Nina Raben

The beta 3-adrenergic receptor is expressed in visceral adipose tissue and is thought to contribute to the regulation of the resting metabolic rate and lipolysis.To investigate whether mutations in the gene for the beta 3-adrenergic receptor predispose patients to obesity and non-insulin-dependent diabetes mellitus (NIDDM), we studied this gene in 10 Pima Indians by analysis of single-stranded conformational polymorphisms and dideoxy sequence analysis. Association studies were performed in 642 Pima subjects (390 with NIDDM and 252 without NIDDM).A missense mutation was identified in the gene for the beta 3-adrenergic receptor that results in the replacement of tryptophan by arginine (Trp64Arg) in the first intracellular loop of the receptor. This mutation was detected with allelic frequencies of 0.31 in Pima Indians, 0.13 in 62 Mexican Americans, 0.12 in 49 blacks, and 0.08 in 48 whites in the United States. Among Pimas, the frequency of the Trp64Arg mutation was similar in nondiabetic and diabetic subjects. However, in subjects homozygous for the mutation the mean (+/- SD) age at the onset of NIDDM was significantly lower (36 +/- 10 years) than in Trp64Arg heterozygotes (40 +/- 10 years) or normal homozygotes (41 +/- 11 years; P = 0.02). Furthermore, subjects with the mutation tended to have a lower adjusted resting metabolic rate (P = 0.14 by analysis of covariance).Pima subjects homozygous for the Trp64Arg beta 3-adrenergic-receptor mutation have an earlier onset of NIDDM and tend to have a lower resting metabolic rate. This mutation may accelerate the onset of NIDDM by altering the balance of energy metabolism in visceral adipose tissue.

The discovery of a gene network regulating lysosomal biogenesis and its transcriptional regulator transcription factor EB (TFEB) revealed that cells monitor lysosomal function and respond to degradation requirements and environmental cues. We report the identification of transcription factor E3 (TFE3) as another regulator of lysosomal homeostasis that induced expression of genes encoding proteins involved in autophagy and lysosomal biogenesis in ARPE-19 cells in response to starvation and lysosomal stress. We found that in nutrient-replete cells, TFE3 was recruited to lysosomes through interaction with active Rag guanosine triphosphatases (GTPases) and exhibited mammalian (or mechanistic) target of rapamycin complex 1 (mTORC1)-dependent phosphorylation. Phosphorylated TFE3 was retained in the cytosol through its interaction with the cytosolic chaperone 14-3-3. After starvation, TFE3 rapidly translocated to the nucleus and bound to the CLEAR elements present in the promoter region of many lysosomal genes, thereby inducing lysosomal biogenesis. Depletion of endogenous TFE3 entirely abolished the response of ARPE-19 cells to starvation, suggesting that TFE3 plays a critical role in nutrient sensing and regulation of energy metabolism. Furthermore, overexpression of TFE3 triggered lysosomal exocytosis and resulted in efficient cellular clearance in a cellular model of a lysosomal storage disorder, Pompe disease, thus identifying TFE3 as a potential therapeutic target for the treatment of lysosomal disorders.

Familial Mediterranean fever (FMF) is an inherited disorder characterized by recurrent episodes of fever and inflammation. Most patients with FMF carry missense mutations in the C-terminal half of the pyrin protein. To study the physiologic role of pyrin, we generated mice expressing a truncated pyrin molecule that, similar to FMF patients, retains the full PYRIN domain. Bacterial lipopolysaccharide (LPS) induces accentuated body temperatures and increased lethality in homozygous mutant mice. When stimulated, macrophages from these mice produce increased amounts of activated caspase-1 and, consequently, elevated levels of mature IL-1β. Full-length pyrin competes in vitro with caspase-1 for binding to ASC, a known caspase-1 activator. Apoptosis is impaired in macrophages from pyrin-truncation mice through an IL-1-independent pathway. These data support a critical role for pyrin in the innate immune response, possibly by acting on ASC, and suggest a biologic basis for the selection of hypomorphic pyrin variants in man. Familial Mediterranean fever (FMF) is an inherited disorder characterized by recurrent episodes of fever and inflammation. Most patients with FMF carry missense mutations in the C-terminal half of the pyrin protein. To study the physiologic role of pyrin, we generated mice expressing a truncated pyrin molecule that, similar to FMF patients, retains the full PYRIN domain. Bacterial lipopolysaccharide (LPS) induces accentuated body temperatures and increased lethality in homozygous mutant mice. When stimulated, macrophages from these mice produce increased amounts of activated caspase-1 and, consequently, elevated levels of mature IL-1β. Full-length pyrin competes in vitro with caspase-1 for binding to ASC, a known caspase-1 activator. Apoptosis is impaired in macrophages from pyrin-truncation mice through an IL-1-independent pathway. These data support a critical role for pyrin in the innate immune response, possibly by acting on ASC, and suggest a biologic basis for the selection of hypomorphic pyrin variants in man.

Lysosomes are ubiquitous intracellular organelles that have an acidic internal pH, and play crucial roles in cellular clearance. Numerous functions depend on normal lysosomes, including the turnover of cellular constituents, cholesterol homeostasis, downregulation of surface receptors, inactivation of pathogenic organisms, repair of the plasma membrane and bone remodeling. Lysosomal storage disorders (LSDs) are characterized by progressive accumulation of undigested macromolecules within the cell due to lysosomal dysfunction. As a consequence, many tissues and organ systems are affected, including brain, viscera, bone and cartilage. The progressive nature of phenotype development is one of the hallmarks of LSDs. In recent years biochemical and cell biology studies of LSDs have revealed an ample spectrum of abnormalities in a variety of cellular functions. These include defects in signaling pathways, calcium homeostasis, lipid biosynthesis and degradation and intracellular trafficking. Lysosomes also play a fundamental role in the autophagic pathway by fusing with autophagosomes and digesting their content. Considering the highly integrated function of lysosomes and autophagosomes it was reasonable to expect that lysosomal storage in LSDs would have an impact upon autophagy. The goal of this review is to provide readers with an overview of recent findings that have been obtained through analysis of the autophagic pathway in several types of LSDs, supporting the idea that LSDs could be seen primarily as “autophagy disorders.”

In recent years, our vision of lysosomes has drastically changed. Formerly considered to be mere degradative compartments, they are now recognized as key players in many cellular processes. The ability of lysosomes to respond to different stimuli revealed a complex and coordinated regulation of lysosomal gene expression. This review discusses the participation of the transcription factors TFEB and TFE3 in the regulation of lysosomal function and biogenesis, as well as the role of the lysosomal pathway in cellular adaptation to a variety of stress conditions, including nutrient deprivation, mitochondrial dysfunction, protein misfolding, and pathogen infection. We also describe how cancer cells make use of TFEB and TFE3 to promote their own survival and highlight the potential of these transcription factors as therapeutic targets for the treatment of neurological and lysosomal diseases.

Abstract Objective The etiology and pathogenesis of human inflammatory myopathies remain unclear. Findings of several studies suggest that the degree of inflammation does not correlate consistently with the severity of clinical disease or of structural changes in the muscle fibers, indicating that nonimmune pathways may contribute to the pathogenesis of myositis. This study was undertaken to investigate these pathways in myositis patients and in a class I major histocompatibility complex (MHC)–transgenic mouse model of myositis. Methods We examined muscle tissue from human myositis patients and from class I MHC–transgenic mice for nonimmune pathways, using biochemical, immunohistochemical, and gene expression profiling assays. Results Up‐regulation of class I MHC in skeletal muscle fibers was an early and consistent feature of human inflammatory myopathies. Class I MHC staining in muscle fibers of myositis patients showed both cell surface and a reticular pattern of internal reactivity. The pathways of endoplasmic reticulum (ER) stress response, the unfolded protein response (glucose‐regulated protein 78 pathway), and the ER overload response (NF‐κB pathway) were significantly activated in muscle tissue of human myositis patients and in the mouse model. Ectopic expression of wild‐type mouse class I MHC (H‐2K b ) but not degradable glycosylation mutants of H‐2K b induced ER stress response in C 2 C 12 skeletal muscle cells. Conclusion These results indicate that the ER stress response may be a major nonimmune mechanism responsible for skeletal muscle damage and dysfunction in autoimmune myositis. Strategies to interfere with this pathway may have therapeutic value in patients with this disease.

The role of autophagy, a catabolic lysosome-dependent pathway, has recently been recognized in a variety of disorders, including Pompe disease, the genetic deficiency of the glycogen-degrading lysosomal enzyme acid-alpha glucosidase. Accumulation of lysosomal glycogen, presumably transported from the cytoplasm by the autophagic pathway, occurs in multiple tissues, but pathology is most severe in skeletal and cardiac muscle. Skeletal muscle pathology also involves massive autophagic buildup in the core of myofibers. To determine if glycogen reaches the lysosome via autophagy and to ascertain whether autophagic buildup in Pompe disease is a consequence of induction of autophagy and/or reduced turnover due to defective fusion with lysosomes, we generated muscle-specific autophagy-deficient Pompe mice. We have demonstrated that autophagy is not required for glycogen transport to lysosomes in skeletal muscle. We have also found that Pompe disease involves induction of autophagy but manifests as a functional deficiency of autophagy because of impaired autophagosomal–lysosomal fusion. As a result, autophagic substrates, including potentially toxic aggregate-prone ubiquitinated proteins, accumulate in Pompe myofibers and may cause profound muscle damage.

Abstract A recently proposed therapeutic approach for lysosomal storage disorders (LSDs) relies upon the ability of transcription factor EB (TFEB) to stimulate autophagy and induce lysosomal exocytosis leading to cellular clearance. This approach is particularly attractive in glycogen storage disease type II [a severe metabolic myopathy, Pompe disease (PD)] as the currently available therapy, replacement of the missing enzyme acid alpha‐glucosidase, fails to reverse skeletal muscle pathology. PD, a paradigm for LSDs, is characterized by both lysosomal abnormality and dysfunctional autophagy. Here, we show that TFEB is a viable therapeutic target in PD: overexpression of TFEB in a new muscle cell culture system and in mouse models of the disease reduced glycogen load and lysosomal size, improved autophagosome processing, and alleviated excessive accumulation of autophagic vacuoles. Unexpectedly, the exocytosed vesicles were labelled with lysosomal and autophagosomal membrane markers, suggesting that TFEB induces exocytosis of autophagolysosomes. Furthermore, the effects of TFEB were almost abrogated in the setting of genetically suppressed autophagy, supporting the role of autophagy in TFEB‐mediated cellular clearance.

To understand the mechanisms of skeletal muscle destruction and resistance to enzyme replacement therapy in Pompe disease, a deficiency of lysosomal acid alpha-glucosidase (GAA), in which glycogen accumulates in lysosomes primarily in cardiac and skeletal muscles.We have analyzed compartments of the lysosomal degradative pathway in GAA-deficient myoblasts and single type I and type II muscle fibers isolated from wild-type, untreated, and enzyme replacement therapy-treated GAA knock-out mice.Studies in myoblasts from GAA knock-out mice showed a dramatic expansion of vesicles of the endocytic/autophagic pathways, decreased vesicular movement in overcrowded cells, and an acidification defect in a subset of late endosomes/lysosomes. Analysis by confocal microscopy of isolated muscle fibers demonstrated that the consequences of the lysosomal glycogen accumulation are strikingly different in type I and II muscle fibers. Only type II fibers, which are the most resistant to therapy, contain large regions of autophagic buildup that span the entire length of the fibers.The vastly increased autophagic buildup may be responsible for skeletal muscle damage and prevent efficient trafficking of replacement enzyme to lysosomes.

The activation of transcription factors is critical to ensure an effective defense against pathogens. In this study we identify a critical and complementary role of the transcription factors TFEB and TFE3 in innate immune response. By using a combination of chromatin immunoprecipitation, CRISPR-Cas9-mediated genome-editing technology, and in vivo models, we determined that TFEB and TFE3 collaborate with each other in activated macrophages and microglia to promote efficient autophagy induction, increased lysosomal biogenesis, and transcriptional upregulation of numerous proinflammatory cytokines. Furthermore, secretion of key mediators of the inflammatory response (CSF2, IL1B, IL2, and IL27), macrophage differentiation (CSF1), and macrophage infiltration and migration to sites of inflammation (CCL2) was significantly reduced in TFEB and TFE3 deficient cells. These new insights provide us with a deeper understanding of the transcriptional regulation of the innate immune response.

Pompe disease is a rare and deadly muscle disorder. As a clinical entity, the disease has been known for over 75 years. While an optimist might be excited about the advances made during this time, a pessimist would note that we have yet to find a cure. However, both sides would agree that many findings in basic science—such as the Nobel prize-winning discoveries of glycogen metabolism, the lysosome, and autophagy—have become the foundation of our understanding of Pompe disease. The disease is a glycogen storage disorder, a lysosomal disorder, and an autophagic myopathy. In this review, we will discuss how these past discoveries have guided Pompe research and impacted recent therapeutic developments.

In the human inflammatory myopathies (polymyositis and dermatomyositis), the early, widespread appearance of MHC class I on the surface of muscle cells and the occurrence of certain myositis-specific autoantibodies are striking features. We have used a controllable muscle-specific promoter system to up-regulate MHC class I in the skeletal muscles of young mice. These mice develop clinical, biochemical, histological, and immunological features very similar to human myositis. The disease is inflammatory, limited to skeletal muscles, self-sustaining, more severe in females, and often accompanied by autoantibodies, including, in some mice, autoantibodies to histidyl-tRNA synthetase, the most common specificity found in the spontaneous human disease, anti-Jo-1. This model suggests that an autoimmune disease may unfold in a highly specific pattern as the consequence of an apparently nonspecific event-the sustained up-regulation of MHC class I in a tissue-and that the specificity of the autoantibodies derives not from the specificity of the stimulus, but from the context, location, and probably the duration of the stimulus. This model further suggests that the presumed order of events as an autoimmune disease develops needs to be reconsidered.

Autoantibodies to histidyl-tRNA synthetase (HisRS) or to alanyl-, asparaginyl-, glycyl-, isoleucyl-, or threonyl-tRNA synthetase occur in approximately 25% of patients with polymyositis or dermatomyositis. We tested the ability of several aminoacyl-tRNA synthetases to induce leukocyte migration. HisRS induced CD4(+) and CD8(+) lymphocytes, interleukin (IL)-2-activated monocytes, and immature dendritic cells (iDCs) to migrate, but not neutrophils, mature DCs, or unstimulated monocytes. An NH(2)-terminal domain, 1-48 HisRS, was chemotactic for lymphocytes and activated monocytes, whereas a deletion mutant, HisRS-M, was inactive. HisRS selectively activated CC chemokine receptor (CCR)5-transfected HEK-293 cells, inducing migration by interacting with extracellular domain three. Furthermore, monoclonal anti-CCR5 blocked HisRS-induced chemotaxis and conversely, HisRS blocked anti-CCR5 binding. Asparaginyl-tRNA synthetase induced migration of lymphocytes, activated monocytes, iDCs, and CCR3-transfected HEK-293 cells. Seryl-tRNA synthetase induced migration of CCR3-transfected cells but not iDCs. Nonautoantigenic aspartyl-tRNA and lysyl-tRNA synthetases were not chemotactic. Thus, autoantigenic aminoacyl-tRNA synthetases, perhaps liberated from damaged muscle cells, may perpetuate the development of myositis by recruiting mononuclear cells that induce innate and adaptive immune responses. Therefore, the selection of a self-molecule as a target for an autoantibody response may be a consequence of the proinflammatory properties of the molecule itself.

We have used gene targeting to create a mouse model of glycogen storage disease type II, a disease in which distinct clinical phenotypes present at different ages. As in the severe human infantile disease (Pompe Syndrome), mice homozygous for disruption of the acid α-glucosidase gene (6neo/6neo) lack enzyme activity and begin to accumulate glycogen in cardiac and skeletal muscle lysosomes by 3 weeks of age, with a progressive increase thereafter. By 3.5 weeks of age, these mice have markedly reduced mobility and strength. They grow normally, however, reach adulthood, remain fertile, and, as in the human adult disease, older mice accumulate glycogen in the diaphragm. By 8–9 months of age animals develop obvious muscle wasting and a weak, waddling gait. This model, therefore, recapitulates critical features of both the infantile and the adult forms of the disease at a pace suitable for the evaluation of enzyme or gene replacement. In contrast, in a second model, mutant mice with deletion of exon 6 (Δ6/Δ6), like the recently published acid α-glucosidase knockout with disruption of exon 13 (Bijvoet, A. G., van de Kamp, E. H., Kroos, M., Ding, J. H., Yang, B. Z., Visser, P., Bakker, C. E., Verbeet, M. P., Oostra, B. A., Reuser, A. J. J., and van der Ploeg, A. T. (1998) Hum. Mol. Genet. 7, 53–62), have unimpaired strength and mobility (up to 6.5 months of age) despite indistinguishable biochemical and pathological changes. The genetic background of the mouse strains appears to contribute to the differences among the three models. We have used gene targeting to create a mouse model of glycogen storage disease type II, a disease in which distinct clinical phenotypes present at different ages. As in the severe human infantile disease (Pompe Syndrome), mice homozygous for disruption of the acid α-glucosidase gene (6neo/6neo) lack enzyme activity and begin to accumulate glycogen in cardiac and skeletal muscle lysosomes by 3 weeks of age, with a progressive increase thereafter. By 3.5 weeks of age, these mice have markedly reduced mobility and strength. They grow normally, however, reach adulthood, remain fertile, and, as in the human adult disease, older mice accumulate glycogen in the diaphragm. By 8–9 months of age animals develop obvious muscle wasting and a weak, waddling gait. This model, therefore, recapitulates critical features of both the infantile and the adult forms of the disease at a pace suitable for the evaluation of enzyme or gene replacement. In contrast, in a second model, mutant mice with deletion of exon 6 (Δ6/Δ6), like the recently published acid α-glucosidase knockout with disruption of exon 13 (Bijvoet, A. G., van de Kamp, E. H., Kroos, M., Ding, J. H., Yang, B. Z., Visser, P., Bakker, C. E., Verbeet, M. P., Oostra, B. A., Reuser, A. J. J., and van der Ploeg, A. T. (1998) Hum. Mol. Genet. 7, 53–62), have unimpaired strength and mobility (up to 6.5 months of age) despite indistinguishable biochemical and pathological changes. The genetic background of the mouse strains appears to contribute to the differences among the three models. In glycogen storage disease type II (GSDII), 1GSDII, glycogen storage disease type II; GAA, acid α-glucosidase; ES, embryonic stem; PAS, periodic acid-Schiff; RT, reverse transcriptase; PCR, polymerase chain reaction; bp, base pair(s); kb, kilobase pair(s). an autosomal recessive disorder, the failure of acid α-glucosidase (GAA, acid maltase, EC 3.2.1.20) to hydrolyze lysosomal glycogen leads to the abnormal accumulation of large lysosomes filled with glycogen in some tissues (2Hirschhorn R. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill, New York1995: 2443-2464Google Scholar). The most severe form, Pompe Syndrome, is a rapidly progressive disease in which heart failure is fatal in infancy. In milder forms, there is progressive skeletal muscle weakness, and death may result from pulmonary failure secondary to diaphragmatic weakness as late as the seventh decade. There is currently no effective therapy, but several candidate therapies, based on the discovery that acid α-glucosidase, like many other lysosomal enzymes, is secreted and can be taken up through cell surface mannose-6-phosphate receptors on other cells (3van der Ploeg A.T. Loonen M.C. Bolhuis P.A. Busch H.M. Reuser A.J. Galjaard H. Pediatr. Res. 1988; 24: 90-94Crossref PubMed Scopus (37) Google Scholar, 4van der Ploeg A.T. Kroos M.A. Willemsen R. Brons N.H. Reuser A.J. J Clin. Invest. 1991; 87: 513-518Crossref PubMed Scopus (69) Google Scholar, 5Neufeld E.F. Annu. Rev. Biochem. 1991; 60: 257-280Crossref PubMed Scopus (484) Google Scholar), are already under development (6van der Ploeg A.T. Bolhuis P.A. Wolterman R.A. Visser J.W. Loonen M.C. Busch H.F. Reuser A.J. J Neurol. 1988; 235: 392-396Crossref PubMed Scopus (38) Google Scholar, 7van Hove J.L. Yang H.W. Wu J.Y. Brady R.O. Chen Y.T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 65-70Crossref PubMed Scopus (105) Google Scholar, 8Zaretsky J.Z. Candotti F. Boerkoel C. Adams E.M. Yewdell J.W. Blaese R.M. Plotz P.H. Hum. Gene Ther. 1997; 8: 1555-1563Crossref PubMed Scopus (33) Google Scholar, 9Kessler P.D. Podsakoff G.M. Chen X. McQuiston S.A. Colosi P.C. Matelis L.A. Kurtzman G.J. Byrne B.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14082-14087Crossref PubMed Scopus (534) Google Scholar, 10Bijvoet A.G. Kroos M.A. Pieper F.R. de Boer H.A. Reuser A.J. van der Ploeg A.T. Verbeet M.P. Biochim. Biophys. Acta. 1996; 1308: 93-96Crossref PubMed Scopus (28) Google Scholar, 11Pauly D.F. Johns D.C. Matelis L.A. Lawrence J.H. Byrne B.J. Kessler P.D. Gene Therapy. 1998; 5: 473-480Crossref PubMed Scopus (47) Google Scholar, 12Kikuchi T. Yang H.W. Pennybacker M. Ichihara N. Mizutani M. van Hove J.L. Chen Y.T. J. Clin. Invest. 1998; 101: 827-833Crossref PubMed Scopus (146) Google Scholar). These studies stimulated efforts to create a mouse model suitable for testing enzyme replacement and gene therapies. Bijvoet et al. (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar) recently reported the generation of knockout mice which develop generalized glycogen storage and cardiomegaly but remain phenotypically normal. We describe here the generation of two models: 1) knockout mice in which the GAA gene is disrupted by a neo insertion in exon 6 (6neo/6neo) and 2) mutant mice in which exon 6 of the GAA gene and the neo gene are removed by Cre/lox-mediated recombination (Δ6/Δ6) (13Sauer B. Henderson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5166-5170Crossref PubMed Scopus (894) Google Scholar). In both models, animals develop biochemical and pathological changes similar to those in humans, but only 6neo/6neo mice show early signs of reduced mobility and muscle strength. By 8–9 months of age 6neo/6neo mice develop a weak, waddling gait, and progressive muscle wasting. GAA genomic clones were isolated from a 129/Sv mouse genomic library. A plasmid containing both the neomycin-resistance (neo) gene and the herpes virus thymidine kinase gene in the pBluescript vector (a gift of Dr. R. Proia) served as the backbone of the targeting vector (14Yamanaka S. Johnson M.D. Grinberg A. Westphal H. Crawley J.N. Taniike M. Suzuki K. Proia R.L. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9975-9979Crossref PubMed Scopus (163) Google Scholar). The organization of the targeting construct is shown in Fig. 1 A. A genomic fragment extending from an XbaI site in intron 2 to a BamHI site in exon 6 was inserted into theXhoI site between the thymidine kinase and neogenes. In addition, a termination codon and a new EcoRV site were introduced within exon 6 upstream from the neo gene. Next, a genomic fragment containing the remainder of exon 6 and exons 7 through 13 was cloned into the SalI site downstream of theneo gene. Two loxP sites were inserted into introns 5 and 6. The resulting vector has ∼2.7 kb of homology upstream and ∼4.3 kb of homology downstream of the neogene. The linearized vector was electroporated into 129/Sv RW4 ES cells (Genome Systems Inc.), and the resulting neo-positive (G418-resistant), thymidine kinase-negative (ganciclovir-resistant) clones were screened by Southern analysis. Chimeric mice were generated by blastocyst injection of heterozygous ES cells into 3.5-day C57BL/6 embryos. Six independent cell lines containing the disrupted GAA allele were used to make chimeras that were bred to C57BL/6 females to generate heterozygous mice (F1). Four mutant lines were then established through germ line transmission; heterozygous F1 mice derived from two independent cell lines, 2-55 and 2-86, were intercrossed to obtain mice homozygous for the disrupted allele (F2 and F3). Alternatively, F1/2-55 and F1/2-86 heterozygous mice were bred to EIIa-cre transgenic mice (FVB/N) for Cre-mediated deletion (Δ6/Δ6) of the neo gene and exon 6 of the GAA gene in vivo. GAA activity in the homogenates of skeletal muscle, liver, heart, and tail was measured as conversion of the substrate 4-methylumbelliferyl-α-d-glucoside to the fluorescent product umbelliferone as described previously (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar, 15Hermans M.M. Kroos M.A. van Beeumen J. Oostra B.A. Reuser A.J. J Biol. Chem. 1991; 266: 13507-13512Abstract Full Text PDF PubMed Google Scholar). Tissues were dissected and homogenized in lysis buffer (300 mm NaCl, 50 mm Tris, 2 mm EDTA, 0.5% Triton X-100) with proteinase inhibitors (4 mm Pefabloc SC, 10 μg/ml aprotinin, 10 μg/ml leupeptin). Samples (50 μg protein) were electrophoresed on 10% SDS-polyacrylamide gel electrophoresis gels and electrotransferred to nitrocellulose membranes. The blots were blocked with bovine serum albumin and incubated with rabbit antiserum to human placental GAA or rabbit antiserum to human urine GAA (kindly provided by Dr. F. Martiniuk and Dr. A. J. J. Reuser). Immunodetection was performed with goat anti-rabbit IgG conjugated to horseradish peroxidase in combination with chemiluminescence (ECL, Amersham Life Science Inc.). RNA was isolated from skeletal muscle and liver using a Total RNA Kit (Qiagen). First strand cDNA synthesis was primed from 2 μg of total RNA with 50 ng of random hexamers according to the manufacturer's instructions (Boehringer Mannheim). Two μl of the cDNA sample were used as a template for PCR amplification with primers flanking the neo gene: cctttctacctggcactggaggac (exon 5 sense) and ggacaatggcggtcgaggagta (exon 7 antisense) or tcaccctctggaaccgggacacacca (exon 4 sense) and ccggccatcctggtgcagctcccgca (exon 8 antisense). The second set of primers was used to detect any possible transcripts in which theneo gene may be spliced out. PCR reactions were carried out for 35 cycles that consisted of 50-s denaturation at 95 °C, 50-s annealing at 55 °C, and 2-min extension at 72 °C using PCR SuperMix (Life Technologies, Inc.). Genomic DNA isolated from ES cells or mouse tails was digested with EcoRV, electrophoresed on 1% agarose gels, and transferred to Nytran membranes. The hybridization probe was generated by PCR, and labeled by the random hexamer method after gel purification. For electron microscopy, tissues were fixed in phosphate-buffered saline containing 4% formaldehyde and 2% glutaraldehyde followed by post-fixation in 1% osmium in 0.1m cacodylate buffer. The tissues were rinsed in an aqueous solution containing 4.5% sucrose, dehydrated in a series of graded alcohol solutions, rinsed in 100% propylene oxide, and embedded in epoxy resin. Thin sections (60 to 70 nm) were double-stained with uranyl acetate and lead citrate. The stained sections were stabilized by carbon evaporation and photographed with a Hitachi H7000 electron microscope operated at 75 kV. For light microscopy, sections from tissues were fixed in 10% formalin, processed, embedded in paraffin, and stained with hematoxylin-eosin or periodic acid-Schiff (PAS) by standard methods. All procedures were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Locomotor activity in an open field was measured in a Digiscan apparatus (model RXYZCM, Omnitech Electronics). Total distance, horizontal activity, and vertical activity were measured by the total number of photocell beam breaks in 10- or 15-min intervals over 1 h, and data averaged over these periods were used for analysis. Three to six independent testing sessions were conducted for each group over a period of 1–2 weeks. Male mice were tested at ages 3.5–6, 8–9, and 10.5–22 weeks. Fourteen 6neo/+, 11 6neo/6neo, 8 Δ6/+, and 9 Δ6/Δ6 mice were used for the test. The origin of the mice which were phenotypically tested is indicated in TableI. Statistical analyses were performed using the one-way analysis of variance test (Sigmastat program). The ability to hang upside down from a wire screen placed 60 cm above a large housing cage was measured as latency to fall into the cage.Table IOrigin of the mice used for behavioral testingCell lineMouse line2–552–862–55/cre2–86/cre6neo/+1 /7/1aF1 mice/F2 mice/F3 mice (n).1 /4/06neo/6neo2 /1bF2 mice/F3 mice (n).3 /5Δ6/+0 /5/03 /0/0Δ6/Δ63 /60 /0a F1 mice/F2 mice/F3 mice (n).b F2 mice/F3 mice (n). Open table in a new tab The murine GAA gene was disrupted by insertion of neointo exon 6, with the expectation that the disruption would completely block gene expression (6neo/6neo). In addition,loxP sites were placed in the introns flanking the disrupted exon 6 so that exon 6 could be precisely removed (Δ6) by mating to Cre-producing mice. In humans, a similar splicing mutation around exon 6 is associated with a relatively mild phenotype (16Adams E.M. Becker J.A. Griffith L. Segal A. Plotz P.H. Raben N. Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (29) Google Scholar). By homologous recombination in ES cells, we created a mutant GAA allele in which a neo cassette disrupts the gene within exon 6 (Fig. 1 A). A termination codon and a new EcoRV site were introduced into exon 6 upstream from theneo gene. Translational termination at the stop codon in exon 6 would result in the synthesis of a truncated protein of ∼36 kDa. The frequency of recombination was 1 in 4 G418/ganciclovir-resistant clones. Recombinant clones were used to produce chimeric mice that transmitted the mutation through the germ line. Heterozygous mice (F1) derived from two independent cell lines (2-55 and 2-86) carrying the targeted allele were used for further breeding. Genotyping of the mice generated by intercrossing of heterozygotes (Fig. 1 B) revealed the expected Mendelian ratio, indicating no effect on embryonic development. Reverse transcription-PCR with two sets of primers flanking theneo gene detected wild-type products in the wild-type (+/+) and heterozygous (+/−) but not in 6neo/6neo (−/−) mice (Fig. 1 C), indicating that normal mRNA is not made in homozygotes. However, mRNA amplification with primers in exon 12 (sense) and exon 14 (antisense) downstream from the neo gene detected a low level of transcripts in 6neo/6neo mice (not shown). Similarly, RT-PCR with primers in exon 5 (sense) and theneo gene (antisense) detected a very low abundance message in the 6neo/6neo; reamplification of the PCR product with nested primers followed by sequencing established that the termination codon introduced into exon 6 upstream from the neo gene remained intact (not shown). In homozygous mice, no GAA protein was detected by Western analysis (Fig. 1 D) using antibodies against either human urine or human placental GAA. The absence of functional protein in 6neo/6neo mice was confirmed by enzyme assay in the lysates of multiple tissues (TableII). The residual levels of enzyme activity (at the standard pH 4.3) in the muscle, heart, and tail samples of 6neo/6neo mice did not exceed the background level found in a fibroblast cell line from an infantile patient (0.64 nmol of 4-methylumbelliferyl-α-d-glucoside/h/mg of protein; cell line 4912) in which mRNA is not expressed (17Martiniuk F. Mehler M. Pellicer A. Tzall S. La Badie G. Hobart C. Ellenbogen A. Hirschhorn R. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9641-9644Crossref PubMed Scopus (91) Google Scholar). At low pH 3.6 (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar) the enzyme activity was below the detection limits (0.7–1.0 ng of 4-methylumbelliferone/10-μl reaction).Table IIGAA activity (nmol of 4-methylumbelliferyl-α-d-glucoside/h/mg of protein) in tissues and tail samplesTissueGenotype+/+6neo/+6neo/6neoHeart10.6 ± 0.694.7 ± 0.50.11 ± 0.01Muscle17.2 ± 1.410.4 ± 1.20.11 ± 0.03Brain57.0 ± 4.516.4 ± 2.40.62 ± 0.04Tail65.8 ± 8.126.3 ± 3.10.54 ± 0.05GAA activity was measured under standard conditions, pH 4.3 (15Hermans M.M. Kroos M.A. van Beeumen J. Oostra B.A. Reuser A.J. J Biol. Chem. 1991; 266: 13507-13512Abstract Full Text PDF PubMed Google Scholar). Open table in a new tab GAA activity was measured under standard conditions, pH 4.3 (15Hermans M.M. Kroos M.A. van Beeumen J. Oostra B.A. Reuser A.J. J Biol. Chem. 1991; 266: 13507-13512Abstract Full Text PDF PubMed Google Scholar). Abnormal lysosomal glycogen storage was found in the heart and skeletal muscle of 6neo/6neo mice. Electron microscopy showed the progressive accumulation of membrane-limited organelles between the bundles of myofibrils at the earliest point examined - age 3 weeks (Fig. 2 a and d). Immunoelectron microscopy with an antibody specific for the LAMP-1 protein confirmed that the organelles were lysosomes (not shown). Over time, the lysosomes increased in size and number (Fig. 2, b, c, e, andf). Furthermore, the density of the accumulated glycogen particles within the lysosomes increased (Fig. 2, h andi). The accumulation was clearly more marked in the heart than in the skeletal muscle (Fig. 2, d–f anda–c). Importantly, in the 6neo/6neo mice, there is a significant reduction in the number of myofibrils, loss of lateral myofibrillar registration, and signs of sacromere degradation, especially the deformation at the Z lines. Some lysosomes appear broken, suggesting that the leakage of lysosomal proteases may have contributed to the damage of the muscle structure. Light microscopy (at 8 weeks) showed PAS-positive, diastase-sensitive material in vacuoles in the heart and skeletal muscle (Fig. 3, b and d). In animals examined at 14 weeks, the diaphragm showed PAS-positive vacuoles by light microscopy (Fig. 3 f). Although the mutant mice appeared normal, when placed in an open field environment 6neo/6neo mice consistently performed significantly worse than heterozygous littermates by several measures of locomotion (Fig. 4). Reduced activity was registered as early as 3.5 weeks of age and was particularly striking for vertical motion (Fig. 4, bottom panel). Similarly, in the wire-hang task, which measures muscular function and grip strength, 6neo/+ mice outperformed 6neo/6neo littermates. At 15–16 weeks of age, 6neo/6neo mice were almost never able to hold on to the inverted screen for more than 2 min (once in 12 tests), whereas in 8 of 12 tests 6neo/+ littermates were able to remain hanging for more than 2 min, and 4 of 12 heterozygous littermates were still holding on at 5 min when the test was stopped. Older mice (8–9 months of age) show obvious signs of muscle weakness with a weak, waddling gait and muscle wasting (Fig. 5). Offspring from independent mutant mouse lines were phenotypically indistinguishable.Figure 5Clinical signs of muscle weakness. This 8-month-old female 6neo/6neo mouse has wasted lower back muscle and displays its hind limbs in a splayed posture.View Large Image Figure ViewerDownload (PPT) In the second model, the disrupted exon 6 of the GAA gene and the neo gene were totally excised from early embryos by breeding 6neo/+ mice (F1/2-55 and F1/2-86; 129/C57BL/6 background) to transgenic homozygous EIIa-cre (18Lakso M. Pichel J.G. Gorman J.R. Sauer B. Okamoto Y. Lee E. Alt F.W. Westphal H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5860-5865Crossref PubMed Scopus (909) Google Scholar) mice (FVB/N background) in which the adenovirus promoter confines the expression of Cre to an early stage of pre-implantation development. F1 heterozygous (mouse lines 2-55/cre and 2-86/cre) for exon 6-deleted allele were subsequently intercrossed to obtain F2 and F3 homozygous mice (Δ6/Δ6). Cre-mediated deletion was detected by PCR with primers in exon 5 and exon 7 (Fig. 6). As expected, the genomic sequence in homozygous mice contained the 5′ part of intron 5, then a singleloxP site in place of exon 6, followed by the 3′ part of intron 7 and exon 7 of the gene (not shown). RT-PCR with two sets of primers (in exons 5/7 and exons 4/8) showed that the mutant mRNA is produced (Fig. 7 A), and that in this mRNA exon 5 is spliced to exon 7, resulting in a precise in-frame deletion of exon 6 (not shown).Figure 7Expression of the exon 6-deleted allele. A, RT-PCR analysis of muscle cDNA from Δ6/Δ6 mice. Primers in exons 4 and 8 detect a 354-bp amplification product; primers in exons 5 and 7 detect a 150-bp product. The sizes of the products correspond to those expected for mRNA with exon 6 deleted. Each PCR was done in duplicate. The RT-PCR negative control (NC) was carried out by omitting RNA from reverse-transcription reaction in which both sets of primers were used. M, DNA marker.B , Western analysis (shown for liver). The blot was probed with rabbit IgG to human placental GAA. Lane 1, 6neo/+; lane 2, 6neo/6neo; lane 3, Δ6/Δ6.View Large Image Figure ViewerDownload (PPT) The Δ6/Δ6 mice were similar to the 6neo/6neo animals with respect to the level of enzyme activity measured in tail skin, muscle, and liver (not shown), absence of protein (Fig. 7 B), and accumulation of lysosomal glycogen in skeletal muscle, heart, and diaphragm (Fig. 8). Strikingly, however, unlike the 6neo/6neomice, their performance in the open field was similar to that of heterozygous Δ6/+ littermates derived from two mouse lines (Fig. 9, Table I). Interestingly, in all measures of activity, the Δ6/+ mice outperformed the 6neo/+ animals, indicating a genetic difference between the two mouse strains. So far (up to 6.5 months of age) the Δ6/Δ6 mice have not developed any clinical symptoms.Figure 9Locomotor activity of mice with exon 6 deletion (heterozygotes, Δ6/+; homozygotes, Δ6/Δ6), and exon 6 disruption (heterozygotes, 6neo/+; homozygotes, 6neo/6neo). Top panel, mean (±S.E.) horizontal activity per min in the open field (measured by the number of photocell beam breaks). Middle panel, mean (±S.E.) total distance (cm) per min in the open field. Bottom panel, mean (±S.E.) vertical activity per min in the open field (measured by the number of photocell beam breaks). Each bar represents the performance of 8–14 animals, and ∼200 intervals (10 min each) were averaged for each bar.View Large Image Figure ViewerDownload (PPT) We have used an efficient method for generating two allelic mutations at the murine GAA locus. The approach required the production of only one targeted mouse line with an exon 6 disrupted allele, which served as a progenitor of the second line with exon 6 deleted allele. Since the targeted locus contains two loxP sites flanking exon 6, the removal of the exon was performed simply by mating to transgenic mice carrying Cre recombinase. The two models were designed to replicate a range of clinical phenotypes: 6neo/6neo mice for a severe phenotype, and Δ6/Δ6 mice for a milder disease. A milder phenotype was predicted in the Δ6/Δ6 mice since a similar, though not identical defect in a patient, splicing out exon 6 and the inclusion of 7 new amino acids encoded by 21 nucleotides from IVS6, resulted in 5–7% of residual enzyme activity and a juvenile form of the illness (16Adams E.M. Becker J.A. Griffith L. Segal A. Plotz P.H. Raben N. Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (29) Google Scholar). Both mouse models, however, resulted in apparently complete “knockout,” as shown by the virtual absence of enzyme activity and the absence of GAA protein. In humans, the severity and the age of onset of GSDII appear to depend largely on the level of residual activity of the enzyme. Lack of enzyme activity or extremely low levels (≤1–2%) are associated with a fatal infantile cardiomyopathy, whereas levels of 10–20% are associated with an adult onset indolent skeletal myopathy (19Reuser A.J. Kroos M.A. Hermans M.M. Bijvoet A.G. Verbeet M.P. van Diggelen O.P. Kleijer W.J. van der Ploeg A.T. Muscle Nerve. 1995; 3: S61-S69Crossref PubMed Scopus (135) Google Scholar, 20Kroos M.A. Van der Kraan M. van Diggelen O.P. Kleijer W.J. Reuser A.J. Van den Boogaard M.J. Ausems M.G. Ploos van Amstel H.K. Poenaru L. Nicolino M. Wevers R. J Med. Genet. 1995; 32: 836-837Crossref PubMed Scopus (83) Google Scholar, 21Raben N. Nichols R.C. Boerkoel C. Plotz P. Muscle Nerve. 1995; 3: S70-S74Crossref PubMed Scopus (44) Google Scholar). Unlike humans, recently described knockout mice (9 months old) (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar) and the Δ6/Δ6 mutants (6.5 months old) described here do not show clinical signs despite a severe enzyme deficiency. In contrast, 6neo/6neomice develop a progressive muscle weakness detectable as early as 3.5 weeks of age. The pathologic findings in 6neo/6neo mice indicate accumulation of lysosomal glycogen in the skeletal muscle and diaphragm, as in the adult human disease, and an even greater accumulation in heart, a hallmark of infantile disease. Tests of cardiac function will allow determination of the effects of the glycogen accumulation in the heart. In quantitative tests of mobility and strength, 6neo/6neomice moved less, especially in the vertical direction, and could not hold on to a wire screen nearly as long as 6neo/+ littermates. By 8–9 months, clinical signs of muscle weakness and muscle wasting are obvious. Longer observation will be necessary to determine if this reduced strength affects lifespan and if glycogen accumulation in the diaphragm reduces lung function. Thus, the 6neo/6neo model has features of both the adult and the infantile forms of the human disease, but the effects are attenuated. This difference in severity and in pace between mice and humans is not surprising since the factors which promote lysosomal glycogen storage are largely obscure. In humans, for example, the deposition of glycogen is very different from tissue to tissue within the same patient and from patient to patient or even sibling to sibling although they may bear the same mutation(s). Of related interest in that regard are the observations that although both the 6neo/6neo and Δ6/Δ6 mice have negligible enzyme activity and accumulate glycogen in skeletal and heart muscles, the 6neo/6neo are weak in open field and wire hang testing, but the Δ6/Δ6 are not. The phenotypic difference between the two models described here cannot be explained by the presence of a neo gene in the targeted locus of the 6neo/6neomice: in both the phenotypically affected 6neo/6neo model and a recently published phenotypically normal model with insertion of aneo gene in exon 13, a hybrid GAA-neo mRNA was detected by RT-PCR. Furthermore, we have studied the expression of the neo gene in a mouse strain with disruption of the HexA gene which is known to perform normally in the open field (14Yamanaka S. Johnson M.D. Grinberg A. Westphal H. Crawley J.N. Taniike M. Suzuki K. Proia R.L. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9975-9979Crossref PubMed Scopus (163) Google Scholar). In this strain, abundant neo transcripts were detected in both liver and muscle by RT-PCR and sequencing (not shown), thus further indicating no effect of neo phosphotransferase on mobility and muscle strength. It is possible that the accumulation of glycogen is different in the muscles crucial for the activities tested; or that accumulation of glycogen in other sites such as the nervous system differs in the two models; or that weakness is related not only to the amount of accumulated glycogen. Indeed, the structural changes in myofibrillar structure may relate to other factors besides simple glycogen accumulation which are involved in lysosomal integrity. In support of the last possibility, it should be noted that the two strains are of different genetic background since the creation of the Δ6/Δ6 required mating to a strain bearing the Cre recombinase (FVB/N) while the 6neo/6neo mice were bred onto a C57BL/6 background. There is abundant similar evidence illustrating the importance of genetic background and modifying genes on phenotypic variation in knockout mice (22Erickson R.P. Bioessays. 1996; 18: 993-998Crossref PubMed Scopus (67) Google Scholar, 23Wilson J.M. J. Clin. Invest. 1996; 97: 1138-1141Crossref PubMed Google Scholar). As shown in Fig. 9, the background activity of the Cre strain control mice is substantially greater than that of the controls for the 6neo/6neo mice, suggesting that other genes influence behavior in the tests, and only in the less active strain is the additional insult of glycogen accumulation reflected in poorer performance. Such strain differences may account for the apparent absence of weakness in the recently published model (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar), which, like the Δ6/Δ6 model described here, was created on the 129/FVB background. It should be noted that the level of residual activity in the exon 13 model was somewhat higher (2.6% in muscle and 3.8% in heart) than the levels in the 6neo/6neoand the Δ6/Δ6 mice when measured at the same low pH 3.6. At that low pH, neither of the knockout strains described here had detectable activity in tail skin, muscle, or heart. It is possible that a residual low level of enzyme activity contributes to rescue of the phenotype of the exon 13 published knockout (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar). Longer observation of the Δ6/Δ6 mice (oldest animals are 6.5 months of age) may clarify this point. Although all of the models created so far could be used for testing proposed gene therapy or enzyme replacement since the pathological and biochemical changes closely resemble those in humans, the nondestructive and easily testable phenotypic abnormalities of the 6neo/6neo model suggest that it would be the preferable choice.

Glycogenosis type II (GSDII, Pompe disease) is an autosomal recessive lysosomal storage disease caused by a deficiency of acid alpha-glucosidase (acid maltase, GAA). The enzyme degrades alpha -1,4 and alpha -1,6 linkages in glycogen, maltose, and isomaltose. Deficiency of the enzyme results in accumulation of glycogen within lysosomes and in cytoplasm eventually leading to tissue destruction. The discovery of the acid a-glucosidase gene has led to rapid progress in understanding the molecular basis of glycogenosis type II and the biological properties of the GAA protein. The last decade has seen several developments: 1) extensive mutational analysis in patients with different forms of the disease, 2) characterization of the enzyme biosynthesis, processing, and lysosomal targeting, 3) generation of knockout mouse models, 4) development of viral vectors for gene replacement therapy, 5) the production of recombinant human enzyme, and 6) a shift in the enzyme replacement therapy approach from theory to practice. It is anticipated that the enzyme replacement therapy will be widely available for human use in the near future. Several recent reviews (including the most comprehensive one by R. Hirschhorn and A. Reuser [1]), address clinical, biochemical and genetic aspects of the disease, as well as development of new therapies for GSDII [2, 3, 4]. In this article we will review recent findings in the area including rapidly accumulating molecular genetic data (more than 20 mutations need to be added to the list), transcriptional control of gene expression, studies in mouse models, and new approaches to gene therapy. We will also highlight some emerging questions following the introduction of enzyme replacement therapy.

Deficiency of acid alpha-glucosidase (GAA) results in widespread cellular deposition of lysosomal glycogen manifesting as myopathy and cardiomyopathy. When GAA−/− mice were treated with rhGAA (20 mg/kg/week for up to 5 months), skeletal muscle cells took up little enzyme compared to liver and heart. Glycogen reduction was less than 50%, and some fibers showed little or no glycogen clearance. A dose of 100 mg/kg/week resulted in ∼75% glycogen clearance in skeletal muscle. The enzyme reduced cardiac glycogen to undetectable levels at either dose. Skeletal muscle fibers with residual glycogen showed immunoreactivity for LAMP-1/LAMP-2, indicating that undigested glycogen remained in proliferating lysosomes. Glycogen clearance was more pronounced in type 1 fibers, and histochemical analysis suggested an increased mannose-6-phosphate receptor immunoreactivity in these fibers. Differential transport of enzyme into lysosomes may explain the strikingly uneven pattern of glycogen removal. Autophagic vacuoles, a feature of both the mouse model and the human disease, persisted despite glycogen clearance. In some groups a modest glycogen reduction was accompanied by improved muscle strength. These studies suggest that enzyme replacement therapy, although at much higher doses than in other lysosomal diseases, has the potential to reverse cardiac pathology and to reduce the glycogen level in skeletal muscle.

American Journal of Medical GeneticsVolume 79, Issue 1 p. 69-72 Letter to the Editor Carrier frequency for glycogen storage disease type II in New York and estimates of affected individuals born with the disease Frank Martiniuk, Corresponding Author Frank Martiniuk [email protected] Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkNew York University Medical Center, Dept. of Medicine, Division of Pulmonary and Critical Care Medicine, New Bellevue 7N24, 550 First Ave., New York, NY 10016Search for more papers by this authorAgnes Chen, Agnes Chen Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorAdra Mack, Adra Mack Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorEleni Arvanitopoulos, Eleni Arvanitopoulos Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorYing Chen, Ying Chen Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorWilliam N. Rom, William N. Rom Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorWilliam J. Codd, William J. Codd Bellevue Hospital Center, Clinical Mycobacterial Laboratory, New York, New YorkSearch for more papers by this authorBruce Hanna, Bruce Hanna Bellevue Hospital Center, Clinical Mycobacterial Laboratory, New York, New YorkSearch for more papers by this authorPhil Alcabes, Phil Alcabes Department of Environmental Medicine, NYU Medical Center, New York, New YorkSearch for more papers by this authorNina Raben, Nina Raben Arthritis and Rheumatism Branch, National Institute of Arthritis, Musculoskeletal, and Skin Diseases, National Institutes of Health, Bethesda, MarylandSearch for more papers by this authorPaul Plotz, Paul Plotz Arthritis and Rheumatism Branch, National Institute of Arthritis, Musculoskeletal, and Skin Diseases, National Institutes of Health, Bethesda, MarylandSearch for more papers by this author Frank Martiniuk, Corresponding Author Frank Martiniuk [email protected] Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkNew York University Medical Center, Dept. of Medicine, Division of Pulmonary and Critical Care Medicine, New Bellevue 7N24, 550 First Ave., New York, NY 10016Search for more papers by this authorAgnes Chen, Agnes Chen Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorAdra Mack, Adra Mack Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorEleni Arvanitopoulos, Eleni Arvanitopoulos Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorYing Chen, Ying Chen Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorWilliam N. Rom, William N. Rom Department of Medicine, Division of Pulmonary and Critical Care Medicine, New York University Medical Center, New York, New YorkSearch for more papers by this authorWilliam J. Codd, William J. Codd Bellevue Hospital Center, Clinical Mycobacterial Laboratory, New York, New YorkSearch for more papers by this authorBruce Hanna, Bruce Hanna Bellevue Hospital Center, Clinical Mycobacterial Laboratory, New York, New YorkSearch for more papers by this authorPhil Alcabes, Phil Alcabes Department of Environmental Medicine, NYU Medical Center, New York, New YorkSearch for more papers by this authorNina Raben, Nina Raben Arthritis and Rheumatism Branch, National Institute of Arthritis, Musculoskeletal, and Skin Diseases, National Institutes of Health, Bethesda, MarylandSearch for more papers by this authorPaul Plotz, Paul Plotz Arthritis and Rheumatism Branch, National Institute of Arthritis, Musculoskeletal, and Skin Diseases, National Institutes of Health, Bethesda, MarylandSearch for more papers by this author First published: 06 December 1998 https://doi.org/10.1002/(SICI)1096-8628(19980827)79:1<69::AID-AJMG16>3.0.CO;2-KCitations: 127AboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Citing Literature Volume79, Issue127 August 1998Pages 69-72 RelatedInformation

Muscle is an attractive target for gene therapy and for immunization with DNA vaccines and is also the target of immunological injury in myositis. It is important therefore to understand the immunologic capabilities of muscle cells themselves. In this study, we show that proinflammatory stimuli induce the expression of other cytokines such as IL-6, transforming growth factor-beta (TGF-beta), and granulocyte-macrophage colony-stimulating factor (GM-CSF) by muscle cells themselves, as well as the up-regulation of human leucocyte antigen (HLA) class I, class II and intercellular adhesion molecule-1 (ICAM-1). Thus, muscle cells have an inherent ability to express and respond to a variety of cytokines and chemokines. The levels of HLA class I, class II and ICAM-1 in inflamed muscle may be affected by the secreted products of the stimulation.

<h2>Abstract</h2> Enzyme replacement therapy (ERT) became a reality for patients with Pompe disease, a fatal cardiomyopathy and skeletal muscle myopathy caused by a deficiency of glycogen-degrading lysosomal enzyme acid α-glucosidase (GAA). The therapy, which relies on receptor-mediated endocytosis of recombinant human GAA (rhGAA), appears to be effective in cardiac muscle, but less so in skeletal muscle. We have previously shown a profound disturbance of the lysosomal degradative pathway (autophagy) in therapy-resistant muscle of GAA knockout mice (KO). Our findings here demonstrate a progressive age-dependent autophagic buildup in addition to enlargement of glycogen-filled lysosomes in multiple muscle groups in the KO. Trafficking and processing of the therapeutic enzyme along the endocytic pathway appear to be affected by the autophagy. Confocal microscopy of live single muscle fibers exposed to fluorescently labeled rhGAA indicates that a significant portion of the endocytosed enzyme in the KO was trapped as a partially processed form in the autophagic areas instead of reaching its target—the lysosomes. A fluid-phase endocytic marker was similarly mistargeted and accumulated in vesicular structures within the autophagic areas. These findings may explain why ERT often falls short of reversing the disease process and point toward new avenues for the development of pharmacological intervention.

The myositis syndromes, the most common forms of which are polymyositis and dermatomyositis, are defined by idiopathic chronic inflammation in skeletal muscle. Although initially described more than a century ago, these diseases are so rare and heterogeneous that we have only a limited understanding of their causes and treatment. Recently, autoimmune responses to nuclear and cytoplasmic autoantigens that are unique to patients with myositis, the myositis-specific autoantibodies, have proved clinically useful in helping predict signs and symptoms of myositis, immunogenetics, responses to therapy, and prognosis. We summarize this new information on the variety and nature of these autoantibodies, their target epitopes, and their possible use in identifying causes, pathogenetic mechanisms, and better therapies for these increasingly recognized disorders.

Pompe disease is a lysosomal storage disorder in which acid alpha-glucosidase (GAA) is deficient or absent. Deficiency of this lysosomal enzyme results in progressive expansion of glycogen-filled lysosomes in multiple tissues, with cardiac and skeletal muscle being the most severely affected. The clinical spectrum ranges from fatal hypertrophic cardiomyopathy and skeletal muscle myopathy in infants to relatively attenuated forms, which manifest as a progressive myopathy without cardiac involvement. The currently available enzyme replacement therapy (ERT) proved to be successful in reversing cardiac but not skeletal muscle abnormalities. Although the overall understanding of the disease has progressed, the pathophysiology of muscle damage remains poorly understood. Lysosomal enlargement/rupture has long been considered a mechanism of relentless muscle damage in Pompe disease. In past years, it became clear that this simple view of the pathology is inadequate; the pathological cascade involves dysfunctional autophagy, a major lysosome-dependent intracellular degradative pathway. The autophagic process in Pompe skeletal muscle is affected at the termination stage-impaired autophagosomal-lysosomal fusion. Yet another abnormality in the diseased muscle is the accelerated production of large, unrelated to ageing, lipofuscin deposits-a marker of cellular oxidative damage and a sign of mitochondrial dysfunction. The massive autophagic buildup and lipofuscin inclusions appear to cause a greater effect on muscle architecture than the enlarged lysosomes outside the autophagic regions. Furthermore, the dysfunctional autophagy affects the trafficking of the replacement enzyme and interferes with its delivery to the lysosomes. Several new therapeutic approaches have been tested in Pompe mouse models: substrate reduction therapy, lysosomal exocytosis following the overexpression of transcription factor EB and a closely related but distinct factor E3, and genetic manipulation of autophagy.

Autophagy, an intracellular system for delivering portions of cytoplasm and damaged organelles to lysosomes for degradation/recycling, plays a role in many physiological processes and is disturbed in many diseases. We recently provided evidence for the role of autophagy in Pompe disease, a lysosomal storage disorder in which acid alphaglucosidase, the enzyme involved in the breakdown of glycogen, is deficient or absent. Clinically the disease manifests as a cardiac and skeletal muscle myopathy. The current enzyme replacement therapy (ERT) clears lysosomal glycogen effectively from the heart but less so from skeletal muscle. In our Pompe model, the poor muscle response to therapy is associated with the presence of pools of autophagic debris. To clear the fibers of the autophagic debris, we have generated a Pompe model in which an autophagy gene, Atg7, is inactivated in muscle. Suppression of autophagy alone reduced the glycogen level by 50–60%. Following ERT, muscle glycogen was reduced to normal levels, an outcome not observed in Pompe mice with genetically intact autophagy. The suppression of autophagy, which has proven successful in the Pompe model, is a novel therapeutic approach that may be useful in other diseases with disturbed autophagy.

Mitochondria-induced oxidative stress and flawed autophagy are common features of neurodegenerative and lysosomal storage diseases (LSDs). Although defective autophagy is particularly prominent in Pompe disease, mitochondrial function has escaped examination in this typical LSD. We have found multiple mitochondrial defects in mouse and human models of Pompe disease, a life-threatening cardiac and skeletal muscle myopathy: a profound dysregulation of Ca2+ homeostasis, mitochondrial Ca2+ overload, an increase in reactive oxygen species, a decrease in mitochondrial membrane potential, an increase in caspase-independent apoptosis, as well as a decreased oxygen consumption and ATP production of mitochondria. In addition, gene expression studies revealed a striking upregulation of the β 1 subunit of L-type Ca2+ channel in Pompe muscle cells. This study provides strong evidence that disturbance of Ca2+ homeostasis and mitochondrial abnormalities in Pompe disease represent early changes in a complex pathogenetic cascade leading from a deficiency of a single lysosomal enzyme to severe and hard-to-treat autophagic myopathy. Remarkably, L-type Ca2+channel blockers, commonly used to treat other maladies, reversed these defects, indicating that a similar approach can be beneficial to the plethora of lysosomal and neurodegenerative disorders.

Research Article27 January 2017Open Access Source DataTransparent process Modulation of mTOR signaling as a strategy for the treatment of Pompe disease Jeong-A Lim Jeong-A Lim Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD, USA Cell Biology and Physiology Center, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD, USA This article has been contributed to by US Government employees and their work is in the public domain in the USA Search for more papers by this author Lishu Li Corresponding Author Lishu Li [email protected] orcid.org/0000-0003-2133-6702 Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD, USA This article has been contributed to by US Government employees and their work is in the public domain in the USA Search for more papers by this author Orian S Shirihai Orian S Shirihai orcid.org/0000-0001-8466-3431 Department of Medicine, Obesity and Nutrition Section, Evans Biomedical Research Center, Boston University School of Medicine, Boston, MA, USA Search for more papers by this author Kyle M Trudeau Kyle M Trudeau Department of Medicine, Obesity and Nutrition Section, Evans Biomedical Research Center, Boston University School of Medicine, Boston, MA, USA Search for more papers by this author Rosa Puertollano Corresponding Author Rosa Puertollano [email protected] orcid.org/0000-0002-1106-5489 Cell Biology and Physiology Center, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD, USA This article has been contributed to by US Government employees and their work is in the public domain in the USA Search for more papers by this author Nina Raben Corresponding Author Nina Raben [email protected] orcid.org/0000-0001-9519-3535 Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD, USA This article has been contributed to by US Government employees and their work is in the public domain in the USA Search for more papers by this author Jeong-A Lim Jeong-A Lim Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD, USA Cell Biology and Physiology Center, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD, USA This article has been contributed to by US Government employees and their work is in the public domain in the USA Search for more papers by this author Lishu Li Corresponding Author Lishu Li [email protected] orcid.org/0000-0003-2133-6702 Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD, USA This article has been contributed to by US Government employees and their work is in the public domain in the USA Search for more papers by this author Orian S Shirihai Orian S Shirihai orcid.org/0000-0001-8466-3431 Department of Medicine, Obesity and Nutrition Section, Evans Biomedical Research Center, Boston University School of Medicine, Boston, MA, USA Search for more papers by this author Kyle M Trudeau Kyle M Trudeau Department of Medicine, Obesity and Nutrition Section, Evans Biomedical Research Center, Boston University School of Medicine, Boston, MA, USA Search for more papers by this author Rosa Puertollano Corresponding Author Rosa Puertollano [email protected] orcid.org/0000-0002-1106-5489 Cell Biology and Physiology Center, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD, USA This article has been contributed to by US Government employees and their work is in the public domain in the USA Search for more papers by this author Nina Raben Corresponding Author Nina Raben [email protected] orcid.org/0000-0001-9519-3535 Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD, USA This article has been contributed to by US Government employees and their work is in the public domain in the USA Search for more papers by this author Author Information Jeong-A Lim1,2,†, Lishu Li *,1,†, Orian S Shirihai3, Kyle M Trudeau3, Rosa Puertollano *,2 and Nina Raben *,1 1Laboratory of Muscle Stem Cells and Gene Regulation, National Institute of Arthritis and Musculoskeletal and Skin Diseases, National Institutes of Health, Bethesda, MD, USA 2Cell Biology and Physiology Center, National Heart, Lung, and Blood Institute, National Institutes of Health, Bethesda, MD, USA 3Department of Medicine, Obesity and Nutrition Section, Evans Biomedical Research Center, Boston University School of Medicine, Boston, MA, USA † These authors contributed equally to this work *Corresponding author. E-mail: [email protected] *Corresponding author. Tel: +1 301 451 2361; E-mail: [email protected] *Corresponding author. Tel: +1 301 496 1474; E-mail: [email protected] EMBO Mol Med (2017)9:353-370https://doi.org/10.15252/emmm.201606547 PDFDownload PDF of article text and main figures. Peer ReviewDownload a summary of the editorial decision process including editorial decision letters, reviewer comments and author responses to feedback. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Abstract Mechanistic target of rapamycin (mTOR) coordinates biosynthetic and catabolic processes in response to multiple extracellular and intracellular signals including growth factors and nutrients. This serine/threonine kinase has long been known as a critical regulator of muscle mass. The recent finding that the decision regarding its activation/inactivation takes place at the lysosome undeniably brings mTOR into the field of lysosomal storage diseases. In this study, we have examined the involvement of the mTOR pathway in the pathophysiology of a severe muscle wasting condition, Pompe disease, caused by excessive accumulation of lysosomal glycogen. Here, we report the dysregulation of mTOR signaling in the diseased muscle cells, and we focus on potential sites for therapeutic intervention. Reactivation of mTOR in the whole muscle of Pompe mice by TSC knockdown resulted in the reversal of atrophy and a striking removal of autophagic buildup. Of particular interest, we found that the aberrant mTOR signaling can be reversed by arginine. This finding can be translated into the clinic and may become a paradigm for targeted therapy in lysosomal, metabolic, and neuromuscular diseases. Synopsis Muscle loss is a feature of lysosomal glycogen storage disorder Pompe disease, also known as acid maltase deficiency. mTORC1 is a key regulator of protein synthesis in muscle. Myotubes and whole muscle from Pompe mice display aberrant mTOR signaling. mTOR activity is diminished in the diseased muscle cells. mTOR is not fully inactivated in the diseased cells after starvation. mTOR remains at the lysosome irrespective of nutrient availability. Lysosomal acidification defect and activation of the AMPK-tuberous sclerosis complex (TSC) pathway are the major culprits responsible for the defective mTOR signaling. TSC inhibition and l-arginine treatments largely correct the defects. Introduction Mechanistic target of rapamycin (mTOR), a highly conserved serine/threonine kinase, forms two multiprotein complexes, mTOR complex 1 (TORC1) and mTOR complex 2 (TORC2). Rapamycin-sensitive mTORC1 complex responds to multiple signals, and when activated, changes the cell metabolism from catabolic to anabolic program, thus promoting protein synthesis and cell growth while repressing autophagy. The role of lysosome in controlling metabolic programs is emphasized by the discovery that activation of this potent anabolic regulator happens at the lysosome in a process mediated through an amino acid-sensing cascade involving V-ATPase, Ragulator, and Rag GTPases. When cells have sufficient amino acids, V-ATPase promotes the guanine nucleotide exchange factor (GEF) activity of Ragulator leading to the formation of active RagA/B·GTP complex at the lysosome; in this active configuration, Rag binds to and delivers mTORC1 to the lysosome where the kinase is activated by Rheb (Ras homolog enriched in brain), a small GTPase that is fixed to the lysosomal surface (Sancak et al, 2010; Zoncu et al, 2011; reviewed in Bar-Peled & Sabatini, 2014). Rheb is a downstream target of tuberous sclerosis complex (TSC) that functions as a GTPase-activating protein (GAP) and converts active GTP-bound Rheb to inactive GDP-bound form, thus inhibiting mTORC1 activity (Inoki et al, 2003; Demetriades et al, 2014; Menon et al, 2014). The recent view of the lysosomes as a site of the mTORC1 activation, along with the long-established role of this kinase in the control of muscle mass, has made the study of mTORC1 signaling of particular interest to research on Pompe disease, a severe muscle wasting disorder characterized by altered lysosomal function. Profound muscle atrophy is a hallmark of Pompe disease, a rare genetic disorder caused by a deficiency of acid alpha-glucosidase (GAA), the enzyme that breaks down glycogen to glucose within lysosomes. Absence of the enzyme leads to a rapidly fatal cardiomyopathy and skeletal muscle myopathy in infants; low levels of residual enzyme activity are associated with childhood and adult-onset progressive skeletal muscle myopathy usually without cardiac involvement (Van der Ploeg & Reuser, 2008). The introduction of enzyme replacement therapy (ERT) changed the natural course of the infantile form because of the notable effect in cardiac muscle; however, the effect in skeletal muscle has been modest at best (Kishnani et al, 2007; Strothotte et al, 2010; Van der Ploeg et al, 2010; Prater et al, 2012). The pathophysiology of muscle damage involves enlargement and rupture of glycogen-filled lysosomes, disturbance of calcium homeostasis and endocytic trafficking, mitochondrial abnormalities, and autophagic defect (Thurberg et al, 2006; Lim et al, 2014, 2015; Nascimbeni et al, 2015). The search for a more effective therapy is currently underway. However, even if muscles are cleared of glycogen and autophagic debris—the two major pathologies in Pompe disease—profound muscle wasting will persist and will remain a major therapeutic challenge. The signaling pathways responsible for the loss of muscle mass in Pompe disease are largely unknown, and the reported studies on mTOR signaling yielded conflicting results. The temptation to boost protein synthesis by stimulating the mTOR pathway is reflected in recent data showing that leucine supplementation halted the decline in muscle mass and reduced glycogen accumulation in GAA-KO muscle (Shemesh et al, 2014). On the other hand, clearance of the excess muscle glycogen was reported following treatment of GAA-KO mice with mTORC1 inhibitor rapamycin; co-administration of rapamycin with the replacement enzyme (recombinant human GAA; alglucosidase alfa, Myozyme®, Genzyme Corporation, a Sanofi Company) reduced muscle glycogen content more than rhGAA or rapamycin alone (Ashe et al, 2010). This study is the first systematic analysis of the upstream regulators and downstream targets of mTORC1 in Pompe muscle cells. We have found a dysregulation of mTOR signaling in the diseased cells—a diminished basal level of mTOR activity, weakened response to cellular stress, and the failure to reallocate mTOR away from lysosomes upon starvation. We have elucidated the molecular mechanisms underlying mTOR dysregulation in Pompe disease and identified points for therapeutic intervention along the mTOR signaling pathway. Furthermore, we have used targeted approaches to reverse the abnormalities in this prototypical lysosomal storage disorder. Results Perturbed mTOR signaling in cultured Pompe muscle cells To explore the mTOR signaling pathway in Pompe disease, we took advantage of a recently developed in vitro model of the disease—GAA-deficient myotubes. These myotubes are formed from conditionally immortalized myoblasts derived from the GAA-KO mice; differentiated myotubes, but not myoblasts, contain large glycogen-filled lysosomes, thus replicating the disease phenotype (Spampanato et al, 2013). Since mTOR kinase is a principal regulator of protein synthesis, we evaluated the rate of protein synthesis in KO cells by using a surface sensing of translation (SUnSET) method, which relies on the incorporation of puromycin into nascent peptide chains resulting in the termination of their elongation (Goodman et al, 2011). A significant decrease (~60%) in anti-puromycin immunoreactivity was detected in KO myotubes compared to WT controls, a finding consistent with a reduction in protein translation (Fig 1A and B). Figure 1. Decreased protein translation in KO cellsSurface sensing of translation (SUnSET) analysis was used to evaluate the incorporation of puromycin into nascent polypeptides. Representative image of Western blot analysis of WT and KO cells treated with puromycin (1 μM) for 30 min. Western blot with anti-vinculin antibody and Ponceau S staining were used as loading controls. Total intensity of puromycin-labeled polypeptides was quantified. Student's t-test was used for statistical analysis. Data are mean ± SE. ***P < 0.001 (P = 0.0009; n = 4). Source data are available online for this figure. Source Data for Figure 1 [emmm201606547-sup-0005-SDataFig1.pdf] Download figure Download PowerPoint Phosphorylation of the 4E-BP1 repressor protein, a downstream mTOR target (Hay & Sonenberg, 2004) reduces its affinity for eIF4E which can then associate with eIF4G to form active eIF4E·eIF4G complex, thus initiating cap-dependent translation. Unexpectedly, the level of phosphorylated 4E-BP1 (p-4E-BP1T37/46) was significantly higher in KO myotubes compared to WT controls (Fig 2A) but the abundance of total 4E-BP1 followed a similar trend, thus confounding the assessment of mTORC1 involvement in protein translation. Therefore, we compared the abundance of eIF4E bound to 4E-BP1 in WT and KO cells; immunoprecipitation of 4E-BP1 from the WT and KO cell lysates followed by Western blotting with eIF4E (and vice versa) antibodies showed an increased eIF4E/4E-BP1 binding in KO cells (Fig 2B), suggesting insufficient mTORC1 activity and suppression of protein synthesis. Consistent with these data, the abundance of non-phosphorylated 4E-BP1 (active form), which binds to and reduces eIF4E availability, was increased in KO cells (Fig 2A). Figure 2. Dysregulation of mTOR signaling and activation of eIF2α/ATF4 pathway in KO cells Representative Western blot of total lysates of WT and KO myotubes. All three forms of 4E-BP1, phosphorylated (p-4E-BP1T37/46), non-phosphorylated (Non-p-4E-BP1T46), and total, are increased in KO cells. WT and KO cell lysates were immunoprecipitated (IP) with either anti-4E-BP1 (left) or anti-eIF4E (right); the immunoprecipitated proteins were then probed with eIF4E or 4E-BP1, respectively. Increased eIF4E/4E-BP1 binding is seen in KO cells. Immunoprecipitation with IgG was included as negative control. Representative Western blot of total lysates of WT and KO myotubes with the indicated antibodies. The levels of eIF2αS51 and ATF4 are increased in KO cells; graphs represent mean ± SE of p-eIF2α/eIF2α ratios (n = 3) and ATF4 (n = 3) levels. *P < 0.05, Student's t-test. Immunoblot analysis of WT and KO lysates showing an increase in both total and p-4E-BP1S65 and a decrease in p-4E-BP1S65/4E-BP1 ratio in KO cells; graph represents mean ± SE (n = 6). **P < 0.01, Student's t-test. Immunoblot analysis of WT and KO lysates showing a decrease in the p-S6K/S6K (n = 5) and p-S6/S6 (n = 6) ratios in KO cells; graphs represent mean ± SE. *P < 0.05, Student's t-test. Data information: Vinculin was used as a loading control (vinculin and its splice variant are commonly seen in both WT and KO, although the ratio of these forms is different; both bands are used for quantitative analysis). All blots (except for IP) are representative of at least three independent experiments. Source data are available online for this figure. Source Data for Figure 2 [emmm201606547-sup-0006-SDataFig2.pdf] Download figure Download PowerPoint A striking enhancement of 4E-BP1 translation despite the general inhibition of protein synthesis in KO cells prompted us to look at the eIF2α/ATF4 pathway. The phosphorylation of eIF2α represses global translation, but leads to increased translation of ATF4 (activation transcription factor 4), which regulates the transcription of many genes [reviewed in Sonenberg and Hinnebusch (2009)]; 4E-BP1 is a potential target of ATF4 because Eif4ebp1 gene contains the ATF4-responsive elements (Kilberg et al, 2009). Indeed, we have found an increase in the levels of p-eIF2αS51 and ATF4 in the KO (Fig 2C). eIF2α/ATF4 pathway plays an important role in the adaptation to stress caused by the generation of reactive oxygen species (Rajesh et al, 2015)—a condition observed in KO cells (Lim et al, 2015). To better assess mTORC1 activity, we evaluated 4E-BP1S65 phosphorylation which is a more reliable indicator since this site is serum- and rapamycin-sensitive, whereas p-4E-BP1T37/46 is only partially sensitive to these treatments (Gingras et al, 2001). Again, we found an increase in both forms, but the ratio of p-4E-BP1S65/total was decreased in Pompe muscle cells, suggesting a diminished mTOR activity (Fig 2D). We then studied the phosphorylation state of S6K, a direct mTORC1 substrate that phosphorylates the ribosomal protein 6 (S6) of the 40S ribosomal subunit. The ratios of p-S6KT421/S424/total S6K and p-S6S235/236/total were decreased in the KO cells (Fig 2E), again suggesting a compromised mTORC1 activity. Next, we began analysis of the upstream inputs to mTORC1—the phosphorylation status of the major upstream regulators of mTOR, AKT, and the AMP-activated protein kinase (AMPK), which have opposite effect on mTORC1 activity. AKT activates mTORC1 through the inhibitory phosphorylation of the tuberous sclerosis complex 2 (TSC2T1426); AMPK-mediated phosphorylation of TSC2S1387 leads to its activation and suppression of mTORC1 (Inoki et al, 2003; Huang & Manning, 2008; Sengupta et al, 2010). The phosphorylation levels of AKT (p-AKTS473) were similar in WT and KO cells on days 4-5 in differentiation medium (not shown) and were even increased in the KO at a later stage of myotubes differentiation (Fig 3A). Despite this increase, AKT-mediated phosphorylation of TSC2T1426 was decreased in KO cells, suggesting a failure of AKT to inhibit TSC2 (Fig 3A). On the other hand, the level of TSC2, as well as the levels of active phosphorylated form of AMPKα (p-AMPKαT172) and its downstream target, p-ACCS79, was increased in KO cell lysates (Fig 3A). AMPKα is activated under low-energy conditions (Sengupta et al, 2010), and its increased activity in KO cells under basal condition is not unexpected; the failure to digest lysosomal glycogen to glucose may deprive muscle cells of a source of energy (Fukuda et al, 2006). Figure 3. Activation of AMPK-TSC2 signaling pathway in KO cells Immunoblot analysis of the phosphorylation levels of AKTS473, TSCT1462, AMPKαT172, and ACCS79 in WT and KO cell lysates. Graphs represent mean ± SE. n = 6 for p-AMPKα; n = 3 for TSC2; n = 3 for p-ACC/ACC. *P < 0.05, **P < 0.01, Student's t-test. Vinculin was used as a loading control. WT and KO myotubes were lysed and subjected to fractionation to obtain lysosome-enriched fractions. The isolated fractions were then examined by Western blot showing increased levels of total and p-TSC2S1387, total and p-AMPKαT172, and total LKB1 in KO cells. Graphs represent mean ± SE. n = 5 for each, p-AMPKα and TSC2; n = 4 for LKB1. *P < 0.05, **P < 0.01, Student's t-test. RHEB was used as a loading control. The blot for RHEB is a composite image; the samples were run on the same gel. Source data are available online for this figure. Source Data for Figure 3 [emmm201606547-sup-0007-SDataFig3.pdf] Download figure Download PowerPoint Recent data have demonstrated that LKB1-mediated phosphorylation of AMPKα in response to energy stress takes place at the endosomal/lysosomal surface leading to inactivation of mTOR and its dissociation from endosome (Zhang et al, 2014). Therefore, we examined the levels of LKB1, AMPKα, and TSC2 in the lysosome-enriched fraction from KO cells (the purity of this fraction is shown in Appendix Fig S1). Indeed, the levels of all three proteins were elevated in KO cells compared to WT (Fig 3B). Furthermore, the levels of p-AMPKαT172 and active phosphorylated form of TSC2S1387 (AMPK-mediated phosphorylation) were increased in the lysosomal fraction in KO cells (Fig 3B). Since TSC2 inhibits mTOR by inactivating the small GTPase Rheb (Inoki et al, 2003), increased levels of AMPK activated TSC2 at the lysosomal surface may explain diminished basal mTOR activity in KO cells. Of note, AKT-mediated phosphorylated form of TSC2T1426 was not detected in the lysosomal fraction (not shown). In vivo results mirror the findings in cultured cells To validate in vivo the relevance of our in vitro findings, we analyzed mTOR signaling in whole muscle of the GAA-KO mice. For these studies, we have used the white part of the gastrocnemius muscle, which are most resistant to ERT (Lim et al, 2014). Significant portions of 4E-BP1 and S6 remained non-phosphorylated (decreased ratios of p-4E-BP1T37/46/total 4E-BP1 and p-S6S235/236/total S6) in GAA-KO muscle compared to WT, suggesting a decrease in mTORC1 activity (Fig 4A and B). Of note, similar to what was found in cultured KO cells, the levels of both p-4E-BP1 and total 4E-BP1 were increased in GAA-KO muscle, consistent with our previous data (Raben et al, 2010). Figure 4. Disturbance of mTOR signaling in vivo in GAA-KO miceMuscle biopsies (white part of gastrocnemius) were obtained from 4- to 6-month-old WT and GAA-KO (KO) mice. A, B. Western blot analysis of whole muscle lysates from WT and GAA-KO mice with the indicated antibodies. Graphical presentation of the data is shown in (B). Data illustrate the mean ± SE. n = 6 for p-4E-BP1/4E-BP1, p-S6/S6, p-PRAS40/PRAS40, and p-TSC2/TSC2; n = 5 for p-AMPKα; n = 3 for LKB1. *P < 0.05, **P < 0.01, ***P < 0.001, Student's t-test. GAPDH was used as a loading control. C. An increase in ADP/ATP ratio in whole muscle of GAA-KO mice. Data illustrate the mean ± SE. n = 3 for WT; n = 4 for KO. *P < 0.05, Student's t-test. D, E. Muscle tissues derived from WT (n = 3) and GAA-KO mice (n = 4) were homogenized in lysis buffer and subjected to fractionation to obtain lysosome-enriched fractions. The isolated fractions were then examined by Western blot showing increased levels of total mTOR, TSC2, and AMPKα in GAA-KO. Graphical presentation of the data is shown in (E). Graphs represent mean ± SE. **P < 0.01, ***P < 0.001, Student's t-test. RHEB and Ponceau S staining were used to verify equal protein loading. F. Immunostaining of a single fiber from a GAA-KO mouse with anti-LAMP1 (red) and anti-mTOR (green) antibodies showing extensive co-localization of the two stains. Scale bar: 10 μm. Source data are available online for this figure. Source Data for Figure 4 [emmm201606547-sup-0008-SDataFig4.pdf] Download figure Download PowerPoint No significant changes in the level of active p-AKTS473 were seen in GAA-KO muscle (Fig 4A). Furthermore, the level of phosphorylated PRAS40 (proline-rich AKT substrate of 40 kDa; p-PRAS40T246), a downstream target of AKT, was also no different in GAA-KO muscle compared to WT, but the total level of PRAS40 was significantly increased (Fig 4A and B). Because AKT- mediated phosphorylation of PRAS40 is known to relieve the inhibitory effect of PRAS40 on mTORC1 (Sancak et al, 2007), an increase in the amount of hypophosphorylated PRAS40 would lead to the inhibition of mTORC1 activity. As in cultured KO cells, the phosphorylation levels of p-AMPKαT172, the master regulator of cellular energy homeostasis, was increased in GAA-KO compared to those in WT muscle (Fig 4A and B). Furthermore, we have found an elevated ADP/ATP ratio in GAA-KO muscle (Fig 4C), indicating energy deprivation—a condition known to trigger AMPKα activation. The rise in the amount of active p-AMPKαT172 also agrees with both an increase in the level of its upstream activation kinase LKB1 and an increase in the phosphorylation level of its direct downstream target, p-TSC2S1387 (Fig 4A and B). Again, as in cultured KO cells, the abundance of AMPKα and TSC2 was increased in lysosome-enriched fraction from GAA-KO muscle (Fig 4D and E). Unexpectedly, the level of mTOR was also increased in the lysosomal fraction, and immunostaining of isolated muscle fibers with mTORC1 and lysosomal marker LAMP1 confirmed a striking co-localization of the two stains (Fig 4D–F). It appears that the activity of mTOR in GAA-KO muscle is reduced despite its excessive accumulation at the lysosome. Thus, the mechanism of perturbed mTORC1 signaling in GAA-KO muscle and in cultured KO cells is similar in that the suppression of mTORC1 activity is AKT-independent, and that a decrease in the ATP content leads to AMPKα-mediated mTOR inhibition. mTOR is locked on the lysosome under nutrient deprivation in KO cells Recent data have shown that multiple proteins which reside in the cytosol and on the lysosomes are engaged in the recruitment of mTORC1 to the lysosome (activation) and its release from the lysosome (inactivation) (Bar-Peled et al, 2012; Demetriades et al, 2014, 2016; Zhang et al, 2014). We reasoned that lysosomal enlargement and the acidification defect in the diseased muscle cells (Fukuda et al, 2006; Takikita et al, 2009) would affect the interaction of the components of the complex machinery responsible for the proper localization and activation/inactivation of mTORC1. To investigate the relationship between the activity of mTOR and its intracellular localization in Pompe muscle, we again turned to the in vitro model. As expected, by 2 h of starvation 4E-BP1 and S6 were almost completely dephosphorylated in WT cells; in contrast, the degree of dephosphorylation in the KO was less pronounced, particularly when the cells were treated with medium lacking only amino acids in the presence of dialyzed serum containing growth factors (Fig 5A and B). A weakened mTORC1 response in KO cells is also observed after refeeding subsequent to 2 h of starvation. In WT cells, the phosphorylation of 4E-BP1 after 30 min rebounds to a level that is higher than that at the basal level, whereas in the KO it does not, as shown by the abundance of hypophosphorylated forms in the diseased cells; consistent with this, the levels of non-phosphorylated 4E-BP1 in the KO are much higher than those in the WT at both 15 and 30 min after refeeding (Fig 5C). Of note, the levels of S6K and S6 in the KO were similar to those in WT following refeeding, suggesting a differential effect on 4E-BP1 versus S6K (Fig 5C). This contrary activity of mTORC1 toward its substrates has been reported in other systems (Liu et al, 2004; Choo et al, 2008). Figure 5. KO cells exhibit a diminished response to starvation and inadequate activation after refeeding WT and KO myotubes were starved (HBSS) for 0, 1, and 2 h, lysed and subjected to immunoblot analysis with the indicated antibodies. The levels of p-4E-BP1T37/46 and p-S6S235/236 in KO are higher compared to WT at 1 and 2 h of starvation. Graph shows an increase in p-4E-BP1T37/46/total (n = 5) and p-S6S235/236/total (n = 3) ratios in KO compared to WT after 2 h starvation; the data represent mean ± SE. *P < 0.05, **P < 0.01, Student's t-test. Vinculin was used as a loading control. The blots are composite images; the samples were run on the same gel. WT and KO myotubes were incubated in HBSS with or without dialyzed serum for 2 h, lysed, and subjected to immunoblot analysis with the indicated antibodies. Both p-4E-BP1T37/46 and p-4E-BP1S65 antibodies were used for the experiments. The degree of 4E-BP1 dephosphorylation after amino acid starvation (AA) is different from that after HBSS in KO (*P < 0.05) but not in WT cells (n.s., not significant). Graph represents mean ± SE; Student's t-test. n = 3 for each condition. WT and KO myotubes were starved (HBSS) for 2 h, and then refed for 15 and 30 min using differentiation medium as shown schematically. Cell lysates were then subjected to immunoblot analysis with the indicated antibodies. Significant amounts of non-phosphorylated and hypophosphorylated forms of 4E-BP1 are still seen after 15 and 30 min of refeeding in KO cells; the levels of S6K and S6 in the KO were not different from those in controls following refeeding. WT and KO myotubes were starved as in (A). The level of p-ULK1S757 in KO is higher than in WT after 2 h starvation. The p-ULK1/vinculin (n = 4) and LC3-II/total (LC3-I + LC3-II; n = 3) ratios at 2 h after starvation were calculated. Data are mean ± SE; *P < 0.05, ***P < 0.001, Student's t-test. The blots are composite images; the samples were run on the same gel. Source data are available online for this figure. Source Data for Figure 5 [emmm201606547-sup-0009-SDataFig5.pdf]

Pompe disease is a rare inherited disorder of lysosomal glycogen metabolism due to acid α-glucosidase (GAA) deficiency. Enzyme replacement therapy (ERT) using alglucosidase alfa, a recombinant human GAA (rhGAA), is the only approved treatment for Pompe disease. Although alglucosidase alfa has provided clinical benefits, its poor targeting to key disease-relevant skeletal muscles results in suboptimal efficacy. We are developing an rhGAA, ATB200 (Amicus proprietary rhGAA), with high levels of mannose-6-phosphate that are required for efficient cellular uptake and lysosomal trafficking. When administered in combination with the pharmacological chaperone AT2221 (miglustat), which stabilizes the enzyme and improves its pharmacokinetic properties, ATB200/AT2221 was substantially more potent than alglucosidase alfa in a mouse model of Pompe disease. The new investigational therapy is more effective at reversing the primary abnormality - intralysosomal glycogen accumulation - in multiple muscles. Furthermore, unlike the current standard of care, ATB200/AT2221 dramatically reduces autophagic buildup, a major secondary defect in the diseased muscles. The reversal of lysosomal and autophagic pathologies leads to improved muscle function. These data demonstrate the superiority of ATB200/AT2221 over the currently approved ERT in the murine model.

Pompe disease, also known as glycogen storage disease type II, is caused by the lack or deficiency of a single enzyme, lysosomal acid alpha-glucosidase, leading to severe cardiac and skeletal muscle myopathy due to progressive accumulation of glycogen. The discovery that acid alpha-glucosidase resides in the lysosome gave rise to the concept of lysosomal storage diseases, and Pompe disease became the first among many monogenic diseases caused by loss of lysosomal enzyme activities. The only disease-specific treatment available for Pompe disease patients is enzyme replacement therapy (ERT) which aims to halt the natural course of the illness. Both the success and limitations of ERT provided novel insights in the pathophysiology of the disease and motivated the scientific community to develop the next generation of therapies that have already progressed to the clinic.

Lysosomal storage disorders (LSDs), which number over fifty, are monogenically inherited and caused by mutations in genes encoding proteins that are involved in lysosomal function. Lack of the functional protein results in storage of a distinctive material within the lysosomes, which for years was thought to determine the pathophysiology of the disorder. However, our current view posits that the primary storage material disrupts the normal role of the lysosome in the autophagic pathway resulting in the secondary storage of autophagic debris. It is this "collateral damage" which is common to the LSDs but nonetheless intricately nuanced in each. We have selected five LSDs resulting from defective proteins that govern widely different lysosomal functions including glycogen degradation (Pompe), lysosomal transport (Cystinosis), lysosomal trafficking (Danon), glycolipid degradation (Gaucher) and an unidentified function (Batten) and argue that despite the disparate functions, these proteins, when mutant, all impair the autophagic process uniquely.

This report demonstrates that a single intravenous administration of a gene therapy vector can potentially result in the correction of all affected muscles in a mouse model of a human genetic muscle disease. These results were achieved by capitalizing both on the positive attributes of modified adenovirus-based vectoring systems and receptor-mediated lysosomal targeting of enzymes. The muscle disease treated, glycogen storage disease type II, is a lysosomal storage disorder that manifests as a progressive myopathy, secondary to massive glycogen accumulations in the skeletal and/or cardiac muscles of affected individuals. We demonstrated that a single intravenous administration of a modified Ad vector encoding human acid α-glucosidase (GAA) resulted in efficient hepatic transduction and secretion of high levels of the precursor GAA proenzyme into the plasma of treated animals. Subsequently, systemic distribution and uptake of the proenzyme into the skeletal and cardiac muscles of the GAA-knockout mouse was confirmed. As a result, systemic decreases (and correction) of the glycogen accumulations in a variety of muscle tissues was demonstrated. This model can potentially be expanded to include the treatment of other lysosomal enzyme disorders. Lessons learned from systemic genetic therapy of muscle disorders also should have implications for other muscle diseases, such as the muscular dystrophies.

Pompe disease (type II glycogen storage disease) is an autosomal recessive disorder caused by a deficiency of lysosomal acid alpha-glucosidase (GAA) leading to the accumulation of glycogen in the lysosomes primarily in cardiac and skeletal muscle. The recombinant human GAA (rhGAA) is currently in clinical trials for enzyme replacement therapy of Pompe disease. Both clinical data and the results of preclinical studies in our knockout model of this disease show that rhGAA is much more effective in resolving the cardiomyopathy than the skeletal muscle myopathy. By contrast, another form of human GAA--transgenic enzyme constitutively produced in liver and secreted into the bloodstream of knockout mice (Gaa-/-)--completely prevented both cardiac and skeletal muscle glycogen accumulation. In the experiments reported here, the transgenic enzyme was much less efficient when delivered to skeletal muscle after significant amounts of glycogen had already accumulated. Furthermore, the transgenic enzyme and the rhGAA have similar therapeutic effects, and both efficiently clear glycogen from cardiac muscle and type I muscle fibers, but not type II fibers. Low abundance of proteins involved in endocytosis and trafficking of lysosomal enzymes combined with increased autophagy in type II fibers may explain the resistance to therapy.

Pompe disease is a lysosomal storage disease caused by the absence of acid alpha-1,4 glucosidase (GAA). The pathophysiology of Pompe disease includes generalized myopathy of both cardiac and skeletal muscle. We sought to use recombinant adeno-associated virus (rAAV) vectors to deliver functional GAA genes in vitro and in vivo. Myotubes and fibroblasts from Pompe patients were transduced in vitro with rAAV2-GAA. At 14 days postinfection, GAA activities were at least fourfold higher than in their respective untransduced controls, with a 10-fold increase observed in GAA-deficient myotubes. BALB/c and Gaa(-/-) mice were also treated with rAAV vectors. Persistent expression of vector-derived human GAA was observed in BALB/c mice up to 6 months after treatment. In Gaa(-/-) mice, intramuscular and intramyocardial delivery of rAAV2-Gaa (carrying the mouse Gaa cDNA) resulted in near-normal enzyme activities. Skeletal muscle contractility was partially restored in the soleus muscles of treated Gaa(-/-) mice, indicating the potential for vector-mediated restoration of both enzymatic activity and muscle function. Furthermore, intramuscular treatment with a recombinant AAV serotype 1 vector (rAAV1-Gaa) led to nearly eight times normal enzymatic activity in Gaa(-/-) mice, with concomitant glycogen clearance as assessed in vitro and by proton magnetic resonance spectroscopy.

Dysferlin deficiency causes limb-girdle muscular dystrophy type 2B (LGMD2B; proximal weakness) and Miyoshi myopathy (distal weakness). Muscle inflammation is often present in dysferlin deficiency, and patients are frequently misdiagnosed as having polymyositis. Because monocytes normally express dysferlin, we hypothesized that monocyte/macrophage dysfunction in dysferlin-deficient patients might contribute to disease onset and progression. We therefore examined phagocytic activity, in the presence and absence of cytokines, in freshly isolated peripheral blood monocytes from LGMD2B patients and in the SJL dysferlin-deficient mouse model. Dysferlin-deficient monocytes showed increased phagocytic activity compared with control cells. siRNA-mediated inhibition of dysferlin expression in the J774 macrophage cell line resulted in significantly enhanced phagocytosis, both at baseline and in response to tumor necrosis factor-alpha. Immunohistochemical analysis revealed positive staining for several mononuclear cell activation markers in LGMD2B human muscle and SJL mouse muscle. SJL muscle showed strong up-regulation of endocytic proteins CIMPR, clathrin, and adaptin-alpha, and LGMD2B muscle exhibited decreased expression of decay accelerating factor, which was not dysferlin-specific. We further showed that expression levels of small Rho family GTPases RhoA, Rac1, and Cdc 42 were increased in dysferlin-deficient murine immune cells compared with control cells. Therefore, we hypothesize that mild myofiber damage in dysferlin-deficient muscle stimulates an inflammatory cascade that may initiate, exacerbate, and possibly perpetuate the underlying myofiber-specific dystrophic process.

We previously proposed that novel expression and/or conformation of autoantigens in the target tissue may play a role in generating phenotype-specific immune responses. The strong association of autoantibodies to histidyl-transfer RNA synthetase (HisRS, Jo-1) with interstitial lung disease in patients with myositis led us to study HisRS expression and conformation in the lung.Normal human tissue specimens were probed with a novel anti-HisRS antibody recognizing its granzyme B-cleavable conformation by immunoblotting and immunohistochemistry. The HisRS granzyme B site was mapped using site-directed mutagenesis, and its relationship to the antibody recognition domain was evaluated in tandem immunoprecipitation/granzyme B cleavage studies.The HisRS alpha-helical coiled-coil N-terminal domain recognized by autoantibodies is bounded by a granzyme B cleavage site. In immunoprecipitation studies with patient sera, HisRS was found to exist in 2 conformations, defined by sensitivity to cleavage by granzyme B and modification by autoantibody binding. Despite similar global expression of HisRS in different tissue, expression of its granzyme B-cleavable form was enriched in the lung and localized to the alveolar epithelium.A proteolytically sensitive conformation of HisRS exists in the lung, the target tissue associated with this autoantibody response. We thus propose that autoimmunity to HisRS is initiated and propagated in the lung.

AbstractIn Pompe disease, a deficiency of lysosomal acid alpha-glucosidase, intralysosomal glycogen accumulates in multiple tissues, with skeletal and cardiac muscle most severely affected.1 Complete enzyme deficiency results in rapidly progressive infantile cardiomyopathy and skeletal muscle myopathy that is fatal within the first two years of life. Patients with partial enzyme deficiency suffer from skeletal muscle myopathy and experience shortened lifespan due to respiratory failure. The major advance has been the development of enzyme replacement therapy, which recently became available for Pompe patients. However, the effective clearance of skeletal muscle glycogen, as shown by both clinical and pre-clinical studies, has proven more difficult than anticipated.2-4 The work published in Annals of Neurology5 was designed to cast light on the problem, and was an attempt to look beyond the lysosomes by analyzing the downstream events affected by the accumulation of undigested substrate in lysosomes. We have found thatthe cellular pathology in Pompe disease spreads to affect both endocytic (the route of the therapeutic enzyme) and autophagic (the route of glycogen) pathways, leading to excessive autophagic buildup in therapy-resistant skeletal muscle fibers of the knockout mice.Addendum to:Dysfunction of Endocytic and Autophagic Pathways in a Lysosomal Storage DiseaseTokiko Fukuda, Lindsay Ewan, Martina Bauer, Robert J. Mattaliano, Kristien Zaal,Evelyn Ralston, Paul H. Plotz and Nina RabenAnn Neurol 2006; 59:700-8

Autophagy is a major pathway for delivery of proteins and organelles to lysosomes where they are degraded and recycled. We have previously shown excessive autophagy in a mouse model of Pompe disease (glycogen storage disease type II), a devastating myopathy caused by a deficiency of the glycogen-degrading lysosomal enzyme, acid alpha-glucosidase. The autophagic buildup constituted a major pathological component in skeletal muscle and interfered with delivery of the therapeutic enzyme. To assess the role of autophagy in the pathogenesis of the human disease, we have analyzed vesicles of the lysosomal-degradative pathway in isolated single muscle fibers from Pompe patients. Human myofibers showed abundant autophagosome formation and areas of autophagic buildup of a wide range of sizes. In patients, as in the mouse model, the enormous autophagic buildup causes greater skeletal muscle damage than the enlarged, glycogen-filled lysosomes outside the autophagic regions. Clearing or preventing autophagic buildup seems, therefore, a necessary target of Pompe disease therapy.

Abstract Macroautophagy (often referred to as autophagy) is an evolutionarily conserved intracellular system by which macromolecules and organelles are delivered to lysosomes for degradation and recycling. Autophagy is robustly induced in response to starvation in order to generate nutrients and energy through the lysosomal degradation of cytoplasmic components. Constitutive, basal autophagy serves as a quality control mechanism for the elimination of aggregated proteins and worn‐out or damaged organelles, such as mitochondria. Research during the last decade has made it clear that malfunctioning or failure of this system is associated with a wide range of human pathologies and age‐related diseases. Our recent data provide strong evidence for the role of autophagy in the pathogenesis of Pompe disease, a lysosomal glycogen storage disease caused by deficiency of acid alpha‐glucosidase (GAA). Large pools of autophagic debris in skeletal muscle cells can be seen in both our GAA knockout model and patients with Pompe disease. In this review, we will focus on these recent data, and comment on the not so recent observations pointing to the involvement of autophagy in skeletal muscle damage in Pompe disease. Published 2012. This article is a U.S. Government work and is in the public domain in the USA.

Pompe disease results in the accumulation of lysosomal glycogen in multiple tissues due to a deficiency of acid alpha-glucosidase (GAA). Enzyme replacement therapy for Pompe disease was recently approved in Europe, the U.S., Canada, and Japan using a recombinant human GAA (Myozyme, alglucosidase alfa) produced in CHO cells (CHO-GAA). During the development of alglucosidase alfa, we examined the in vitro and in vivo properties of CHO cell-derived rhGAA, an rhGAA purified from the milk of transgenic rabbits, as well as an experimental version of rhGAA containing additional mannose-6-phosphate intended to facilitate muscle targeting. Biochemical analyses identified differences in rhGAA N-termini, glycosylation types and binding properties to several carbohydrate receptors. In a mouse model of Pompe disease, glycogen was more efficiently removed from the heart than from skeletal muscle for all enzymes, and overall, the CHO cell-derived rhGAA reduced glycogen to a greater extent than that observed with the other enzymes. The results of these preclinical studies, combined with biochemical characterization data for the three molecules described within, led to the selection of the CHO-GAA for clinical development and registration as the first approved therapy for Pompe disease.

Lysosomes are the final destination of the autophagic pathway. It is in the acidic milieu of the lysosomes that autophagic cargo is metabolized and recycled. One would expect that diseases with primary lysosomal defects would be among the first systems in which autophagy would be studied. In reality, this is not the case. Lysosomal storage diseases, a group of more than 60 diverse inherited disorders, have only recently become a focus of autophagic research. Studies of these clinically severe conditions promise not only to clarify pathogenic mechanisms, but also to expand our knowledge of autophagy itself. In this chapter, we will describe the lysosomal storage diseases in which autophagy has been explored, and present the approaches used to evaluate this essential cellular pathway.

Abstract Background Pompe disease is an autosomal recessive metabolic neuromuscular disorder caused by a deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA). It has long been believed that the underlying pathology leading to tissue damage is caused by the enlargement and rupture of glycogen-filled lysosomes. Recent studies have also implicated autophagy, an intracellular lysosome-dependent degradation system, in the disease pathogenesis. In this study, we characterize the long-term impact of enzyme replacement therapy (ERT) with recombinant human GAA (rhGAA) on lysosomal glycogen accumulation and autophagy in some of the oldest survivors with classic infantile Pompe disease (IPD). Methods Muscle biopsies from 8 [4 female, 4 male; 6 cross-reactive immunologic material (CRIM)-positive, 2 CRIM-negative] patients with a confirmed diagnosis of classic IPD were examined using standard histopathological approaches. In addition, muscle biopsies were evaluated by immunostaining for lysosomal marker (lysosomal-associated membrane protein-2; LAMP2), autophagosomal marker (microtubule-associated protein 1 light chain 3; LC3), and acid and alkaline ATPases. All patients received rhGAA by infusion at cumulative biweekly doses of 20–40 mg/kg. Results Median age at diagnosis of classic IPD was 3.4 months (range: 0 to 6.5 months; n = 8). At the time of muscle biopsy, the patients’ ages ranged from 1 to 103 months and ERT duration ranged from 0 (i.e., baseline, pre-ERT) to 96 months. The response to therapy varied considerably among the patients: some patients demonstrated motor gains while others experienced deterioration of motor function, either with or without a period of initial clinical benefit. Skeletal muscle pathology included fiber destruction, lysosomal vacuolation, and autophagic abnormalities (i.e., buildup), particularly in fibers with minimal lysosomal enlargement. Overall, the pathology reflected clinical status. Conclusions This is the first study to investigate the impact of rhGAA ERT on lysosomal glycogen accumulation and autophagic buildup in patients with classic IPD beyond 18 months of treatment. Our findings indicate that ERT does not fully halt or reverse the underlying skeletal muscle pathology in IPD. The best outcomes were observed in the two patients who began therapy early, namely at 0.5 and 1.1 months of age.

Pompe disease, an inherited deficiency of lysosomal acid alpha-glucosidase (GAA), is a metabolic myopathy with heterogeneous clinical presentations. Late-onset Pompe disease (LOPD) is a debilitating progressive muscle disorder that can occur anytime from early childhood to late adulthood. Enzyme replacement therapy (ERT) with recombinant human GAA is currently available for Pompe patients. Although ERT shows some benefits, the reversal of skeletal muscle pathology - lysosomal glycogen accumulation and autophagic buildup - remains a challenge. In this study, we examined the clinical status and muscle pathology of 22 LOPD patients and one atypical infantile patient on ERT to understand the reasons for muscle resistance to ERT.The patients were divided into three groups for analysis, based on the age of onset and diagnosis: adult-onset patients, juvenile-onset patients, and those identified through newborn screening (NBS). The areas of autophagic buildup found in patients' biopsies of all three groups, contained large autofluorescent inclusions which we show are made of lipofuscin, an indigestible intralysosomal material typically associated with ageing. These inclusions, analysed by staining, spectral analysis, time-resolved Fluorescence Lifetime Imaging (FLIM), and Second Harmonic Generation (SHG) imaging, were the major pathology remaining in many fibers after ERT. The best outcome of ERT both clinically and morphologically was observed in the NBS patients.The muscle biopsy, in spite of its shortcomings, allowed us to recognize an underreported, ERT-resistant pathology in LOPD; numerous lysosomes and autolysosomes loaded with lipofuscin appear to be a hallmark of LOPD skeletal muscle. Lipofuscin accumulation - a result of inefficient lysosomal degradation - may in turn exacerbate both lysosomal and autophagic abnormalities.

Pompe disease (glycogen storage disease type II) is caused by mutations in acid α-glucosidase (GAA) resulting in lysosomal pathology and impairment of the muscular and cardio-pulmonary systems. Enzyme replacement therapy (ERT), the only approved therapy for Pompe disease, improves muscle function by reducing glycogen accumulation but this approach entails several limitations including a short drug half-life and an antibody response that results in reduced efficacy. To address these limitations, new treatments such as gene therapy are under development to increase the intrinsic ability of the affected cells to produce GAA. Key components to gene therapy strategies include the choice of vector, promoter, and the route of administration. The efficacy of gene therapy depends on the ability of the vector to drive gene expression in the target tissue and also on the recipient's immune tolerance to the transgene protein. In this review, we discuss the preclinical and clinical studies that are paving the way for the development of a gene therapy strategy for patients with early and late onset Pompe disease as well as some of the challenges for advancing gene therapy.

To enhance the delivery of rhGAA (recombinant GAA, where GAA stands for acid alpha-glucosidase) to the affected muscles in Pompe disease, the carbohydrate moieties on the enzyme were remodelled to exhibit a high affinity ligand for the CI-MPR (cation-independent M6P receptor, where M6P stands for mannose 6-phosphate). This was achieved by chemically conjugating on to rhGAA, a synthetic oligosaccharide ligand bearing M6P residues in the optimal configuration for binding the receptor. The carbonyl chemistry used resulted in the conjugation of approx. six synthetic ligands on to each enzyme. The resulting modified enzyme [neo-rhGAA (modified recombinant human GAA harbouring synthetic oligosaccharide ligands)] displayed near-normal specific activity and significantly increased affinity for the CI-MPR. However, binding to the mannose receptor was unaffected despite the introduction of additional mannose residues in neo-rhGAA. Uptake studies using L6 myoblasts showed neo-rhGAA was internalized approx. 20-fold more efficiently than the unmodified enzyme. Administration of neo-rhGAA into Pompe mice also resulted in greater clearance of glycogen from all the affected muscles when compared with the unmodified rhGAA. Comparable reductions in tissue glycogen levels in the Pompe mice were realized using an approx. 8-fold lower dose of neo-rhGAA in the heart and diaphragm and an approx. 4-fold lower dose in the skeletal muscles. Treatment of older Pompe mice, which are more refractory to enzyme therapy, with 40 mg/kg neo-rhGAA resulted in near-complete clearance of glycogen from all the affected muscles as opposed to only partial correction with the unmodified rhGAA. These results demonstrate that remodelling the carbohydrate of rhGAA to improve its affinity for the CI-MPR represents a feasible approach to enhance the efficacy of enzyme replacement therapy for Pompe disease.

The authors previously reported the generation of a knockout mouse model of Pompe disease caused by the inherited deficiency of lysosomal acid alpha-glucosidase (GAA). The disorder in the knockout mice (GAA-/-) resembles the human disease closely, except that the clinical symptoms develop late relative to the lifespan of the animals. In an attempt to accelerate the course of the disease in the knockouts, the authors increased the level of cytoplasmic glycogen by overexpressing glycogen synthase (GSase) or GlutI glucose transporter.GAA-/- mice were crossed to transgenic mice overexpressing GSase or GlutI in skeletal muscle.Both transgenics on a GAA knockout background (GS/GAA-/- and GlutI/GAA-/-) developed a severe muscle wasting disorder with an early age at onset. This finding, however, is not the major focus of the study. Unexpectedly, the mice bearing the GSase transgene, but not those bearing the GlutI transgene, accumulated structurally abnormal polysaccharide (polyglucosan) similar to that observed in patients with Lafora disease, glycogenosis type IV, and glycogenosis type VII. Ultrastructurally, the periodic acid-Schiff (PAS)-positive polysaccharide inclusions were composed of short, amorphous, irregular branching filaments indistinguishable from classic polyglucosan bodies. The authors show here that increased level of GSase in the presence of normal glycogen branching enzyme (GBE) activity leads to polyglucosan accumulation. The authors have further shown that inactivation of lysosomal acid alpha-glucosidase in the knockout mice does not contribute to the process of polyglucosan formation.An imbalance between GSase and GBE activities is proposed as the mechanism involved in the production of polyglucosan bodies. The authors may have inadvertently created a "muscle polyglucosan disease" by simulating the mechanism for polyglucosan formation.

In an attempt to understand the mechanisms of cell injury in the inflammatory myopathies, we analyzed the expression of costimulatory molecules, CTLA4, CD28, CD86, CD40, and CD154 as well as HLA class I, HLA class II, and ICAM-I in normal muscle and in muscle biopsies from patients with polymyositis (PM) or dermatomyositis (DM). By immunohistochemical staining, DM and PM biopsies showed the presence of CTLA4, CD28, CD86, and CD40 on inflammatory cells. More strikingly, however, low levels of CTLA4 and CD28 were observed on muscle cells. The expression of CTLA4 and CD28 on nonlymphoid cells has not been previously reported. These unexpected findings were confirmed in cultured normal human myoblasts: various proinflammatory cytokines induced the expression of CTLA4 and CD28 on normal human muscle cells. The sequences of the cDNAs were found to be identical to the sequences for these molecules in T cells. The data suggest a novel complexity in the network of cellular interactions between the infiltrated immune cells and the muscle cells in which the normal relationship between infiltrating inflammatory cells and target tissue is under a previously unrecognized set of controls.

In myositis, disease-specific autoantibodies may be directed against an aminoacyl-tRNA synthetase, usually histidyl-tRNA synthetase. To explore the basis for this phenomenon, we have made recombinant histidyl-tRNA synthetase in the baculovirus system. It was enzymatically active and recognized by human autoantibodies. A truncated protein lacking the first 60 amino acids was inactive as an antigen and as an enzyme. This region is within the first two exons, is predicted to have a coiled-coil configuration, and is found in some other synthetases but not in Escherichia coli or yeast histidyl-tRNA synthetase. Circular dichroism showed that the peptides from this region (amino acids 1-60 and 1-47) have the predicted high alpha-helical content, but smaller fragments (1-30, 14-45, and 31-60) do not. The peptides with a high alpha-helical content could inhibit autoantibodies almost completely, whereas the smaller peptides were unable to do so. The amino acid sequence of this coiled-coil domain in human histidyl-tRNA synthetase resembles the sequence of the extended this coiled-coil arm near the NH2 terminus of bacterial seryl-tRNA synthetase as well as similar regions in some eukaryotic aminoacyl-tRNA synthetases, raising the possibility that this domain serves a similar tRNA-stabilizing role and has been preserved from a common ancestor.

Phosphofructokinase deficiency (Tarui disease, glycogen storage disease VII, GSD VII) stands out among all the GSDs. PFK deficiency was the first recognized disorder that directly affects glycolysis. Ever since the discovery of the disease in 1965, a wide range of biochemical, physiological and molecular studies of the disorder have greatly expanded our understanding of the function of normal muscle, general control of glycolysis and glycogen metabolism. The studies of PFK deficiency vastly enriched the field of glycogen storage diseases, as well as the field of metabolic and neuromuscular disorders. This article cites a historical overview of this clinical entity and the progress that has been made in molecular genetic area. We will also present the results of a search in-silico, which allowed us to identify a previously unknown sequence of the human platelet PFK gene (PFK-P). In addition, we will describe phylogenetic analysis of evolution of PFK genes.

Glycogen storage disease type II (GSDII)/Pompe disease is an autosomal recessive multi-system disorder due to a deficiency of the glycogen-degrading lysosomal enzyme, acid alpha-glucosidase. Without adequate levels of alpha-glucosidase, there is a progressive accumulation of glycogen inside the lysosome, resulting in lysosomal expansion in many tissues, although the major clinical manifestations are seen in cardiac and skeletal muscle. Pompe disease presents as a continuum of clinical phenotypes. In the most severe cases, disease onset occurs in infancy and death results from cardiac and respiratory failure within the first 1 or 2 years of life. In the milder late-onset forms, cardiac muscle is spared and muscle weakness is the primary symptom. Weakness of respiratory muscles is the major cause of mortality in these cases. Enzyme replacement therapy (ERT) with alglucosidase alfa (Myozyme; Genzyme Corp., Framingham, MA) is now available for all forms of glycogen storage disease type II. ERT has shown remarkable success in reversing pathology in cardiac muscle and extending life expectancy in infantile patients. However, skeletal muscle has proven to be a more challenging target for ERT. Although ERT is less effective in skeletal muscle than was hoped for, the lessons learned from both clinical and pre-clinical ERT studies have greatly expanded our understanding of the pathogenesis of the disease. A combination of fundamental studies and clinical follow-up, as well as exploration of other therapies, is necessary to take treatment for glycogen storage disease type II to the next level.

Pompe disease (glycogen storage disease II) is caused by mutations in the acid α-glucosidase gene. The most common form is rapidly progressive with glycogen storage, particularly in muscle, which leads to profound weakness, cardiac failure, and death by the age of 2 years. Although usually considered a muscle disease, glycogen storage also occurs in the CNS. We evaluated the progression of neuropathologic and behavioral abnormalities in a Pompe disease mouse model (6neo/6neo) that displays many features of the human disease. Homozygous mutant mice store excess glycogen within large neurons of hindbrain, spinal cord, and sensory ganglia by the age of 1 month; accumulations then spread progressively within many CNS cell types. "Silver degeneration" and Fluoro-Jade C stains revealed severe degeneration in axon terminals of primary sensory neurons at 3 to 9 months. These abnormalities were accompanied by progressive behavioral impairment on rotorod, wire hanging, and foot fault tests. The extensive neuropathologic alterations in this model suggest that therapy of skeletal and cardiac muscle disorders by systemic enzyme replacement therapy may not be sufficient to reverse functional deficits due to CNS glycogen storage, particularly early-onset, rapidly progressive disease. A better understanding of the basis for clinical manifestations is needed to correlate CNS pathology with Pompe disease manifestations.

Pompe disease is a lysosomal storage disorder caused by the deficiency of acid alpha-glucosidase, the enzyme that degrades glycogen in the lysosomes. The disease manifests as a fatal cardiomyopathy and skeletal muscle myopathy in infants; in milder late-onset forms skeletal muscle is the major tissue affected. We have previously demonstrated that autophagic inclusions in muscle are prominent in adult patients and the mouse model. In this study we have evaluated the contribution of the autophagic pathology in infants before and 6 months after enzyme replacement therapy. Single muscle fibers, isolated from muscle biopsies, were stained for autophagosomal and lysosomal markers and analyzed by confocal microscopy. In addition, unstained bundles of fixed muscles were analyzed by second harmonic imaging. Unexpectedly, the autophagic component which is so prominent in juvenile and adult patients was negligible in infants; instead, the overwhelming characteristic was the presence of hugely expanded lysosomes. After 6 months on therapy, however, the autophagic buildup becomes visible as if unmasked by the clearance of glycogen. In most fibers, the two pathologies did not seem to coexist. These data point to the possibility of differences in the pathogenesis of Pompe disease in infants and adults.

The complexity of the pathogenic cascade in lysosomal storage disorders suggests that combination therapy will be needed to target various aspects of pathogenesis. The standard of care for Pompe disease (glycogen storage disease type II), a deficiency of lysosomal acid alpha glucosidase, is enzyme replacement therapy (ERT). Many patients have poor outcomes due to limited efficacy of the drug in clearing muscle glycogen stores. The resistance to therapy is linked to massive autophagic buildup in the diseased muscle. We have explored two strategies to address the problem. Genetic suppression of autophagy in muscle of knockout mice resulted in the removal of autophagic buildup, increase in muscle force, decrease in glycogen level, and near-complete clearance of lysosomal glycogen following ERT. However, this approach leads to accumulation of ubiquitinated proteins, oxidative stress, and exacerbation of muscle atrophy. Another approach involves AAV-mediated TSC knockdown in knockout muscle leading to upregulation of mTOR, inhibition of autophagy, reversal of atrophy, and efficient cellular clearance on ERT. Importantly, this approach reveals the possibility of reversing already established autophagic buildup, rather than preventing its development. The complexity of the pathogenic cascade in lysosomal storage disorders suggests that combination therapy will be needed to target various aspects of pathogenesis. The standard of care for Pompe disease (glycogen storage disease type II), a deficiency of lysosomal acid alpha glucosidase, is enzyme replacement therapy (ERT). Many patients have poor outcomes due to limited efficacy of the drug in clearing muscle glycogen stores. The resistance to therapy is linked to massive autophagic buildup in the diseased muscle. We have explored two strategies to address the problem. Genetic suppression of autophagy in muscle of knockout mice resulted in the removal of autophagic buildup, increase in muscle force, decrease in glycogen level, and near-complete clearance of lysosomal glycogen following ERT. However, this approach leads to accumulation of ubiquitinated proteins, oxidative stress, and exacerbation of muscle atrophy. Another approach involves AAV-mediated TSC knockdown in knockout muscle leading to upregulation of mTOR, inhibition of autophagy, reversal of atrophy, and efficient cellular clearance on ERT. Importantly, this approach reveals the possibility of reversing already established autophagic buildup, rather than preventing its development.

Pompe disease, a severe and often fatal neuromuscular disorder, is caused by a deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA). The disease is characterized by the accumulation of excess glycogen in the heart, skeletal muscle, and CNS. Currently approved enzyme replacement therapy or experimental adeno-associated virus (AAV)-mediated gene therapy has little effect on CNS correction. Here we demonstrate that a newly developed AAV-PHP.B vector can robustly transduce both the CNS and skeletal muscles in GAA-knockout (GAAKO) mice. A single intravenous injection of an AAV-PHP.B vector expressing human GAA under the control of cytomegalovirus (CMV) enhancer-chicken β-actin (CB) promoter into 2-week-old GAAKO mice resulted in widespread GAA expression in the affected tissues. Glycogen contents were reduced to wild-type levels in the brain and heart, and they were significantly decreased in skeletal muscle by the AAV treatment. The histological assay showed no visible glycogen in any region of the brain and spinal cord of AAV-treated mice. In this study, we describe a set of behavioral tests that can detect early neurological deficits linked to extensive lysosomal glycogen accumulation in the CNS of untreated GAAKO mice. Furthermore, we demonstrate that the therapy can help prevent the development of these abnormalities.

Clinical studies of enzyme replacement therapy for Pompe disease have indicated that relatively high doses of recombinant human acid α-glucosidase (rhGAA) may be required to reduce the abnormal glycogen storage in cardiac and skeletal muscles. This may be because of inefficient cation-independent mannose 6-phosphate receptor (CI-MPR)-mediated endocytosis of the enzyme by the affected target cells. To address this possibility, we examined whether the addition of a high affinity ligand to rhGAA would improve its delivery to these cells. Chemical conjugation of high mannose oligosaccharides harboring mono- and bisphosphorylated mannose 6-phosphates onto rhGAA (neo-rhGAA) significantly improved its uptake characteristics by muscle cells <i>in vitro</i>. Infusion of neo-rhGAA into Pompe mice also resulted in greater delivery of the enzyme to muscle tissues when compared with the unmodified enzyme. Importantly, this increase in enzyme levels was associated with significantly improved clearance of glycogen (∼5-fold) from the affected tissues. These results suggest that CI-MPR-mediated endocytosis of rhGAA is an important pathway by which the enzyme is delivered to the affected lysosomes of Pompe muscle cells. Hence, the generation of rhGAA containing high affinity ligands for the CI-MPR represents a strategy by which the potency of rhGAA and therefore the clinical efficacy of enzyme replacement therapy for Pompe disease may be improved.

Glycogenosis type II is a recessively inherited disorder caused by mutations in the acid maltase (GAA) gene. Clinically, three different phenotypes are recognized: infantile, juvenile and adult forms. A majority of compound heterozygous adult-onset patients carry a t-13g mutation in intron 1 associated with splicing out the first coding exon (exon 2). We have studied the mechanism of this mutation in a model system with wild-type and mutant minigenes expressed in a GAA deficient cell line. We have demonstrated that the mutation does not prevent normal splicing; low levels of correctly spliced mRNA are generated with the mutant construct. The data explain why the mutation is restricted to a milder, adult-onset phenotype. We also demonstrate that splicing out of exon 2 occurs with the wild-type construct, and thus represents alternative splicing which takes place in normal cells. Three splice variants (SV1, SV2 and SV3) are made with both the mutant and the wild-type constructs. Furthermore, as shown by RNAse protection assay, these mRNA variants are less abundant with the mutant construct. Thus, a major effect of the mutation appears to be a low splicing efficiency, since the total amount of all the transcripts generated from the mutant construct is reduced compared with the wild type. The removal of ∼90% of the intron 1 (2.6 kb) sequence resulted in a dramatic increase in the levels of correctly spliced mRNA, indicating that the intron may contain a powerful transcriptional repressor.

An autosomal recessive deficiency of acid alpha-glucosidase (GAA), type II glycogenosis, is genetically and clinically heterogeneous. The discovery of an enzyme-inactivating genomic deletion of exon 18 in three unrelated genetic compound patients--two infants and an adult--provided a rare opportunity to analyze the effect of the second mutation in patients who displayed dramatically different phenotypes. A deletion of Lys-903 in one patient and a substitution of Arg for Leu-299 in another resulted in the fatal infantile form. In the adult, a T-to-G base change at position -13 of intron 1 resulted in alternatively spliced transcripts with deletion of exon 2, the location of the start codon. The low level of active enzyme (12% of normal) generated from the leakage of normally spliced mRNA sustained the patient to adult life.

Pompe disease is caused by an inherited deficiency of acid a-glucosidase (GAA), a lysosomal enzyme that catalyzes the breakdown of glycogen to glucose. In the absence of GAA, enlarged, glycogen-laden lysosomes accumulate in multiple tissues, although the major clinical manifestations are seen in cardiac and skeletal muscle. For many years, it was believed that the rupture of glycogen-filled lysosomes was the major cause of the profound muscle damage observed in patients with Pompe disease. Here, we present evidence that a failure of productive autophagy in muscle tissue contributes strongly to disease pathology in both patients with Pompe disease and GAA-knockout mice. In the GAA-knockout mouse model, progressive accumulation of autophagic vesicles is restricted to Type II-rich muscle fibers. Not only does this build-up of autophagosomes disrupt the contractile apparatus in the muscle fibers, it also interferes with enzyme replacement therapy by acting as a sink for the recombinant enzyme and preventing its efficient delivery to the lysosomes. Our data indicate that a re-examination of the presumed pathological mechanism in Pompe disease is necessary, and suggest that successful treatment of patients with Pompe disease will require consideration of the dramatic failure of autophagy that occurs in this disease.

The role of autophagy, a catabolic lysosome-dependent pathway, has recently been recognized in a variety of disorders, including Pompe disease, which results from a deficiency of the glycogen-degrading lysosomal hydrolase acid-alpha glucosidase (GAA). Skeletal and cardiac muscle are most severely affected by the progressive expansion of glycogen-filled lysosomes. In both humans and an animal model of the disease (GAA KO), skeletal muscle pathology also involves massive accumulation of autophagic vesicles and autophagic buildup in the core of myofibers, suggesting an induction of autophagy. Only when we suppressed autophagy in the skeletal muscle of the GAA KO mice did we realize that the excess of autophagy manifests as a functional deficiency. This failure of productive autophagy is responsible for the accumulation of potentially toxic aggregate-prone ubiquitinated proteins, which likely cause profound muscle damage in Pompe mice. Also, by generating muscle-specific autophagy-deficient wild-type mice, we were able to analyze the role of autophagy in healthy skeletal muscle.

Glycogen storage disease type II (GSDII) or Pompe disease is an autosomal recessive disorder caused by acid alpha-glucosidase (GAA) deficiency, leading to lysosomal glycogen accumulation. Affected individuals store glycogen mainly in cardiac and skeletal muscle tissues resulting in fatal hypertrophic cardiomyopathy and respiratory failure in the most severe infantile form. Enzyme replacement therapy has already proved some efficacy, but results remain variable especially in skeletal muscle. Substrate reduction therapy was successfully used to improve the phenotype in several lysosomal storage disorders. We have recently demonstrated that shRNA-mediated reduction of glycogen synthesis led to a significant reduction of glycogen accumulation in skeletal muscle of GSDII mice. In this paper, we analyzed the effect of a complete genetic elimination of glycogen synthesis in the same GSDII model. GAA and glycogen synthase 1 (GYS1) KO mice were inter-crossed to generate a new double-KO model. GAA/GYS1-KO mice exhibited a profound reduction of the amount of glycogen in the heart and skeletal muscles, a significant decrease in lysosomal swelling and autophagic build-up as well as a complete correction of cardiomegaly. In addition, the abnormalities in glucose metabolism and insulin tolerance observed in the GSDII model were corrected in double-KO mice. Muscle atrophy observed in 11-month-old GSDII mice was less pronounced in GAA/GYS1-KO mice, resulting in improved exercise capacity. These data demonstrate that long-term elimination of muscle glycogen synthesis leads to a significant improvement of structural, metabolic and functional defects in GSDII mice and offers a new perspective for the treatment of Pompe disease.

PGC-1α is a transcriptional co-activator that plays a central role in the regulation of energy metabolism. Our interest in this protein was driven by its ability to promote muscle remodeling. Conversion from fast glycolytic to slow oxidative fibers seemed a promising therapeutic approach in Pompe disease, a severe myopathy caused by deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA) which is responsible for the degradation of glycogen. The recently approved enzyme replacement therapy (ERT) has only a partial effect in skeletal muscle. In our Pompe mouse model (KO), the poor muscle response is seen in fast but not in slow muscle and is associated with massive accumulation of autophagic debris and ineffective autophagy. In an attempt to turn the therapy-resistant fibers into fibers amenable to therapy, we made transgenic KO mice expressing PGC-1α in muscle (tgKO). The successful switch from fast to slow fibers prevented the formation of autophagic buildup in the converted fibers, but PGC-1α failed to improve the clearance of glycogen by ERT. This outcome is likely explained by an unexpected dramatic increase in muscle glycogen load to levels much closer to those observed in patients, in particular infants, with the disease. We have also found a remarkable rise in the number of lysosomes and autophagosomes in the tgKO compared to the KO. These data point to the role of PGC-1α in muscle glucose metabolism and its possible role as a master regulator for organelle biogenesis - not only for mitochondria but also for lysosomes and autophagosomes. These findings may have implications for therapy of lysosomal diseases and other disorders with altered autophagy.

Pompe disease, a deficiency of glycogen-degrading lysosomal acid alpha-glucosidase (GAA), is a disabling multisystemic illness that invariably affects skeletal muscle in all patients. The patients still carry a heavy burden of the disease, despite the currently available enzyme replacement therapy. We have previously shown that progressive entrapment of glycogen in the lysosome in muscle sets in motion a whole series of "extra-lysosomal" events including defective autophagy and disruption of a variety of signaling pathways. Here, we report that metabolic abnormalities and energy deficit also contribute to the complexity of the pathogenic cascade. A decrease in the metabolites of the glycolytic pathway and a shift to lipids as the energy source are observed in the diseased muscle. We now demonstrate in a pre-clinical study that a recently developed replacement enzyme (recombinant human GAA; AT-GAA; Amicus Therapeutics) with much improved lysosome-targeting properties reversed or significantly improved all aspects of the disease pathogenesis, an outcome not observed with the current standard of care. The therapy was initiated in GAA-deficient mice with fully developed muscle pathology but without obvious clinical symptoms; this point deserves consideration.

Lysosomal storage diseases (LSDs) represent a group of monogenic inherited metabolic disorders characterized by the progressive accumulation of undegraded substrates inside lysosomes, resulting in aberrant lysosomal activity and homeostasis. This SnapShot summarizes the intracellular localization and function of proteins implicated in LSDs. Common aspects of LSD pathogenesis and the major current therapeutic approaches are noted. To view this SnapShot, open or download the PDF.

Both enzyme replacement and gene therapy of lysosomal storage disorders rely on the receptor-mediated uptake of lysosomal enzymes secreted by cells, and for each lysosomal disorder it is necessary to select the correct cell type for recombinant enzyme production or for targeting gene therapy. For example, for the therapy of Pompe disease, a severe metabolic myopathy and cardiomyopathy caused by deficiency of acid α-glucosidase (GAA), skeletal muscle seems an obvious choice as a depot organ for local therapy and for the delivery of the recombinant enzyme into the systemic circulation. Using knockout mice with this disease and transgenes containing cDNA for the human enzyme under muscle or liver specific promoters controlled by tetracycline, we have demonstrated that the liver provided enzyme far more efficiently. The achievement of therapeutic levels with skeletal muscle transduction required the entire muscle mass to produce high levels of enzyme of which little found its way to the plasma, whereas liver, comprising <5% of body weight, secreted 100-fold more enzyme, all of which was in the active 110 kDa precursor form. Furthermore, using tetracycline regulation, we somatically induced human GAA in the knockout mice, and demonstrated that the skeletal and cardiac muscle pathology was completely reversible if the treatment was begun early.

To the Editor: Conventional historiographical research provides abundant evidence of the African roots of African American populations, but, because of the absence of complete documentary records—for example, the point of embarkation of a particular slave vessel does not necessarily indicate who was actually on that vessel, and slave cargoes tended to be composed of mixed populations—it remains a frustrating task to identify exactly who was transported to the Americas (Curtin, 1969Curtin PD (1969) The Atlantic slave trade: a census. University of Wisconsin Press, MadisonGoogle Scholar; Parish, 1989Parish PJ Slavery: history and historians. Harper and Row, New York1989Google Scholar; Thornton, 1992Thornton J Africa and Africans in the making of the Atlantic world. Cambridge University Press, New York1992Google Scholar). The presence of a genetic marker in an African American population, however, might furnish a verifiable link, for the individuals who carry the trait, to a specific tribe or even to a point of origin. In the autosomal recessive disorder glycogen-storage disease type II (GSD II [MIM 232300]), a deficiency of acid maltase (GAA; acid α-glucosidase) leads to the pathological accumulation of glycogen in lysosomes. In its most severe form, progressive cardiomyopathy causes cardiorespiratory failure and death within the 1st year of life (Pompe syndrome). Among the mutations identified (see Lin and Shieh, 1995Lin CY Shieh JJ Identification of a de novo point mutation resulting in infantile form of Pompe's disease.Biochem Biophys Res Commun. 1995; 208: 886-893Crossref PubMed Scopus (13) Google Scholar; Raben et al., 1995Raben N Nichols RC Boerkoel C Plotz P Genetic defects in patients with glycogenosis type II (acid maltase deficiency).Muscle Nerve. 1995; : S70-S74Crossref PubMed Scopus (40) Google Scholar; Tsunoda et al., 1996Tsunoda H Ohshima T Tohyama J Sasaki M Sakuragawa N Martiniuk F Acid alpha-glucosidase deficiency: identification and expression of a missense mutation (S529V) in a Japanese adult phenotype.Hum Genet. 1996; 97: 496-499Crossref PubMed Scopus (10) Google Scholar; Adams et al., 1997Adams EM Becker JA Griffith L Segal A Plotz PH Raben N Glycogenosis type II: a juvenile specific mutation with an unusual splicing pattern and a shared mutation in African Americans.Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (28) Google Scholar; reviewed by Reuser et al., 1995Reuser AJ Kroos MA Hermans MM Bijvoet AG Verbeet MP van Diggelen OP Kleijer WJ et al.Glycogenosis type II (acid maltase deficiency).Muscle Nerve. 1995; : S61-S69Crossref PubMed Scopus (127) Google Scholar; Hirschhorn and Huie, 1997Hirschhorn R Huie ML Glycogen storage disease type II: acid α-glucosidase (acid maltase deficiency).in: Scriver CR The metabolic and molecular basis of inherited disease. McGraw-Hill, New York (CD-ROM)1997Google Scholar, three that lead to the total loss of enzyme activity occur frequently in particular ethnic groups: deletion of exon 18 in Caucasians (Boerkoel et al., 1992Boerkoel C Raben N Martiniuk F Miller F Plotz P Identification of a deletion common to adult and infantile onset acid alpha glucosidase deficiency.Am J Hum Genet. 1992; : A347PubMed Google Scholar; Huie et al.Huie ML Chen AS Sklower Brooks S Grix A Hirschhorn R A de novo 13 nt deletion, a newly identified C647W missense mutation and a deletion of exon 18 in infantile onset glycogen storage disease type II (GSDII).Hum Mol Genet. 1994a; 3: 1081-1087Crossref PubMed Scopus (62) Google Scholar; Van der Kraan et al., 1994Van der Kraan M Kroos MA Joosse M Bijvoet AG Verbeet MP Kleijer WJ Reuser AJ Deletion of exon 18 is a frequent mutation in glycogen storage disease type II.Biochem Biophys Res Commun. 1994; 203: 1535-1541Crossref PubMed Scopus (46) Google Scholar; Kroos et al., 1995Kroos MA Van der Kraan M van Diggelen OP Kleijer WJ Reuser AJ Van den Boogaard MJ Ausems MG et al.Glycogen storage disease type II: frequency of three common mutant alleles and their associated clinical phenotypes studied in 121 patients.J Med Genet. 1995; 32: 836-837Crossref PubMed Scopus (79) Google Scholar), deletion of T525 in northern Europeans (Hermans et al., 1994Hermans MM de Graaff E Kroos MA Mohkamsing S Eussen BJ Joosse M Willemsen R et al.The effect of a single base pair deletion (delta T525) and a C1634T missense mutation (pro545leu) on the expression of lysosomal alpha-glucosidase in patients with glycogen storage disease type II.Hum Mol Genet. 1994; 3: 2213-2218Crossref PubMed Scopus (58) Google Scholar; Kroos et al., 1995Kroos MA Van der Kraan M van Diggelen OP Kleijer WJ Reuser AJ Van den Boogaard MJ Ausems MG et al.Glycogen storage disease type II: frequency of three common mutant alleles and their associated clinical phenotypes studied in 121 patients.J Med Genet. 1995; 32: 836-837Crossref PubMed Scopus (79) Google Scholar), and D645E in Chinese patients from Taiwan (Shieh et al., 1994Shieh JJ Wang LY Lin CY Point mutation in Pompe disease in Chinese.J Inherit Metab Dis. 1994; 17: 145-148Crossref PubMed Scopus (27) Google Scholar; Lin and Shieh, 1996Lin CY Shieh JJ Molecular study on the infantile form of Pompe disease in Chinese in Taiwan.Acta Paediatr Sinica. 1996; 37: 115-121Google Scholar). The chance to study several affected infants of African parents has permitted us to identify a common African mutation, to confirm our previous suggestion that the mutation is also common in African Americans (Adams et al., 1997Adams EM Becker JA Griffith L Segal A Plotz PH Raben N Glycogenosis type II: a juvenile specific mutation with an unusual splicing pattern and a shared mutation in African Americans.Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (28) Google Scholar), and, thereby, to explore the molecular roots of GSD II in African Americans. We initially studied a 3-mo-old infant (patient 1), from the Ivory Coast, of healthy, nonconsanguineous parents; the mother is Mandingo, and the father is Guéré (table 1). The patient is a compound heterozygote harboring a previously described C2560T transition in exon 18 (Hermans et al.Hermans MM de Graaff E Kroos MA Wisselaar HA Willemsen R Oostra BA Reuser AJ The conservative substitution Asp-645→Glu in lysosomal alpha-glucosidase affects transport and phosphorylation of the enzyme in an adult patient with glycogen-storage disease type II.Biochem J. 1993a; 289: 687-693Crossref PubMed Scopus (61) Google Scholar; Adams et al., 1997Adams EM Becker JA Griffith L Segal A Plotz PH Raben N Glycogenosis type II: a juvenile specific mutation with an unusual splicing pattern and a shared mutation in African Americans.Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (28) Google Scholar) and a novel T2846A transversion in exon 20. An unusual feature of the novel exon 20 mutation (V949D) is its localization at the carboxy terminus of the 952 amino acid precursor, the tail that is removed during processing into mature forms (Wisselaar et al., 1993Wisselaar HA Kroos M Hermans MM van Beeumen J Reuser AJ Structural and functional changes of lysosomal acid alpha-glucosidase during intracellular transport and maturation.J Biol Chem. 1993; 268: 2223-2231Abstract Full Text PDF PubMed Google Scholar). Expression studies showed that the mutation results in complete inactivation of the enzyme: catalytic activity of the mutant protein in transfected COS cells did not exceed the background levels—778, 30, and 26 nmol 4-4-methylumbelliferone/h/mg cell protein for the wild-type, mutant, and mock-transfected cells, respectively. The mature protein was not detected by western analysis, thereby adequately explaining the absence of enzyme activity in this allele (data not shown). Apparently, the mutation results in a degradation of the precursor molecules prior to processing and maturation.Table 1Presence of R854X or Other Mutations on African or African American ChromosomesMutation Status ofGroup and PatientChromosome 1Chromosome 2African: Patient 1 (Ivory Coast)R854XV949D Patient 2 (Nigeria)R854XNegativeaR854X not present. Patient 3 (Ghana)R854XR854X Patient 4 (Ovambo-Namibia)R854XR854X Patient 5 (Zulu-South Africa)NegativeNegativeAfrican American:bPatient 6 has been reported in detail elsewhere (Adams et al. 1997). Patient 7 was the 6-wk-old daughter of healthy, nonconsanguineous African American parents; patient 8 was a 6-mo-old African American male referred to New York University Medical Center by Dr. H. Mussel; patients 9–11 (C2123, C1992, and C9752) were referred to the New York State Institute for Basic Research and New York University Medical Center. The cell lines designated "GM" were obtained from the National Institutes of Health Mutant Repository, Coriell Cell Repositories (Camden, NJ) and were derived from African American patients with infantile-onset GSD II (GM 00248, GM 12932, GM 03329, GM 00338, and GM 04912) (Martiniuk et al. 1986; Zhong et al. 1991) or adult-onset GSD II (GM 01935). Additional clinical information is present in the Coriell catalogue. Mutations and additional molecular information have been reported for GM 03329 (Huie et al. 1994b) and GM 01935 (Martiniuk et al. 1991; Hermans et al. 1993a). The diagnosis of severe deficiency of GAA was demonstrated in each of these patients by enzymatic assay of fibroblasts and/or muscle. Patient 6 (mixed)R854XIVS6 −22 t→g Patient 7R854XNegative Patient 8R854XNegative Patient 9 (C2123)R854XR854X Patient 10 (C1992)NegativeNegative Patient 11 (C9752)NegativeNegative GM 00248R854XR854X GM 00338R854XR854X GM 01935R854XD654E GM 03329NegativeM519V GM 04912NegativeNegative GM 12932NegativeNegativeNote.—This study was carried out under protocols approved by the institutional review boards of the National Institute of Arthritis and Musculoskeletal and Skin Diseases and of the institutions where the samples were obtained. Details of the primers, PCR conditions, and identification of mutations are available on request.a R854X not present.b Patient 6 has been reported in detail elsewhere (Adams et al., 1997Adams EM Becker JA Griffith L Segal A Plotz PH Raben N Glycogenosis type II: a juvenile specific mutation with an unusual splicing pattern and a shared mutation in African Americans.Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (28) Google Scholar). Patient 7 was the 6-wk-old daughter of healthy, nonconsanguineous African American parents; patient 8 was a 6-mo-old African American male referred to New York University Medical Center by Dr. H. Mussel; patients 9–11 (C2123, C1992, and C9752) were referred to the New York State Institute for Basic Research and New York University Medical Center. The cell lines designated "GM" were obtained from the National Institutes of Health Mutant Repository, Coriell Cell Repositories (Camden, NJ) and were derived from African American patients with infantile-onset GSD II (GM 00248, GM 12932, GM 03329, GM 00338, and GM 04912) (Martiniuk et al., 1986Martiniuk F Mehler M Pellicer A Tzall S La Badie G Hobart C Ellenbogen A et al.Isolation of a cDNA for human acid alpha-glucosidase and detection of genetic heterogeneity for mRNA in three alpha-glucosidase-deficient patients.Proc Natl Acad Sci USA. 1986; 83: 9641-9644Crossref PubMed Scopus (84) Google Scholar; Zhong et al., 1991Zhong N Martiniuk F Tzall S Hirschhorn R Identification of a missense mutation in one allele of a patient with Pompe disease, and use of endonuclease digestion of PCR-amplified RNA to demonstrate lack of mRNA expression from the second allele.Am J Hum Genet. 1991; 49: 635-645PubMed Google Scholar) or adult-onset GSD II (GM 01935). Additional clinical information is present in the Coriell catalogue. Mutations and additional molecular information have been reported for GM 03329 (Huie et al.Huie ML Hirschhorn R Chen AS Martiniuk F Zhong N Mutation at the catalytic site (M519V) in glycogen storage disease type II (Pompe disease).Hum Mutat. 1994b; 4: 291-293Crossref PubMed Scopus (14) Google Scholar) and GM 01935 (Martiniuk et al., 1991Martiniuk F Mehler M Bodkin M Tzall S Hirschhorn K Zhong N Hirschhorn R Identification of a missense mutation in an adult-onset patient with glycogenosis type II expressing only one allele.DNA Cell Biol. 1991; 10: 681-687Crossref PubMed Scopus (22) Google Scholar; Hermans et al.Hermans MM de Graaff E Kroos MA Wisselaar HA Willemsen R Oostra BA Reuser AJ The conservative substitution Asp-645→Glu in lysosomal alpha-glucosidase affects transport and phosphorylation of the enzyme in an adult patient with glycogen-storage disease type II.Biochem J. 1993a; 289: 687-693Crossref PubMed Scopus (61) Google Scholar). The diagnosis of severe deficiency of GAA was demonstrated in each of these patients by enzymatic assay of fibroblasts and/or muscle. Open table in a new tab Note.—This study was carried out under protocols approved by the institutional review boards of the National Institute of Arthritis and Musculoskeletal and Skin Diseases and of the institutions where the samples were obtained. Details of the primers, PCR conditions, and identification of mutations are available on request. The paternally inherited nonsense mutation in exon 18 (R854X), which resides on a silent allele, had been previously described in a compound-heterozygous adult African American patient (cell line GM 01935) (Hermans et al.Hermans MM de Graaff E Kroos MA Wisselaar HA Willemsen R Oostra BA Reuser AJ The conservative substitution Asp-645→Glu in lysosomal alpha-glucosidase affects transport and phosphorylation of the enzyme in an adult patient with glycogen-storage disease type II.Biochem J. 1993a; 289: 687-693Crossref PubMed Scopus (61) Google Scholar) and in a half–African American (African American father and Caucasian mother) child (patient 6) with the juvenile form of the disease (table 1). The data thus strongly pointed to an African origin of the R854X mutation in the African Americans and prompted us to look for more patients of a similar background. Two other infants born of western African parents were available for study. The R854X mutation was present on one allele of a 2-mo-old infant (patient 2) of healthy, nonconsanguineous parents who were of Hausa origin. One parent was from the province of Katsina, and the other was from the northeastern Borno province (parental DNAs were not available); the patient's male sibling had died at age 5 mo, of unknown causes. Both alleles of a 4-mo-old Ghanaian infant (patient 3) of healthy, nonconsanguineous parents, who were from the Twi subgroup of the Ashanti tribe and were living in Accra, bore R854X. We also sought the mutation in infants of different backgrounds who were from southern Africa and who had been reported by Van der Ploeg et al., 1989Van der Ploeg AT Hoefsloot LH Hoogeveen-Westerveld M Petersen EM Reuser AJ Glycogenosis type II: protein and DNA analysis in five South African families from various ethnic origins.Am J Hum Genet. 1989; 44: 787-793PubMed Google Scholar. Both alleles of an Ovambo infant (patient 4) from Namibia carried R854X, and a Zulu infant (patient 5) was negative. (R854X was also absent in the two infants from southern Africa who were of uncertain ethnic background.) R854X was present, therefore, in four of five African infants of known ethnic background, on 6 of 10 chromosomes. Among the 12 African American patients studied (patients 6–11 and six GM cell lines), 3 are homozygous, and 4 are heterozygous, for R854X (table 1). Therefore, 10 of 23 African American chromosomes (the mother of patient 6 is Caucasian) carry the R854X mutation, resulting in an allele frequency of .43 among African Americans with GSD II. The other mutation described in an African American (Hermans et al.Hermans MM de Graaff E Kroos MA Wisselaar HA Willemsen R Oostra BA Reuser AJ The conservative substitution Asp-645→Glu in lysosomal alpha-glucosidase affects transport and phosphorylation of the enzyme in an adult patient with glycogen-storage disease type II.Biochem J. 1993a; 289: 687-693Crossref PubMed Scopus (61) Google Scholar) and also identified in Chinese patients—that is, D645E—was not found in any of our cases. In African American patients (Hermans et al.Hermans MM Svetkey LP Oostra BA Chen YT Reuser AJ The loss of a polymorphic glycosylation site caused by Thr-927→Ile is linked to a second polymorphic Val-816→Ile substitution in lysosomal alpha-glucosidase of American blacks.Genomics. 1993b; 16: 300-301Crossref PubMed Scopus (8) Google Scholar) but not Chinese patients (C-Y Lin, personal communication), the mutation is associated with two polymorphic sites in exons 17 and 19 (I816 and I927) found in several healthy unrelated African Americans, suggesting that the Chinese and African American D645E mutations occurred independently. By contrast, all eight polymorphic sites (596G, 668A, 921T, 1203A, 1374T, 2154C, 2338A, and 2553A) residing on the R854X mutated African American allele in our juvenile case (Adams et al., 1997Adams EM Becker JA Griffith L Segal A Plotz PH Raben N Glycogenosis type II: a juvenile specific mutation with an unusual splicing pattern and a shared mutation in African Americans.Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (28) Google Scholar) are identical to those found in the infants from the Ivory Coast, Ghana, and Namibia, a finding that suggests a common haplotype and a common origin of the R854X mutation. The R854X mutation was not found in 7 infantile- and 34 adult-onset Caucasian patients with GSD II. This represents 48 chromosomes at risk for a "null" mutation: 2 from each infant and only 1 from each adult, since adult patients have some enzyme activity. These results clearly document that R854X is not frequent in all populations. However, the mutation was found in homozygosity in an infantile patient from consanguineous Pakistani parents and was found in heterozygosity in a Mexican American patient and in a French patient. The R854X mutation is a C→T transition at a CG dinucleotide and therefore is at a site susceptible to recurrent mutations. Further investigation of haplotypes could reveal whether these are independently recurring events. Of the 12 million African captives, <600,000 ever reached North American shores. The slave trade to North America experienced two particularly strong periods: one just before the American Revolution of 1776, and the second at the turn of the 19th century, just before the passage, in 1808, of a law prohibiting the importation of African slaves (Rawley, 1985Rawley JA The transatlantic slave trade: a history. WW Norton, New York1985Google Scholar). The first Africans to be enslaved in the 16th century were peoples from the western Atlantic region. Traders then worked their way incrementally along the coast, focusing next on Guinea Coast peoples, and, at the height of the late-18th century trade, peoples of the Guinea Coast, often of Ashanti origin, were most common in slave cargoes. The trade eventually reached Angola, around 1800 (Curtin, 1969Curtin PD (1969) The Atlantic slave trade: a census. University of Wisconsin Press, MadisonGoogle Scholar). The four African ethnic groups currently known to carry R854X (fig. 1) have a history of long-standing interaction. The Hausa, although they claim northern Nigeria as their homeland, are widely dispersed throughout western Africa. Their commercial activities, initiated as early as 1100, brought them into direct and prolonged contact with the western Atlantic region, where they encountered the Guéré of the Ivory Coast. The Guéré, in turn, were a subgroup of the Kru who, because of their boating skills, were used as deckhands on European trading vessels sailing in Africa's coastal waters. The Hausa also had strong contacts with the Ashanti nation, in what is today the nation of Ghana, both through trade connections and through residential enclaves. The Ovambo of Namibia, although they were beyond the reach of the Hausa trade network, are a Bantu-speaking group descended from a population originally located on the Bauchi plateau of northern Nigeria, adjacent to the Hausa homelands. Segments of this Nigerian group, who would eventually become the Ovambo, undertook a gradual southward migration that brought them to their current location in Angola and northern Namibia, sometime during the period of 800–900 (Turnbull, 1977Turnbull CM Man in Africa. Anchor Doubleday, Garden City, NY1977Google Scholar; Curtin and Bohannon, 1988Curtin PD Bohannon P Africa and Africans. Waveland Press, Prospect Heights, IL1988Google Scholar). Thus, although it is probable that the closest African ancestors of the African American patients were culturally Ashanti and were brought to North America from the Guinea Coast, their genetic makeup strongly suggests that they have Hausa roots. It is reasonable to speculate that the mutation occurred some time before the southward migration of the Ovambo away from the territory of the Hausas, possibly in their common ancestral population from north-central Africa.

Although many lysosomal disorders are corrected by a small amount of the missing enzyme, it has been generally accepted that 20–30% of normal acid α-glucosidase (GAA) activity, provided by gene or enzyme replacement therapy, would be required to reverse the myopathy and cardiomyopathy in Pompe disease. We have addressed the issue of reversibility of the disease in the Gaa–/– mouse model. We have made transgenic lines expressing human GAA in skeletal and cardiac muscle of Gaa–/– mice, and we turned the transgene on at different stages of disease progression by using a tetracycline-controllable system. We have demonstrated that levels of 20–30% of normal activity are indeed sufficient to clear glycogen in the heart of young Gaa–/– mice, but not in older mice with a considerably higher glycogen load. However, in skeletal muscle—a major organ affected in infantile and in milder, late-onset variants in humans—induction of GAA expression in young Gaa–/– mice to levels greatly exceeding wildtype values did not result in full phenotypic correction, and some muscle fibers showed little or no glycogen clearance. The results demonstrate that complete reversal of pathology in skeletal muscle or long-affected heart muscle will require much more enzyme than previously expected or a different approach.

The large size of the multinucleated muscle fibers of skeletal muscle makes their examination for structural and pathological defects a challenge. Sections and single fibers are accessible to antibodies and other markers but imaging of such samples does not provide a three-dimensional view of the muscle. Regrettably, bundles of fibers cannot be stained or imaged easily. Two-photon microscopy techniques overcome these obstacles. Second harmonic generation (SHG) by myosin filaments and two-photon excited fluorescence (2PEF) of mitochondrial and lysosomal components provides detailed structural information on unstained tissue. Furthermore, the infrared exciting light can penetrate several layers of muscle fibers and the minimal processing is particularly valuable for fragile biopsies. Here we demonstrate the usefulness of SHG, combined with 2PEF, to reveal enlarged lysosomes and accumulations of non-contractile material in muscles from the mouse model for the lysosomal storage disorder Pompe disease (PD), and in biopsies from adult and infant PD patients. SHG and 2PEF also detect sarcomeric defects that may presage the loss of myofibrils in atrophying muscle and signify loss of elasticity. The combination of SHG and 2PEF should be useful in the analysis and diagnosis of a wide range of skeletal muscle pathologies.

Lysosomes filled with glycogen are a major pathologic feature of Pompe disease, a fatal myopathy and cardiomyopathy caused by a deficiency of the glycogen-degrading lysosomal enzyme, acid α-glucosidase (GAA). To facilitate studies germane to this genetic disorder, we developed two in vitro Pompe models: myotubes derived from cultured primary myoblasts isolated from Pompe (GAA KO) mice, and myotubes derived from primary myoblasts of the same genotype that had been transduced with cyclin-dependent kinase 4 (CDK4). This latter model is endowed with extended proliferative capacity. Both models showed extremely large alkalinized, glycogen-filled lysosomes as well as impaired trafficking to lysosomes. Although both Pompe tissue culture models were derived from fast muscles and were fast myosin positive, they strongly resemble slow fibers in terms of their pathologic phenotype and their response to therapy with recombinant human GAA (rhGAA). Autophagic buildup, a hallmark of Pompe disease in fast muscle fibers, was absent, but basal autophagy was functional. To evaluate substrate deprivation as a strategy to prevent the accumulation of lysosomal glycogen, we knocked down Atg7, a gene essential for autophagosome formation, via siRNA, but we observed no effect on the extent of glycogen accumulation, thus confirming our recent observation in autophagy-deficient Pompe mice [N. Raben, V. Hill, L. Shea, S. Takikita, R. Baum, N. Mizushima, E. Ralston, P. Plotz, Suppression of autophagy in skeletal muscle uncovers the accumulation of ubiquitinated proteins and their potential role in muscle damage in Pompe disease, Hum. Mol. Genet. 17 (2008) 3897–3908] that macroautophagy is not the major route of glycogen transport to lysosomes. The in vitro Pompe models should be useful in addressing fundamental questions regarding the pathway of glycogen to the lysosomes and testing panels of small molecules that could affect glycogen biosynthesis or speed delivery of the replacement enzyme to affected lysosomes.

It is hard to find an area of biology in which autophagy is not involved. In fact, the topic extends beyond scientific research to stimulate intellectual exercise and entertainment-autophagy has found its way into a crossword puzzle (Klionsky, 2013). We have found yet another function of autophagy while searching for a better treatment for Pompe disease, a devastating metabolic myopathy resulting from excessive lysosomal glycogen storage. To relieve this glycogen burden, we stimulated lysosomal exocytosis through upregulation of transcription factor EB (TFEB). Overexpression of TFEB in Pompe muscle clears the cells of enlarged lysosomes, reduces glycogen levels, and alleviates autophagic buildup, the major secondary abnormality in Pompe disease. Unexpectedly, the process of exocytosis does not seem to be a purely lysosomal event; vesicles arranged along the plasma membrane are double-labeled with the lysosomal marker LAMP1 and the autophagosomal marker LC3, indicating that TFEB induces the exocytosis of autolysosomes. Furthermore, the effects of TFEB are almost abrogated in autophagy-deficient Pompe mice, suggesting a previously unrecognized role of autophagy in TFEB-mediated cellular clearance.

Pompe disease, an inherited deficiency of lysosomal acid α-glucosidase (GAA), is a severe metabolic myopathy with a wide range of clinical manifestations. It is the first recognized lysosomal storage disorder and the first neuromuscular disorder for which a therapy (enzyme replacement) has been approved. As GAA is the only enzyme that hydrolyses glycogen to glucose in the acidic environment of the lysosome, its deficiency leads to glycogen accumulation within and concomitant enlargement of this organelle. Since the introduction of the therapy, the overall understanding of the disease has progressed significantly, but the pathophysiology of muscle damage is still not fully understood. The emerging complex picture of the pathological cascade involves disturbance of calcium homeostasis, mitochondrial abnormalities, dysfunctional autophagy, accumulation of toxic undegradable materials, and accelerated production of lipofuscin deposits that are unrelated to aging. The relationship of Pompe disease to other lysosomal storage disorders and potential therapeutic interventions for Pompe disease are discussed.

Glycogen storage disease type II (GSDII) is a recessively inherited disorder caused by defects in lysosomal acid alpha-glucosidase. In an attempt to reproduce the range of clinical manifestations of the human illness we have created null alleles at the acid alpha-glucosidase locus (GAA) with several gene targeting strategies. In each knockout strain, enzyme activity was completely abolished and glycogen accumulated at indistinguishable rates. The phenotypes, however, differed strikingly. Acid alpha-glucosidase deficiency on a 129xC57BL/6 background resulted in a severe phenotype with progressive cardiomyopathy and profound muscle wasting similar to that in patients with glycogen storage disease type II. On a 129/C57BL/6xFVB background, homozygous mutants developed a milder phenotype with a later age of onset. Females were more affected than males irrespective of genetic background. As in humans with glycogen storage disease type II, therefore, other genetic loci affect the phenotypic expression of a single gene mutation.

A deficiency of the muscle isoform of the enzyme, phosphofructokinase (PFK, EC 2.7.1.11), leads to an illness (glycogenosis, Type VII) characterized by myopathy and hemolysis. A patient with this disease and an affected sister were found to have a G to A substitution at the 5' donor site of intron 5 of the PFK-M gene. This mutation led to a splicing defect: a complete deletion of the preceding exon in the patient's mRNA. The patient, an affected sister, and related and unrelated family members, who were of Ashkenazic Jewish background, were screened for the mutation by denaturing gradient gel electrophoresis and by allele specific hybridization of genomic DNA. The affected sisters are homozygous for the mutation, and their children, who are unaffected, are heterozygous. The only previously characterized genetic defect in this disease, found in a Japanese patient, was a G to T mutation at the beginning of intron 15 with splicing to a cryptic site within exon 15 (1). Both mutations lead to inframe deletions, but of different parts of the protein. The differences between the two aberrant proteins may account for clinical differences between our patients and the Japanese patient.

Mutations in the muscle phosphofructokinase gene (PFK-M) result in a metabolic myopathy characterized by exercise intolerance and compensated hemolysis. PFK deficiency, glycogenosis type VII (Tarui disease) is a rare, autosomal, recessively inherited disorder. Multiple mutations, including splicing defects, frameshifts, and missense mutations, have recently been identified in patients from six different ethnic backgrounds establishing genetic heterogeneity of the disease. There is no obvious correlation between the genotype and phenotypic expression of the disease. PFK-M deficiency appears to be prevalent among people of Ashkenazi Jewish descent. Molecular diagnosis is now feasible for Ashkenazi patients who share two common mutations in the gene; the more frequent is an exon 5 splicing defect, which accounts for approximately 68% of mutant alleles in this population.

Glycogen storage disease type II (GSDII) or Pompe disease is an autosomal recessive disorder caused by defects in the acid alpha-glucosidase gene, which leads to lysosomal glycogen accumulation and enlargement of the lysosomes mainly in cardiac and muscle tissues, resulting in fatal hypertrophic cardiomyopathy and respiratory failure in the most severely affected patients. Enzyme replacement therapy has already proven to be beneficial in this disease, but correction of pathology in skeletal muscle still remains a challenge. As substrate deprivation was successfully used to improve the phenotype in other lysosomal storage disorders, we explore here a novel therapeutic approach for GSDII based on a modulation of muscle glycogen synthesis. Short hairpin ribonucleic acids (shRNAs) targeted to the two major enzymes involved in glycogen synthesis, i.e. glycogenin (shGYG) and glycogen synthase (shGYS), were selected. C2C12 cells and primary myoblasts from GSDII mice were stably transduced with lentiviral vectors expressing both the shRNAs and the enhanced green fluorescent protein (EGFP) reporter gene. Efficient and specific inhibition of GYG and GYS was associated not only with a decrease in cytoplasmic and lysosomal glycogen accumulation in transduced cells, but also with a strong reduction in the lysosomal size, as demonstrated by confocal microscopy analysis. A single intramuscular injection of recombinant AAV-1 (adeno-associated virus-1) vectors expressing shGYS into newborn GSDII mice led to a significant reduction in glycogen accumulation, demonstrating the in vivo therapeutic efficiency. These data offer new perspectives for the treatment of GSDII and could be relevant to other muscle glycogenoses.

Abstract Objective Multinucleated cells are relatively resistant to classic apoptosis, and the factors initiating cell death and damage in myositis are not well defined. We hypothesized that nonimmune autophagic cell death may play a role in muscle fiber damage. Recent reports indicate that TRAIL may induce both NF‐κB activation and autophagic cell death in other systems. We undertook this study to investigate the role of TRAIL in cell death and pathogenesis in vitro and in vivo, using myositis muscle tissues from humans and mice. Methods Gene expression profiling was performed in myositis patient and control muscle specimens. Immunohistochemistry analysis was performed to confirm the gene array findings. We also analyzed TRAIL‐induced cell death (apoptosis and autophagy) and NF‐κB activation in vitro in cultured cells. Results TRAIL was expressed predominantly in myositis muscle fibers, but not in biopsy specimens from normal or other dystrophic‐diseased muscle. Autophagy markers were up‐regulated in humans with myositis and in mouse models of myositis. TRAIL expression was restricted to regenerating/atrophic areas of muscle fascicles, blood vessels, and infiltrating lymphocytes. TRAIL induced NF‐κB activation and IκB degradation in cultured cells that are resistant to TRAIL‐induced apoptosis but that undergo autophagic cell death. Conclusion Our data demonstrate that TRAIL is expressed in myositis muscle and may mediate both activation of NF‐κB and autophagic cell death in myositis. Thus, this nonimmune pathway may be an attractive target for therapeutic intervention in myositis.

Pompe disease is a lethal cardioskeletal myopathy in infants and results from genetic deficiency of the lysosomal enzyme acid alpha-glucosidase (GAA). Genetic replacement of the cDNA for human GAA (hGAA) is one potential therapeutic approach. Three months after a single intramuscular injection of 10(8) plaque-forming units (PFU) of E1-deleted adenovirus encoding human GAA (Ad-hGAA), the activity in whole muscle lysates of immunodeficient mice is increased to 20 times the native level. Direct transduction of a target muscle, however, may not correct all deficient cells. Therefore, the amount of enzyme that can be transferred to deficient cells from virally transduced cells was studied. Fibroblasts from an affected patient were transduced with AdhGAA, washed, and plated on transwell culture dishes to serve as donors of recombinant enzyme. Deficient fibroblasts were plated as acceptor cells, and were separated from the donor monolayer by a 22-microm pore size filter. Enzymatic and Western analyses demonstrate secretion of the 110-kDa precursor form of hGAA from the donor cells into the culture medium. This recombinant, 110-kDa species reaches the acceptor cells, where it can be taken up by mannose 6-phosphate receptor-mediated endocytosis. It then trafficks to lysosomes, where Western analysis shows proteolytic processing to the 76- and 70-kDa lysosomal forms of the enzyme. Patient fibroblasts receiving recombinant hGAA by this transfer mechanism reach levels of enzyme activity that are comparable to normal human fibroblasts. Skeletal muscle cell cultures from an affected patient were also transduced with Ad-hGAA. Recombinant hGAA is identified in a lysosomal location in these muscle cells by immunocytochemistry, and enzyme activity is transferred to deficient skeletal muscle cells grown in coculture. Transfer of the precursor protein between muscle cells again occurs via mannose 6-phosphate receptors, as evidenced by competitive inhibition with 5 mM mannose 6-phosphate. In vivo studies in GAA-knockout mice demonstrate that hepatic transduction with adenovirus encoding either murine or human GAA can provide a depot of recombinant enzyme that is available to heart and skeletal muscle through this mechanism. Taken together, these data show that the mannose 6-phosphate receptor pathway provides a useful strategy for cell-to-cell distribution of virally derived recombinant GAA.

Inherited deficiency of acid α-glucosidase (acid maltase, GAA) leads to glycogen storage disease type II. Clinical manifestations and prognosis of the disease depend on the age of onset and tissue involvement. GAA deficiency is extremely heterogeneous, ranging from a rapidly progressive fatal infantile-onset form to a slowly progressive adult-onset myopathy associated with respiratory insufficiency. Biochemical and immunochemical studies of the biosynthesis of the enzyme in GAA-deficient patients established the molecular diversity of the disease. Cloning and sequencing of the cDNA and the gene provided the basis for genetic analysis of the patients with different phenotypes. In this article, we summarize the data on mutations in the GAA gene and discuss the correlation between the genotype and phenotypic expression of the disease. © 1995 John Wiley & Sons, Inc.

Cystinuria is an autosomal recessive disease characterized by the development of kidney stones. Guided by the identification of the SLC3A1 amino acid-transport gene on chromosome 2, we recently established genetic linkage of cystinuria to chromosome 2p in 17 families, without evidence for locus heterogeneity. Other authors have independently identified missense mutations in SLC3A1 in cystinuria patients. In this report we describe four additional cystinuria-associated mutations in this gene: a frameshift, a deletion, a transversion inducing a critical amino acid change, and a nonsense mutation. The latter stop codon was found in all of eight Ashkenazi Jewish carrier chromosomes examined. This report brings the number of disease-associated mutations in this gene to 10. We also assess the frequency of these mutations in our 17 cystinuria families.

In Pompe disease, a deficiency of lysosomal acid alpha-glucosidase, glycogen accumulates in multiple tissues, but clinical manifestations are mainly due to skeletal and cardiac muscle involvement. A major advance has been the development of enzyme replacement therapy (ERT), which recently became available for Pompe patients. Based on clinical and pre-clinical studies, the effective clearance of skeletal muscle glycogen appears to be more difficult than anticipated. Skeletal muscle destruction and resistance to therapy remain unsolved problems. We have found that the cellular pathology in Pompe disease spreads to affect both the endocytic and autophagic pathways, leading to excessive autophagic buildup in therapy resistant muscle fibers of knockout mice. Furthermore, the autophagic buildup had a profound effect on the trafficking and processing of the therapeutic enzyme along the endocytic pathway. These findings may explain why ERT often falls short of reversing the disease process, and point to new avenues for the development of pharmacological intervention.

Skeletal muscle pathologies cause irregularities in the normally periodic organization of the myofibrils. Objective grading of muscle morphology is necessary to assess muscle health, compare biopsies, and evaluate treatments and the evolution of disease. To facilitate such quantitation, we have developed a fast, sensitive, automatic imaging analysis software. It detects major and minor morphological changes by combining texture features and Fourier transform (FT) techniques. We apply this tool to second harmonic generation (SHG) images of muscle fibers which visualize the repeating myosin bands. Texture features are then calculated by using a Haralick gray-level cooccurrence matrix in MATLAB. Two scores are retrieved from the texture correlation plot by using FT and curve-fitting methods. The sensitivity of the technique was tested on SHG images of human adult and infant muscle biopsies and of mouse muscle samples. The scores are strongly correlated to muscle fiber condition. We named the software MARS (muscle assessment and rating scores). It is executed automatically and is highly sensitive even to subtle defects. We propose MARS as a powerful and unbiased tool to assess muscle health.

We have determined the sequence of cDNA for the human histidyl-tRNA synthetase (HRS) in a hepatoma cell line and confirmed it in fetal myoblast and fibroblast cell lines. The newly determined sequence differs in 48 places, including insertions and deletions, from a previously published sequence. By sequence specific probing and by direct sequencing, we have established that only the newly determined sequence is present in genomic DNA and we have sequenced 500 hundred bases upstream of the translation start site. The predicted amino acid sequence now clearly demonstrates all three motifs recognized in class 2 aminoacyl-tRNA synthetases. Alignment of E. coli , yeast, and when available, mammalian predicted amino acid sequences for three of the four members of the class 2a subgroup (his, pro, ser, and thr) shows strong preservation of amino acid specific signature regions proximal to motif 2 and proximal to motif 3. These probably represent the active site binding regions for the proximal acceptor stem and for the amino acid. The first two exons of human HRS contain a 32 amino acid helical motif, first described in human QRS, a class 1 synthetase, which is found also in a yeast RNA polymerase, a rabbit termination factor, and both bovine and human WRS, suggesting that It may be an RNA binding motif.

Glycogenosis type II (GSD II) is a lysosomal disorder affecting skeletal and cardiac muscle. In the infantile form of the disease, patients display cardiac impairment, which is fatal before 2 years of life. Patients with juvenile or adult forms can present diaphragm involvement leading to respiratory failure. The enzymatic defect in GSD II results from mutations in the acid α-glucosidase (GAA) gene, which encodes a 76 kDa protein involved in intralysosomal glycogen hydrolysis. We previously reported the use of an adenovirus vector expressing GAA (AdGAA) for the transduction of myoblasts and myotubes cultures from GSD II patients. Transduced cells secreted GAA in the medium, and GAA was internalized by receptor-mediated capture, allowing glycogen hydrolysis in untransduced cells. In this study, using a GSD II mouse model, we evaluated the feasibility of GSD II gene therapy using muscle as a secretary organ. Adenovirus vector encoding AdGAA was injected in the gastrocnemius of neonates. We detected a strong expression of GAA in the injected muscle, secretion into plasma, and uptake by peripheral skeletal muscle and the heart. Moreover, glycogen content was decreased in these tissues. Electron microscopy demonstrated the disappearance of destruction foci, normally present in untreated mice. We thus demonstrate for the first time that muscle can be considered as a safe and easily accessible organ for GSD II gene therapy.

Pompe disease, a deficiency of lysosomal acid alpha-glucosidase, is a disorder of glycogen metabolism that can affect infants, children, or adults. In all forms of the disease, there is progressive muscle pathology leading to premature death. The pathology is characterized by accumulation of glycogen in lysosomes, autophagic buildup, and muscle atrophy. The purpose of the present investigation was to determine if myofibrillar dysfunction in Pompe disease contributes to muscle weakness beyond that attributed to atrophy. The study was performed on isolated myofibers dissected from severely affected fast glycolytic muscle in the alpha-glucosidase knockout mouse model. Psoas muscle fibers were first permeabilized, so that the contractile proteins could be directly relaxed or activated by control of the composition of the bathing solution. When normalized by cross-sectional area, single fibers from knockout mice produced 6.3 N/cm2 of maximum Ca2+-activated tension compared with 12.0 N/cm2 produced by wild-type fibers. The total protein concentration was slightly higher in the knockout mice, but concentrations of the contractile proteins myosin and actin remained unchanged. Structurally, X-ray diffraction showed that the actin and myosin filaments, normally arranged in hexagonal arrays, were disordered in the knockout muscle, and a lower fraction of myosin cross bridges was near the actin filaments in the relaxed muscle. The results are consistent with a disruption of actin and myosin interactions in the knockout muscles, demonstrating that impaired myofibrillar function contributes to weakness in the diseased muscle fibers.

Mucolipidosis type IV (MLIV) is a lysosomal storage disease characterized by neurologic and ophthalmologic abnormalities. There is currently no effective treatment. MLIV is caused by mutations in MCOLN1, a lysosomal cation channel from the transient receptor potential (TRP) family. In this study, we used genome editing to knockout the two mcoln1 genes present in Danio rerio (zebrafish). Our model successfully reproduced the retinal and neuromuscular defects observed in MLIV patients, indicating that this model is suitable for studying the disease pathogenesis. Importantly, our model revealed novel insights into the origins and progression of the MLIV pathology, including the contribution of autophagosome accumulation to muscle dystrophy and the role of mcoln1 in embryonic development, hair cell viability and cellular maintenance. The generation of a MLIV model in zebrafish is particularly relevant given the suitability of this organism for large-scale in vivo drug screening, thus providing unprecedented opportunities for therapeutic discovery.

Pompe disease is a rare genetic disorder characterized by a deficiency of acid α-glucosidase (GAA), leading to the accumulation of glycogen in various tissues, especially in skeletal muscles. The disease manifests as a large spectrum of phenotypes from infantile-onset Pompe disease (IOPD) to late-onset Pompe disease (LOPD), depending on the age of symptoms onset. Quantifying GAA activity and glycogen content in skeletal muscle provides important information about the disease severity. However, the distribution of GAA and glycogen levels in skeletal muscles from healthy individuals and those impacted by Pompe disease remains poorly understood, and there is currently no universally accepted standard assay for GAA activity measurement. This systematic literature review aims to provide an overview of the available information on GAA activity and glycogen content levels in skeletal muscle biopsies from patients with Pompe disease. A structured review of PubMed and Google Scholar literature (with the latter used to check that no additional publications were identified) was conducted to identify peer-reviewed publications on glycogen storage disease type II [MeSH term] + GAA, protein human (supplementary concept), Pompe, muscle; and muscle, acid alpha-glucosidase. A limit of English language was applied. Results were grouped by methodologies used to quantify GAA activity and glycogen content in skeletal muscle. The search and selection strategy were devised and carried out in line with Preferred Reporting of Items in Systematic Reviews and Meta-Analysis guidelines and documented using a flowchart. Bibliographies of papers included in the analysis were reviewed and applicable publications not already identified in the search were included. Of the 158 articles retrieved, 24 (comprising >100 muscle biopsies from >100 patients) were included in the analysis, with four different assays. Analysis revealed that patients with IOPD exhibited markedly lower GAA activity in skeletal muscles than those with LOPD, regardless of the measurement method employed. Additionally, patients with IOPD had notably higher glycogen content levels in skeletal muscles than those with LOPD. In general, however, it was difficult to fully characterize GAA activity because of the different methods used. The findings underscore the challenges in the interpretation and comparison of the results across studies because of the substantial methodological variations. There is a need to establish standardized reference ranges of GAA activity and glycogen content in healthy individuals and in Pompe disease patients based on globally standardized methods to improve comparability and reliability in assessing this rare disease.

Human phosphofructokinase (PFK) is a tetrameric enzyme, encoded by muscle, liver, and platelet genes. Deficiency of muscle PFK (PFK-M), glycogenosis type VII (Tarui disease), is an autosomal recessive disorder characterized by an exertional myopathy and hemolytic syndrome. Several disease-causing mutations have been identified in the PFK-M gene in Japanese, Ashkenazi Jewish, and Italian patients. We describe the genetic defects in French Canadian and Swiss patients with the disease, and we use a genetically well-defined yeast system devoid of endogenous PFK for structure-function studies of the mutant PFKs. A G-to-A transition at codon 209-in exon 8 of the PFK-M gene, changing an encoded Gly to Asp, is responsible for the disease in a homozygous French Canadian patient. Gly-209-mutated protein is completely inactive in the yeast system. The Swiss patient is a genetic compound, carrying a G-to-A transition at codon 100 in exon 6 (Arg to Gln) and a G-to-A transition at codon 696 in exon 22 (Arg to His). The mutants expressed in yeast generate functional enzyme with modest changes in thermal stability. The advantages and limitations of the yeast system for expression of human mutant PFKs are discussed.

Phosphofructokinase (PFK) catalyzes the rate-limiting step of glycolysis. Deficiency of the muscle enzyme is manifested by exercise intolerance and a compensated hemolytic anemia. Case reports of this autosomal recessive disease suggest a predominance in Ashkenazi Jews in the United States. We have explored the genetic basis for this illness in nine affected families and surveyed the normal Ashkenazi population for the mutations we have found. Genomic DNA was amplified using PCR, and denaturing gradient-gel electrophoresis was used to localize exons with possible mutations. The polymorphic exons were sequenced or digested with restriction enzymes. A previously described splicing mutation, delta 5, accounted for 11 (61%) of 18 abnormal alleles in the nine families. A single base deletion leading to a frameshift mutation in exon 22 (delta C-22) was found in six of seven alleles. A third mutation, resulting in a nonconservative amino acid substitution in exon 4, accounted for the remaining allele. Thus, three mutations could account for all illness in this group, and two mutations could account for 17 of 18 alleles. In screening 250 normal Ashkenazi individuals for all three mutations, we found only one delta 5 allele. Clinical data revealed no correlation between the particular mutations and symptoms, but male patients were more symptomatic than females, and only males had frank hemolysis and hyperuricemia. Because PFK deficiency in Ashkenazi Jews is caused by a limited number of mutations, screening genomic DNA from peripheral blood for the described mutations in this population should enable rapid diagnosis without muscle biopsy.

Insulin receptor substrate-1 (IRS-1) is an endogenous substrate for the insulin receptor tyrosine kinase, which plays an important role in insulin signaling. Mutations in the IRS-1 gene are associated in some populations with obesity and Type 2 diabetes.To determine whether variation in the IRS-1 gene contributes to genetic susceptibility to insulin resistance and Type 2 diabetes in Mexican Americans, the entire coding region of the IRS-1 gene was screened for variation in 31 unrelated subjects with Type 2 diabetes using single-stranded conformational polymorphism analysis (SSCP) and dideoxy sequence analysis. Variants encoding amino acid substitutions were genotyped in 27 unrelated nondiabetic Mexican Americans and in all family members of subjects containing these variants, and association analyses were performed. To trace the ancestral origins of the variants, Iberian Caucasians and Pima Indians were also genotyped.Eight single base changes were found: four silent polymorphisms and four missense mutations (Ala94Thr, Ala512Pro, Ser892Gly and Gly971Arg). Allele frequencies were 0.009, 0.017, 0.017 and 0.043, respectively. There were no significant associations of any of these variants with diabetes, glucose or insulin levels during an oral glucose tolerance test, or with body mass index (BMI) in Mexican American families except for a modest association between the Ala94Thr variant and decreased BMI (30.4 kg/m(2) vs 24.0 kg/m(2); p=0.035). None of these four missense mutations were detected in Pima Indians. In Iberian Caucasians, neither Ala94Thr nor Ser892Gly were detected, and Ala512Pro was detected in only 0/60 diabetic patients and 1/60 nondiabetic controls. Gly971Arg was relatively more common in Iberian Caucasians with 12/58 diabetic patients and 7/60 nondiabetic controls being heterozygous for this variant (p=0.21 for comparison between diabetic and nondiabetic subjects).Ala94Thr, Ala512Pro and Ser892Gly mutation are rare in the populations studied. Gly971Arg, is more common in Mexican Americans and Caucasians, but is not a major contributor to genetic susceptibility to Type 2 diabetes.

Mutations in the insulin gene can impair the bioactivity of the insulin molecule. Previously, two classes of mutations have been identified: 1) those that impair posttranslational processing of proinsulin to insulin, and 2) those that alter the structure of the insulin molecule, thereby reducing the affinity of the molecule for the insulin receptor. We have investigated two apparently unrelated patients, both of which have mutations that inhibit the conversion of proinsulin to insulin. By directly sequencing genomic DNA amplified by polymerase chain reaction, we have demonstrated that both patients are heterozygous for the same point mutation converting codon 65 from an arginine (CGT) to a histidine (CAT) codon. Because Arg65 is one of the two dibasic amino acids at the site of proteolytic cleavage between the insulin A-chain and C-peptide, this mutation explains the impairment in the cleavage of proinsulin to insulin. Interestingly, the same His65 mutation has been identified in the insulin gene of a Japanese kindred with familial hyperproinsulinemia. Thus, this mutation has occurred in three apparently unrelated kindreds from two different racial groups. This observation is consistent with the hypothesis that the dinucleotide sequence CpG, the first two nucleotides in the arginine (CGT) codon, is a "hot spot" for mutations.

Laforin, encoded by the EPM2A gene, is a dual specificity protein phosphatase that has a functional glycogen-binding domain. Mutations in the EPM2A gene account for around half of the cases of Lafora disease, an autosomal recessive neurodegenerative disorder, characterized by progressive myoclonus epilepsy. The hallmark of the disease is the presence of Lafora bodies, which contain polyglucosan, a poorly branched form of glycogen, in neurons and other tissues. We examined the level of laforin protein in several mouse models in which muscle glycogen accumulation has been altered genetically. Mice with elevated muscle glycogen have increased laforin as judged by Western analysis. Mice completely lacking muscle glycogen or with 10% normal muscle glycogen had reduced laforin. Mice defective in the GAA gene encoding lysosomal α-glucosidase (acid maltase) overaccumulate glycogen in the lysosome but did not have elevated laforin. We propose, therefore, that laforin senses cytosolic glycogen accumulation which in turn determines the level of laforin protein.

Alglucosidase alpha is an orphan drug approved for enzyme replacement therapy (ERT) in Pompe disease (PD); however, its efficacy is limited in skeletal muscle because of a partial blockage of autophagic flux that hinders intracellular trafficking and enzyme delivery. Adjunctive therapies that enhance autophagic flux and protect mitochondrial integrity may alleviate autophagic blockage and oxidative stress and thereby improve ERT efficacy in PD. In this study, we compared the benefits of ERT combined with a ketogenic diet (ERT-KETO), daily administration of an oral ketone precursor (1,3-butanediol; ERT-BD), a multi-ingredient antioxidant diet (ERT-MITO; CoQ10, α-lipoic acid, vitamin E, beetroot extract, HMB, creatine, and citrulline), or co-therapy with the ketone precursor and multi-ingredient antioxidants (ERT-BD-MITO) on skeletal muscle pathology in GAA-KO mice. We found that two months of 1,3-BD administration raised circulatory ketone levels to ≥1.2 mM, attenuated autophagic buildup in type 2 muscle fibers, and preserved muscle strength and function in ERT-treated GAA-KO mice. Collectively, ERT-BD was more effective vs. standard ERT and ERT-KETO in terms of autophagic clearance, dampening of oxidative stress, and muscle maintenance. However, the addition of multi-ingredient antioxidants (ERT-BD-MITO) provided the most consistent benefits across all outcome measures and normalized mitochondrial protein expression in GAA-KO mice. We therefore conclude that nutritional co-therapy with 1,3-butanediol and multi-ingredient antioxidants may provide an alternative to ketogenic diets for inducing ketosis and enhancing autophagic flux in PD patients.

Gene therapy is under advanced clinical development for several lysosomal storage disorders. Pompe disease, a debilitating neuromuscular illness that affects infants, children, and adults with different degrees of severity, is caused by a deficiency of lysosomal glycogen-degrading enzyme acid alpha-glucosidase (GAA). Here, we demonstrated that adeno-associated virus (AAV9)-mediated systemic gene transfer fully reversed glycogen storage in all key therapeutic targets - skeletal and cardiac muscles, the diaphragm, and the central nervous system (CNS) - in both young and severely affected old Gaa knockout mice. Furthermore, the therapy reversed secondary cellular abnormalities in skeletal muscle, such as autophagy and mTORC1/AMPK signaling. We used a newly developed AAV9 vector encoding a chimeric human GAA protein with enhanced uptake and secretion to facilitate efficient spread of the expressed protein among multiple target tissues. These results lay the groundwork for future clinical development strategy in Pompe disease.

Pompe disease (PD) is a progressive myopathy caused by the aberrant accumulation of glycogen in skeletal and cardiac muscle resulting from the deficiency of the enzyme acid alpha-glucosidase (GAA). Administration of recombinant human GAA as enzyme replacement therapy (ERT) works well in alleviating the cardiac manifestations of PD but loses sustained benefit in ameliorating the skeletal muscle pathology. The limited efficacy of ERT in skeletal muscle is partially attributable to its inability to curb the accumulation of new glycogen produced by the muscle enzyme glycogen synthase 1 (GYS1). Substrate reduction therapies aimed at knocking down GYS1 expression represent a promising avenue to improve Pompe myopathy. However, finding specific inhibitors for GYS1 is challenging given the presence of the highly homologous GYS2 in the liver. Antisense oligonucleotides (ASOs) are chemically modified oligomers that hybridize to their complementary target RNA to induce their degradation with exquisite specificity. In the present study, we show that ASO-mediated Gys1 knockdown in the Gaa -/- mouse model of PD led to a robust reduction in glycogen accumulation in skeletal and cardiac muscle. In addition, combining Gys1 ASO with ERT further reduced glycogen content in muscle, eliminated autophagic buildup and lysosomal dysfunction, and improved motor function in Gaa -/- mice. Our results provide a strong foundation for further validation of the use of Gys1 ASO, alone or in combination with ERT, as a therapy for PD. We propose that early administration of Gys1 ASO in combination with ERT may be the key to preventative treatment options in PD.

Autophagy is an evolutionarily conserved lysosome-dependent degradation of cytoplasmic constituents. The system operates as a critical cellular pro-survival mechanism in response to nutrient deprivation and a variety of stress conditions. On top of that, autophagy is involved in maintaining cellular homeostasis through selective elimination of worn-out or damaged proteins and organelles. The autophagic pathway is largely responsible for the delivery of cytosolic glycogen to the lysosome where it is degraded to glucose via acid α-glucosidase. Although the physiological role of lysosomal glycogenolysis is not fully understood, its significance is highlighted by the manifestations of Pompe disease, which is caused by a deficiency of this lysosomal enzyme. Pompe disease is a severe lysosomal glycogen storage disorder that affects skeletal and cardiac muscles most. In this review, we discuss the basics of autophagy and describe its involvement in the pathogenesis of muscle damage in Pompe disease. Finally, we outline how autophagic pathology in the diseased muscles can be used as a tool to fast track the efficacy of therapeutic interventions.

Polymyositis is regarded as an autoimmune inflammatory muscle disease. A major subgroup of patients have autoantibodies to cellular histidyl-transfer RNA synthetase (HRS). We have analyzed the role of the autoantigen HRS in the induction of murine myositis in a comparative study of inoculation of BALB/c mice with recombinant HRS protein versus naked DNA coding for HRS. Adult BALB/c mice produced antibodies to human HRS following inoculation with HRS protein and adjuvant, but myositis was not observed. Alternatively, expression plasmid DNA constructs encoding full-length and truncated human HRS were inoculated intramuscularly in gene transfer studies. DNA-inoculated mice produced relatively low anti-HRS antibody titers. However, in contrast to recombinant HRS protein-inoculated mice, HRS gene transfer induced pathology with evidence of cellular infiltration of perivascular and endomysial regions of the inoculated muscle. Multiple inoculations of a plasmid construct encoding a hybrid molecule consisting of HRS and the transferrin receptor cytoplasmic tail induced the highest levels of antibodies and persisting cellular infiltration. Unlike HRS, expression of influenza virus hemagglutinin (HA) following inoculation of an HA plasmid did not induce myositis. Transfer of naked DNA constructs expressing HRS is likely to provide valuable information on the autoimmune response to this protein and its role in the development of myositis. Delivery of naked DNA encoding the gene for the candidate autoantigen histidyl-transfer RNA synthetase (HRS) in polymyositis into skeletal muscle of mice induced a marked inflammatory response that was long-lasting. In contrast, immunization of mice with recombinant HRS protein did not result in myositis. Anti-HRS antibodies were found in mice using both immunization protocols but were of higher titer in mice inoculated with recombinant HRS protein. These differences probably reflect the differences in antigen processing and presentation pathways between endogenous and exogenous delivery of antigens. The expression of autoantigens by naked DNA transfer is a new approach for the development of animal models for autoimmune diseases.

Denaturing gradient gel electrophoresis (DGGE) has been used to screen for mutations in the insulin receptor gene. Each of the 22 exons was amplified by the polymerase chain reaction (PCR). For each exon, one of the two PCR primers contained a guanine-cytosine (GC) clamp at its 5' end. The DNA was analyzed by electrophoresis through a polyacrylamide gel containing a gradient of denaturants. Two geometries for the gels were compared; the gradient of denaturants was oriented either parallel or perpendicular to the electric field. The sensitivity of the technique was evaluated by determining whether DGGE succeeded in detecting known mutations and polymorphisms in the insulin receptor gene. With parallel gels, 12 of 16 sequence variants were detected. The use of perpendicular gels increased the sensitivity of detection so that all 16 sequence variants were successfully detected when DNA was analyzed by a combination of perpendicular and parallel gels. Furthermore, DGGE was used to investigate a patient with leprechaunism whose insulin receptor genes had not previously been studied. Two mutant alleles were identified in this patient. The allele inherited from the father had a mutation substituting alanine for Val-28; in the allele inherited from the mother, arginine was substituted for Gly-366.

Hes-1, the mammalian homologue 1 of Drosophila hairy and Enhancer of split proteins, belongs to a family of basic helix–loop–helix proteins that are essential to neurogenesis, myogenesis, hematopoiesis, and sex determination. Hes-1 is a transcriptional repressor for a number of known genes including the human acid α-glucosidase (GAA) gene as we have previously shown in Hep G2 cells. The human GAA gene encodes the enzyme for glycogen breakdown in lysosomes, deficiency of which results in Glycogen Storage Disease type II (Pompe syndrome). Using constructs containing the DNA element that demonstrates repressive activity in Hep G2 cells and conditions in which the same transcription factors, Hes-1 and YY1, bind, we have shown that this element functions as an enhancer in human fibroblasts. Site-directed mutagenesis and overexpression of Hes-1 showed that Hes-1 functions as a transcriptional activator. The dual function of Hes-1 we have found is likely to contribute to the subtle tissue-specific control of this housekeeping gene.

The recessively inherited deficiency of acid alpha-glucosidase (GAA) called Glycogenosis Type II is expressed as three different phenotypes: infantile, juvenile, and adult. At the molecular level, infantile and adult forms of the disease have been extensively studied, but little is known regarding the genetic defects associated with the juvenile form. We describe a novel mutation that defines the intermediate juvenile phenotype in a compound heterozygous patient. A transversion of t to g in intron 6 at position -22 creates a cryptic acceptor site and results in unusual splicing abnormality: insertion of 21 nucleotides of the intronic sequence into mRNA and removal of exon 6 without disruption of the reading frame. The second mutation, Arg854Stop in exon 18, had been previously identified in another African-American patient (Hermans et al., 1993a). Family study indicates that a silent allele harboring the Arg854Stop mutation in our patient is inherited from the patient's father, who is also African-American, thus suggesting a common mutation in this population.

The human histidyl-tRNA synthetase (HRS) gene encodes an enzyme that catalyzes the esterification of histidine to its cognate tRNA as an early step in protein biosynthesis. Previous reports have described a bidirectional promoter element which coordinates the transcription of both HRS and an unknown mRNA whose gene is oriented in a head-to-head configuration with HRS. We have isolated and characterized a human genomic DNA clone that encodes portions of these oppositely transcribed mRNAs and a putatively full-length cDNA clone (HO3) corresponding to the gene mapping immediately 5' of HRS. The largest open reading frame within HO3 (1518 bp) shares approximately 75% nucleotide sequence identity with human HRS (1527 bp) and predicts a polypeptide with extensive amino acid sequence homology with the HRS protein (72%). Moreover, amino acid sequence motifs characteristic of class II aminoacyl-tRNA synthetases are conserved within HO3. Despite their similarity, HRS and HO3 have divergent amino-terminal domains which correspond to the first two exons of each gene. RNA blot analysis revealed that HRS (2.0 kb) and HO3 (2.5 kb) exhibit distinct patterns of steady-state mRNA expression among multiple human tissues.