests, seeds were grown in darkness for 5 days on horizontal MS plates with 1% sucrose containing 1-aminocyclopropane-1-carboxylic acid as described (44Alonso J.M. Stepanova A.N. Solano R. Wisman E. Ferrari S. Ausubel F.M. Ecker J.R. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2992-2997Crossref PubMed Scopus (305) Google Scholar). For photomorphogenesis tests, seeds sown on MS/10 without sucrose were first exposed to light for 6 h and subsequently grown horizontally in darkness or light. All experiments were performed at least in triplicates. Root elongation and hypocotyl length were measured on photographs using NIH ImageJ software. HS::AXR3NT-GUS Experiments-The relevant genotypes were isolated in the F2 progeny of a cross between a Col-0 HS::AXR3NT-GUS transgenic plant (45Gray W.M. Kepinski S. Rouse D. Leyser O. Estelle M. Nature. 2001; 414: 271-276Crossref PubMed Scopus (1044) Google Scholar) and a Ler sgt1b-3 csn2-5 plant. At least two independent lines per genotype were analyzed. Plants were grown for 6–7 days in liquid MS medium in 6-well microtiter plates. To induce expression of AXR3NT-GUS (β-glucuronidase), the plates were placed in a 37 °C water bath for 2 h. GUS staining was performed overnight at 37 °C as described (46Jefferson R.A. Plant Mol. Biol. Rep. 1987; 5: 387-405Crossref Scopus (4032) Google Scholar). Map-based Cloning of csn2-5 Mutation-A Ler sgt1b-3 csn2-5 cross to Col sgt1beta3 was used as mapping population. Bulk segregant analysis of ∼100 polymorphic AFLP (amplified fragment length polymorphism) markers was performed on pooled DNAs of 10 resistant or sensitive F2 families selected on 0.2 μm 2,4-D using SacI/TaqI adaptors as described (47Vos P. Hogers R. Bleeker M. Reijans M. van de Lee T. Hornes M. Frijters A. Pot J. Peleman J. Kuiper M. Zabeau M. Nucleic Acids Res. 1995; 23: 4407-4414Crossref PubMed Scopus (10517) Google Scholar). Three linked markers were excised, reamplified, sequenced, and localized to chromosome 2 (see supplemental Fig. 1). Mapping was refined using CAPS, dCAPS, and microsatellite markers (primers available upon request) on ∼1300 DNAs from resistant F2 plants selected from the mapping population. Coding regions of genes from the final 46-kb genetic interval containing csn2-5 were amplified by PCR and treated with SURVEYOR nuclease as described by the manufacturer (Transgenomic). RT-PCR Analysis-RNA isolated from 6-day-old seedlings grown under sterile conditions was reverse-transcribed using SuperScript reverse transcriptase (Invitrogen) and oligo(dT) primers following the manufacturer's instructions. Relative mRNA accumulation was determined in three independent biological samples under nonsaturating PCR conditions (primer sequences available upon request). Generation of 35S::CSN2-HAStrep Transgenic Lines-The coding region of CSN2 without stop codon was amplified by PCR from total Col-0 cDNA and cloned into pENTR/D as recommended (Invitrogen) giving pE-CSN2. The csn2-5 mutation was introduced by site-directed mutagenesis resulting in pE-csn2-5. The sequences coding for CSN2 and csn2-5 were recombined into pXCSG-HAStrep giving pXCSG-CSN2-HAStrep and pXCSG-csn2-5-HAStrep. To generate pXCSG-HAStrep, the EcoRV gateway rfB cassette was cloned into pXCS-HAStrep SmaI site (48Witte C.P. Noël L.D. Gielbert J. Parker J.E. Romeis T. Plant Mol. Biol. 2004; 55: 135-147Crossref PubMed Scopus (155) Google Scholar). Generation of HA-Strep-tagged TIR1-The genomic Col-0 TIR1 region covering the 1.7-kb promoter, complete 5′-untranslated region, and coding region without stop codon was amplified by PCR and cloned into pExtag-HAStrep, giving pXC-np::TIR1-HAStrep. Plant Transformations-Stable transformation of Arabidopsis, selection, and genetic analysis was performed as described (43Noël L.D. Cagna G. Stuttmann J. Wirthmuller L. Betsuyaku S. Witte C.P. Bhat R. Pochon N. Colby T. Parker J.E. Plant Cell. 2007; 19: 4061-4076Crossref PubMed Scopus (167) Google Scholar). MG-132, Cycloheximide, and 2,4-D Treatments-Seedlings were grown in 6-well plates using liquid MS in the presence/absence of 100 μm cycloheximide (Sigma), 50 μm MG-132 (Calbiochem), and 5 μm 2,4-D. StrepII Affinity Purification-StrepII affinity purifications were performed as described (48Witte C.P. Noël L.D. Gielbert J. Parker J.E. Romeis T. Plant Mol. Biol. 2004; 55: 135-147Crossref PubMed Scopus (155) Google Scholar). For purification of CSN2-HAStrep, 2 g of tissue from 7-day-old seedlings grown on solid MS/10 medium were used. For TIR1 ubiquitination analysis, seedlings were grown in liquid MS medium with or without a 6-h MG-132 and/or 2,4-D treatment.1g of tissue was used for purification, and bound proteins were eluted in Laemmli buffer. Gel Filtration Analysis-Soluble protein extracts were prepared from 7-day-old in vitro grown seedlings essentially as described (40Dohmann E.M. Kuhnle C. Schwechheimer C. Plant Cell. 2005; 17: 1967-1978Crossref PubMed Scopus (80) Google Scholar). A 100-μl sample was loaded on a Superdex 200 HR 10/30 column (Amersham Biosciences) at 0.2 ml/min flow with extraction buffer. 0.7-ml fractions were sampled, precipitated with 10% trichloroacetic acid, and analyzed by SDS-PAGE. Column calibration was performed as described (43Noël L.D. Cagna G. Stuttmann J. Wirthmuller L. Betsuyaku S. Witte C.P. Bhat R. Pochon N. Colby T. Parker J.E. Plant Cell. 2007; 19: 4061-4076Crossref PubMed Scopus (167) Google Scholar). SDS-PAGE and Immunoblotting-Total soluble protein extracts were prepared from entire seedlings and separated by SDS-PAGE as described (48Witte C.P. Noël L.D. Gielbert J. Parker J.E. Romeis T. Plant Mol. Biol. 2004; 55: 135-147Crossref PubMed Scopus (155) Google Scholar). Immunoblots with the Strep-Tactin alkaline phosphatase conjugate (IBA GmbH, Göttingen, Germany) were performed as described (48Witte C.P. Noël L.D. Gielbert J. Parker J.E. Romeis T. Plant Mol. Biol. 2004; 55: 135-147Crossref PubMed Scopus (155) Google Scholar). The following antibodies were used: mouse anti-LexA (Santa Cruz Biotechnology), rabbit anti-CUL1 (11Shen W.H. Parmentier Y. Hellmann H. Lechner E. Dong A. Masson J. Granier F. Lepiniec L. Estelle M. Genschik P. Mol. Biol. Cell. 2002; 13: 1916-1928Crossref PubMed Scopus (140) Google Scholar), rabbit anti-CUL3A (5Dieterle M. Thomann A. Renou J.P. Parmentier Y. Cognat V. Lemonnier G. Muller R. Shen W.H. Kretsch T. Genschik P. Plant J. 2005; 41: 386-399Crossref PubMed Scopus (76) Google Scholar), rabbit anti-CUL4 (13Bernhardt A. Lechner E. Hano P. Schade V. Dieterle M. Anders M. Dubin M.J. Benvenuto G. Bowler C. Genschik P. Hellmann H. Plant J. 2006; 47: 591-603Crossref PubMed Scopus (111) Google Scholar), rabbit anti-CSN2 (25Serino G. Su H. Peng Z. Tsuge T. Wei N. Gu H. Deng X.W. Plant Cell. 2003; 15: 719-731Crossref PubMed Scopus (52) Google Scholar), rabbit anti-CSN5 (38Kwok S.F. Solano R. Tsuge T. Chamovitz D.A. Ecker J.R. Matsui M. Deng X.W. Plant Cell. 1998; 10: 1779-1790Crossref PubMed Scopus (145) Google Scholar), rabbit anti-CSN6 (49Peng Z. Serino G. Deng X.W. Development (Camb.). 2001; 128: 4277-4288PubMed Google Scholar), rabbit anti-HSC70 (SPA-795, Stressgen) (rat anti-HA, 1867423; Roche Applied Science), mouse antiubiquitin antibody (NB300-130; Novus Biologicals), mouse anti-c-Myc (Santa Cruz Biotechnology). Secondary antibodies were purchased from Sigma (alkaline phosphatase conjugates) and Santa Cruz Biotechnology (horseradish peroxidase conjugates). Alkaline phosphatase and horseradish peroxidase activity was detected with p-nitro blue tetrazolium and enhanced chemiluminescence (SuperSignal West Femto chemiluminescent substrate, Pierce), respectively. To quantify immunoblot results, membranes or films derived from three independent biological samples were scanned and analyzed with ImageJ software. Background values were measured above and below the specific signal and used for corrections. Measurements were repeated at least twice, and measurement errors were <5%. Average values and standard deviations for three biological replicates were calculated. Schizosaccharomyces pombe Experiments-A Gateway cloning cassette was introduced into pREP3X expression vector giving pREP3XG (details available upon request). The genomic sequence coding for SpCSN2 was amplified by PCR from yeast strain 501 (50Murray J.M. Doe C.L. Schenk P. Carr A.M. Lehmann A.R. Watts F.Z. Nucleic Acids Res. 1992; 20: 2673-2678Crossref PubMed Scopus (68) Google Scholar) and cloned into pENTR/D giving pE-SpCSN2. The csn2-5 mutation was introduced into pE-SpCSN2 by site-directed mutagenesis, giving pE-Spcsn2-5. Sequences coding for AtCSN2, SpCSN2, and Spcsn2-5 were recombined into pREP3XG. The resulting plasmids were transformed in strain pcu1-MYC csn2-d (28Mundt K.E. Liu C. Carr A.M. Mol. Biol. Cell. 2002; 13: 493-502Crossref PubMed Scopus (99) Google Scholar). For UV sensitivity tests, three parallel dilution series were prepared from overnight liquid cultures for each genotype. Dilutions plated on Petri dishes were given a single dose of UV-C (254 nm; 0–100 kJ/m2; without lid) using a Stratalinker 2400 (Stratagene, La Jolla, CA). Colony-forming units were determined in the appropriate dilutions after 4 days at 28 °C. Two independent experiments were performed. Total protein extracts were prepared under denaturing conditions as described (51Caspari T. Dahlen M. Kanter-Smoler G. Lindsay H.D. Hofmann K. Papadimitriou K. Sunnerhagen P. Carr A.M. Mol. Cell. Biol. 2000; 20: 1254-1262Crossref PubMed Scopus (207) Google Scholar). Structure Prediction of CSN2-One PSI-BLAST iteration of the A. thaliana CSN2 query sequence on the NCBI nr Database was performed and only sequences with identity higher than 30% were kept (52Altschul S.F. Madden T.L. Schaffer A.A. Zhang J. Zhang Z. Miller W. Lipman D.J. Nucleic Acids Res. 1997; 25: 3389-3402Crossref PubMed Scopus (59915) Google Scholar). A multiple sequence alignment was built from the 27 retrieved CSN2-like sequences using MUSCLE (53Edgar R.C. Nucleic Acids Res. 2004; 32: 1792-1797Crossref PubMed Scopus (30500) Google Scholar). Secondary structure predictions were performed using PsiPred on this alignment (54Jones D.T. J. Mol. Biol. 1999; 292: 195-202Crossref PubMed Scopus (4465) Google Scholar). HMM-HMM comparison using the HHpred server on the Protein Data Bank data base was used to search for structural templates suitable for comparative modeling (55Soding J. Bioinformatics (Oxf.). 2005; 21: 951-960Crossref PubMed Scopus (1864) Google Scholar). From the results, a structural model of CSN2 A. thaliana could be built from several templates detected with high confidence. Residues 40–321 matched, with highest probabilities, the HEAT repeat from the Danio rerio γ-SNAP (probability = 98.9%, E-value = 2.8e-09, sequence ID = 16%) and the Saccharomyces cerevisiae SEC17 (probability = 98.22%, E-value = 1.1e-05, sequence ID = 11%, Protein Data Bank codes 2ifu and 1qqe, respectively); residues 285–388 matched a region spanning the HAM (HEAT analogous motif) and the WH (winged helix) domain of the Homo sapiens eIF3k subunit (probability = 95.02%, E-value = 0.13, sequence ID = 10%, Protein Data Bank code 1rz4); residues 348 -417 matched the WH C-terminal domain of the Mus musculus CSN4 COP9 subunit (probability = 98.88%, E-value = 1.4e-11, sequence ID = 21%, Protein Data Bank code 1ufm). The four templates were combined into a single alignment together with the A. thaliana CSN2 sequence. The alignment was optimized locally by hand so

Article8 February 2011free access The conserved factor DE-ETIOLATED 1 cooperates with CUL4–DDB1DDB2 to maintain genome integrity upon UV stress Enric Castells Enric Castells Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, FrancePresent address: Department of Plant Molecular Genetics, Centre for Research in Agricultural Genomics (CRAG, CSIC-IRTA-UAB), Barcelona, Spain Search for more papers by this author Jean Molinier Jean Molinier Institut de Biologie Moléculaire des Plantes du CNRS (UPR2357), Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Giovanna Benvenuto Giovanna Benvenuto Stazione Zoologica Anton Dohrn, Naples, Italy Search for more papers by this author Clara Bourbousse Clara Bourbousse Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Gerald Zabulon Gerald Zabulon Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Antoine Zalc Antoine Zalc Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Stefano Cazzaniga Stefano Cazzaniga Dipartimento di Biotecnologie, Università di Verona, Verona, Italy Search for more papers by this author Pascal Genschik Pascal Genschik Institut de Biologie Moléculaire des Plantes du CNRS (UPR2357), Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Fredy Barneche Corresponding Author Fredy Barneche Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Chris Bowler Chris Bowler Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Enric Castells Enric Castells Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, FrancePresent address: Department of Plant Molecular Genetics, Centre for Research in Agricultural Genomics (CRAG, CSIC-IRTA-UAB), Barcelona, Spain Search for more papers by this author Jean Molinier Jean Molinier Institut de Biologie Moléculaire des Plantes du CNRS (UPR2357), Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Giovanna Benvenuto Giovanna Benvenuto Stazione Zoologica Anton Dohrn, Naples, Italy Search for more papers by this author Clara Bourbousse Clara Bourbousse Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Gerald Zabulon Gerald Zabulon Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Antoine Zalc Antoine Zalc Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Stefano Cazzaniga Stefano Cazzaniga Dipartimento di Biotecnologie, Università di Verona, Verona, Italy Search for more papers by this author Pascal Genschik Pascal Genschik Institut de Biologie Moléculaire des Plantes du CNRS (UPR2357), Conventionné avec l'Université de Strasbourg, Strasbourg, France Search for more papers by this author Fredy Barneche Corresponding Author Fredy Barneche Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Chris Bowler Chris Bowler Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France Search for more papers by this author Author Information Enric Castells1,‡, Jean Molinier2,‡, Giovanna Benvenuto3, Clara Bourbousse1, Gerald Zabulon1, Antoine Zalc1, Stefano Cazzaniga4, Pascal Genschik2, Fredy Barneche 1 and Chris Bowler1 1Institut de Biologie de l'Ecole Normale Supérieure, Section de Génomique Environnementale et Evolutive, CNRS UMR 8197 INSERM U1021, Paris, France 2Institut de Biologie Moléculaire des Plantes du CNRS (UPR2357), Conventionné avec l'Université de Strasbourg, Strasbourg, France 3Stazione Zoologica Anton Dohrn, Naples, Italy 4Dipartimento di Biotecnologie, Università di Verona, Verona, Italy ‡These authors contributed equally to this work *Corresponding author. Institut de Biologie de l'Ecole Normale Supérieure (IBENS), Environmental and Evolutionary Genomics Section, CNRS UMR 8197 INSERM U1024, 46 rue d'Ulm, 75230 Paris Cedex 05, France. Tel.: +33 1 44 32 24; Fax: +33 1 44 32 39 35; E-mail: [email protected] The EMBO Journal (2011)30:1162-1172https://doi.org/10.1038/emboj.2011.20 Present address: Department of Plant Molecular Genetics, Centre for Research in Agricultural Genomics (CRAG, CSIC-IRTA-UAB), Barcelona, Spain PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Plants and many other eukaryotes can make use of two major pathways to cope with mutagenic effects of light, photoreactivation and nucleotide excision repair (NER). While photoreactivation allows direct repair by photolyase enzymes using light energy, NER requires a stepwise mechanism with several protein complexes acting at the levels of lesion detection, DNA incision and resynthesis. Here we investigated the involvement in NER of DE-ETIOLATED 1 (DET1), an evolutionarily conserved factor that associates with components of the ubiquitylation machinery in plants and mammals and acts as a negative repressor of light-driven photomorphogenic development in Arabidopsis. Evidence is provided that plant DET1 acts with CULLIN4-based ubiquitin E3 ligase, and that appropriate dosage of DET1 protein is necessary for efficient removal of UV photoproducts through the NER pathway. Moreover, DET1 is required for CULLIN4-dependent targeted degradation of the UV-lesion recognition factor DDB2. Finally, DET1 protein is degraded concomitantly with DDB2 upon UV irradiation in a CUL4-dependent mechanism. Altogether, these data suggest that DET1 and DDB2 cooperate during the excision repair process. Introduction Most organisms are exposed to the damaging effects of sunlight and need to repair UV-induced DNA lesions to maintain genome integrity. Among the repertoire of DNA repair pathways, plants and many other multicellular organisms can make use of two major mechanisms to remove UV-induced DNA photoproducts, photoreactivation and nucleotide excision repair (NER). Photoreactivation is a fast, efficient and error-free mechanism that involves specific cyclobutane pyrimidinone dimer (CPD)- and 6,4-photolyase enzymes to remove CPDs and pyrimidine (6,4) pyrimidinone dimers (6,4PPs), respectively, using the light energy from a photon in the UV-A/blue light range (Britt, 1999). This light-dependent repair mechanism allows direct conversion of pyrimidine dimers to monomers without a DNA excision step (reviewed in Sancar et al, 2004). The pathway is not found in placental mammals such as humans, and is supplemented in all eukaryotes by NER, a light-independent mechanism that allows removal of a wide spectrum of helix-distorting base lesions, including UV-induced CPDs and 6,4PPs (Svejstrup, 2002; Gillet and Scharer, 2006). NER entails a multistep process that involves ∼30 proteins for damage recognition, helix opening, dual incision of the 25–30 nt damaged strand, gap-filling DNA synthesis and ligation of the newly synthesized DNA (Wood et al, 2000). The damage detection step is differentially achieved depending on the location of the lesion and thereby leads to two sub-pathways. When located within transcribed regions UV-DNA lesions stall RNA polymerase II. This serves as a damage recognition signal by the Cockayne Syndrome type A or B (CSA or CSB) factors, thereby initiating transcription-coupled repair (TCR; Svejstrup, 2002; Fousteri and Mullenders, 2008). In non-transcribed regions, damage detection relies on the damaged DNA binding protein 2 (DDB2 protein; Wittschieben et al, 2005) and on the XPC–HR23B–CEN2 complex (Volker et al, 2001), which act as sensors to detect DNA conformational changes and initiate the global genome repair pathway (GGR; Hanawalt et al, 2003). Genetic deficiencies in the recognition factors CSA and DDB2 lead to hereditary diseases such as Cockayne syndrome (CS) and xeroderma pigmentosum (XP), which are marked by cutaneous hypersensitivity to sunlight exposure and high susceptibility to UV-induced skin cancer (reviewed in Shuck et al, 2008). Although acting in the two different TCR and GGR sub-pathways, CSA and DDB2 have been found to assemble within nearly identical complexes containing DDB1, CULLIN4 (CUL4) and regulator of cullin 1 (ROC1 or RBX1) to form typical cullin-RING ubiquitin E3 ligases (CRL) whose activity is regulated by the COP9 signalosome (CSN) (Groisman et al, 2003; Bernhardt et al, 2006; Chen et al, 2006). The current accepted model establishes that CUL4–DDB1 either directly docks substrates to the ubiquitylation machinery or acts indirectly by recruiting a third protein harbouring WD40-repeats with conserved WDxR motifs (such as DDB2), which is responsible for substrate specificity (Angers et al, 2006; He et al, 2006; Higa et al, 2006). This structure positions CUL4 as a modular protein that serves as a scaffold to assemble multiple CRL complexes (reviewed in Petroski and Deshaies, 2005), with several targets during NER. In humans, the DDB2 protein has strong affinity for bulky DNA lesions such as 6,4PPs and CPDs (Scrima et al, 2008). Upon UV irradiation, DDB2 dissociates from the CSN, detects and directly binds the DNA lesion where it recruits XPC by protein–protein interaction. Together with CUL4 neddylation, this contributes to activate the E3 ligase activity of a CUL4–DDB1 CRL that poly-ubiquitylates several targets such as XPC, various histones, as well as DDB2 and CUL4 themselves, triggering different protein fates. While poly-ubiquitylation induces DDB2 proteolytic degradation and triggers histone release from nucleosomes, it also facilitates the DNA-binding activity of XPC. Because DDB2 exhibits a high affinity for DNA photoproducts, its proteolysis potentiates its displacement by XPC and other downstream GG-NER factors (Chen et al, 2001; Nag et al, 2001; Rapic-Otrin et al, 2002; Sugasawa et al, 2005; El-Mahdy et al, 2006; Kapetanaki et al, 2006; Wang et al, 2006; Guerrero-Santoro et al, 2008). In this process, DDB2 is therefore the target of a CUL4–DDB1-containing ubiquitin ligase for proteasome-mediated degradation. Although these mechanisms have been poorly studied in plants, it was recently shown that the roles of CUL4–DDB1DDB2 and CUL4–DDB1CSA E3 ligases in NER are conserved in Arabidopsis thaliana and interconnect to the highly efficient light-dependent photoreactivation system as well as with the checkpoint kinase ataxia telangiectasia and Rad3-related (ATR) factor (Molinier et al, 2008; Biedermann and Hellmann, 2010; Zhang et al, 2010). These observations are of interest in light of other studies that have revealed the role of CUL4–DDB1 E3 ligases in plant development and in particular in the control of photomorphogenesis (reviewed in Jackson and Xiong, 2009). More specifically, intensive efforts in Arabidopsis have revealed the existence of several CUL4–DDB1-containing CRLs that contribute to repress light-responsive genes in darkness by associating with negative regulators such as COnstitutive-Photomorphogenic 1 (COP1) and suppressor of phytochrome A (SPA) (Chen et al, 2010), as well as with the CDD complex in both darkness and under light conditions (Bernhardt et al, 2006; Chen et al, 2006). The Arabidopsis CDD complex comprises DDB1A, De-Etiolated 1 (DET1) and COP10, a plant-specific ubiquitin-conjugating E2 variant (Schroeder et al, 2002; Yanagawa et al, 2004; Lau and Deng, 2009). This ∼350 kDa complex can associate with the CSN and COP1 complexes, and the three factors act together to control specific steps of plant development (Yanagawa et al, 2004). The role of COP1 and DET1 in the inhibition of photomorphogenesis in darkness has been proposed to mainly rely on ubiquitin-mediated proteolytic degradation of target factors such as the bZIP factor LONG HYPOCOTYL5 (HY5) (Chory, 1992; Osterlund et al, 2000). After its discovery through genetic screens for plants affected in etiolated development (Chory et al, 1989; Pepper et al, 1994), DET1 was shown to be conserved in humans and also to associate with COP1 and a CUL4–DDB1 E3 ligase to target c-jun for degradation (Wertz et al, 2004; Pick et al, 2007). Recent analyses of mutants in Arabidopsis COP1, DET1 and CSN subunits revealed that these photomorphogenic mutants display elevated levels of single- and/or double-strand DNA breaks, as evidenced in situ using a TUNEL assay (Dohmann et al, 2008). By contrast, we have recently observed that the det1-1 mutant exhibits hyposensitivity to UV-C irradiation that mainly relies on two cooperative effects directly linked to its photomorphogenic phenotype: (i) UV-induced DNA damage is reduced as a consequence of the overaccumulation of UV-absorbing compounds acting as ‘sunscreens’ and (ii) photoreactivation is enhanced due to the strong overexpression of the two photolyase genes (Castells et al, 2010). To better assess this apparent discrepancy, we investigated the potential impact of DET1 on DNA damage responses in light-independent repair mechanisms. We present evidence that appropriate dosage of the DET1 protein is necessary for efficient removal of UV-induced DNA lesions through the GGR pathway, and that DET1 is required for CUL4–DDB1-mediated proteolytic degradation of DDB2. We further show that DET1 is degraded upon UV irradiation in a CUL4-dependent manner, leading us to propose that DET1 and DDB2 cooperate during the DNA excision repair process. RESULTS DET1 protein dosage influences UV-C sensitivity Arabidopsis plants bearing null mutations in the DET1 gene are lethal at early stages of embryo or seedling development (Misera et al, 1994) and therefore cannot be tested for UV sensitivity. Nevertheless, most individuals bearing the hypomorphic det1-1 allele can survive, and display a constitutive photomorphogenic phenotype (Pepper et al, 1994). We produced Arabidopsis transgenic lines overexpressing myc-tagged DET1 protein (DET1 OE-1, OE-2 and OE-3 lines) and used them together with the det1-1 mutant to better determine how DET1 protein dosage affects UV-C sensitivity. As estimated using an antibody for the MYC-epitope tag (Figure 1A) and a rabbit antiserum raised against the full-length Arabidopsis DET1 protein (Supplementary Figure S1), the abundance of the mycDET1 protein ranges from endogenous DET1 levels in the OE-1 line to about 10-fold in DET1 OE-3. The mycDET1 fusion protein is functional since it can efficiently rescue the pale and dwarf phenotype of det1-1 mutant seedlings and partially complement its skotomorphogenic phenotype by restoring normal hypocotyl elongation in darkness (Supplementary Figure S2). Figure 1.DET1 dosage influences UV-C sensitivity upon recovery in both light and dark conditions. (A) mycDET1 overexpression in DET1 OE transgenic lines. Equal amounts of whole protein extracts from epitope-tagged mycDET1 lines OE-1, OE-2 and OE-3 were loaded on a 10% SDS–PAGE and analysed by immunoblot using an anti-myc antibody. The same blot was analysed with an anti-tubulin antibody as loading control. (B, C) Root growth inhibition upon UV-C exposure. Four-day-old seedlings with the indicated genotypes were exposed to UV-C (600 J/m2) and immediately returned to normal light conditions (B) or to complete darkness (C). Relative root growth was determined 24 h after irradiation by comparison with the respective non-irradiated control of the same genotype (100% root growth). Error bars represent standard deviations from three replicate experiments (n>20). Asterisks indicate t-test significant differences at P⩽0.05 relative to wild-type control at same dose. Download figure Download PowerPoint To test sensitivity of these genotypes to UV, 3-day-old seedlings were first exposed to a single dose of UV-C irradiation and kept 24 h under normal light conditions for recovery before determining relative primary root growth inhibition. A mutant deficient for the two photolyase genes UVR3 and PHRI as well as the cul4-1 mutant were used as controls for photoreactivation and GGR defects, respectively. By contrast to the effect of DET1 knock-down, the two strong DET1 overexpressing lines were significantly more UV sensitive than wild-type seedlings (Figure 1B). Although they do not reach the high level of sensitivity of the uvr3phrI photolyase double mutant, in agreement with the major role played by photoreactivation in the removal of UV-DNA photoproducts under light conditions, the sensitivity of DET1 OE-2 and OE-3 lines is comparable to the effect of the cul4-1 mutation. The ddb1a-2 and ddb2-2 mutants are slightly less affected, as previously observed (Molinier et al, 2008), and no significant defect is observed in a ddb1b-2 mutant, a knockout for the second orthologue of DDB1 in Arabidopsis. These data indicate that DET1 dosage influences UV-C sensitivity following recovery under light conditions. Because this effect might be explained by repression of photolyase gene expression as a consequence of DET1 overexpression, we examined mRNA levels of UVR3 and PHRI by RT–qPCR in DET1 OE seedlings. In contrast to their overexpression in det1-1, no significant difference with wild-type seedlings was observed in the three DET1 OE lines (Supplementary Figure S3A). The alternative possibility that UV-absorbing compounds such as flavonoids are decreased in DET1 OE lines was also tested and shown not to be the case (Supplementary Figure S3B). We conclude from these data that disturbing DET1 cellular content affects DNA repair at a level other than sunscreen effect or photoreactivation. To avoid the confounding effect of photoreactivation and to better assess the possible implication of NER, we tested UV-C sensitivity following recovery in darkness. Under these conditions, the cul4-1, ddb1a-2 and ddb2-2 mutants defective in GGR are significantly more sensitive than wild type, while the uvr3phrI photolyase mutant is not (Figure 1C). In both light and dark conditions, cul4-1, ddb1a-2 but not ddb1b-2 mutants are sensitive (Figure 1B and C), suggesting that DDB1A but not DDB1B is involved in NER. These two proteins share a high sequence similarity (Schroeder et al, 2002) and both can interact with DET1 (Supplementary Figure S4), indicating that the Arabidopsis CDD complex may contain one molecule either of DDB1A or DDB1B in addition to COP10. Like in light conditions, the strong DET1 OE lines exhibited significant UV-C sensitivity in darkness, at levels that correlate with DET1 overexpression levels (Figure 1C). Importantly, these experiments revealed that, following recovery in darkness, det1-1 mutant plants are more sensitive than the wild type, even though these plants display an enhanced level of UV-protecting compounds and are therefore significantly less damaged than wild type (Castells et al, 2010). Altogether, these data suggest that appropriate DET1 dosage may be necessary for an efficient light-independent DNA repair mechanism. DET1 is required for efficient DNA photoproduct removal through a light-independent pathway In order to determine whether UV-C hypersensitivity of the det1-1 mutant and of DET1 OE lines is related to a defect in DNA repair, we measured the removal efficiency of UV-induced DNA photoproducts in the different plant lines. The amount of photoproducts was quantified by immunodot-blot of genomic DNA using anti-6,4PP and anti-CPD antibodies. For each genotype, the remaining amount of CPDs and 6,4PPs was determined after 24 h in darkness and compared with the initial damage immediately after UV irradiation (Castells et al, 2010). This approach avoids biases due to reduced DNA damage in det1-1 mutant seedlings. As expected, upon recovery in darkness similar amounts of both CPDs and 6,4PPs remained in wild type and in the photoreactivation mutant uv3phrI (Figure 2A). Also, most of the DNA photoproducts persisted 24 h after irradiation in the cul4-1 mutant that is impaired in GGR (92 and 96% of CPDs and 6,4PPs remaining, respectively). Removal of photoproducts was also significantly impaired in the det1-1 mutant and was abolished in the strong DET1 OE line (∼100% remaining). Altogether, these data confirm that DET1 dosage can affect the efficient removal of UV-induced DNA photoproducts through a light-independent DNA repair pathway. Figure 2.DET1 is required for synthesis-dependent repair of UV-induced DNA lesions. (A) Modulation of DET1 level affects the removal of 6,4PP and CPD photoproducts by light-independent DNA repair. Fourteen-day-old wild-type (Col-0), uvr3phrI, cul4-1, det1-1 and DET1 OE-3 seedlings were irradiated with UV-C (1000 J/m2) and harvested immediately after irradiation or allowed to repair for 24 h in darkness. Serial dilutions of genomic DNA were subjected to immunodot-blot analysis using anti-CPD (white bars) or anti-6,4PP (black bars) antibodies, respectively, and normalized relative to 5-methylcytosine content. For each genotype, the percent of CPDs and 6,4PPs remaining after 24 h was calculated relative to the initial level immediately after UV irradiation. Error bars represent standard deviations from three independent experiments. Asterisks indicate t-test significant differences at P⩽0.05 relative to wild-type controls at the same dose. (B) Arabidopsis DET1-defective plants are impaired in synthesis-dependent repair of UV-induced DNA lesions in vitro. Cell extracts from wild-type and det1-1 mutant plants were incubated for 0, 1 or 2 h with UV-C damaged (+UV) and undamaged control plasmid (−UV) in the presence of DIG-dUTP to monitor synthesis-dependent DNA repair efficiency. Download figure Download PowerPoint DET1-defective plants are impaired in synthesis-dependent repair of UV-induced DNA lesions In order to further characterize the role of DET1 in light-independent DNA repair, we tested the capacity of the det1-1 mutant to perform synthesis-dependent repair of UV-induced DNA lesions using an in vitro DNA repair assay. This assay evaluates the efficiency of DIG-dUTP incorporation by plant extracts in a UV-C damaged plasmid, reflecting the ability to perform efficient NER (Li et al, 2002). Figure 2B shows that nuclear extracts of det1-1 plants were less efficient than wild type in incorporating DIG-dUTP, following 1 or 2 h of incubation. This observation indicates that UV-C hypersensitivity of det1-1 mutant plants correlates with a defect in the excision repair process, as previously shown for cul4-1 and ddb2-2 mutants (Molinier et al, 2008). As DET1 knock-down and overexpressing plants both exhibit impaired removal of UV-DNA photoproducts and enhanced UV-C sensitivity, the DET1 OE-3 line was further tested using the same assay. This line also displayed a defect in synthesis-dependent DNA repair (Supplementary Figure S5), further indicating that DET1 dosage is critical for efficient NER. These observations suggest that DET1 may have a direct function in the GGR repair process together with its known partners CUL4 and DDB1A. Epistatic interaction of det1-1 and rad10 mutations To further understand the positioning of DET1 in light-independent DNA repair pathways, we introgressed the det1-1 allele in a mutant for RAD10 (Molinier et al, 2008), which encodes an endonuclease that excises bulky DNA lesions as part of the NER process. UV-C sensitivity of the det1-1rad10 double mutant was determined by root growth assay upon recovery in light or darkness. As expected, under light conditions the det1-1 single mutant exhibited a clear UV-C hyposensitivity with a dominant effect over the secondary mutation observed in the det1-1rad10 double mutant (Figure 3A). This is consistent with increased UV-protecting compounds and exacerbated photoreactivation in det1-1 (Castells et al, 2010). Conversely, upon recovery in darkness the det1-1rad10 double mutant was significantly more sensitive than wild type, with a reduction of relative root growth that is similar to the det1-1 and rad10 single mutants and to the DET1 overexpressing line (Figure 3B). These data indicate that the det1-1 mutation is epistatic to rad10, and are consistent with DET1 being involved in the same UV-DNA repair pathway as the RAD10 endonuclease. We further tested whether the det1-1 mutant was affected in other repair pathways by assessing its sensitivity to cisplatin, an agent that produces DNA inter-crosslinks. By contrast to ddb2-2, we observed that det1-1 plants do not exhibit hypersensitivity to this genotoxic agent (Supplementary Figure S6), suggesting that DET1 may act more specifically in UV-DNA damage repair. Surprisingly, the DET1 OE-3 overexpressing line was found to be sensitive, which we can explain only through possible indirect effects. Finally, like the ddb2-2 mutant, we observed that det1-1 mutation does not increase sensitivity to hydrogen peroxide, in agreement with the fact that H2O2-induced DNA lesions are not predominantly repaired by the NER pathway (data not shown). Figure 3.Genetic interactions between det1-1 and rad10 and their effect on UV-C sensitivity. (A, B) Root growth inhibition upon UV-C exposure. Four-day-old seedlings with the indicated genotypes were exposed to UV-C (600 J/m2) and immediately returned to normal light conditions (A) or to complete darkness (B) for 24 h. Relative root growth was determined 24 h after irradiation by comparison with the respective non-irradiated control of the same genotype (100% root growth). Error bars represent standard deviations from three replicate experiments (n>20). Asterisks indicate t-test significant differences at P⩽0.05 relative to wild-type controls at the same dose, while plus signs (+) indicate no significant difference with respect to the det1-1 mutant. Download figure Download PowerPoint CUL4-dependent DET1 protein degradation upon UV-C irradiation In order to determine whether DET1 acts together with CUL4 in the GGR pathway, we first tested the genetic interaction between DET1 and CUL4 genes in UV sensitivity. Following recovery in darkness, det1-1cul4-1 double mutants displayed a UV-induced root growth reduction similar to det1-1 and cul4-1 single mutants (Figure 4A), consistent with an epistatic interaction between the two alleles and implying that DET1 and CUL4 act in the same DNA repair pathway. Figure 4.CUL4 interconnects with DET1 and triggers DET1 protein degradation upon UV-C exposure. (A) CUL4 and DET1 mutations are epistatic for UV-C sensitivity. Seedlings with the indicated genotypes were exposed to UV-C (600 J/m2) and immediately placed in complete darkness. Relative root growth was determined 24 h after irradiation by comparison with respective non-irradiated controls of the same genotype (100% root growth). Error bars represent standard deviations from three replicate experiments (n>20). Asterisks indicate t-test significant differences at P⩽0.05 relative to wild-type controls at the same dose. (B) Immunoblot analysis of endogenous DET1 content before (0) or 15, 60 and 120 min after UV-C exposure (3000 J/m2) in wild-type and cul4-1 seedlings. Coomassie blue staining (lower panels) is shown as loading controls. Asterisks indicate cross-reacting bands. (C) Analysis of DET1 expression upon UV-C exposure. Quantitative RT–PCR analysis was used to monitor DET1 mRNA levels in 10-day-old wild-type seedlings (Col-0) harvested at the indicated times after UV-C exposure (900 J/m2). Error bars indicate standard deviations from two biological replicates. (D) Immunoblot analysis of mycDET1 protein content before (0) or 30 and 60 min after UV-C exposure (3000 J/m2). Equal amounts of whole protein extracts were loaded on a 10% SDS–PAGE and analysed by immunoblot using anti-DET1 antibody. The same blot was probed with anti-RbCL antibody as a loading control. Download figure Download PowerPoint Considering that CUL4–DDB1DDB2 ubiquitylates and triggers the proteolytic degradation of several proteins in the NER process, including CUL4 and DDB2 themselves, we questioned whether DET1 stability was affected following UV irradiation. The DET1 antibody was therefore used to analyse endogenous DET1 protein levels upon UV-C exposure. To this end, seedlings were immediately kept in darkness after UV-C irradiation and total proteins were extracted after 15, 60 or 120 min for immunoblot analysis. Interestingly, in wild-type plants DET1 steady-state levels rapidly decreased after UV-C treatment and the protein was barely detectable after 2 h (Figure 4B). Because this reduction in DET1 content wa

One of the predominant cell-cycle programs found in mature tissues is endoreplication, also known as endoreduplication, that leads to cellular polyploidy. A key question for the understanding of endoreplication cycles is how oscillating levels of cyclin-dependent kinase activity are generated that control repeated rounds of DNA replication. The APC/C performs a pivotal function in the mitotic cell cycle by promoting anaphase and paving the road for a new round of DNA replication. However, using marker lines and plants in which APC/C components are knocked down, we show here that outgrowing and endoreplicating Arabidopsis leaf hairs display no or very little APC/C activity. Instead we find that RBX1-containing Cullin-RING E3 ubiquitin-Ligases (CRLs) are of central importance for the progression through endoreplication cycles; in particular, we have identified CULLIN4 as a major regulator of endoreplication in Arabidopsis trichomes. We have incorporated our findings into a bio-mathematical simulation presenting a robust two-step model of endoreplication control with one type of cyclin-dependent kinase inhibitor function for entry and a CRL-dependent oscillation of cyclin-dependent kinase activity via degradation of a second type of CDK inhibitor during endoreplication cycles.

Plant growth control has become a major focus due to economic reasons and results from a balance of cell proliferation in meristems and cell elongation that occurs during differentiation. Research on plant cell proliferation over the last two decades has revealed that the basic cell-cycle machinery is conserved between human and plants, although specificities exist. While many regulatory circuits control each step of the cell cycle, the ubiquitin proteasome system (UPS) appears in fungi and metazoans as a major player. In particular, the UPS promotes irreversible proteolysis of a set of regulatory proteins absolutely required for cell-cycle phase transitions. Not unexpectedly, work over the last decade has brought the UPS to the forefront of plant cell-cycle research. In this review, we will summarize our knowledge of the function of the UPS in the mitotic cycle and in endoreduplication, and also in meiosis in higher plants.

The plant cell cycle is tightly regulated by factors that integrate endogenous cues and environmental signals to adapt plant growth to changing conditions. Under drought, cell division in young leaves is blocked by an active mechanism, reducing the evaporative surface and conserving energy resources. The molecular function of cyclin-dependent kinase-inhibitory proteins (CKIs) in regulating the cell cycle has already been well studied, but little is known about their involvement in cell cycle regulation under adverse growth conditions. In this study, we show that the transcript of the CKI gene SIAMESE-RELATED1 (SMR1) is quickly induced under moderate drought in young Arabidopsis (Arabidopsis thaliana) leaves. Functional characterization further revealed that SMR1 inhibits cell division and affects meristem activity, thereby restricting the growth of leaves and roots. Moreover, we demonstrate that SMR1 is a short-lived protein that is degraded by the 26S proteasome after being ubiquitinated by a Cullin-RING E3 ubiquitin ligase. Consequently, overexpression of a more stable variant of the SMR1 protein leads to a much stronger phenotype than overexpression of the native SMR1. Under moderate drought, both the SMR1 transcript and SMR1 protein accumulate. Despite this induction, smr1 mutants do not show overall tolerance to drought stress but do show less growth inhibition of young leaves under drought. Surprisingly, the growth-repressive hormone ethylene promotes SMR1 induction, but the classical drought hormone abscisic acid does not.

Article15 May 1997free access The human RNA 3′-terminal phosphate cyclase is a member of a new family of proteins conserved in Eucarya, Bacteria and Archaea Pascal Genschik Pascal Genschik Institut de Biologie Moléculaire des Plantes du CNRS, 12 rue du Général Zimmer, 67084 Strasbourg, France Search for more papers by this author Eric Billy Eric Billy Friedrich Miescher-Institut, PO Box 2543, 4002 Basel, Switzerland Search for more papers by this author Michal Swianiewicz Michal Swianiewicz Friedrich Miescher-Institut, PO Box 2543, 4002 Basel, Switzerland Search for more papers by this author Witold Filipowicz Corresponding Author Witold Filipowicz Friedrich Miescher-Institut, PO Box 2543, 4002 Basel, Switzerland Search for more papers by this author Pascal Genschik Pascal Genschik Institut de Biologie Moléculaire des Plantes du CNRS, 12 rue du Général Zimmer, 67084 Strasbourg, France Search for more papers by this author Eric Billy Eric Billy Friedrich Miescher-Institut, PO Box 2543, 4002 Basel, Switzerland Search for more papers by this author Michal Swianiewicz Michal Swianiewicz Friedrich Miescher-Institut, PO Box 2543, 4002 Basel, Switzerland Search for more papers by this author Witold Filipowicz Corresponding Author Witold Filipowicz Friedrich Miescher-Institut, PO Box 2543, 4002 Basel, Switzerland Search for more papers by this author Author Information Pascal Genschik2, Eric Billy1, Michal Swianiewicz1 and Witold Filipowicz 1 1Friedrich Miescher-Institut, PO Box 2543, 4002 Basel, Switzerland 2Institut de Biologie Moléculaire des Plantes du CNRS, 12 rue du Général Zimmer, 67084 Strasbourg, France The EMBO Journal (1997)16:2955-2967https://doi.org/10.1093/emboj/16.10.2955 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info RNA 3′-terminal phosphate cyclase catalyses the ATP-dependent conversion of the 3′-phosphate to a 2′,3′-cyclic phosphodiester at the end of RNA. The physiological function of the cyclase is not known, but the enzyme could be involved in the maintenance of cyclic ends in tRNA splicing intermediates or in the cyclization of the 3′ end of U6 snRNA. In this work, we describe cloning of the human cyclase cDNA. The purified bacterially overexpressed protein underwent adenylylation in the presence of [α-32P]ATP and catalysed cyclization of the 3′-terminal phosphate in different RNA substrates, consistent with previous findings. Comparison of oligoribonucleotides and oligodeoxyribonucleotides of identical sequence demonstrated that the latter are ∼500-fold poorer substrates for the enzyme. In Northern analysis, the cyclase was expressed in all analysed mammalian tissues and cell lines. Indirect immunofluorescence, performed with different transfected mammalian cell lines, showed that this protein is nuclear, with a diffuse nucleoplasmic localization. The sequence of the human cyclase has no apparent motifs in common with any proteins of known function. However, inspection of the databases identified proteins showing strong similarity to the enzyme, originating from as evolutionarily distant organisms as yeast, plants, the bacterium Escherichia coli and the archaeon Methanococcus jannaschii. The overexpressed E.coli protein has cyclase activity similar to that of the human enzyme. The conservation of the RNA 3′-terminal phosphate cyclase among Eucarya, Bacteria and Archaea argues that the enzyme performs an important function in RNA metabolism. Introduction RNA 3′-terminal phosphate cyclase, an enzyme that catalyses conversion of a 3′-phosphate group to the 2′,3′-cyclic phosphodiester at the 3′ end of RNA, has been identified in extracts of HeLa cells and Xenopus nuclei (Filipowicz and Shatkin, 1983; Filipowicz et al., 1983). The HeLa cell cyclase has been purified and its mechanism of action studied (Filipowicz et al., 1985; Reinberg et al., 1985; Vicente and Filipowicz, 1988; reviewed by Filipowicz and Vicente, 1990). The cyclization of the 3′-terminal phosphate, catalysed by the enzyme, occurs in three steps: (i) Enzyme + ATP→Enzyme−AMP + PPi (ii) RNA-N3′p + Enzyme−AMP→RNA-N3′pp5′A + Enzyme (iii) RNA-N3′pp5′A→RNA-N>p + AMP Support for step (i) comes from identification of the covalent cyclase–AMP complex and the ability of 3′-phosphorylated RNA but not the 3′-OH-terminated RNA to release AMP from the preformed cyclase–AMP complex (Filipowicz et al., 1985, Reinberg et al., 1985, Vicente and Filipowicz, 1988). Step (ii) is inferred from experiments demonstrating accumulation of the RNA-N3′pp5′A molecules when the ribose at the RNA 3′-terminus is replaced with the 2′-deoxy- or 2′-O-methylribose (Filipowicz et al., 1985). Reaction (iii) probably occurs non-enzymatically as the result of nucleophilic attack by the adjacent 2′-OH on the phosphorus in the phosphodiester linkage. The biological role of the cyclase remains unknown, but the enzyme likely functions in some aspects of cellular RNA processing. The anabolic function of the 2′,3′-cyclic phosphate in RNA first emerged when it was found that eukaryotic RNA ligases require 2′,3′-cyclic ends for RNA ligation (Konarska et al., 1981, 1982; Filipowicz and Shatkin, 1983; Filipowicz et al., 1983; Furneaux et al., 1983; Greer et al., 1983a; Schwartz et al., 1983; Perkins et al., 1985; Pick et al., 1986; reviewed by Filipowicz and Gross, 1984; Westaway and Abelson, 1995). This requirement applies to both the non-organellar RNA ligases characterized to date, one of which ligates RNA ends via the unusual 3′,5′-phosphodiester, 2′-phosphomonoester linkage, while the other joins the ends via the regular 3′,5′-phosphodiester (reviewed by Filipowicz and Gross, 1984; Phizicky and Greer, 1993; Westaway and Abelson, 1995). The involvement of the two RNA ligases in nuclear pre-tRNA splicing is well documented (Filipowicz et al., 1983; Gegenheimer et al., 1983; Greer et al., 1983a; Laski et al., 1983; Stange and Beier, 1987; Zillmann et al., 1991; Phizicky et al., 1992) but these enzymes might also function in the ligation of other natural RNA molecules such as virusoids and viroids (Branch et al., 1982; Kikuchi et al., 1982; Kiberstis et al., 1985). This possibility is supported by the observation that, while yeast RNA ligase shows a strong preference for tRNA halves (Greer et al., 1983a; Phizicky et al., 1986), plant and mammalian RNA ligases also efficiently ligate artificial non-tRNA substrates (Konarska et al., 1981, 1982; Filipowicz et al., 1983; Furneaux et al., 1983; Schwartz et al., 1983; Perkins et al., 1985; Pick et al., 1986). Although the splicing endonucleases directly generate 5′-tRNA halves carrying 2′,3′-cyclic phosphate, during tRNA splicing reactions (Peebles et al., 1983; Gandini-Attardi et al., 1985; Stange and Beier, 1987; Rauhut et al., 1990), it is possible that other putative substrates depend upon the action of RNA 3′-terminal phosphate cyclase to form the cyclic phosphodiester ends. It is of interest, that the only cellular RNA ligase identified to date in bacteria also requires 2′,3′-cyclic ends for ligation (Greer et al., 1983b; Arn and Abelson, 1996). Another finding uncovering the potential role of the 2′,3′-cyclic phosphate in RNA metabolism was the demonstration that the U6 spliceosomal snRNA in species as diverse as humans, fruit fly and soybean has a cyclic 2′,3′-phosphodiester at the 3′-terminus. The mechanism and enzymes responsible for this modification are not known, but RNA 3′-phosphate cyclase is one obvious candidate (Lund and Dahlberg, 1992). With the long-term aim of determining the function of the cyclase in cellular RNA metabolism we have cloned the cDNA encoding the human cyclase. We have analysed the expression pattern and subcellular localization of the enzyme in mammalian cells. Furthermore, we report that proteins showing strong similarity to the human cyclase are not only present in eukaryotes, but also in Bacteria and Archaea. We show that the bacterially overexpressed Escherichia coli protein has RNA 3′-phosphate cyclase activity similar to that of the human enzyme. Results Cloning of the human cyclase cDNA The cyclase was purified from HeLa cells by a modification of the procedure described previously (Filipowicz and Vicente, 1990; see Materials and methods). Purified protein was subjected to tryptic digestion and four peptides were microsequenced. Different combinations of degenerate oligodeoxyribonucleotide primers were used in order to clone, using a PCR approach, a cDNA encoding the enzyme. One amplified 668 bp DNA fragment contained an ORF encoding the peptides pep2 and pep3 (Figure 1) not used for the design of PCR primers. This partial cDNA was used as a probe to screen a HeLa λgt11 cDNA library. Out of 1×106 recombinant phages, eight positive clones were isolated. Their inserts were analysed by restriction mapping and sequencing of the ends. The longest cDNA obtained from this screening [1349 nt, not including the poly(A) tail] extended to position 191 (Figure 1). The upstream coding and non-coding sequence of the clone was obtained by: (i) characterizing additional PCR-generated clones using the λgt11 library DNA as a template; (ii) sequencing the human CpG island genomic clone (DDBJ/EMBL/GenBank accession number Z57130; Cross et al., 1994) corresponding to the upstream region of the cyclase gene; and (iii) identifying an EST clone (Z42277) representing the upstream portion of the cDNA (see Materials and methods). Figure 1.The nucleotide and deduced amino acid sequences of the human cDNA encoding RNA 3′-terminal phosphate cyclase. The short (5-amino-acid) ORF in the 5′ leader region is underlined. Termination codons in the leader sequence are overlined. The putative polyadenylation signal is double underlined. Amino acid sequences of the sequenced peptides (pep1, pep2, pep3 and pep4) are shaded. It has not been directly established that position 1 indeed represents the start of transcription. Download figure Download PowerPoint Conceptual translation of the cDNA predicted a 39.4 kDa protein of 366 amino acids with an isoelectric point of 7.8. All the microsequenced peptides are present in the deduced protein (Figure 1). The sequence surrounding the initiation codon (TCCCCCATGG) is similar to the consensus (GCCACCATGG) established for vertebrates mRNAs (Kozak, 1987). The 170-nt 5′-terminal leader sequence contains one additional ATG, present in a much less favourable context, CCAGGCATGA. Translation initiated at this ATG would terminate five codons downstream (Figure 1). Activity of the overexpressed human protein The coding region of the cDNA was subcloned into an inducible expression vector, pGEX-2T, to express the cyclase as a fusion protein with glutathione S-transferase at the N-terminus. The recombinant protein was overproduced in E.coli and purified using glutathione–Sepharose 4B resin (Figure 2A). The purified fusion protein, migrating at ∼60 kDa, still contains material with a lower molecular mass (∼30 kDa) which likely corresponds to polypeptides prematurely terminated at rare codons present in the region encoding the N-terminal portion of the cyclase (see Figure 2A and its legend). Figure 2.Purification and labelling with [α-32P]ATP of the overexpressed human cyclase. (A) Purified and overexpressed human cyclase (GST fusion, 1.8 μg; lane 2) analysed by SDS–PAGE and Coomassie blue staining. The ∼30 kDa material most probably corresponds to polypeptides prematurely terminated at rare codons present in the upstream part of the cyclase cDNA. Since cyclase expression levels in bacteria were very low, further purification of the protein was not attempted. Extracts prepared from mock-transfected E.coli cells did not yield either the ∼60 or ∼30 kDa bands upon fractionation on the glutathione–Sepharose 4B column (data not shown). (B) Labelling of the cyclase–GST fusion protein with [α-32P]ATP. A total of 20 ng of cyclase was incubated under assay conditions in the presence of [α-32P]ATP for 1 min (lane 1), 30 min (lane 2), 1 h (lane 3), 3 h (lane 4) or 6 h (lane 5) at 25°C. Products of the reaction were analysed by SDS–PAGE and autoradiography. Positions of protein size markers (in kDa) are indicated. Download figure Download PowerPoint Several lines of evidence indicated that the overexpressed fusion protein has RNA 3′-terminal phosphate cyclase activity. First, incubation with [α-32P]ATP resulted in the time-dependent labelling of the ∼60-kDa protein (Figure 2B), consistent with previous findings demonstrating formation of a covalent cyclase–AMP complex, an intermediate in the cyclization reaction (see Introduction). Second, two different oligoribonucleotides, CCCCACCCCG3′p* and AAAAUAAAAG3′p*, both radiolabelled at the 3′-terminal phosphate, were tested as cyclization substrates (Figure 3A). Incubation of either oligoribonucleotide with increasing amounts of the fusion protein resulted in formation of molecules with a 3′-terminal phosphate resistant to the action of calf intestine phosphatase (CIP), a property expected for 2′,3′-cyclic phosphodiester ends. The purine-rich and pyrimidine-rich substrates were modified with comparable efficiencies, in agreement with the previous findings that cyclase can utilize molecules with different sequences and base composition as substrates (Filipowicz et al., 1983; Reinberg et al., 1985; Filipowicz and Vicente, 1990). Third, it was found previously that, for the cyclase purified from HeLa cells, ATP is the best cofactor, but GTP, CTP and UTP (but not dATP) can also act as cofactors in the reaction, although much less efficiently (Vicente and Filipowicz, 1988). As shown in Figure 3B, the overexpressed protein has a similar nucleotide specificity. Fourth, TLC analysis was performed to demonstrate directly that incubation of AAAAUAAAAG3′p* with the overexpressed protein results in formation of the 2′,3′-cyclic phosphate at the terminus. Following incubation with either the recombinant cyclase or the enzyme purified from HeLa cells, the oligoribonucleotide was digested with nuclease P1. In both cases, the resulting product co-migrated with the pG>p marker (Figure 4A, lanes 4 and 6) while treatment of the unreacted substrate released Pi (lane 2). The presumptive pG>p* from a reaction similar to that shown in Figure 4A, lane 6 was isolated and characterized further. As expected, it was resistant to digestion with nuclease P1 (Figure 4B, lane 1) but was converted to G>p* (lane 2) and pG3′p* (lane 3) by treatment with CIP and RNase T2, respectively. Treatment with RNase T2 followed by nuclease P1 liberated Pi (Figure 4B, lane 4). Digestion of pG>p* with the 2′,3′-cyclic nucleotide 3′-phosphodiesterase from brain (CNPase) resulted in the formation of pG2′p* (lane 5) which, as expected, was resistant to treatment with nuclease P1 (lane 6). Presumptive pG>p* was also found to co-migrate with authentic pG>p during TLC in solvent B (data not shown). Furthermore, in another set of experiments, it was found that oligoribonucleotides containing p*Cp ligated at the 3′ end, Nnp*Cp, were converted into Nnp*C>p products upon incubation with the overexpressed protein (data not shown). All these results support the conclusion that the recombinant protein has RNA 3′-terminal phosphate cyclase activity. Figure 3.Cyclization of the 3′-terminal phosphate catalysed by the overexpressed human cyclase measured by the CIP/Norit assay. (A) Comparison of CCCCACCCCG3′p* and AAAAUAAAAG3′p* substrates. (B) Effect of different NTPs. Except when indicated otherwise, assays were performed as described in Materials and methods with 90 (A) and 50 (B) fmol of the substrate added per reaction. Amounts of added cyclase in (A) are as indicated. In (B), the assays contained 600 pg of cyclase and 0.2 mM NTPs. Download figure Download PowerPoint Figure 4.Analysis of the reaction products by TLC. Incubations with the cyclase were essentially as described in Materials and methods and contained 0.2 mM ATP, 60 fmol AAAAUAAAAG3′p* and either 50 ng of partially purified HeLa cell cyclase [the poly(A)–Sepharose fraction (Vicente and Filipowicz, 1988); panel A, lanes 3 and 4] or 40 ng of the overexpressed protein (panel A, lanes 5 and 6, and panel B). Incubations were for 20 min at 25°C. In (A) aliquots of the reactions were either applied to TLC without any additional treatment (lanes 1, 3 and 5) or were digested with nuclease P1 (lanes 2, 4 and 6). (B) Putative pG>p*, obtained by digestion of the reacted AAAAUAAAAG3′p* substrate with nuclease P1 and isolated by cellulose TLC in solvent B, was subjected to treatment with the following enzymes: none (lane 1); CIP (lane 2); RNase T2 (lane 3); RNase T2 followed by nuclease P1 (lane 4); CNPase (lane 5); CNPase followed by nuclease P1 (lane 6). Chromatography was in solvent A. Positions of nucleotide markers are indicated. Download figure Download PowerPoint Comparison of RNA and DNA molecules as substrates We have previously shown that oligoribonucleotides containing terminal 2′-deoxy- or 2′-O-methylribose can be converted, upon incubation with the cyclase and ATP, into products bearing the 3′-terminal structures dN3′pp5′A and Nm3′pp5′A, respectively (Filipowicz et al., 1985). These experiments led to the proposal that cyclization of the 3′-phosphate in RNA proceeds via formation of a terminal N3′pp5′A intermediate. However, these findings also raised the possibility that DNA molecules bearing a phosphate at the 3′-terminus might be physiological substrates for the enzyme. Two different assays were used to compare the ability of the 3′-phosphorylated oligoribonucleotide AAAAUAAAAG3′p, referred to as RNA3′p, and the oligodeoxyribonucleotide of equivalent sequence AAAATAAAAG3′p, referred to as DNA3′p, to act as substrates for the enzyme. Using a competition assay (Figure 5A), it was found that an ∼500-fold higher concentration of DNA3′p than RNA3′p (or another oligoribonucleotide, CCCCACCCCG3′p), is required to compete with the cyclization of the radiolabelled AAAAUAAAAG3′p* substrate. A mixture of 3′-phosphorylated oligodeoxyribonucleotides [(dN)npdN3′p, n = 8–14], obtained by a limited digestion of a synthetic 80-mer oligodeoxyribonucleotide with micrococcal nuclease was also a poor competitor in the reaction (Figure 5A). A 3′-hydroxyl-terminated oligodeoxyribonucleotide (DNA3′OH) did not compete with the cyclization of RNA3′p* even when added at 10 000-fold excess (Figure 5A), while a similar excess of RNA3′OH inhibited the reaction by ∼40%. This small degree of inhibition observed in the presence of a large excess of RNA3′OH is most probably due to the traces of hydrolysis of the oligoribonucleotide, resulting in the formation of fragments bearing the 3′-phosphate group. Figure 5.Activity of oligoribo- or oligodeoxyribonucleotides containing either 3′-p or 3′-OH termini in the competition (A) and AMP release (B) assays. (A) Cyclase assays were performed as described in Materials and methods. They contained 360 pg of the overexpressed cyclase, 40 fmol of AAAAUAAAAG3′p* and different unlabelled oligonucleotides, acting as substrates or competitors, at molar excess over AAAAUAAAAG3′p* as indicated. The 3′-OH-containing AAAATAAAAG (DNA3′OH) was obtained either by chemical synthesis (○) or by dephosphorylation of DNA3′p with CIP (⋄). (B) AMP release assays were performed as described in Materials and methods. Different amounts of substrates were added: none (lane N); 2 fmol (lane a); 22 fmol (lane b); 220 fmol (lane c); 2200 fmol (lane d); 20 pmol (lane e) and 200 pmol (lane f). Download figure Download PowerPoint In the second assay, the oligoribo- and oligodeoxyribonucleotides were compared for their ability to release AMP from the preformed adenylylated enzyme complex (Reinberg et al., 1985). The complex was formed by preincubation of the fusion protein with [α-32P]ATP. Incubations were then continued in the presence of increasing quantities of different oligonucleotides. Addition of 22 fmol RNA3′p decreased the amount of the complex by >95% (Figure 5B, lane b) while no complex was detected when 220 or 2200 fmol RNA3′p was added in the second incubation (Figure 5, lanes c and d). In contrast, incubation in the presence of 220 or 2200 fmol of either RNA3′OH, DNA3′p or DNA3′OH (lanes c and d) did not result in the release of the label from the preformed cyclase–AMP complex. In the presence of still higher amounts (20 and 200 pmol), DNA3′p but not DNA3′OH resulted in AMP release from the complex (Figure 5B, lanes e and f). In another set of experiments we have directly demonstrated that prolonged incubation of 3′-phosphorylated oligodeoxynucleotides in the presence of an excess of the cyclase generates low amounts of products bearing a dN3′pp5′A terminus (P.Genschik, W.Filipowicz and O.Vicente, unpublished results). Taken together, these results indicate that 3′-phosphorylated oligodeoxyribonucleotides are ∼500-fold poorer substrates for the cyclase than oligoribonucleotides. Intracellular localization of the cyclase The intracellular localization of the cyclase was determined by an epitope-tagging approach combined with indirect immunofluorescence. The coding region of the cyclase cDNA was cloned in the vector pBact-myc to express the enzyme containing a myc epitope fused in frame at the N-terminus. The plasmid expressing the tagged protein was transfected into HeLa cells, rat glioma C6 cells and mouse embryonal carcinoma P19 cells. As a control, HeLa cells were transfected with a plasmid expressing the splicing factor ASF/SF2 (Manley and Tacke, 1996) fused in frame to the same epitope. The cells were processed for immunofluorescence microscopy, using a mouse anti-myc monoclonal antibody and FITC-conjugated goat anti-mouse antibody (Figure 6). Images were analysed with the help of the confocal laser scanning microscope. Indirect immunofluorescence indicated that in HeLa and C6 cells, 98–99% of cyclase localizes to the nucleus and shows a diffuse distribution throughout the nucleoplasm with the protein being excluded from the nucleoli. The remaining 1–2% of fluorescence was seen in the cytoplasm (Figure 6, panels A–D; and the legend). The ratio of nuclear to cytoplasmic staining was independent of the amount of plasmid used for transfection or the time (24–48 h) at which cells were collected after transfection (data not shown). Assessment of the significance of the low cytoplasmic staining seen with the HeLa and C6 cells will require experiments with specific anti-cyclase antibodies. With the mouse P19 cells, the protein was found exclusively in the nucleoplasm and no cytoplasmic staining was observed (Figure 6, panel E). With all three cell lines, no signal was obtained in mock-transfected cells (data not shown) or in the non-transfected cells present in the same field as transfected cells (Figure 6, panels A–E). Likewise, no fluorescence was detectable when the anti-myc antibody was omitted (not shown). The diffuse nucleoplasmic staining seen in the cyclase cDNA-transfected cells was clearly different from the characteristic speckled staining observed with HeLa cells expressing the splicing factor ASF/SF2 (Figure 6, panel F; A.Krainer, personal communication). The monoclonal mouse antibody against the spliceosomal protein U2B′, followed by FITC-conjugated goat anti-mouse antibody, also yielded a speckled immunofluorescence pattern similar to that seen for ASF/SF2 (data not shown). Figure 6.Analysis of cyclase localization by indirect immuno- fluorescence in different cell lines. Cells were transfected with pBact-CYC-myc, encoding the myc-epitope-tagged cyclase (A–E) or with pMyc-ASF, expressing the myc-epitope-tagged splicing factor ASF/SF2 (F). The transfected cells were treated with the mouse anti-myc monoclonal antibody GE10 followed by the FITC-conjugated goat anti-mouse antibody. Slides were examined with a Zeiss Axiophot microscope and a Leica confocal scanning laser microscope. HeLa cells (A and B), C6 rat glioma cells (C and D) and mouse embryonal carcinoma P19 cells (E), expressing the myc-tagged cyclase. (F) HeLa cells expressing the myc-tagged ASF/SF2. Panels (B) and (D) represent higher intensity images of the fields shown in (A) and (C), respectively, in order to visualize low cytoplasmic staining. Similar overexposure of the fields shown in (E) and (F) did not reveal cytoplasmic fluorescence (not shown). For pBact-myc-transfected HeLa and C6 cells, the cytoplasmic fluorescence was calculated as 1.2% (average for eight cells) and 1.8% (average for five cells), respectively. Download figure Download PowerPoint Cyclase mRNA in different human tissues and cell lines Expression of mRNA encoding the cyclase was determined in various cell lines (Figure 7A) and different human tissues (Figure 7B) by Northern blot analysis. Cyclase is expressed ubiquitously. Two hybridizing RNA species, of ∼1.8 and 3 kb, were detected. The 1.8-kb mRNA corresponds in size to the cDNA characterized in this work; the identity of the longer RNA is unknown. The ratio between the two RNAs varies among tissues and cell lines. The 3-kb transcript is present at a relatively low level in Namalwa cells, HeLa cells, and in heart and placenta (between 21% and 30% of total transcripts as determined by PhosphorImager quantification). Among the tissues analysed, the highest cyclase mRNA level was observed in skeletal muscle. Figure 7.Levels of cyclase mRNA in different cell lines (A) and human tissues (B), as analysed by Northern blotting. (A) The following cell lines were used to isolate RNA: Namalwa (Burkitt lymphoma), lane 1; HeLa, lane 2; MCF7 (breast adenocarcinoma), lane 3; K562 (chronic myeloid leukaemia), lane 4; HUT78 and Jurkat (T-cell lymphomas), lanes 5 and 6, respectively; 293T (a transformed primary embryonic kidney line), lane 7. (B) RNA was isolated from the following tissues: heart (lane 1), brain (lane 2), placenta (lane 3), lung (lane 4), liver (lane 5), skeletal muscle (lane 6), kidney (lane 7) and pancreas (lane 8). Sizes of mRNAs (arrows) and markers are indicated. Download figure Download PowerPoint Cyclase is conserved from bacteria to humans The sequence of the cloned human cyclase was used for database searches. Several ORFs encoding proteins of unknown function, but sharing significant similarity with the cloned protein, were identified in different organisms. These organisms include Drosophila melanogaster, Caenorhabditis elegans, Schizosaccharomyces pombe, Saccharomyces cerevisiae, Toxoplasma gondii, the bacterium E.coli and the archaeon Methanococcus jannaschii. Moreover, we have identified EST clones encoding cyclase-like proteins in mouse, Arabidopsis thaliana and zebrafish, and also an EST encoding another cyclase-like protein in humans (see legend to Figure 8). The human EST clone has been sequenced and the deduced protein encoded by it, although not full length, is included in the alignment shown in Figure 8. The two human proteins, referred to in Figure 8 as Hs1 and Hs2 show 30% identity and 52% similarity. The identified mouse ESTs encode counterparts of each of the two human proteins (data not shown). The human cyclase characterized in this work and the other cyclase-like proteins listed in Figure 8 have no apparent structural features or motifs in common with proteins of known function deposited in various databases (see Discussion). Figure 8.Comparison of amino acid sequences of the cloned human cyclase (Hs1) and other cyclase-like proteins encoded by genes or cDNAs originating from different organisms. Hs2, partial human sequence deduced from the EST clone (DDBJ/EMBL/GenBank accession number D82436). This clone, kindly provided by Dr J.Takeda, Gunma University, Japan, was completely sequenced by us on both strands. Dm, partial sequence deduced from the genomic clone of D.melanogaster (X04754 and M15898) after removal of two putative introns (67 and 54 nt). Ce, sequence based on a genomic (cosmid) clone from C.elegans (U58758), after removal of two putative introns (each 47 nt); also supported by the EST clone T00099. Sp, sequence deduced from the S.pombe cosmid c12G12 (Z66568; Swissprot Q09870). Sc, protein deduced from the gene sequenced within the yeast S.cerevisiae genome project (Z74752). Ec, sequence deduced from the E.coli genomic fragment (U18997), following resequencing of the gene. Mj, sequence deduced from the sequenced genome of M.jannaschii (Bult et al., 1996). ESTs encoding cyclase-like proteins (not shown in the figure) were also identified in the following organisms: mouse (DDBJ/EMBL/GenBank accession numbers W80010 and AA007803, encoding the counterparts of Hs1 and Hs2, respectively), zebrafish (H56797), A.thaliana (Z34762 and Z34936) and T.gondii (N60808). Multiple sequence alignment was performed with the ClustalW 1.5 program (Thompson et al., 1994) using the complete multiple alignment protocol with default parameters. Alignment was improved manually. Identical amino acids and amino acids conserved in at least 50% of sequences are indicated by black and grey boxes, respectively. Download figure Download PowerPoint The overexpressed E.coli protein has cyclase activity The protein encoded by the E.coli gene having similarity with the human cyclase cDNA has been overexpressed in E.coli as a fusion protein with the 6×His tag at the C–terminus. The protein was purified using the Ni–NTA resin; its purity was >95% as judged after Coomassie blue staining of the gel (Figure 9A). Two oligoribonucleotides, CCCCACCCCG3′p* and AAAAUAAAAG3′p*, used for assaying activity of the human cycla

Recently in yeast and animal cells, one particular class of ubiquitin ligase (E3), called the SCF, was demonstrated to regulate diverse processes including cell cycle and development.In plants SCF-dependent proteolysis is also involved in different developmental and hormonal regulations.To further investigate the function of SCF, we characterized at the molecular level the Arabidopsis RING-H2 finger protein AtRbx1.We demonstrated that the plant gene is able to functionally complement a yeast knockout mutant strain and showed that AtRbx1 protein interacts physically with at least two members of the Arabidopsis cullin family (AtCul1 and AtCul4).AtRbx1 also associates with AtCul1 and the Arabidopsis SKP1-related proteins in planta, indicating that it is part of plant SCF complexes.AtRbx1 mRNAs accumulate in various tissues of the plant, but at higher levels in tissues containing actively dividing cells.Finally to study the function of the gene in planta, we either overexpressed AtRbx1 or reduced its expression by a dsRNA strategy.Down-regulation of AtRbx1 impaired seedling growth and development, indicating that the gene is essential in plants.Furthermore, the AtRbx1-silenced plants showed a reduced level of At-Cul1 protein, but accumulated higher level of cyclin D3.

Cullin (CUL)-dependent ubiquitin ligases form a class of structurally related multisubunit enzymes that control the rapid and selective degradation of important regulatory proteins involved in cell cycle progression and development, among others. The CUL3-BTB ligases belong to this class of enzymes and despite recent findings on their molecular composition, our knowledge on their functions and substrates remains still very limited. In contrast to budding and fission yeast, CUL3 is an essential gene in metazoans. The model plant Arabidopsis thaliana encodes two related CUL3 genes, called CUL3A and CUL3B. We recently reported that cul3a loss-of-function mutants are viable but exhibit a mild flowering and light sensitivity phenotype. We investigated the spatial and temporal expression of the two CUL3 genes in reproductive tissues and found that their expression patterns are largely overlapping suggesting possible functional redundancy. Thus, we investigated the consequences on plant development of combined Arabidopsis cul3a cul3b loss-of-function mutations. Homozygous cul3b mutant plants developed normally and were fully fertile. However, the disruption of both the CUL3A and CUL3B genes reduced gametophytic transmission and caused embryo lethality. The observed embryo abortion was found to be under maternal control. Arrest of embryogenesis occurred at multiple stages of embryo development, but predominantly at the heart stage. At the cytological level, CUL3 loss-of-function mutations affected both embryo pattern formation and endosperm development.

Obligate photoautotrophs such as plants must capture energy from sunlight and are therefore exposed to the damaging collateral effects of ultraviolet (UV) irradiation, especially on DNA. Here we investigated the interconnection between light signaling and DNA repair, two concomitant pathways during photomorphogenesis, the developmental transition associated with the first light exposure. It is shown that combination of an enhanced sunscreen effect and photoreactivation confers a greater level of tolerance to damaging UV-C doses in the constitutive photomorphogenic de-etiolated1-1 (det1--1) Arabidopsis mutant. In darkness, expression of the PHR1 and UVR3 photolyase genes, responsible for photoreactivation, is maintained at a basal level through the positive action of HY5 and HYH photomorphogenesis-promoting transcription factors and the repressive effects of DET1 and COP1. Upon light exposure, HY5 and HYH activate PHR1 gene expression while the constitutively expressed nuclear-localized DET1 protein exerts a strong inhibitory effect. Altogether, the data presented indicate a dual role for DET1 in controlling expression of light-responsive and DNA repair genes, and describe more precisely the contribution of photomorphogenic regulators in the control of light-dependent DNA repair.

In metazoans, autophagy is an essential component of host defense against viruses, orchestrating their degradation. Such antiviral functions for autophagy have also been long suspected in the green lineage. Two recent reports provide molecular insights on how plants selectively send viral proteins and even particles to the vacuole.

Regulated gene expression is key to the orchestrated progression of the cell cycle. Many genes are expressed at specific points in the cell cycle, including important cell cycle regulators, plus factors involved in signal transduction, hormonal regulation, and metabolic control. We demonstrate that post-embryonic depletion of Arabidopsis (Arabidopsis thaliana) ARGONAUTE1 (AGO1), the main effector of plant microRNAs (miRNAs), impairs cell division in the root meristem. We utilized the highly synchronizable tobacco (Nicotiana tabacum) Bright yellow 2 (BY2) cell suspension to analyze mRNA, small RNAs, and mRNA cleavage products of synchronized BY2 cells at S, G2, M, and G1 phases of the cell cycle. This revealed that in plants, only a few miRNAs show differential accumulation during the cell cycle, and miRNA-target pairs were only identified for a small proportion of the more than 13,000 differentially expressed genes during the cell cycle. However, this unique set of miRNA-target pairs could be key to attenuate the expression of several transcription factors and disease resistance genes. We also demonstrate that AGO1 binds to a set of 19-nucleotide, tRNA-derived fragments during the cell cycle progression.

In Arabidopsis (Arabidopsis thaliana), the F-box protein F-BOX-LIKE17 (FBL17) was previously identified as an important cell-cycle regulatory protein. FBL17 is required for cell division during pollen development and for normal cell-cycle progression and endoreplication during the diploid sporophyte phase. FBL17 was reported to control the stability of the CYCLIN-DEPENDENT KINASE inhibitor KIP-RELATED PROTEIN (KRP), which may underlie the drastic reduction in cell division activity in both shoot and root apical meristems observed in fbl17 loss-of-function mutants. However, whether FBL17 has other substrates and functions besides degrading KRPs remains poorly understood. Here we show that mutation of FBL17 leads not only to misregulation of cell cycle genes, but also to a strong upregulation of genes involved in DNA damage and repair processes. This phenotype is associated with a higher frequency of DNA lesions in fbl17 and increased cell death in the root meristem, even in the absence of genotoxic stress. Notably, the constitutive activation of DNA damage response genes is largely SOG1-independent in fbl17. In addition, through analyses of root elongation, accumulation of cell death, and occurrence of γH2AX foci, we found that fbl17 mutants are hypersensitive to DNA double-strand break-induced genotoxic stress. Notably, we observed that the FBL17 protein is recruited at nuclear foci upon double-strand break induction and colocalizes with γH2AX, but only in the presence of RETINOBLASTOMA RELATED1. Altogether, our results highlight a role for FBL17 in DNA damage response, likely by ubiquitylating proteins involved in DNA-damage signaling or repair.

Plant RNA viruses form organized membrane-bound replication complexes to replicate their genomes. This process requires virus- and host-encoded proteins and leads to the production of double-stranded RNA (dsRNA) replication intermediates. Here, we describe the use of Arabidopsis thaliana expressing GFP-tagged dsRNA-binding protein (B2:GFP) to pull down dsRNA and associated proteins in planta upon infection with Tobacco rattle virus (TRV). Mass spectrometry analysis of the dsRNA-B2:GFP-bound proteins from infected plants revealed the presence of viral proteins and numerous host proteins. Among a selection of nine host candidate proteins, eight showed relocalization upon infection, and seven of these colocalized with B2-labeled TRV replication complexes. Infection of A. thaliana T-DNA mutant lines for eight such factors revealed that genetic knockout of dsRNA-BINDING PROTEIN 2 (DRB2) leads to increased TRV accumulation and DRB2 overexpression caused a decrease in the accumulation of four different plant RNA viruses, indicating that DRB2 has a potent and wide-ranging antiviral activity. We propose B2:GFP-mediated pull down of dsRNA to be a versatile method to explore virus replication complex proteomes and to discover key host virus replication factors. Given the universality of dsRNA, development of this tool holds great potential to investigate RNA viruses in other host organisms.

Most cellular proteins involved in genome replication are conserved in all eukaryotic lineages including yeast, plants and animals. However, the mechanisms controlling their availability during the cell cycle are less well defined. Here we show that the Arabidopsis genome encodes for two ORC1 proteins highly similar in amino acid sequence and that have partially overlapping expression domains but with distinct functions. The ancestral ORC1b gene, present before the partial duplication of the Arabidopsis genome, has retained the canonical function in DNA replication. ORC1b is expressed in both proliferating and endoreplicating cells, accumulates during G1 and is rapidly degraded upon S-phase entry through the ubiquitin-proteasome pathway. In contrast, the duplicated ORC1a gene has acquired a specialized function in heterochromatin biology. ORC1a is required for efficient deposition of the heterochromatic H3K27me1 mark by the ATXR5/6 histone methyltransferases. The distinct roles of the two ORC1 proteins may be a feature common to other organisms with duplicated ORC1 genes and a major difference with animal cells.

We have previously shown that the tobacco cyclin B1;1 protein accumulates during the G2 phase of the cell cycle and is subsequently destroyed during mitosis. Here, we investigated the sub-cellular localisation of two different B1-types and one A3-type cyclin during the cell cycle by using confocal imaging and differential interference contrast (DIC) microscopy. The cyclins were visualised as GFP-tagged fusion proteins in living tobacco cells. Both B1-type cyclins were found in the cytoplasm and in the nucleus during G2 but when cells entered into prophase, both cyclins became associated with condensing chromatin and remained on chromosomes until metaphase. As cells exited metaphase, the B1-type cyclins became degraded, as shown by time-lapse images. A stable variant of cyclin B1;1-GFP fusion protein, in which the destruction box had been mutated, maintained its association with the nuclear material at later phases of mitosis such as anaphase and telophase. Furthermore, we demonstrated that cyclin B1;1 protein is stabilised in metaphase-arrested cells after microtubule destabilising drug treatments. In contrast to the B1-type cyclins, the cyclin A3;1 was found exclusively in the nucleus in interphase cells and disappeared earlier than the cyclin B1 proteins during mitosis.

A polyubiquitin-encoding gene was identified from a Nicotiana tabacum genomic library using a specific probe spanning the 3' untranslated region of the corresponding cDNA. The gene, Ubi.U4, is expressed in various amounts in the whole plant, except in just-fully-expanded leaves. Genomic blots indicate that it originates from N. tomentosiformis. Sequence analyses reveal that the gene consists of four ubiquitin monomers extended by a fifth truncated subunit. It is disrupted by a single 457-bp intron in close proximity to the start codon of translation. Primer extension experiments localized the transcription start point (tsp). Transient gene expression in N. tabacum protoplasts indicates that the deletion of the intron has no significant influence on gene expression. Mutagenesis on putative cis-regulatory elements indicates at least three important motifs in the proxiroal promoter: an ‘ACGT’ core element, an A+T-rich sequence and a less clearly defined cis-element located between bp −162 and −113.

The Plant JournalVolume 6, Issue 4 p. 537-546 Free Access Molecular characterization of a β-type proteasome subunit from Arabidopsis thaliana co-expressed at a high level with an α-type proteasome subunit early in the cell cycle Pascal Genschik, Pascal GenschikSearch for more papers by this authorElisabeth Jamet, Elisabeth JametSearch for more papers by this authorGabriel Phillips, Gabriel PhillipsSearch for more papers by this authorYves Parmentier, Yves ParmentierSearch for more papers by this authorClaude Gigot, Claude GigotSearch for more papers by this authorJacqueline Fleck, Jacqueline FleckSearch for more papers by this author Pascal Genschik, Pascal GenschikSearch for more papers by this authorElisabeth Jamet, Elisabeth JametSearch for more papers by this authorGabriel Phillips, Gabriel PhillipsSearch for more papers by this authorYves Parmentier, Yves ParmentierSearch for more papers by this authorClaude Gigot, Claude GigotSearch for more papers by this authorJacqueline Fleck, Jacqueline FleckSearch for more papers by this author First published: October 1994 https://doi.org/10.1046/j.1365-313X.1994.6040537.xCitations: 34AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Citing Literature Volume6, Issue4October 1994Pages 537-546 RelatedInformation

CULLIN (CUL)-dependent ubiquitin ligases form a class of structurally related multi-subunit enzymes that control the rapid and selective degradation of important regulatory proteins involved in cell cycle progression and development, among others. Several classes of these E3s are also conserved in plants and genetic analyses, using Arabidopsis thaliana, indicate that they play an important function during plant development and responses to the environment. In this review, we will discuss the molecular composition and function of these enzymes in plants with a major emphasis on phytohormone signal transduction pathways.

CUL4-RING ubiquitin E3 ligases (CRL4s) were recently shown to exert their specificity through the binding of various substrate receptors, which bind the CUL4 interactor DNA DAMAGED BINDING PROTEIN1 (DDB1) through a WDxR motif. In a segregation-based mutagenesis screen, we identified a WDxR motif–containing protein (WDR55) required for male and female gametogenesis and seed development. We demonstrate that WDR55 physically interacts with Arabidopsis thaliana DDB1A in planta, suggesting that WDR55 may be a novel substrate recruiter of CRL4 complexes. Examination of mutants revealed a failure in the fusion of the polar cells in embryo sac development, in addition to embryo and endosperm developmental arrest at various stages ranging from the zygote stage to the globular stage. wdr55-2 embryos suggest a defect in the transition to bilateral symmetry in the apical embryo domain, further supported by aberrant apical embryo localization of DORNROESCHEN, a direct target of the auxin response factor protein MONOPTEROS. Moreover, the auxin response pattern, as determined using the synthetic auxin-responsive reporter ProDR5:GREEN FLUORESCENT PROTEIN, was shifted in the basal embryo and suspensor but does not support a strong direct link to auxin response. Interestingly, the observed embryo and endosperm phenotype is reminiscent of CUL4 or DDB1A/B loss of function and thus may support a regulatory role of a putative CRL4WDR55 E3 ligase complex.

Due to their sessile lifestyle, plants are especially exposed to various stresses, including genotoxic stress, which results in altered genome integrity. Upon the detection of DNA damage, distinct cellular responses lead to cell cycle arrest and the induction of DNA repair mechanisms. Interestingly, it has been shown that some cell cycle regulators are not only required for meristem activity and plant development but are also key to cope with the occurrence of DNA lesions. In this review, we first summarize some important regulatory steps of the plant cell cycle and present a brief overview of the DNA damage response (DDR) mechanisms. Then, the role played by some cell cycle regulators at the interface between the cell cycle and DNA damage responses is discussed more specifically.

In eukaryotic cells, pre-tRNAs spliced by a pathway that produces a 3′,5′-phosphodiester, 2′-phosphomonoester linkage contain a 2′-phosphate group adjacent to the tRNA anticodon. This 2′-phosphate is transferred to NAD to give adenosine diphosphate (ADP)-ribose 1“,2”-cyclic phosphate (Appr>p), which is subsequently metabolized to ADP-ribose 1“-phosphate (Appr-1”p). The latter reaction is catalyzed by a cyclic phosphodiesterase (CPDase), previously identified in yeast and wheat. In the work presented here, we describe cloning of the Arabidopsis cDNA encoding the 20-kDa CPDase that hydrolyzes Appr>p to Appr-1“p. Properties of the bacterially overexpressed and purified Arabidopsis enzyme are similar to those of wheat CPDase. In addition to their transformation of Appr>p, both enzymes hydrolyze nucleoside 2′,3′-cyclic phosphates to nucleoside 2′-phosphates. For theArabidopsis CPDase, the apparent K mvalues for Appr>p, A>p, C>p, G>p, and U>p are 1.35, 1.34, 2.38, 16.86, and 17.67 mm, respectively. Southern analysis indicated that CPDase in Arabidopsis is encoded by a single copy gene that is expressed, at different levels, in allArabidopsis organs that were analyzed. Indirect immunofluorescence, performed with transfected protoplasts, showed that CPDase is localized in the cytoplasm. Based on substrate specificity and products generated, the plant enzyme differs from other known cyclic phosphodiesterases. The Arabidopsis CPDase does not have recognizable structural similarity or motifs in common with proteins deposited in public data bases. In eukaryotic cells, pre-tRNAs spliced by a pathway that produces a 3′,5′-phosphodiester, 2′-phosphomonoester linkage contain a 2′-phosphate group adjacent to the tRNA anticodon. This 2′-phosphate is transferred to NAD to give adenosine diphosphate (ADP)-ribose 1“,2”-cyclic phosphate (Appr>p), which is subsequently metabolized to ADP-ribose 1“-phosphate (Appr-1”p). The latter reaction is catalyzed by a cyclic phosphodiesterase (CPDase), previously identified in yeast and wheat. In the work presented here, we describe cloning of the Arabidopsis cDNA encoding the 20-kDa CPDase that hydrolyzes Appr>p to Appr-1“p. Properties of the bacterially overexpressed and purified Arabidopsis enzyme are similar to those of wheat CPDase. In addition to their transformation of Appr>p, both enzymes hydrolyze nucleoside 2′,3′-cyclic phosphates to nucleoside 2′-phosphates. For theArabidopsis CPDase, the apparent K mvalues for Appr>p, A>p, C>p, G>p, and U>p are 1.35, 1.34, 2.38, 16.86, and 17.67 mm, respectively. Southern analysis indicated that CPDase in Arabidopsis is encoded by a single copy gene that is expressed, at different levels, in allArabidopsis organs that were analyzed. Indirect immunofluorescence, performed with transfected protoplasts, showed that CPDase is localized in the cytoplasm. Based on substrate specificity and products generated, the plant enzyme differs from other known cyclic phosphodiesterases. The Arabidopsis CPDase does not have recognizable structural similarity or motifs in common with proteins deposited in public data bases. Transcripts of many tRNA genes in eukaryotes contain a single short intron, located in a conserved position in the anticodon loop, which is excised by a different mechanism to that utilized during nuclear pre-mRNA processing (Fig. 1; reviewed in Refs. 1Phizicky E.M. Greer C. Trends Biochem. Sci. 1993; 18: 31-34Abstract Full Text PDF PubMed Scopus (6) Google Scholar and2Westaway S.K. Abelson J. Soell D. RajBhandary U.L. tRNA: Structure, Biosynthesis and Function. American Society for Microbiology, Washington, D. C.1995: 79-92Google Scholar). Splicing of pre-tRNA is initiated by endonucleolytic cleavages that result in removal of the intron and formation of two tRNA half-molecules, a 5′-half terminating in a 2′,3′-cyclic phosphate and a 3′-half bearing a 5′-hydroxyl group (3Filipowicz W. Shatkin A.J. Cell. 1983; 32: 547-557Abstract Full Text PDF PubMed Scopus (111) Google Scholar, 4Laski F.A. Fire A.Z. RajBhandary U.L. Sharp P.A. J. Biol. Chem. 1983; 258: 11974-11980Abstract Full Text PDF PubMed Google Scholar, 5Peebles C.L. Gegenheimer P. Abelson J. Cell. 1983; 32: 525-536Abstract Full Text PDF PubMed Scopus (154) Google Scholar, 6Gandini-Attardi D. Margarit I. Tocchini-Valentini G.P. EMBO J. 1985; 4: 3289-3297Crossref PubMed Scopus (31) Google Scholar, 7Rauhut R. Green P.R. Abelson J. J. Biol. Chem. 1990; 265: 18180-18184Abstract Full Text PDF PubMed Google Scholar). In yeast and plants, these two tRNA exons are ligated to give an unusual 3′,5′-phosphodiester, 2′-phosphomonoester linkage. This reaction, catalyzed by the RNA ligase (8Konarska M. Filipowicz W. Domdey H. Gross H.J. Nature. 1981; 293: 112-116Crossref PubMed Scopus (100) Google Scholar, 9Greer C.L. Peebles C.L. Gegenheimer P. Abelson J. Cell. 1983; 32: 537-546Abstract Full Text PDF PubMed Scopus (180) Google Scholar, 10Phizicky E.M. Schwartz R.C. Abelson J. J. Biol. Chem. 1986; 261: 2978-2986Abstract Full Text PDF PubMed Google Scholar, 11Stange N. Beier H. EMBO J. 1987; 6: 2811-2818Crossref PubMed Scopus (67) Google Scholar), is a multistep process resulting in formation of the mature length tRNA containing a 2′-phosphate at the splice junction (1Phizicky E.M. Greer C. Trends Biochem. Sci. 1993; 18: 31-34Abstract Full Text PDF PubMed Scopus (6) Google Scholar, 2Westaway S.K. Abelson J. Soell D. RajBhandary U.L. tRNA: Structure, Biosynthesis and Function. American Society for Microbiology, Washington, D. C.1995: 79-92Google Scholar) (Fig. 1). The ligation pathway leading to the formation of the 2′-phosphate-bearing tRNA molecules is also conserved in vertebrates (12Zillmann M. Gorovsky M.A. Phizicky E.M. Mol. Cell. Biol. 1991; 11: 5410-5416Crossref PubMed Scopus (80) Google Scholar), despite the fact that in these organisms most of the tRNA splicing appears to involve another RNA ligase, an enzyme which joins two tRNA halves by the regular 3′,5′-phosphodiester (3Filipowicz W. Shatkin A.J. Cell. 1983; 32: 547-557Abstract Full Text PDF PubMed Scopus (111) Google Scholar, 4Laski F.A. Fire A.Z. RajBhandary U.L. Sharp P.A. J. Biol. Chem. 1983; 258: 11974-11980Abstract Full Text PDF PubMed Google Scholar,13Nishikura K. DeRobertis E.M. J. Mol. Biol. 1981; 145: 405-420Crossref PubMed Scopus (135) Google Scholar). The 2′-phosphate present in the product of the spliced tRNA is removed by a specific phosphotransferase, previously identified in yeast and vertebrates (14McCraith S.M. Phizicky E.M. J. Biol. Chem. 1991; 266: 11986-11992Abstract Full Text PDF PubMed Google Scholar, 15Zillmann M. Gorovsky M.A. Phizicky E.M. J. Biol. Chem. 1992; 267: 10289-10294Abstract Full Text PDF PubMed Google Scholar). Culver et al. (16Culver G.M. McCraith S.M. Zillmann M. Kierzek R. Michaud N. LaReau R.D. Turner D.H. Phizicky E.M. Science. 1993; 261: 206-208Crossref PubMed Scopus (80) Google Scholar) found that this enzyme transfers the 2′-phosphate to an NAD acceptor molecule, to produce ADP-ribose 1“,2”-cyclic phosphate (Appr>p). 1The abbreviations used are: Appr>p, ADP-ribose 1“,2”-cyclic phosphate; Appr-1“p, ADP-ribose 1”-phosphate; Appr-2“p, ADP-ribose 2”-phosphate; N, any of four (A, G, C, U) nucleosides; pN, N3′p, N2′p, and N>p, nucleosides 5′-, 3′-, 2′-, and 2′,3′-cyclic phosphate, respectively; pG>p, guanosine 5′-phosphate, 2′,3′-cyclic phosphate; CIP, calf intestine phosphatase; CNPase, 2′,3′-cyclic nucleotide 3′-phosphodiesterase; CPDase, cyclic phosphodiesterase; EST, expressed sequence tag; Mes, 2-(N-morpholino)ethanesulfonic acid; Mops, 3-(N-morpholino)propanesulfonic acid; HPLC, high pressure liquid chromatography; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; RACE, rapid amplification of cDNA ends; TLC, thin layer chromatography. However, Appr>p is not the final product of this complex series of reactions. It has been found recently that Appr>p is converted into ADP-ribose 1“-phosphate (Appr-1”p) by the action of the cyclic phosphodiesterase (CPDase), identified in yeast and wheat (17Culver G.M. Consaul S.A. Tycowski K.T. Filipowicz W. Phizicky E.M. J. Biol. Chem. 1994; 269: 24928-24934Abstract Full Text PDF PubMed Google Scholar). Although all partial reactions leading to the formation of Appr>p and Appr-1“p have, to date, only been demonstrated in yeast (16Culver G.M. McCraith S.M. Zillmann M. Kierzek R. Michaud N. LaReau R.D. Turner D.H. Phizicky E.M. Science. 1993; 261: 206-208Crossref PubMed Scopus (80) Google Scholar, 17Culver G.M. Consaul S.A. Tycowski K.T. Filipowicz W. Phizicky E.M. J. Biol. Chem. 1994; 269: 24928-24934Abstract Full Text PDF PubMed Google Scholar), the available evidence suggests that both compounds are also produced, as a result of the tRNA splicing reaction, in plants and vertebrates (12Zillmann M. Gorovsky M.A. Phizicky E.M. Mol. Cell. Biol. 1991; 11: 5410-5416Crossref PubMed Scopus (80) Google Scholar, 15Zillmann M. Gorovsky M.A. Phizicky E.M. J. Biol. Chem. 1992; 267: 10289-10294Abstract Full Text PDF PubMed Google Scholar, 16Culver G.M. McCraith S.M. Zillmann M. Kierzek R. Michaud N. LaReau R.D. Turner D.H. Phizicky E.M. Science. 1993; 261: 206-208Crossref PubMed Scopus (80) Google Scholar, 17Culver G.M. Consaul S.A. Tycowski K.T. Filipowicz W. Phizicky E.M. J. Biol. Chem. 1994; 269: 24928-24934Abstract Full Text PDF PubMed Google Scholar). It has been suggested that Appr>p, or its hydrolysis product, may perform some as yet unspecified regulatory function(s) in the cell (16Culver G.M. McCraith S.M. Zillmann M. Kierzek R. Michaud N. LaReau R.D. Turner D.H. Phizicky E.M. Science. 1993; 261: 206-208Crossref PubMed Scopus (80) Google Scholar). Conservation of the Appr>p-forming pathway in vertebrates (12Zillmann M. Gorovsky M.A. Phizicky E.M. Mol. Cell. Biol. 1991; 11: 5410-5416Crossref PubMed Scopus (80) Google Scholar, 15Zillmann M. Gorovsky M.A. Phizicky E.M. J. Biol. Chem. 1992; 267: 10289-10294Abstract Full Text PDF PubMed Google Scholar, 16Culver G.M. McCraith S.M. Zillmann M. Kierzek R. Michaud N. LaReau R.D. Turner D.H. Phizicky E.M. Science. 1993; 261: 206-208Crossref PubMed Scopus (80) Google Scholar), despite the fact that most of the cellular tRNA in these organisms seems to be processed by another pathway (see above), offers some support for this hypothesis. The plant CPDase was originally purified from wheat as an enzyme that hydrolyzes nucleoside 2′,3′-cyclic phosphates to nucleoside 2′-phosphates (18Tyc K. Kellenberger C. Filipowicz W. J. Biol. Chem. 1987; 262: 12994-13000Abstract Full Text PDF PubMed Google Scholar). The biological significance of this reaction is not known, but the ability of the enzyme to convert the 2′,3′-cyclic phosphate to the 2′-phosphate in mononucleotides but not in cyclic-phosphate-terminated oligoribonucleotides, together with its ability to hydrolyze Appr>p, clearly distinguishes it from other known enzymes having the 2′,3′-cyclic phosphate 3′-phosphodiesterase activity (17, 18; see “Discussion”). Although the yeast phosphodiesterase shares many characteristics with the wheat enzyme, it has a different substrate specificity, hydrolyzing Appr>p to Appr-1“p, but having no detectable activity on nucleoside 2′,3′-cyclic phosphates (17Culver G.M. Consaul S.A. Tycowski K.T. Filipowicz W. Phizicky E.M. J. Biol. Chem. 1994; 269: 24928-24934Abstract Full Text PDF PubMed Google Scholar). Fractionation experiments performed with yeast and wheat germ extracts indicated that phosphodiesterases described above are, most probably, the only cellular activities converting Appr>p to Appr-1”p (17Culver G.M. Consaul S.A. Tycowski K.T. Filipowicz W. Phizicky E.M. J. Biol. Chem. 1994; 269: 24928-24934Abstract Full Text PDF PubMed Google Scholar). In this work we describe the molecular characterization of the plant cyclic phosphodiesterase. The cDNA encoding this protein inArabidopsis has been cloned and the properties of the bacterially overexpressed and purified enzyme have been compared with those of its purified wheat counterpart. The Arabidopsisenzyme has no apparent structural resemblance to other known cyclic nucleotide phosphodiesterases. Plantlets of Arabidopsis thaliana, ecotype Columbia C0, were grown in Petri dishes containing 0.8% agar, 1% sucrose, and MS salts (19Murashige T. Skoog F. Physiol. Plant. 1962; 15: 473-497Crossref Scopus (54339) Google Scholar) in a 22 °C growth chamber under a 12-h light/12-h dark cycle. Three weeks after sowing, leaves, roots, and floral buds were harvested. For leaf strip incubation, the leaves were sliced and incubated in a culture medium described by Nagy and Maliga (20Nagy J.J. Maliga P. Z. Pflanzenphysiol. 1976; 78: 453-455Crossref Google Scholar), containing 1 mg/liter of 2,4-dichlorophenoxyacetic acid. Aliquots were harvested at different times of culture for total RNA extraction. About 5 μg of wheat germ CPDase, purified as described previously (18Tyc K. Kellenberger C. Filipowicz W. J. Biol. Chem. 1987; 262: 12994-13000Abstract Full Text PDF PubMed Google Scholar), was applied to the SDS-PAGE 10% gel. After blotting to the polyvinylidene difluoride membrane (Bio-Rad) and staining with Ponceau S, the approximately 23-kDa CPDase band was excised and treated with trypsin. Proteolytic peptides were resolved by HPLC and sequenced by Dr. W. S. Lane (Harvard MicroChem, Cambridge, MA). Three peptides were sequenced (Fig.2). A λZAP cDNA library, prepared with a mixture of the poly(A)+ RNA isolated from 24, 48, and 72 h leaf strip cultures (a gift from J. Fleck, Institut de Biologie Moléculaire des Plantes du CNRS, Strasbourg, France), was screened with the partial cDNA clone (theArabidopsis EST; GenBank™/EBI accession number T12916; kindly provided by the Arabidopsis Biological Resource Center at Ohio State University, Columbus, OH) as a probe. Hybridizations were performed overnight at 42 °C in 5 × SSPE (SSPE: 0.18 m NaCl, 10 mmNaH2PO4, 1 mm Na2-EDTA, pH 7.7) containing 50% formamide, 5 × Denhardt's solution (100 × Denhardt's solution is 2% Ficoll, 2% polyvinylpyrrolidone, 2% bovine serum albumin), 1% SDS, and 50 μg/ml denatured salmon sperm DNA. Filters were subsequently washed in 2 × SSC (SSC: 0.15 m NaCl, 15 mmNa2citrate) and 0.1% SDS for 30 min at 42 °C and in 0.2 × SSC and 0.1% SDS for 30 min at 42 °C. Twenty-nine clones were isolated after screening 800,000 recombinant phages. After excision of the phagemids, the inserts were analyzed by restriction mapping and sequencing of the ends. The longest clones were subsequently sequenced on both strands. Primer extension was carried out (21Ausubel F. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J. Smith A. Struhl K. Current Protoclos in Molecular Biology. Greene Publishing, New York1990Google Scholar) using a 25-mer-specific 32P-labeled oligonucleotide 1 (ACGGTGACGTGAGGAACGAATCTTG), complementary to positions 203–227 of the cDNA (Fig. 2), 10 units of avian myoblastosis virus reverse transcriptase, and 100 μg of RNA isolated from theArabidopsis leaf strip cultures incubated for either 24 or 48 h. The resulting cDNA was purified on a 6% denaturing polyacrylamide gel and its 3′ end was tagged with the 5′-phosphorylated oligonucleotide 2 (pCATCTCGAGCGGCCGCATCA) using T4 RNA ligase (22Dumas J.B. Edwards M. Delort J. Mallet J. Nucleic Acids Res. 1991; 19: 5227-5232Crossref PubMed Scopus (289) Google Scholar). The CPDase cDNA sequence was PCR-amplified using oligonucleotide 3 (GTGAGGAACGAATCTTGG; complementary to positions 202 to 219; Fig. 2) and oligonucleotide 4 (TGATGCGGCCGCTCGAGA; complementary to the 3′ tag) as primers. The PCR products were cloned into pBluescript (Stratagene) and sequenced. The fragment encompassing 226 base pairs of the promoter and upstream portion of the transcribed region was cloned by inverse PCR (23Triglia T. Peterson M.G. Kemp D.J. Nucleic Acids Res. 1988; 16: 8186Crossref PubMed Scopus (725) Google Scholar). TheArabidopsis DNA was digested with EcoRI and ligated using T4 DNA ligase. PCR was performed using oligonucleotide 5 (CGATTCCTCATCTGGTAATGC; complementary to positions 130 to 150 in Fig.2) and oligonucleotide 6 (GCTAATGGAAGCTTTGAGATCC; positions 168 to 189 in Fig. 2) as primers. The amplified fragments were cloned into theSmaI site of pBluescript and sequenced. Total RNA from Arabidopsis organs and leaf strip cultures was isolated as described by Hall et al. (24Hall T.C. Ma Y. Buchbinder B.U. Pyne J.W. Sun S.M. Bliss F.A. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 3196-3200Crossref PubMed Scopus (161) Google Scholar). RNA (10 μg/lane) was separated on a formaldehyde-agarose gel, blotted onto Hybond-N nylon membrane (Amersham Corp.) by capillary transfer using 20 × SSPE, and UV-cross-linked to the membrane. The integrity and the amount of RNA applied to each lane were verified by control hybridizations using a tomato 25 S rRNA probe (25Kiss T. Kis M. Solymosy F. Nucleic Acids Res. 1989; 17: 796Crossref PubMed Scopus (71) Google Scholar). The cDNA fragment extending from positions 430–741 (Fig. 2) was used as a CPDase probe. The histone H4 probe corresponds to the 196-base pair restriction fragmentAccI/DdeI of the coding region of the gene H4A748 (26Chaboute M.E. Chaubet N. Philipps G. Ehling M. Gigot C. Plant Mol. Biol. 1987; 8: 179-191Crossref PubMed Scopus (75) Google Scholar). The actin probe corresponds to the 570-base pair PCR-amplified fragment of the Arabidopsis actin gene AAc1 (27Nairn C.J. Winesett L. Ferl R.J. Gene ( Amst .). 1988; 65: 247-257Crossref PubMed Scopus (77) Google Scholar). The genomic DNA was isolated from lyophilized Arabidopsisplants using a procedure similar to that of Murray and Thompson (28Murray M.G. Thompson W.F. Nucleic Acids Res. 1980; 8: 4321-4325Crossref PubMed Scopus (9497) Google Scholar). The probes were labeled with [α-32P]dCTP (3000 Ci/mmol, Amersham) by the random priming method (29Feinberg A.P. Vogelstein B. Anal. Biochem. 1983; 132: 6-13Crossref PubMed Scopus (16651) Google Scholar). RNA as well as DNA gel blots were hybridized overnight at 42 °C in 5 × SSPE, 50% formamide, 10% dextran sulfate, 1% SDS, and 50 μg/ml denatured salmon sperm DNA. The blots were subsequently washed in 2 × SSC and 0.1% SDS for 30 min at 42 °C and in 0.2 × SSC and 0.1% SDS for 30 min at 42 °C and then at 60 °C. For immunoblot analysis, proteins were fractionated by SDS-PAGE and electroblotted onto the polyvinylidene difluoride membrane. The membrane was probed with a 1:1000 dilution of the hen polyclonal antibody. The immunoreactive proteins were detected using peroxidase-conjugated affinity-purified rabbit anti-chicken IgYs (Dianova) and the ECL Western blotting analysis system from Amersham. ABamHI site was introduced 3′ to the CPDase coding sequence by site-directed mutagenesis (30Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4560) Google Scholar). The NcoI/BamHI fragment (the NcoI site is present at the AUG initiation codon of the CPDase cDNA) was cloned into the pQE-60 vector (Qiagen) yielding plasmid pQECPDase. In this construct, 10 additional amino acids (sequence GSRSHHHHHH) are placed in frame at the C terminus of the recombinant protein. The protein remained soluble during expression in the Escherichia coli strain BL21(DE3) and was purified in the native form, under nondenaturing conditions, using the nickel-nitrilotriacetic acid resin and following the Qiagen protocol. The purified CPDase was applied to a 10-ml Sephadex G-25 column equilibrated and eluted with 20 mm Tris acetate, pH 7.6, 0.5 mm dithiothreitol, 0.1 mm EDTA, 0.5 mm dithiothreitol, 5% (v/v) glycerol, 0.01% Triton X-100, and 10 μm phenylmethylsulfonyl fluoride. The protein concentration was measured by the method of Bradford (31Bradford M.M. Anal. Biochem. 1976; 72: 248-254Crossref PubMed Scopus (217544) Google Scholar) using bovine serum albumin as a standard. Two hens were immunized with the purified recombinant CPDase. For primary immunization, 20 μg of the protein, in Freund's complete adjuvant, was used. After 4 weeks, 20 μg of the protein with Freund's incomplete adjuvant was injected. Eggs were collected daily starting 2 weeks after the last immunization. Antibodies were purified from egg yolk according to the three-step method of Polson and von Wechmar (32Polson A. von Wechmar M.B. van Regenmortel M.H.V. Immunol. Commun. 1980; 9: 475-493Crossref PubMed Scopus (357) Google Scholar). A 2 m(NH4)2 SO4 precipitation was used for the complete removal of polyethylene glycol. All nucleoside 2′,3′-cyclic and 3′,5′-cyclicphosphates, nucleoside 5′-, 3′- and 2′-phosphates, pG>p and inositol 1,2-cyclic phosphate were obtained from Sigma and Pharmacia Biotech Inc. A>p, G>p, and C>p were purified by reverse phase HPLC on Nucleosil C4 RP-300 column using 50 mm triethyl-ammonium acetate-acetonitrile gradient. Products were collected as a single peak. Appr>p was chemically synthesized as described elsewhere (33Hall J. Genschik P. Filipowicz W. Helv. Chim. Acta. 1996; 79: 1005-1010Crossref Scopus (5) Google Scholar). The 32P-labeled oligoribonucleotide AAAAUAAAAG>p* (asterisk denotes the position of the label) was prepared as follows: the synthetic oligoribonucleotide AAAAUAAAAG (0.7 μg), obtained from MWG-Biotech (Munich, Germany), was 3′-terminally labeled using 5′-[32P]pCp (*pCp) and T4 RNA ligase. The ligation product was then digested with 5 units of RNase T1 yielding AAAAUAAAAGp*. The latter was quantitatively converted into AAAUAAAAG>p* by incubation with the RNA 3′-terminal phosphate cyclase purified from HeLa cells (34Filipowicz W. Vicente O. Methods Enzymol. 1990; 181: 499-510Crossref PubMed Scopus (16) Google Scholar). The oligonucleotide was recovered by phenol extraction and ethanol precipitation. For calculation of specific activities and kinetic analysis, a quantitative assay based on a measurement of the phosphatase-sensitive nucleotide product was used. All incubations (20 μl) contained 50 mm Tris-HCl, pH 7.0, and 0.01% Triton X-100. Concentrations of CPDase and substrates and incubation times at 30 °C were as indicated in the figure legends. Reactions were stopped by boiling for 2 min, and 80 μl of 0.1 mTris-HCl, pH 8.0, containing 0.2 unit of CIP was added. After incubation for 10 min at 37 °C, liberated phosphate was assayed according to Hess and Derr (35Hess H.H. Derr J.E. Anal. Biochem. 1975; 63: 607-613Crossref PubMed Scopus (368) Google Scholar). For determination of theK m and V max values, the assays contained substrates at concentrations of 1.38–12.5 mm. All velocities were calculated from the initial linear rates. Values were fitted to the Lineweaver-Burk equation by the linear regression method assuming proportional errors. Products of enzymatic digestions, performed as described previously (8Konarska M. Filipowicz W. Domdey H. Gross H.J. Nature. 1981; 293: 112-116Crossref PubMed Scopus (100) Google Scholar), were analyzed by cellulose TLC in solvent A (saturated (NH4)2SO4/3 m sodium acetate/isopropyl alcohol (80:6:2)) or by polyethyleneimine-cellulose TLC in solvent B (0.75 m LiCl). The nucleotide standards and reaction products were visualized under UV light. The CPDase coding sequence (theNcoI-BamHI fragment from pQECPDase; see above) was cloned into the NcoI and BamHI sites of the pGGS.5 expression vector (kindly provided by Gordon Simpson of this laboratory; the vector contains a duplicated cauliflower mosaic virus promoter and a cauliflower mosaic virus poly(A) signal), resulting in the plasmid pHATCPDase. The CPDase encoded by pHATCPDase contains the influenza hemagglutinin nonapeptide epitope tag (flu tag, amino acids YPYDVPDYA) at the C terminus. A similar plasmid (pNRBP43) expressing the nuclear RNA-binding protein N-RBP43 of Nicotiana plumbaginifolia with the flu tag fused at the C terminus, was used as a control for the nuclear-localized protein. Mesophyll protoplasts of N. plumbaginifolia were transfected by the polyethylene glycol method (36Goodall G.J. Wiebauer K. Filipowicz W. Methods Enzymol. 1990; 181: 148-161Crossref PubMed Scopus (149) Google Scholar), using 20 μg of plasmid per transfection. Transfected protoplasts were collected 24 h after transfection, washed twice with 10 ml of W5 solution (36Goodall G.J. Wiebauer K. Filipowicz W. Methods Enzymol. 1990; 181: 148-161Crossref PubMed Scopus (149) Google Scholar), twice with 10 ml of 0.5% Mes, pH 5.7, containing 175 mm CaCl2, and suspended in 100 μl of the same Mes/CaCl2 buffer. Indirect immunofluorescence analysis was performed according to Cairnset al. (37Cairns E. Gschwender H.H. Primke M. Yamakawa M. Traub P. Schweiger H.G. Proc. Natl. Acad. Sci. U. S. A. 1978; 75: 5557-5559Crossref PubMed Scopus (11) Google Scholar) and Neuhaus et al. (38Neuhaus G. Neuhaus-Url G. Gruss P. Schweiger H.G. EMBO J. 1984; 3: 2169-2172Crossref PubMed Scopus (32) Google Scholar), with modifications. Aliquots of the protoplast suspension were spread on the surface of detergent- and acetone-washed glass slides. The slides were dried in an oven at 55 °C and kept overnight under vacuum in a desiccator. Samples were fixed for 30 min at room temperature by overlaying with 100 μl of the fixation solution (4% formaldehyde, 1% Triton X-100 in 0.1 m potassium phosphate buffer, pH 8.0). They were subsequently washed four times for 30 min with 1 ml of washing solution A (2.5% NaCl in 0.1 m glycine-KOH buffer, pH 8.5), and overlaid for 1 h in a wet chamber with 100 μl of a solution of the rabbit antiserum against the flu epitope (antibody HA-11; Berkley Antibody Co.), diluted 1:80 with buffer B (2.5% NaCl solution in 0.1 m Tris-HCl, pH 7.4). Glass slides were washed four times for 15 min with 1 ml of solution A and overlaid for 30 min with the fluorescein isothiocyanate-conjugated goat anti-rabbit antibody (AffiniPure F(ab′)2 fragment; Jackson/Milan Analytica AG). The secondary antibody was diluted 1:100 with buffer B, containing 10 μg/ml Hoechst 33258 dye. After washing four times with 1 ml of solution A and four times with 1 ml of solution C (0.1m glycine-KOH, pH 8.5), samples were overlaid with a drop of the embedding material and covered with a cover glass. Samples were examined with a Zeiss Axiophot microscope and a Leica TCS 4D confocal scanning laser microscope, using a 63× objective. Images were recorded using the Leica software (SCANware 4.2) provided with the system and analyzed with the Imaris software on a Silicon Graphics work station. The previously purified wheat germ CPDase (18Tyc K. Kellenberger C. Filipowicz W. J. Biol. Chem. 1987; 262: 12994-13000Abstract Full Text PDF PubMed Google Scholar) was subjected to tryptic digestion, and three peptide sequences were obtained. One of these, the 20-amino acid-long pep3, showed 80% identity and 100% similarity to an open reading frame of the Arabidopsis EST, present in the GenBank™/EBI data base (accession number T12916). The EST cDNA was used as a probe to screen the λZAP cDNA library made with the poly(A)+ RNA obtained from the Arabidopsis leaf strip culture. Twenty-nine positive recombinant phages were isolated, and their inserts were analyzed by restriction mapping and sequencing of the ends. The longest cDNA obtained from this screening started approximately 85 nucleotides downstream from the transcription initiation site, as determined by primer extension (data not shown). To determine the 5′-terminal mRNA sequence, RACE experiments were performed using RNA isolated from leaf strip cultures incubated for either 24 or 48 h. Both RNA preparations yielded cDNA clones of identical sequence and extending to the same position (position 1 in Fig. 2). The sequence of the region identified by RACE was independently confirmed by cloning, using inverse PCR, and sequencing the promoter region of the gene. The apparent full-length cDNA is 741 nucleotides long, without counting the poly(A) tail (Fig. 2). The sequence including the presumed AUG initiation codon (AUCCAUGGA) is similar to the consensus (AACCAUGGC) established for plant genes (39Lütcke H.A. Chow K.C. Mickel F.S. Moss K.A. Kern H.F. Scheele G.A. EMBO J. 1987; 6: 43-48Crossref PubMed Scopus (872) Google Scholar). The 5′-terminal leader contains one additional AUG in a much less favorable context, followed by termination codons (Fig. 2). Conceptual translation of the cDNA yields a 20.5-kDa protein of 181 amino acids with a predicted isoelectric point of 4.82. The deducedArabidopsis protein contains sequences showing significant similarities with all sequenced peptides derived from the wheat protein. The greatest sequence homology is for pep3 (see above). Peptides pep1 and pep2 show 39 and 38% similarity and 39 and 31% identity, respectively. The coding region of theArabidopsis cDNA was subcloned in the pQE-60-inducible expression vector to yield a fusion protein containing six histidine residues at the C terminus. The tagged protein was overproduced inE. coli and purified using the nickel-nitrilotriacetic acid resin (Fig. 3 A). The protein was over 95% pure as judged by SDS-PAGE. The polyclonal antibodies, raised in chickens immunized with the overexpressed ArabidopsisCPDase, detected purified Arabidopsis protein on Western blots and also cross-reacted with the purified wheat CPDase (Fig.3 B). The antibodies did not detect the CPDase in crude cellular extracts prepared from the leaves of Arabidopsis, but the protein band likely to correspond to the CPDase could be detected after partial purification of the enzyme (data not shown). Hence, consistent with previous observations (18Tyc K. Kellenberger C. Filipowicz W. J. Biol. Chem. 1987; 262: 12994-13000Abstract Full Text PDF PubMed Google Scholar), the CPDase appears to be a nonabundant protein. The Arabidopsis CPDase hydrolyzed all four nucleoside 2′,3′-cyclic phosphates to the corresponding 2′-phosphomonoesters as analyzed by cellulose TLC (Fig. 4). No 3′-phosphomonoester formation could be detected. Thus, lik

The anaphase promoting complex or cyclosome is the ubiquitin-ligase that targets destruction box-containing proteins for proteolysis during the cell cycle. Anaphase promoting complex or cyclosome and its activator (the fizzy and fizzy-related) proteins work together with ubiquitin-conjugating enzymes (UBCs) (E2s). One class of E2s (called E2-C) seems specifically involved in cyclin B1 degradation. Although it has recently been shown that mammalian E2-C is regulated at the protein level during the cell cycle, not much is known concerning the expression of these genes. Arabidopsis encodes two genes belonging to the E2-C gene family (called UBC19 and UBC20). We found that UBC19 is able to complement fission yeast (Schizosaccharomyces pombe) UbcP4-140 mutant, indicating that the plant protein can functionally replace its yeast ortholog for protein degradation during mitosis. In situ hybridization experiments were performed to study the expression of the E2-C genes in various tissues of plants. Their transcripts were always, but not exclusively, found in tissues active for cell division. Thus, the UBC19/20 E2s may have a key function during cell cycle, but may also be involved in ubiquitylation reactions occurring during differentiation and/or in differentiated cells. Finally, we showed that a translational fusion protein between UBC19 and green fluorescent protein localized both in the cytosol and the nucleus in stable transformed tobacco (Nicotiana tabacum cv Bright Yellow 2) cells.

Abstract Many G2/M phase-specific genes in plants contain mitosis-specific activator (MSA) elements, which act as G2/M phase-specific enhancers and bind with R1R2R3-Myb transcription factors. Here, we examined the genome-wide effects of NtmybA2 overexpression, one of the R1R2R3-Myb transcription factors in tobacco (Nicotiana tabacum). We used a custom-made 16-K cDNA microarray for comparative transcriptome analysis of transgenic tobacco BY-2 cell lines that overexpress NtmybA2 or its truncated hyperactive form. The microarray was also used to determine the transcript profile during the cell cycle in synchronized cultures of BY-2 cells. Combined microarray data from transgenic lines and synchronized cells revealed that overexpression of the truncated hyperactive form of NtmybA2, but not its full-length form, preferentially up-regulated many G2/M phase-specific genes in BY-2 cells. We determined promoter sequences of several such up-regulated genes and showed that all contain MSA-like motifs in the proximal regions of their promoters. One of the up-regulated genes, NtE2C, encoding for cyclin-specific ubiquitin carrier proteins, contained a single functional MSA-like motif, which specifically controlled the expression of a reporter gene in the G2/M phase in BY-2 cells. Furthermore, a genomic footprint experiment showed that the MSA element in the NtE2C promoter interacted with nuclear proteins in vivo. Therefore, we propose that the transcription of many G2/M phase-specific genes in tobacco is positively regulated by NtmybA2, in most cases through direct binding to the MSA elements.

In plants and some animal lineages, RNA silencing is an efficient and adaptable defense mechanism against viruses. To counter it, viruses encode suppressor proteins that interfere with RNA silencing. Phloem-restricted viruses are spreading at an alarming rate and cause substantial reduction of crop yield, but how they interact with their hosts at the molecular level is still insufficiently understood. Here, we investigate the antiviral response against phloem-restricted turnip yellows virus (TuYV) in the model plant Arabidopsis thaliana. Using a combination of genetics, deep sequencing, and mechanical vasculature enrichment, we show that the main axis of silencing active against TuYV involves 22-nt vsiRNA production by DCL2, and their preferential loading into AGO1. Moreover, we identify vascular secondary siRNA produced from plant transcripts and initiated by DCL2-processed AGO1-loaded vsiRNA. Unexpectedly, and despite the viral encoded VSR P0 previously shown to mediate degradation of AGO proteins, vascular AGO1 undergoes specific post-translational stabilization during TuYV infection. Collectively, our work uncovers the complexity of antiviral RNA silencing against phloem-restricted TuYV and prompts a re-assessment of the role of its suppressor of silencing P0 during genuine infection.

The basic mechanism of mitosis is universally conserved in all eucaryotes, but specific solutions to achieve this process have been adapted by different organisms during evolution. Although cytological studies of plant cells have contributed to our understanding of chromatin dynamics during mitosis, many of the molecular mechanisms that control mitosis have been identified in yeast and animal cells. Nevertheless, recent advances have begun to fill the gaps in our understanding of how mitosis is regulated in plants, and raise intriguing questions to be answered in the future.

A cDNA clone isolated from an Arabidopsis thaliana cell suspension culture library showed considerable similarities to the proteasome 28 kDa alpha subunit of Drosophila [(1990) Gene 90, 235-241]. The 250 amino acid-long protein encoded by Arabidopsis TAS-g64 clone has important homologies in its primary structure and in the predicted secondary structure with the PROS-28.1 clone from Drosophila. The only divergence observed between the two sequences is for the 20 C-terminal amino acids. This subunit might share important functions in both kingdoms, as revealed by the important conservation between plants and animals. In plant cells it is encoded by a single-copy gene and probably regulated by stress and/of division.

Background Selective protein degradation via the ubiquitin-26S proteasome is a major mechanism underlying DNA replication and cell division in all Eukaryotes. In particular, the APC/C (Anaphase Promoting Complex or Cyclosome) is a master ubiquitin protein ligase (E3) that targets regulatory proteins for degradation allowing sister chromatid separation and exit from mitosis. Interestingly, recent work also indicates that the APC/C remains active in differentiated animal and plant cells. However, its role in post-mitotic cells remains elusive and only a few substrates have been characterized. Methodology/Principal Findings In order to identify novel APC/C substrates, we performed a yeast two-hybrid screen using as the bait Arabidopsis APC10/DOC1, one core subunit of the APC/C, which is required for substrate recruitment. This screen identified DRB4, a double-stranded RNA binding protein involved in the biogenesis of different classes of small RNA (sRNA). This protein interaction was further confirmed in vitro and in plant cells. Moreover, APC10 interacts with DRB4 through the second dsRNA binding motif (dsRBD2) of DRB4, which is also required for its homodimerization and binding to its Dicer partner DCL4. We further showed that DRB4 protein accumulates when the proteasome is inactivated and, most importantly, we found that DRB4 stability depends on APC/C activity. Hence, depletion of Arabidopsis APC/C activity by RNAi leads to a strong accumulation of endogenous DRB4, far beyond its normal level of accumulation. However, we could not detect any defects in sRNA production in lines where DRB4 was overexpressed. Conclusions/Significance Our work identified a first plant substrate of the APC/C, which is not a regulator of the cell cycle. Though we cannot exclude that APC/C-dependent degradation of DRB4 has some regulatory roles under specific growth conditions, our work rather points to a housekeeping function of APC/C in maintaining precise cellular-protein concentrations and homeostasis of DRB4.

In eukaryotes, DNA repair pathways help to maintain genome integrity and epigenomic patterns. However, the factors at the nexus of DNA repair and chromatin modification/remodeling remain poorly characterized. Here, we uncover a previously unrecognized interplay between the DNA repair factor DNA DAMAGE BINDING PROTEIN2 (DDB2) and the DNA methylation machinery in Arabidopsis thaliana Loss-of-function mutation in DDB2 leads to genome-wide DNA methylation alterations. Genetic and biochemical evidence indicate that at many repeat loci, DDB2 influences de novo DNA methylation by interacting with ARGONAUTE4 and by controlling the local abundance of 24-nucleotide short interfering RNAs (siRNAs). We also show that DDB2 regulates active DNA demethylation mediated by REPRESSOR OF SILENCING1 and DEMETER LIKE3. Together, these findings reveal a role for the DNA repair factor DDB2 in shaping the Arabidopsis DNA methylation landscape in the absence of applied genotoxic stress.

The ubiquitin-proteasome system is vital to hormone-mediated developmental and stress responses in plants. Ubiquitin ligases target hormone-specific transcriptional activators (TAs) for degradation, but how TAs are processed by proteasomes remains unknown. We report that in Arabidopsis , the salicylic acid– and ethylene-responsive TAs, NPR1 and EIN3, are relayed from pathway-specific ubiquitin ligases to proteasome-associated HECT-type UPL3/4 ligases. Activity and stability of NPR1 were regulated by sequential action of three ubiquitin ligases, including UPL3/4, while proteasome processing of EIN3 required physical handover between ethylene-responsive SCF EBF2 and UPL3/4 ligases. Consequently, UPL3/4 controlled extensive hormone-induced developmental and stress-responsive transcriptional programs. Thus, our findings identify unknown ubiquitin ligase relays that terminate with proteasome-associated HECT-type ligases, which may be a universal mechanism for processive degradation of proteasome-targeted TAs and other substrates.

Protein degradation is essential in plant growth and development. The stability of Cullin3 substrate adaptor protein BPM1 is regulated by multiple environmental cues pointing on manifold control of targeted protein degradation. A small family of six MATH-BTB genes (BPM1-6) is described in Arabidopsis thaliana. BPM proteins are part of the Cullin E3 ubiquitin ligase complexes and are known to bind at least three families of transcription factors: ERF/AP2 class I, homeobox-leucine zipper and R2R3 MYB. By targeting these transcription factors for ubiquitination and subsequent proteasomal degradation, BPMs play an important role in plant flowering, seed development and abiotic stress response. In this study, we generated BPM1-overexpressing plants that showed an early flowering phenotype, resistance to abscisic acid and tolerance to osmotic stress. We analyzed BPM1-GFP protein stability and found that the protein has a high turnover rate and is degraded by the proteasome 26S in a Cullin-dependent manner. Finally, we found that BPM1 protein stability is environmentally conditioned. Darkness and salt stress triggered BPM1 degradation, whereas elevated temperature enhanced BPM1 stability and accumulation in planta.

Studies in plants were often pioneering in the field of RNA silencing and revealed a broad range of small RNA (sRNA) categories. When associated with ARGONAUTE (AGO) proteins, sRNAs play important functions in development, genome integrity, stress responses, and antiviral immunity. Today, most of the protein factors required for the biogenesis of sRNA classes, their amplification through the production of double-stranded RNA, and their function in transcriptional and post-transcriptional regulation have been identified. Nevertheless, and despite the importance of RNA silencing, we still know very little about their post-translational regulation. This is in stark contrast with studies in metazoans, where different modifications such as prolyl hydroxylation, phosphorylation, sumoylation, ubiquitylation, and others have been reported to alter the activity and stability of key factors, such as AGO proteins. Here, we review current knowledge of how key components of the RNA silencing machinery in plants are regulated during development and by microbial hijacking of endogenous proteases.

RNA viruses co-opt the host endomembrane system and organelles to build replication complexes for infection. How the host responds to these membrane perturbations is poorly understood. Here, we explore the autophagic response of Arabidopsis thaliana to three viruses that hijack different cellular compartments. Autophagy is significantly induced within systemically infected tissues, its disruption rendering plants highly sensitive to infection. Contrary to being an antiviral defense mechanism as previously suggested, quantitative analyses of the viral loads established autophagy as a tolerance pathway. Further analysis of one of these viruses, the Turnip Crinkle Virus (TCV) that hijack mitochondria, showed that despite perturbing mitochondrial integrity, TCV does not trigger a typical mitophagy response. Instead, TCV and Turnip yellow mosaic virus (TYMV) infection activates a distinct selective autophagy mechanism, where oligomeric metabolic enzymes moonlight as selective autophagy receptors and degrade key executors of defense and cell death such as EDS1. Altogether, our study reveals an autophagy-regulated metabolic rheostat that gauges cellular integrity during viral infection and degrades cell death executors to avoid catastrophic amplification of immune signaling.

The complexity of the proteasome gene family in higher plants was investigated by identification and sequencing cDNA clones from the Arabidopsis thaliana database showing homologies to 20S proteasome subunits. We identified plant counterparts for each of the 14 proteasomal subunit subfamilies. Moreover, several of them were highly related isoforms. Mapping data indicate a random distribution of the proteasome genes over the Arabidopsis genome.

RNA silencing has become a major focus of molecular and biomedical research in the last decade. This mechanism, which is conserved in most eukaryotes, has been extensively studied and is associated to various pathways implicated in the regulation of development, in the control of transposition events, heterochromatin maintenance and also playing a role in defense against viruses. Despite of its importance, the regulation of the RNA silencing machinery itself remains still poorly explored. Recently several reports in both plants and metazoans revealed that key components of RNA silencing, such as RNA-induced silencing complex component ARGONAUTE proteins, but also the endonuclease Dicer are subjected to proteasomal and autophagic pathways. Here we will review these post-translational proteolytic regulations with a special emphasis on plant research and also discuss their functional relevance.

One of the major challenges for plant science going forward will be to provide the stability and increase in crop yields required to mitigate against climate change and population growth. Understanding how plants cope with changes in the environment by altering their proteome composition, will be an important component of developing approaches to deliver sustainability. In recent years, the cellular processes that change the proteome landscape are beginning to be unravelled. Protein homeostasis (or proteostasis) integrates cellular pathways that mediate biogenesis, folding, trafficking and degradation of polypeptides, to maintain the required concentrations of all proteins that compose the proteome (Fig. 1). As an example, changes in protein concentration can be the result of the degradation of transcription factors to modulate a transcriptional response, or the endocytosis and transport into the vacuole for degradation of activated receptor kinases. Other proteins that are required in higher concentrations can be stabilized by inhibition of their degradation, induced biosynthesis. Proteostasis is the result of the constant interplay between protein degradation and biosynthetic pathways, which allows cells to modulate the concentration of each protein with exquisite precision. Advances in genomics and proteomic analyses have revealed that biological complexity is largely orchestrated not through gene number but by variation at the protein level (proteoforms; Aebersold et al., 2018). Post-translational modification (PTM) events create a plethora of proteoforms to proteome generate flexibility in almost every biological process. Furthermore, the dynamic nature of PTMs achieved through covalent attachment of ubiquitin and ubiquitin-like proteins allows organisms, particularly plants with their inherently sessile nature, to respond to even highly transient changes in the environment with precise fine-tuning. In response to environmental cues, these protein modifications provide a fast and easily reversible modulation of protein function, which can regulate the intensity and amplitude of cellular responses to stress. The Plant Proteostasis community encompasses scientists working on diverse aspects of plant proteostasis, such as protein translation, protein quality control, proteases, PTMs including ubiquitin and ubiquitin-like proteins, vesicular traffic, autophagy, as well as proteasomal and vacuolar degradation (Fig. 1). Protein degradation systems have taken centre stage in investigations of proteoform function, as they are pivotal to ensure proteostasis during stress. These include the proteasomal and vacuolar degradation pathways, both of which encompass a variety of processes including the endocytic degradatory route, as well as other pathways driven by PTMs such as ubiquitination and SUMOylation, and related modifications such as involved in autophagy. The Arabidopsis genome project identified more than a thousand genes encoding components of protein degradation pathways, potentially representing c. 8% of the entire plant protein-coding genome, far more than any other eukaryote group, indicating that control of protein stability is a key adaptive trait for plants. Mutations in components of these systems affect all aspects of plant development, abiotic stress tolerance and pathogen defence. To date, every single plant hormone signalling pathway has been shown to be regulated by protein ubiquitination. More intriguing is the fact that a number of phytohormones are directly perceived by components of the ubiquitination machinery. This could be due to the high level of substrate selectivity built within the ubiquitin E3 targeting system, illustrating the extent to which plants have evolved to rely on protein degradation as a central signalling mechanism. In the last two decades, research in the area of plant proteostasis has been intense, and resulted in many ground-breaking discoveries that have significantly enhanced our understanding of plant cellular signalling. However, many key questions remain unanswered, and in particular, the molecular interaction between the different areas of proteostasis and signalling consequences remains an important under-investigated area. Research in the past concentrated on loss-of-function genetic approaches, or constitutive or conditional induction of specific pathways such as autophagy. However, to obtain mechanistic insights of the pathways safeguarding proteostasis, novel approaches are required. In recent years the Plant Proteostasis research community has developed new tools, such as ratiometric reports to quantify protein degradation, as presented by Freddie Theodooulou (Rothamsted Research, Harpenden, UK), the use of pathogen effectors, synthetic and computational biology and new methods of mass-spectrometric analysis (discussed in Kowarschik et al., 2017; Stephani et al., 2019). The Plant Proteostasis community did not have an on-going meeting structure to share data, tools and build research collaborations to move the field forward. The two-day New Phytologist Workshop at Durham University (UK) in July 2018 brought together key researchers in this community to develop a strategic meeting structure to focus on the role of proteostasis in diverse aspects of plant development and response to the environment. The success of the New Phytologist Workshop underpinned the organization of a larger conference in Freiburg in September 2019 with more diverse sponsorship and participants, as well as a significantly greater number of participants, including many early career researchers. An overview of the topics discussed at the Freiburg Proteostasis meeting is given below. Ubiquitin and the ubiquitin-like proteins, SUMO and NEDD8, form a family of small proteins that are covalently attached to substrates for the PTM of cellular proteins. Their covalent attachment to target proteins provides a fast and reversible modulation of protein function and turnover. The central nature of these modifiers meant that an important focus of the Freiburg Proteostasis meeting was on processes that regulate ubiquitin and ubiquitin-like pathways. While we are beginning to understand the effects of PTMs on target proteins, the control of the processes leading to the modification of target proteins is also an active field of research. Claus Schwechheimer (Technical University of Munich, Germany) showed that in neddylation, the autoneddylation of the E1 activating enzyme can determine the activity of the ubiquitin conjugating enzyme (E2), and this process is closely regulated by the activity of NEDD8 proteases (Mergner et al., 2017). Ari Sadanandom (Durham University, UK) presented evidence that the specificity of SUMOylation, for which only three types of E3 ligases have been described so far, is potentially dependent on SUMO proteases. In stark contrast, over 1500 E3 ligases provide specificity to the ubiquitin modification system. Cleaving SUMO from target proteins may thus be an important mechanism providing reversibility to the pathway and controlling the intensity of dependant cellular responses (Orosa et al., 2018; Srivastava et al., 2018, 2020). Ubiquitin can be conjugated to substrates as a monomer or as a chain of different lengths interlinked to any of its seven lysine residues, or to the methionine in position 1. The linkage-type of the ubiquitin chain determines the fate of the substrate protein, leading to either degradation or to non-proteolytic alteration. E2s catalyse the attachment of ubiquitin to target proteins, and they contribute to determining ubiquitin chain linkages. Marco Trujillo (University of Freiburg, Germany) reported that E2 and E3 ubiquitin ligase enzymes interact dynamically in vivo, and that an E3 ligase can interact with multiple E2 conjugating enzymes, which cooperate to build ubiquitin chains (Trujillo, 2017; Turek et al., 2018). Gregory Vert (University of Toulouse, France) discussed the characterization of two E2 enzymes responsible for building K63-linked chains, and revealed K63-polyubiquitin networks and the connection to multiple E3 ligases. Erika Isono (University Konstanz, Germany) presented evidence that K63-linked chains are also a key signal that is deciphered by ubiquitin adaptor proteins at the endosomal sorting complex in protein trafficking (Mosesso et al., 2019). Beatriz Orosa (University of Edinburgh, UK) reported that proteins with some of these ubiquitin chain linkages accumulate during plant immune responses and are associated with specific E3 ligases. Luz Irina A. Calderón Villalobos (Leibniz IPB, Halle (Saale), Germany) elaborated on structural proteomics advancements to capture E3–target protein ensembles, and on the role of intrinsically disordered degrons in ubiquitylation targets for hormone-driven recognition by Cullin RING-type E3s (Winkler et al., 2017; Niemeyer et al., 2019). Steven Spoel (University of Edinburgh, UK) reported that a family of E3 ligases physically associate with the proteasome, potentially constituting an additional layer of regulation for previously ubiquitinated proteins targeted for degradation. Concomitant to the understanding of their regulation, the specific biological roles of ubiquitination and ubiquitin-like modifications is starting to be deciphered. A main focus has been the interplay between these modifications and immunity. Ubiquitin and ubiquitin-like pathways regulate every layer of immunity from perception to plant reprogramming (Orosa et al., 2018; Turek et al., 2018; Skelly et al., 2019). Key regulators in immunity appear to be tightly regulated by one or more PTM(s). For instance, the cell surface-resident receptor Flagellin Sensitive 2 (FLS2) is modified by SUMO (Orosa et al., 2018), ubiquitin (Lu et al., 2011), phosphorylation (Cao et al., 2013) and S-acylation (Hurst et al., 2019). In fact, the interplay between these modifications is critical for cell signalling. Jacqueline Monaghan (Queen's University, Kingston, Canada) talked about the interplay between phosphorylation and ubiquitination, where a kinase regulates the activity of immune-related E3 ligases, enhancing its ability to ubiquitinate the key immune kinase BIK1 (Monaghan et al., 2015). Similarly, Libo Shan (Texas A&M University, College Station, TX, USA) focused on how ubiquitination regulates cell surface receptor-like kinase complexes involved in immunity and growth, such as BAK1 (Zhou et al., 2019). The relevance of PTMs in plant immune responses is highlighted by the fact that these mechanisms are targeted by pathogens to disable plant immune responses. Paul Birch (University of Dundee, UK) and Pascal Genschik (IMBP-CNRS, France) discussed the capacity of different pathogens, fungi and viruses respectively, to hijack plant E3 ligases to avoid plant immunity and establish infection (Michaeli et al., 2019). Ubiquitin and ubiquitin-like modifications are also involved in the regulation of many other cellular processes. Pedro Rodriguez (IMBCP, Valencia, Spain) revealed that cullin3 (CUL3)-RING-based E3 ligases (CRL3s), target PP2Cs for degradation in a mechanism that is complementary to inhibition of PP2Cs by the ABA receptors PYR/PYL/RCAR during drought (Julian et al., 2019). Judy Callis (University of California Davis, USA) reported on the function of a membrane associated RING domain E3 ligase that governs amino acid secretion in Arabidopsis (Pratelli et al., 2012). Daniel Gibbs (University of Birmingham, UK) described for the first time how a group of E3 ligases may be associated with the regulation of mRNA translation, while Pablo Pulido (University of Oxford, UK) showed the importance of E3s in chloroplast envelope-protein removal and their degradation by the cytosolic 26S proteasome (Ling et al., 2019). Ute Hoecker (University of Cologne, Germany) reported how the control of light signal transduction is connected to ubiquitination via the activity of specific E3 ligases in a light-dependent manner (Ordoñez-Herrera et al., 2018), Sandra Noir (IMBP-CNRS, France) revealed the role of the ubiquitin pathway in cell cycle control and DNA damage responses (Noir et al., 2015 and unpublished data), while Michael Holdsworth (University of Nottingham, UK) discussed novel functions of the plant N-degron pathways. The relevance of these pathways across evolution was highlighted by Roberto Solano (CNB-CSIC, Madrid, Spain), who reported during his EMBO keynote lecture the functional conservation of the E3 complex co-receptor COI1 across 450 million years of evolution (Monte et al., 2019). Maria Lois (CRAG, Barcelona, Spain) showed that the E2 binding region in E1 activating enzymes is conserved only across phylogenetically closely related species (Liu et al., 2019). In the last 10 years, numerous efforts have been made to unravel how autophagy functions at the molecular level, and which processes are tightly associated with this degradation mechanism. Autophagy is implicated in a plethora of cellular processes in plants including reproduction, development, hormone signalling, cellular homeostasis, senescence, abiotic and biotic stress responses. Autophagy relies on a core set of conserved autophagy-related (ATG) genes to form double membrane compartments, termed autophagosomes, that sequester and deliver cytoplasmic cargo to the lytic vacuole for breakdown and recycling (Marshall & Vierstra, 2018). ATG8 proteins are required for membrane expansion and found on autophagosomes until their lytic destruction. Similar to the proteasomal pathway, autophagy is a major degradation route implicated in safeguarding cellular homeostasis, implicated in stress tolerance and immunity in eukaryotic organisms (Marshall & Vierstra, 2018). For a long time, autophagy was regarded as a largely unspecific (‘bulk’) degradation mechanism mainly recycling unwanted cytoplasmic contents. However, new evidence indicates that autophagy acts as a highly selective mechanism to target various components including proteins, organelles, or viral proteins, under different stress conditions (Marshall & Vierstra, 2018). Specificity is driven by autophagic receptors that interact with both ATG8 and ubiquitin, which are attached to autophagosomes and cargo, respectively. This surfacing view was best reflected by Richard Vierstra (Washington University, St Louis, MO, USA), who posed the question during his keynote lecture: ‘Is there even bulk autophagy, or is everything selective autophagy?’ His laboratory recently identified a new class of autophagy adaptors that were previously classified as ubiquitin-interacting motifs (UIMs)-like sequences, rather than the classical ATG8-interacting motif (AIM) (Marshall et al., 2019). This study revealed a large collection of novel ATG8 interactors in plants, yeast, and humans, expanding the repertoire of possible selective autophagy adaptors and potential autophagy cargo. These findings strongly suggest that there is even more specificity to autophagic degradation than previously assumed. In addition to its role in cellular housekeeping and development, autophagy is also implicated in plant–pathogen interactions (Üstün et al., 2017, 2018; Leary et al., 2019). Recent efforts revealed that the hemi-biotrophic oomycete Phytophthora infestans evolved the effector protein PexRD54 to counteract selective autophagy-mediated pathogen restriction (Dagdas et al., 2016, 2018). Along this line, the bacterial pathogen Pseudomonas syringae pv. tomato activates autophagy to mediate proteasome degradation and enhance its virulence (Üstün et al., 2018). Both Alex Leary (Imperial College, London, UK) and Suayib Üstün (University of Tübingen, Germany) introduced pathogenic effector molecules as tools to dissect the autophagy pathway and its role during plant defence responses. Of note, both speakers emphasized the tight interconnection between vesicle trafficking and autophagy during plant immunity, which is an upcoming theme in autophagy research (Zeng et al., 2019). Accordingly, Xiaohong Zhuang (Chinese University of Hong Kong, China) reported on how the BAR-domain protein SH3P2 regulates autophagosome formation (Zhuang et al., 2013), while also being involved in intracellular trafficking (Mosesso et al., 2019) and cytokinesis (Ahn et al., 2017). SH3P2 might be a perfect example showcasing the implication of proteins in autophagy, as well as vesicular traffic, thus connecting different pathways to autophagy. It is therefore not surprising that a bacterial effector targets this multi-functional protein to perturb autophagy and other cellular trafficking processes, which was introduced by Suayib Üstün. Marisa Otegui (University of Wisconsin-Madison, USA) presented an electron tomography approach to look at membrane remodelling during endosomal sorting, which may prove to be a valuable addition to our current toolbox to study autophagy responses. In addition to studies of plant immunity, Daphne Goring provided evidence on the role of autophagy in Brassicaceae self-incompatibility. Their findings reveal that autophagy is upregulated during pollen rejection (Doucet et al., 2019; Jany et al., 2019). In parallel, vesicle trafficking seems to be inhibited during self-incompatibility, again suggesting an interplay between vesicle transport and autophagy. Markus Wirtz discussed how sulphur deficiency activates the autophagy pathway (Dong et al., 2017) and follow-up studies on tissue-specific autophagy responses. Yasin Dagdas (GMI, Vienna, Austria) emphasized their efforts to develop new tools to study autophagy to circumvent the problem of pleiotropic autophagy mutants. His group is studying the autophagy degradome and ATG8-related specificity (Zess et al., 2019). With these new tools they were able to reveal new insights about the unfolded protein response and autophagy pathway. With regard to abiotic stress, Venkatesh P. Thirumalaikumar (Max Planck Institute for Molecular Plant Physiology, Potsdam, Germany) introduced the role of autophagy in resetting cellular memory of heat stress (Sedaghatmehr et al., 2018), which may be mediated by the selective autophagy adaptor NBR1, previously involved in aggregate clearance during heat stress (Zhou et al., 2013). Nuria S. Coll (CRAG, Barcelona, Spain) also discussed the role and dynamics of stress-induced protein aggregates in plants and which potential mechanisms are required to degrade them. This meeting highlighted the emerging view that ubiquitin and ubiquitin-like pathways regulate a huge diversity of layers of plant growth, development and response to the environment, from perception to transcriptional reprogramming, and our understanding of their mechanisms is rapidly increasing. However, there are still many key questions to be answered: How are the distinct ubiquitin signals generated and transduced into specific responses? What is the degradome upon specific stimuli, how does it impact cellular processes and how is it regulated? These active and fruitful lines of research will continue to shed light into the specific regulation and the biological relevance of these highly conserved ubiquitin and ubiquitin-like processes, and should allow the development of much-needed new strategies for increasing crop productivity in a time of changing global climate. Several common themes surfaced during the meeting: (1) the diversity of mechanisms in place that regulate ubiquitin and ubiquitin-like pathways; (2) the critical role of ubiquitin and ubiquitin-like proteins in controlling cell-signalling; (3) the evolutionary conservation of these pathways across millions of years of plant evolution; (4) the interplay of autophagy with other cellular pathways, such as vesicular trafficking and proteasomal degradation; (5) a surge of selectivity components in autophagy, and (6) using pathogens effectors as tools to dissect protein degradation pathways. Overall two messages were clear: first, ubiquitin and ubiquitin-like pathways provide a fast and reversible modulation of protein function, which modulates the cellular proteome in response to stressors. And second, even though it is now well-established under which conditions degradation pathways are activated, we are still a long way from identifying and understanding the degradation landscapes, the ‘degradome’. This is most acute for autophagy, where a rapidly increasing number of potential selective autophagy adaptors are being identified, but not the specific targets they recognize. The identification of proteins targeted for degradation during environmental stress conditions will be an important step in developing strategies to generate plants that are more resilient. New techniques such as TurboID, cell-type specific systems for modulation of protein degradation and a focus on the possible functional specialization of degradation signals such as ATG8 isoforms, or specific ubiquitin chain types, might help us to decipher the degradome. The Proteostasis 2019 meeting in Freiburg showcased the rich and varied research environment encompassing plant proteostasis, and future meetings should continue to enhance this thriving community. Its success is also reflected by the eagerness to continue this line of meetings in order to provide a venue for the Plant Proteostasis community. The next International Conference on Plant Proteostasis will take place in 2022. Moreover, to increase dialogue within the larger international community, a Gordon Conference on Plant Proteolysis will take place in July 2021. The first of these biannual meetings under the theme ‘Towards an integrative understanding of proteolysis in plant biology’, will take place in the United States, and aims to bring together the scientific communities working on proteostasis and proteases. To reach out to the global community and increase information exchange, a Proteostasis network was started on the Plantae digital platform (https://plantae.org/), a crowdsourced initiative powered by the ASPB. Changing global climate, with increasing temperatures and extreme weather patterns, poses additional challenges for the maintenance of cellular homeostasis in crop plants, which has a direct negative impact on crop growth, resulting in increasing yield penalties. Hence, the identification of agronomically relevant traits and the development of strategies to buffer negative effects on yield, are of paramount importance. Proteolytic pathways provide a wide and novel spectrum of possibilities to reach these goals. We apologize to the colleagues that were not mentioned in this short report but contributed to the success of the International Conference on Plant Proteostasis.

Endomitosis and endoreplication are atypical modes of cell cycle that results in genome duplication in single nucleus. Because the cell size of given cell type is generally proportional to the nuclear DNA content, endoreplication and endomitosis are effective strategy of cell growth, which are widespread in multicellular organisms, especially those in plant kingdom. We found that these processes might be differently regulated by GIGAS CELL1 (GIG1) and its paralog UV-INSENSITIVE4 (UVI4) in Arabidopsis thaliana. GIG1 and UVI4 may negatively regulate activities of anaphase-promoting complex or cyclosome (APC/C) ubiquitin ligase that acts as an important mitotic regulator. The gig1 mutation induced ectopic occurrence of endomitosis during somatic cell division, while it has been reported that uvi4 mutation resulted in premature occurrence of endoreplication during organ development. Overexpression of GIG1 and UVI4 dramatically increased the amount of mitotic cyclin, CYCB1;1, a well-known substrate of APC/C. Ectopic endomitosis in gig1 was enhanced by mutation in CYCB2;2 and suppressed by downregulation of APC10 encoding a core subunit of APC/C. Overexpression of CDC20.1, an activator protein of APC/C, further promoted the ectopic endomitosis in gig1. These findings suggest that endomitosis and endoreplication are regulated by similar molecular mechanisms, in which two related proteins, GIG1 and UVI4, may inhibit APC/C in different ways.

Real interesting new gene (RING) finger proteins act as E3 ubiquitin-protein ligases and play critical roles in targeting the destruction of proteins of diverse functions in all eukaryotes, ranging from yeast to mammals. Arabidopsis genome contains a large number of genes encoding RING finger proteins. In this report we describe the identification of more than 40 RING-H2 finger proteins that are of small size, not more than 200 amino acids, and contain no other recognizable protein-protein interaction domain(s). We characterize RHA2b, one of these small RING-H2 finger genes. A gene trap line, SGT6304, was identified to contain a Dissociation (Ds) insertion in RHA2b gene. No RHA2b transcript was detected in the homozygous SGT6304 plants. Despite the elimination of RHA2b function, homozygous SGT6304 plants lacked detectable growth or development defects, suggesting functional redundancy of RHA2b with other RING finger genes. Expression of RHA2b was specifically active in vascular tissue and in upper pistil of inflorescence as well as in root tip and shoot apical meristem region. Potential functions of ubiquitin-proteolysis pathway in vascular formation and in fertilization are discussed.

Abstract Maintenance of genome integrity depends on controlling the availability of DNA replication initiation proteins, e.g., CDT1, a component of the pre-replication complexes that regulates chromatin licensing for replication. To understand the evolutionary history of CDT1 regulation, we have identified the mechanisms involved in CDT1 dynamics. During cell cycle, CDT1a starts to be loaded early after mitotic exit and maintains high levels until the G1/S transition. Soon after the S-phase onset, CDT1a is rapidly degraded in a proteasome-dependent manner. Plant cells use a specific SCF-mediated pathway that relies on the FBL17 F-box protein for CDT1a degradation, which is independent of CUL4a-containing complexes. A similar oscillatory pattern occurs in endoreplicating cells, where CDT1a is loaded just after finishing the S-phase. CDT1a is necessary to maintain genome stability, an ancient strategy although unique proteins and mechanisms have evolved in different eukaryotic lineages to ensure its degradation during S-phase. Impact statement The DNA replication protein CDT1a is crucial for genome integrity and is targeted for proteasome degradation just after S-phase initiation by FBL17 in proliferating and endoreplicating cells of Arabidopsis

Summary Agrobacterium T‐DNA‐encoded 6B proteins cause remarkable growth effects in plants. Nicotiana otophora carries two cellular T‐DNAs with three slightly divergent 6b genes ( TE‐1‐6b‐L , TE‐1‐6b‐R and TE‐2‐6b ) originating from a natural transformation event. In Arabidopsis thaliana , expression of 2× 35S:TE‐2‐6b , but not 2× 35S:TE‐1‐6b‐L or 2× 35S:TE‐1‐6b‐R , led to plants with crinkly leaves, which strongly resembled mutants of the miR319a/ TCP module. This module is composed of MIR319A and five CIN ‐like TCP ( TEOSINTHE BRANCHED1, CYCLOIDEA and PROLIFERATING CELL NUCLEAR ANTIGEN BINDING FACTOR ) genes ( TCP2 , TCP3 , TCP4 , TCP10 and TCP24 ) targeted by miR319a. The CIN ‐like TCP genes encode transcription factors and are required for cell division arrest at leaf margins during development. MIR319A overexpression causes excessive growth and crinkly leaves. TE‐2‐6b plants did not show increased miR319a levels, but the mRNA levels of the TCP4 target gene LOX2 were decreased, as in jaw‐D plants. Co‐expression of green fluorescent protein (GFP)‐tagged TCPs with native or red fluorescent protein (RFP)‐tagged TE‐6B proteins led to an increase in TCP protein levels and formation of numerous cytoplasmic dots containing 6B and TCP proteins. Yeast double‐hybrid experiments confirmed 6B/TCP binding and showed that TE‐1‐6B‐L and TE‐1‐6B‐R bind a smaller set of TCP proteins than TE‐2‐6B. A single nucleotide mutation in TE‐1‐6B‐R enlarged its TCP‐binding repertoire to that of TE‐2‐6B and caused a crinkly phenotype in Arabidopsis. Deletion analysis showed that TE‐2‐6B targets the TCP4 DNA‐binding domain and directly interferes with transcriptional activation. Taken together, these results provide detailed insights into the mechanism of action of the N. otophora TE‐encoded 6b genes.

This chapter contains sections titled: The Molecular Machinery Mediating Ubiquitin-Dependent Proteolysis The SCF and APC/C: the two Master E3s Regulating the Cell Cycle Cell Cycle Targets of the Proteolytic Machinery Conclusion

ABSTRACT Plant RNA viruses form highly organized membrane-bound virus replication complexes (VRCs) to replicate their genome and multiply. This process requires both virus- and host-encoded proteins and leads to the production of double-stranded RNA (dsRNA) intermediates of replication that trigger potent antiviral defenses in all eukaryotes. In this work, we describe the use of A. thaliana constitutively expressing GFP-tagged dsRNA-binding protein (B2:GFP) to pull down viral replicating RNA and associated proteins in planta upon infection with tobacco rattle virus (TRV). Mass spectrometry analysis of the dsRNA-B2:GFP-bound proteins from TRV-infected plants revealed the presence of (i) viral proteins such as the replicase, which attested to the successful isolation of VRCs, and (ii) a number of host proteins, some of which have previously been involved in virus infection. Among a set of nine selected such host candidate proteins, eight showed dramatic re-localization upon infection, and seven of these co-localized with B2-labeled TRV replication complexes, providing ample validation for the immunoprecipitation results. Infection of A. thaliana T-DNA mutant lines for eight of these factors revealed that genetic knock-out of the Double-stranded RNA-Binding protein 2 (DRB2) leads to increased TRV accumulation. In addition, over-expression of this protein caused a dramatic decrease in the accumulation of four unrelated plant RNA viruses, indicating that DRB2 has a potent and wide-ranging antiviral activity. We therefore propose B2:GFP-mediated pull down of dsRNA to be a novel and robust method to explore the proteome of VRCs in planta , allowing the discovery of key players in the viral life cycle. AUTHOR SUMMARY Viruses are an important class of pathogens that represent a major problem for human, animal and plant health. They hijack the molecular machinery of host cells to complete their replication cycle, a process frequently associated with the production of double-stranded RNA (dsRNA) that is regarded as a universal hallmark of infection by RNA viruses. Here we exploited the capacity of a GFP-tagged dsRNA-binding protein stably expressed in transgenic Arabidopsis to pull down dsRNA and associated proteins upon virus infection. In this manner we specifically captured short and long dsRNA from tobacco rattle virus (TRV) infected plants, and successfully isolated viral proteins such as the replicase, which attested to the successful isolation of virus replication complexes (VRCs). More excitingly, a number of host proteins, some of which have previously been involved in virus infection, were also captured. Remarkably, among a set of nine host candidates that were analyzed, eight showed dramatic re-localization to viral factories upon infection, and seven of these co-localized dsRNA-labeled VRCs. Genetic knock-out and over-expression experiments revealed that one of these proteins, A. thaliana DRB2, has a remarkable antiviral effect on four plant RNA viruses belonging to different families, providing ample validation of the potential of this experimental approach in the discovery of novel defense pathways and potential biotech tools to combat virus infections in the field. Being compatible with any plant virus as long as it infects Arabidopsis, we propose our dsRNA-centered strategy to be a novel and robust method to explore the proteome of VRCs in planta .