Martha M. Monick

Abstract The role of vitamin D in innate immunity is increasingly recognized. Recent work has identified a number of tissues that express the enzyme 1α-hydroxylase and are able to activate vitamin D. This locally produced vitamin D is believed to have important immunomodulatory effects. In this paper, we show that primary lung epithelial cells express high baseline levels of activating 1α-hydroxylase and low levels of inactivating 24-hydroxylase. The result of this enzyme expression is that airway epithelial cells constitutively convert inactive 25-dihydroxyvitamin D3 to the active 1,25-dihydroxyvitamin D3. Active vitamin D that is generated by lung epithelium leads to increased expression of vitamin D-regulated genes with important innate immune functions. These include the cathelicidin antimicrobial peptide gene and the TLR coreceptor CD14. dsRNA increases the expression of 1α-hydroxylase, augments the production of active vitamin D, and synergizes with vitamin D to increase expression of cathelicidin. In contrast to induction of the antimicrobial peptide, vitamin D attenuates dsRNA-induced expression of the NF-κB-driven gene IL-8. We conclude that primary epithelial cells generate active vitamin D, which then influences the expression of vitamin D-driven genes that play a major role in host defense. Furthermore, the presence of vitamin D alters induction of antimicrobial peptides and inflammatory cytokines in response to viruses. These observations suggest a novel mechanism by which local conversion of inactive to active vitamin D alters immune function in the lung.

Endotoxin-induced cytokine gene transcription in monocytes and macrophages is regulated in part by NF-κB. We have previously shown that the p38 mitogen-activated protein (MAP) kinase is necessary for endotoxin-induced cytokine gene transcription. Due to the fact that most cytokine promoter sequences have active NF-κB sites, we hypothesized that the p38 MAP kinase was necessary for NF-κB-dependent gene expression. We found that NF-κB-dependent gene expression was reduced to near control levels with either SB 203580 or a dominant-negative p38 MAP kinase expression vector. Inhibition of the p38 MAP kinase did not alter NF-κB activation at any level, but it significantly reduced the DNA binding of TATA-binding protein (TBP) to the TATA box. The dominant-negative p38 MAP kinase expression vector interfered with the direct interaction of native TFIID (TBP) with a co-transfected p65 fusion protein. Likewise, this dominant-negative plasmid also interfered with the direct interaction of a co-transfected TBP fusion protein with the native p65 subunit. The p38 kinase also phosphorylated TFIID (TBP) in vitro, and SB 203580 inhibited phosphorylation of TFIID (TBP) in vivo. Thus, the p38 MAP kinase regulates NF-κB-dependent gene transcription, in part, by modulating activation of TFIID (TBP). Endotoxin-induced cytokine gene transcription in monocytes and macrophages is regulated in part by NF-κB. We have previously shown that the p38 mitogen-activated protein (MAP) kinase is necessary for endotoxin-induced cytokine gene transcription. Due to the fact that most cytokine promoter sequences have active NF-κB sites, we hypothesized that the p38 MAP kinase was necessary for NF-κB-dependent gene expression. We found that NF-κB-dependent gene expression was reduced to near control levels with either SB 203580 or a dominant-negative p38 MAP kinase expression vector. Inhibition of the p38 MAP kinase did not alter NF-κB activation at any level, but it significantly reduced the DNA binding of TATA-binding protein (TBP) to the TATA box. The dominant-negative p38 MAP kinase expression vector interfered with the direct interaction of native TFIID (TBP) with a co-transfected p65 fusion protein. Likewise, this dominant-negative plasmid also interfered with the direct interaction of a co-transfected TBP fusion protein with the native p65 subunit. The p38 kinase also phosphorylated TFIID (TBP) in vitro, and SB 203580 inhibited phosphorylation of TFIID (TBP) in vivo. Thus, the p38 MAP kinase regulates NF-κB-dependent gene transcription, in part, by modulating activation of TFIID (TBP). lipopolysaccharide or endotoxin nuclear factor κB IκB kinase transcription factor IIB transcription factor IID TATA-binding protein mitogen-activated protein extracellular signal-regulated kinase activating transcription factor 2 MAP kinase kinase kinase 1 c-Jun MAP kinase polyacrylamide gel electrophoresis Cytokine gene expression in endotoxin (LPS)1-stimulated macrophages is regulated, at least in part, at the level of transcription. A transcription factor that is necessary for the transcription of many cytokine genes is nuclear factor κB (NF-κB) (1Collart M.A. Baeuerle P. Vassalli P. Mol. Cell. Biol. 1990; 10: 1498-1506Crossref PubMed Google Scholar, 2Libermann T.A. Baltimore D. Mol. Cell. Biol. 1990; 10: 2327-2334Crossref PubMed Google Scholar, 3Matsusaka T. Fujikawa K. Nishio Y. Mukaida N. Matsushima K. Kishimoto T. Akira S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10193-10197Crossref PubMed Scopus (893) Google Scholar, 4Zhang Y.H. Lin J.X. Vilcek J. Mol. Cell. Biol. 1990; 10: 3818-3823Crossref PubMed Scopus (236) Google Scholar). In addition to others, we have previously shown that NF-κB binds to specific cytokine promoter sequences (1Collart M.A. Baeuerle P. Vassalli P. Mol. Cell. Biol. 1990; 10: 1498-1506Crossref PubMed Google Scholar, 2Libermann T.A. Baltimore D. Mol. Cell. Biol. 1990; 10: 2327-2334Crossref PubMed Google Scholar, 3Matsusaka T. Fujikawa K. Nishio Y. Mukaida N. Matsushima K. Kishimoto T. Akira S. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 10193-10197Crossref PubMed Scopus (893) Google Scholar, 4Zhang Y.H. Lin J.X. Vilcek J. Mol. Cell. Biol. 1990; 10: 3818-3823Crossref PubMed Scopus (236) Google Scholar, 5Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1998; 18: 384-391Crossref PubMed Scopus (115) Google Scholar, 6Shakhov A.N. Collart M.A. Vassalli P. Nedospasov S.A. Jongeneel C.V. J. Exp. Med. 1990; 171: 35-47Crossref PubMed Scopus (739) Google Scholar, 7Goldfeld A.E. Strominger J.L. Doyle C. J. Exp. Med. 1991; 174: 73-81Crossref PubMed Scopus (137) Google Scholar, 8Kunsch C. Lang R.K. Rosen C.A. Shannon M.F. J. Immunol. 1994; 153: 153-164PubMed Google Scholar). NF-κB is composed of heterodimers (most commonly p50 and p65) of members of the Rel family of transcription factors. In quiescent cells the heterodimers are kept in the cytoplasm by an inhibitor protein, IκB (9Finco T.S. Baldwin A.S. Immunity. 1995; 3: 263-272Abstract Full Text PDF PubMed Scopus (385) Google Scholar, 10Matthews J.R. Hay R.T. Int. J. Biochem. Cell Biol. 1995; 27: 865-879Crossref PubMed Scopus (72) Google Scholar, 11Yin M.J. Yamamoto Y. Gaynor R.B. Nature. 1998; 396: 77-80Crossref PubMed Scopus (1453) Google Scholar). NF-κB translocation and DNA binding is dependent on IκB kinase (IKK), which phosphorylates IκB on serines within the amino-terminal domain (12Brockman J.A. Scherer D.C. McKinsey T.A. Hall S.M. Qi X. Lee W.Y. Ballard D.W. Mol. Cell. Biol. 1995; 15: 2809-2818Crossref PubMed Google Scholar, 13Brown K. Gerstberger S. Carlson L. Franzoso G. Siebenlist U. Science. 1995; 267: 1485-1488Crossref PubMed Scopus (1326) Google Scholar, 14DiDonato J. Mercurio F. Rosette C. Wu-Li J. Suyang H. Ghosh S. Karin M. Mol. Cell. Biol. 1996; 16: 1295-1304Crossref PubMed Google Scholar, 15Whiteside S.T. Ernst M.K. LeBail O. Laurent-Winter C. Rice N. Israel A. Mol. Cell. Biol. 1995; 15: 5339-5345Crossref PubMed Google Scholar, 16Traenckner E.B. Pahl H.L. Henkel T. Schmidt K.N. Wilk S. Baeuerle P.A. EMBO J. 1995; 14: 2876-2883Crossref PubMed Scopus (938) Google Scholar, 17O'Connell M.A. Bennett B.L. Mercurio F. Manning A.M. Mackman N. J. Biol. Chem. 1998; 273: 30410-30414Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). This phosphorylation results in IκB degradation, thus allowing NF-κB translocation to the nucleus. Other factors, however, have been shown to be essential for NF-κB transcriptional activation, especially phosphorylation of the p65 subunit of NF-κB in one of two of its transactivation domains (18Naumann M. Scheidereit C. EMBO J. 1994; 13: 4597-4607Crossref PubMed Scopus (329) Google Scholar). In addition, the association of the carboxyl terminus of p65 with basal transcription factors, such as transcription factor IIB (TFIIB) and TATA-binding protein (TBP), is known to be important for transcriptional regulation of NF-κB (19Kerr L.D. Ransone L.J. Wamsley P. Schmitt M.J. Boyer T.G. Zhou Q. Berk A.J. Verma I.M. Nature. 1993; 365: 412-419Crossref PubMed Scopus (137) Google Scholar, 20Xu X. Prorock C. Ishikawa H. Maldonado E. Ito Y. Gelinas C. Mol. Cell. Biol. 1993; 13: 6733-6741Crossref PubMed Scopus (98) Google Scholar, 21Blair W.S. Bogerd H.P. Madore S.J. Cullen B.R. Mol. Cell. Biol. 1994; 14: 7226-7234Crossref PubMed Scopus (104) Google Scholar, 22Schmitz M.L. Stelzer G. Altmann H. Meisterernst M. Baeuerle P.A. J. Biol. Chem. 1995; 270: 7219-7226Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). One family of kinases that is essential for transferring signals from the cell surface to the nucleus is the mitogen-activated protein (MAP) kinases. We and others have shown that the p38 MAP kinase is critical for LPS-induced cytokine gene expression (23Lee J.C. Laydon J.T. McDonnell P.C. Gallagher T.F. Kumar S. Green D. McNulty D. Blumenthal M.J. Heys J.R. Landvatter S.W. Strickler J.E. McLaughlin M.M. Siemens I.R. Fisher S.M. Livi G.P. White J.R. Adams J.L. Young P.R. Nature. 1994; 372: 739-746Crossref PubMed Scopus (3181) Google Scholar, 24Lee J.C. Young P.R. J. Leukocyte Biol. 1996; 59: 152-157Crossref PubMed Scopus (376) Google Scholar, 25Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1999; 20: 751-758Crossref PubMed Scopus (284) Google Scholar, 26Shapiro L. Dinarello C.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12230-12234Crossref PubMed Scopus (236) Google Scholar). Some of these studies showed that LPS, interleukin 1, and osmotic stress activate p38 MAP kinases, and inhibition with SB 203580, a competitive inhibitor of the p38 MAP kinases, reduced cytokine release but did not affect cytokine mRNA accumulation (23Lee J.C. Laydon J.T. McDonnell P.C. Gallagher T.F. Kumar S. Green D. McNulty D. Blumenthal M.J. Heys J.R. Landvatter S.W. Strickler J.E. McLaughlin M.M. Siemens I.R. Fisher S.M. Livi G.P. White J.R. Adams J.L. Young P.R. Nature. 1994; 372: 739-746Crossref PubMed Scopus (3181) Google Scholar, 24Lee J.C. Young P.R. J. Leukocyte Biol. 1996; 59: 152-157Crossref PubMed Scopus (376) Google Scholar, 26Shapiro L. Dinarello C.A. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 12230-12234Crossref PubMed Scopus (236) Google Scholar). These studies suggested that the p38 MAP kinase is necessary for the translation of cytokine mRNAs (23Lee J.C. Laydon J.T. McDonnell P.C. Gallagher T.F. Kumar S. Green D. McNulty D. Blumenthal M.J. Heys J.R. Landvatter S.W. Strickler J.E. McLaughlin M.M. Siemens I.R. Fisher S.M. Livi G.P. White J.R. Adams J.L. Young P.R. Nature. 1994; 372: 739-746Crossref PubMed Scopus (3181) Google Scholar). In addition, we found that the p38 MAP kinase also regulated LPS-induced cytokine gene expression at the level of transcription in macrophages (25Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1999; 20: 751-758Crossref PubMed Scopus (284) Google Scholar). The p38 MAP kinase is known to regulate various transcription factors, such as ATF-2, by phosphorylation (27Raingeaud J. Gupta S. Rogers J.S. Dickens M. Han J. Ulevitch R.J. Davis R.J. J. Biol. Chem. 1995; 270: 7420-7426Abstract Full Text Full Text PDF PubMed Scopus (2061) Google Scholar, 28Nick J.A. Avdi N.J. Gerwins P. Johnson G.L. Worthen G.S. J. Immunol. 1996; 156: 4867-4875PubMed Google Scholar, 29Derijard B. Raingeaud J. Barrett T. Wu I.H. Han J. Ulevitch R.J. Davis R.J. Science. 1995; 267: 682-685Crossref PubMed Scopus (1431) Google Scholar, 30Cuenda A. Cohen P. Buee-Scherrer V. Goedert M. EMBO J. 1997; 16: 295-305Crossref PubMed Scopus (318) Google Scholar). One study, using tumor necrosis factor as a stimulus, found that inhibition of the p38 MAP kinase with SB 203580 did not alter NF-κB DNA binding (31Beyaert R. Cuenda A. Vanden Berghe W. Plaisance S. Lee J.C. Haegeman G. Cohen P. Fiers W. EMBO J. 1996; 15: 1914-1923Crossref PubMed Scopus (609) Google Scholar). Another study showed that overexpression of MEKK1, an upstream kinase that activates both the p38 and c-Jun (JNK) MAP kinases, increased NF-κB-driven transcription (32Read M.A. Whitley M.Z. Gupta S. Pierce J.W. Best J. Davis R.J. Collins T. J. Biol. Chem. 1997; 272: 2753-2761Abstract Full Text Full Text PDF PubMed Scopus (339) Google Scholar). MEKK1 has also been found to interact directly with both IKK-α and IKK-β (33Nemoto S. DiDonato J.A. Lin A. Mol. Cell. Biol. 1998; 18: 7336-7343Crossref PubMed Google Scholar). Using a promoter construct driven only by NF-κB, we found that LPS-induced NF-κB-dependent gene expression was inhibited by SB 203580 and a dominant-negative p38 MAP kinase expression vector. We performed electrophoretic mobility shift assays and found that inhibition of the p38 MAP kinase with SB 203580 did not affect NF-κB DNA binding. To confirm these findings, we also found that IκB-β degradation was not affected by p38 MAP kinase inhibition. We next evaluated if the p38 MAP kinase regulated phosphorylation of the p65 subunit by performing in vivo phosphorylation studies and found that SB 203580 did not regulate phosphorylation of the p65 subunit of NF-κB. The inhibition of the p38 MAP kinase with SB 203580 did, however, reduce the DNA binding of TFIID (TBP) to the TATA box, and the dominant-negative p38 MAP kinase expression vector altered the direct interaction of TFIID (TBP) with a co-transfected His-p65 fusion protein. It also interfered with the binding of a co-transfected His-TBP fusion protein with native p65. The p38 MAP kinase was also found to phosphorylate TFIID (TBP) in vitro, and SB 203580 inhibited the phosphorylation of TFIID (TBP) in vivo. These findings suggest that the p38 MAP kinase regulates NF-κB-driven gene expression, in part, by regulation of TFIID (TBP) activation. The THP-1 cell line was obtained from American Type Culture Collection (Manassas, VA). The cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium supplemented with gentamicin and 10% fetal calf serum (Life Technologies, Inc.). In in vivo phosphorylation studies, cells were cultured in phosphate-free RPMI 1640 medium (Life Technologies, Inc.) with the same supplements. NF-κB-dependent gene expression was evaluated using a luciferase reporter gene driven by four tandem copies of the κ enhancer (κB4) in a pUC vector (CLONTECH, Palo Alto, CA). The pCMV-Flag-p38 plasmid has been previously described (a generous gift from Dr. Roger Davis, University of Massachusetts, Worcester, MA) (27Raingeaud J. Gupta S. Rogers J.S. Dickens M. Han J. Ulevitch R.J. Davis R.J. J. Biol. Chem. 1995; 270: 7420-7426Abstract Full Text Full Text PDF PubMed Scopus (2061) Google Scholar). The cDNA for the p65 subunit of NF-κB was generated by reverse transcription-polymerase chain reaction from a total RNA preparation (RNA Stat-60, Tel-test B, Friendswood, TX) from THP-1 cells. First-strand synthesis was performed using the primer 5′-GCTTTTGGAGGGCTTCAATC-3′. Amplification of the p65 gene was performed using the primer 5′-CCCGCGGCATGGACGAACTG-3′. A set of nested primers, 5′-CTGGGATCCCTATGGACGAACTGTTCCCCCTC-3′ and 5′-AGACTCGAGTTAGGAGCTGATCTGACTCAGC-3′ were then used in a second polymerase chain reaction to generate an amplicon that consisted of the p65 coding sequence flanked by BamHI and XhoI restriction sites. This amplicon was ligated with the pcDNA3.1/HisA vector (Invitrogen, Carlsbad, CA) to give plasmid pcDNA-His-p65. The cDNA for TBP was generated from THP-1 RNA by reverse transcription-polymerase chain reaction. Amplification of the TBP gene was performed by using the primers 5′-CTAGGATCCAGATGGATCAGAACAACAGCCTGCC-3′ and 5′-CTATCTAGATTACGTCGTCTTCCTGAATCCC-3′. The resulting amplicon was then digested with BamHI and XbaI and ligated into the similarly digested expression vector pcDNA3.1/HisA (Invitrogen) to generate the plasmid pcDNA-His-TBP. The correct reading frame and sequence were verified by fluorescent automated DNA sequencing performed by the University of Iowa DNA Facility. Transfections were performed using the Effectene transfection reagent (Qiagen, Valencia, CA) according to the manufacturer's recommendations. Twenty-four h after transfection the cells were stimulated with Escherichia coli serotype 026:B6 LPS (Sigma) at a dose of 100 μg/ml. Luciferase activity, which was normalized to total protein, was measured after 6 h (Promega, Madison, WI), which was determined to be the time of maximal activity. The p38 MAP kinase inhibitor, SB 203580 (Calbiochem), at 0.5 μm, was added 1 h before stimulation with LPS. THP-1 cells were cultured in the presence or absence of SB 203580 for 1 h before stimulation with LPS. After 3 h, the cells were harvested, and nuclear protein was extracted as described previously (5Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1998; 18: 384-391Crossref PubMed Scopus (115) Google Scholar). A consensus NF-κB (5′-AGTTGAGGGGATTTTCCCAGGC-3′) oligonucleotide (Promega) and a TFIID (TBP) (5′-GCAGAGCATATAAAATGAGGTAGGA-3′) oligonucleotide (Santa Cruz Biotechnology, Santa Cruz, CA) were labeled with [γ-32P]ATP (NEN Life Science Products). Binding reactions were performed as described previously (5Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1998; 18: 384-391Crossref PubMed Scopus (115) Google Scholar), and the protein-DNA complexes were separated on a 5% polyacrylamide gel. Whole cell lysates were prepared as described previously (25Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1999; 20: 751-758Crossref PubMed Scopus (284) Google Scholar, 34Monick M.M. Carter A.B. Gudmundsson G. Mallampalli R. Powers L.S. Hunninghake G.W. J. Immunol. 1999; 162: 3005-3012PubMed Google Scholar). The p38, JNK1, or Erk2 MAP kinases were immunoprecipitated from the lysates overnight at 4 °C with either a p38, JNK1, or Erk2 polyclonal rabbit antibodies (Santa Cruz Biotechnology), respectively, bound to Gammabind with Sepharose (Amersham Pharmacia Biotech). Kinase activity was assayed as described previously using ATF-2, c-Jun, or TFIID (TBP) (Santa Cruz Biotechnology) as a substrate (25Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1999; 20: 751-758Crossref PubMed Scopus (284) Google Scholar, 34Monick M.M. Carter A.B. Gudmundsson G. Mallampalli R. Powers L.S. Hunninghake G.W. J. Immunol. 1999; 162: 3005-3012PubMed Google Scholar). For Western blot analysis, SDS-polyacrylamide gels were transferred to polyvinylidene difluoride membranes (Amersham Pharmacia Biotech) in 25 mmTris, 192 mm glycine, and 20% methanol. IκB-β, p65, TFIID (TBP), Erk2, JNK1, and p38 MAP kinase rabbit polyclonal antibodies (Santa Cruz Biotechnology) were used at 1:1000 dilutions. The anti-Xpress monoclonal antibody (Invitrogen) recognizes the sequence Asp-Leu-Tyr-Asp-Asp-Asp-Asp-Lys from the leader peptide in the His-p65 and His-TBP fusion proteins and was used at a 1:5000 dilution. Immunoreactive proteins were developed using a chemiluminescent (Amersham Pharmacia Biotech) or chemifluorescent (JBL Scientific, San Luis Obispo, CA) substrate. The cells were labeled with 1.25 mCi of 32Pi/group (NEN Life Science Products) in phosphate-free RPMI medium with 10% fetal calf serum for 3 h at 37 °C. The cells were harvested and placed in RPMI 1640 medium with 10% fetal calf serum and stimulated with LPS for 1 h at 37 °C. The cells were harvested, resuspended in radioimmunoprecipitation assay lysis buffer (1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS, 0.15 m NaCl, 0.01m Na3PO4 (pH 7.2), 2 mmEDTA, 50 mm NaF, 0.2 mmNa3VO4, 1 μm okadaic acid, 100 μg/ml phenylmethylsulfonyl fluoride, 50 μg/ml aprotinin, 10 μg/ml leupeptin, 50 μg/ml pepstatin), and sonicated. The p65 subunit of NF-κB or TFIID (TBP) were immunoprecipitated with either the p65 or TFIID (TBP) rabbit polyclonal antibodies (Santa Cruz Biotechnology), respectively, bound to Gammabind with Sepharose (Amersham Pharmacia Biotech) for 2 h to overnight at 4 °C. The Sepharose pellet was washed twice with high salt radioimmunoprecipitation assay buffer (1m NaCl) and twice with radioimmunoprecipitation assay buffer. The samples were separated on a SDS-PAGE discontinuous gel. Before assessing the role of the p38 MAP kinase in regulating NF-κB-driven gene expression, we assured ourselves that SB 203580 was working appropriately in THP-1 cells. To demonstrate that SB 203580 was inhibiting p38 MAP kinase and not Erk- or JNK-mediated signaling, we performed kinase assays and Western blot analysis of the Erk2, JNK1, and p38 MAP kinases. We found that LPS significantly increased Erk2 kinase activity by measuring the phosphorylation of c-Jun, and SB 203580 had no detectable effect on this activity (Fig.1 A). Likewise, LPS increased JNK1 kinase activity, and SB 203580 had no appreciable effect on this activity, which was measured by detecting the phosphorylation of c-Jun (Fig. 1 B). In contrast, although LPS also significantly increased p38 kinase activity, as shown by the phosphorylation of ATF-2, SB 203580 reduced this activity to control levels (Fig.1 C). Western blot analysis for each of these kinase assays showed equal loading of proteins. These studies confirm that SB 203580 is effective and relatively specific for p38 MAP kinase-mediated signaling. To evaluate the role of the p38 MAP kinase in regulating LPS-induced NF-κB-dependent gene expression, we measured NF-κB-dependent promoter activity using luciferase reporter plasmids. We found that LPS significantly increased (greater than 10× control) luciferase activity, and inhibition of the p38 MAP kinase with SB 203580 reduced this activity to near control levels (Fig. 2 A). Due to previous studies that have suggested that the p38 MAP kinase inhibitors have a nonspecific effect (35Borsch-Haubold A.G. Pasquet S. Watson S.P. J. Biol. Chem. 1998; 273: 28766-28772Abstract Full Text Full Text PDF PubMed Scopus (255) Google Scholar), we performed similar studies using a dominant-negative p38 MAP kinase expression vector. In these studies, either a blank vector or the dominant-negative p38 MAP kinase expression vector was co-transfected with the luciferase reporter plasmid. The luciferase activity was reduced to near control levels in the cells that expressed the dominant-negative p38 MAP kinase compared with cells with the blank vector alone (Fig. 2 B). As an aggregate, these studies show that LPS-induced NF-κB-dependent gene expression requires an active p38 MAP kinase. To determine the role of the p38 MAP kinase in regulating NF-κB-dependent gene expression, we first asked if the p38 MAP kinase regulated NF-κB translocation. LPS caused a significant increase in NF-κB translocation and DNA binding in THP-1 cells, and inhibition of the p38 MAP kinase with SB 203580 had no significant effect on this activation (Fig. 3). To evaluate translocation in a different manner and confirm this finding, we measured IκB-β degradation in LPS-stimulated THP-1 cells since NF-κB-dependent gene expression requires activation of IKK-β (17O'Connell M.A. Bennett B.L. Mercurio F. Manning A.M. Mackman N. J. Biol. Chem. 1998; 273: 30410-30414Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). We found that IκB-β degradation was maximal at 60 min (data not shown), and inhibition of the p38 MAP kinase did not affect IκB-β degradation (Fig. 4). We next determined if the p38 MAP kinase altered phosphorylation of the p65 subunit of NF-κB. THP-1 cells were labeled with32Pi, and phosphorylation was measured. LPS induced phosphorylation of native p65, and SB 203580 had no significant effect on this phosphorylation (Fig. 5). Taken together, these findings show that the p38 MAP kinase does not directly regulate degradation of IκB, NF-κB translocation, NF-κB DNA binding, or phosphorylation of the p65 subunit.Figure 4IκB-β degradation. THP-1 cells were cultured for 1 h in the presence or absence of SB 203580 (SB). Cells were then stimulated with LPS for 1 h, which was determined to be the time point of maximal degradation. Samples from the whole cell lysates were separated on a SDS-PAGE gel and transferred to polyvinylidene difluoride membrane. IκB-β rabbit polyclonal antibody was used at a 1:1000 dilution, and immunoreactive proteins were detected by a chemiluminescent substrate. This figure is representative of three different experiments. k = 1000.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 5Phosphorylation of p65 subunit of NF-κB. Cells were labeled with32Pi in phosphate-free media for 3 h. Cells were stimulated with LPS for 1 h. Whole cell lysates were subjected to immunoprecipitation with a p65 rabbit polyclonal antibody, and samples were separated on a SDS-PAGE gel. This figure is representative of six different experiments. SB, SB 203580.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Since NF-κB-driven transcription also depends on activation of basal transcription factors, such as TFIIB and TFIID (TBP), we next evaluated if the p38 MAP kinase regulated this activity. We first determined whether the p38 MAP kinase regulated the direct interaction of the p65 subunit with the basal transcription factors using two reciprocal methods. First, we co-transfected the pcDNA-His-p65 plasmid with either the dominant-negative p38 MAP kinase expression vector or a blank vector. By immunoprecipitating whole cell lysates with anti-Xpress antibody and performing Western blot analysis for the TFIID (TBP), we found that LPS increased this interaction in cells co-transfected with the blank vector. Cells that expressed the dominant-negative p38 kinase had a greater than 50% reduction, as measured by densitometry, in the direct interaction of TFIID (TBP) and the His-p65 fusion protein (Fig.6, A and B). In the second method, we co-transfected the pcDNA-His-TBP with either the dominant-negative p38 MAP kinase expression vector or a blank vector. The His-TBP fusion protein was immunoprecipitated with anti-Xpress antibody. Western blot analysis for the p65 subunit showed that LPS increased the interaction of His-TBP with the native p65 in the cells expressing the blank vector compared with those expressing the dominant-negative p38 MAP kinase, which had a greater than 50% reduction in direct interaction (Fig. 6 C). These findings suggest that an active p38 MAP kinase is necessary for direct binding of these transcription factors. We next evaluated if inhibition of the p38 MAP kinase altered TBP binding to the TATA box. THP-1 cells stimulated with LPS had an increase in TBP DNA binding, and SB 203580 significantly reduced this binding to control levels (Fig. 7). If the p38 MAP kinase regulated TBP binding, it seemed logical that it would regulate binding by phosphorylation. Thus, we determined if the p38 MAP kinase phosphorylated TFIID (TBP) in vitro. We found that TFIID (TBP) was phosphorylated in vitro by LPS-stimulated p38 MAP kinase obtained from THP-1 cells (Fig.8 A). The activation kinetics of p38 MAP kinase was maximal at 15 min, but there was increased activity as early as 5 min and as late as 90 min after exposure to LPS (Fig. 8 B). The binding kinetics of TBP to the TATA box are similar to the activation kinetics of p38 MAP kinase. There was increased binding as early as 5 min, and there was a gradual increase in binding up to 90 min (Fig. 8 C). This suggests that the continuous activity of the p38 MAP kinase results in increased TBP phosphorylation and subsequent binding to the TATA box. To confirm that the phosphorylation of the TFIID (TBP) by the p38 MAP kinase is physiologically relevant, we performed in vivophosphorylation studies. THP-1 cells were labeled with32Pi, and phosphorylation was measured. LPS induced phosphorylation of native TFIID (TBP), and SB 203580 reduced this phosphorylation to control levels (Fig.9 A). Western blot analysis for TFIID (TBP) shows equal loading of each immunoprecipitated protein (Fig. 9 B). As an aggregate, these findings suggest that the phosphorylation of TFIID (TBP) by the p38 MAP kinase regulates the interaction of the TFIID (TBP) with the p65 subunit and the DNA binding to the TATA box.Figure 8TFIID ( TBP ) phosphorylation by the p38 MAP kinase. A, THP-1 cells were cultured in the presence or absence of LPS as indicated for 15 min. Whole cell lysates were subjected to immunoprecipitation with Gammabind alone, as negative control (first lane), or p38 MAP kinase rabbit polyclonal antibody (second and third lanes). In vitrokinase assays were performed using TFIID (TBP) as the substrate. Western blot analysis for p38 protein was performed to confirm equal loading of proteins. B, THP-1 cells were stimulated with LPS at the designated time points. Whole cell lysates were subjected to immunoprecipitation with p38 MAP kinase rabbit polyclonal antibody.In vitro kinase assays were performed using TFIID (TBP) as the substrate. C, THP-1 cells were stimulated with LPS at the designated time points, and nuclear protein was isolated. Binding reactions were performed with the consensus TFIID (TBP) oligonucleotide labeled with [γ-32P]ATP. These figures are representative of three different experiment.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 9Phosphorylation of TFIID ( TBP ). A, cells were labeled with 32Pi in phosphate-free media for 3 h. Cells were stimulated with LPS for 1 h. Whole cell lysates were subjected to immunoprecipitation with a TFIID (TBP) rabbit polyclonal antibody, and samples were separated on a SDS-PAGE gel. B, Western blot analysis for TFIID (TBP) was performed to confirm equal loading of the immunoprecipitated proteins. These figures are representative of three different experiments.SB, SB 203580.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In these studies, we found that LPS-induced NF-κB-dependent gene expression was significantly reduced by SB 203580, a competitive inhibitor of the p38 MAP kinase, and by a dominant-negative p38 MAP kinase expression vector. These observations showed that the p38 MAP kinase was necessary for NF-κB-dependent gene transcription. To determine the level at which this regulation occurred, we first evaluated NF-κB translocation and DNA binding and found that SB 203580 had no appreciable effect. To confirm these findings in a different manner, we measured IκB-β degradation and found that it was not reduced by p38 MAP kinase inhibition. We next evaluated if the p38 MAP kinase regulated phosphorylation of the p65 subunit of NF-κB by performingin vivo phosphorylation studies. We found that SB 203580 did not regulate phosphorylation of native p65. Due to the interaction of the p65 subunit with basal transcription factors, such as TFIID (TBP), we determined what role the p38 MAP kinase had in regulating its activation. The dominant-negative p38 MAP kinase expression vector altered the interaction of TFIID (TBP) with a co-transfected His-p65 fusion protein. Likewise, the dominant-negative p38 kinase also regulated the interaction of native p65 with a co-transfected His-TBP fusion protein. In addition, we found that inhibition of the p38 MAP kinase reduced TFIID (TBP) binding to the TATA box and that the p38 kinase phosphorylated this basal transcription factor in vitro. We confirmed that these observations were physiologically relevant by showing that inhibition of the p38 MAP kinase decreased the LPS-induced phosphorylation of TFIID (TBP) in vivo. The regulation of NF-κB-dependent gene expression can occur at multiple levels after cell stimulation. Early regulation occurs in the cytoplasm with the activation of IKK and subsequent IκB phosphorylation, ubiquitination, and proteolysis (9Finco T.S. Baldwin A.S. Immunity. 1995; 3: 263-272Abstract Full Text PDF PubMed Scopus (385) Google Scholar, 10Matthews J.R. Hay R.T. Int. J. Biochem. Cell Biol. 1995; 27: 865-879Crossref PubMed Scopus (72) Google Scholar, 11Yin M.J. Yamamoto Y. Gaynor R.B. Nature. 1998; 396: 77-80Crossref PubMed Scopus (1453) Google Scholar, 12Brockman J.A. Scherer D.C. McKinsey T.A. Hall S.M. Qi X. Lee W.Y. Ballard D.W. Mol. Cell. Biol. 1995; 15: 2809-2818Crossref PubMed Google Scholar, 14DiDonato J. Mercurio F. Rosette C. Wu-Li J. Suyang H. Ghosh S. Karin M. Mol. Cell. Biol. 1996; 16: 1295-1304Crossref PubMed Google Scholar, 15Whiteside S.T. Ernst M.K. LeBail O. Laurent-Winter C. Rice N. Israel A. Mol. Cell. Biol. 1995; 15: 5339-5345Crossref PubMed Google Scholar, 16Traenckner E.B. Pahl H.L. Henkel T. Schmidt K.N. Wilk S. Baeuerle P.A. EMBO J. 1995; 14: 2876-2883Crossref PubMed Scopus (938) Google Scholar, 17O'Connell M.A. Bennett B.L. Mercurio F. Manning A.M. Mackman N. J. Biol. Chem. 1998; 273: 30410-30414Abstract Full Text Full Text PDF PubMed Scopus (164) Google Scholar). Several studies have shown that MEKK1, an upstream activator of the p38 MAP kinase, regulates NF-κB translocation and, thus, NF-κB-dependent transcription (32Read M.A. Whitley M.Z. Gupta S. Pierce J.W. Best J. Davis R.J. Collins T. J. Biol. Chem. 1997; 272: 2753-2761Abstract Full Text Full Text PDF PubMed Scopus (339) Google Scholar, 33Nemoto S. DiDonato J.A. Lin A. Mol. Cell. Biol. 1998; 18: 7336-7343Crossref PubMed Google Scholar). It appears from these studies that MEKK1 regulates NF-κB-dependent transcription by activating IKK. In fact, MEKK1 directly interacts with both IKK-α and IKK-β and phosphorylates them (33Nemoto S. DiDonato J.A. Lin A. Mol. Cell. Biol. 1998; 18: 7336-7343Crossref PubMed Google Scholar). Our studies reveal that the regulatory role of the p38 MAP kinase is downstream of IKK. Like other transcription factors, NF-κB activation is also controlled by phosphorylation of it subunits (18Naumann M. Scheidereit C. EMBO J. 1994; 13: 4597-4607Crossref PubMed Scopus (329) Google Scholar, 36Schmitz M.L. dos Santos Silva M.A. Baeuerle P.A. J. Biol. Chem. 1995; 270: 15576-15584Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). The DNA binding of the p65 subunit is augmented after undergoing phosphorylation in the nucleus (18Naumann M. Scheidereit C. EMBO J. 1994; 13: 4597-4607Crossref PubMed Scopus (329) Google Scholar). The transcriptional activity of p65 is also dependent on phosphorylation in one or both of its COOH-terminal transactivation domains (36Schmitz M.L. dos Santos Silva M.A. Baeuerle P.A. J. Biol. Chem. 1995; 270: 15576-15584Abstract Full Text Full Text PDF PubMed Scopus (144) Google Scholar). Our data shows that LPS induces the phosphorylation of the p65 subunit; however, the p38 MAP kinase is not directly involved in this phosphorylation. These findings are similar to those of Beyaertet al. (31Beyaert R. Cuenda A. Vanden Berghe W. Plaisance S. Lee J.C. Haegeman G. Cohen P. Fiers W. EMBO J. 1996; 15: 1914-1923Crossref PubMed Scopus (609) Google Scholar), who found that the p38 MAP kinase pathway regulated tumor necrosis factor-induced interleukin 6 synthesis (31Beyaert R. Cuenda A. Vanden Berghe W. Plaisance S. Lee J.C. Haegeman G. Cohen P. Fiers W. EMBO J. 1996; 15: 1914-1923Crossref PubMed Scopus (609) Google Scholar). In this study, the p38 MAP kinase also regulated NF-κB activity but not NF-κB phosphorylation. The means by which the p38 MAP kinase regulates NF-κB activity was not determined in this study. The mechanism(s) by which the p38 MAP kinase regulates NF-κB-dependent gene expression has not previously been shown. Subunits of NF-κB are known to interact with other transcription factors, such as ATF-2, TFIIB, and TBP (19Kerr L.D. Ransone L.J. Wamsley P. Schmitt M.J. Boyer T.G. Zhou Q. Berk A.J. Verma I.M. Nature. 1993; 365: 412-419Crossref PubMed Scopus (137) Google Scholar, 20Xu X. Prorock C. Ishikawa H. Maldonado E. Ito Y. Gelinas C. Mol. Cell. Biol. 1993; 13: 6733-6741Crossref PubMed Scopus (98) Google Scholar, 21Blair W.S. Bogerd H.P. Madore S.J. Cullen B.R. Mol. Cell. Biol. 1994; 14: 7226-7234Crossref PubMed Scopus (104) Google Scholar, 22Schmitz M.L. Stelzer G. Altmann H. Meisterernst M. Baeuerle P.A. J. Biol. Chem. 1995; 270: 7219-7226Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar, 37Stein B. Baldwin Jr., A.S. Ballard D.W. Greene W.C. Angel P. Herrlich P. EMBO J. 1993; 12: 3879-3891Crossref PubMed Scopus (573) Google Scholar, 38Kaszubska W. Hooft van Huijsduijnen R. Ghersa P. DeRaemy-Schenk A.M. Chen B.P. Hai T. DeLamarter J.F. Whelan J. Mol. Cell. Biol. 1993; 13: 7180-7190Crossref PubMed Google Scholar, 39Du W. Thanos D. Maniatis T. Cell. 1993; 74: 887-898Abstract Full Text PDF PubMed Scopus (410) Google Scholar). It is unlikely that ATF-2 is necessary in our system, because our reporter plasmid is driven by NF-κB alone. The interaction of NF-κB with the basal transcription factors, such as TFIIB and TBP, is a much more likely scenario. The p65 subunit interacts directly with these basal transcription factors in a manner that activates gene expression in COS7 cells (22Schmitz M.L. Stelzer G. Altmann H. Meisterernst M. Baeuerle P.A. J. Biol. Chem. 1995; 270: 7219-7226Abstract Full Text Full Text PDF PubMed Scopus (139) Google Scholar). TBP is an essential component of transcription initiation in class I, II, and III promoters (40Timmers H.T. Meyers R.E. Sharp P.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 8140-8144Crossref PubMed Scopus (58) Google Scholar, 41Brou C. Chaudhary S. Davidson I. Lutz Y. Wu J. Egly J.M. Tora L. Chambon P. EMBO J. 1993; 12: 489-499Crossref PubMed Scopus (155) Google Scholar, 42Lescure A. Lutz Y. Eberhard D. Jacq X. Krol A. Grummt I. Davidson I. Chambon P. Tora L. EMBO J. 1994; 13: 1166-1175Crossref PubMed Scopus (97) Google Scholar, 43Martinez E. Chiang C.M. Ge H. Roeder R.G. EMBO J. 1994; 13: 3115-3126Crossref PubMed Scopus (162) Google Scholar), and it is one of the subunits of TFIID (40Timmers H.T. Meyers R.E. Sharp P.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 8140-8144Crossref PubMed Scopus (58) Google Scholar). One study has shown that phosphorylation of both TBP and TFIIB in the amino-terminal regions could regulate the transcription of class II promoters (44Chibazakura T. Watanabe F. Kitajima S. Tsukada K. Yasukochi Y. Teraoka H. Eur. J. Biochem. 1997; 247: 1166-1173Crossref PubMed Scopus (41) Google Scholar). Our data corroborates that phosphorylation of TFIID (TBP) regulates transcription of class II promoters. The novel finding, however, is that the p38 MAP kinase regulates the activation of TFIID (TBP). In fact, we found that inhibition of phosphorylation reduced its binding to the TATA box and its interaction with the p65 subunit of NF-κB. This, in turn, is a plausible mechanism for the regulation of NF-κB-dependent gene expression by the p38 MAP kinase. A phosphorylation substrate for the p38 MAP kinase must have the minimal consensus sequence Ser/Thr-Pro (45Alvarez E. Northwood I.C. Gonzalez F.A. Latour D.A. Seth A. Abate C. Curran T. Davis R.J. J. Biol. Chem. 1991; 266: 15277-15285Abstract Full Text PDF PubMed Google Scholar). One study has shown that another serine/threonine kinase, DNA-dependent protein kinase, phosphorylates TBP in the amino-terminal region (44Chibazakura T. Watanabe F. Kitajima S. Tsukada K. Yasukochi Y. Teraoka H. Eur. J. Biochem. 1997; 247: 1166-1173Crossref PubMed Scopus (41) Google Scholar), so there are several Ser/Thr-Pro motifs present in the first 160 amino acids. Although DNA-dependent protein kinase has a slightly different consensus sequence requirement, both proline-directed and minimal consensus sequences, which are necessary for MAP kinase specificity, are present in the amino-terminal region of TBP. Our data clearly shows that the p38 MAP kinase phosphorylates TFIID (TBP), and this phosphorylation is necessary for TBP binding to the TATA box. Therefore, the p38 MAP kinase regulates NF-κB-dependent transcription in part by modulating activation of basal transcription factors. We thank the University of Iowa DNA Facility for sequencing the plasmids used in this study and R. Similien for outstanding technical assistance.

Epidemiological studies suggest that low vitamin D levels may increase the risk or severity of respiratory viral infections. In this study, we examined the effect of vitamin D on respiratory syncytial virus (RSV)-infected human airway epithelial cells. Airway epithelium converts 25-hydroxyvitamin D3 (storage form) to 1,25-dihydroxyvitamin D3 (active form). Active vitamin D, generated locally in tissues, is important for the nonskeletal actions of vitamin D, including its effects on immune responses. We found that vitamin D induces IkappaBalpha, an NF-kappaB inhibitor, in airway epithelium and decreases RSV induction of NF-kappaB-driven genes such as IFN-beta and CXCL10. We also found that exposing airway epithelial cells to vitamin D reduced induction of IFN-stimulated proteins with important antiviral activity (e.g., myxovirus resistance A and IFN-stimulated protein of 15 kDa). In contrast to RSV-induced gene expression, vitamin D had no effect on IFN signaling, and isolated IFN induced gene expression. Inhibiting NF-kappaB with an adenovirus vector that expressed a nondegradable form of IkappaBalpha mimicked the effects of vitamin D. When the vitamin D receptor was silenced with small interfering RNA, the vitamin D effects were abolished. Most importantly we found that, despite inducing IkappaBalpha and dampening chemokines and IFN-beta, there was no increase in viral mRNA or protein or in viral replication. We conclude that vitamin D decreases the inflammatory response to viral infections in airway epithelium without jeopardizing viral clearance. This suggests that adequate vitamin D levels would contribute to reduced inflammation and less severe disease in RSV-infected individuals.

Smoking is associated with a wide variety of adverse health outcomes including cancer, chronic obstructive pulmonary disease, diabetes, depression, and heart disease. Unfortunately, the molecular mechanisms through which these effects are conveyed are not clearly understood. To examine the potential role of epigenetic factors in these processes, we examined the relationship of smoking to genome wide methylation and gene expression using biomaterial from two independent samples, lymphoblast DNA and RNA (n = 119) and lung alveolar macrophage DNA (n = 19). We found that in both samples current smoking status was associated with significant changes in DNA methylation, in particular at the aryl hydrocarbon receptor repressor (AHRR), a known tumor suppressor. Both baseline DNA methylation and smoker associated DNA methylation signatures at AHRR were highly correlated (r = 0.94 and 0.45, respectively). DNA methylation at the most differentially methylated AHRR CpG residue in both samples, cg0557592, was significantly associated with AHRR gene expression. Pathway analysis of lymphoblast data (genes with most significant methylation changes) demonstrated enrichment in protein kinase C pathways and in TGF beta signaling pathways. For alveolar macrophages, pathway analysis demonstrated alterations in inflammation-related processes. We conclude that smoking is associated with functionally significant genome wide changes in DNA methylation in both lymphoblasts and pulmonary macrophages and that further integrated investigations of these epigenetic effects of smoking on carcinogenesis and other related co-morbidities are indicated.

Abstract Background Regular smoking is associated with a wide variety of syndromes with prominent inflammatory components such as cancer, obesity and type 2 diabetes. Heavy regular smoking is also associated with changes in the DNA methylation of peripheral mononuclear cells. However, in younger smokers, inflammatory epigenetic findings are largely absent which suggests the inflammatory response(s) to smoking may be dose dependent. To help understand whether peripheral mononuclear cells have a role in mediating these responses in older smokers with higher cumulative smoke exposure, we examined genome-wide DNA methylation in a group of well characterized adult African American subjects informative for smoking, as well as serum C-reactive protein (CRP) and interleukin-6 receptor (IL6R) levels. In addition, complementary bioinformatic analyses were conducted to delineate possible pathways affected by long-term smoking. Results Genome-wide DNA methylation analysis with respect to smoking status yielded 910 significant loci after Benjamini-Hochberg correction. In particular, two loci from the AHRR gene (cg05575921 and cg23576855) and one locus from the GPR15 gene (cg19859270) were identified as highly significantly differentially methylated between smokers and non-smokers. The bioinformatic analyses showed that long-term chronic smoking is associated with altered promoter DNA methylation of genes coding for proteins mapping to critical sub-networks moderating inflammation, immune function, and coagulation. Conclusions We conclude that chronic regular smoking is associated with changes in peripheral mononuclear cell methylation signature which perturb inflammatory and immune function pathways and may contribute to increased vulnerability for complex illnesses with inflammatory components.

Section:ChooseTop of pageAbstract <<Materials and MethodsResultsDiscussionReferencesCITING ARTICLES

Airway epithelial cells are unresponsive to endotoxin (lipopolysaccharide (LPS)) exposure under normal conditions. This study demonstrates that respiratory syncytial virus (RSV) infection results in increased sensitivity to this environmental exposure. Infection with RSV results in increased expression of Toll-like receptor (TLR) 4 mRNA, protein, and increased TLR4 membrane localization. This permits significantly enhanced LPS binding to the epithelial monolayer that is blocked by disruption of the Golgi. The increased TLR4 results in an LPS-induced inflammatory response as demonstrated by increased mitogen-activated protein (MAP) kinase activity, IL-8 production, and tumor necrosis factor α production. RSV infection also allowed for tumor necrosis factor α production subsequent to TLR4 cross-linking with an immobilized antibody. These data suggest that RSV infection sensitizes airway epithelium to a subsequent environmental exposure (LPS) by altered expression and membrane localization of TLR4. The increased interaction between airway epithelial cells and LPS has the potential to profoundly alter airway inflammation.

Chronic obstructive pulmonary disease (COPD) is the fourth leading cause of death in the United States, and cigarette smoking is the major risk factor for COPD.Fibroblasts play an important role in repair and lung homeostasis.Recent studies have demonstrated a reduced growth rate for lung fibroblasts in patients with COPD.In this study we examined the effect of cigarette smoke extract (CSE) on fibroblast proliferative capacity.We found that cigarette smoke stopped proliferation of lung fibroblasts and upregulated two pathways linked to cell senescence (a biological process associated with cell longevity and an inability to replicate), p53 and p16-retinoblastoma protein pathways.We compared a single exposure of CSE to multiple exposures over an extended time course.A single exposure to CSE led to cell growth inhibition at multiple phases of the cell cycle without killing the cells.The decrease in proliferation was accompanied by increased ATM, p53, and p21 activity.However, several important senescent markers were not present in the cells at an earlier time point.When we examined multiple exposures to CSE, we found that the cells had profound growth arrest, a flat and enlarged morphology, upregulated p16, and senescenceassociated ␤-galactosidase activity, which is consistent with a classic senescent phenotype.These observations suggest that while a single exposure to cigarette smoke inhibits normal fibroblast proliferation (required for lung repair), multiple exposures to cigarette smoke move cells into an irreversible state of senescence.This inability to repair lung injury may be an essential feature of emphysema.

Abstract Respiratory syncytial virus (RSV) preferentially infects airway epithelial cells, causing bronchiolitis, upper respiratory infections, asthma exacerbations, chronic obstructive pulmonary disease exacerbations, and pneumonia in immunocompromised hosts. A replication intermediate of RSV is dsRNA. This is an important ligand for both the innate immune receptor, TLR3, and protein kinase R (PKR). One known effect of RSV infection is the increased responsiveness of airway epithelial cells to subsequent bacterial ligands (i.e., LPS). In this study, we examined a possible role for RSV infection in increasing amounts and responsiveness of another TLR, TLR3. These studies demonstrate that RSV infection of A549 and human tracheobronchial epithelial cells increases the amounts of TLR3 and PKR in a time-dependent manner. This leads to increased NF-κB activity and production of the inflammatory cytokine IL-8 following a later exposure to dsRNA. Importantly, TLR3 was not detected on the cell surface at baseline but was detected on the cell surface after RSV infection. The data demonstrate that RSV, via an effect on TLR3 and PKR, sensitizes airway epithelial cells to subsequent dsRNA exposure. These findings are consistent with the hypothesis that RSV infection sensitizes the airway epithelium to subsequent viral and bacterial exposures by up-regulating TLRs and increasing their membrane localization.

Alveolar macrophages are essential for clearing bacteria from the alveolar surface and preventing microbe-induced infections. It is well documented that smokers have an increased incidence of infections, in particular lung infections. Alveolar macrophages accumulate in smokers' lungs, but they have a functional immune deficit. In this study, we identify an autophagy defect in smokers' alveolar macrophages. Smokers' alveolar macrophages accumulate both autophagosomes and p62, a marker of autophagic flux. The decrease in the process of autophagy leads to impaired protein aggregate clearance, dysfunctional mitochondria, and defective delivery of bacteria to lysosomes. This study identifies the autophagy pathway as a potential target for interventions designed to decrease infection rates in smokers and possibly in individuals with high environmental particulate exposure.

Abstract Exposure of human alveolar macrophages to bacterial LPS results in activation of a number of signal transduction pathways. An early event after the alveolar macrophage comes in contact with LPS is activation of the phosphatidylinositol 3 kinase (PI 3-kinase). This study evaluates the downstream effects of that activation. We observed that LPS exposure results in phosphorylation of Akt (serine 473). We found this using both phosphorylation-specific Abs and also by in vivo phosphorylation with 32P-loaded cells. AKT activation resulted in the phosphorylation-dependent inactivation of glycogen synthase kinase (GSK-3) (serine 21/9). We found that both of these events were linked to PI 3-kinase because the PI 3-kinase inhibitors, wortmannin and LY294002, inhibited LPS-induced phosphorylation of both AKT and GSK-3. Inactivation of GSK-3 has been shown to reduce the ubiquitination of β-catenin, resulting in nuclear accumulation and transcriptional activity of β-catenin. Consistent with this, we found that LPS caused an increase in the amounts of PI 3-kinase-dependent nuclear β-catenin in human alveolar macrophages and expression of genes that require nuclear β-catenin for their activation. This is the first demonstration that LPS exposure activates AKT, inactivates GSK-3, and causes accumulation and transcriptional activity of β-catenin in the nucleus of any cell, including alveolar macrophages.

Inhalation of nanoparticles has been implicated in respiratory morbidity and mortality. In particular, carbon black nanoparticles are found in many different environmental exposures. Macrophages take up inhaled nanoparticles and respond via release of inflammatory mediators and in some cases cell death. Based on new data, we propose that exposure of macrophages (both a macrophage cell line and primary human alveolar macrophages) to carbon black nanoparticles induces pyroptosis, an inflammasome-dependent form of cell death. Exposure of macrophages to carbon black nanoparticles resulted in inflammasome activation as defined by cleavage of caspase 1 to its active form and downstream IL-1β release. The cell death that occurred with carbon black nanoparticle exposure was identified as pyroptosis by the protective effect of a caspase 1 inhibitor and a pyroptosis inhibitor. These data demonstrate that carbon black nanoparticle exposure activates caspase 1, increases IL-1β release after LPS priming, and induces the proinflammatory cell death, pyroptosis. The identification of pyroptosis as a cellular response to carbon nanoparticle exposure is novel and relates to environmental and health impacts of carbon-based particulates.

Prior studies have demonstrated that a small proportion of blood lymphocytes from patients with human cytomegalovirus (HCMV) infection express only the viral immediate-early (IE) genes (L. Einhorn and A. Ost, J. Infect. Dis. 149:207-214, 1984; G. P. A. Rice, R. D. Schrier, and M. B. A. Oldstone, Proc. Natl. Acad. Sci. USA 81:6134-6138, 1984). The present studies demonstrate that the IE genes of HCMV are transcribed in Jurkat cells (T lymphocytes) only after activation of the cells with mitogens. Transcription of the IE genes is from an upstream enhancer promoter-regulatory region containing several different repeated sequence motifs. Chimeric plasmids were constructed with just a single copy or three copies of a synthetic oligonucleotide sequence of either the 16-, 18-, 19-, or 21-base-pair (bp) repeat elements upstream of the minimal wild-type promoter sequence to drive expression of the indicator gene, chloramphenicol acetyltransferase (CAT). The 18- or 19-bp motifs in the enhancer region were found to be important in mediating the effect of the mitogens. However, the CAT activity detected with the 19-bp repeat was always significantly higher than that found with the 18-bp repeat. There was an additive effect by multiple copies of the 18- or 19-bp repeat sequences on gene expression. The 19-bp repeat contains a sequence identical to that described for a cyclic AMP (cAMP) response element, and plasmids containing only this sequence and the minimal promoter sequences upstream of the CAT gene respond to agents which increase intracellular cAMP. Functional cAMP response elements are present in the wild-type promoter-regulatory region and are associated with the 19-bp repeat sequences. It is proposed that activation of lymphocytes results in expression of the IE genes of HCMV, in part via the activation of cellular trans-acting factors which interact with the 18- and 19-bp motifs in the HCMV IE promoter-regulatory region. The 19-bp repeat is the major contributor to the strength of this enhancer-containing promoter-regulatory region.

An increase in the number of mononuclear phagocytes in lung biopsies from patients with idiopathic pulmonary fibrosis (IPF) worsens prognosis. Chemokines that recruit mononuclear phagocytes, such as CC chemokine ligand 2 (CCL2), are elevated in bronchoalveolar lavage (BAL) fluid (BALF) from patients with IPF. However, little attention is given to the role of the mononuclear phagocyte survival and recruitment factor, macrophage colony-stimulating factor (M-CSF), in pulmonary fibrosis.To investigate the role of mononuclear phagocytes and M-CSF in pulmonary fibrosis.Wild-type, M-CSF-/-, or CCL2-/- mice received intraperitoneal bleomycin. Lung inflammation and fibrosis were measured by immunohistochemistry, ELISA, collagen assay, BAL differentials, real-time polymerase chain reaction, and Western blot analysis. Human and mouse macrophages were stimulated with M-CSF for CCL2 expression. BALF from patients with IPF was examined for M-CSF and CCL2.M-CSF-/- and CCL2-/- mice had less lung fibrosis, mononuclear phagocyte recruitment, collagen deposition, and connective tissue growth factor (CTGF) expression after bleomycin administration than wild-type littermates. Human and mouse macrophages stimulated with M-CSF had increased CCL2 production, and intratracheal administration of M-CSF in mice induced CCL2 production in BALF. Finally, BALF from patients with IPF contained significantly more M-CSF and CCL2 than BALF from normal volunteers. Elevated levels of M-CSF were associated with elevated CCL2 in BALF and the diagnosis of IPF.These data suggest that M-CSF contributes to the pathogenesis of pulmonary fibrosis in mice and in patients with IPF through the involvement of mononuclear phagocytes and CCL2 production.

Our understanding of vitamin D metabolism and biological effects has grown exponentially in recent years and it has become clear that vitamin D has extensive immunomodulatory effects. The active vitamin D generating enzyme, 1α-hydroxylase, is expressed by the airway epithelium, alveolar macrophages, dendritic cells, and lymphocytes indicating that active vitamin D can be produced locally within the lungs. Vitamin D generated in tissues is responsible for many of the immunomodulatory actions of vitamin D. The effects of vitamin D within the lungs include increased secretion of the antimicrobial peptide cathelicidin, decreased chemokine production, inhibition of dendritic cell activation, and alteration of T-cell activation. These cellular effects are important for host responses against infection and the development of allergic lung diseases like asthma. Epidemiological studies do suggest that vitamin D deficiency predisposes to viral respiratory tract infections and mycobacterial infections and that vitamin D may play a role in the development and treatment of asthma. Randomized, placebo-controlled trials are lacking but ongoing.

Known therapies for influenza A virus infection are complicated by the frequent emergence of resistance. A therapeutic strategy that may escape viral resistance is targeting host cellular mechanisms involved in viral replication and pathogenesis. The endoplasmic reticulum (ER) stress response, also known as the unfolded protein response (UPR), is a primitive, evolutionary conserved molecular signaling cascade that has been implicated in multiple biological phenomena including innate immunity and the pathogenesis of certain viral infections. We investigated the effect of influenza A viral infection on ER stress pathways in lung epithelial cells. Influenza A virus induced ER stress in a pathway-specific manner. We showed that the virus activates the IRE1 pathway with little or no concomitant activation of the PERK and the ATF6 pathways. When we examined the effects of modulating the ER stress response on the virus, we found that the molecular chaperone tauroursodeoxycholic acid (TUDCA) significantly inhibits influenza A viral replication. In addition, a specific inhibitor of the IRE1 pathway also blocked viral replication. Our findings constitute the first evidence that ER stress plays a role in the pathogenesis of influenza A viral infection. Decreasing viral replication by modulating the host ER stress response is a novel strategy that has important therapeutic implications.

Human alveolar macrophages are critical components of the innate immune system. Cigarette smoking-induced changes in alveolar macrophage gene expression are linked to reduced resistance to pulmonary infections and to the development of emphysema/COPD. We hypothesized that microRNAs (miRNAs) could control, in part, the unique messenger RNA (mRNA) expression profiles found in alveolar macrophages of cigarette smokers. Activation of macrophages with different stimuli in vitro leads to a diverse range of M1 (inflammatory) and M2 (anti-inflammatory) polarized phenotypes that are thought to mimic activated macrophages in distinct tissue environments. Microarray mRNA data indicated that smoking promoted an "inverse" M1 mRNA expression program, defined by decreased expression of M1-induced transcripts and increased expression of M1-repressed transcripts with few changes in M2-regulated transcripts. RT-PCR arrays identified altered expression of many miRNAs in alveolar macrophages of smokers and a decrease in global miRNA abundance. Stratification of human subjects suggested that the magnitude of the global decrease in miRNA abundance was associated with smoking history. We found that many of the miRNAs with reduced expression in alveolar macrophages of smokers were predicted to target mRNAs upregulated in alveolar macrophages of smokers. For example, miR-452 is predicted to target the transcript encoding MMP12, an important effector of smoking-related diseases. Experimental antagonism of miR-452 in differentiated monocytic cells resulted in increased expression of MMP12. The comprehensive mRNA and miRNA expression profiles described here provide insight into gene expression regulation that may underlie the adverse effects cigarette smoking has on alveolar macrophages.

Macrophages, including alveolar macrophages, are primary phagocytic cells of the innate immune system. Many studies of macrophages and inflammation have been done in mouse models, in which inducible NO synthase (NOS2) and NO are important components of the inflammatory response. Human macrophages, in contrast to mouse macrophages, express little detectable NOS2 and generate little NO in response to potent inflammatory stimuli. The human NOS2 gene is highly methylated around the NOS2 transcription start site. In contrast, mouse macrophages contain unmethylated cytosine-phosphate-guanine (CpG) dinucleotides proximal to the NOS2 transcription start site. Further analysis of chromatin accessibility and histone modifications demonstrated a closed conformation at the human NOS2 locus and an open conformation at the murine NOS2 locus. In examining the potential for CpG demethylation at the NOS2 locus, we found that the human NOS2 gene was resistant to the effects of demethylation agents both in vitro and in vivo. Our data demonstrate that epigenetic modifications in human macrophages are associated with CpG methylation, chromatin compaction, and histone modifications that effectively silence the NOS2 gene. Taken together, our findings suggest there are significant and underappreciated differences in how murine and human macrophages respond to inflammatory stimuli.

Respiratory syncytial virus (RSV) infects airway epithelial cells, resulting in cell death and severe inflammation through the induction of NF-κB activity and inflammatory cytokine synthesis. Both NF-κB activity and apoptosis regulation have been linked to phosphatidylinositol 3-kinase (PI 3-K) and its downstream effector enzymes, AKT and GSK-3. This study evaluates the role of PI 3-K and its downstream mediators in apoptosis and inflammatory gene induction during RSV infection of airway epithelial cells. Whereas RSV infection alone did not produce significant cytotoxicity until 24–48 h following infection, simultaneous RSV infection and exposure to LY294002, a blocker of PI 3-K activity, resulted in cytotoxicity within 12 h. Furthermore, we found that RSV infection during PI 3-K blockade resulted in apoptosis by examining DNA fragmentation, DNA labeling by terminal dUTP nick-end labeling assay, and poly(ADP-ribose) polymerase cleavage by Western blotting. RSV infection produced an increase in the phosphorylation state of AKT, GSK-3, and the p85 regulatory subunit of PI 3-K. The activation of PI 3-K by RSV and its inhibition by LY294002 was confirmed in direct PI 3-K activity assays. Further evidence for the central role of a pathway involving PI 3-K and AKT in preserving cell viability during RSV infection was established by the observation that constitutively active AKT transfected into A549 cells prevented the cytotoxicity and apoptosis of combined RSV and LY294002 treatment. Finally, both PI 3-K inhibition by LY294002 and AKT inhibition by transfection of a dominant negative enzyme blocked RSV-induced NF-κB transcriptional activity. These data demonstrate that anti-apoptotic signaling and NF-κB activation by RSV are mediated through activation of PI 3-K-dependent pathways. Blockade of PI 3-K activation resulted in rapid, premature apoptosis and inhibition of RSV-stimulated NF-κB-dependent gene transcription. Respiratory syncytial virus (RSV) infects airway epithelial cells, resulting in cell death and severe inflammation through the induction of NF-κB activity and inflammatory cytokine synthesis. Both NF-κB activity and apoptosis regulation have been linked to phosphatidylinositol 3-kinase (PI 3-K) and its downstream effector enzymes, AKT and GSK-3. This study evaluates the role of PI 3-K and its downstream mediators in apoptosis and inflammatory gene induction during RSV infection of airway epithelial cells. Whereas RSV infection alone did not produce significant cytotoxicity until 24–48 h following infection, simultaneous RSV infection and exposure to LY294002, a blocker of PI 3-K activity, resulted in cytotoxicity within 12 h. Furthermore, we found that RSV infection during PI 3-K blockade resulted in apoptosis by examining DNA fragmentation, DNA labeling by terminal dUTP nick-end labeling assay, and poly(ADP-ribose) polymerase cleavage by Western blotting. RSV infection produced an increase in the phosphorylation state of AKT, GSK-3, and the p85 regulatory subunit of PI 3-K. The activation of PI 3-K by RSV and its inhibition by LY294002 was confirmed in direct PI 3-K activity assays. Further evidence for the central role of a pathway involving PI 3-K and AKT in preserving cell viability during RSV infection was established by the observation that constitutively active AKT transfected into A549 cells prevented the cytotoxicity and apoptosis of combined RSV and LY294002 treatment. Finally, both PI 3-K inhibition by LY294002 and AKT inhibition by transfection of a dominant negative enzyme blocked RSV-induced NF-κB transcriptional activity. These data demonstrate that anti-apoptotic signaling and NF-κB activation by RSV are mediated through activation of PI 3-K-dependent pathways. Blockade of PI 3-K activation resulted in rapid, premature apoptosis and inhibition of RSV-stimulated NF-κB-dependent gene transcription. respiratory syncytial virus phosphatidylinositol 3-kinase terminal deoxynucleotidyltransferase dUTP nick-end labeling poly(ADP-ribose) polymerase interleukin regulated on activation normal T cell expressed and secreted tumor necrosis factor Eagle's minimum essential medium lactate dehydrogenase electrophoretic mobility shift assay 1-chloro-3-tosylamido-7amino-2-heptanone fluorescein isothiocyanate mammalian targets of rapamycin interferon regulatory factor 1 IL-1β-converting enzyme phosphatidylinositol phosphate-buffered saline Respiratory syncytial virus (RSV),1 a negative-stranded RNA virus of the Paramyxoviridae family, is among the most important respiratory pathogens in children (1Shay D.K. Holman R.C. Newman R.D. Liu L.L. Stout J.W. Anderson L.J. J. Am. Med. Assoc. 1999; 282: 1440-1446Crossref PubMed Scopus (1147) Google Scholar). Worldwide, RSV is the most common etiology of bronchiolitis-associated hospitalizations in children less than 2 years old (1Shay D.K. Holman R.C. Newman R.D. Liu L.L. Stout J.W. Anderson L.J. J. Am. Med. Assoc. 1999; 282: 1440-1446Crossref PubMed Scopus (1147) Google Scholar, 2Parrott R.H. Kim H.W. Arrobio J.O. Hodes D.S. Murphy B.R. Brandt C.D. Camargo E. Chanock R.M. Am. J. Epidemiol. 1973; 98: 289-300Crossref PubMed Scopus (358) Google Scholar, 3Brandt C.D. Kim H.W. Arrobio J.O. Jeffries B.C. Wood S.C. Chanock R.M. Parrott R.H. Am. J. Epidemiol. 1973; 98: 355-364Crossref PubMed Scopus (132) Google Scholar). RSV is also a significant cause of excess morbidity and mortality in adult patient groups including those with compromised immune status, chronic inflammatory lung disease, and the elderly (4Dowell S.F. Anderson L.J. Gary Jr., H.E. Erdman D.D. Plouffe J.F. File Jr., T.M. Marston B.J. Breiman R.F. J. Infect. Dis. 1996; 174: 456-462Crossref PubMed Scopus (353) Google Scholar, 5Falsey A.R. Cunningham C.K. Barker W.H. Kouides R.W. Yuen J.B. Menegus M. Weiner L.B. Bonville C.A. Betts R.F. J. Infect. Dis. 1995; 172: 389-394Crossref PubMed Scopus (323) Google Scholar, 6Glezen W.P. Greenberg S.B. Atmar R.L. Piedra P.A. Couch R.B. J. Am. Med. Assoc. 2000; 283: 499-505Crossref PubMed Scopus (471) Google Scholar). Furthermore, RSV causes long term morbidity and mortality by increasing risk for recurrent wheezing and asthma symptoms throughout childhood (7Folkerts G. Busse W.W. Nijkamp F.P. Sorkness R. Gern J.E. Am. J. Respir. Crit. Care Med. 1998; 157: 1708-1720Crossref PubMed Scopus (231) Google Scholar, 8Hogg J.C. Am. J. Respir. Crit. Care Med. 1999; 160: 26-28Crossref PubMed Scopus (80) Google Scholar, 9Pullan C.R. Hey E.N. Br. Med. J. 1982; 284: 1665-1669Crossref PubMed Scopus (473) Google Scholar, 10Sigurs N. Bjarnason R. Sigurbergsson F. Kjellman B. Am. J. Respir. Crit. Care Med. 2000; 161: 1501-1507Crossref PubMed Scopus (914) Google Scholar, 11Stein R.T. Sherrill D. Morgan W.J. Holberg C.J. Halonen M. Taussig L.M. Wright A.L. Martinez F.D. Lancet. 1999; 354: 541-545Abstract Full Text Full Text PDF PubMed Scopus (1324) Google Scholar). The mechanisms and signaling pathways activated by RSV that result in airway epithelial cell death and inflammation are not completely understood. In this study, we investigated a novel mechanism through which RSV inhibits apoptotic cell death and regulates the activity of nuclear transcription factor NF-κB. The earliest pathologic findings in RSV-associated bronchiolitis are airway epithelial necrosis and accumulation of inflammatory cells including neutrophils, lymphocytes, and macrophages (12Everard M.L. Swarbrick A. Wrightham M. McIntyre J. Dunkley C. James P.D. Sewell H.F. Milner A.D. Arch. Dis. Child. 1994; 71: 428-432Crossref PubMed Scopus (317) Google Scholar, 13Aherne W. Bird T. Court S.D. Gardner P.S. McQuillin J. J. Clin. Pathol. 1970; 23: 7-18Crossref PubMed Scopus (313) Google Scholar). Chemokines, including the C-X-C chemokine IL-8, attract neutrophils and lymphocytes to the infected epithelium and contribute to their subsequent activation (14Baggiolini M. Walz A. Kunkel S.L. J. Clin. Invest. 1989; 84: 1045-1049Crossref PubMed Scopus (1620) Google Scholar, 15Larsen C.G. Anderson A.O. Appella E. Oppenheim J.J. Matsushima K. Science. 1989; 243: 1464-1466Crossref PubMed Scopus (913) Google Scholar). Our previous work and that of others (16Mastronarde J.G. He B. Monick M.M. Mukaida N. Matsushima K. Hunninghake G.W. J. Infect. Dis. 1996; 174: 262-267Crossref PubMed Scopus (133) Google Scholar) has demonstrated the direct stimulation of IL-8 synthesis and release from airway epithelial cells by RSV. RSV induces the synthesis and release of IL-8 through activation of multiple transcription factors including NF-κB (16Mastronarde J.G. He B. Monick M.M. Mukaida N. Matsushima K. Hunninghake G.W. J. Infect. Dis. 1996; 174: 262-267Crossref PubMed Scopus (133) Google Scholar, 17Mastronarde J.G. Monick M.M. Mukaida N. Matsushima K. Hunninghake G.W. J. Infect. Dis. 1998; 177: 1275-1281Crossref PubMed Scopus (122) Google Scholar, 18Fiedler M.A. Wernke-Dollries K. Stark J.M. J. Virol. 1996; 70: 9079-9082Crossref PubMed Google Scholar). NF-κB is also a critical transcription factor for other inflammatory mediators produced during RSV infection including IL-1α, IL-6, IL-11, RANTES, and intercellular adhesion molecule-1 (19Bitko V. Velazquez A. Yang L. Yang Y.C. Barik S. Virology. 1997; 232: 369-378Crossref PubMed Scopus (136) Google Scholar, 20Thomas L.H. Friedland J.S. Sharland M. Becker S. J. Immunol. 1998; 161: 1007-1016PubMed Google Scholar, 21Chini B.A. Fiedler M.A. Milligan L. Hopkins T. Stark J.M. J. Virol. 1998; 72: 1623-1626Crossref PubMed Google Scholar). Therefore, the activation of NF-κB is a central determinant of the inflammatory response provoked by RSV infection. In addition to its role in regulating cytokine synthesis, NF-κB also functions as an important mediator in apoptotic signaling pathways. Inhibition of NF-κB activation has been associated with increased apoptotic cell death initiated by a variety of stimuli including TNF, ionizing radiation, and chemotherapeutic agents (22Wang C.Y. Mayo M.W. Baldwin Jr., A.S. Science. 1996; 274: 784-787Crossref PubMed Scopus (2509) Google Scholar, 23Beg A.A. Baltimore D. Science. 1996; 274: 782-784Crossref PubMed Scopus (2933) Google Scholar). NF-κB appears to mediate the suppression of apoptosis through stimulus-specific induction of inhibitor proteins, including IAP (IAP1, IAP2, and XIAP), TRAF, (TRAF1 and TRAF2), Bcl-2 (A1/Bfl-1 and Bcl-xL), and A20 (24Wang C.Y. Mayo M.W. Korneluk R.G. Goeddel D.V. Baldwin Jr., A.S. Science. 1998; 281: 1680-1683Crossref PubMed Scopus (2573) Google Scholar, 25Wang C.Y. Guttridge D.C. Mayo M.W. Baldwin Jr., A.S. Mol. Cell. Biol. 1999; 19: 5923-5929Crossref PubMed Scopus (542) Google Scholar, 26Chen C. Edelstein L.C. Gelinas C. Mol. Cell. Biol. 2000; 20: 2687-2695Crossref PubMed Scopus (696) Google Scholar, 27Hu X. Yee E. Harlan J.M. Wong F. Karsan A. Blood. 1998; 92: 2759-2765Crossref PubMed Google Scholar). However, the effects of NF-κB on apoptosis are not necessarily anti-apoptotic. In hypoxia-induced epithelial death (28Matsushita H. Morishita R. Nata T. Aoki M. Nakagami H. Taniyama Y. Yamamoto K. Higaki J. Yasufumi K. Ogihara T. Circ. Res. 2000; 86: 974-981Crossref PubMed Scopus (170) Google Scholar), reovirus-induced epithelial death (29Connolly J.L. Rodgers S.E. Clarke P. Ballard D.W. Kerr L.D. Tyler K.L. Dermody T.S. J. Virol. 2000; 74: 2981-2989Crossref PubMed Scopus (143) Google Scholar), and activation-induced T-cell death (30Rivera-Walsh I. Cvijic M.E. Xiao G. Sun S.C. J. Biol. Chem. 2000; 275: 25222-25230Abstract Full Text Full Text PDF PubMed Scopus (51) Google Scholar, 31Lin B. Williams-Skipp C. Tao Y. Schleicher M.S. Cano L.L. Duke R.C. Scheinman R.I. Cell Death Differ. 1999; 6: 570-582Crossref PubMed Scopus (142) Google Scholar), NF-κB activity promotes apoptosis. Overall, the pro-apoptotic or anti-apoptotic effects of NF-κB appear to be determined by both the type of stimulus and the cell type. The impact of NF-κB up-regulation by RSV with respect to apoptosis has not been categorized in airway epithelial cells. NF-κB activity is regulated at multiple levels both in the cytoplasm, where it is sequestered in an inactive state, and in the nucleus following translocation. The NF-κB superfamily of transcriptional activators form homodimers or heterodimers composed of subunits of the Rel family (p65/RelA, p50/NF-κB1, p52/NF-κB2, RelB, and c-Rel), which are sequestered in the cytoplasm by the inhibitor proteins IκBα and IκBβ. NF-κB is released and translocates to the nucleus when IκB is phosphorylated by IκB kinase and targeted for degradation (32Matthews J.R. Hay R.T. Int. J. Biochem. Cell Biol. 1995; 27: 865-879Crossref PubMed Scopus (70) Google Scholar). Specific NF-κB subunits including p65/RelA may be further regulated by phosphorylation in the transactivation domain (33Naumann M. Scheidereit C. EMBO J. 1994; 13: 4597-4607Crossref PubMed Scopus (326) Google Scholar, 34Bird T.A. Schooley K. Dower S.K. Hagen H. Virca G.D. J. Biol. Chem. 1997; 272: 32606-32612Abstract Full Text Full Text PDF PubMed Scopus (188) Google Scholar, 35Sizemore N. Leung S. Stark G.R. Mol. Cell. Biol. 1999; 19: 4798-4805Crossref PubMed Google Scholar). Finally, NF-κB activity may also be determined by the ability of the individual subunits to associate with basal transcription factors including TFIID/TBP (36Kerr L.D. Ransone L.J. Wamsley P. Schmitt M.J. Boyer T.G. Zhou Q. Berk A.J. Verma I.M. Nature. 1993; 365: 412-419Crossref PubMed Scopus (131) Google Scholar, 37Carter A.B. Knudtson K.L. Monick M.M. Hunninghake G.W. J. Biol. Chem. 1999; 274: 30858-30863Abstract Full Text Full Text PDF PubMed Scopus (418) Google Scholar). The lipid kinase, phosphatidylinositol 3-kinase (PI 3-K), has been implicated in the regulation of diverse cellular functions including proliferation, metabolic regulation, and apoptosis (38Rameh L.E. Cantley L.C. J. Biol. Chem. 1999; 274: 8347-8350Abstract Full Text Full Text PDF PubMed Scopus (851) Google Scholar, 39Toker A. Cantley L.C. Nature. 1997; 387: 673-676Crossref PubMed Scopus (1223) Google Scholar). In addition to its direct role in apoptosis and metabolic signaling, there is evidence that PI 3-K may play a role in NF-κB regulation. PI 3-K has been shown to mediate NF-κB up-regulation during IL-1 and bradykinin stimulation of cultured epidermoid and airway epithelial cells, respectively (40Reddy S.A. Huang J.H. Liao W.S. J. Biol. Chem. 1997; 272: 29167-29173Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar, 41Pan Z.K. Christiansen S.C. Ptasznik A. Zuraw B.L. J. Biol. Chem. 1999; 274: 9918-9922Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Whereas the precise mechanism of NF-κB up-regulation by PI 3-K remains to be identified, the effects may be partially mediated through AKT (protein kinase B). The enzyme activity of AKT, a serine/threonine kinase, is regulated by the phosphoinositide products of PI 3-K both directly by binding of these lipids to its pleckstrin homology domain (42Franke T.F. Kaplan D.R. Cantley L.C. Toker A. Science. 1997; 275: 665-668Crossref PubMed Scopus (1303) Google Scholar, 43Franke T.F. Kaplan D.R. Cantley L.C. Cell. 1997; 88: 435-437Abstract Full Text Full Text PDF PubMed Scopus (1522) Google Scholar) and indirectly through subsequent phosphorylation by the phosphoinositol lipid-dependent, upstream kinase PDK-1 (44Stokoe D. Stephens L.R. Copeland T. Gaffney P.R. Reese C.B. Painter G.F. Holmes A.B. McCormick F. Hawkins P.T. Science. 1997; 277: 567-570Crossref PubMed Scopus (1046) Google Scholar, 45Alessi D.R. Deak M. Casamayor A. Caudwell F.B. Morrice N. Norman D.G. Gaffney P. Reese C.B. MacDougall C.N. Harbison D. Ashworth A. Bownes M. Curr. Biol. 1997; 7: 776-789Abstract Full Text Full Text PDF PubMed Scopus (618) Google Scholar, 46Alessi D.R. James S.R. Downes C.P. Holmes A.B. Gaffney P.R. Reese C.B. Cohen P. Curr. Biol. 1997; 7: 261-269Abstract Full Text Full Text PDF PubMed Google Scholar). AKT has been found to play a role in cell survival and apoptosis through its downstream effects on the apoptosis-related proteins BAD and caspase 9 (47Datta S.R. Brunet A. Greenberg M.E. Genes Dev. 1999; 13: 2905-2927Crossref PubMed Scopus (3718) Google Scholar). Furthermore, AKT has been shown specifically to contribute to NF-κB regulation through association with and activation of IκB kinase during TNF signaling in 293 cells and platelet-derived growth factor signaling in primary fibroblasts (48Ozes O.N. Mayo L.D. Gustin J.A. Pfeffer S.R. Pfeffer L.M. Donner D.B. Nature. 1999; 401: 82-85Crossref PubMed Scopus (1896) Google Scholar, 49Romashkova J.A. Makarov S.S. Nature. 1999; 401: 86-90Crossref PubMed Scopus (1666) Google Scholar). Together, these findings are consistent with the observation that that PI 3-K inhibition can prevent the downstream activation of both AKT and NF-κB in pervanadate-stimulated T cells (50Beraud C. Henzel W.J. Baeuerle P.A. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 429-434Crossref PubMed Scopus (264) Google Scholar). Additionally, AKT may contribute to NF-κB regulation through p65/RelA phosphorylation as observed in HepG2 cells with IL-1 stimulation, an effect that did not appear dependent on IκB kinase activation and IκB degradation (35Sizemore N. Leung S. Stark G.R. Mol. Cell. Biol. 1999; 19: 4798-4805Crossref PubMed Google Scholar). Therefore, the PI 3-K/AKT pathway provides multiple potential links between survival or apoptosis signaling and NF-κB regulation. We have undertaken these studies to define further the mechanisms of inflammatory gene induction and cell death during RSV infection. Because cultured airway epithelial cells display little or no cytotoxic effects early in the course of RSV infection, we hypothesized that RSV activates cell survival and gene transcription pathways that maintain cell viability until mature viral production has been accomplished. In A549-cultured airway epithelial cells, we have found that simultaneous RSV infection and PI 3-K blockade by chemical inhibition with LY294002 results in premature and exaggerated cell death in comparison to RSV alone. Furthermore, the death produced by concurrent RSV infection and LY294002 has features of apoptosis including characteristic DNA fragmentation and poly(ADP-ribose) polymerase (PARP) cleavage. RSV infection produces an early activation of PI 3-K as measured directly by PI 3-K activity assays and indirectly by phosphorylation of the PI 3-K p85 regulatory subunit. Additionally, the RSV-induced PI 3-K activity correlates with phosphorylation of the downstream effectors, AKT and GSK-3, at regulatory-specific residues. The phosphorylation was blocked by pretreatment with LY294002. The role of the PI 3-K/AKT pathway in preserving cellular viability during infection was further supported by the observation that constitutively active AKT attenuated the cytotoxicity and apoptotic effect of chemical PI 3-K blockade. Finally, PI 3-K inhibition by LY294002 or AKT inhibition by transfection of a dominant negative AKT blocked RSV-induced NF-κB transcriptional activity. These observations suggest that RSV activates the PI 3-K/AKT survival pathway, which promotes cellular survival and contributes to NF-κB activation. PI 3-K p85 monoclonal antibody and LY294002 were purchased from Calbiochem. Serine 473-phospho-AKT and serine 21/9-phospho-GSK-3 antibodies were purchased from Cell Signaling Laboratories, (Beverly, MA). Phosphotyrosine PY20, GSK-3, AKT, PARP, and horseradish peroxidase-conjugated anti-mouse and anti-rabbit antibodies were all purchased from Santa Cruz Biotechnology (Santa Cruz, CA). A549 cells, a tumor cell line with properties of normal airway epithelial cells (16Mastronarde J.G. He B. Monick M.M. Mukaida N. Matsushima K. Hunninghake G.W. J. Infect. Dis. 1996; 174: 262-267Crossref PubMed Scopus (133) Google Scholar, 51Lazrak A. Samanta A. Matalon S. Am. J. Physiol. 2000; 278: L848-L857Crossref PubMed Google Scholar), were obtained from American Type Culture Collection (ATCC, Manassas, VA) and incubated at 37o in 5% CO2. The cells were cultured in Eagle's minimum essential medium (MEM, Invitrogen) supplemented with 10% fetal bovine serum (HyClone, Logan, UT) and 40 mg/ml gentamicin and had been subcultured by harvesting in 0.12% trypsin no more than 20 times from stock originally designated at pass 70. To minimize effects of exogenous growth factors or cytokines in our system, we reduced the supplemented serum concentration to 0.5% 24 h prior to and during all experiments with RSV infection. This serum supplement concentration slowed, but did not stop, cell division and produced no evidence of cytotoxicity for 72 h. RSV, strain A2, was obtained from Advanced Biotechnologies Inc. (Columbia, MD) and was used directly as supplied for all experiments. The viral preparation was tested to have a TCID50 titer of ∼1 × 109 in Hep-2 cells at 7 days. Sterile vials of the RSV preparation were supplied in MEM supplemented with 10% fetal calf serum, stored at −135 °C and rapidly thawed at 37 °C immediately prior to use. The RSV was diluted to a final concentration of 1:1000 of original stock for all experimental treatments. A replication-defective adenovirus vector encoding a constitutively active murine AKT (Ad.myr-AKT) was generously provided by K. Walsh (Boston). The vector contained epitope tagged enzyme (HA-AKT) with the c-srcmyristoylation sequence fused in sequence to the N terminus of the coding sequence. The construction and activity of the vector has been described previously (52Fujio Y. Walsh K. J. Biol. Chem. 1999; 274: 16349-16354Abstract Full Text Full Text PDF PubMed Scopus (489) Google Scholar). The vector was amplified without modification in 293 cells, purified by CsCl gradient centrifugation, and stored at −80 °C in 10 mm Tris buffer containing 20% glycerol. Virus particle titers were determined byA260 measurement for DNA and were ∼1013 DNA particles/ml. Control adenovirus vector containing β-galactosidase (Ad.LacZ) was purchased commercially (Vector Core Laboratory, University of Iowa, Iowa City). Plasmid vectors containing a hemagglutinin-tagged, murine α-AKT mutant (K179M) inserted into a pCMV6 parental vector were generously provided by A. Toker (Boston, MA). This mutation is a substitution of lysine with methionine at position 179 in the ATP-binding site resulting in complete inhibition of the kinase activity. This mutation has been characterized previously (53Bellacosa A. Chan T.O. Ahmed N.N. Datta K. Malstrom S. Stokoe D. McCormick F. Feng J. Tsichlis P. Oncogene. 1998; 17: 313-325Crossref PubMed Scopus (456) Google Scholar, 54Franke T.F. Yang S.I. Chan T.O. Datta K. Kazlauskas A. Morrison D.K. Kaplan D.R. Tsichlis P.N. Cell. 1995; 81: 727-736Abstract Full Text PDF PubMed Scopus (1826) Google Scholar). Cell death and cytotoxicity were measured by two different methods: lactate dehydrogenase assay to quantify cellular lysis and an ethidium homodimer/calcein combined fluorescent assay to quantify membrane integrity and cell viability. For the lactate dehydrogenase assay cell culture, supernatants were aspirated, and the remaining adherent cells were lysed by addition of 0.1% Triton X-100 directly to each tissue culture well. Following incubation at 4 °C for 30 min, the supernatants and lysates were centrifuged to remove debris. After addition of phosphate buffer (0.1m, pH 7.40), NADH (0.3 mm), and sodium pyruvate (0.6 mm), absorbance kinetics were measured at 340 nm. LDH activity in the supernatant was normalized to total LDH measured in supernatant plus lysate for each sample and expressed as percent of total activity, (i.e. % LDH activity = LDH activity supernatant/LDH activity supernatant + LDH activity cell lysate). For the death and viability combined assay a commercially available kit, the LIVE/DEAD® Viability/Cytotoxicity kit (Molecular Probes, Eugene, OR) was used in a 96-well microplate format. A549 cells were seeded in 96-well tissue culture plate at 20,000 cells/well and infected with adenoviral vector constructs as described below. After 36 h, the media were replaced with MEM at 0.5% and the cells cultured overnight. The cells were then exposed to 50 μmLY294002 or solvent control for 1 h followed by infection with RSV. Twelve or twenty four hours post-infection, the A549 cells were stained with 8 μm ethidium homodimer (EthD-1) for 15 min, and the fluorescence of EthD-1 bound to DNA in damaged cells was measured using 540 ± 10 nm excitation filter and 620 ± 10 nm emission filter on a Victor2® (EG&G Wallac, Gaithersburg, MD) microplate reader. The same cells were subsequently stained with 4 μm calcein acetoxymethyl ester (calcein-AM) for 30 min, and the fluorescence of calcein was measured using 485 ± 8 nm excitation filter and 620 ± 10 nm emission filter. Cell death and cell viability were expressed as relative fluorescence intensity of EthD-1 and calcein, respectively, after subtraction of background fluorescence from wells containing the fluorescent dyes in culture media and no cells. Terminal deoxynucleotidyltransferase dUTP nick end labeling (TUNEL) analysis for DNA fragmentation was carried out using an Apo-DirectTM kit obtained from PharMingen (San Diego, CA). Briefly, A549 cells were grown to 80% confluence in 100-mm tissue culture dishes, incubated 24 h in MEM supplemented with 0.5% fetal calf serum, and exposed to LY294002 (50 μm) or control solvent Me2SO (1 μl/ml) for 1 h. RSV was added and the cells incubated for an additional 6 h. Cells were washed once with PBS and harvested by trypsinization. Cells in the washes and supernatants were pelleted and combined with the adherent fractions. The cells were fixed in 1% paraformaldehyde for 15 min and stored in 70% ethanol at −20 °C until staining and analysis. Cells were labeled with FITC-conjugated deoxyuridine triphosphate nucleotides and propidium iodide according to manufacturer's instructions and analyzed by flow cytometry (FACScanTM, Becton Dickson, San Jose, CA) using CELLQuest software, (Becton Dickson). Cellular DNA was isolated using Easy-DNATM obtained from Invitrogen (Carlsbad, CA). Briefly, A549 cells in 100-mm tissue culture dishes were exposed to LY294002 and RSV as above, harvested by scraping, and washed once with PBS. Following cell lysis, DNA was extracted by phenol/chloroform partition and precipitated in ethanol. The DNA was then resuspended in TE buffer (10 mm Tris-HCl, pH 7.5, 1 mm EDTA, pH 8.0) and purified by RNase treatment (10 μg/ml) at 37 °C for 30 min. DNA fragmentation was assessed by gel electrophoresis in 1.7% agarose containing 3.0 μg/ml ethidium bromide. Following experimental exposure, the cells were washed in sterile PBS and harvested by scraping into lysis buffer (0.05 m Tris, pH 7.4, 0.15 m NaCl, 1% Nonidet P-40, 0.5 m phenylmethylsulfonyl fluoride, 50 μg/ml aprotinin, 10 μg/ml leupeptin, 50 μg/ml pepstatin, 0.4 mm sodium orthovanadate, 10 mm sodium fluoride, and 10 mm sodium pyrophosphate, all from Roche Molecular Biochemicals). Detached cells in supernatants and wash were pelleted at 300 × g for 3 min and combined with the scraped lysate. Complete cell disruption was carried out by sonication for 15 s, and insoluble debris was pelleted by centrifugation at 15,000 × g for 10 min. The protein concentration in the lysate supernatant was measured by Bradford assay normalized to bovine serum albumin. Equal protein weights were mixed 1:1 with sample buffer (20% glycerol, 4% SDS, 10% β-mercaptoethanol, 0.05% bromphenol blue, and 1.25 m Tris, pH 6.8), separated by SDS-PAGE, and transferred to a nitrocellulose membrane by electroblotting. Immunoreactive bands were developed using a chemiluminescent substrate (ECL Plus, Amersham Biosciences). Following development of phospho-AKT and phospho-GSK-3 bands, bound immunoglobulins were removed from the membranes by washing for 1 h at room temperature in ImmunoPure IgG Elution Buffer (Pierce), and the membranes were re-probed for total AKT and GSK-3. Adherent and detached cells were harvested following the same procedures for the Western blot protocol. 200 μg of total cell protein was cleared by incubating for 2 h with 1 μg/sample of rabbit IgG and 10 μl/sample of GammaBind-Sepharose. After centrifuging, the supernatants were transferred to a tube containing 2.5 μg/sample of anti-p85 antibody bound to GammaBind-Sepharose and rotated at 4o overnight. For study of the PI 3-K phosphorylation status, the immunoprecipitated protein was washed three times with high salt buffer (0.5 m Tris, pH 7.4, 0.50 m NaCl, and 1% Nonidet P-40) and twice with lysis buffer (see Western analysis). The protein was then released with 2× Western sample buffer (above), incubated at 95 °C for 5 min, separated by SDS-PAGE, and immunoblotted for phosphotyrosine. Activity was assayed by measuring the formation of PI 3-[32P]phosphate by immunoprecipitated PI 3-kinase preparations. Immunoprecipitation using an antibody to the p85 regulatory subunit of PI 3-kinase was performed as above. Following isolation, the bound protein was washed three times with buffer I (phosphate-buffered saline containing 1% Nonidet P-40 and 100 μm Na3VO4), three times with buffer II (100 mm Tris-HCl, pH 7.5, 500 mmLiCl, and 100 μm Na3VO4), and finally three times with buffer III (Tris-HCl, pH 7.5, 100 mm NaCl, 1 mm EDTA, and 100 μmNa3VO4). After pelleting, the immunoprecipitates were resuspended in 50 μl of buffer III with the addition of 10 μl of 100 mm MgCl2 and 10 μl of PI (2 μg/ml). The PI was prepared by drying down an aliquot of chloroform-diluted stock under nitrogen, adding Tris, pH 7.5, with 1 mm EGTA to the tube, and sonicating on ice until the lipid was dispersed in suspension. It was then added immediately to the assay tube. The samples were equilibrated at room temperature for 5 min prior to the addition of 10 μl of radiolabeled substrate ATP (440 μm ATP with 30 μCi/10 μl of [γ-32P]ATP). Following gentle agitation for 10 min, the reaction was terminated by the ad

Rhinoviruses are important respiratory pathogens implicated in asthma exacerbations. The mechanisms by which rhinoviruses trigger inflammatory responses in the lower airway are poorly understood, in particular their ability to infect the lower airway. Bronchial inflammatory cell (lymphocyte and eosinophil) recruitment has been demonstrated. IL-8 is a potent proinflammatory chemokine that is chemotactic for neutrophils, lymphocytes, eosinophils, and monocytes and may be important in the pathogenesis of virus-induced asthma. Increased levels of IL-8 have been found in nasal samples in natural and experimental rhinovirus infections. In these studies we therefore examine the ability of rhinovirus to infect a transformed lower airway epithelial cell line (A549) and to induce IL-8 protein release and mRNA induction. We observed that rhinovirus type 9 is able to undergo full viral replication in A549 cells, and peak viral titers were found 24 h after inoculation. Rhinovirus infection induced a dose- and time-dependent IL-8 release up to 5 days after infection and an increase in IL-8 mRNA expression that was maximal between 3 and 24 h after infection. UV inactivation of the virus completely inhibited replication, but only reduced IL-8 protein production and mRNA induction by half, while prevention of virus-receptor binding completely inhibited virus-induced IL-8 release, suggesting that part of the observed effects was due to viral replication and part was due to virus-receptor binding. These studies demonstrate that rhinoviruses are capable of infecting a pulmonary epithelial cell line and inducing IL-8 release. These findings may be important in understanding the pathogenesis of rhinovirus-induced asthma exacerbations.

The immediate early (IE) genes of human cytomegalovirus (HCMV) can be expressed in monocytes/macrophages and are known to regulate other viral genes. The purpose of these studies was to determine if HCMV IE gene products also modulate expression of a monocyte/macrophage-derived gene, interleukin 1 (IL-1) beta. Steady-state cell-derived IL-1 beta mRNA was increased in lipopolysaccharide (LPS)-stimulated THP-1 cells when transfected with the HCMV IE1 + 2 genes, when compared to cells transfected with a control DNA. LPS-stimulated THP-1 cells also exhibited approximately 30-fold higher IL-1 CAT activity when cotransfected with IE1 + 2 than was observed for the same cells cotransfected with IL-1 CAT and a control plasmid containing the IE promoter alone. LPS increased IL-1 CAT activity in the absence of HCMV genes only twofold. IE1, by itself, increased IL-1 CAT activity in LPS-stimulated cells, whereas, IE2, by itself, caused no change in IL-1 CAT activity. These studies show that the IE1 gene of HCMV can regulate IL-1 beta gene expression. The observations further suggest that some of the inflammatory processes associated with HCMV infection may be due to an effect of HCMV IE genes on cell-derived genes, such as the IL-1 beta gene.

A critical feature of sepsis-induced adult respiratory distress syndrome (ARDS) is the release of cytokines (such as interleukin [IL]-6, IL-8, and tumor necrosis factor [TNF]) from endotoxin (lipopolysaccharide [LPS])-activated alveolar macrophages (AM). Nuclear factor kappa B (NF-kappaB) is activated in AM from patients with ARDS, and it is essential for the transcription of many cytokine genes. In these studies, we evaluated the regulation of LPS-induced cytokine release and the activation of NF-kappaB in human AM. We found that the activation of NF-kappaB and the release of IL-6, IL-8, and TNF from AM exposed to LPS was protein kinase C-independent and tyrosine kinase- and phosphatidylcholine-specific phospholipase C-dependent. We also found that LPS-induced activation of NF-kappaB was enhanced in AM cultured in serum or in the presence of LPS-binding protein, simulating conditions in the lung that are present in ARDS. In addition, LPS triggered the activation of several different NF-kappaB complexes in AM, and different forms of NF-kappaB bound to the IL-6, IL-8, and TNF promoter sequences. These observations suggest that physiologic abnormalities present in the lungs of patients with ARDS facilitate the activation of NF-kappaB and local release of cytokines.

Respiratory viruses often express mechanisms to resist host antiviral systems, but the biochemical basis for evasion of interferon effects by respiratory syncytial virus (RSV) is poorly defined. In this study, we identified RSV effects on interferon (IFN)-dependent signal transduction and gene expression in human airway epithelial cells. Initial experiments demonstrated inhibition of antiviral gene expression induced by IFN-alpha and IFN-beta, but not IFN-gamma, in epithelial cells infected with RSV. Selective viral effects on type I IFN-dependent signaling were confirmed when we observed impaired type I, but not type II, IFN-induced activation of the transcription factor Stat1 in RSV-infected cells. RSV infection of airway epithelial cells resulted in decreased Stat2 expression and function with preservation of upstream signaling events, providing a molecular mechanism for viral inhibition of the type I IFN JAK-STAT pathway. Furthermore, nonspecific pharmacologic inhibition of proteasome function in RSV-infected cells restored Stat2 levels and IFN-dependent activation of Stat1. The results indicate that RSV acts on epithelial cells in the airway to directly modulate the type I IFN JAK-STAT pathway, and this effect is likely mediated though proteasome-dependent degradation of Stat2. Decreased antiviral gene expression in RSV-infected airway epithelial cells may allow RSV replication and establishment of a productive viral infection through subversion of IFN-dependent immunity.

Extracellular signal-regulated kinases (ERKs) are key regulatory proteins that mediate cell survival, proliferation, and differentiation. Reactive oxygen species (ROS) may play a role in activation of the ERK pathway. Because mitochondria are a major source of ROS, we investigated whether mitochondria-derived ROS play a role in ERK activation. Diazoxide, a potent mitochondrial ATP-sensitive K + (K ATP ) channel opener, is known to depolarize the mitochondrial membrane potential and cause a reversible oxidation of respiratory chain flavoproteins, thus increasing mitochondrial ROS production. Using THP-1 cells as a model, we postulated that opening mitochondrial K ATP channels would increase production of ROS and, thereby, regulate the activity of the ERK kinase. We found that opening mitochondrial K ATP channels by diazoxide induced production of ROS as determined by an increased rate of dihydroethidium and dichlorofluorescein fluorescence. This increased production of ROS was associated with increased phosphorylation of ERK kinase in a time-dependent fashion. The MEK inhibitors PD-98059 and U-0126 blocked ERK activation mediated by diazoxide. N-acetylcysteine, but not diphenyleneiodonium, attenuated ERK activation mediated by diazoxide. Adenovirus-mediated overexpression of manganese superoxide dismutase, which is expressed in mitochondria, decreased the rate of dihydroethidium oxidation as well as ERK activation. We conclude that mitochondrial K ATP channel openers trigger ERK activation via mitochondria-derived ROS.

A unique feature of human alveolar macrophages is their prolonged survival in the face of a stressful environment. We have shown previously that the ERK MAPK is constitutively active in these cells and is important in prolonging cell survival. This study examines the role of the ERK pathway in maintaining mitochondrial energy production. The data demonstrate that ATP levels in alveolar macrophages depend on intact mitochondria and optimal functioning of the electron transport chain. Significant levels of MEK and ERK localize to the mitochondria and inhibition of ERK activity induces an early and profound depletion in cellular ATP coincident with a loss of mitochondrial transmembrane potential. The effect of ERK suppression on ATP levels was specific, since it did not occur with PI3K/Akt, p38, or JNK suppression. ERK inhibition led to cytosolic release of mitochondrial proteins and caspase activation. Both ERK inhibition and mitochondrial blockers induced loss of plasma membrane permeability and cell death. The cell death induced by ERK inhibition had hallmarks of both apoptotic (caspase activation) and necrotic (ATP loss) cell death. By blocking ERK inhibition-induced reactive oxygen species, caspase activation was prevented, although necrotic pathways continued to induce cell death. This suggests that mitochondrial dysfunction caused by ERK inhibition generates both apoptotic and necrotic cell death-inducing pathways. As a composite, these data demonstrate a novel mitochondrial role for ERK in maintaining mitochondrial membrane potential and ATP production in human alveolar macrophages.

Ebola virus outbreaks, such as the 2014 Makona epidemic in West Africa, are episodic and deadly. Filovirus antivirals are currently not clinically available. Our findings suggest interferon gamma, an FDA-approved drug, may serve as a novel and effective prophylactic or treatment option. Using mouse-adapted Ebola virus, we found that murine interferon gamma administered 24 hours before or after infection robustly protects lethally-challenged mice and reduces morbidity and serum viral titers. Furthermore, we demonstrated that interferon gamma profoundly inhibits Ebola virus infection of macrophages, an early cellular target of infection. As early as six hours following in vitro infection, Ebola virus RNA levels in interferon gamma-treated macrophages were lower than in infected, untreated cells. Addition of the protein synthesis inhibitor, cycloheximide, to interferon gamma-treated macrophages did not further reduce viral RNA levels, suggesting that interferon gamma blocks life cycle events that require protein synthesis such as virus replication. Microarray studies with interferon gamma-treated human macrophages identified more than 160 interferon-stimulated genes. Ectopic expression of a select group of these genes inhibited Ebola virus infection. These studies provide new potential avenues for antiviral targeting as these genes that have not previously appreciated to inhibit negative strand RNA viruses and specifically Ebola virus infection. As treatment of interferon gamma robustly protects mice from lethal Ebola virus infection, we propose that interferon gamma should be further evaluated for its efficacy as a prophylactic and/or therapeutic strategy against filoviruses. Use of this FDA-approved drug could rapidly be deployed during future outbreaks.

Background: Smoking causes a global down-regulation in alveolar macrophage miRNA expression.Results: Cigarette smoke exposure modifies the RNA endonuclease DICER, resulting in a microRNA processing defect.Conclusion: Cigarette smoke alters alveolar macrophage microRNA expression, in part, by SUMOylation of DICER.Significance: This is the first description of an environmental exposure causing changes in microRNA expression via posttranslational modification of DICER.Despite the fact that alveolar macrophages play an important role in smoking-related disease, little is known about what regulates their pathophysiologic phenotype.Evaluating smoker macrophages, we found significant down-regulation of multiple microRNAs (miRNAs).This work investigates the hypothesis that cigarette smoke alters mature miRNA expression in lung macrophages by inhibiting processing of primary miRNA transcripts.Studies on smoker alveolar macrophages showed a defect in miRNA maturation.Studies on the miRNA biogenesis machinery led us to focus on the cytosolic RNA endonuclease, DICER.DICER cleaves the stem-loop structure from pre-miRNAs, allowing them to dissociate into their mature 20 -22nucleotide single-stranded form.DICER activity assays confirmed impaired DICER activity following cigarette smoke exposure.Further protein studies demonstrated a decreased expression of the native 217-kDa form of DICER and an accumulation of high molecular weight forms with cigarette smoke exposure.This molecular mass shift was shown to contain SUMO moieties and could be blocked by silencing RNA directed at the primary SUMOylating ligase, Ubc9.In determining the cigarette smoke components responsible for changes in DICER, we found that N-acetylcysteine, an antioxidant and anti-aldehyde, protected DICER protein and activity from cigarette smoke extract.This massive down-regulation of miRNAs (driven in part by alterations in DICER) may be an important regulator of the disease-promoting macrophage phenotype found in the lungs of smokers.COPD 2 is characterized by inflammation in both small airways and alveoli, eventually leading to irreversible airflow limi-

Abstract Human alveolar macrophages respond to endotoxin (LPS) by activation of a number of mitogen-activated protein kinase pathways, including the p42/44 (extracellular signal-related kinase (ERK)) kinase pathway. In this study, we evaluated the role of the atypical protein kinase C (PKC) isoform, PKC ζ, in LPS-induced activation of the ERK kinase pathway. Kinase activity assays showed that LPS activates PKC ζ, mitogen-activated protein/ERK kinase (MEK, the upstream activator of ERK), and ERK. LPS did not activate Raf-1, the classic activator of MEK. Pseudosubstrate-specific peptides with attached myristic acid are cell permeable and can be used to block the activity of specific PKC isoforms in vivo. We found that a peptide specific for PKC ζ partially blocked activation of both MEK and ERK by LPS. We also found that this peptide blocked in vivo phosphorylation of MEK after LPS treatment. In addition, we found that LPS caused PKC ζ to bind to MEK in vivo. These observations suggest that MEK is an LPS-directed target of PKC ζ. PKC ζ has been shown in other systems to be phosphorylated by phosphatidylinositol (PI) 3-kinase-dependent kinase. We found that LPS activates PI 3-kinase and causes the formation of a PKC ζ/PI 3-kinase-dependent kinase complex. These data implicate the PI 3-kinase pathway as an integral part of the LPS-induced PKC ζ activation. Taken as a whole, these studies suggest that LPS activates ERK kinase, in part, through activation of an atypical PKC isoform, PKC ζ.

This study uses human alveolar macrophages to determine whether activation of a phosphatidylcholine (PC)-specific phospholipase C (PC-PLC) is linked to activation of the p42/44 (ERK) kinases by LPS. LPS-induced ERK kinase activation was inhibited by tricyclodecan-9-yl xanthogenate (D609), a relatively specific inhibitor of PC-PLC. LPS also increased amounts of diacylglycerol (DAG), and this increase in DAG was inhibited by D609. LPS induction of DAG was, at least in part, derived from PC hydrolysis. Ceramide was also increased in LPS-treated alveolar macrophages, and this increase in ceramide was inhibited by D609. Addition of exogenous C2 ceramide or bacterial-derived sphingomyelinase to alveolar macrophages increased ERK kinase activity. LPS also activated PKC zeta, and this activation was inhibited by D609. LPS-activated PKC zeta phosphorylated MAP kinase kinase, the kinase directly upstream of the ERK kinases. LPS-induced cytokine production (RNA and protein) was also inhibited by D609. As an aggregate, these studies support the hypothesis that one way by which LPS activates the ERK kinases is via activation of PC-PLC and that activation of a PC-PLC is an important component of macrophage activation by LPS.

Section:ChooseTop of pageAbstract <<Materials and MethodsResultsDiscussionReferencesCITING ARTICLES

Our previous work demonstrated that hypoxia decreases transcription of the human prostaglandin H synthase-2 (PGHS-2) gene during exposure to lipopolysaccharide (LPS), resulting in decreased prostaglandin E2 (PGE2) synthesis (J. Biol. Chem. 269:32979-32984, 1994). Because PGE2 is reported to inhibit interleukin 1 (IL-1) and tumor necrosis factor (TNF), it is likely that hypoxia, through changes in PGE2, will alter IL-1 and TNF release from the human alveolar macrophage. In addition, like PGHS-2, the TNF and IL-1 promoters contain oxidant-sensitive elements which might be altered by hypoxia. Therefore, we hypothesized that LPS-induced release of TNF and IL-1 would be altered by hypoxia. To test this, human alveolar macrophages were cultured for 24 h with 0 to 1 microgram/ml LPS in a room-air incubator with 5% CO2 or a hypoxia incubator continuously perfused with 5% CO2/95% N2 (O2 < 0.05%). With room air, LPS increased IL-1 beta mRNA and increased IL-1 beta protein release into the culture medium in a dose-dependent manner. Hypoxia increased the LPS-stimulated release of IL-1 beta 30% above that of room-air controls. However, immunoblots showed that hypoxia caused no change in intracellular IL-1 beta compared with room-air controls. There was also no change in LPS-induced IL-1 beta message with hypoxia. The inhibitor of IL-1, IL-1RA, was apparently decreased by hypoxia, but this decrease was not statistically significant. TNF-alpha mRNA and release of protein also increased during LPS exposure in room air. Hypoxia markedly increased LPS-induced TNF-alpha message and release of TNF-alpha compared with LPS-exposed room-air controls. Consistent with our prior observations, hypoxia decreased LPS-induced PGHS-2 message and protein, and also the PGHS-2 product, PGE2. Because PGE2 is reported to inhibit the expression of IL-1 and TNF genes, we inhibited PGE2 synthesis with indomethacin during culture in room air; the result was an increase in the release of IL-1 and TNF. In additional studies, adding PGE2 inhibited TNF release from the hypoxia cells to values near those of room-air controls. In summary, hypoxia increases the release of the cytokines IL-1 beta and TNF-alpha. This increase may be due to decreased PGE2 synthesis during hypoxia. These results demonstrate that the response of the human alveolar macrophage to hypoxia is complex. Hypoxia increases the LPS-stimulated release of the inflammatory cytokines IL-1 and TNF, whereas synthesis of PGHS-2, which generates the anti-inflammatory prostaglandin PGE2 is decreased.

Cytomegalovirus (CMV) is an important cause of disease in the immunocompromised patient and CMV infection is associated with predominantly mononuclear inflammatory response. Since products of the CMV immediate early (IE) gene region are potent trans-activators, we used the monocyte cell line THP-1 and a transient transfection assay to determine if these viral proteins upregulate expression of the TNF gene. The IE genes of CMV upregulated TNF gene activity as judged by increases in promoter activity, steady state mRNA, and protein production. The presence or absence of the 3' untranslated region of the TNF gene did not affect gene expression induced by the IE gene products. These studies suggest that activation of TNF gene expression by the CMV IE gene products may, in part, account for the inflammatory response associated with CMV infections.

Respiratory syncytial virus (RSV) preferentially infects lung epithelial cells. Infection by RSV leads to an extended inflammatory response, characterized by the release of interleukin-8 (IL-8). Activation of ERK MAP kinase is required for both RSV-induced inflammation and the extended survival of infected cells. In this study, we analyzed the role of the epidermal growth factor receptor (EGFR) in RSV activation of ERK. We demonstrate for the first time that RSV activates EGFR in lung epithelial cells. Activation of EGFR results in increased ERK activity, contributing to both the inflammatory response (IL-8 release) and prolonging the survival of RSV-infected cells. Inhibition of EGFR with siRNA decreased both ERK activation and IL-8 production after RSV. In analyzing the effect of EGFR activation on survival of RSV-infected cells, we found that EGFR activation by RSV resulted in ERK-dependent alterations in the balance of pro- <i>versus</i> anti-apoptotic Bcl2 proteins. RSV altered the balance between pro- and anti-apoptotic Bcl2 proteins (increased BclxL and decreased BimEL) increasing the relative amount of pro-survival proteins. This occurred in an EGFR-dependent manner. This study supports an important role for EGFR activity in the lifespan and inflammatory potential of RSV-infected epithelial cells.

Human alveolar macrophages have both lipopolysaccharide (LPS)-induced and constitutive phosphatidylinositol 3-kinase (PI3K) activity. We observed that blocking PI3K activity increased release of prostaglandin E2 after LPS exposure, and increasing PI3K activity (interleukin-13) decreased release of prostaglandin E2 after LPS exposure. This was not because of an effect of PI3K on phospholipase 2 activity. PI3K inhibition resulted in an increase in cyclooxygenase 2 (COX2) protein, mRNA, and mRNA stability. PI3K negatively regulated activation of the p38 pathway (p38, MKK3/6, and MAPKAP2), and an active p38 was necessary for COX2 production. The data suggest that PI3K inhibition of p38 modulates COX2 expression via destabilization of LPS-induced COX2 mRNA. Human alveolar macrophages have both lipopolysaccharide (LPS)-induced and constitutive phosphatidylinositol 3-kinase (PI3K) activity. We observed that blocking PI3K activity increased release of prostaglandin E2 after LPS exposure, and increasing PI3K activity (interleukin-13) decreased release of prostaglandin E2 after LPS exposure. This was not because of an effect of PI3K on phospholipase 2 activity. PI3K inhibition resulted in an increase in cyclooxygenase 2 (COX2) protein, mRNA, and mRNA stability. PI3K negatively regulated activation of the p38 pathway (p38, MKK3/6, and MAPKAP2), and an active p38 was necessary for COX2 production. The data suggest that PI3K inhibition of p38 modulates COX2 expression via destabilization of LPS-induced COX2 mRNA. lipopolysaccharide cyclooxygenase prostaglandin phospholipase phosphatidylinositol 3-kinase nuclear factor κB mitogen-activated protein extracellular signal-regulated kinase c-Jun NH2-terminal kinase enzyme-linked immunosorbent assay threshold cycles mitogen-activated protein kinase kinase 3/6 mitogen-activated protein kinase activated protein kinase-2 hypoxanthine phosphorilosyltransferase phosphatidylinositol phosphate Alveolar macrophages are major effector cells of the innate immune system. They play a central role in the response to Gram-negative bacteria in the lung. Endotoxin (LPS)1 is the principle activating component of the Gram-negative cell wall and is a major activator of these macrophages. After initial exposure to LPS, expression of prostaglandin endoperoxide H synthase 2 (COX2) and production of prostaglandin E2 (PGE2) appears at 12 to 24 h after stimulation (1Monick M. Glazier J. Hunninghake G.W. Am. Rev. Respir. Dis. 1987; 135: 72-77PubMed Google Scholar). Cyclooxygenases (COXs) catalyze the conversion of arachidonic acid and O2 to PGH2. It is the rate-limiting step in the metabolism of arachidonic acid to prostanoid products. Arachidonic acid is a 20-carbon unsaturated fatty acid that is hydrolyzed from membrane-bound phospholipids by the actions of phospholipases (PLA) (secretory PLA2 and cytosolic PLA2). Both COX1 and -2 catalyze the same step in the arachidonic acid pathway (a cyclooxygenase reaction in which arachidonic acid is converted to PGG2 and a peroxidase reaction in which PGG2 is reduced to PGH2) (2Smith W.L. DeWitt D.L. Garavito R.M. Annu. Rev. Biochem. 2000; 69: 145-182Crossref PubMed Scopus (2394) Google Scholar, 3Smith W.L. Garavito R.M. DeWitt D.L. J. Biol. Chem. 1996; 271: 33157-33160Abstract Full Text Full Text PDF PubMed Scopus (1828) Google Scholar). COX1 is a constitutively present enzyme, and its products are thought to be important in gastric and renal homeostasis (4Smith W.L. Langenbach R. J. Clin. Invest. 2001; 107: 1491-1495Crossref PubMed Scopus (526) Google Scholar, 5Brock T.G. McNish R.W. Peters-Golden M. J. Biol. Chem. 1999; 274: 11660-11666Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar). It is the only cyclooxygenase present in platelets and has been linked to platelet production of thromboxane A2. In contrast, COX2 is induced by inflammatory mediators and has been linked to inflammation, fever, pain, and a number of cancers (6Tilley S.L. Coffman T.M. Koller B.H. J. Clin. Invest. 2001; 108: 15-23Crossref PubMed Scopus (676) Google Scholar). The preferred prostanoid products of COX2 are prostacyclin and PGE2 (5Brock T.G. McNish R.W. Peters-Golden M. J. Biol. Chem. 1999; 274: 11660-11666Abstract Full Text Full Text PDF PubMed Scopus (241) Google Scholar). We have shown that in alveolar macrophages LPS induces COX2 expression and PGE2 release (1Monick M. Glazier J. Hunninghake G.W. Am. Rev. Respir. Dis. 1987; 135: 72-77PubMed Google Scholar, 7Hempel S.L. Monick M.M., He, B. Yano T. Hunninghake G.W. J. Biol. Chem. 1994; 269: 32979-32984Abstract Full Text PDF PubMed Google Scholar, 8Hempel S.L. Monick M.M. Hunninghake G.W. J. Clin. Invest. 1994; 93: 391-396Crossref PubMed Scopus (289) Google Scholar, 9Hempel S.L. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1996; 14: 170-176Crossref PubMed Scopus (89) Google Scholar). Phosphatidylinositol 3-kinase (PI3K) is a heterodimeric dual function lipid and protein kinase that has been linked to cell survival, transcription factor activation, and multiple signaling pathways (10Toker A. Cantley L.C. Nature. 1997; 387: 673-676Crossref PubMed Scopus (1216) Google Scholar, 11Fruman D.A. Mauvais-Jarvis F. Pollard D.A. Yballe C.M. Brazil D. Bronson R.T. Kahn C.R. Cantley L.C. Nat. Genet. 2000; 26: 379-382Crossref PubMed Scopus (249) Google Scholar, 12Vanhaesebroeck B. Jones G.E. Allen W.E. Zicha D. Hooshmand-Rad R. Sawyer C. Wells C. Waterfield M.D. Ridley A.J. Nat. Cell Biol. 1999; 1: 69-71Crossref PubMed Scopus (198) Google Scholar). Class 1A PI3Ks (found in alveolar macrophages) consist of a p85-kDa subunit protein (α and β) and a p110-kDa catalytic subunit (α, β, and δ) or a p101-kDa regulatory unit and a p110-kDa catalytic unit (γ). The p85 regulatory unit is activated via interaction of the SH2 domain with YXXM motifs of multiple receptors. The p101 regulatory unit is activated by γβ subunits of G proteins downstream of G protein-coupled receptors (10Toker A. Cantley L.C. Nature. 1997; 387: 673-676Crossref PubMed Scopus (1216) Google Scholar). Once activated PI3K catalyzes the transfer of ATP to thed-3 position of the inositol ring of membrane-localized phosphoinositides. This results in the production of a number of bioactive lipid species including PI3P, PI3,4P, and PI3,4,5P. Both PI3,4P and PI3,4,5P are absent in most unstimulated cells and increase dramatically following PI3K activation. The presence of PI3,4,5P results in the membrane recruitment of proteins containing pleckstrin homology domains. This includes PI3K-dependent kinase (PDK-1), which phosphorylates a number of biologically important substrates (Akt, protein kinase A, and multiple protein kinase C isoforms) (13Toker A. Newton A.C. Cell. 2000; 103: 185-188Abstract Full Text Full Text PDF PubMed Scopus (362) Google Scholar). We have shown previously that LPS activates Akt via activation of PI3K in alveolar macrophages (14Monick M.M. Carter A.B. Flaherty D.M. Peterson M.W. Hunninghake G.W. J. Immunol. 2000; 165: 4632-4639Crossref PubMed Scopus (108) Google Scholar, 15Monick M.M. Carter A.B. Robeff P.K. Flaherty D.M. Peterson M.W. Hunninghake G.W. J. Immunol. 2001; 166: 4713-4720Crossref PubMed Scopus (155) Google Scholar, 16Monick M.M. Mallampalli R.K. Carter A.B. Flaherty D.M. McCoy D. Robeff P.K. Peterson M.W. Hunninghake G.W. J. Immunol. 2001; 167: 5977-5985Crossref PubMed Scopus (59) Google Scholar). Activation of Akt is linked to NFκB translocation and transactivation, endothelial nitric oxide synthase activation, and inhibition of a number of substrates positively involved in apoptosis. The apoptosis-related factors that are inhibited by Akt include glycogen synthase kinase 3, forkhead transcription factors, Bad, and caspase 9 (17Ivanov V.N. Krasilnikov M. Ronai Z. J. Biol. Chem. 2002; 277: 4932-4944Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar). Glycogen synthase kinase 3 inhibition results in increased signaling from a number of transcription factors, β catenin, nuclear factor of activated T-cells, CCAAT/enhancer binding protein, GATA 4, and some of the activator protein 1 proteins (18Piwien-Pilipuk G. Van Mater D. Ross S.E. MacDougald O.A. Schwartz J. J. Biol. Chem. 2001; 276: 19664-19671Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar). Activation of PI3K is therefore linked to multiple biological effects. One possible role of PI3K activity is as a modulator of MAP kinase signaling. Akt, in some conditions, has been shown to negatively regulate c-Raf (part of the ERK pathway in some cells) (19Rommel C. Clarke B.A. Zimmermann S. Nunez L. Rossman R. Reid K. Moelling K. Yancopoulos G.D. Glass D.J. Science. 1999; 286: 1738-1741Crossref PubMed Scopus (659) Google Scholar), p38 (20Blum S. Issbruker K. Willuweit A. Hehlgans S. Lucerna M. Mechtcheriakova D. Walsh K. von der Ahe D. Hofer E. Clauss M. J. Biol. Chem. 2001; 276: 33428-33434Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar), and stress-activated protein kinase kinase (upstream of JNK) (21Park H.S. Kim M.S. Huh S.H. Park J. Chung J. Kang S.S. Choi E.J. J. Biol. Chem. 2002; 277: 2573-2578Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). The MAP kinases are a family of evolutionarily conserved enzymes that connect cell surface receptors to regulatory targets that include both cytoplasmic and nuclear proteins. The three major MAP kinase families are the ERK (1 and 2), p38 (α, β, γ, and δ), and the JNK (1, 2, and 3) (22Kyriakis J.M. Avruch J. Physiol. Rev. 2001; 81: 807-869Crossref PubMed Scopus (2833) Google Scholar). LPS exposure leads to the activation of all three MAP kinase pathways (ERK, p38, and JNK) (23Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1999; 20: 751-758Crossref PubMed Scopus (280) Google Scholar, 24Matsuguchi T. Musikacharoen T. Johnson T.R. Kraft A.S. Yoshikai Y. Mol. Cell. Biol. 2001; 21: 6999-7009Crossref PubMed Scopus (65) Google Scholar), and activation of ERK and p38 has been linked to COX2 expression (25Subbaramaiah K. Hart J.C. Norton L. Dannenberg A.J. J. Biol. Chem. 2000; 275: 14838-14845Abstract Full Text Full Text PDF PubMed Scopus (294) Google Scholar, 26Subbaramaiah K. Chung W.J. Dannenberg A.J. J. Biol. Chem. 1998; 273: 32943-32949Abstract Full Text Full Text PDF PubMed Scopus (198) Google Scholar). p38 phosphorylates both cytoplasmic and nuclear substrates. Non-transcription factor effects of p38 include increasing mRNA stability and phosphorylation of basal transcription complex components (27Lasa M. Mahtani K.R. Finch A. Brewer G. Saklatvala J. Clark A.R. Mol. Cell. Biol. 2000; 20: 4265-4274Crossref PubMed Scopus (366) Google Scholar, 28Carter A.B. Knudtson K.L. Monick M.M. Hunninghake G.W. J. Biol. Chem. 1999; 274: 30858-30863Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar). p38 activity has been linked to regulation of cytokine mRNA stability via its inhibitory actions on the mRNA destabilizing protein tristetraprolin (29Carballo E. Cao H. Lai W.S. Kennington E.A. Campbell D. Blackshear P.J. J. Biol. Chem. 2001; 276: 42580-42587Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar). More specifically, p38 activation has been linked to COX2 mRNA stability (27Lasa M. Mahtani K.R. Finch A. Brewer G. Saklatvala J. Clark A.R. Mol. Cell. Biol. 2000; 20: 4265-4274Crossref PubMed Scopus (366) Google Scholar, 30Lasa M. Brook M. Saklatvala J. Clark A.R. Mol. Cell. Biol. 2001; 21: 771-780Crossref PubMed Scopus (215) Google Scholar, 31Jang B.C. Sanchez T. Schaefers H.J. Trifan O.C. Liu C.H. Creminon C. Huang C.K. Hla T. J. Biol. Chem. 2000; 275: 39507-39515Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). In these studies, we found that inhibition of the PI3K pathway increased LPS-induced COX2 and PGE2. Lack of PI3K activity increased the stability of COX2 mRNA, and this increased stability correlated with increased PGE2 release. We found PI3K activity to be correlated inversely with LPS-induced p38 activity. Inhibition of PI3K resulted in increased p38 activity. These studies suggest that constitutive and LPS-induced PI3K activity in alveolar macrophages delays and decreases the production of COX2 and release of PGE2. Chemicals were obtained from Sigma andCalbiochem. Protease inhibitors were obtained from Roche Molecular Biochemicals. LPS was obtained from LIST Biologicals, Campbell, CA, and LY294002 was from Calbiochem. IL-13 was from R&D Systems, Minneapolis, MN. Nitrocellulose and ECL Plus were obtained fromAmersham Biosciences. Antibodies were obtained from various sources; antibodies to ERK, p38, MKK3, and MAPKAP2 were obtained from Santa Cruz Biotechnology, Santa Cruz, CA. Antibody to COX1 and COX2 was obtained from Cayman Chemicals, Ann Arbor, MI. Phosphorylation-specific antibodies to ERK and p38 were obtained from Sigma, and all other phosphorylation-specific antibodies were from Cell Signaling, Beverly, MA. Alveolar macrophages were obtained from normal non-smoking volunteers, as described previously (32Monick M.M. Carter A.B. Hunninghake G.W. J. Biol. Chem. 1999; 274: 18075-18080Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar). Briefly, normal volunteers with a lifetime non-smoking history, no acute or chronic illness, and no current medications underwent bronchoalveolar lavage. The cell pellet was washed twice in Hanks’ balanced salt solution without Ca2+and Mg2+ and suspended in complete medium, RPMI tissue culture medium (Invitrogen) with 100 ng/ml lipopolysaccharide-binding protein (a gift from Peter Tobias, Scripps Research Institute, La Jolla, CA) and added to gentamycin (80 μg/ml). Differential cell counts were determined using a Wright- Giemsa-stained cytocentrifuge preparation. All cell preparations had between 90–100% alveolar macrophages. This study was approved by the Committee for Investigations Involving Human Subjects at the University of Iowa. Alveolar macrophages were cultured in complete medium at 1–5 × 106 cells per ml depending on the experiment. Most cultures were done in 1.8-ml microfuge tubes at 37 °C, 5% CO2. Inhibitors (LY294002 at 10 μm or SB202190 at 10 μm) were added 30 min before LPS (100 ng/ml). Whole cell protein was obtained by lysing the cells on ice for 20 min in 500 μl of lysis buffer (0.05 m Tris, pH 7.4, 0.15 m NaCl, 1% Nonidet P-40, 1 protease minitab (Roche Molecular Biochemicals)/10 ml, and 1× phosphatase inhibitor mixture (catalog number 524625;Calbiochem). The lysates were then sonicated for 20 s and incubated at 4 °C for 30 min, and the insoluble fraction was removed by centrifugation at 15,000 × g for 10 min. Protein determinations were made using a protein measurement kit from Bio-Rad (Hercules, CA). Western analysis for the presence of particular proteins or for phosphorylated forms of proteins was performed as described previously (33Thomas K.W. Monick M.M. Staber J.M. Yarovinsky T. Carter A.B. Hunninghake G.W. J. Biol. Chem. 2002; 277: 492-501Abstract Full Text Full Text PDF PubMed Scopus (121) Google Scholar). 50 μg of protein was mixed 1:1 with 2× sample buffer (20% glycerol, 4% SDS, 10% β-mercaptoethanol, 0.05% bromphenol blue, and 1.25 mTris, pH 6.8) and loaded onto a 10% SDS-PAGE gel and run at 30 mA for 3 h. Cell proteins were transferred to nitrocellulose with a Bio-Rad semi-dry transfer system, according to the manufacturer’s instructions. Equal loading of the protein groups on the blots was evaluated using Ponceau S, a staining solution designed for staining proteins on nitrocellulose membranes. The nitrocellulose was then blocked with 5% milk in TTBS (Tris-buffered saline with 0.1% Tween 20) for 1 h, washed, and then incubated with the primary antibody at dilutions of 1:500 to 1:2000 overnight. The blots were washed four times with TTBS and incubated for 1 h with horseradish-peroxidase conjugated anti-IgG antibody (1:5000 to 1:20,000). Immunoreactive bands were developed using a chemiluminescent substrate, ECL Plus (AmershamBiosciences). An autoradiograph was obtained, with exposure times of 10 s to 2 min. Alveolar macrophages were cultured in standard medium for 24 or 48 h with and without LPS (100 ng/ml) or LY294002 or both. In some experiments, IL-13 (10 ng/ml) was added 30 min before the LPS. After the culture period, the supernatants were harvested and stored at −70o until they were assayed. The amount of PGE2 in the supernatant was measured by ELISA. (Amersham Biosciences). Total RNA was isolated using the Absolutely RNA RT-PCR miniprep kit (Stratagene, La Jolla, CA) following the manufacturer’s instructions. RNA was quantitated using a RiboGreen kit (Molecular Probes, Eugene, OR). RNA samples were stored at −70 °C. 1 μg of total RNA was reverse-transcribed to cDNA using a RETROscript RT-PCR kit (Ambion, Austin, TX). The resulting cDNA was subjected to PCR in a Bio-Rad iCycler iQ system as follows: in a 0.2-ml PCR tube (Bio-Rad), 2 μl of cDNA was added to 48 μl of PCR reaction mixture containing 2 mm each dNTP (Invitrogen), 3.0 mmMgCl2 (Invitrogen), 1:15,000 SYBR Green I DNA dye (Molecular Probes, Eugene, OR), 0.2 μm of each sense and antisense primer (IDT, Coralville, IA), and 2.5 units of PlatinumTaqDNA (Invitrogen). Amplification and data collection was performed as described previously (34Sanlioglu S. Williams C.M. Samavati L. Butler N.S. Wang G. McCray P.B., Jr. Ritchie T.C. Hunninghake G.W. Zandi E. Engelhardt J.F. J. Biol. Chem. 2001; 276: 30188-30198Abstract Full Text Full Text PDF PubMed Scopus (348) Google Scholar). Primers for human COX2 and HPRT genes are as follows (5′ to 3′): COX2 sense, TCAGCCATACAGCAAATCCTT; COX2 antisense, GTGCACTGTGTTTGGAGTGG; HPRT sense, CCTCATGGACTGATTATGGAC; HPRT antisense, CAGATTCAACTTG- CGCTCATC. Relative quantitative gene expression was calculated as follows. For each sample assayed, the threshold cycles (Ct) for reactions amplifying COX2 and HPRT were determined. The COX2 Ct for each sample was corrected by subtracting the Ct for HPRT (ΔCt). Untreated controls were chosen as the reference samples, and the ΔCt for all LPS-treated experimental samples were subtracted by the ΔCt for the controls samples (ΔΔCt). Finally, LPS-treated COX2 mRNA abundance, relative to control COX2 mRNA abundance, was calculated by the formula 2 − (ΔΔCt). Validity of this approach was confirmed by using serial 10-fold dilutions of template containing COX2 and HPRT genes. Using this set of template mixtures, the amplification efficiencies for COX2 and HPRT amplimers were found to be identical. Statistical analysis was performed on densitometry data, ELISA results, and real-time PCR data. Significance was determined by Student's t test. For these studies, some of the cells were treated with LPS and/or the PI3K inhibitor, LY294002. LY294002 is a competitive inhibitor that binds to the ATP-binding site of PI3K (35Vlahos C.J. Matter W.F. Brown R.F. Traynor-Kaplan A.E. Heyworth P.G. Prossnitz E.R., Ye, R.D. Marder P. Schelm J.A. Rothfuss K.J. et al.J. Immunol. 1995; 154: 2413-2422PubMed Google Scholar, 36Vlahos C.J. Matter W.F. Hui K.Y. Brown R.F. J. Biol. Chem. 1994; 269: 5241-5248Abstract Full Text PDF PubMed Google Scholar). We have shown that in alveolar macrophages, LY294002 blocks PI3K activation and phosphorylation of Akt (15Monick M.M. Carter A.B. Robeff P.K. Flaherty D.M. Peterson M.W. Hunninghake G.W. J. Immunol. 2001; 166: 4713-4720Crossref PubMed Scopus (155) Google Scholar, 16Monick M.M. Mallampalli R.K. Carter A.B. Flaherty D.M. McCoy D. Robeff P.K. Peterson M.W. Hunninghake G.W. J. Immunol. 2001; 167: 5977-5985Crossref PubMed Scopus (59) Google Scholar). After culture for various periods of time, supernatants were harvested, and PGE2 was measured. LPS stimulation of alveolar macrophages resulted in increased amounts of PGE2. Significant levels of PGE2 first appear around 24 h and continue expanding out to 48 h (Fig.1A). The amounts of PGE2 were increased by inhibition of PI3K activity. At 24 h the increase with PI3K inhibition was 3- to 4-fold (Fig. 1B). At 48 h the increase was 8- to 10-fold. Because we found a significant difference in PGE2 at 24 h, and a 24-h culture period allowed us to avoid the significant viability differences in alveolar macrophages found at 48 h, the remaining experiments were done at 24 h. These data demonstrate that inhibition of the PI3K pathway increases the release of PGE2 after exposure to LPS significantly. The Th2 cytokine, IL-13, is a strong activator of the PI3K pathway (37Ceponis P.J. Botelho F. Richards C.D. McKay D.M. J. Biol. Chem. 2000; 275: 29132-29137Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 38Wright K. Ward S.G. Kolios G. Westwick J. J. Biol. Chem. 1997; 272: 12626-12633Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Therefore, we treated the cells with IL-13 (10 ng/ml) and LPS and evaluated release of PGE2. First we evaluated the effect of IL-13 on Akt activation in alveolar macrophages. We found that, consistent with the literature, IL-13 activated Akt (Fig.2A). The administration of IL-13 caused a decrease in LPS-induced PGE2 release (∼70%) (Fig.2B). These two pieces of data (LY294002-dependent increases in PGE2 and IL-13-dependent decreases in PGE2) suggest that the PI3K pathway regulates LPS-induced PGE2 production negatively.Figure 2IL-13 activates Akt and inhibits LPS-induced PGE2.A, alveolar macrophages were cultured with IL-13 (10 ng/ml) for various times (1 min to 6 h), whole cell lysates were obtained, and Western analysis was performed for Akt phosphorylation (serine 473) as described under “Experimental Procedures.” B, alveolar macrophages were cultured with and without LPS (100 ng/ml) and IL-13 (10 ng/ml) for 24 h. The supernatant was removed, and PGE2 levels were determined by ELISA. The data represent three separate experiments. **, p < 0.01.View Large Image Figure ViewerDownload Hi-res image Download (PPT) In alveolar macrophages, Akt activation depends on PI3K activity and can be used as an indicator of active PI3K (15Monick M.M. Carter A.B. Robeff P.K. Flaherty D.M. Peterson M.W. Hunninghake G.W. J. Immunol. 2001; 166: 4713-4720Crossref PubMed Scopus (155) Google Scholar). Akt activation occurs through phosphorylation of threonine 308 in the activation loop, followed by autophosphorylation of serine 473 in the carboxy-terminal region (39Toker A. Newton A.C. J. Biol. Chem. 2000; 275: 8271-8274Abstract Full Text Full Text PDF PubMed Scopus (419) Google Scholar). We evaluated phosphorylation of serine 473 as a marker of both PI3K and Akt activity. To determine whether there is high baseline PI3K activity in alveolar macrophages, we obtained cells from four normal volunteers, cultured them for 30 min with LY294002, and obtained whole cell lysates. Examining newly isolated alveolar macrophages, we found significant amounts of phosphorylated Akt at baseline that was decreased by LY294002 incubation (Fig.3). These data, combined with our earlier studies showing increased activation of PI3K after LPS, suggest that alveolar macrophages have a mechanism (PI3K activity) that dampens production of PGE2. Having found significant amounts of baseline and LPS-induced PI3K activity at early time points (5 min to 3 h) (see Fig. 3 and earlier studies (15Monick M.M. Carter A.B. Robeff P.K. Flaherty D.M. Peterson M.W. Hunninghake G.W. J. Immunol. 2001; 166: 4713-4720Crossref PubMed Scopus (155) Google Scholar, 16Monick M.M. Mallampalli R.K. Carter A.B. Flaherty D.M. McCoy D. Robeff P.K. Peterson M.W. Hunninghake G.W. J. Immunol. 2001; 167: 5977-5985Crossref PubMed Scopus (59) Google Scholar)), we next evaluated long term PI3K activation after exposure to LPS. We found that there was a time-dependent decrease in Akt activation (Fig.4). Akt activation was decreased to below baseline levels by 4 to 6 h after LPS and continued to decrease further out to 24 h. These data suggest that the inhibitory effect of PI3K on PGE2 decreases as cells begin to release PGE2. Inflammation-induced PGE2 production is regulated by the availability of arachidonic acid and by the production of COX2. Arachidonic acid is cleaved from phospholipids by PLA2. This provides a substrate for peroxidase, cyclooxygenase, and PGE synthase activities that lead to the generation of PGE2. The increased PGE2 seen with PI3K inhibition could be because of either increased production of COX2 or increased PLA2 activity. To determine whether the increased PGE2 was because of increased PLA2 activity or activation of the endogenous COX1, we bypassed PLA2 by providing exogenous arachidonic acid. The arachidonic acid was dried, resuspended in media, and added directly to the cultures. Previous studies have shown that arachidonic acid is taken up very quickly (5 min) by macrophages when added in this manner (40Mathur S.N. Field F.J. Spector A.A. Armstrong M.L. Biochim. Biophys. Acta. 1985; 837: 13-19Crossref PubMed Scopus (32) Google Scholar). Fig. 5A shows that when the cell is provided with free arachidonic acid at early time points there is no difference in the amount of PGE2 produced by endogenous enzymes. This suggests that the LY294002 is not acting on the endogenous COX1. Fig. 5B shows that if the arachidonic acid is provided after the production of LPS-induced COX2 (24 h), there are still demonstrable increases in PGE2 in the LY294002-treated cells. If LY294002 was acting primarily on PLA2, the added arachidonic acid should have eliminated the increase in PGE2 in the LY294002-treated group. The fact that we still see LY294002-induced increases in PGE2 with surplus amounts of arachidonic acid suggests that PI3K inhibition is acting at some point other than the release of arachidonic acid from phospholipids. For these studies, alveolar macrophages were treated for 24 h with LPS and LPS with LY294002, whole cell lysates were obtained, and COX2 protein was evaluated by Western analysis. The addition of LY294002 caused an ∼3-fold increase in the amount of COX2 protein after 24 h of LPS (Fig.6A). In addition, we evaluated the effect of LPS and PI3K inhibition on COX1 levels. Fig.6B shows that COX1 levels remain the same in control, Ly294002, LPS, and LPS with LY294002-treated cells. These data, combined with the previous experiment showing no effect of LY294002 on PLA2 activity or on the production of PGE2 by constitutive COX1, suggest that the increase in LPS-induced PGE2 in LY294002-treated cells is dependent on an increase in the production of COX2 protein. Alveolar macrophages were cultured with LPS with and without LY294002 for 6 or 24 h. RNA was isolated, and COX2 mRNA levels were analyzed via real-time RT-PCR. Fig.7 demonstrates that by 6 h after LPS treatment, LY294002 had increased the level of COX2 mRNA. By 24 h, the difference between LPS-treated cells and LPS with LY294002-treated cells had expanded significantly. The increase in COX2 mRNA and protein suggests that PI3K inhibition regulates LPS-induced COX2 production positively. COX2 mRNA stability is regulated at the 3′ untranslated region. The most abundant COX2 mRNA contains an exceptionally long untranslated region (2.5 kb) that contains multiple AUUUA repeats. Interactions at this region modulate the half-life of COX2 mRNA (27Lasa M. Mahtani K.R. Finch A. Brewer G. Saklatvala J. Clark A.R. Mol. Cell. Biol. 2000; 20: 4265-4274Crossref PubMed Scopus (366) Google Scholar, 30Lasa M. Brook M. Saklatvala J. Clark A.R. Mol. Cell. Biol. 2001; 21: 771-780Crossref PubMed Scopus (215) Google Scholar, 31Jang B.C. Sanchez T. Schaefers H.J. Trifan O.C. Liu C.H. Creminon C. Huang C.K. Hla T. J. Biol. Chem. 2000; 275: 39507-39515Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar). For these studies, cells were cultured for 24 h with and without LPS and LY294002. At 24 h, actinomycin D was added and RNA harvested at 1, 2, and 3 h. Fig. 8Ademonstrates that PI3K inhibition prolongs the half-life of LPS-induced COX2 mRNA. LPS-induced COX2 mRNA has a half-life of ∼2 h. When PI3K activity is suppressed, ∼80% of the COX2 mRNA remains at 3 h, and the mRNA half-life was ∼8 h (data not shown). These data suggest that one mechanism by which PI3K inhibition increases LPS-induced PGE2 production is by extending the half-life of COX2 mRNA. Several studies have identified p38 as an upstream regulator of COX2 message stability (27Lasa M. Mahtani K.R. Finch A. Brewer G. Saklatvala J. Clark A.R. Mol. Cell. Biol. 2000; 20: 4265-4274Crossref PubMed Scopus (366) Google Scholar, 30Lasa M. Brook M. Saklatvala J. Clark A.R. Mol. Cell. Biol. 2001; 21: 771-780Crossref PubMed Scopus (215) Google Scholar, 31Jang B.C. Sanchez T. Schaefers H.J. Trifan O.C. Liu C.H. Creminon C. Huang C.K. Hla T. J. Biol. Chem. 2000; 275: 39507-39515Abstract Full Text Full Text PDF PubMed Scopus (71) Google Scholar, 41Faour W.H., He, Y., He, Q.W. de Ladurantaye M. Quintero M. Mancini A. Di Battista J.A. J. Biol. Chem. 2001; 276: 31720-31731Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). To evaluate the role of p38 in the PI3K inhibition-induced COX2 mRNA stability, we added a p38 inhibitor 1 h before the addition of actinomycin D. The addition of a p38 inhibitor (SB202190) (42Lee J.C. Laydon J.T. McDonnell P.C. Gallagher T.F. Kumar S. Green D. McNulty D. Blumenthal M.J. Heys J.R. Landvatter S.W. et al.Nature. 1994; 372: 739-746Crossref PubMed Scopus (3113) Google Scholar) to the PI3K-inhibited LPS sample decreased the mRNA stability almost to the levels of LPS alone (Fig. 8B). The p38 inhibitor was not added until 1 h before the actinomycin D, because we wanted to focus on mRNA stability and not p38-driven transcriptional effects. These data suggest that an increase in p38 activity is necessary for much (though not all) of the incr

Using a human T-cell line sensitive to interleukin-2 (IL-2), we evaluated supernatants of unstimulated, purified lung T-lymphocytes from patients with sarcoidosis and high-intensity alveolitis (active disease), patients with sarcoidosis and low-intensity alveolitis (inactive disease), patients with idiopathic pulmonary fibrosis, and normal volunteers for the presence of IL-2. After 24 h in culture, supernatants of lung T-cells from patients with sarcoidosis and high-intensity alveolitis contained significantly greater amounts of IL-2 than did supernatants of lung T-cells from the other 3 groups, which we used as controls (p less than 0.001 for each comparison). The IL-2 present in supernatants of lung T-cells had a molecular weight of approximately 15,000 daltons and the supernatants that contained IL-2 significantly (p less than 0.01) increased in vitro immunoglobulin production by T-cell-depleted normal mononuclear cell suspensions stimulated with pokeweed mitogen. These studies suggest that the release of IL-2 by lung T-cells may explain in part the local proliferation of T-cells and hypergammaglobulinemia that are characteristic of pulmonary sarcoidosis.

Using a murine model of sepsis, we found that the balance of tissue pro- to anti-inflammatory cytokines directly correlated with severity of infection and mortality. Sepsis was induced in C57BL/6 mice by cecal ligation and puncture (CLP). Liver tissue was analyzed for levels of IL-1β, IL-1 receptor antagonist (IL-1ra), tumor necrosis factor (TNF)-α, and soluble TNF receptor 1 by ELISA. Bacterial DNA was measured using quantitative real-time PCR. After CLP, early predominance of proinflammatory cytokines (6 h) transitioned to anti-inflammatory predominance at 24 h. The elevated anti-inflammatory cytokines were mirrored by increased tissue bacterial levels. The degree of anti-inflammatory response compared with proinflammatory response correlated with the bacterial concentration. To modulate the timing of the anti-inflammatory response, mice were treated with IL-1ra before CLP. This resulted in decreased proinflammatory cytokines, earlier bacterial load, and increased mortality. These studies show that the initial tissue proinflammatory response to sepsis is followed by an anti-inflammatory response. The anti-inflammatory phase is associated with increased bacterial load and mortality. These data suggest that it is the timing and magnitude of the anti-inflammatory response that predicts severity of infection in a murine model of sepsis.

Rationale: Werner's syndrome is a genetic disorder that causes premature aging due to loss-of-function mutations in a gene encoding a member of the RecQ helicase family.Both Werner's syndrome and cigarette smoking accelerate aging.No studies have examined the effect of cigarette smoke on Werner's syndrome protein.Objectives: To investigate the role of Werner's syndrome protein in cigarette smoke-induced cellular senescence.Methods: Cellular senescence and amounts of Werner's syndrome protein were measured in fibroblasts isolated from patients with emphysema and compared with age-matched nonsmokers.The in vitro effects of cigarette smoke on amounts of Werner's syndrome protein, function, and senescence were also evaluated in primary human lung fibroblasts and epithelial cells.Measurements and Main Results: Cultured lung fibroblasts isolated from patients with emphysema exhibited a senescent phenotype accompanied by a decrease in Werner's syndrome protein.Cigarette smoke extract decreased Werner's syndrome protein in cultured fibroblasts and epithelial cells.Werner's syndrome protein-deficient fibroblasts were more susceptible to cigarette smoke-induced cellular senescence and cell migration impairment.In contrast, exogenous overexpression of Werner's syndrome protein attenuated the cigarette smoke effects.Conclusions: Cigarette smoke induces cellular senescence and cell migration impairment via Werner's syndrome protein downregulation.Rescue of Werner's syndrome protein down-regulation may represent a potential therapeutic target for smoking-related diseases.

Increasing numbers of individuals may be exposed to nanomaterials during pregnancy. The overarching goal of this investigation was to determine if prenatal inhalation exposure to copper nanoparticles (Cu NPs) has an effect on dams and offspring, including an analysis of inflammatory markers (Th1/Th2 cytokine profiles).Physicochemical characterization of Cu NPs was performed. Pregnant and non-pregnant mice (C57Bl/6 J) were exposed to Cu NPs or laboratory air in the whole-body chamber for 4 hrs/day on gestation days (GD) 3-19 (3.5 mg/m(3)). Animals were euthanized on GD 19 (0 week) or 7 weeks later. Bronchoalveolar lavage (BAL) fluid was analyzed for total and differential cells. Cytokine/chemokine concentrations were determined in the BAL fluid and the plasma of dams/non-pregnant mice and pups. Cu content was determined in the lungs and the blood of dams/non-pregnant mice and pups, in the placentas as well as in the whole bodies of pups immediately after delivery. Lungs and placentas were evaluated for histopathological changes. Gene expression of the Th1/Th2 profiles were analyzed in spleens of pups.The survival rate of 7 week old pups exposed to Cu NPs was significantly lower than control pups (73 vs. 97 %). The average litter size, male/female ratio, body weight and lenght at birth were not different between Cu NP-exposed and control mice. Both pregnant and non-pregnant mice exposed to Cu NPs had significant pulmonary inflammation with increased number of neutrophils in the BAL fluid compared to controls. Perivascular lymphoplasmacytic cuffing was found in the lungs of exposed mice and was more pronounced in the non-pregnant group. Similarly, levels of inflammatory cytokines/chemokines IL-12(p40), G-CSF, GM-CSF, KC, MCP-1, MIP-1α, MIP-1β, RANTES and TNF-α in BAL fluid were significantly higher in non-pregnant than pregnant exposed mice. Histopathology evaluation of placentas did not identify any pathological changes. No translocation of Cu into the placenta or the fetus was found by inductively coupled plasma-mass spectroscopy. Expression of several Th1/Th2 or other immune response genes in pups' spleens were found to be significantly up- or down-regulated.Prenatal exposure to Cu NPs caused a profound pulmonary inflammation in dams and strong immunomodulatory effects in offspring. There was no clear polarization of genes expressed in pups' spleens towards Th1 or Th2 type of response.

Abstract Respiratory syncytial virus (RSV) is an important respiratory pathogen that preferentially infects epithelial cells in the airway and causes a local inflammatory response. Very little is known about the second messenger pathways involved in this response. To characterize some of the acute response pathways involved in RSV infection, we used cultured human epithelial cells (A549) and optimal tissue culture-infective doses (TCID50) of RSV. We have previously shown that RSV-induced IL-8 release is linked to activation of the extracellular signal-related kinase (ERK) mitogen-activated protein kinase pathway. In this study, we evaluated the upstream events involved in ERK activation by RSV. RSV activated ERK at two time points, an early time point consistent with viral binding and a later sustained activation consistent with viral replication. We next evaluated the role of protein kinase C (PKC) isoforms in RSV-induced ERK kinase activity. We found that A549 cells contain the Ca2+-dependent isoforms α and β1, and the Ca2+-independent isoforms δ, ε, η, μ, θ, and ζ. Western analysis showed that RSV caused no change in the amounts of these isoforms. However, kinase activity assays demonstrated activation of isoform ζ within 10 min of infection, followed by a sustained activation of isoforms β1, δ, ε, and μ 24–48 h postinfection. A cell-permeable peptide inhibitor specific for the ζ isoform decreased early ERK kinase activation by RSV. Down-regulation of the other PKC isoforms with PMA blocked the late sustained activation of ERK by RSV. These studies suggest that RSV activates multiple PKC isoforms with subsequent downstream activation of ERK kinase.

Despite the fact that adeno-associated virus type 2 (AAV2) is an extremely attractive gene therapy vector, its application has been limited to certain tissues such as muscle and the brain. In an attempt to broaden the array of target organs for this vector, molecular studies on the mechanism(s) of AAV transduction have expanded over the past several years. These studies have led to the development of innovative strategies capable of overcoming intracellular barriers to AAV2 transduction. The basis of these technologic breakthroughs has stemmed from a better understanding of the molecular processes that control AAV entry and intracellular trafficking to the nucleus. This review will focus on the identification of molecular components important for recombinant AAV (rAAV) transduction while highlighting the techniques used to discover them and potential clinical application of research findings.

Previously, we have shown in a model of hypersensitivity pneumonitis that Th1-biased C57BL/6 mice are susceptible and Th2-biased DBA/2 mice are resistant to disease. We also showed that this was explained in part by differential regulation of IL-12 by IL-4. For these reasons, we postulated that C57BL/6 and DBA/2 mice differentially express IL-4. In this study, we show that C57BL/6 immune cells express Th2 but not Th1 cytokines at lower levels than DBA/2 cells. We also found that C57BL/6 splenocytes exhibit decreased mRNA stability of Th2 cytokines, relative to DBA/2 splenocytes. Stability of IL-2 and IFN-gamma were similar in the two strains of mice. Differences in Th2 cytokine mRNA stability between C57BL/6 and DBA/2 cells were not due to sequence polymorphism at specific regions of the IL-4/IL-13 locus. Furthermore, expression of Th1- and Th2-specific transcription factors T-bet and GATA-3, as well as the nuclear factor of activated T cells transcription factor, NFATc, was not significantly different between the two mice. Our data suggest that decreased mRNA stability of Th2 cytokines in C57BL/6 splenocytes may underlie the differential susceptibility to hypersensitivity pneumonitis between C57BL/6 and DBA/2 mice. Moreover, our results indicate that regulation of mRNA stability may serve as an important mechanism underlying Th1/Th2 immune polarization.

Respiratory syncytial virus (RSV) preferentially infects lung epithelial cells. Infected cells remain viable well into the infection. This prolonged survival results from RSV-induced activation of pro-survival pathways, including Akt and extracellular signal-related kinase (ERK). Sphingosine 1-phosphate (S1P) is a sphingolipid metabolite with demonstrated links to cell survival. It is enzymatically generated by sequential activation of ceramidase (generation of sphingosine) and sphingosine kinase (generation of S1P). In these studies, we found that RSV stimulated neutral ceramidase and sphingosine kinase activities in lung epithelial cells. The combined effect of activation of these two enzymes would decrease proapoptotic ceramide and increase antiapoptotic S1P. S1P activated Akt and ERK within minutes, and inhibition of sphingosine kinase blocked RSV-induced ERK and Akt activation, leading to accelerated cell death after viral infection. RSV infection does eventually kill infected cells but activation of cell survival pathways significantly delays cell death. The studies are the first evidence linking sphingolipid metabolites to cell survival mechanisms in the context of a viral infection.

Respiratory syncytial virus (RSV) is a clinically important pathogen. It preferentially infects airway epithelial cells causing bronchiolitis in infants, exacerbations in patients with obstructive lung disease, and life-threatening pneumonia in the immunosuppressed. The p53 protein is a tumor suppressor protein that promotes apoptosis and is tightly regulated for optimal cell growth and survival. A critical negative regulator of p53 is murine double minute 2 (Mdm2), an E3 ubiquitin ligase that targets p53 for proteasome degradation. Mdm2 is activated by phospho-Akt, and we previously showed that RSV activates Akt and delays apoptosis in primary human airway epithelial cells. In this study, we explore further the mechanism by which RSV regulates p53 to delay apoptosis but paradoxically enhance inflammation. We found that RSV activates Mdm2 1-6 h after infection resulting in a decrease in p53 6-24 h after infection. The p53 down-regulation correlates with increased airway epithelial cell longevity. Importantly, inhibition of the PI3K/Akt pathway blocks the activation of Mdm2 by RSV and preserves the p53 response. The effects of RSV infection are antagonized by Nutlin-3, a specific chemical inhibitor that prevents the Mdm2/p53 association. Nutlin-3 treatment increases endogenous p53 expression in RSV infected cells, causing earlier cell death. This same increase in p53 enhances viral replication and limits the inflammatory response as measured by IL-6 protein. These findings reveal that RSV decreases p53 by enhancing Akt/Mdm2-mediated p53 degradation, thereby delaying apoptosis and prolonging survival of airway epithelial cells.

Respiratory syncytial virus (RSV) is a ubiquitous virus that preferentially infects airway epithelial cells, causing asthma exacerbations and severe disease in immunocompromised hosts. Acute RSV infection induces inflammation in the lung. Thymus- and activation-regulated chemokine (TARC) recruits Th2 cells to sites of inflammation. We found that acute RSV infection of BALB/c mice increased TARC production in the lung. Immunization of BALB/c mice with individual RSV proteins can lead to the development of Th1- or Th2-biased T cell responses in the lung after RSV infection. We primed animals with a recombinant vaccinia virus expressing either the RSV fusion (F) protein or the RSV attachment (G) protein, inducing Th1- and Th2-biased pulmonary memory T cell responses, respectively. After RSV infection, TARC production significantly increased in the vaccinia virus G-primed animals only. These data suggest a positive feedback loop for TARC production between RSV infection and Th2 cytokines. RSV-infected lung epithelial cells cultured with IL-4 or IL-13 demonstrated a marked increase in the production of TARC. The synergistic effect of RSV and IL-4/IL-13 on TARC production reflected differential induction of NF kappa B and STAT6 by the two stimuli (both are in the TARC promoter). These findings demonstrate that RSV induces a chemokine TARC that has the potential to recruit Th2 cells to the lung.

Individuals exposed to cigarette smoke have a greater number and severity of viral infections, including respiratory syncytial virus (RSV) infections, than do nonsmokers, but the cellular mechanism is unknown. Our objective was to determine the mechanism by which cigarette smoke augments viral infection. We hypothesize that cigarette smoke causes necrosis and prevents virus-induced cellular apoptosis, and that this is associated with increased inflammation and viral replication. Primary airway epithelial cells were exposed to cigarette smoke extract for 2 days, followed by 1 day of RSV exposure. Western blot detection of cleaved caspases 3 and 7 showed less apoptosis when cells were treated with cigarette smoke before viral infection. This finding was confirmed with ELISA and TUNEL detection of apoptosis. Measures of cell viability, including propidium iodide staining, ATP assay, and cell counts, indicated that cigarette smoke causes necrosis rather than virus-induced apoptosis. Using plaque assay and fluorescently-labeled RSV, we showed that although there were less live cells in the cigarette smoke-pretreated group, viral load was increased. The effect was inhibited by pretreatment of cells with N-acetylcysteine and aldehyde dehydrogenase, suggesting that the effect was primarily mediated by reactive aldehydes. Cigarette smoke causes necrosis rather than apoptosis in viral infection, resulting in increased inflammation and enhanced viral replication.

The impact of respiratory syncytial virus (RSV) on morbidity and mortality is significant in that it causes bronchiolitis in infants, exacerbations in patients with obstructive lung disease, and pneumonia in immunocompromised hosts. RSV activates protein kinase R (PKR), a cellular kinase relevant to limiting viral replication (Groskreutz, D. J., Monick, M. M., Powers, L. S., Yarovinsky, T. O., Look, D. C., and Hunninghake, G. W. (2006) J. Immunol. 176, 1733-1740). It is activated by autophosphorylation, likely triggered by a double-stranded RNA intermediate during replication of the virus. In most instances, ph-PKR targets the alpha subunit of eukaryotic translation initiation factor 2 (eIF2alpha) protein via phosphorylation, leading to an inhibition of translation of cellular and viral protein. However, we found that although ph-PKR increases in RSV infection, significant eIF2alpha phosphorylation is not observed, and inhibition of protein translation does not occur. RSV infection attenuates eIF2alpha phosphorylation by favoring phosphatase rather than kinase activity. Although PKR is activated, RSV sequesters PKR away from eIF2alpha by binding of the kinase to the RSV N protein. This occurs in conjunction with an increase in the association of the phosphatase, PP2A, with eIF2alpha following PKR activation. The result is limited phosphorylation of eIF2alpha and continued translation of cellular and viral proteins.

Cigarette smoking is implicated in numerous diseases, including emphysema and lung cancer. The clinical expression of lung disease in smokers is not well explained by currently defined variations in gene expression or simple differences in smoking exposure. Alveolar macrophages play a critical role in the inflammation and remodeling of the lung parenchyma in smoking-related lung disease. Significant gene expression changes in alveolar macrophages from smokers have been identified. However, the mechanism for these changes remains unknown. One potential mechanism for smoking-altered gene expression is via changes in cytosine methylation in DNA regions proximal to gene-coding sequences. In this study, alveolar macrophage DNA from heavy smokers and never smokers was isolated and methylation status at 25,000 loci determined. We found differential methylation in genes from immune-system and inflammatory pathways. Analysis of matching gene expression data demonstrated a parallel enrichment for changes in immune-system and inflammatory pathways. A significant number of genes with smoking-altered mRNA expression had inverse changes in methylation status. One gene highlighted by this data was the FLT1, and further studies found particular up-regulation of a splice variant encoding a soluble inhibitory form of the receptor. In conclusion, chronic cigarette smoke exposure altered DNA methylation in specific gene promoter regions in human alveolar macrophages.

The local mechanisms that result in the cellular inflammation and bronchial airway hyperreactivity that characterize allergic bronchial asthma are poorly defined. In order to study these processes, we developed a method for local allergen challenge using a fiberoptic bronchoscope and direct observation and bronchoalveolar lavage (BAL) to assess the airway responses to allergen. In these studies, 11 allergic asthmatics (all of whom had previously demonstrated a late-phase asthmatic response to aeroallergen challenge) and 6 healthy, asymptomatic subjects volunteered to undergo bronchoalveolar lavage after local airway challenge via a bronchoscope wedged into subsegmental airways. These studies revealed that asthmatic airways respond to allergen with an immediate pallor followed by reactive hyperemia, edema, and bronchial narrowing. This site and a control site were relavaged at 48 or 96 h after the immediate response. Neutrophils and eosinophils increased significantly at 48 h after challenge, as did helper...

Hypersensitivity pneumonitis (HP) is a granulomatous, inflammatory lung disease caused by inhalation of organic Ags, most commonly thermophilic actinomycetes. Only a minority of individuals exposed to these Ags develops disease, suggesting that host factors are important for the expression of HP. We compared the expression of HP in a sensitive strain of mice, C57BL/6, and in a resistant strain of mice, DBA/2. They were exposed to the thermophilic bacteria Saccharopolyspora rectivirgula (SR) or to saline alone for 3 consecutive days/week for 3 wk. After exposure to Ag, C57BL/6 mice, but not DBA/2 mice, developed granulomatous inflammation with an increase in lung index (lung weight). Both strains had similar amounts of Ag delivered to the lungs after intranasal installation, as determined with 14C-labeled Ag. Both also had similar increases in total bronchoalveolar cells after Ag exposure, but the C57BL/6 mice had more lymphocytes. Compared with the resistant strain, the sensitive strain had a significantly greater Ag-induced increase in IL-12 and IFN-gamma gene expression. DBA/2 mice resembled sensitive, C57BL/6 mice if they received IL-12 augmentation therapy at the time of Ag exposure. These findings were not limited to lung, since both unstimulated and SR-stimulated spleen cells from C57BL/6 mice released significantly more IL-12 than cells from DBA/2 mice. However, spleen cells from DBA/2 mice made more IFN-gamma when exposed to IL-12, than cells from C57BL/6 mice. These results suggest that the IL-12 response to Ag may modulate in part the expression of HP.

Rhinoviruses are important upper respiratory pathogens that are strongly associated with asthma exacerbations. However, the inflammatory response to rhinovirus infection is poorly understood. Interleukin (IL)-8 has been implicated in the pathogenesis of respiratory viral infections and asthma. Rhinovirus-induced IL-8 release and mRNA induction were examined in peripheral blood mononuclear cells (PBMC). Rhinoviruses induced IL-8 release for up to 7 days after inoculation onto PBMC. This was associated with an increase in IL-8 mRNA expression that peaked 48 h after exposure to the virus. IL-8 protein production was reduced by UV inactivation of the virus and abolished by preventing virus-receptor binding. Although rhinovirus replication was not demonstrated in PBMC, low-grade productive infection was shown in the human monocyte cell line THP-l. Rhinovirus induction of IL-8 in monocytes or airway macrophages may be important in the pathogenesis of rhinovirus-induced asthma exacerbation.

The airway inflammation that results from respiratory syncytial virus infection is associated with a marked increase in interleukin 8 and neutrophils in the infected sites of the lung. In this study, the relationship between production of interleukin 8, infection of A549 cells by the virus, and activation of mitogen-activated protein kinases (MAPKs) was investigated. Infection of A549 cells by the virus caused an increase on the activity of extracellular signal-regulated kinase 2 (ERK2) by about 10-fold compared with the noninfected cells. The increase in the activity of ERK2 during the viral infection was an immediate event and occurred prior to the viral replication process. PD98059, which blocks the activation of MAPK/ERK kinase 1 (MEK1), inhibited the increase in the activity of ERK2 by infection of respiratory syncytial virus by about 50% at 10 microM. Pretreatment of A549 cells with PD98059 before the viral infection also inhibited the increase in the production of interleukin 8 by 50%, but had little effect on the mRNA level. The viral infection had no effect on the activities of p38 and c-jun N-terminal kinase (JNK). These observations suggest that activation of ERK2 by respiratory syncytial virus infection may be one of the mechanisms that result in the increase of the production of interleukin 8.

Respiratory syncytial virus (RSV) is an important respiratory pathogen that preferentially infects epithelial cells in the airway, and causes a local inflammatory response. Although it has been previously demonstrated that RSV-infected airway epithelial produce cytokines, including interleukin-8 (IL-8), which contributes to the inflammatory response, the regulation of this effect of RSV is unknown. To further characterize the mechanisms by which RSV infection triggers release of IL-8, we first exposed cultured A549 cells to RSV, and measured IL-8 release via enzyme-linked immunosorbent assays (ELISA), and IL-8 messenger RNA (mRNA) induction via Northern blot analysis. We observed a dose- and time-dependent release of IL-8 in response to RSV. The optimal dose of RSV was 10(4) TCID50/ml, and maximal release of IL-8 was measured at 72 to 96 h after infection. RSV induced a biphasic (early and late) increase in IL-8 mRNA. The early phase was independent of viral infection, whereas the more pronounced late phase required the presence of live virus and infection of the epithelium. Partial (< 50%) cytopathic effects were noted at 48 h and progressed to 75% at 96 h. The monolayer was still intact at 96 h. Inhibitors of nitric oxide, including NG-monomethyl-L-arginine (L-NMMA), NG-nitro-L-arginine methyl ester (L-NAME), and aminoguanidine had no effect on IL-8 release or IL-8 mRNA induction. We did, however, demonstrate a dose-dependent decrease in IL-8 release and IL-8 mRNA induction in RSV-infected epithelial treated with the antioxidants dimethyl sulfoxide (DMSO) or 5,5-dimethyl-1-pyrroline-N-oxide (DMPO). Peak effects were noted at a concentration of 2% DMSO and 50 microM DMPO. The antioxidants did not inhibit viral replication or infection. This data suggest that RSV-induced IL-8 production in airway epithelium is mediated via changes in oxidant tone. The data also suggest a potential therapeutic role for antioxidants in RSV infections.

The phosphatidylinositol (PI) 3-kinase pathway is an important regulator of cell survival. In human alveolar macrophages, we found that LPS activates PI 3-kinase and its downstream effector, Akt. LPS exposure of alveolar macrophages also results in the generation of ceramide. Because ceramide exposure induces apoptosis in other cell types and the PI 3-kinase pathway is known to inhibit apoptosis, we determined the relationship between LPS-induced ceramide and PI 3-kinase activation in alveolar macrophages. We found that ceramide exposure activated PI 3-kinase and Akt. When we blocked LPS-induced ceramide with the inhibitor D609, we blocked LPS-induced PI 3-kinase and Akt activation. Evaluating cell survival after ceramide or LPS exposure, we found that blocking PI 3-kinase induced a significant increase in cell death. Because these effects of PI 3-kinase inhibition were more pronounced in ceramide- vs LPS-treated alveolar macrophages, we also evaluated NF-kappaB, which has also been linked to cell survival. We found that LPS, to a greater degree than ceramide, induced NF-kappaB translocation to the nucleus. As a composite, these studies suggest that the effects of ceramide exposure in alveolar macrophages may be very different from the effects described for other cell types. We believe that LPS induction of ceramide results in PI 3-kinase activation and represents a novel effector mechanism that promotes survival of human alveolar macrophages in the setting of pulmonary sepsis.

Human cytomegalovirus (HCMV) is a common cause of morbidity and mortality in immunosuppressed patients, especially transplant recipients. In this population, infection is frequently due to reactivation of latent virus. The major immediate early promoter of HCMV controls production of immediate early gene products, which are both trans- and cis-active and are responsible for reactivation. Activation of this promoter is therefore a crucial step in regulation of reactivation infection. It is known that there are cAMP-response elements in the HCMV major immediate early promoter. We hypothesized that prostaglandins (PG), like PGE2, which are known to increase cAMP, as well as cytokines known to be released during acute inflammation, may be important in the regulation of this promoter and thus in reactivation of HCMV. To examine this, we transfected pCAT760, a plasmid containing the major immediate early promoter of HCMV upstream of a chloramphenicol acetyltransferase (CAT) gene, into THP-1 cells. These cells were subsequently stimulated with PGE2 and/or one of a variety of cytokines. We found that PGE2, tumor necrosis factor (TNF)-alpha, and interleukin (IL)-1 beta each upregulated the HCMV major immediate early promoter. TNF-alpha, IL-1 beta, IL-6, and IL-10 were each synergistic or additive with PGE2 in upregulating the promoter. Since PGE2 and the cytokines are all products of activated macrophages, we suggest that acute inflammation and macrophage activation may predispose to reactivation of latent HCMV.

Human cytomegalovirus (HCMV) immediate early (IE) genes act as trans-acting factors to upregulate various viral promoters. We used various IE plasmid constructs in transient transfection assays and demonstrated that the HCMV IE2 gene product upregulated expression from the interleukin (IL)-2 and IL-2 receptor (IL-2R) promoters and increased amounts of endogenous, steady-state IL-2 and IL-2R RNA. In marked contrast, the IE1 gene product, which can upregulate the major IE promoter and the IL-1 beta promoter, had no effect on the IL-2 and IL-2R promoters. These studies suggest a role for the HCMV IE2 gene product as a modulator of the inflammatory response associated with HCMV infection.

We examined the influence of untreated interstitial lung disease (ILD) on the in vitro release of interleukin-1β (IL-1β) and interleukin-1 receptor antagonist (IL-1ra) from alveolar macrophages (AM); AM were harvested from normal volunteers, ILD patients, and patients with asbestos-related pleural disease but no ILD. AM were cultured for 24 h and assays for IL-1β and IL-1ra were done using sensitive and specific enzyme-linked immunosorbent assay. A greater amount of IL-1β was detected in AM supernatants from asbestosis, sarcoidosis, and IPF patients than in those from normal subjects. The IL-1β: IL-1ra ratio (IL-1β activity index [IL-1AI]) was significantly lower in supernatants of normal macrophages compared with macrophage supernatants from individuals with ILD. The IL-1AI correlated with bronchoalveolar lavage cellularity, a marker of disease activity. Current smoking was associated with lower IL-1β and IL-1ra release in ILD. The IL-1AI is a convenient method for comparison of IL-1β activity between patient populations. We examined the influence of untreated interstitial lung disease (ILD) on the in vitro release of interleukin-1β (IL-1β) and interleukin-1 receptor antagonist (IL-1ra) from alveolar macrophages (AM); AM were harvested from normal volunteers, ILD patients, and patients with asbestos-related pleural disease but no ILD. AM were cultured for 24 h and assays for IL-1β and IL-1ra were done using sensitive and specific enzyme-linked immunosorbent assay. A greater amount of IL-1β was detected in AM supernatants from asbestosis, sarcoidosis, and IPF patients than in those from normal subjects. The IL-1β: IL-1ra ratio (IL-1β activity index [IL-1AI]) was significantly lower in supernatants of normal macrophages compared with macrophage supernatants from individuals with ILD. The IL-1AI correlated with bronchoalveolar lavage cellularity, a marker of disease activity. Current smoking was associated with lower IL-1β and IL-1ra release in ILD. The IL-1AI is a convenient method for comparison of IL-1β activity between patient populations.

The mechanisms regulating IL-4 mRNA stability in differentiated T cells are not known. We found that early exposure of CD4+ T cells to endogenous IL-4 increased IL-4 mRNA stability. This effect of IL-4 was mediated by the RNA-binding protein HuR. IL-4 mRNA interacted with HuR and the dominant binding site was shown within the coding region of IL-4 mRNA. Exposure of CD4+ T cells to IL-4 had no effects on HuR expression or subcellular localization, but triggered HuR binding to IL-4 mRNA. Thus, IL-4 plays a positive role in maintaining IL-4 mRNA stability in CD4+ T cells via a HuR-mediated mechanism.

Human alveolar macrophages, central to immune responses in the lung, are unique in that they have an extended life span in contrast to precursor monocytes. We have shown previously that the ERK MAPK (ERK) pathway is constitutively active in human alveolar macrophages and contributes to the prolonged survival of these cells. We hypothesized that ERK maintains survival, in part, by positively regulating protein translation. In support of this hypothesis, we have found novel links among ERK, JNK, protein phosphatase 1 (PP1), and the eukaryotic initiation factor (eIF) 2alpha. eIF2alpha is active when hypophosphorylated and is essential for initiation of protein translation (delivery of initiator tRNA charged with methionine to the ribosome). Using [(35)S]methionine labeling, we found that ERK inhibition significantly decreased protein translation rates in alveolar macrophages. Decreased protein translation resulted from phosphorylation (and inactivation) of eIF2alpha. We found that ERK inhibition increased JNK activity. JNK in turn inactivated (via phosphorylation) PP1, the phosphatase responsible for maintaining the hypophosphorylated state of eIF2alpha. As a composite, our data demonstrate that in human alveolar macrophages, constitutive ERK activity positively regulates protein translation via the following novel pathway: active ERK inhibits JNK, leading to activation of PP1alpha, eIF2alpha dephosphorylation, and translation initiation. This new role for ERK in alveolar macrophage homeostasis may help to explain the survival characteristic of these cells within their unique high oxygen and stress microenvironment.

On 20 March 2010, the Icelandic volcano Eyjafjallajökull erupted for the first time in 190 years. Despite many epidemiological reports showing effects of volcanic ash on the respiratory system, there are limited data evaluating cellular mechanisms involved in the response to ash. Epidemiological studies have observed an increase in respiratory infections in subjects and populations exposed to volcanic eruptions.We physicochemically characterized volcanic ash, finding various sizes of particles, as well as the presence of several transition metals, including iron. We examined the effect of Eyjafjallajökull ash on primary rat alveolar epithelial cells and human airway epithelial cells (20-100 µg/cm(2)), primary rat and human alveolar macrophages (5-20 µg/cm(2)), and Pseudomonas aeruginosa (PAO1) growth (3 µg/104 bacteria).Volcanic ash had minimal effect on alveolar and airway epithelial cell integrity. In alveolar macrophages, volcanic ash disrupted pathogen-killing and inflammatory responses. In in vitro bacterial growth models, volcanic ash increased bacterial replication and decreased bacterial killing by antimicrobial peptides.These results provide potential biological plausibility for epidemiological data that show an association between air pollution exposure and the development of respiratory infections. These data suggest that volcanic ash exposure, while not seriously compromising lung cell function, may be able to impair innate immunity responses in exposed individuals.

Despite being a major health problem, respiratory syncytial virus (RSV) infections remain without specific therapy. Identification of novel host cellular responses that play a role in the pathogenesis of RSV infection is needed for therapeutic development. The endoplasmic reticulum (ER) stress response is an evolutionarily conserved cellular signaling cascade that has been implicated in multiple biological phenomena, including the pathogenesis of some viral infections. In this study, we investigate the role of the ER stress response in RSV infection using an in vitro A549 cell culture model. We found that RSV infection induces a non-canonical ER stress response with preferential activation of the inositol-requiring enzyme 1 (IRE1) and activated transcription factor 6 (ATF6) pathways with no concomitant significant activation of the protein kinase R-like ER kinase (PERK) pathway. Furthermore, we discovered that IRE1 has an inhibitory effect on RSV replication. Our data characterize, for the first time, the nature of the ER stress response in the setting of RSV infection and identify the IRE1 stress pathway as a novel cellular anti-RSV defense mechanism. Despite being a major health problem, respiratory syncytial virus (RSV) infections remain without specific therapy. Identification of novel host cellular responses that play a role in the pathogenesis of RSV infection is needed for therapeutic development. The endoplasmic reticulum (ER) stress response is an evolutionarily conserved cellular signaling cascade that has been implicated in multiple biological phenomena, including the pathogenesis of some viral infections. In this study, we investigate the role of the ER stress response in RSV infection using an in vitro A549 cell culture model. We found that RSV infection induces a non-canonical ER stress response with preferential activation of the inositol-requiring enzyme 1 (IRE1) and activated transcription factor 6 (ATF6) pathways with no concomitant significant activation of the protein kinase R-like ER kinase (PERK) pathway. Furthermore, we discovered that IRE1 has an inhibitory effect on RSV replication. Our data characterize, for the first time, the nature of the ER stress response in the setting of RSV infection and identify the IRE1 stress pathway as a novel cellular anti-RSV defense mechanism.

Although many functions of human alveolar macrophages are altered compared with their precursor cell, the blood monocyte (monocyte), the reason(s) for these functional changes have not been determined. We recently reported that human alveolar macrophages do not express AP-1 DNA binding activity (Monick, M. M., Carter, A. B., Gudmundsson, G., Geist, L. J., and Hunninghake, G. W. (1998) Am. J. Physiol. 275, L389—L397). To determine why alveolar macrophages do not express AP-1 DNA binding activity, we first showed that there was not a decrease in expression of the FOS and JUN proteins that make up the AP-1 complex. There was, however, a significant difference in the amounts of the nuclear protein, REF-1 (which regulates AP-1 DNA binding by altering the redox status of FOS and JUN proteins), in alveolar macrophages compared with monocytes. In addition, in vitrodifferentiation of monocytes to a macrophage-like cell resulted in decreased amounts of REF-1. Finally, addition of REF-1 from activated monocytes to alveolar macrophage nuclear proteins resulted in a marked increase in AP-1 DNA binding. These studies strongly suggest that the process of differentiation of monocytes into alveolar macrophages is associated with a loss of REF-1 and AP-1 activity. This observation may explain, in part, some of the functional differences observed for alveolar macrophages compared with monocytes. Although many functions of human alveolar macrophages are altered compared with their precursor cell, the blood monocyte (monocyte), the reason(s) for these functional changes have not been determined. We recently reported that human alveolar macrophages do not express AP-1 DNA binding activity (Monick, M. M., Carter, A. B., Gudmundsson, G., Geist, L. J., and Hunninghake, G. W. (1998) Am. J. Physiol. 275, L389—L397). To determine why alveolar macrophages do not express AP-1 DNA binding activity, we first showed that there was not a decrease in expression of the FOS and JUN proteins that make up the AP-1 complex. There was, however, a significant difference in the amounts of the nuclear protein, REF-1 (which regulates AP-1 DNA binding by altering the redox status of FOS and JUN proteins), in alveolar macrophages compared with monocytes. In addition, in vitrodifferentiation of monocytes to a macrophage-like cell resulted in decreased amounts of REF-1. Finally, addition of REF-1 from activated monocytes to alveolar macrophage nuclear proteins resulted in a marked increase in AP-1 DNA binding. These studies strongly suggest that the process of differentiation of monocytes into alveolar macrophages is associated with a loss of REF-1 and AP-1 activity. This observation may explain, in part, some of the functional differences observed for alveolar macrophages compared with monocytes. Alveolar macrophages are critical cells that are important for pulmonary host defense and the development of inflammation in the lung (1Brown G.P. Monick M.M. Hunninghake G.W. Am. J. Physiol. 1988; 254: C809Crossref PubMed Google Scholar, 2Campbell D.A. Poulter L.W. Du Bois R.M. Thorax. 1986; 41: 429-434Crossref PubMed Scopus (23) Google Scholar, 3Carter A.B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1998; 18: 384-391Crossref PubMed Scopus (115) Google Scholar, 4Geist L.J. Hopkins H.A. Dai L.Y. He B. Monick M.M. Hunninghake G.W. Am. J. Respir. Cell Mol. Biol. 1997; 16: 31-37Crossref PubMed Scopus (34) Google Scholar, 5Hempel S.L. Monick M.M. He B. Yano T. Hunninghake G.W. J. Biol. Chem. 1994; 269: 32979-32984Abstract Full Text PDF PubMed Google Scholar, 6Hoogsteden H.C. van Dongen J.J. van Hal P.T. Delahaye M. Hop W. Hilvering C. Chest. 1989; 95: 574-577Abstract Full Text Full Text PDF PubMed Scopus (32) Google Scholar, 7Hunninghake G.W. Gadek J.E. Szapiel S.V. Strumpf I.J. Kawanami O. Ferrans V.J. Keogh B.A. Crystal R.G. Methods Cell Biol. 1980; : 95-105Crossref PubMed Scopus (35) Google Scholar, 8Hunninghake G.W. Ann. N. Y. Acad. Sci. 1986; 465: 82-90Crossref PubMed Scopus (20) Google Scholar, 9Kline J.N. Schwartz D.A. Monick M.M. Floerchinger C.S. Hunninghake G.W. Chest. 1993; 104: 47-53Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 10Monick M. Glazier J. Hunninghake G.W. Am. Rev. Respir. Dis. 1987; 135: 72-77PubMed Google Scholar, 11Monick M.M. Carter A.B. Gudmundsson G. Geist L.J. Hunninghake G.W. Am. J. Physiol. 1998; 275: L389-L397Crossref PubMed Google Scholar, 12Strieter R.M. Chensue S.W. Basha M.A. Standiford T.J. Lynch J.P. Baggiolini M. Kunkel S.L. Am. J. Respir. Cell Mol. Biol. 1990; 2: 321-326Crossref PubMed Scopus (171) Google Scholar). Alveolar macrophages are derived from monocytes after migration of the cells into the lung and differentiation into more mature macrophages (13Hempel S.L. Monick M.M. Hunninghake G.W. J. Clin. Invest. 1994; 93: 391-396Crossref PubMed Scopus (289) Google Scholar, 14Peters-Golden M. McNish R.W. Brieland J.K. Fantone J.C. J. Immunol. 1990; 144: 4320-4326PubMed Google Scholar). During the process of differentiation, there are a number of phenotypic changes that result in an increased capacity to adhere to various surfaces, an increased phagocytic ability, a difference in morphology, and a changed ability to secrete cytokines (15Elias J.A. Schreiber A.D. Gustilo K. Chien P. Rossman M.D. Lammie P.J. Daniele R.P. J. Immunol. 1985; 135: 3198-3204PubMed Google Scholar, 16Balter M.S. Toews G.B. Peters-Golden M. J. Immunol. 1989; 142: 602-608PubMed Google Scholar). Although these differences in phenotype are well described, there is little information about changes in signal transduction pathways that might mediate the different functions of these two cell types. The only relevant studies are those of Peters-Golden et al. (14Peters-Golden M. McNish R.W. Brieland J.K. Fantone J.C. J. Immunol. 1990; 144: 4320-4326PubMed Google Scholar) and a study by Monick et al. (11Monick M.M. Carter A.B. Gudmundsson G. Geist L.J. Hunninghake G.W. Am. J. Physiol. 1998; 275: L389-L397Crossref PubMed Google Scholar). Both of these studies noted that normal alveolar macrophages had a decreased capacity to express protein kinase C activity, compared with monocytes or other macrophages. In the study by Monick et al. (11Monick M.M. Carter A.B. Gudmundsson G. Geist L.J. Hunninghake G.W. Am. J. Physiol. 1998; 275: L389-L397Crossref PubMed Google Scholar), we also found that normal human alveolar macrophages had a decreased capacity to express protein kinase C-induced AP-1 DNA binding. There are a number of FOS- and JUN-like proteins that can form the heterodimers or homodimers that make up the AP-1 complexes (17Karin M. J. Biol. Chem. 1995; 270: 16483-16486Abstract Full Text Full Text PDF PubMed Scopus (2258) Google Scholar, 18Karin M. Liu Z. Zandi E. Curr. Opin. Cell Biol. 1997; 9: 240-246Crossref PubMed Scopus (2324) Google Scholar, 19Foletta V.C. Segal D.H. Cohen D.R. J. Leukocyte Biol. 1998; 63: 139-152Crossref PubMed Scopus (315) Google Scholar, 20McBride K. Nemer M. Mol. Cell. Biol. 1998; 18: 5073-5081Crossref PubMed Google Scholar). The classic complex is comprised of c-FOS and c-JUN, and these proteins are found in the nucleus of cells. AP-1 activity can be regulated at many levels, including transcription of genes that code for AP-1 proteins, message stability, and translation of the mRNAs. AP-1 activity is also regulated by the composition of the AP-1 complexes, phosphorylation of the proteins, and redox regulation of cysteine residues in the AP-1 proteins (17Karin M. J. Biol. Chem. 1995; 270: 16483-16486Abstract Full Text Full Text PDF PubMed Scopus (2258) Google Scholar, 18Karin M. Liu Z. Zandi E. Curr. Opin. Cell Biol. 1997; 9: 240-246Crossref PubMed Scopus (2324) Google Scholar, 19Foletta V.C. Segal D.H. Cohen D.R. J. Leukocyte Biol. 1998; 63: 139-152Crossref PubMed Scopus (315) Google Scholar, 20McBride K. Nemer M. Mol. Cell. Biol. 1998; 18: 5073-5081Crossref PubMed Google Scholar, 21Bernstein L.R. Ferris D.K. Colburn N.H. Sobel M.E. J. Biol. Chem. 1994; 269: 9401-9404Abstract Full Text PDF PubMed Google Scholar). The redox status of the AP-1 protein complex determines the binding of AP-1 to DNA. A dual function nuclear protein called REF-1 (or apurinic/apyrimidinic endonuclease DNA repair enzyme) regulates the binding activity of AP-1 (22Xanthoudakis S. Miao G. Wang F. Pan Y.C. Curran T. EMBO J. 1992; 11: 3323-3335Crossref PubMed Scopus (826) Google Scholar, 23Xanthoudakis S. Curran T. EMBO J. 1992; 11: 653-665Crossref PubMed Scopus (602) Google Scholar, 24Xanthoudakis S. Miao G.G. Curran T. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 23-27Crossref PubMed Scopus (320) Google Scholar, 25Hirota K. Matsui M. Iwata S. Nishiyama A. Mori K. Yodoi J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3633-3638Crossref PubMed Scopus (728) Google Scholar). This protein has two distinct and separate functions that involve different parts of the protein. REF-1 repairs apurinic/apyrimidinic sites in DNA, and it is activated by thioredoxin to reduce cysteine residues on both FOS and JUN enabling DNA binding by AP-1 (22Xanthoudakis S. Miao G. Wang F. Pan Y.C. Curran T. EMBO J. 1992; 11: 3323-3335Crossref PubMed Scopus (826) Google Scholar, 23Xanthoudakis S. Curran T. EMBO J. 1992; 11: 653-665Crossref PubMed Scopus (602) Google Scholar, 24Xanthoudakis S. Miao G.G. Curran T. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 23-27Crossref PubMed Scopus (320) Google Scholar, 25Hirota K. Matsui M. Iwata S. Nishiyama A. Mori K. Yodoi J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3633-3638Crossref PubMed Scopus (728) Google Scholar). This study analyzed possible mechanisms for the lack of AP-1 DNA binding in alveolar macrophages. We found no differences in expression of c-FOS or c-JUN proteins in alveolar macrophages compared with monocytes at base line or after protein kinase C stimulation. We did find that alveolar macrophages are deficient in REF-1. Reconstituting alveolar macrophage nuclear proteins with monocyte-derived REF-1 reconstituted AP-1 binding activity. In addition, when monocytes were allowed to differentiate into macrophages, in vitro, they lost REF-1 and the ability to respond to PMA 1The abbreviations used are: PMA, phorbol 12-myristate 13-acetate; RPMI, Roswell Park Memorial Institute; LPS, lipopolysaccharide. with increased AP-1 binding. We conclude that the process of differentiation of monocytes into alveolar macrophages is accompanied by a loss of REF-1, affecting AP-1 binding and subsequent expression of AP-1-driven genes. Alveolar macrophages were obtained from bronchoalveolar lavage as described previously (5Hempel S.L. Monick M.M. He B. Yano T. Hunninghake G.W. J. Biol. Chem. 1994; 269: 32979-32984Abstract Full Text PDF PubMed Google Scholar). Briefly, normal volunteers with a lifetime non-smoking history, no acute or chronic illness, and no current medications, underwent bronchoalveolar lavage. The lavage procedure used five 25-ml aliquots of sterile, warmed saline in each of three segments of the lung. The lavage fluid was filtered through two layers of gauze and centrifuged at 1500 × g for 5 min. The cell pellet was washed twice in Hanks' balanced salt solution without Ca2+and Mg2+ and suspended in complete medium, Roswell Park Memorial Institute (RPMI) tissue culture medium (Life Technologies, Inc.), with 5% fetal calf serum (HyClone, Logan, UT) and added gentamycin (80 μg/ml). Differential cell counts were determined using a Wright-Giemsa-stained cytocentrifuge preparation. All cell preparations had between 90 and 100% alveolar macrophages. This study was approved by the Committee for Investigations Involving Human Subjects at the University of Iowa. 180 ml of heparinized blood was obtained by venipuncture of the same volunteers who underwent bronchoscopy. Monocytes were isolated using a Ficoll-Paque gradient (Sigma). After harvesting the mononuclear cell layer, cells were washed four times in phosphate-buffered saline and then resuspended in RPMI medium. Additional purification was obtained by a 1-h adherence at 37 oC. Non-adherent cells were then washed off, and RPMI medium was added back to the adherent cells. In some instances the monocytes were allowed to differentiate into more macrophage-like cells. In order to do this, adherent monocytes were cultured in RPMI with 10% added human AB serum for a period of 7–10 days. At the end of that period, floating cells were washed off, and the remaining adherent cells had spread out and obtained the pancake-like appearance of macrophages. Alveolar macrophages and monocytes were cultured for 3 h with or without 100 ng/ml PMA. The nuclear pellets were prepared by resuspending cells in 0.4 ml of lysis buffer (10 mm HEPES, pH 7.8, 10 mm KCl, 2 mmMgCl2, 0.1 mm EDTA), placing them on ice for 15 min, and then vigorously mixing after the addition of 25 μl of 10% Nonidet P-40. After a 30-s centrifugation (16,000 × g, 4 °C), the pelleted nuclei were resuspended in 50 μl of extraction buffer (50 mm HEPES, pH 7.8, 50 mm KCl, 300 mm NaCl, 0.1 mm EDTA, 10% glycerol) and incubated on ice for 20 min. Nuclear extracts were stored at 70 °C. The DNA binding reaction (electrophoretic mobility shift assay) was done at room temperature in a mixture containing 5 μg of nuclear proteins, 1 μg of poly(dI-dC), and 15,000 cpm of32P-labeled double-stranded oligonucleotide probe for 30 min. The samples were fractionated through a 5% polyacrylamide gel in 1× TBE (Tris base 6.05 g/liter, boric acid 3.06 g/liter, EDTA-Na2·H2O 0.37 g/liter). Sequence of the nucleotide was 5′-CGCTTGATGAGTCAGCCGGAA-3′ (AP-1). Experiments were repeated 3 times. Supershift assays were performed by incubating the nuclear protein with antibodies specific for c-FOS and c-JUN (Santa Cruz Biotechnology, Santa Cruz, CA) for 30 min at room temperature before the addition of the labeled DNA probe. Specific c-FOS and c-JUN proteins are indicated by a higher band on the gel and by an overall decrease in binding. Whole-cell RNA was isolated using RNA Stat-60 according to the manufacturer's instructions (Tel-Test “B”, Friendswood, TX). The isolated RNA was fractionated in a 1.5% denaturing agarose gel containing 2.2m formaldehyde. An RNA ladder (0.24–9.5 kilobase pairs; Life Technologies, Inc.) was included as a molecular size standard. RNA loading was confirmed by equivalent ethidium bromide staining in each lane. The RNAs were transferred to GeneScreen Plus (NEN Life Science Products) as suggested by the manufacturer. c-FOS and c-JUN cDNA probes (generated by polymerase chain reaction with primers obtained from CLONTECH, Palo Alto, CA) were labeled with [γ-32P]CTP (NEN Life Science Products) by the random primer method. Blots were prehybridized for 3 h at 42 °C (formamide 10 ml, NaCl 5 mm, 50% dextran 4 ml, 10% SDS, Tris, pH 7.0, 1 m, and 0.4 ml 50× Denhardt's solution) and then hybridized with the labeled probe overnight at 42 °C. The filters were washed twice with 1× SSC at 25 °C, twice with 1× SSC plus 1% SDS at 65 °C, and then once with 0.1× SSC at 25 °C. The filters were exposed to autoradiographic film at −70 °C. For these studies, alveolar macrophages and monocytes were cultured for 3 h with or without PMA (10 or 100 ng/ml). At the end of the culture period, either whole-cell protein extracts or nuclear protein extracts (see gel shift protocol) were obtained as described previously (11Monick M.M. Carter A.B. Gudmundsson G. Geist L.J. Hunninghake G.W. Am. J. Physiol. 1998; 275: L389-L397Crossref PubMed Google Scholar). The cell material was sonicated 15 s on ice, allowed to sit for 20 min, and then centrifuged at 15,000 × g for 10 min. An aliquot of the supernatant was used to determine protein concentration by the Coomassie Blue method. Equal amounts of protein (100 μg for whole cell extracts and 20 μg for nuclear extracts) were mixed 1:1 with 2× sample buffer and loaded onto a 10% SDS-polyacrylamide gel and run at 80 V for 2 h. Cell proteins were transferred to nitrocellulose (ECL, Amersham Pharmacia Biotech) overnight at 30 V and visualized using c-FOS, c-JUN, or REF-1-specific antibodies (Santa Cruz Biotechnology, Santa Cruz, CA). Immunoreactive bands were developed using a chemiluminescent substrate (ECL, Amersham Pharmacia Biotech). In order to evaluate the effect of PMA (a model of protein kinase C-driven activation) on AP-1 DNA binding in monocytes and alveolar macrophages from the same individual, cells were cultured for 3 h with and without PMA (10 ng/ml) and LPS (1 μg/ml) for 3 h. Nuclear proteins were isolated, and DNA binding was evaluated in a standard gel shift assay. In Fig.1 A, we show that PMA caused an increase in protein binding to the AP-1 consensus sequence with nuclear protein from monocytes and but not with nuclear protein from alveolar macrophages. LPS did not increase AP-1 binding in monocytes or alveolar macrophages. In Fig. 1 B, we use cold competition to show that it is the upper band (seen only with monocyte samples) that can be competed off with cold AP-1 oligonucleotide. In order to confirm that the alveolar macrophages were functional, we also evaluated binding to the NF-κB sequence. We showed that LPS increases both monocyte and alveolar macrophage nuclear protein binding to the NF-κB consensus sequence (data not shown). In Fig. 2, we show that PMA causes an increase in AP-1 binding in monocytes over a prolonged time course (0.5–6 h). At none of these time points was there the appearance of AP-1 binding activity in alveolar macrophages. These data show that the difference in AP-1 binding activity between monocytes and macrophages is not simply a function of different response times. One possible explanation for the lack of AP-1 DNA binding in alveolar macrophages is that alveolar macrophages do not make the same amounts of AP-1 proteins as monocytes. We initially evaluated the composition of the PMA-induced AP-1-binding proteins in monocytes with a supershift assay. Both the upward shift of the band and the decrease in binding shown in Fig.3 demonstrate that the monocyte AP-1 complex includes both c-FOS and c-JUN proteins. We next analyzed both cell types for the production of specific c-FOS and c-JUN mRNAs. Cells were cultured for 3 h, as in the gel shift experiments, and then harvested- and whole-cell RNA was extracted (Fig.4 A). Both monocytes and alveolar macrophages responded to PMA with increased amounts of c-FOS and c-JUN message. Compared with monocytes, the alveolar macrophages show increased amounts of both c-FOS and c-JUN mRNA. We next evaluated c-FOS and c-JUN proteins in PMA-treated cells. Both alveolar macrophages and monocytes responded to PMA with increases in amounts of c-FOS and c-JUN proteins (Fig. 4 B). These experiments suggest that the decreased AP-1 binding to DNA observed in alveolar macrophages is not due to a lack of the appropriate AP-1 proteins.Figure 4PMA induces increased c-FOS and c-JUN mRNA and protein in both monocytes and alveolar macrophages.Monocytes and alveolar macrophages were cultured with LPS (1 μg/ml) or PMA (100 ng/ml) for 3 h. A, whole cell RNA was obtained and run out on a 1.5% formaldehyde gel. A Northern blot was obtained and probed with 32P-labeled c-DNA, specific for c-FOS and c-JUN. This is an autoradiogram of the labeled blot.B, whole-cell protein from cells treated identically to the mRNA cells was isolated and run out on a 10% polyacrylamide-SDS gel. Western analysis was performed, and c-FOS and c-JUN were visualized using c-FOS- and c-JUN-specific antibodies and chemiluminescence. These are autoradiograms of the immunoreactive bands.View Large Image Figure ViewerDownload (PPT) Binding of AP-1 proteins to the DNA is determined not only by presence of the transcription factor but also by its redox state that is regulated by REF-1. In order to determine if the observed differences in AP-1 binding between monocytes and alveolar macrophages could be explained by differences in amounts of the protein REF-1, we obtained nuclear protein from both alveolar macrophages and monocytes from three different individuals. Western analysis for REF-1 was performed, and the results are shown in Fig.5, A and B. In all three individuals there was significantly more REF-1 in the nuclei of monocytes than in the nuclei of alveolar macrophages. This experiment provided a possible explanation for the lack of AP-1 binding observed in PMA-treated alveolar macrophages. In order to make sure that treatment of the cells is not changing the amounts of REF-1, we evaluated REF-1 protein levels in both alveolar macrophages and monocytes that were treated with either LPS or PMA for 3 h. As shown in Fig. 6, neither LPS nor PMA altered the amounts of REF-1 in the cells.Figure 6LPS and PMA do not change the amounts of REF-1 in either alveolar macrophages or monocytes. Nuclear protein was isolated from monocytes and alveolar macrophages after 3 h of treatment with either LPS (1 μg/ml) or PMA (100 ng/ml). Western analysis was performed on 20 μg/sample of nuclear protein. REF-1 was visualized using an REF-1-specific antibody and chemiluminescence. This is an autoradiogram of the immunoreactive bands.View Large Image Figure ViewerDownload (PPT) We next performed an experiment that links differentiation of monocytes to the defect in AP-1 DNA binding seen in alveolar macrophages. As an in vitrocorrelate of the in vivo differentiation of monocytes into alveolar macrophages, we evaluated the amount of REF-1 in the nucleus of differentiated monocytes and the ability of PMA to induce AP-1 binding in differentiated monocytes. In order to do this, we obtained blood monocytes and harvested nuclear protein from half the cells immediately after isolation. The remaining cells were put into culture with 10% human AB serum for 7 days. At the end of this time period, the cells morphologically resembled macrophages and nuclear protein was isolated. Fig. 7 shows that the process of differentiation into macrophage-like cells is associated with decreased amounts of REF-1. Fig. 8 is an AP-1 gel shift with PMA-treated nuclear proteins from monocytes compared with differentiated monocytes. The differentiated monocytes have lost their ability to increase AP-1 binding with PMA. There is more AP-1 binding in the control differentiated monocytes than in the control undifferentiated monocytes. This could just be a function of the difference between in vitro differentiation and in vivo differentiation. As a composite these two experiments show that with differentiation monocytes have reduced amounts of REF-1 and do not respond to PMA with increased AP-1 DNA binding.Figure 8In vitro differentiation of monocytes results in a decreased amount of PMA-induced AP-1 binding. Monocytes were harvested and either treated immediately with PMA (100 ng/ml) and nuclear protein isolated or cultured for 7 days on plastic, followed by 3 h incubation with PMA (100 ng/ml), followed by isolation of nuclear protein. A gel shift assay, as described for Fig. 1, was then performed.View Large Image Figure ViewerDownload (PPT) The second experiment to link a defect in AP-1 binding to REF-1 was performed in alveolar macrophages. Both monocytes and alveolar macrophages were cultured with and without PMA, and nuclear protein was isolated. We next immunoprecipitated REF-1 from 20 μg of monocyte nuclear extract and added it to the macrophage nuclear proteins 15 min before addition of the labeled probe and allowed to sit at room temperature. Fig.9 shows that PMA-treated macrophages alone do not exhibit significant amounts of AP-1 DNA binding (2nd lane) and that the addition of monocyte REF-1 results in AP-1 binding (3rd lane). The amount of AP-1 binding in the control alveolar macrophage is a function of the variation found between individuals. Some people showed no AP-1 binding, and others showed a small amount of base-line binding. None of the individuals studied showed any increase in binding with the addition of PMA. We also performed a number of controls as follows: the4th lane contains macrophage nuclear extract with monocyte protein precipitated with an isotype control antibody (rabbit IgG), the 5th lane contains macrophage nuclear protein with monocyte protein precipitated with an irrelevant antibody (αp65, Santa Cruz Biotechnology), and the 6th lane contains immunoprecipitated monocyte REF-1 with no macrophage nuclear protein. Also shown on this blot is an AP-1 gel shift of the monocyte nuclear protein used for the immunoprecipitations. This figure shows that AP-1 proteins from PMA-treated alveolar macrophages can bind to DNA after monocyte REF-1 has been added. This study shows that the defect in protein kinase C-induced AP-1 DNA binding activity seen in normal alveolar macrophages, compared with monocytes, is due to a relative lack of the redox protein, REF-1, and is not due to a lack of AP-1 proteins. We were able to reconstitute normal AP-1 DNA binding in alveolar macrophage nuclear extracts by adding REF-1 from monocytes. This was specific for AP-1, since the DNA binding activity of NF-κB was similar in alveolar macrophages and monocytes. This loss of REF-1 in alveolar macrophages may be due to the process of macrophage differentiation since monocytes lost REF-1 as they differentiated in vitro, into macrophage-like cells. To our knowledge, this study is the first description of normal cells with a defect in AP-1 binding caused by a lack of REF-1. AP-1 is an important regulator of expression of many genes. The relative lack of REF-1 and AP-1 DNA binding activity may explain, in part, the functional differences between alveolar macrophages and their precursors, monocytes. REF-1 is a ubiquitous nuclear protein found in mammalian nuclear extracts. It was initially studied for its DNA repair function, which is found at the C-terminal portion of the molecule. The redox regulator, located close to the N terminus, is structurally and functionally distinct from the DNA portion of the molecule (35Rothwell D.G. Barzilay G. Gorman M. Morera S. Freemont P. Hickson I.D. Oncol. Res. 1997; 9: 275-280PubMed Google Scholar, 36Abate L. Patel L. Rauscher F.J. Currau T. Science. 1990; 249: 1157-1161Crossref PubMed Scopus (1377) Google Scholar). REF-1, itself, is controlled by redox modification of cysteines by the protein, thioredoxin (25Hirota K. Matsui M. Iwata S. Nishiyama A. Mori K. Yodoi J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3633-3638Crossref PubMed Scopus (728) Google Scholar). REF-1 controls the DNA binding capacity of FOS and JUN proteins through conserved cysteine residues flanked by basic amino acids found in the DNA binding domain of all FOS- and JUN-related proteins (37Kerppola T.K. Curran T. Science. 1991; 254: 1210-1214Crossref PubMed Scopus (163) Google Scholar, 38Kerppola T.K. Curran T. Cell. 1991; 66: 317-326Abstract Full Text PDF PubMed Scopus (257) Google Scholar). There are only a few previously described instances of modulation of the expression of REF-1. Fung et al. (26Fung H. Kow Y.W. Van Houten B. Taatjes D.J. Hatahet Z. Janssen Y.M. Vacek P. Faux S.P. Mossman B.T. Cancer Res. 1998; 58: 189-194PubMed Google Scholar) showed that asbestos caused an increase in REF-1 gene expression in mesothelial cells. Asai et al. (27Asai T. Kambe F. Kikumori T. Seo H. Biochem. Biophys. Res. Commun. 1997; 236: 71-74Crossref PubMed Scopus (39) Google Scholar) showed that thyrotropin increased REF-1 mRNA and protein in rat thyroid FRTL-5 cells, and Suzuki et al. (28Suzuki S. Nagaya T. Suganuma N. Tomoda Y. Seo H. Biochem. Mol. Biol. Int. 1998; 44: 217-224PubMed Google Scholar) showed that human chorionic gonadotropin increased REF-1 in murine Leydig cells. In an animal model, Gillardonet al. (29Gillardon F. Bottiger B. Hossmann K.A. Brain Res. Mol. Brain Res. 1997; 52: 194-200Crossref PubMed Scopus (46) Google Scholar) showed that global ischemia induced by cardiac arrest increased expression of REF-1 in the rat hippocampus. All of these studies are cases in which an intervention results in an increase in REF-1 expression. In contrast to these studies, Robertson et al. (30Robertson K.A. Hill D.P. Xu Y. Liu L. Van Epps S. Hockenbery D.M. Park J.R. Wilson T.M. Kelley M.R. Cell Growth Differ. 1997; 8: 443-449PubMed Google Scholar) showed that induction of apoptosis in HL-60 cells results in down-regulation of REF-1. Walton et al. (31Walton M. Lawlor P. Sirimanne E. Williams C. Gluckman P. Dragunow M. Brain Res. Mol. Brain Res. 1997; 44: 167-170Crossref PubMed Scopus (64) Google Scholar) evaluated rat brains following ischemia and found that apoptotic cells had a significant decrease in amounts of REF-1. One possible explanation for our data is that the alveolar macrophages are undergoing apoptosis. This is not likely since all studies of normal human alveolar macrophages reported to date showed that the cells must be exposed to a toxic stimulus to trigger apoptosis. We showed in a number of studies that alveolar macrophages are not activated, unless they are exposed to endotoxin or another stimulus in vitro (5Hempel S.L. Monick M.M. He B. Yano T. Hunninghake G.W. J. Biol. Chem. 1994; 269: 32979-32984Abstract Full Text PDF PubMed Google Scholar, 9Kline J.N. Schwartz D.A. Monick M.M. Floerchinger C.S. Hunninghake G.W. Chest. 1993; 104: 47-53Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 10Monick M. Glazier J. Hunninghake G.W. Am. Rev. Respir. Dis. 1987; 135: 72-77PubMed Google Scholar, 11Monick M.M. Carter A.B. Gudmundsson G. Geist L.J. Hunninghake G.W. Am. J. Physiol. 1998; 275: L389-L397Crossref PubMed Google Scholar, 32Hopkins H.A. Monick M.M. Hunninghake G.W. Am. J. Physiol. 1995; 269: L849-L854Crossref PubMed Google Scholar, 33Hopkins H.A. Monick M.M. Hunninghake G.W. J. Infect. Dis. 1996; 174: 69-74Crossref PubMed Scopus (23) Google Scholar). Our studies evaluated REF-1 immediately after the cells were obtained from normal volunteers. These observations are supported by observations of Bingisser et al. (34Bingisser R. Stey C. Weller M. Groscurth P. Russi E. Frei K. Am. J. Respir. Cell Mol. Biol. 1996; 15: 64-70Crossref PubMed Scopus (102) Google Scholar) who showed that unstimulated normal human alveolar macrophages do not undergo apoptosis but that apoptosis could be induced in human alveolar macrophages by high levels of endotoxin. These studies are the first to show that a normal cell can be deficient in REF-1 and that this can result in a defect in AP-1 DNA binding. These studies also suggest that it is the process of differentiation that results in the decreased levels of REF-1 in alveolar macrophages. The findings that we describe in this study may explain some of the functional differences between alveolar macrophages and their precursors blood monocytes.

These studies demonstrate that treatment of macrophages with lovastatin, a cholesterol-lowering drug that blocks farnesylation and geranylgeranylation of target proteins, increases LPS-induced TNF-alpha production. This is reversed by the addition of mevalonate, which bypasses the lovastatin block. Examination of membrane localization of RhoA, Cdc42, Rac1, and Ras demonstrated decreased membrane localization of the geranylgeranylated Rho family members (RhoA, Cdc42, and Rac1) with no change in the membrane localization of farnesylated Ras. LPS-induced TNF-alpha production in the presence of the Rho family-specific blocker (toxin B from Clostridium difficile) was significantly enhanced consistent with the lovastatin data. One intracellular signaling pathway that is required for TNF-alpha production by LPS is the extracellular signal-regulated kinase (ERK). Significantly, we found prolonged ERK activation after LPS stimulation of lovastatin-treated macrophages. When we inhibited ERK, we blocked the lovastatin-induced increase in TNF-alpha production. As a composite, these studies demonstrate a negative role for one or more Rho family GTPases in LPS-induced TNF-alpha production.

Prointerleukin 1 beta (IL-1 beta) is a cytokine that mediates a broad range of biological activities. Genomic sequences that regulate IL-1 beta transcription include both inducible regulatory elements located more than 2,700 bp upstream of the transcriptional start site (cap site) and proximal elements located near the TATA box of this gene. In this study, we focused on the identification and characterization of trans-acting nuclear regulatory proteins that bind to the cap site-proximal region of the human IL-1 beta gene. We identified a protein, termed NFIL-1 beta A (NF beta A), that binds to a highly conserved 12-bp DNA sequence (-49 to -38) located upstream of the TATA box motif in both the human and murine IL-1 beta genes. The IL-1 alpha gene, which lacks a TATA motif, does not possess an NF beta A-binding sequence within the promoter region, suggesting that NF beta A may selectively regulate IL-1 beta expression. Using electrophoretic mobility shift assays, we identified several distinct DNA-protein complexes that are expressed in a cell-type-specific manner. In monocytic cell lines, the relative abundance of these complexes varies rapidly following stimulation of the cells with phorbol esters or lipopolysaccharide. UV cross-linking analysis identified two distinct DNA-binding polypeptides that comprise distinct complexes. The functional role of NF beta A was assessed in transient transfection assays. These data indicate that NF beta A is required for both basal and inducible promoter activity in monocytic cells. Furthermore, the human cytomegalovirus immediate-early 1 gene product requires the presence of NF beta A in order to trans-activate the proximal IL-1 beta promoter in a monocytic cell line. We propose that NF beta A is a factor that mediates either direct or indirect activation by the immediate-early 1 gene product. The proximity of this essential factor to the TATA motif suggests a possible role in transcriptional initiation.

The alveolar macrophage plays an important role in immune surveillance of the lung.Early responses to infectious agents by macrophages can decrease tissue injury and promote recovery of the host.Macrophage responses to pathogens are the cornerstone of the innate or nonspecific immune system.In particular, the response of macrophages to endotoxin from Gram negative bacteria has been the focus of many recent studies.The recent discovery of the endotoxin receptor has accelerated the study of signalling in macrophages.This review focuses on the downstream events that occur following exposure of the alveolar macrophage to endotoxin.

Alveolar macrophages have been implicated in the pathogenesis of a number of acute and chronic lung disorders. We have previously shown that normal human alveolar macrophages exhibit decreased DNA binding activity of the transcription factor, AP-1, compared with monocytes. Furthermore, this decrease in AP-1 DNA binding appears to be due to a decrease in the redox active protein, redox factor (Ref)-1. Ref-1 is an important redox regulator of a number of transcription factors, including NF-kappaB and AP-1. In this study we evaluated the role of asbestos, a prototypic model of chronic fibrotic lung disease, in Ref-1 expression and activity. We found that incubation with low concentrations of crocidolite asbestos (0.5-1.25 microg/cm(2)) resulted in an increase in nuclear Ref-1 protein after 5 min, with a persistent elevation in protein up to 24 h. Additionally, an increase in nuclear Ref-1 could be induced by treating the cells with an oxidant-generating stimulus (iron loading plus PMA) and inhibited by diphenyleneiodonium chloride, an inhibitor of NADPH oxidase. The asbestos-induced accumulation of nuclear Ref-1 was associated with an increase in AP-1 DNA binding activity. These findings suggest that an exposure associated with fibrotic lung disease, i.e., asbestos, modulates accumulation of nuclear Ref-1 in macrophages, and that this effect is mediated by an oxidant stimulus.

Human cytomegalovirus (HCMV) is an important pathogen of the lung. We determined whether the HCMV immediate early genes (IE1 and IE2) can alter the regulation of the cellular immediate early genes (c-fos and c-myc). Plasmid constructs containing the promoter-regulatory regions c-myc or c-fos upstream of the reporter gene, chloramphemicol acetyl transferase, were co-transfected into T cells (Jurkat cells), monocytes/macrophages (THP-1 cells), or human fibroblast cells with plasmid constructs containing the promoter-regulatory region of the HCMV IE genes upstream of the bona fide IE1, IE2 or IE+2 genes; a plasmid that contained no IE coding region was used as a control. These studies show that both products of the HCMV IE genes markedly upregulated expression of the cellular c-fos and c-myc genes. The viral effects of individual proteins (IE1 or IE2) were dependent both on the promoter-regulatory region of the cellular gene and the cell type. In all cells, the combination of IE1 and IE2 further upregulated both cellular genes, suggesting a synergistic effect of IE1 with IE2. Both of the c-myc promoters (P1 and P2) were up-regulated by the HCMV IE gene products. IE1 and IE2 also upregulated the cells' endogenous c-myc and c-fos genes, as determined by amounts of the respective mRNAs. These studies show that HCMV can markedly alter cellular IE gene expression and that the effects of HCMV IE1 and IE2 proteins are dependent both on the promoter-regulatory region of the cellular gene and the type of cell in which the interaction occurs.

Human alveolar macrophages are unique in that they have an extended life span in contrast to precursor monocytes. In evaluating the role of sphingolipids in alveolar macrophage survival, we found high levels of sphingosine, but not sphingosine-1-phosphate. Sphingosine is generated by the action of ceramidase(s) on ceramide, and alveolar macrophages have high constitutive levels of acid ceramidase mRNA, protein, and activity. The high levels of acid ceramidase were specific to alveolar macrophages, because there was little ceramidase protein or activity (or sphingosine) in monocytes from matching donors. In evaluating prolonged survival of alveolar macrophages, we observed a requirement for constitutive activity of ERK MAPK and the PI3K downstream effector Akt. Blocking acid ceramidase but not sphingosine kinase activity in alveolar macrophages led to decreased ERK and Akt activity and induction of cell death. These studies suggest an important role for sphingolipids in prolonging survival of human alveolar macrophages via distinct survival pathways.

Macrophages and T-lymphocytes physically interact in the lung in disorders such as sarcoidosis to initiate and/or maintain cellular immune responses. In these studies, we demonstrated that natural interleukin-1 (IL-1), as well as recombinant IL-1 beta, a polypeptide released from stimulated macrophages, is a potent chemotactic factor that is relatively specific for helper T-cells. This chemotactic activity is blocked by a species-specific anti-IL-1. Compared with its capacity to augment proliferation of phytohemagglutinin-stimulated murine thymocytes, IL-1 is more active as a chemotactic factor for mature T-cells. These studies suggest that stimulated lung macrophages, as well as other macrophages, may enhance their interaction with circulating T-lymphocytes via IL-1, which acts as both a chemoattractant and an initiator of T-lymphocyte activation.

It has been suggested that human alveolar macrophages have a limited capacity to release interleukin-1 (IL-1). To determine whether this apparent defect in cell function is related to the release of factors that inhibit the response of lymphocytes to IL-1, we evaluated the capacity of human alveolar macrophages to release prostaglandin E2 (PGE2), a factor that is known to suppress the response of lymphocytes to IL-1. The amount of PGE2 released by alveolar macrophages was dependent on the amount of LPS present in the cultures and the amount of time the cells were present in culture. After 24 h in culture, the alveolar macrophage supernatants contained sufficient amounts of PGE2 to significantly suppress PHA-induced lymphocyte proliferation (p less than 0.01), IL-1-induced thymocyte proliferation (p less than 0.001), but not IL-2-induced lymphocyte proliferation (p greater than 0.2). Consistent with these observations, only small amounts of IL-1 activity could be detected in 24-h supernatants of LPS-stimulated alveolar macrophages using thymocyte proliferation as an assay for IL-1. Using a more sensitive assay for IL-1, however, it was demonstrated that the supernatants of LPS-stimulated macrophages contained amounts of IL-1 that were not significantly different from those present in supernatants of LPS-stimulated monocytes. Indomethacin (1 microgram/ml) completely suppressed the release of PGE2 by alveolar macrophages. These observations suggest that the apparent defect in the release of IL-1 by human alveolar macrophages may be due in part to the release of large amounts of PGE2, which suppresses various lymphocyte functions.

Rationale:Although it has been postulated that liver injury results in impaired clearance of bacteria from the blood, no prior study has evaluated hepatic bacterial clearance during sepsis.Objectives: We hypothesized that liver injury during the evolution of sepsis would result in impaired hepatic bacterial clearance.Methods: Mild and severe bacteremia were generated in C57BL/6 mice by low-and high-dose intratracheal inoculation with Pseudomonas aeruginosa. Measurements and Main Results:The mortality rates with mild and severe bacteremia were 20% and 60%, respectively.Hepatic bacterial clearance was preserved throughout the evolution of mild bacteremia but was lost late with severe bacteremia.The loss of hepatic bacterial clearance resulted in increased systemic bacteremia and mortality.Pretreatment with a caspase inhibitor resulted in preservation of hepatic bacterial clearance with severe bacteremia and eventual control of the bacteremia.When Kupffer cells were ablated before the onset of bacteremia, there was a loss of hepatic bacterial clearance.This converted an initially mild bacteremia into severe bacteremia with increased organ injury and mortality.Conclusions: These observations suggest that hepatic bacterial clearance may be lost during the evolution of sepsis, resulting in a failure to control bacteremia.Thus, the capacity of the liver to clear bacteria is an important determinant of the outcome in sepsis.

Both insulin-like growth factor (IGF)-1 and bacterial clearance by Kupffer cells are significantly reduced in severe sepsis. Kupffer cell apoptosis is triggered by tumor necrosis factor (TNF)-alpha and activation of the PI-3 kinase pathway prevents TNF-induced Kupffer cell death.We evaluated if the marked decline in IGF-1 is related to bacterial clearance in sepsis.Sepsis was induced in C57BL/6 mice by intratracheal inoculation with Pseudomonas aeruginosa (strain PA103). Some mice received IGF-1 24 mg/kg either before infection or 12 hours after infection. In vitro studies were performed using the clonal Kupffer cell line KC13-2.Sepsis resulted in decreased levels of IGF-1. In vitro studies with KC13-2 cells demonstrated that IGF-1 protected Kupffer cells against TNF-alpha-induced apoptosis by activating the PI-3 kinase pathway and stabilizing the inhibitor of apoptosis protein, XIAP. In the animal model, pretreatment with IGF-1 decreased hepatic TNF-alpha and IL-6, improved hepatic bacterial clearance as demonstrated by real-time polymerase chain reaction with primers specific for P. aeruginosa, and improved survival in severe sepsis. Moreover, we rescued mice from severe sepsis by IGF-1 treatment 12 hours after infection.These studies show that the decline in IGF-1 levels in sepsis is related to bacterial clearance and that replacement of IGF-1 in a murine model of sepsis improves overall survival.

Alveolar macrophages play an important role in host defense and in other types of inflammatory processes in the lung. These cells exhibit many alterations in function compared with their precursor cells, blood monocytes. To evaluate a potential mechanism for these differences in function, we evaluated expression of protein kinase C (PKC) isoforms. We found an increase in Ca 2+ -dependent PKC isoforms in monocytes compared with alveolar macrophages. We also found differential expression of the Ca 2+ -independent isoforms in alveolar macrophages compared with monocytes. One consequence of the activation of PKC can be increased expression of mitogen-activated protein (MAP) kinase pathways. Therefore, we also evaluated activation of the MAP kinase extracellular signal-regulated kinase (ERK) 2 by the phorbol ester phorbol 12-myristate 13-acetate (PMA). PMA activated ERK2 kinase in both alveolar macrophages and monocytes; however, monocytes consistently showed a significantly greater activation of ERK2 kinase by PMA compared with alveolar macrophages. Another known consequence of the activation of PKC and subsequent activation of ERK kinase is activation of the transcription factor activator protein-1 (AP-1). We evaluated the activation of AP-1 by PMA in both monocytes and macrophages. We found very little detectable activation of AP-1, as assessed in a gel shift assay, in alveolar macrophages, whereas monocytes showed a substantial activation of AP-1 by PMA. These studies show that the differential expression of PKC isoforms in alveolar macrophages and blood monocytes is associated with important functional alterations in the cells.

A number of immunologically mediated lung disorders are characterized by the presence of fibrosis. In these studies, we demonstrate that immune (gamma) interferon, as well as interleukin-1 (IL-1), can function as a growth factor for human lung fibroblasts, Interleukin-2 has no effect on the proliferation of these cells. Interferon increases the proliferation of lung fibroblasts in a dose-dependent manner and functions as a progression factor by complementing the growthpromoting effects of a characterized competence factor such as fibroblast growth factor. These observations suggest that interferon, as well as IL-1, may play an important role in the fibrotic response as well as the immune response in the lung.

Exposure of macrophages to endotoxin [lipopolysaccharide (LPS)] results in a cascade of events resulting in the release of multiple inflammatory and anti-inflammatory mediators. The Toll-like receptor (TLR) 4 complex is the major receptor that mediates LPS signaling. However, there is evidence that other surface molecules may play a complementary role in the TLR-induced events. Integrin receptors are one class of receptors that have been linked to LPS signaling. This study investigates the role of macrophage integrin receptors in the activation of mitogen-activated protein (MAP) kinases by LPS. In conditions where macrophages were not permitted to adhere to matrix or a tissue culture surface, we found a decrease in LPS signaling as documented by a marked reduction in tyrosine phosphorylation of whole cell proteins. This was accompanied by a significant decrease in extracellular signal-regulated kinase and c-Jun NH(2)-terminal kinase MAP kinase activation. Inhibition of integrin signaling, with EDTA or RGD peptides, decreased LPS-induced MAP kinase activity. The functional consequence of blocking integrin signaling was demonstrated by decreased LPS-induced tumor necrosis factor-alpha production. These observations demonstrate that, in addition to the TLR receptor complex, optimal LPS signaling requires complementary signals from integrin receptors.

The alveolar macrophage responds to bacterial infection with the production of inflammatory mediators that include TNFalpha. Early production of TNFalpha results in increased bacterial clearance, whereas too much TNFalpha results in many of the hallmarks of bacterial sepsis. TNFalpha production is regulated at many levels, including multiple signaling pathways, that lead to transcription, translation, and release of functional TNFalpha. Interactions of mitogen-activated protein (MAP) kinases, lipid signaling pathways, and oxidant-mediated mechanisms regulate the response of alveolar macrophages to infection. Animal models of sepsis support the central role played by macrophage-derived TNFalpha in sepsis.

Macrophages exposed to hyperoxia in the lung continue to survive for prolonged periods. We previously reported (Nyunoya, T., Powers, L. S., Yarovinsky, T. O., Butler, N. S., Monick, M. M., and Hunninghake, G. W. (2003) J. Biol. Chem. 278, 36099–36106) that hyperoxia induces cell cycle arrest and sustained extracellular signal-related kinase (ERK) activity in macrophages. In this study, we determined the mechanisms of hyperoxia-induced ERK activation and how ERK activity plays a pro-survival role in hyperoxia-exposed cells. Inhibition of ERK activity decreased survival of hyperoxia-exposed macrophages. This was due, at least in part, to down-regulation of the pro-apoptotic Bcl-2 family member, BimEL. In determining the mechanism of ERK activation by hyperoxia, we found that ERK activation was not associated with hyperoxia-induced activation of the upstream ERK kinase mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1/2. When we examined the ability of whole cell lysates from hyperoxia-exposed cells to dephosphorylate purified phosphorylated ERK, we found decreased ERK-directed phosphatase activity. Two particular ERK-directed phosphatases (protein phosphatase 2A and MAPK phosphatase-3) demonstrated decreased activity in hyperoxia-exposed cells. Moreover, whole cell lysates from normoxia-exposed cells depleted of PP2A or MAPK phosphatase-3 were also less able to dephosphorylate ERK. These data demonstrate that, in hyperoxia-exposed macrophages, sustained activation of ERK due to phosphatase down-regulation permits macrophage survival via effects on the balance between pro- and anti-apoptotic Bcl-2 family proteins. Macrophages exposed to hyperoxia in the lung continue to survive for prolonged periods. We previously reported (Nyunoya, T., Powers, L. S., Yarovinsky, T. O., Butler, N. S., Monick, M. M., and Hunninghake, G. W. (2003) J. Biol. Chem. 278, 36099–36106) that hyperoxia induces cell cycle arrest and sustained extracellular signal-related kinase (ERK) activity in macrophages. In this study, we determined the mechanisms of hyperoxia-induced ERK activation and how ERK activity plays a pro-survival role in hyperoxia-exposed cells. Inhibition of ERK activity decreased survival of hyperoxia-exposed macrophages. This was due, at least in part, to down-regulation of the pro-apoptotic Bcl-2 family member, BimEL. In determining the mechanism of ERK activation by hyperoxia, we found that ERK activation was not associated with hyperoxia-induced activation of the upstream ERK kinase mitogen-activated protein kinase/extracellular signal-regulated kinase kinase 1/2. When we examined the ability of whole cell lysates from hyperoxia-exposed cells to dephosphorylate purified phosphorylated ERK, we found decreased ERK-directed phosphatase activity. Two particular ERK-directed phosphatases (protein phosphatase 2A and MAPK phosphatase-3) demonstrated decreased activity in hyperoxia-exposed cells. Moreover, whole cell lysates from normoxia-exposed cells depleted of PP2A or MAPK phosphatase-3 were also less able to dephosphorylate ERK. These data demonstrate that, in hyperoxia-exposed macrophages, sustained activation of ERK due to phosphatase down-regulation permits macrophage survival via effects on the balance between pro- and anti-apoptotic Bcl-2 family proteins. Supplemental oxygen therapy is indispensable for patients with respiratory failure, even though high concentrations of inspired oxygen can cause tracheobronchitis, acute lung injury, and subsequent pulmonary fibrosis. Hyperoxia can induce cellular damage, in part, through increased production of reactive oxygen species (1Freeman B.A. Crapo J.D. J. Biol. Chem. 1981; 256: 10986-10992Abstract Full Text PDF PubMed Google Scholar). The effect of hyperoxia has been extensively evaluated in epithelial cells (2Lee P.J. Alam J. Wiegand G.W. Choi A.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 10393-10398Crossref PubMed Scopus (329) Google Scholar, 3O'Reilly M.A. Staversky R.J. Finkelstein J.N. Keng P.C. Am. J. Physiol. 2003; 284: L368-L375Crossref PubMed Scopus (33) Google Scholar, 4Ogunlesi F. Cho C. McGrath-Morrow S.A. Biochim. Biophys. Acta. 2004; 1688: 112-120Crossref PubMed Scopus (24) Google Scholar, 5Ahmad A. Ahmad S. Schneider B.K. Allen C.B. Chang L.Y. White C.W. Am. J. Physiol. 2002; 283: L573-L584Crossref PubMed Scopus (73) Google Scholar, 6Ray P. Devaux Y. Stolz D.B. Yarlagadda M. Watkins S.C. Lu Y. Chen L. Yang X.F. Ray A. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 6098-6103Crossref PubMed Scopus (128) Google Scholar, 7Li Y. Arita Y. Koo H.C. Davis J.M. Kazzaz J.A. Am. J. Respir. Cell Mol. Biol. 2003; 29: 779-783Crossref PubMed Scopus (49) Google Scholar) and endothelial cells (8Ahmad S. Ahmad A. Gerasimovskaya E. Stenmark K.R. Allen C.B. White C.W. Am. J. Respir. Cell Mol. Biol. 2003; 28: 179-187Crossref PubMed Scopus (34) Google Scholar, 9Ahmad S. Ahmad A. Ghosh M. Leslie C.C. White C.W. J. Biol. Chem. 2004; 279: 16317-16325Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar); however, little is known about the effect of hyperoxia on macrophages. Macrophages in the lung are at ∼13% oxygen under normal conditions. Under conditions of supplemental oxygen exposure (acutely ill patients), macrophages can be exposed to up to 90% oxygen. It is known that macrophages exposed to one type of oxidant stress, cigarette smoke, survive for prolonged periods of time in the lung (10Marques L.J. Teschler H. Guzman J. Costabel U. Am. J. Respir. Crit. Care Med. 1997; 156: 1700-1702Crossref PubMed Scopus (38) Google Scholar). The prolonged life of the macrophages of smokers compared with our previous observations on the cell cycle effects of hyperoxia (hyperoxia induces macrophage cell cycle arrest accompanied by induction of p21Cip1 and activation of the retinoblastoma protein (11Nyunoya T. Powers L.S. Yarovinsky T.O. Butler N.S. Monick M.M. Hunninghake G.W. J. Biol. Chem. 2003; 278: 36099-36106Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar)) suggests the activation of one or more survival pathways by hyperoxia. Macrophages, in vitro, survive hyperoxia for a prolonged period of time, and this is associated with sustained activation of extracellular signal-regulated kinases (ERK) 1The abbreviations used are: ERK, extracellular signal-regulated kinase; BH, Bcl-2 homology; LPS, lipopolysaccharide; MAPK, mitogen-activated protein kinase; MKP, MAPK phosphatase; MEK, MAPK kinase; PP2A, protein phosphatase 2A; PTP, protein/tyrosine phosphatase; HePTP, hematopoietic PTP; STEP, striatum-enriched phosphatase. (11Nyunoya T. Powers L.S. Yarovinsky T.O. Butler N.S. Monick M.M. Hunninghake G.W. J. Biol. Chem. 2003; 278: 36099-36106Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). In this study, we pursued the hypothesis that hyperoxia-linked down-regulation of ERK-directed phosphatases leads to prolonged ERK activation and increased ERK-dependent survival. ERK can be activated via stimulation of receptor tyrosine kinases, G-protein-coupled receptors, and integrin receptors (12Widmann C. Gibson S. Jarpe M.B. Johnson G.L. Physiol. Rev. 1999; 79: 143-180Crossref PubMed Scopus (2274) Google Scholar). ERK can also be activated in response to redox changes in the cell through still unidentified mechanisms (13Samavati L. Monick M.M. Sanlioglu S. Buettner G.R. Oberley L.W. Hunninghake G.W. Am. J. Physiol. 2002; 283: C273-C281Crossref PubMed Scopus (101) Google Scholar). ERK is activated by dual phosphorylation of tyrosine and threonine residues by mitogen-activated protein kinase kinase 1/2 (MEK1/2). The duration of ERK phosphorylation affects the biological responses in cells. Short duration of ERK activation (as seen with lipopolysaccharide (LPS)) does not alter the cell cycle, whereas prolonged ERK activation regulates cell proliferation (14Kahan C. Seuwen K. Meloche S. Pouyssegur J. J. Biol. Chem. 1992; 267: 13369-13375Abstract Full Text PDF PubMed Google Scholar). A potential mechanism to induce sustained activation of ERK is a decrease in phosphatase activity, because ERK is inactivated by phosphatases. The specific removal of phosphate from either the tyrosine or the threonine is enough to eliminate or decrease enzyme activity (15Posada J. Cooper J.A. Science. 1992; 255: 212-215Crossref PubMed Scopus (219) Google Scholar, 16Hancock C.N. Dangi S. Shapiro P. J. Biol. Chem. 2005; 280: 11590-11598Abstract Full Text Full Text PDF PubMed Scopus (9) Google Scholar). There are several types of known phosphatases that regulate ERK, including serine/threonine phosphatases, such as PP2A (17Alessi D.R. Gomez N. Moorhead G. Lewis T. Keyse S.M. Cohen P. Curr. Biol. 1995; 5: 283-295Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar), dual-specificity phosphatases, such as mitogen-activated protein kinase phosphatases (MKPs) (18Sun H. Charles C.H. Lau L.F. Tonks N.K. Cell. 1993; 75: 487-493Abstract Full Text PDF PubMed Scopus (1027) Google Scholar, 19Muda M. Theodosiou A. Rodrigues N. Boschert U. Camps M. Gillieron C. Davies K. Ashworth A. Arkinstall S. J. Biol. Chem. 1996; 271: 27205-27208Abstract Full Text Full Text PDF PubMed Scopus (310) Google Scholar), protein/tyrosine phosphatases (PTPs), such as striatum-enriched phosphatase (STEP) (20Paul S. Nairn A.C. Wang P. Lombroso P.J. Nat. Neurosci. 2003; 6: 34-42Crossref PubMed Scopus (270) Google Scholar), and hematopoietic PTP (HePTP) (21Huang Z. Zhou B. Zhang Z.Y. J. Biol. Chem. 2004; 279: 52150-52159Abstract Full Text Full Text PDF PubMed Scopus (24) Google Scholar). Under most conditions, ERK activation is brief, because PP2A, a constitutively expressed phosphatase is already present in the complex at base line and rapidly switches off ERK activity by removing a phosphate from the threonine residue (17Alessi D.R. Gomez N. Moorhead G. Lewis T. Keyse S.M. Cohen P. Curr. Biol. 1995; 5: 283-295Abstract Full Text Full Text PDF PubMed Scopus (322) Google Scholar). Another means of ERK inactivation occurs via induction and activation of one or more MKPs leading to dual dephosphorylation of ERK (22Pouyssegur J. Lenormand P. Eur. J. Biochem. 2003; 270: 3291-3299Crossref PubMed Scopus (155) Google Scholar). MKPs have unique specificities toward their MAPK substrates and distinct subcellular localizations. MKP-1 is located in the nucleus and preferentially inactivates p38 MAPK, c-Jun N-terminal kinase, and ERK (in that order) (23Wu J.J. Bennett A.M. J. Biol. Chem. 2005; 280: 16461-16466Abstract Full Text Full Text PDF PubMed Scopus (140) Google Scholar). In contrast, MKP-3 is located in the cytoplasm and preferentially dephosphorylates ERKs (19Muda M. Theodosiou A. Rodrigues N. Boschert U. Camps M. Gillieron C. Davies K. Ashworth A. Arkinstall S. J. Biol. Chem. 1996; 271: 27205-27208Abstract Full Text Full Text PDF PubMed Scopus (310) Google Scholar, 24Camps M. Nichols A. Arkinstall S. FASEB J. 2000; 14: 6-16Crossref PubMed Scopus (718) Google Scholar, 25Keyse S.M. Curr. Opin. Cell Biol. 2000; 12: 186-192Crossref PubMed Scopus (710) Google Scholar). Both MKPs and PTPs have catalytic site cysteines that, when oxidized, inactivate the phosphatases (26Denu J.M. Tanner K.G. Biochemistry. 1998; 37: 5633-5642Crossref PubMed Scopus (824) Google Scholar, 27Chiarugi P. Fiaschi T. Taddei M.L. Talini D. Giannoni E. Raugei G. Ramponi G. J. Biol. Chem. 2001; 276: 33478-33487Abstract Full Text Full Text PDF PubMed Scopus (170) Google Scholar, 28Mishra O.P. Delivoria-Papadopoulos M. Neuroscience. 2004; 129: 665-673Crossref PubMed Scopus (20) Google Scholar). The serine/threonine phosphatase PP2A has also been shown to be negatively regulated by redox modulation of a cysteine (29Kim H.S. Song M.C. Kwak I.H. Park T.J. Lim I.K. J. Biol. Chem. 2003; 278: 37497-37510Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 30Foley T.D. Kintner M.E. Biochem. Biophys. Res. Commun. 2005; 330: 1224-1229Crossref PubMed Scopus (23) Google Scholar). Because of this known redox-linked negative regulation of phosphatases, we hypothesized that hyperoxia induces prolonged ERK activation via inactivation of one or more phosphatases involved in ERK regulation. Bcl-2 family members are essential regulators of apoptosis. The Bcl-2 family consists of two classes: anti-apoptotic members, such as Bcl-2 and Bcl-xL that protect cells from apoptosis, and pro-apoptotic members that trigger or sensitize for apoptosis. More than 20 pro-apoptotic Bcl-2 family proteins have been identified in mammals and can be divided into two subgroups by the number of Bcl-2 homology (BH) domains that they contain (31Huang D.C. Strasser A. Cell. 2000; 103: 839-842Abstract Full Text Full Text PDF PubMed Scopus (901) Google Scholar). Pro-apoptotic Bcl-2 family members include Bax and Bak with 2–3 BH domains and other proteins identified as BH3-only proteins, including Bim and Bad. The BH3-only proteins are crucial for initiation of apoptosis. In contrast, Bax/Bak-like proteins are further downstream effectors in the cell death program. The BH-3-only protein Bim is expressed in various cells, including macrophages, and is strictly regulated at both the transcriptional and post-transcriptional level (31Huang D.C. Strasser A. Cell. 2000; 103: 839-842Abstract Full Text Full Text PDF PubMed Scopus (901) Google Scholar). Bim is a major apoptotic signal following withdrawal of survival factors. Bim–/– mice show a marked accumulation of monocytes, granulocytes, and lymphocytes (32Bouillet P. Metcalf D. Huang D.C. Tarlinton D.M. Kay T.W. Kontgen F. Adams J.M. Strasser A. Science. 1999; 286: 1735-1738Crossref PubMed Scopus (1304) Google Scholar). Moreover, Bim–/– lymphocytes are resistant to cytokine withdrawal in culture (33Shinjyo T. Kuribara R. Inukai T. Hosoi H. Kinoshita T. Miyajima A. Houghton P.J. Look A.T. Ozawa K. Inaba T. Mol. Cell. Biol. 2001; 21: 854-864Crossref PubMed Scopus (188) Google Scholar). ERK can bind and promote phosphorylation of Bim, targeting it for degradation via the proteosome (34Ley R. Balmanno K. Hadfield K. Weston C. Cook S.J. J. Biol. Chem. 2003; 278: 18811-18816Abstract Full Text Full Text PDF PubMed Scopus (503) Google Scholar). Luciano et al. (35Luciano F. Jacquel A. Colosetti P. Herrant M. Cagnol S. Pages G. Auberger P. Oncogene. 2003; 22: 6785-6793Crossref PubMed Scopus (384) Google Scholar) reports that ERK-dependent degradation of Bim protects leukemia cells from Imatinib-induced apoptosis (35Luciano F. Jacquel A. Colosetti P. Herrant M. Cagnol S. Pages G. Auberger P. Oncogene. 2003; 22: 6785-6793Crossref PubMed Scopus (384) Google Scholar). However, the role of Bim regulation in cell survival under hyperoxia has not been studied. In this study, we showed that hyperoxia induces sustained ERK phosphorylation leading to a pro-survival change in the balance between pro- and anti-apoptotic Bcl-2 family members. The prolonged ERK activity is not associated with an increase in activity of upstream kinases. Rather, hyperoxia induces a sustained decrease in total ERK-directed phosphatase activity. The effect of hyperoxia results from alterations in multiple ERK-linked phosphatases. On one hand, hyperoxia fails to trigger auto-inactivation of ERK via induction of MKP-1 (as is found with LPS-induced ERK activation). On the other hand, hyperoxia does decrease ERK-directed phosphatase activity of at least two major ERK-directed phosphatases (MKP-3 and PP2A). In combination, these findings support an important role for phosphatase down-regulation in the sustained ERK activation seen with macrophages exposed to hyperoxia. These data suggest an important role for ERK in macrophage survival under hyperoxic conditions that is driven by multiple effects on phosphatases. Reagents and Antibodies—Chemicals were obtained from Sigma. Nitrocellulose membranes, ECL and ECL Plus, were obtained from Amersham Biosciences. Antibodies were obtained from various sources. Anti-Bim was from Stressgen Biotechnologies (Victoria, British Columbia, Canada). Anti-ERK2, anti-MEK1, anti-MKP-1, anti-MKP-3, and anti-PP2A were from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-β-actin was from Sigma. Phosphorylation-specific antibodies for ERK and MEK1/2 were from Cell Signaling (Beverly, MA). Developing antibodies (horseradish peroxidase-conjugated anti-rabbit, anti-goat, or anti-mouse Ig) were obtained from Santa Cruz Biotechnology. Tissue culture plates were obtained from Corning (Corning, NY). Cell Culture and Cell Viability Assay—RAW 264.7 cells (TIB-71, American Type Culture Collection) were maintained at 37 °C in Dulbecco's modified Eagle's medium (high glucose) with 10% fetal bovine serum and gentamicin (40 μg/ml). The cells were subcultured every 2–3 days. Experiments were performed in six-well (35 mm) Costar tissue culture plates or regular tissue culture dishes (100 mm) under normoxia (O2 = 21%) or hyperoxia (O2 = 95%) at the starting cell density of 0.5 × 106/ml. The percentage of viable cells in each group at 24 h was determined by the trypan blue assay. Isolation of Whole Cell Extracts—Whole cell protein was obtained by lysing the cells on ice for 20 min in 500 μl of lysis buffer (0.05 m Tris, pH 7.4, 0.15 m NaCl, 1% Nonidet P-40) supplemented with Complete protease inhibitors (Roche Applied Science) and 1× phosphatase inhibitors (Calbiochem, La Jolla, CA). The lysates were then sonicated for 20 s, incubated on ice for 30 min, and centrifuged at 15,000 × g for 10 min at 4 °C. Protein was quantified using a protein measurement kit (Protein Assay Kit 500–0006, Bio-Rad). Cell lysates were stored at –70 °C until use. Western Blot Analysis—Western blot analysis for the presence of particular proteins or for phosphorylated forms of proteins was performed on whole cell lysates. Protein (30–80 μg) was mixed 1:1 with 2× sample buffer (20% glycerol, 4% SDS, 10% β-mercaptoethanol, 0.05% bromphenol blue, and 1.25 m Tris, pH 6.8; all from Sigma) heated to 95 °C for 5 min, and fractionated on a 10 or 12.5% SDS-polyacrylamide gel run at 100 V for 90 min. Cell proteins were transferred to nitrocellulose membranes (Amersham Biosciences) by semidry transfer (Bio-Rad) at 20 V for 45 min. Equal loading of the protein groups on the blots was evaluated using the primary antibodies or anti-β actin or Ponceau S stain (Sigma). The membranes were blocked with 5% milk in Trisbuffered saline with 0.1% Tween 20 for 1 h, washed, and then incubated with the primary antibody overnight. The blots were washed four times with Tris-buffered saline with Tween 20 and incubated for 1 h with horseradish peroxidase-conjugated anti-rabbit or anti-mouse IgG antibodies. Immunoreactive bands were developed using a chemiluminescent substrate (and ECL or ECL Plus). An autoradiograph was obtained, with exposure times of 10 s–2 min. In Vitro ERK Dephosphorylation Assay—In vitro ERK dephosphorylation assay in this study was similar to others (36Kassel O. Sancono A. Kratzschmar J. Kreft B. Stassen M. Cato A.C. EMBO J. 2001; 20: 7108-7116Crossref PubMed Scopus (406) Google Scholar, 37Cicchillitti L. Fasanaro P. Biglioli P. Capogrossi M.C. Martelli F. J. Biol. Chem. 2003; 278: 19509-19517Abstract Full Text Full Text PDF PubMed Scopus (99) Google Scholar). The whole cell lysates were obtained as previously described, except that phosphatase inhibitors were not used. In some instances, okadaic acid (3 μm) and/or sodium orthovanadate (2 mm) were added to the lysates for 5 min, and whole cell lysates (20 μg) were incubated with recombinant phosphorylated ERK protein (Stratagene) (0.1 μg) at 37 °C for 20 min, followed by boiling in 2× sample buffer. Total phosphatase activity for pERK in conditions of normoxia and hyperoxia were measured by Western blotting using anti-pERK antibody (Cell Signaling). To evaluate PP2A- or MKP-3-dependent effects on pERK dephosphorylation, immunoprecipitation was performed by incubation of each lysate (500 μg/500 μl) with anti-PP2A (5 μg) or anti-MKP-3 (5 μg). Overnight incubation at 4 °C with rotation was followed by the addition of 40 μl/sample protein G plus-agarose (Santa Cruz Biotechnology) for 1 h. The immunoprecipitates were washed two times with lysis buffer without phosphatase inhibitors and transferred to new tubes and then were washed one more time with phosphatase buffer (50 mm Tris-HCl, pH 7.5, 1 mm MgCl2, 0.1 mm EDTA, 0.9 mg/ml bovine serum albumin) in non-reducing conditions without β-mercaptoethanol. Immunoprecipitated PP2A or MKP-3 was incubated with recombinant pERK at 37 °C for 20 min in phosphatase buffer and released from agarose by boiling in 2× sample buffer. The specific phosphatase activity for pERK in conditions of normoxia and hyperoxia were measured by Western blotting using anti-pERK antibodies. Immunodepletion—The whole cell lysates from macrophages in conditions of normoxia were obtained as previously described, except that phosphatase inhibitors were not used. To evaluate PP2A- or MKP-3-dependent effects on pERK dephosphorylation in cell lysates with normoxia, immunoprecipitation for PP2A or MKP-3 was performed as described in the in vitro ERK dephosphorylation assay. After protein G-agarose plus was pulled down, the supernatants were transferred to Eppendorf tubes in ice and were used as PP2A- or MKP-3-immunodepleted cell lysates. PP2A- or MKP-3-immunodepleted cell lysates (20 μg) were incubated with recombinant pERK (0.1 μg) at 37 °C for 20 min in phosphatase buffer and were boiled in 2× sample buffer for 5 min. The ERK-directed phosphatase activity in PP2A- or MKP-3-immunodepleted cell lysates was measured by Western blotting using anti-pERK antibodies. Statistical Analysis—The results were expressed as the mean ± S.E. The number of cells in each condition at various time points was compared using a Student's unpaired t test. Macrophages Survive Hyperoxia via Sustained ERK Activation—Our initial studies showed that RAW 264.7 cells (macrophages) do not die for up to 48 h under hyperoxia. We found that hyperoxia did not alter the activity of protein kinase B (Akt), a transducer of multiple survival signals. In contrast, we found that hyperoxia induces sustained ERK activation (11Nyunoya T. Powers L.S. Yarovinsky T.O. Butler N.S. Monick M.M. Hunninghake G.W. J. Biol. Chem. 2003; 278: 36099-36106Abstract Full Text Full Text PDF PubMed Scopus (20) Google Scholar). Previous studies have shown that ERK activity can play both a pro- (38Goillot E. Raingeaud J. Ranger A. Tepper R.I. Davis R.J. Harlow E. Sanchez I. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 3302-3307Crossref PubMed Scopus (246) Google Scholar, 39Petrache I. Choi M.E. Otterbein L.E. Chin B.Y. Mantell L.L. Horowitz S. Choi A.M. Am. J. Physiol. 1999; 277: L589-L595Crossref PubMed Google Scholar, 40van den Brink M.R. Kapeller R. Pratt J.C. Chang J.H. Burakoff S.J. J. Biol. Chem. 1999; 274: 11178-11185Abstract Full Text Full Text PDF PubMed Scopus (91) Google Scholar) and an anti-apoptotic role (34Ley R. Balmanno K. Hadfield K. Weston C. Cook S.J. J. Biol. Chem. 2003; 278: 18811-18816Abstract Full Text Full Text PDF PubMed Scopus (503) Google Scholar, 35Luciano F. Jacquel A. Colosetti P. Herrant M. Cagnol S. Pages G. Auberger P. Oncogene. 2003; 22: 6785-6793Crossref PubMed Scopus (384) Google Scholar, 41Nair V.D. Yuen T. Olanow C.W. Sealfon S.C. J. Biol. Chem. 2004; 279: 27494-27501Abstract Full Text Full Text PDF PubMed Scopus (82) Google Scholar), depending on the cell type and context. To directly evaluate the role of hyperoxia-induced ERK activation on cell survival in macrophages, we performed the following experiments. Macrophages were cultured in standard tissue culture plates, with or without U0126, a MEK inhibitor (the ERK upstream kinase, 10 μm), under conditions of normoxia (21% O2) or hyperoxia (95% O2). Western blot analysis was performed for phosphorylation of ERK. We determined that hyperoxia induces sustained ERK activation without a change in the amount of total ERK (Fig. 1A). Cell viability was measured at 24 h by trypan blue staining. As shown in Fig. 1B, macrophage survival after 24 h of hyperoxia was close to 100%. In contrast, macrophage survival after 24 h of hyperoxia with ERK inhibition was significantly decreased (∼60%) (p < 0.05). These data support the hypothesis that hyperoxia-induced ERK activation is a crucial signal to maintain cell viability in macrophages. Hyperoxia Down-regulates a Pro-apoptotic Bcl-2 Family Protein, BimEL, in an ERK-dependent Manner—The Bcl-2 family members are key regulators of cell survival and death. However, little is known about the effects of hyperoxia on the Bcl-2 family proteins in macrophages. To evaluate this, macrophages were cultured in normoxia (21% O2) or hyperoxia (95% O2) in standard tissue culture plates. Western blot analysis was performed for BimEL (the Bim isoform abundant in macrophages (data not shown)) and Bcl-xL at 24 h. Hyperoxia decreased BimEL but increased Bcl-xL (Fig. 2A). These results suggest that hyperoxia alters the balance of Bcl-2 family proteins toward a pro-survival phenotype. It is known that ERK triggers degradation of the proapoptotic protein Bim in cultured fibroblasts (34Ley R. Balmanno K. Hadfield K. Weston C. Cook S.J. J. Biol. Chem. 2003; 278: 18811-18816Abstract Full Text Full Text PDF PubMed Scopus (503) Google Scholar). Therefore, we postulated that hyperoxia-induced ERK activation down-regulates Bim. To evaluate this, macrophages were cultured, with or without U0126 (a MEK inhibitor), in normoxia (21% O2) or hyperoxia (95% O2) in standard tissue culture plates. Western blot analysis was performed for total BimEL and phosphorylation of ERK at 24 h. Hyperoxia decreased BimEL protein levels, and the effect was dependent on ERK activity (Fig. 2B). These results suggest that hyperoxia down-regulates BimEL protein in an ERK-dependent manner. We next addressed the mechanism of extended ERK activation in hyperoxia-exposed cells. Hyperoxia-induced ERK Activation Is Not Associated with Increased Activation of the Upstream ERK Kinase MEK1/2 but Rather with Down-regulation of ERK-directed Phosphatases— ERK activity is regulated by the balance between upstream kinase activity and downstream phosphatase activity. We determined whether the increased activity of ERK induced by hyperoxia was due to activation of upstream kinases in the ERK pathway. We used LPS as a positive control for activation of upstream kinases. Macrophages were cultured under conditions of normoxia (21% O2) with or without LPS (1 μg/ml) or hyperoxia (95% O2). Western blot analysis was performed to determine whether there was activation (phosphorylation) of MEK1/2. LPS induced phosphorylation of MEK1/2 at 15 min, but hyperoxia did not increase MEK activity for up to 24 h (Fig. 3A). This demonstrates that hyperoxia-induced ERK activity is not linked to increased activity of upstream kinases. Hyperoxia does not increase MEK activity, but there is still a potential role for the base-line MEK activity in ERK activation by hyperoxia. To address this question, macrophages were cultured under conditions of normoxia (21% O2) or hyperoxia (95% O2) with or without U0126 (10 μm), a MEK inhibitor. Western blot analysis was performed to determine whether there was base-line activation (phosphorylation) of ERK that could be inhibited by U0126. MEK inhibition blocked ERK phosphorylation in both normoxia and hyperoxia (Fig. 3B). These data indicate that base-line MEK activity is necessary for hyperoxia-induced ERK activation. However, the lack of increased MEK activity with hyperoxia suggests an alternative mechanism for the increase in ERK activity. One possibility is that hyperoxia decreases the constitutive activity of the phosphatases involved in ERK regulation. Thus, we postulated that hyperoxia decreases dephosphorylation of ERK in exposed macrophages. The following experiments address this hypothesis. To investigate the effect of hyperoxia on total macrophage phosphatase activity, an in vitro ERK dephosphorylation assay was performed. Macrophages were cultured in normoxia (21% O2) or hyperoxia (95% O2) for 24 h. Whole cell lysates were obtained and incubated with recombinant phosphorylated ERK. Whole cell lysate phosphatase activity for ERK in conditions of normoxia and hyperoxia was measured by Western blot analysis using anti-phospho-ERK antibody. As shown in Fig. 3C, hyperoxia decreased ERK-directed whole cell lysate phosphatase activity. Thus, hyperoxia-induced ERK activation does not appear to be due to an increase in MEK activity, but rather to a decrease in phosphatase activity. Hyperoxia Decreases PP2A and MKP-3 Activity for ERK Dephosphorylation—It is known that oxidant stimuli, such as hydrogen peroxide, decrease activity of some phosphatases, resulting in ERK activation (29Kim H.S. Song M.C. Kwak I.H. Park T.J. Lim I.K. J. Biol. Chem. 2003; 278: 37497-37510Abstract Full Text Full Text PDF PubMed Scopus (111) Google Scholar, 42Foley T.D. Armstrong J.J. Kupchak B.R. Biochem. Biophys. Res. Commun. 2004; 315: 568-574Crossref PubMed Scopus (49) Google Scholar, 43Whisler R.L. Goyette M.A. Grants I.S. Newhouse Y.G. Arch. Biochem. Biophys. 1995; 319: 23-25Crossref PubMed Scopus (172) Google Scholar). To identify the specific phosphatases responsible for hyperoxia-induced ERK activation, we performed the following experiments. Macrophages were cultured in normoxia (21% O2) or hyperoxia (95% O2) for 24 h. Whole cell lysates were obtained and PP2A, MKP-3, STEP, and HePTP activity were immunoprecipitated and used in an in vitro ERK dephosphorylation assay. Macrophage exposure to hyperoxia decreased the ability of immunoprecipitated PP2A and MKP-3 to dephosphorylate ERK (Fig. 4A). However, hyperoxia did not decrease the ability of STEP or HePTP to dephosphorylate ERK (data not shown). These results suggest that a decrease in PP2A and MKP-3 activity contribute, at least in part, to the sustained ERK activation in h

Objectives To investigate the effect of antibiotics on infection, lung injury, and mortality rate in polymicrobial sepsis and to determine whether an association exists between infection and lung injury and mortality rate. To circumvent the effect of antibiotics on cultures, we used polymerase chain reaction to detect bacteria. Design Prospective, randomized, controlled laboratory trial. Setting University research laboratory. Subjects C57/BL6 mice. Interventions Mice underwent cecal ligation and puncture without antibiotics (CLP) or with imipenem (CLP + Abx). Measurements and Main Results CLP resulted in 50% mortality rate at 48 hrs and 100% mortality rate at 84 hrs. Antibiotics delayed these time points to 72 and 120 hrs, respectively. Lung injury occurred before mortality in both groups. Polymerase chain reaction detected bacteria in the blood and lungs of all CLP mice by 24 hrs. Antibiotics delayed but did not prevent infection in CLP + Abx mice. Serum tumor necrosis factor-α and lung endotoxin were elevated to similar concentrations in both CLP and CLP + Abx mice. Conclusions In this model of sepsis, antibiotics delay but do not prevent acute lung injury and mortality. Even in the presence of antibiotics, acute lung injury is strongly associated with bacteremia and bacteria within the lungs.

Human alveolar macrophages play a critical role in host defense and in the development of inflammation and fibrosis in the lung.Unlike their precursor cells, blood monocytes, alveolar macrophages are long-lived and tend to be resistant to apoptotic stimuli.In this study, we examined the role of differentiation in altering baseline phosphatidylinositol (PI) 3-kinase/Akt activity.We found that differentiation increased activity of pro-survival PI 3-kinase/ Akt while decreasing amounts of the negative PI 3-kinase regulator, PTEN.PTEN is a lipid phosphatase with activity against phosphatidylinositol 3,4,5-trisphosphate (PI 3,4,5 P3), the major bioactive product of PI 3-kinase.Examining in vivo differentiation of alveolar macrophages (by comparing blood monocytes to alveolar macrophages from single donors), we found that differentiation resulted in increased baseline reactive oxygen species (ROS) in the alveolar macrophages.This led to a deficiency in PTEN, increased activity of Akt, and prolonged survival of alveolar macrophages.These data support the hypothesis that alterations in ROS levels contribute to macrophage homeostasis by altering the balance between PI 3-kinase/Akt and the phosphatase, PTEN.

Vitamin D deficiency has been implicated as a factor in a number of infectious and inflammatory lung diseases. In the lung, alveolar macrophages play a key role in inflammation and defense of infection, but there are little data exploring the immunomodulatory effects of vitamin D on innate lung immunity in humans. The objective of this study was to determine the effects of vitamin D supplementation on gene expression of alveolar macrophages. We performed a parallel, double-blind, placebo-controlled, randomized trial to determine the effects of vitamin D on alveolar macrophage gene expression. Vitamin D3 (1000 international units/day) or placebo was administered to adults for three months. Bronchoscopy was performed pre- and post-intervention to obtain alveolar macrophages. Messenger RNA was isolated from the macrophages and subjected to whole genome exon array analysis. The primary outcome was differential gene expression of the alveolar macrophage in response to vitamin D supplementation. Specific genes underwent validation by polymerase chain reaction methods. Fifty-eight subjects were randomized to vitamin D (n = 28) or placebo (n = 30). There was a marginal overall difference between treatment group and placebo group in the change of 25-hydroxyvitaminD levels (4.43 ng/ml vs. 0.2 ng/ml, p = 0.10). Whole genome exon array analysis revealed differential gene expression associated with change in serum vitamin D levels in the treated group. CCL8/MCP-2 was the top-regulated cytokine gene and was further validated. Although only a non-significant increased trend was seen in serum vitamin D levels, subjects treated with vitamin D supplementation had immune-related differential gene expression in alveolar macrophages. ClinicalTrials.org: NCT01967628 .

Several studies have demonstrated that cytomegalovirus (CMV) infection increases expression of the tumor necrosis factor (TNF) gene. This effect is mediated, in part, by an effect of the CMV immediate early 1 (IE1) gene product on the TNF promoter. To further analyze these interactions, we used plasmids with TNF promoter truncations to determine the site within the promoter where the CMV IE1 gene product mediates its effect. The site was localized to a 40-base pair segment that contains a cAMP response element (CREB). Deletion of the cAMP response element increased basal promoter activation but had little effect on IE1-induced activation. Additional studies demonstrated that the cAMP element is flanked 5' by a PU.1 site and 3' by an NF-kappa B site, both of which increase expression of the TNF promoter. These sequences demonstrated IE1 responsiveness. We next determined the relevance of these observations for normal human cells by infecting human alveolar macrophages with CMV. In these studies we evaluated expression of NF-kappa B, PU.1 and CREB by gel shift assay at immediate early times after infection. We found that CMV infection increased the binding activity of NF-kappa B and PU.1 and decreased the binding activity of CREB. CMV infection also increased expression of the TNF gene in alveolar macrophages. These observations suggest that CMV increases TNF gene expression, in part, by altering the binding activity of transcription factors that regulate gene expression.

Abstract Hypersensitivity pneumonitis (HP) is a granulomatous, inflammatory lung disease caused by inhalation of organic Ags, most commonly thermophilic actinomycetes that cause farmer’s lung disease. The early response to Ag is an increase in neutrophils in the lung, whereas the late response is a typical Th1-type granulomatous disease. Many patients who develop disease report a recent viral respiratory infection. These studies were undertaken to determine whether viruses can augment the inflammatory responses in HP. C57BL/6 mice were exposed to the thermophilic bacteria Saccharopolyspora rectivirgula (SR) for 3 consecutive days per wk for 3 wk. Some mice were exposed to SR at 2 wk after infection with respiratory syncytial virus (RSV), whereas others were exposed to SR after exposure to saline alone or to heat-inactivated RSV. SR-treated mice developed a typical, early neutrophil response and a late granulomatous inflammatory response. Up-regulation of IFN-γ and IL-2 gene expression was also found during the late response. These responses were augmented by recent RSV infection but not by heat-inactivated RSV. Mice with a previous RSV infection also had a greater early neutrophil response to SR, with increased macrophage inflammatory protein-2 (MIP-2, murine equivalent of IL-8) release in bronchoalveolar lavage fluid. These studies suggest that viral infection can augment both the early and late inflammatory responses in HP.

Silica causes release of tumor necrosis factor (TNF) from mononuclear phagocytes. One hypothesis is that silica increases TNF production, in part, by upregulating the TNF gene. To evaluate this hypothesis, THP-1 cells (a myelomonocytic cell line) were exposed to various amounts of silica and then the TNF gene transcription was evaluated. In this study silica caused a dose-dependent increase in TNF mRNA and the peak response occurred at 3 h following stimulation. A transient transfection assay also showed that silica upregulated expression of a TNF CAT construct in THP-1 cells. Furthermore, a nuclear run-on assay demonstrated that silica particles induce increased TNF gene transcription in exposed cells. THP-1 cells cultured for various periods of time in the presence of silica released TNF into the cell supernatants. These studies show that silica can upregulate the TNF gene, which results in the release of TNF protein from the cells.

Objective Type 2 diabetes disproportionately affects African American women, a population exposed to high levels of stress, including financial strain (Centers for Disease Control &amp; Prevention, 2011, http://www.cdc.gov/diabetes/pubs/pdf/ndfs_2011.pdf ). We tested a mediational model in which chronic financial strain among African American women contributes to elevated serum inflammation markers, which, in turn, lead to increased haemoglobin A1C (HbA1c) levels and risk for type 2 diabetes. Methods We assessed level of financial strain four times over a 10‐year period and tested its effect on two serum inflammation markers, C‐reactive protein ( CRP ) and soluble interleukin‐6 receptor (sIL‐6R) in year 11 of the study. We tested the inflammation markers as mediators in the association between chronic financial strain and HbA1c, an index of average blood glucose level over several months. Design Data were from 312 non‐diabetic African American women from the Family and Community Health Study (FACHS; Cutrona et al ., 2000, J. Pers. Soc. Psychol ., 79 , 1088). Results Chronic financial strain predicted circulating sIL‐6R after controlling for age, BMI, health behaviours, and physical health measures. In turn, sIL‐6R significantly predicted HbA1c levels. The path between chronic financial strain and HbA1c was significantly mediated by sIL‐6R. Contrary to prediction, CRP was not predicted by chronic financial strain. Conclusions Results support the role of inflammatory factors in mediating the effects of psychosocial stressors on risk for type 2 diabetes. Findings have implications for interventions that boost economic security and foster effective coping as well as medical interventions that reduce serum inflammation to prevent the onset of type 2 diabetes. Statement of contribution What is already known on this subject? Financial strain is a risk factor for many disorders, and it is associated with inflammation in the peripheral bloodstream. Inflammation processes are known to be associated with insulin resistance, a risk factor for type 2 diabetes mellitus. What does this study add? Financial strain, a psychological stressor, predicts higher levels of an inflammatory marker, sIL‐6r, when controlling for a set of known predictors of inflammation. This inflammatory marker, in turn, predicts haemoglobin A1C level, a marker of risk for diabetes. The association between financial strain, a psychological stressor, and hemoglobin A1C is mediated by the inflammatory marker, sIL‐6r, suggesting that one mechanism through which psychological stressors increase risk for diabetes is through inflammatory mechanisms.

APE-1/Ref-1 is a ubiquitous multifunctional protein that possesses both DNA repair activity and redox regulatory activity. Originally named apurinic/apyrimidinic endonuclease (APE-1) and HAP-1 (Human APE-1) for its endonuclease activity, APE-1/Ref-1 is a major enzyme in the base excision repair pathway (1) and is involved in repair of spontaneous and oxidative damage to cellular DNA (2). In signal transduction, APE-1/Ref-1 is important in mediating DNA binding of a number of transcription factors including AP-1, nuclear factor (NF)B, Pax-5, Pax-8, HIF-1, and HLF (Table 1) (2–8). Although the nomenclature is not standardized, many authors refer to the protein as APE-1/ Ref-1 to reflect its dual function. APE-1/Ref-1 is ubiquitously expressed, though there are complex patterns of distribution within cells and between different cell types (9–13). These patterns of cellular distribution may be related to the varying functions of APE-1/Ref-1. Based on its multiple functions, APE-1/Ref-1 likely plays an important role in maintaining genomic integrity and in regulating gene expression via redox activation of a variety of transcription factors. Human cells in vitro are estimated to undergo spontaneous depurination of DNA at a rate of approximately 10,000 bases/day/cell (14), with the greatest number of apurinic/apyrimidinic (AP) sites occurring in the brain, heart, and colon (15). In addition to spontaneous loss of nucleotides, DNA can also be damaged via oxidant stress that results in oxidation of bases and sugars (16). To protect the integrity of the genome, all cells have developed a repair system to excise and replace the damaged nucleotides (AP sites) in DNA. In the base excision repair pathway, damaged bases are excised by a DNA glycosylase, creating an AP site. APE-1/Ref-1 cleaves the DNA backbone 5 to the AP site and repair is completed by DNA polymerase and DNA ligase (17–19). There are two families of endonucleases that are differentiated based on their functions and homology to Escherichia coli exonucleases (20). APE-1/Ref-1 belongs to the first of two families of AP endonucleases and shares sequence homology with E. coli exonuclease III. It accounts for approximately 95% of DNA repair capabilities in humans. In the yeast Saccharomyces cerevisiae , AP endonuclease-1 (APN-1) is the primary AP endonuclease and accounts for the majority of the yeast DNA repair activity. In contrast to APE-1/Ref-1, APN-1 belongs to the second family of AP endonucleases and shares homology with E. coli exonuclease IV (21). Though both enzymes have comparable 5 endonuclease activity and the ability to repair AP sites, APN-1 has much greater 3 -diesterase activity, and no known redox capability. In APE-1/Ref-1, the DNA repair activity resides in the C-terminal portion of the protein, while the N-terminal domain is necessary for redox regulation of transcription (22). In addition to the 90% homology between various mammalian AP endonucleases, there is a highly conserved cysteine at position 65 in human, mouse, and rat AP endonucleases that is thought to be important in redox function of these proteins. APE-1/Ref-1 functions as a regulatory protein for redox activation of a number of transcription factors (2–8). Xanthoudakis and Curran (2) originally identified the redox function of APE-1/Ref-1 when they studied the in vitro activation of AP-1 DNA binding in HeLa cells. APE-1/ Ref-1 acts via a post-translational mechanism in which conserved cysteine residues in the DNA-binding domains of Fos and Jun proteins are reduced, allowing DNA binding to occur. We have demonstrated a direct correlation between the amounts of nuclear APE-1/Ref-1 and AP-1 activity in alveolar macrophages, suggesting an important role for APE-1/Ref-1 in the inflammatory response in the lung (23). AP-1 is one of many transcription factors under redox control of APE-1/Ref-1. Table 1 lists the transcription factors shown to exhibit redox regulation by APE-1/ Ref-1. For example, Jayaraman and colleagues (24) demonstrated that cotransfection of p53, a transcription factor that is involved in the response to oxidative stress and apoptosis, with APE-1/Ref-1, increases expression of the p53-dependent genes, cyclin G, p21, and BAX. Additionally, the Pax family of genes, important for normal development, cellular differentiation, and thyroid function, has been shown to exhibit transcriptional activation of specific promotors in cotransfection experiments with APE-1/Ref-1 (7, 8). These and other transcription factors under redox control of APE-1/Ref-1 are involved in regulation of a number of important cellular functions and these studies suggest a complex, multifunctional role for APE-1/Ref-1 in cellular response to stress. Regulation of APE-1/Ref-1 occurs at both the transcriptional and post-translational level. Transcriptional regulation of APE-1/Ref-1 has been shown to occur via a ( Received in original form September 22, 2001 )

Adverse immunological reactions to adenoviral vectors have significantly impacted the utility of this virus for treating genetic and environmentally induced diseases. In this study, we evaluate the effect of adenoviral vectors on an animal model of sepsis. Systemic delivery of first-generation adenoviral vectors to septic mice (cecal ligation and puncture) resulted in a shortened survival time. This effect was not observed with second-generation or inactivated first-generation vectors. The accelerated death was accompanied by a number of important changes in the disease. These changes included increased liver cell apoptosis (including Kupffer cells) and a marked increase in liver bacterial load. In the lung, the combination induced an increase in bacterial load, as well as greater lung injury. In the serum, the combination was associated with decreased TNF-alpha levels and an increase in bacterial load. Finally, a profound degree of lymphocyte apoptosis was observed in these animals. These observations suggest that prior exposure to first-generation adenovirus gene therapy vectors may worsen the outcome of some forms of sepsis.

Sarcoidosis is a granulomatous disease of unknown cause characterized by a lymphocytic alveolitis. Previous studies have shown that the inflammatory cell population of the distal lung units of patients with this disorder can be accurately assessed using bronchoalveolar lavage (BAL). The present study evaluated the uniformity of BAL between different sites of the lung in patients with sarcoidosis. In general, there was a good correlation between sites for percentages of lymphocyes (LYM) (r = 0.750, p < 0.0001), LYM number (r = 0.356, p = 0.0007), percentages of neutrophils (NEUT) (r = 0.917, p < 0.0001), NEUT number (r = 0.999, p < 0.0001), and macrophage (MAC) number (r = 0.858, p < 0.001). Despite the good overall correlation, we found that 43% of the patients with high percent LYM (> 30%) had this finding on one side only. These patients did not differ from the group as a whole based on radiographic stage of their disease but did differ in the number of radiographs demonstrating focal infiltrates (2 of 28 patients with both sides < 30% LYM, 2 of 14 with both sides > 30% LYM, and 4 of 9 with only one side > 30% LYM p < 0.05 by chi-square); and in each situation the highest percent LYM was seen on the side with focal changes on the chest radiograph. In addition, as a group, the patients with bilateral > 30% LYM had a lower percent predicted TLC (p < 0.05 compared with those with unilateral > 30% LYM and p < 0.01 compared with those with bilateral < 30% LYM) and DlCO (p < 0.01 compared with both groups). Similar groups defined by MAC number, though, did not differ from one another in any of the pulmonary function tests. These findings suggest that potentially useful information can be gained by the lavage of more than one site in patients with sarcoidosis, that these patients are not easily recognized prior to BAL, and that patients with bilateral > 30% LYM have worse pulmonary function as a group than do those with a bilateral or unilateral low LYM recovery.

Airway epithelial cells are often the sites of targeted adenovirus vector delivery. Activation of the host inflammatory response and modulation of signal transduction pathways by adenovirus vectors have been previously documented, including activation of MAP kinases and phosphatidylinositol 3-kinase (PI3-kinase). The effect of activation of these pathways by adenovirus vectors on cell survival has not been examined. Both the PI3-kinase/Akt and ERK/MAP kinase signaling pathways have been linked to cell survival. Akt has been found to play a role in cell survival and apoptosis through its downstream effects on apoptosis-related proteins. Constitutive activation of either PI3-kinase or Akt blocks apoptosis induced by c-Myc, UV radiation, transforming growth factor-β, Fas, and respiratory syncytial virus infection. We examined the effect of adenovirus vector infection on activation of these prosurvival pathways and its downstream consequences. Airway epithelial cells were transduced with replication-deficient adenoviral vectors containing a nonspecific transgene, green fluorescent protein driven by the cytomegalovirus promoter, or an empty vector with no transgene. They were then exposed to the proapoptotic stimulus actinomycin D plus TNF-α, and evidence of apoptosis was evaluated. Compared with the cells treated with actinomycin/TNF alone, the adenovirus vector-infected cells had a 50% reduction in apoptosis. When we examined induction of the prosurvival pathways, ERK and AKT, in the viral vector-infected cells, we found that there was significant activation of both Akt and ERK.

Section:ChooseTop of pageAbstract <<Materials and MethodsResultsDiscussionReferencesCITING ARTICLES

Staphylococcal enterotoxin B induces toxic shock and is a major virulence factor of staphylococcal diseases. We examined the effects of systemic adenoviral infection on responses to staphylococcal enterotoxin B in a murine model. We found that adenoviral infection markedly increases the severity of liver injury following exposure to staphylococcal enterotoxin B without d-galactosamine sensitization. In adenovirus-infected mice, staphylococcal enterotoxin B triggered a more profound hypothermia and increased apoptosis in the liver. Consistent with these observations, we also found that adenoviral infection primed for an increased production of gamma interferon in vivo and in vitro following stimulation with staphylococcal enterotoxin B. Gamma-interferon-knockout mice did not show increased sensitivity to staphylococcal enterotoxin B following adenoviral infection. These data suggest that a preexisting viral infection primes mice for subsequent staphylococcal enterotoxin B exposure, possibly via a gamma-interferon-mediated mechanism.

Background: Acrolein is a ubiquitous environmental hazard to human health. Acrolein has been reported to activate the DNA damage response and induce apoptosis. However, little is known about the effects of acrolein on cellular senescence.Objectives: We examined whether acrolein induces cellular senescence in cultured normal human lung fibroblasts (NHLF).Methods: We cultured NHLF in the presence or absence of acrolein and determined the effects of acrolein on cell proliferative capacity, senescence-associated β-galactosidase activity, the known senescence-inducing pathways (e.g., p53, p21), and telomere length.Results: We found that acrolein induced cellular senescence by increasing both p53 and p21. The knockdown of p53 mediated by small interfering RNA (siRNA) attenuated acrolein-induced cellular senescence. Acrolein decreased Werner's syndrome protein (WRN), a member of the RecQ helicase family involved in DNA repair and telomere maintenance. Acrolein-induced down-regulation of WRN protein was rescued by p53 knockdown or proteasome inhibition. Finally, we found that acrolein accelerated p53-mediated telomere shortening.Conclusions: These results suggest that acrolein induces p53-mediated cellular senescence accompanied by enhanced telomere attrition and WRN protein down-regulation.Citation: Jang JH, Bruse S, Huneidi S, Schrader RM, Monick MM, Lin Y, Carter AB, Klingelhutz AJ, Nyunoya T. 2014. Acrolein-exposed normal human lung fibroblasts in vitro: cellular senescence, enhanced telomere erosion, and degradation of Werner's syndrome protein. Environ Health Perspect 122:955–962; http://dx.doi.org/10.1289/ehp.1306911

Hyperoxia induces growth arrest, apoptosis, necrosis, and morphological changes (spreading and adhesion) in various types of cells. The mechanism of hyperoxia-induced cell growth arrest has not been well elucidated, especially in macrophages. One possible mechanism is a role of cell adhesion in hyperoxia-induced cell cycle arrest. To evaluate this finding, macrophages were cultured in normoxia (21% O₂) or hyperoxia (95% O₂) in adhesion or low adhesion conditions. Incubation of macrophages in hyperoxia induced cell cycle arrest. The hyperoxia-induced cell cycle arrest was prevented by low adhesion conditions. To evaluate pathways potentially involved in hyperoxia-induced growth arrest, we measured extracellular regulated kinase and retinoblastoma protein activation and p21^Cip1 and p53 accumulation. Hyperoxia strongly induced activation of extracellular regulated kinase and retinoblastoma protein as well as up-regulation of p21^Cip1. These effects of hyperoxia were attenuated under low adhesion conditions, suggesting a role for integrin-dependent signaling. The induction of p21^Cip1 and activation of retinoblastoma protein occurred via a p53-independent mechanism. These results suggest that adhesion-dependent pathways are required for hyperoxia-induced cell cycle arrest in macrophages.

ABSTRACT Many bacterial pathogens, including Staphylococcus aureus , use a variety of pore-forming toxins as important virulence factors. Staphylococcal alpha-toxin, a prototype β-barrel pore-forming toxin, triggers the release of proinflammatory mediators and induces primarily necrotic death in susceptible cells. However, whether host factors released in response to staphylococcal infections may increase cell resistance to alpha-toxin is not known. Here we show that prior exposure to interferons (IFNs) prevents alpha-toxin-induced membrane permeabilization, the depletion of ATP, and cell death. Moreover, pretreatment with IFN-α decreases alpha-toxin-induced secretion of interleukin 1β (IL-1β). IFN-α, IFN-β, and IFN-γ specifically protect cells from alpha-toxin, whereas tumor necrosis factor alpha (TNF-α), IL-6, and IL-4 have no effects. Furthermore, we show that IFN-α-induced protection from alpha-toxin is not dependent on caspase-1 or mitogen-activated protein kinases, but requires protein synthesis and fatty acid synthase activity. Our results demonstrate that IFNs may increase cell resistance to staphylococcal alpha-toxin via the regulation of lipid metabolism and suggest that interferons play a protective role during staphylococcal infections.

Human cytomegalovirus (HCMV), which is a major cause of morbidity and mortality in immunosuppressed patients, can itself alter immune function. It has previously been shown that HCMV immediate early (IE) gene products regulate the IL-1 beta promoter. The purpose of these studies was to determine whether HCMV IE gene products regulate expression of the IL-1 receptor antagonist (IL-1ra) gene. THP-1 cells, a myelomonocytic cell line, were transfected with a plasmid containing one or more of the HCMV IE genes downstream of the HCMV major immediate early promoter, or with a control plasmid. IL-1 beta and IL-1ra protein secretion was evaluated by ELISA, and expression of the mRNA for the cytokines was examined by means of Northern blot analysis. The HCMV IE1+2 gene products were found to increase expression of the mRNA for both IL-1 beta and IL-1ra; however, only the IL-1ra protein was released in increased amounts. The individual HCMV IE gene products had different effects on expression of the IL-1ra gene; the HCMV IE1 gene product down-regulated expression of the IL-1ra gene, whereas the IE2 gene product up-regulated expression of the IL-1ra gene. Thus, HCMV IE gene products can either up-regulate or down-regulate expression of the IL-1ra gene, depending on which IE genes are expressed in monocytes-macrophages. This study adds to the understanding of how HCMV can alter immune function during both active and latent infection.

A number of lung diseases, including many interstitial lung diseases and HIV infection, are associated with decreases in intracellular thiols. Altered Th1/Th2 T cell balance has also been associated with disease progression in many of the same diseases. IFN-gamma and IL-4 are critical effector cytokines of Th1 and Th2 cells, respectively. To determine the effect of thiols on the production of IFN-gamma and IL-4 by splenocytes, cells were incubated in the presence and the absence of N-acetylcysteine (NAC) and stimulated with alphaCD3 or alphaCD3 and IL-12. Augmenting intracellular soluble thiol pools ( approximately 2-fold) with 15 mM NAC blocked induction of IFN-gamma and increased production of IL-4 without causing significant changes in intracellular glutathione levels. The effect of NAC on IL-4 production was not linked to an increase in STAT6 phosphorylation, as STAT6 levels were decreased, nor did the increase in IL-4 occur with purified CD4 cells. We found that NAC increased splenocyte IL-4 production via an effect on APCs. We also found that NAC increased two IL-4 relevant transcription factors (AP-1) and NFATc. These studies suggest that increasing intracellular reduced thiol pools decreases IL-12 signaling and IFN-gamma production, while increasing IL-4 production. The sum of these effects may contribute to alterations in the balance between Th1 and Th2 responses in lung diseases associated alterations in intracellular thiol pools.

Silicosis is an interstitial lung disorder that is frequently associated with hypergammaglobulinemia and increased numbers of lymphocytes at sites of disease. To determine the effect of silica on the generation of immunoglobulin-secreting cells, mononuclear cells were stimulated with antigens or mitogens and placed into 1) high-density cultures (2.5 X 10(6) cells/ml) that were not exposed to silica, in which pokeweed mitogen (PWM)-induced generation of immunoglobulin-secreting cells was suppressed by the presence of monocytes; or 2) low-density cultures (0.5 X 10(6) cells/ml) that were not exposed to silica, in which PWM-induced generation of immunoglobulin-secreting cells was not suppressed. Silica added to PWM-stimulated high-density cultures significantly increased the numbers of immunoglobulin-secreting cells. Silica also significantly increased the numbers of immunoglobulin-secreting cells in high-density cultures stimulated with purified protein derivative and tetanus toxoid and augmented the proliferation of phytohemagglutinin-stimulated mononuclear cells (P less than 0.05). In contrast to high-density cultures, silica added with PWM to low-density cultures reduced the numbers of immunoglobulin-secreting cells. These studies suggest that silica can have potent regulatory effects on various cellular immune processes that are relevant to the lung.

TNF-α influences morbidity and mortality during the course of endotoxemia. However, the complex pleiotropic functions of TNF-α remain poorly understood. We evaluated how hepatic induction of NF-κB and TNF-α influence survival and hepatocellular death in a lethal murine model of endotoxic shock. Using dominant-negative viral vectors to inhibit the IKK complex, we demonstrate through this study that the liver is a major source of TNF-α during the course of lethal endotoxemia and that IKKβ (but not IKKα) is predominantly responsible for activating NF-κB and TNF-α in the liver after LPS administration. Using TNF-α knockout mice and hepatic-specific inhibition of IKKβ, we demonstrate that the status of TNF-α and NF-κB balances necrotic and apoptotic fates of hepatocytes in the setting of endotoxemia. In the presence of TNF-α, inhibiting hepatic IKKβ resulted in increased survival, reduced serum proinflammatory cytokines, and reduced hepatocyte necrosis in response to a lethal dose of endotoxin. In contrast, inhibiting hepatic IKKβ in TNF-α knockout mice resulted in decreased survival and increased caspase 3-mediated hepatocyte apoptosis after endotoxin challenge, despite a reduced proinflammatory cytokine response. In the presence of TNF-α, NF-κB-dependent hepatocellular necrosis predominated, while in the absence of TNF-α, NF-κB primarily influenced apoptotic fate of hepatocytes. Changes in JNK phosphorylation after LPS challenge were also dynamically affected by both IKKβ and TNF-α; however, this pathway could not solely explain the differential outcomes in hepatocellular fates. In conclusion, our studies demonstrate that induction of NF-κB and TNF-α balances protective (antiapoptotic) and detrimental (proinflammatory) pathways to determine hepatocellular fates during endotoxemia.

Inhalation of asbestos fibers results in a variety of lung diseases, including pulmonary fibrosis. Various animal models have demonstrated the importance of cytokines in the pathogenesis of pulmonary fibrosis. Alveolar macrophages from patients exposed to asbestos spontaneously release increased amounts of cytokines. The purpose of these studies was to determine whether asbestos directly stimulates cytokine release from human alveolar macrophages after in vitro exposure. We demonstrate that, although asbestos triggers cytokine release from blood monocytes, normal alveolar macrophages do not respond to asbestos stimulation with cytokine release. However, normal alveolar macrophages are activated by asbestos particles, in vitro, as determined by the upregulation of mRNAs for cytokines, and activation of the p38 kinase, which has been shown to be important in the translation of cytokine message into protein. These studies demonstrate that asbestos stimulates both normal blood monocytes and normal alveolar macrophages, but that there is a block in translation of cytokine mRNAs in the macrophages.

Interleukin (IL-1) and tumor necrosis factor (TNF) activate human lung fibroblasts through interactions with specific receptors. One effect of this interaction of IL-1 and TNF with fibroblasts is an increased production of the cytokines, IL-6 and IL-8. Dexamethasone blocks the induction of IL-6 and IL-8 by IL-1 or TNF. In these studies, we determined whether dexamethasone interferes with the upregulation of IL-6 and IL-8 by downregulating expression of the IL-1 or TNF receptor genes. Confluent lung fibroblasts were treated with medium alone (control) or medium with dexamethasone (10(-6) M). Dexamethasone did not decrease the binding of IL-1 and TNF to their receptors, nor did it decrease amounts of IL-1 or TNF receptor RNA. Both IL-1 and TNF increased release of IL-6 and IL-8 from the cells in a dose-dependent manner and dexamethasone inhibited this effect. Dexamethasone also inhibited the induction of IL-6 and IL-8 RNA by IL-1 and TNF. The studies show that dexamethasone does not block the effects of IL-1 or TNF on fibroblasts by decreasing expression of IL-1 or TNF receptors.

We used the ILO classification for occupational lung disease to determine whether there was any correlation between the type and/or severity of pulmonary infiltration on chest roentgenograms and either pulmonary function tests or the types of inflammatory cells present in BAL fluid in patients with interstitial lung disease. Of the 62 patients evaluated (27 with sarcoidosis, 18 with IPF, and 17 with a CV disease and lung involvement), 49 had irregular linear opacities and 13 had normal chest x-rays. There were no significant correlations between the types of cells present in BAL fluid and the various categories of infiltrate or profusion of the infiltrates within each disease group. In patients with sarcoidosis, more extensive infiltration (profusion) was associated with lower FEV, (p less than 0.01). In patients with IPE, linear opacity type, profusion, and the presence or absence of honeycombing were not related to the severity of pulmonary function abnormalities. We conclude that the ILO classification for analysis of chest roentgenograms can be applied to patients with interstitial lung disease not associated with an occupational exposure and that this approach is useful, especially for communication. However, these data provide no information regarding the inflammatory process in the lung and limited information regarding abnormalities in pulmonary function.

Latent cytomegalovirus (CMV) infection is often reactivated in the lung. We postulated that this reactivation could occur by stimulation of the CMV major immediate early (IE) promoter by other viruses that infect the lung. The specific aim of this study was to investigate whether adenovirus early proteins could stimulate the CMV IE promoter in inflammatory cells. We transfected the monocyte/macrophage THP-1 cell line and the T-lymphocyte Jurkat cell line with plasmids coding for adenovirus E1A 12S or 13S proteins, along with a plasmid containing the CMV IE promoter region linked to the chloramphenicol acetyltransferase (CAT) reporter gene. In unstimulated THP-1 cells, the E1A 13S gene product increased CMV IE CAT activity by 18-fold compared with cells containing the control E1A plasmid. This effect was not seen in cells transfected with the E1A 12S plasmid. There was a similar effect of the E1A 13S gene product in LPS-stimulated THP-1 cells. In unstimulated Jurkat cells, the E1A 13S gene product stimulated CMV IE CAT activity by 19-fold compared with cells containing the E1A control plasmid; the E1A 12S gene product had no effect. There was a similar effect of the 13S E1A gene product in phorbol myristate acetate-stimulated Jurkat cells. These findings demonstrate that the CMV IE promoter can be stimulated by early viral proteins of adenovirus in inflammatory cells. These observations could be important for understanding the reactivation of latent CMV infection.