László Fésüs

Research in autophagy continues to accelerate,(1) and as a result many new scientists are entering the field. Accordingly, it is important to establish a standard set of criteria for monitoring macroautophagy in different organisms. Recent reviews have described the range of assays that have been used for this purpose.(2,3) There are many useful and convenient methods that can be used to monitor macroautophagy in yeast, but relatively few in other model systems, and there is much confusion regarding acceptable methods to measure macroautophagy in higher eukaryotes. A key point that needs to be emphasized is that there is a difference between measurements that monitor the numbers of autophagosomes versus those that measure flux through the autophagy pathway; thus, a block in macroautophagy that results in autophagosome accumulation needs to be differentiated from fully functional autophagy that includes delivery to, and degradation within, lysosomes (in most higher eukaryotes) or the vacuole (in plants and fungi). Here, we present a set of guidelines for the selection and interpretation of the methods that can be used by investigators who are attempting to examine macroautophagy and related processes, as well as by reviewers who need to provide realistic and reasonable critiques of papers that investigate these processes. This set of guidelines is not meant to be a formulaic set of rules, because the appropriate assays depend in part on the question being asked and the system being used. In addition, we emphasize that no individual assay is guaranteed to be the most appropriate one in every situation, and we strongly recommend the use of multiple assays to verify an autophagic response.

Transglutaminase 2 (TG2) is an inducible transamidating acyltransferase that catalyzes Ca(2+)-dependent protein modifications. It acts as a G protein in transmembrane signalling and as a cell surface adhesion mediator, this distinguishes it from other members of the transglutaminase family. The sequence motifs and domains revealed in the recent TG2 structure, can each be assigned distinct cellular functions, including the regulation of cytoskeleton, cell adhesion and cell death. Ablation of TG2 in mice results in impaired wound healing, autoimmunity and diabetes, reflecting the number and variety of TG2 functions. An important role for the enzyme in the pathogenesis of coeliac disease, fibrosis and neurodegenerative disorders has also been demonstrated, making TG2 an important therapeutic target.

During the involution of lead nitrate-induced hyperplasia in rat liver a significant increase of transglutaminase activity, enzyme concentration, transglutaminase messenger RNA and protein-bound epsilon-(gamma-glutamyl)lysine (product of transglutaminase action) coincided with programmed death (apoptosis) of hepatocytes. Immunohistochemical examination showed the appearance of transglutaminase in apoptotic hepatocytes. An increased transglutaminase level was also detected during glucocorticoid-induced apoptosis of rat thymocytes.

Tissue transglutaminase (TGase2) is a protein-crosslinking enzyme known to be associated with the in vivo apoptosis program. Here we report that apoptosis could be induced in TGase2-/- mice; however, the clearance of apoptotic cells was defective during the involution of thymus elicited by dexamethasone, anti-CD3 antibody, or gamma-irradiation, and in the liver after induced hyperplasia. The lack of TGase2 prevented the production of active transforming growth factor-beta1 in macrophages exposed to apoptotic cells, which is required for the up-regulation of TGase2 in the thymus in vivo, for accelerating deletion of CD4+CD8+ cells and for efficient phagocytosis of apoptotic bodies. The deficiency is associated with the development of splenomegaly, autoantibodies, and immune complex glomerulonephritis in TGase2-/- mice. These findings have broad implications not only for diseases linked to inflammation and autoimmunity but also for understanding the interrelationship between the apoptosis and phagocytosis process.

Physiological deletion of cells ensues programmed death which involves formation of apoptotic bodies with fragmented DNA. Here we report that apoptotic hepatocytes are insoluble in detergents, urea, guanidine hydrochloride, reducing agents and thereby can be isolated from rat liver following collagenase treatment. They are wrinkled, spherical structures similar to cornified envelopes of epidermis by phase-contrast microscopy and show irregular, globular morphology by scanning-electron microscopy. Part of their DNA content is cleaved into nucleosomal and oligonucleosomal fragments. Their insolubility, like that of the cornified envelope, is evoked by epsilon-(gamma-glutamyl)lysine and N1,N8-bis(gamma-glutamyl)spermidine protein cross-linking bonds formed by transglutaminase.

Retinoids induce myeloblastic leukemia (HL-60) cells to differentiate into granulocytes, which subsequently die by apoptosis. Retinoid action is mediated through at least two classes of nuclear receptors: retinoic acid receptors, which bind both all-trans retinoic acid and 9-cis retinoic acid, and retinoid X receptors, which bind only 9-cis retinoic acid. Using receptor-selective synthetic retinoids and HL-60 cell sublines with different retinoid responsiveness, we have investigated the contribution that each class of receptors makes to the processes of cellular differentiation and death. Our results demonstrate that ligand activation of retinoic acid receptors is sufficient to induce differentiation, whereas ligand activation of retinoid X receptors is essential for the induction of apoptosis in HL-60 cell lines.

Tissue transglutaminase is a cytosolic enzyme whose primary function is to catalyze the covalent cross-linking of proteins. To investigate the functions of this enzyme in physiological systems, we have established lines of Balb-C 3T3 fibroblasts stably transfected with a constitutive tissue transglutaminase expression plasmid. Several cell lines expressing high levels of catalytically active tissue transglutaminase have been isolated and characterized. Transglutaminase-transfected cells showed morphologic features quite distinct from their nontransfected counterparts. Many of the cells showed an extended and very flattened morphology that reflected increased adhesion of the cells to the substratum. Other cells, particularly those showing the highest levels of intracellular transglutaminase expression, showed extensive membrane blebbing and cellular fragmentation. The results of these experiments suggest that the induction and activation of tissue transglutaminase may contribute both to changes in cellular morphology and adhesiveness.

By crossing Huntington's disease (HD) R6/1 transgenic mice with 'tissue' transglutaminase (TG2) knock-out mice, we have demonstrated that this multifunctional enzyme plays an important role in the neuronal death characterising this disorder in vivo. In fact, a large reduction in cell death is observed in R6/1, TG2−/− compared with R6/1 transgenic mice. In addition, we have shown that the formation of neuronal intranuclear inclusions (NII) is potentiated in absence of the 'tissue' transglutaminase. These phenomena are paralleled by a significant improvement both in motor performances and survival of R6/1, TG2−/− versus R6/1 mice. Taken together these findings suggest an important role for tissue transglutaminase in the regulation of neuronal cell death occurring in Huntington's disease.

Transglutaminase 2 (TG2), a multifunctional enzyme with Ca 2+ ‐dependent protein crosslinking activity and GTP‐dependent G protein functions, is often upregulated in cells undergoing apoptosis. In cultured cells TG2 may exert both pro‐ and anti‐apoptotic effects depending upon the type of cell, the kind of death stimuli, the intracellular localization of the enzyme and the type of its activities switched on. The majority of data support the notion that transamidation by TG2 can both facilitate and inhibit apoptosis, while the GTP‐bound form of the enzyme generally protects cells against death. In vivo studies confirm the Janus face of TG2 in the initiation of the apoptotic program. In addition, they reveal a further role: the prevention of inflammation, tissue injury and autoimmunity once the apoptosis has already been initiated. This function of TG2 is partially achieved by being expressed and activated also in macrophages digesting apoptotic cells and mediating a crosstalk between dying and phagocytic cells.

Abstract Macrophages acquire their capacity for efficient phagocytosis of apoptotic cells during their differentiation from monocytes. The peroxisome proliferator‐activated receptor gamma (PPARγ) is highly up‐regulated during this maturation program. We report that addition of PPARγ antagonist during differentiation of human monocytes to macrophages significantly reduced the capacity of macrophages to engulf apoptotic neutrophils, but did not influence phagocytosis of opsonized bacteria. Macrophage‐specific deletion of PPARγ in mice also resulted in decreased uptake of apoptotic cells. The antagonist acted in a dose‐dependent manner during the differentiation of human macrophages and could also reverse the previously observed augmentation of phagocytosis by glucocorticoids. Blocking activation of PPARγ led to down‐regulation of molecular elements (CD36, AXL, TG2 and PTX3) of the engulfment process. Inhibition of PPARγ‐dependent gene expression did not block the anti‐inflammatory effect of apoptotic neutrophils or synthetic glucocorticoid, but significantly decreased production of IL‐10 induced by LPS. Our results suggest that during differentiation of macrophages natural ligands of PPARγ are formed, regulating the expression of genes responsible for effective clearance of apoptotic cells and macrophage‐mediated inflammatory responses.

Abstract Transglutaminase 2 (TG2), a protein cross-linking enzyme with many additional biological functions, acts as coreceptor for integrin β3. We have previously shown that TG2−/− mice develop an age-dependent autoimmunity due to defective in vivo clearance of apoptotic cells. Here we report that TG2 on the cell surface and in guanine nucleotide-bound form promotes phagocytosis. Besides being a binding partner for integrin β3, a receptor known to mediate the uptake of apoptotic cells via activating Rac1, we also show that TG2 binds MFG-E8 (milk fat globulin EGF factor 8), a protein known to bridge integrin β3 to apoptotic cells. Finally, we report that in wild-type macrophages one or two engulfing portals are formed during phagocytosis of apoptotic cells that are characterized by accumulation of integrin β3 and Rac1. In the absence of TG2, integrin β3 cannot properly recognize the apoptotic cells, is not accumulated in the phagocytic cup, and its signaling is impaired. As a result, the formation of the engulfing portals, as well as the portals formed, is much less efficient. We propose that TG2 has a novel function to stabilize efficient phagocytic portals.

Cells may use multiple pathways to commit suicide. In certain contexts, dying cells generate large amounts of autophagic vacuoles and clear large proportions of their cytoplasm, before they finally die, as exemplified by the treatment of human mammary carcinoma cells with the anti-estrogen tamoxifen (TAM, < or = 1 microM). Protein analysis during autophagic cell death revealed distinct proteins of the nuclear fraction including GST-pi and some proteasomal subunit constituents to be affected during autophagic cell death. Depending on the functional status of caspase-3, MCF-7 cells may switch between autophagic and apoptotic features of cell death [Fazi, B., Bursch, W., Fimia, G.M., Nardacci R., Piacentini, M., Di Sano, F., Piredda, L., 2008. Fenretinide induces autophagic cell death in caspase-defective breast cancer cells. Autophagy 4(4), 435-441]. Furthermore, the self-destruction of MCF-7 cells was found to be completed by phagocytosis of cell residues [Petrovski, G., Zahuczky, G., Katona, K., Vereb, G., Martinet, W., Nemes, Z., Bursch, W., Fésüs, L., 2007. Clearance of dying autophagic cells of different origin by professional and non-professional phagocytes. Cell Death Diff. 14 (6), 1117-1128]. Autophagy also constitutes a cell's strategy of defense upon cell damage by eliminating damaged bulk proteins/organelles. This biological condition may be exemplified by the treatment of MCF-7 cells with a necrogenic TAM-dose (10 microM), resulting in the lysis of almost all cells within 24h. However, a transient (1h) challenge of MCF-7 cells with the same dose allowed the recovery of cells involving autophagy. Enrichment of chaperones in the insoluble cytoplasmic protein fraction indicated the formation of aggresomes, a potential trigger for autophagy. In a further experimental model HL60 cells were treated with TAM, causing dose-dependent distinct responses: 1-5 microM TAM, autophagy predominant; 7-9 microM, apoptosis predominant; 15 microM, necrosis. These phenomena might be attributed to the degree of cell damage caused by tamoxifen, either by generating ROS, increasing membrane fluidity or forming DNA-adducts. Finally, autophagy constitutes a cell's major adaptive (survival) strategy in response to metabolic challenges such as glucose or amino acid deprivation, or starvation in general. Notably, the role of autophagy appears not to be restricted to nutrient recycling in order to maintain energy supply of cells and to adapt cell(organ) size to given physiological needs. For instance, using a newly established hepatoma cell line HCC-1.2, amino acid and glucose deprivation revealed a pro-apoptotic activity, additive to TGF-beta1. The pro-apoptotic action of glucose deprivation was antagonized by 2-deoxyglucose, possibly by stabilizing the mitochondrial membrane involving the action of hexokinase II. These observations suggest that signaling cascades steering autophagy appear to provide links to those regulating cell number. Taken together, our data exemplify that a given cell may flexibly respond to type and degree of (micro)environmental changes or cell death stimuli; a cell's response may shift gradually from the elimination of damaged proteins by autophagy and the recovery to autophagic or apoptotic pathways of cell death, the failure of which eventually may result in necrosis.

Pathogen-activated and damage-associated molecular patterns activate the inflammasome in macrophages. We report that mouse macrophages release IL-1β while co-incubated with pro-B (Ba/F3) cells dying, as a result of IL-3 withdrawal, by apoptosis with autophagy, but not when they are co-incubated with living, apoptotic, necrotic or necrostatin-1 treated cells. NALP3-deficient macrophages display reduced IL-1β secretion, which is also inhibited in macrophages deficient in caspase-1 or pre-treated with its inhibitor. This finding demonstrates that the inflammasome is activated during phagocytosis of dying autophagic cells. We show that activation of NALP3 depends on phagocytosis of dying cells, ATP release through pannexin-1 channels of dying autophagic cells, P(2)X(7) purinergic receptor activation, and on consequent potassium efflux. Dying autophagic Ba/F3 cells injected intraperitoneally in mice recruit neutrophils and thereby induce acute inflammation. These findings demonstrate that NALP3 performs key upstream functions in inflammasome activation in mouse macrophages engulfing dying autophagic cells, and that these functions lead to pro-inflammatory responses.

Schizophrenia requires lifelong treatment, potentially causing systemic changes in metabolic homeostasis. In the clinical setting, antipsychotic treatment may differentially lead to weight gain among individual patients, although the molecular determinants of such adverse effects are currently unknown. In this study, we investigated changes in the expression levels of critical regulatory genes of adipogenesis, lipid metabolism and proinflammatory genes during the differentiation of primary human adipose-derived stem cells (ADSCs). These cells were isolated from patients with body mass indices <25 and treated with the second-generation antipsychotics olanzapine, ziprasidone, clozapine, quetiapine, aripiprazole and risperidone and the first-generation antipsychotic haloperidol. We found that antipsychotics exhibited a marked effect on key genes involved in the regulation of cell cycle, signal transduction, transcription factors, nuclear receptors, differentiation markers and metabolic enzymes. In particular, we observed an induction of the transcription factor NF-KB1 and NF-KB1 target genes in adipocytes in response to these drugs, including the proinflammatory cytokines TNF-α, IL-1β, IL-8 and MCP-1. In addition, enhanced secretion of both IL8 and MCP-1 was observed in the supernatant of these cell cultures. In addition to their remarkable stimulatory effects on proinflammatory gene transcription, three of the most frequently prescribed antipsychotic drugs, clozapine, quetiapine and aripiprazole, also induced the expression of essential adipocyte differentiation genes and the adipocyte hormones leptin and adiponectin, suggesting that both glucose and fat metabolism may be affected by these drugs. These data further suggest that antipsychotic treatments in patients alter the gene expression patterns in adipocytes in a coordinated fashion and priming them for a low-level inflammatory state.

Brown and beige adipocytes contribute significantly to the regulation of whole body energy expenditure and systemic metabolic homeostasis not exclusively by thermogenesis through mitochondrial uncoupling. Several studies have provided evidence in rodents that brown and beige adipocytes produce a set of adipokines ("batokines") which regulate local tissue homeostasis and have beneficial effects on physiological functions of the entire body. We observed elevated secretion of Interleukin (IL)-6, IL-8 and monocyte chemoattractant protein (MCP)-1, but not tumor necrosis factor alpha (TNFα) or IL-1β pro-inflammatory cytokines, by ex vivo differentiating human beige adipocytes (induced by either PPARγ agonist or irisin) compared to white. Higher levels of IL-6, IL-8 and MCP-1 were released from human deep neck adipose tissue biopsies (enriched in browning cells) than from subcutaneous ones. IL-6 was produced in a sustained manner and mostly by the adipocytes and not by the undifferentiated progenitors. Continuous blocking of IL-6 receptor by specific antibody during beige differentiation resulted in downregulation of brown marker genes and increased morphological changes that are characteristic of white adipocytes. The data suggest that beige adipocytes adjust their production of IL-6 to reach an optimal level for differentiation in the medium enhancing browning in an autocrine manner.

The retinoblastoma gene product (pRB) plays an important role in controlling both cell release from the G 1 phase and apoptosis.We show here that in the early phases of apoptosis, pRB is posttranslationally modified by a tissue transglutaminase (tTG)-catalyzed reaction.In fact, by employing a novel haptenized lysis synthetic substrate which allows the isolation of glutaminyl-tTG substrates in vivo, we identified pRB as a potential tTG substrate in U937 cells undergoing apoptosis.In keeping with this finding, we showed that apoptosis of U937 cells is characterized by the rapid disappearance of the 105,000-to 110,000-molecular-weight pRB forms concomitantly with the appearance of a smear of immunoreactive products with a molecular weight of greater than 250,000.The shift in pRB molecular weight was reproduced by adding exogenous purified tTG to extracts obtained from viable U937 cells and was prevented by dansylcadaverine, a potent enzyme inhibitor.The effect of the pRB posttranslational modification during apoptosis was investigated by determining the E2F-1 levels and by isolating and characterizing pRB-null clones from U937 cells.Notably, the lack of pRB in these U937-derived clones renders these p53-null cells highly resistant to apoptosis induced by serum withdrawal, calphostin C, and ceramide.Taken together, these data suggest that tTG, acting on the pRB protein, might play an important role in the cell progression through the death program.

Peripheral blood mononuclear cells and lymphoid tissues from HIV-infected individuals display high levels of "tissue" transglutaminase (tTG) with respect to seronegative persons. In asymptomatic individuals, &gt; 80% of the circulating CD4+ T cells synthesize tTG protein and the number of these cells matches the level of apoptosis detected in the peripheral blood mononuclear cells from the same patients. In HIV-infected lymph nodes tTG protein is localized in large number of cells (macrophages, follicular dendritic cells, and endothelial cells), showing distinctive morphological and biochemical features of apoptosis as well as in lymphocytes and syncytia. These findings demonstrate that during the course of HIV infection, high levels of apoptosis also occur in the accessory cells of lymphoid organs. The increased concentration of epsilon(gamma-glutamyl)lysine isodipeptide, the degradation product of tTG cross-linked proteins, observed in the blood of HIV-infected individuals demonstrates that the enzyme accumulated in the dying cells actively cross-links intracellular proteins. The enhanced levels of epsilon(gamma-glutamyl)lysine in the blood parallels the progression of HIV disease, suggesting that the isodipeptide determination might be a useful method to monitor the in vivo rate of apoptosis.

The fructose-streptozotocin (FRU-STZ) diabetic model has been presented as a viable model of type2 diabetes but its impact on the testes and epididymis of Wistar rats is yet to be investigated. In this study, we probed the role of caffeic acid, a potent antioxidant, in FRU-STZ diabetic rats. Twenty normoglycemic rats were randomly divided into four groups of five rats each: Control, Fructose-Streptozotocin (FRU+STZ), Fructose-Streptozotocin + Caffeic Acid (FRU+STZ+CA), and Caffeic Acid (CA). Diabetes was induced by the administration of 10 % fructose solution ad libitum for 2 weeks followed by a single intraperitoneal injection of 50 mg/kg bwt of streptozotocin. Treatment with CA (50 mg/kg bwt) lasted for two weeks. Results showed that FRU-STZ diabetes was able to induce amyloidosis and histopathological deficits in the testis and epididymis characteristic of cytotoxic agents. Poor PCNA immunoreactivity, reactive Nrf2 expression, and defective steroidogenesis were also observed in the diabetic group. FRU-STZ diabetes was also associated with significantly increased Na+-K+ ATPase activity in both testes and epididymis. Treatment with caffeic acid was able to restore steroidogenesis and spermatogenesis in the diabetic rats to levels comparable to the control; histological features and Na+-K+ ATPase activity were also reduced in the CA-treated group. Generally, normal rats treated with caffeic acid did not evince any deleterious effects. Our study demonstrates that CA exerts a protective role in FRU-STZ diabetes.

Transglutaminase 2 (TG2) is the first described cellular member of an enzyme family catalyzing Ca(2+)-dependent transamidation of proteins. During the last two decades its additional enzymatic (GTP binding and hydrolysis, protein disulfide isomerase, protein kinase) and non-enzymatic (multiple interactions in protein scaffolds) activities, which do not require Ca(2+) , have been recognized. It became a prevailing view that TG2 is silent as a transamidase, except in extreme stress conditions, in the intracellular environment characterized by low Ca(2+) and high GTP concentrations. To counter this presumption a critical review of the experimental evidence supporting the role of this enzymatic activity in cellular processes is provided. It includes the structural basis of TG2 regulation through non-canonical Ca(2+) binding sites, mechanisms making it sensitive to low Ca(2+) concentrations, techniques developed for the detection of protein transamidation in cells and examples of basic cellular phenomena as well as pathological conditions influenced by this irreversible post-translational protein modification.

Abstract Efficient execution of apoptotic cell death followed by efficient clearance mediated by professional macrophages is a key mechanism in maintaining tissue homeostasis. Removal of apoptotic cells usually involves three central elements: 1) attraction of phagocytes via soluble “find me” signals, 2) recognition and phagocytosis via cell surface-presenting “eat me” signals, and 3) suppression or initiation of inflammatory responses depending on additional innate immune stimuli. Suppression of inflammation involves both direct inhibition of proinflammatory cytokine production and release of anti-inflammatory factors, which all contribute to the resolution of inflammation. In the current study, using wild-type and adenosine A2A receptor (A2AR) null mice, we investigated whether A2ARs, known to mediate anti-inflammatory signals in macrophages, participate in the apoptotic cell-mediated immunosuppression. We found that macrophages engulfing apoptotic cells release adenosine in sufficient amount to trigger A2ARs, and simultaneously increase the expression of A2ARs, as a result of possible activation of liver X receptor and peroxisome proliferators activated receptor δ. In macrophages engulfing apoptotic cells, stimulation of A2ARs suppresses the NO-dependent formation of neutrophil migration factors, such as macrophage inflammatory protein-2, using the adenylate cyclase/protein kinase A pathway. As a result, loss of A2ARs results in elevated chemoattractant secretion. This was evident as pronounced neutrophil migration upon exposure of macrophages to apoptotic cells in an in vivo peritonitis model. Altogether, our data indicate that adenosine is one of the soluble mediators released by macrophages that mediate engulfment-dependent apoptotic cell suppression of inflammation.

The accumulation of misfolded proteins in intracellular inclusions is a generic feature of neurodegenerative disorders. Although heavily ubiquitylated, the aggregated proteins are not degraded by the proteasomes. A possible reason for this phenomenon may be a modification of deposited proteins by transglutaminases forming gamma-glutamyl-epsilon-lysine (GGEL) cross-links between distinct proteins. Here, we show that the frequency of GGEL cross-links is an order of magnitude higher in Alzheimer's brain cortex than in age-matched or younger controls. This difference is due to the accumulation of GGEL cross-links in ubiquitin-immunopositive protein particles present in both Alzheimer's brains and those from aged individuals. The highly cross-linked protein aggregates show immunoreactivity to antibodies against tau and neurofilament proteins, and partially also to alpha-synuclein, indicating that these structures are inherent in Alzheimer's neurofibrillary tangles and Lewy bodies. Using mass sequence analysis, we identified the same six pairs of peptide sequences cross-linked in both senile and Alzheimer's specimens: Gln31 and Gln190 of HSP27 protein are cross-linked with Lys29 and Lys48 of ubiquitin and HSP27 therefore may cross-link two (poly)ubiquitin chains. One lysine residue of parkin and one of alpha-synuclein were also found to be cross-linked. The data suggest that cross-linking of (poly)ubiquitin moieties via HSP27 may have a role in the stabilization of the intraneuronal protein aggregates by interference with the proteasomal elimination of unfolded proteins.

Clarification of the molecular details of forms of natural cell death, including apoptosis, has become one of the most challenging issues of contemporary biomedical sciences. One of the effector elements of various cell death pathways is the covalent cross-linking of cellular proteins by transglutaminases. This review will discuss the accumulating data related to the induction and regulation of these enzymes, particularly of tissue type transglutaminase, in the molecular program of cell death. A wide range of signalling pathways can lead to the parallel induction of apoptosis and transglutaminase, providing a handle for better understanding the exact molecular interactions responsible for the mechanism of regulated cell death.

A lysine derivative, 3-[N α[N ε-[2′,4′-dinitrophenyl]-amino-n-hexanoyl-l-lysylamido]-propane-1-ol, a novel amine substrate of transglutaminases, was synthesized and delivered into intact HL-60 and U937 human leukemia cells to probe the function of the intracellular enzyme. The novel substrate compound was covalently incorporated into intracellular proteins in these cells expressing high levels of tissue transglutaminase and undergoing apoptosis following the induction of their differentiation with dimethyl sulfoxide and retinoic acid. Immunoaffinity purification and microsequencing of labeled proteins identified cytoplasmic actin as the main endogenous glutaminyl substrate in these cells. As shown by confocal image analysis, cells revealed distinct labeling of the microfilament meshwork structures by the novel compound as the result of the intracellular action of transglutaminase.

Several molecular elements of programmed cell death and apoptosis have recently been revealed. The function of gene products which deliver the lethal 'hit' is still not known. Well-characterized and newly discovered cell surface structures (e.g. antigen receptors, FAS/APO-1), as well as transcriptional factors (steroid receptor, c-myc, P53, retinoblastoma protein and others), have been implicated in the initiation of the death pathway. Negative regulators of the process (ced-9 gene product in programmed death of cells in Caenorhabditis elegans and bcl-2 protein in apoptosis) have been described. Biochemical mechanisms responsible for the silent nature of natural deaths of cells include their rapid engulfment (mainly through integrin receptors), transglutaminase-catalyzed cross-linking of cellular proteins, and fragmentation of DNA. Several lines of evidence suggest that distinct molecular mechanisms may operate in various forms of natural cell death.

The expression of "tissue" transglutaminase (tTG) in two human tumor cell lines (the cervix adenocarcinoma line HeLa-TV and the neuroblastoma cells SK-N-BE-2) was found to be in correlation with the rate of physiological cell death (apoptosis) in culture. We investigated the effect of retinoic acid (RA) and alpha-difluoromethylornithine (DFMO) in order to elucidate the relationship between tTG expression and apoptosis. RA led to a 6-fold increase of tTG activity in HeLa-TV cells and to a 12-fold increase in SK-N-BE(2) cells, which was paralleled in both cell lines by a proportional increase in the number of apoptotic bodies recovered from the cultures. On the contrary, DFMO determined a dramatic reduction of tTG expression and of the apoptotic index. Immunohistochemical analysis using an anti-tTG antibody showed that the enzyme was accumulated in both cell lines within typical apoptotic bodies. Immunocytochemistry and cell cloning of SK-N-BE(2) line demonstrated that tTG was absent in cells showing neurite outgrowth, indicating that the enzyme expression is not associated with neural differentiation, even though both phenomena are elicited by retinoic acid. On the whole, these data indicate that also in tumors tTG activation takes place in cells undergoing apoptosis. The enzyme is activated in apoptotic cells to form cross-linked protein envelopes which are insoluble in detergents and chaotropic agents. The number of insoluble protein envelopes as well as the N,N-bis(gamma-glutamyl)polyamine cross-links is related with both tTG expression and apoptotic index, strongly suggesting the participation of the enzyme in the apoptotic program.(ABSTRACT TRUNCATED AT 250 WORDS)

The multifunctional tissue transglutaminase 2 (TG2) has a four-domain structure with several Ca(2+)-regulated biochemical activities, including transglutamylation and GTP hydrolysis. The structure of the Ca(2+)-binding form of the human enzyme is not known, and its Ca(2+)-binding sites have not been fully characterized. By mutagenesis, we have targeted its active site Cys, three sites based on homology to Ca(2+)-binding residues of epidermal transglutaminase and factor XIIIa (S1-S3), and two regions with negative surface potentials (S4 and S5). CD spectroscopy, antibody-binding assay and GTPase activity measurements indicated that the amino acid substitutions did not cause major structural alterations. Calcium-45 equilibrium dialysis and isothermal calorimetric titration showed that both wild-type and active site-deleted enzymes (C277S) bind six Ca(2+). Each of the S1-S5 mutants binds fewer than six Ca(2+), S1 is a strong Ca(2+)-binding site, and mutation of one site resulted in the loss of more than one bound Ca(2+), suggesting cooperativity among sites. All mutants were deficient in transglutaminase activity, and GTP inhibited remnant activities. Like those of the wild-type enzyme, the GTPase activities of the mutants were inhibited by Ca(2+), except in the case of the S4 and S5 mutants, which exhibited increased activity. TG2 is the major autoantigen in celiac disease, and testing the reactivity of mutants with autoantibodies from celiac disease patients revealed that S4 strongly determines antigenicity. It can be concluded that five of the Ca(2+)-binding sites of TG2 influence its transglutaminase activity, two sites are involved in the regulation of GTPase activity, and one determines antigenicity for autoantibodies in celiac patients.

MCF-7 cells undergo autophagic death upon tamoxifen treatment. Plated on non-adhesive substratum these cells died by anoikis while inducing autophagy as revealed by monodansylcadaverine staining, elevated light-chain-3 expression and electron microscopy. Both de novo and anoikis-derived autophagic dying cells were engulfed by human macrophages and MCF-7 cells. Inhibition of autophagy by 3-methyladenine abolished engulfment of cells dying through de novo autophagy, but not those dying through anoikis. Blocking exposure of phosphatidylserine (PS) on both dying cell types inhibited phagocytosis by MCF-7 but not by macrophages. Gene expression profiling showed that though both types of phagocytes expressed full repertoire of the PS recognition and signaling pathway, macrophages could evolve during engulfment of de novo autophagic cells the potential of calreticulin-mediated processes as well. Our data suggest that cells dying through autophagy and those committing anoikis with autophagy may engage in overlapping but distinct sets of clearance mechanisms in professional and non-professional phagocytes.

Phagocytosis of naturally dying cells usually blocks inflammatory reactions in host cells. We have recently observed that clearance of cells dying through autophagy leads to a pro-inflammatory response in human macrophages. Investigating this response further, we found that during engulfment of MCF-7 or 293T cells undergoing autophagic death, but not apoptotic or anoikic ones, caspase-1 was activated and IL-1β was processed, then secreted in a MyD88-independent manner. Autophagic dying cells were capable of preventing some LPS-induced pro-inflammatory responses, such as TNFα, IL-6 and IL-8 induction, but synergized with LPS for IL-1β production. Caspase-1 inhibition prevented macrophage IL-1β release triggered by the dying cells and also other pro-inflammatory cytokines which were not formed in the presence of IL-1 receptor antagonist anakinra either. IL-1β secretion was also observed using calreticulin knock down or necrostatin treated autophagic MCF-7 cells and it required phagocytosis of the dying cells which led to ATP secretion from macrophages. Blocking K (+) efflux during phagocytosis, the presence of apyrase, adding an antagonist of the P2X7 receptor or silencing the NOD-like receptor protein NALP3 inhibited IL-1β secretion. These data suggest that during phagocytosis of autophagic dying cells ATP, acting through its receptor, initiates K (+) efflux, inflammasome activation and secretion of IL-1β, which initiates further pro-inflammatory events. Thus, autophagic death of malignant cells and their clearance may lead to immunogenic response.

The multifunctional, protein cross-linking transglutaminase 2 (TG2) is the main autoantigen in celiac disease, an autoimmune disorder with defined etiology. Glutamine-rich gliadin peptides from ingested cereals, after their deamidation by TG2, induce T-lymphocyte activation accompanied by autoantibody production against TG2 in 1–2% of the population. The pathogenic role and exact binding properties of these antibodies to TG2 are still unclear. Here we show that antibodies from different celiac patients target the same conformational TG2 epitope formed by spatially close amino acids of adjacent domains. Glu153 and 154 on the first alpha-helix of the core domain and Arg19 on first alpha-helix of the N-terminal domain determine the celiac epitope that is accessible both in the closed and open conformation of TG2 and dependent on the relative position of these helices. Met659 on the C-terminal domain also can cooperate in antibody binding. This composite epitope is disease-specific, recognized by antibodies derived from celiac tissues and associated with biological effects when passively transferred from celiac mothers into their newborns. These findings suggest that celiac antibodies are produced in a surface-specific way for which certain homology of the central glutamic acid residues of the TG2 epitope with deamidated gliadin peptides could be a structural basis. Monoclonal mouse antibodies with partially overlapping epitope specificity released celiac antibodies from patient tissues and antagonized their harmful effects in cell culture experiments. Such antibodies or similar specific competitors will be useful in further functional studies and in exploring whether interference with celiac antibody actions leads to therapeutic benefits.

Autophagy is a basic cell biological process ongoing under physiologic circumstances in almost all cell types of the human organism and upregulated by various stress conditions including those leading to inflammation. Since autophagy affects the effector cells of innate and adaptive immunity mediating the inflammatory response, its activity in these cells influences the antimicrobial response, the development of an effective cognate immune defense, and the course of the normal sterile inflammatory reactions. The level of autophagic activity may determine whether tissue cells die by apoptosis, necrosis, or through autophagy, and, as a consequence, whether the clearance of these dying cells is a silent process or results in an inflammatory response. Loss or decreased autophagy may lead to necrotic death that can initiate an inflammatory reaction in phagocytes through their surface and cytosolic receptors. Engulfment of certain cells dying through autophagy can activate the inflammasome. The intertwining regulatory connections between inflammation and immunity extend to pathologic conditions including chronic inflammatory diseases, autoimmunity and cancer. Antioxid. Redox Signal. 14, 2233–2243.

The daily clearance of physiologically dying cells is performed safely mainly by cells in the mononuclear phagocyte system. They can recognize and engulf dying cells utilizing several cooperative mechanisms. In our study we show that the expression of a broad range of apopto-phagocytic genes is strongly up-regulated during differentiation of human monocytes to macrophages with different donor variability. The glucocorticoid dexamethasone has a profound effect on this process by selectively up-regulating six genes and down-regulating several others. The key role of the up-regulated mer tyrosine kinase (Mertk) in dexamethasone induced enhancement of phagocytosis could be demonstrated in human monocyte derived macrophages by gene silencing as well as blocking antibodies, and also in a monocyte-macrophage like cell line. However, the additional role of other glucocorticoid induced elements must be also considered since the presence of autologous serum during phagocytosis could almost completely compensate for the blocked function of Mertk.

Abstract Obesity leads to adipose tissue inflammation that is characterized by increased release of proinflammatory molecules and the recruitment of activated immune cells. Although macrophages are present in the highest number among the immune cells in obese adipose tissue, not much is known about their direct interaction with adipocytes. We have introduced an ex vivo experimental system to characterize the cellular interactions and the profile of secreted cytokines in cocultures of macrophages and human adipocytes differentiated from either mesenchymal stem cells or a preadipocyte cell line. As observed by time-lapse microscopy, flow, and laser-scanning cytometry, macrophages phagocytosed bites of adipocytes (trogocytosis), which led to their de novo, phagocytosis and NF- κ B-dependent synthesis, then release of interleukin (IL)-6 and monocyte chemoattractant protein (MCP)-1. IL-6 secretion was not accompanied by secretion of other proinflammatory cytokines, such as tumor necrosis factor (TNF)- α and IL-8, except MCP-1. LPS-induced release of TNF- α , IL-8 and MCP-1 was decreased in the presence of the differentiated adipocytes but the IL-6 level did not subside suggesting that phagocytosis-dependent IL-6 secretion may have significant regulatory function in the inflamed adipose tissue.

Retinal pigment epithelial (RPE) cells can undergo different forms of cell death, including autophagy-associated cell death during age-related macular degeneration (AMD). Failure of macrophages or dendritic cells (DCs) to engulf the different dying cells in the retina may result in the accumulation of debris and progression of AMD. ARPE-19 and primary human RPE cells undergo autophagy-associated cell death upon serum depletion and oxidative stress induced by hydrogen peroxide (H2O2). Autophagy was revealed by elevated light-chain-3 II (LC3-II) expression and electron microscopy, while autophagic flux was confirmed by blocking the autophago-lysosomal fusion using chloroquine (CQ) in these cells. The autophagy-associated dying RPE cells were engulfed by human macrophages, DCs and living RPE cells in an increasing and time-dependent manner. Inhibition of autophagy by 3-methyladenine (3-MA) decreased the engulfment of the autophagy-associated dying cells by macrophages, whereas sorting out the GFP-LC3-positive/autophagic cell population or treatment by the glucocorticoid triamcinolone (TC) enhanced it. Increased amounts of IL-6 and IL-8 were released when autophagy-associated dying RPEs were engulfed by macrophages. Our data suggest that cells undergoing autophagy-associated cell death engage in clearance mechanisms guided by professional and non-professional phagocytes, which is accompanied by inflammation as part of an in vitro modeling of AMD pathogenesis.

Abstract Brown and beige adipocytes are enriched in mitochondria with uncoupling protein-1 (UCP1) to generate heat instead of ATP contributing to healthy energy balance. There are few human cellular models to reveal regulatory networks in adipocyte browning and key targets for enhancing thermogenesis in obesity. The Simpson-Golabi-Behmel syndrome (SGBS) preadipocyte line has been a useful tool to study human adipocyte biology. Here we report that SGBS cells, which are comparable to subcutaneous adipose-derived stem cells, carry an FTO risk allele. Upon sustained PPARγ stimulation or irisin (a myokine released in response to exercise) treatment, SGBS cells differentiated into beige adipocytes exhibiting multilocular lipid droplets, high UCP1 content with induction of typical browning genes ( Cidea, Elovl3 ) and the beige marker Tbx1 . The autocrine mediator BMP7 led to moderate browning with the upregulation of the classical brown marker Zic1 instead of Tbx1 . Thermogenesis potential resulted from PPARγ stimulation, irisin and BMP7 can be activated in UCP1-dependent and the beige specific, creatine phosphate cycle mediated way. The beige phenotype, maintained under long-term (28 days) conditions, was partially reversed by withdrawal of PPARγ ligand. Thus, SGBS cells can serve as a cellular model for both white and sustainable beige adipocyte differentiation and function.

Retinoic acids are morphogenic signaling molecules that are derived from vitamin A and involved in a variety of tissue functions. Two groups of their nuclear receptors have been identified: retinoic acid receptors (RARs) and retinoic acid X receptors (RXRs). All-<i>trans</i> retinoic acid is the high affinity ligand for RARs, and 9-<i>cis</i> retinoic acid also binds to RXRs with high affinity. In cells at high concentrations, all-<i>trans</i> retinoic acid can be converted to 9-<i>cis</i> retinoic acid via unknown mechanisms. It was previously shown that retinoic acids prevents activation-induced death of thymocytes. Here, we report that both all-<i>trans</i> and 9-<i>cis</i> retinoic acid induce apoptosis of mouse thymocytes and purified CD4⁺CD8⁺ cells in <i>ex vivo</i> cultures, with 9-<i>cis</i> retinoic acid being 50 times more effective. The induction of apoptosis by retinoic acids is mediated by RARγ because (a) the phenomenon can be reproduced only by RARγ-selective retinoic acid analogs, (b) the cell death induced by either retinoic acids or RARγ analogs can be inhibited by RARγ-specific antagonists, and (c) CD4⁺CD8⁺thymocytes express RARγ. <i>In vivo</i> administration of an RARγ analog resulted in thymus involution with the concomitant activation of the apoptosis-related endonuclease and induction of tissue transglutaminase. The RARγ pathway of apoptosis is RNA and protein synthesis dependent, affects the CD4⁺CD8⁺ double positive thymocytes, and can be inhibited by the addition of either Ca²⁺ chelators or protease inhibitors. Using various RAR- and RXR-specific analogs and antagonists, it was demonstrated that stimulation of RARα inhibits the RARγ-specific death pathway (which explains the lack of apoptosis stimulatory effects of all-<i>trans</i> retinoic acid at physiological concentrations) and that costimulation of the RXR receptors (in the case of 9-<i>cis</i> retinoic acid) can neutralize this inhibitory effect. It is suggested that formation of 9-<i>cis</i> retinoic acid may be a critical element in regulating both the positive selection and the “default cell death pathway” of thymocytes.

Genetic defects of the CD95 (Fas/Apo-1) receptor/ligand system, has recently been involved in the development of human and murine autoimmunity. We investigated whether a deregulation of the ‘tissue’ transglutaminase (tTG), a multifunctional enzyme which is part of the molecular program of apoptosis, may act as a cofactor in the development of autoimmunity. We found that MRLlpr/lpr, which are characterized by a defect in the CD95 receptor and suffer of a severe systemic lupus erythematosus-like disease, produce large amounts of circulating tTG autoantibodies. This phenomenon is paralleled by an abnormal accumulation of an inactive enzyme protein in the accessory cells of lymphoid organs. To investigate the molecular mechanisms by which tTG inhibition may contribute to the development of autoimmunity we generated a cell culture model system consisting of L929 cells stably transfected with a full length tTG cDNA. When L929 cells were killed by Tumor Necrosis Factor α (TNFα) a pronounced release of DNA and Lactate Dehydrogenase (LDH) was observed. Overexpression of tTG in these cells largely prevented the leakage of macromolecules determined by TNFα treatment, an effect which is abolished by inactivating the enzyme cross-linking activity by a synthetic inhibitor. These in vitro observations provided the basis to explain the increased levels of plasmatic LDH we detected in MRLlpr/lpr mice. These data suggest that lack of an active tTG may represent a cofactor in the development of autoimmunity.

This paper provides a rational molecular basis for studies intended to clarify the interactions between cancer chemopreventive agents and apoptosis, one of the natural forms of cell death that overlaps molecular mechanisms with other forms such as programmed cell death and specialized forms of physiological cell death. Molecular details of the process show the existence of distinct molecular pathways leading to the activation of critical effector elements (apoptosis gene products) functioning under the control of network of negative regulatory elements. Dysregulation of either apoptosis or anti-apoptosis genes has a significant role in multistage carcinogenesis. Inhibition of apoptosis is one of the underlying mechanisms of the action of tumor promoters. The network of apoptosis and anti-apoptosis gene products provides multiple targets for compounds with cancer chemopreventive potential. Many data in the literature show initiating, potentiating or inhibitory effects of such compounds on apoptosis. However, the molecular mechanism of these effects is largely unknown. We initiated a series of studies using mouse thymocytes which undergo apoptosis through distinct molecular mechanisms after T-cell receptor activation (TCR pathway), following the addition of glucocorticoids (DEX pathway) or DNA damaging agents (p53 pathway). All trans-and 9-cis-retinoic acid induced apoptosis, elicited through the DEX pathway, inhibited the TCR pathway, and did not affect p53- initiated apoptosis. N-acetylcysteine can inhibit all forms. Sodium salicylate enhanced spontaneous cell death, decreased p53-dependent apoptosis, and did not affect the DEX and TCR pathways. These preliminary results, which show differential effects of the studied compounds on distinct molecular pathways of apoptosis, warrant further investigations in the effort to utilize the molecular elements of apoptosis in proper cancer chemoprevention, and find biochemical targets for apoptosis-related surrogate endpoint biomarker assays of chemoprevention.

We report the induction of apoptosis in a human neuroblastoma cell line SK-N-BE(2) by cisplatin or retinoic acid, and its relation to cell cycle. Apoptosis was monitored by counting apoptotic bodies and evaluating the activity of 'tissue' transglutaminase (EC 2.3.2.13), one of the genes specifically expressed in apoptotic cells. Data indicate that both agents enhance apoptosis, even though cells arrest at different cell cycle phases. In fact, retinoic acid causes accumulation in G1, whilst cisplatin induces accumulation of cells in the G2/M phase. This evidence suggests the presence of multiple start points for the apoptotic death programme within the cell cycle of human neuroblastoma cells.

Vitamin A deficiency has been known for a long time to be accompanied with immune deficiency and susceptibility to a wide range of infectious diseases. Increasing evidence suggests that retinoic acids derived from vitamin A are involved in the functional regulation of the immune system. Of the two groups of retinoid receptors, retinoic acid receptors (RARs) and retinoid X receptors (RXRs) all-trans and 9-cis retinoic acids are high affinity ligands for RARs and 9-cis retinoic acid additionally binds to RXRs. In cells, at high concentrations, all-trans retinoic acid can be converted to 9-cis retinoic acid by unknown mechanisms. Apoptosis plays a major role in shaping the T cell repertoire and one way in which retinoids may affect immune functions is to influence the various apoptosis pathways. Indeed, it has been shown that retinoic acids can induce apoptosis, increase the rate of dexamethasone-induced death and inhibit activation-induced death of thymocytes and T lymphocytes. Therefore, retinoids together with glucocorticoids may be involved in regulating positive and negative selection of T lymphocytes. Here we demonstrate that retinoids can induce apoptosis of T cells through the stimulation of RARgamma. Specific stimulation of RARalpha, on the other hand, prevents both RARgamma-dependent and TCR-mediated cell death. In all these functions 9-cis retinoic acid proved to be more effective than all-trans retinoic acid suggesting the involvement of RXRs. Based on these results a possible mechanism through which costimulation of RARs and RXRs might affect spontaneous and activation-induced death of T lymphocytes is proposed.

Abstract Promyelocytic NB4 leukemia cells undergo differentiation to granulocytes following retinoic acid treatment. Here we report that tissue transglutaminase (TG2), a protein cross-linking enzyme, was induced, then partially translocated into the nucleus, and became strongly associated with the chromatin during the differentiation process. The transglutaminase-catalyzed cross-link content of both the cytosolic and the nuclear protein fractions increased while NB4 cells underwent cellular maturation. Inhibition of cross-linking activity of TG2 by monodansylcadaverin in these cells led to diminished nitroblue tetrazolium (NBT) positivity, production of less superoxide anion, and decreased expression of GP91PHOX, the membrane-associated subunit of NADPH oxidase. Neutrophils isolated from TG2–/– mice showed diminished NBT reduction capacity, reduced superoxide anion formation, and down-regulation of the gp91phox subunit of NADPH oxidase, compared with wild-type cells. It was also observed that TG2–/– mice exhibited increased neutrophil phagocytic activity, but had attenuated neutrophil chemotaxis and impaired neutrophil extravasation with higher neutrophil counts in their circulation during yeast extract–induced peritonitis. These results clearly suggest that TG2 may modulate the expression of genes related to neutrophil functions and is involved in several intracellular and extracellular functions of extravasating neutrophil.

The effects of kernel extract obtained from sour cherry (Prunus cerasus) seed on the postischemic cardiac recovery were studied in isolated working rat hearts. Rats were treated with various daily doses of the extract for 14 days, and hearts were then isolated and subjected to 30 min of global ischemia followed by 120 min of reperfusion. The incidence of ventricular fibrillation (VF) and tachycardia (VT) fell from their control values of 92% and 100% to 50% (not significant) and 58% (not significant), 17% (P<0.05), and 25% (P<0.05) with the doses of 10 mg/kg and 30 mg/kg of the extract, respectively. Lower concentrations of the extract (1 and 5 mg/kg) failed to significantly reduce the incidence of VF and VT during reperfusion. Sour cherry seed kernel extract (10 and 30 mg/kg) significantly improved the postischemic recovery of cardiac function (coronary flow, aortic flow, and left ventricular developed pressure) during reperfusion. We have also demonstrated that the extract-induced protection in cardiac function significantly reflected in a reduction of infarct size. Immunohistochemistry indicates that a reduction in caspase-3 activity and apoptotic cells by the extract, beside other potential action mechanisms of proanthocyanidin, trans-resveratrol, and flavonoid components of the extract, could be responsible for the cardioprotection in ischemic-reperfused myocardium.

The sites of transglutamination of fibronectin and fibronectin fragments, by coagulation factor XIIIa and tissue transglutaminase, were studied. It was shown that the intact fibronectin molecule has two sites sensitive to coagulation factor XIIIa and four sites sensitive to tissue transglutaminase: 180--190-kDa gelatin/heparin-binding fragments, 2 and 5--6 sites; 29-kDa heparin-I/fibrin-I-binding N-terminal fragments, 1 and 2 sites; 70-kDa gelatin-binding fragments, 0 and 1 site; 60-kDa cell-binding central fragments, 1 and 3--4 sites; 60-kDa, 45-kDa, 30-kDa heparin-II-binding C-terminal fragments, 1 and 2 sites. Thus, we have found a new coagulation-factor-XIIIa-sensitive site localized in the cell-binding central fragment, inaccessible to enzyme in the intact fibronectin molecule. Tissue transglutaminase appeared to interact with all of the three coagulation-factor-XIIIa-sensitive sites and, in addition, some others which are either available on the intact molecule or can be revealed only in proteolytic fragments of the fibronectin. We suggest that interdomain and intersubunit interactions in the intact fibronectin molecule account for the masking of glutamine residues potentially accessible to transglutaminases.

A simple, reproducible, animal-material free method for cultivating and characterizing cornea limbal epithelial stem cells (LESCs) on human lens capsule (LC) was developed for future clinical transplantation. The limbal tissue explants (2×2×0.25 mm) were harvested from 77 cadavers and expanded ex vivo on either cell culture plates or LC in medium containing human serum as the only growth supplement. Cell outgrowth at the edge of the explants was observed within 24 hours of cultivation and achieved viable outgrowth (>97% viability as measured by MTT assay and flow cytometry) within two weeks. The outgrowing cells were examined by genome-wide microarray including markers of stemness (p63α, ABCG2, CK19, Vimentin and Integrin α9), proliferation (Ki-67), limbal epithelial cells (CK 8/18 and 14) and differentiated cornea epithelial cells (CK 3 and 12). Immunostaining revealed the non-hematopoietic, -endothelial and -mesenchymal stem cell phenotype of the LESCs and the localization of specific markers in situ. Cell adhesion molecules, integrins and lectin-based surface carbohydrate profiling showed a specific pattern on these cells, while colony-formation assay confirmed their clonal potency. The LESCs expressed a specific surface marker fingerprint (CD117/c-kit, CXCR4, CD144/VE-Cadherin, CD146/MCAM, CD166/ALCAM, and surface carbohydrates: WGA, ConA, RCA, PNA and AIL) which can be used for better localization of the limbal stem cell niche. In summary, we report a novel method combining the use of a medium with human serum as the only growth supplement with LC for cultivating, characterizing and expanding cornea LESCs from cadavers or alternatively from autologous donors for possible treatment of LESC deficiency.

The clearance of apoptotic cells has an important role in the maintenance of tissue homeostasis and in the protection of tissues from the inflammatory and immunogenic contents of dying cells. A defect in the recognition and phagocytosis of apoptotic cells contributes to the development of chronic inflammation and autoimmune disorders. We have observed that compared with healthy donors, differentiated macrophages from patients with untreated systemic lupus erythematosus (SLE) showed decreased phagocytosis of apoptotic neutrophils. A TaqMan Low Density Array was designed to determine the mRNA expression levels of 95 apopto-phagocytic genes in differentiated non-phagocytosing and phagocytosing macrophages. In the macrophages of clinically and immunoserologically active SLE patients, 39 genes were expressed at lower levels than in the control macrophages. When inactive patients were compared with those with minor immunoserological abnormalities or patients in an immunoserologically active state, a relationship was observed between the altered gene expression profile and the disease state. In the macrophages of patients with engulfing apoptotic cells, an upregulation of genes involved in inflammation, autophagy, and signaling was observed. These results indicate that novel immune-pathological pathways are involved in SLE and suggest targets for potential therapeutic modulation.

Laser-scanning cytometry is presented as a tool allowing population scale analysis of ex vivo human brown adipogenic differentiation. It combines texture analysis and detection of Ucp1 protein content in single brown adipocytes of mixed cell populations with gene expression pattern and functional characteristics of browning. Using this method we could validate mouse data in human samples demonstrating the effectiveness of irisin to induce "beige" differentiation of subcutaneous white adipocytes.

Administration of second-generation antipsychotic drugs (SGAs) often leads to weight gain and consequent cardio-metabolic side effects. We observed that clozapine but not six other antipsychotic drugs reprogrammed the gene expression pattern of differentiating human adipocytes ex vivo, leading to an elevated expression of the browning marker gene UCP1, more and smaller lipid droplets and more mitochondrial DNA than in the untreated white adipocytes. Laser scanning cytometry showed that up to 40% of the differentiating single primary and Simpson-Golabi-Behmel syndrome (SGBS) adipocytes had the characteristic morphological features of browning cells. Furthermore, clozapine significantly upregulated ELOVL3, CIDEA, CYC1, PGC1A and TBX1 genes but not ZIC1 suggesting induction of the beige-like and not the classical brown phenotype. When we tested whether browning induced by clozapine can be explained by its known pharmacological effect of antagonizing serotonin (5HT) receptors, it was found that browning cells expressed 5HT receptors 2A, 1D, 7 and the upregulation of browning markers was diminished in the presence of exogenous 5HT. Undifferentiated progenitors or completely differentiated beige or white adipocytes did not respond to clozapine administration. The clozapine-induced beige cells displayed increased basal and oligomycin-inhibited (proton leak) oxygen consumption, but these cells showed a lower response to cAMP stimulus as compared with control beige adipocytes indicating that they are less capable to respond to natural thermogenic anti-obesity cues. Our data altogether suggest that novel pharmacological stimulation of these masked beige adipocytes can be a future therapeutic target for the treatment of SGA-induced weight gain.

Brown adipocytes, abundant in deep-neck (DN) area in humans, are thermogenic with anti-obesity potential. FTO pro-obesity rs1421085 T-to-C single-nucleotide polymorphism (SNP) shifts differentiation program towards white adipocytes in subcutaneous fat. Human adipose-derived stromal cells were obtained from subcutaneous neck (SC) and DN fat of nine donors, of which 3-3 carried risk-free (T/T), heterozygous or obesity-risk (C/C) FTO genotypes. They were differentiated to white and brown (long-term Peroxisome proliferator-activated receptor gamma (PPARγ) stimulation) adipocytes; then, global RNA sequencing was performed and differentially expressed genes (DEGs) were compared. DN and SC progenitors had similar adipocyte differentiation potential but differed in DEGs. DN adipocytes displayed higher browning features according to ProFAT or BATLAS scores and characteristic DEG patterns revealing associated pathways which were highly expressed (thermogenesis, interferon, cytokine, and retinoic acid, with UCP1 and BMP4 as prominent network stabilizers) or downregulated (particularly extracellular matrix remodeling) compared to SC ones. Part of DEGs in either DN or SC browning was PPARγ-dependent. Presence of the FTO obesity-risk allele suppressed the expression of mitochondrial and thermogenesis genes with a striking resemblance between affected pathways and those appearing in ProFAT and BATLAS, underlining the importance of metabolic and mitochondrial pathways in thermogenesis. Among overlapping regulatory influences that determine browning and thermogenic potential of neck adipocytes, FTO genetic background has a thus far not recognized prominence.

Brown and beige adipocytes dissipate energy by uncoupling protein 1 (UCP1)‐dependent and UCP1‐independent thermogenesis, which may be utilized to develop treatments against obesity. We have found that mRNA and protein expression of the alanine/serine/cysteine transporter‐1 (ASC‐1) was induced during adipocyte differentiation of human brown‐prone deep neck and beige‐competent subcutaneous neck progenitors, and SGBS preadipocytes. cAMP stimulation of differentiated adipocytes led to elevated uptake of serine, cysteine, and glycine, in parallel with increased oxygen consumption, augmented UCP1‐dependent proton leak, increased creatine‐driven substrate cycle‐coupled respiration, and upregulation of thermogenesis marker genes and several respiratory complex subunits; these outcomes were impeded in the presence of the specific ASC‐1 inhibitor, BMS‐466442. Our data suggest that ASC‐1‐dependent consumption of serine, cysteine, and glycine is required for efficient thermogenic stimulation of human adipocytes.

Immunoglobulin A class transglutaminase autoantibodies are highly predictive markers of active coeliac disease, a disorder difficult to recognize solely on clinical grounds.To develop and evaluate a simple rapid test for point-of-care detection of coeliac autoantibodies.The novel whole blood test utilizes the patient's endogenous transglutaminase in red blood cells for detection of transglutaminase-specific immunoglobulin A antibodies present in the blood sample, with normal plasma immunoglobulin A detection as positive test control. We evaluated 284 patients under suspicion of coeliac disease and undergoing jejunal biopsy, and 263 coeliac patients on a gluten-free diet, 383 being tested prospectively in a point-of-care setting. Results were compared with histology, conventional serum autoantibody results and dietary adherence.The rapid test showed 97% sensitivity and 97% specificity for untreated coeliac disease, and identified all immunoglobulin A-deficient samples. Point-of-care testing found new coeliac cases as efficiently as antibody tests in laboratory. Coeliac autoantibodies were detected onsite in 21% of treated patients, while endomysial and transglutaminase antibodies were positive in 20% and 19%, respectively. The positivity rate correlated with dietary lapses and decreased on intensified dietary advice given upon positive point-of-care test results.Point-of-care testing was accurate in finding new coeliac cases and helped to identify and decrease dietary non-compliance.

Abstract Understanding substrate specificity and identification of natural targets of transglutaminase 2 (TG2), the ubiquitous multifunctional cross‐linking enzyme, which forms isopeptide bonds between protein‐linked glutamine and lysine residues, is crucial in the elucidation of its physiological role. As a novel means of specificity analysis, we adapted the phage display technique to select glutamine‐donor substrates from a random heptapeptide library via binding to recombinant TG2 and elution with a synthetic amine‐donor substrate. Twenty‐six Gln‐containing sequences from the second and third biopanning rounds were susceptible for TG2‐mediated incorporation of 5‐(biotinamido)penthylamine, and the peptides GQQQTPY, GLQQASV, and WQTPMNS were modified most efficiently. A consensus around glutamines was established as pQX(P,T,S)l, which is consistent with identified substrates listed in the TRANSDAB database. Database searches showed that several proteins contain peptides similar to the phage‐selected sequences, and the N‐terminal glutamine‐rich domain of SWI1/SNF1‐related chromatin remodeling proteins was chosen for detailed analysis. MALDI/TOF and tandem mass spectrometry‐based studies of a representative part of the domain, SGYGQQGQTPYYNQQSPHPQQQQPPYS (SnQ1), revealed that Q 6 , Q 8 , and Q 22 are modified by TG2. Kinetic parameters of SnQ1 transamidation ( K M app = 250 μM, k cat = 18.3 sec −1 , and k cat / K M app = 73,200) classify it as an efficient TG2 substrate. Circular dichroism spectra indicated that SnQ1 has a random coil conformation, supporting its accessibility in the full‐length parental protein. Added together, here we report a novel use of the phage display technology with great potential in transglutaminase research.

The identification of transglutaminase in the growth-factor-dependent mouse mast cell line PT18 was accomplished through its characteristic catalytic properties (specificity, calcium dependency, and inhibition by iodoacetamide); and by both immunoprecipitation and Western blot analysis using affinity purified antibody. The enzymatic activity in these cells increased in association with the release of histamine from the cells induced by an IgE-dependent mechanism or by exposure to the ionophores A23187 or Br-x537A. The increase in transglutaminase activity was paralleled by a marked increase in the level of protein-bound gamma-glutamylhistamine, determined in radiolabeled form in mast cells that were either metabolically labeled with [3H]histidine or incubated with [3H]histamine before degranulation. The highest level of bound gamma-glutamylhistamine was found in the immunologically stimulated cells. Enzymatic activity and the gamma-glutamyl derivative were associated primarily with the cells, both before and after stimulation. Separation of gamma-glutamylhistamine in a proteolytic digest of these cells was carried out using a combination of ion exchange chromatography and high performance liquid chromatography. The gamma-glutamyl compound was identified and quantitated through the enzymatic production of histamine with the use of gamma-glutamylamine cyclotransferase, an enzyme specific for the disassembly of gamma-glutamylamines.

Deamidated gliadin peptides are efficient antigens in diagnostic tests for celiac disease, and results correlate better with transglutaminase 2-based assays than those with native gliadin. We investigated whether deamidated gliadin antigens are structurally similar to transglutaminase 2 or could mimic transglutaminase epitopes.Serum samples from 74 celiac and 65 control patients, and 13 different transglutaminase 2-specific monoclonal mouse antibodies were investigated for their binding to commercially available deamidated gliadin peptides using enzyme-linked immunosorbent assay, competition studies, and molecular modelling.The enzyme-linked immunosorbent assay with deamidated gliadin peptides had 100% sensitivity and 98.5% specificity in patients. Deamidated gliadin epitopes also were recognized by 3 transglutaminase-specific monoclonal antibodies, and antibodies affinity-purified with deamidated gliadin peptides from celiac patient sera reacted with transglutaminase but did not show endomysial binding. The binding of the monoclonal antibodies to deamidated gliadin was inhibited dose dependently by full-length recombinant human transglutaminase, its fragments containing the binding sites of these monoclonal antibodies, or by celiac patient antibodies. Deamidated gliadin peptides decreased the binding of transglutaminase-specific monoclonal antibodies to transglutaminase. Three different cross-reacting transglutaminase epitopes were found, of which 2 are located in the C-terminal domain and 1 is conformational. The binding of celiac serum samples to deamidated gliadin peptides could not be abolished by transglutaminase or by any of the transglutaminase-specific monoclonals, indicating that celiac sera also contain additional antibodies to gliadin epitopes different from transglutaminase.Certain deamidated gliadin-derived peptides and transglutaminase 2 epitopes have similar 3-dimensional appearance. This homology may contribute to the induction of transglutaminase autoantibodies by molecular mimicry.

The binding of soluble immune complexes (IC) or haemolysin-sensitized erythocytes (EA) to the Fc receptor of rat peritoneal macrophages was followed by a rapid increase of macrophage transglutaminase activity measured in cell homogenates and a time-dependent incorporation of 14C-methylamine into proteins of the intact cells. Methylamine, a competitive substrate inhibitor of transglutaminase could inhibit EA rosette formation as well as the soluble IC- or EA-induced lipid reordering of the plasma membrane of macrophages. Cytochalasin B (CB) which prevents EA rosette formation as well as IC-induced lipid reordering did not affect the stimulation of transglutaminase activity by IC. The possible relation of transglutaminase activation, lipid reordering and the contractile system to each other in the IC (multivalent ligand)-induced Fc receptor redistribution is discussed.

Healthy multiparous Holstein-Friesian cows (n = 22, parity: 2-4) from a large-scale dairy herd in Hungary were subjected to an intravenous glucose tolerance test 10-15 days after calving.AluI genotype of growth hormone, several plasma metabolites and metabolic hormones were determined, and current and previous lactation yields were recorded.We also used the Revised Quantitative Insulin Sensitivity Check Index (RQUICKI) and its modified version (RQUICKI BHB ) for the estimation of peripheral insulin sensitivity.The majority of cows (n = 18) was leucine homozygous (LL), four were heterozygous (LV) and there were no valine homozygous (VV) animals in the population.Current average milk production was not different between AluI genotypes, but LV cows tended to have higher 305-day previous lactation yields (P = 0.13).AluI polymorphism was not associated with any of the calculated glucose and leptin parameters of the intravenous glucose tolerance test (P > 0.58).Heterozygous cows were prone to higher basal insulin levels (P = 0.064), longer time to reach half of the maximal and basal insulin concentrations (P = 0.035 and P = 0.054, respectively) and larger insulin area under the curve (P = 0.032).Both RQUICKI and RQUICKI BHB estimated decreased insulin sensitivity in LV compared to LL cows (P = 0.055 and P = 0.044, respectively).Higher plasma NEFA and BHB levels accounted for slower glucose disappearance and lower insulin release and insulin clearance rate (P < 0.05).Average yield was inversely related to glucose area under the curve (P = 0.040) and time to reach baseline concentration (P = 0.005).Plasma cortisol lowered glucose clearance rate (P = 0.040) and prolonged time to reach basal levels (P = 0.006).More weight loss was associated with higher glucose peak and prolonged glucose disappearance time (P = 0.055 and P = 0.024, respectively).All cows became cyclic and showed signs of estrus during the study period.There were no differences between leucine homozygous and heterozygous animals in the onset of ovarian activity and in the time of first observed estrus (P > 0.540).We conclude that Holstein-Friesian cows heterozygous for AluI polymorphism of the growth hormone gene may be more likely to develop insulin resistance during early lactation than leucine homozygous cows.Decreased insulin sensitivity could be part of a homeorhetic adaptation process that supports nutrient partioning for the use of the mammary gland and may allow LV cows to reach higher yields throughout lactation.

The multifunctional enzyme, transglutaminase 2 (TG2), can be found intracellularly, in the extracellular matrix and on the cell surface. Cell surface TG2 (csTG2) could not be detected by TG2-specific antibodies or autoantibodies on immunocompetent cells. A supposedly csTG2-specific antibody, 6B9, was recently shown to actually react with CD44. Though the importance of TG2-mediated deamidation of gluten in the pathogenesis of celiac disease has been well recognized, it is not known in which intestinal cells or cell compartment the deamidation occurs. Duodenal dendritic cells (DCs) can be directly involved in gluten-reactive T-cell activation. Here we use blood monocyte-derived dendritic cells (iDC) and macrophages (MΦ) as a model for intestinal antigen-presenting cells (APCs) and show that they contain large amounts of TG2. We found that TG100, a commercial TG2-specific monoclonal antibody can recognize TG2 on the surface of these cells, that is monocyte-derived APCs express surface-associated TG2. TG2 expression was found on the surface of individual tunica propria cells in frozen small bowel tissue sections from both normal and celiac subjects. We also demonstrate that the pool of TG2 on the surface of iDCs can be catalytically active, hence it might directly be involved in the deamidation of gliadin peptides. Bacterial lipopolysaccharide (LPS) increased the level of TG2 on the surface of maturing DCs, supporting the hypothesis that an unspecific inflammatory process in the gut may expose more transglutaminase activity.

TG2 (transglutaminase 2) is a calcium-dependent protein cross-linking enzyme which is involved in a variety of cellular processes. The threshold level of calcium needed for endogenous and recombinant TG2 activity has been controversial, the former being more sensitive to calcium than the latter. In the present study we address this question by identifying a single amino acid change from conserved valine to glycine at position 224 in recombinant TG2 compared with the endogenous sequence present in the available genomic databases. Substituting a valine residue for Gly224 in the recombinant TG2 increased its calcium-binding affinity and transamidation activity 10-fold and isopeptidase activity severalfold, explaining the inactivity of widely used recombinant TG2 at physiological calcium concentrations. ITC (isothermal titration calorimetry) measurements showed 7-fold higher calcium-binding affinities for TG2 valine residues which could be activated inside cells. The two forms had comparable substrate- and GTP-binding affinities and also bound fibronectin similarly, but coeliac antibodies had a higher affinity for TG2 valine residues. Structural analysis indicated a higher stability for TG2 valine residues and a decrease in flexibility of the calcium-binding loop resulting in improved metal-binding affinity. The results of the present study suggest that Val224 increases TG2 activity by modulating its calcium-binding affinity enabling transamidation reactions inside cells.

Modification of the enzymatic functions of tissue transglutaminase (TG2) by anti-TG2 autoantibodies may play a role in manifestations of coeliac disease. Our aim was to evaluate the effect of coeliac autoantibodies on reactions catalysed by TG2 by a systematic biochemical approach, and in relation to observed clinical presentation type. Coeliac antibodies did not have significant inhibitory effect on transamidation/deamidation activity of TG2 as measured by amine-incorporation into solid and immobilised casein and by ultraviolet kinetic assay. In contrast, immunoglobulins from patients with severe malabsorption enhanced the reaction velocity to 105.4–242.2%. This activating effect was dose-dependent, most pronounced with immobilised glutamine-acceptor substrates, and correlated inversely with the basal specific activity of the enzyme and with dietary treatment. A similar activation could be demonstrated also with the TG2-specific fraction of autoantibodies and in transamidation activity assays which use fibronectin-bound TG2 and thereby mimic in vivo conditions. These results suggest that coeliac antibodies may stabilise the enzyme in a catalytically advantageous conformation. GTPase activity of TG2 decreased to 67.0–73.4% in the presence of antibodies raising the possibility that inhibition of GTPase activity may affect cellular signalling in case coeliac autoantibodies would reach intracellular compartments.

Tissue transglutaminase (TG2) is a protein cross-linking enzyme known to be expressed by hepatocytes and to be induced during the in vivo hepatic apoptosis program. TG2 is also a G protein that mediates intracellular signaling by the alpha-1b-adrenergic receptor (AR) in liver cells. Fas/Fas ligand interaction plays a crucial role in various liver diseases, and administration of agonistic anti-Fas antibodies to mice causes both disseminated endothelial cell apoptosis and fulminant hepatic failure. Here we report that an intraperitoneal dose of anti-Fas antibodies, which is sublethal for wild-type mice, kills all the TG2 knock-out mice within 20 hours. Although TG2-/- thymocytes exposed to anti-Fas antibodies die at the same rate as wild-type mice, TG2-/- hepatocytes show increased sensitivity toward anti-Fas treatment both in vivo and in vitro, with no change in their cell surface expression of Fas, levels of FLIP(L) (FLICE-inhibitory protein), or the rate of I-kappaBalpha degradation, but a decrease in the Bcl-xL expression. We provide evidence that this is the consequence of the impaired AR signaling that normally regulates the levels of Bcl-xL in the liver. In conclusion, our data suggest the involvement of adrenergic signaling pathways in the hepatic regeneration program, in which Fas ligand-induced hepatocyte proliferation with a simultaneous inhibition of the Fas-death pathway plays a determinant role.

Autophagy as a natural part of cellular homeostasis usually takes place unnoticed by neighboring cells. However, its co-occurrence with cell death may contribute to the clearance of these dying cells by recruited phagocytes. Autophagy associated with programmed cell death has recently been reported to be essential for presentation of phoshatidylserine (PS) on the cell surface (Qu et al. 2007) that has a key role in the clearance of apoptotic cells. Recently, we have demonstrated that upon triggering cell death by autophagy in MCF-7 cells, the corpses were efficiently phagocytosed by both human macrophages and non-dying MCF-7 cells. Death as well as engulfment could be prevented by inhibiting autophagy. Based on our data, two molecular mechanisms have been proposed for the uptake of cells which die through autophagy: a PS-dependent pathway which was exclusively used by the living MCF-7 cells acting as non-professional phagocytes, and a PS-independent uptake mechanism that was active in macrophages acting as professional phagocytes. Several lines of evidence suggest that macrophages utilize calreticulin-mediated recognition, tethering, tickling and engulfment processes. Phagocytic uptake of cells dying through autophagy by macrophages leads to a pro-inflammatory response characterized by the induction and secretion of IL-6, TNFα, IL-8 and IL-10.Addendum to:Clearance of Dying Autophagic Cells of Different Origin by Professional and Non-Professional PhagocytesG. Petrovski, G. Zahuczky, K. Katona, G. Vereb, W. Martinet, Z. Nemes, W. Bursch and L. FésüsCell Death Differ 2007;14:1117-28

Although under normal conditions many cells die daily mainly by apoptosis in human tissues, inflammation does not occur. The redundant function of a relatively large number of molecules are available to recognize changes occurring on the surface of apoptotic cells, to opsonize the dead cells and to engulf the apoptotic cells previously opsonized or not. Several components of the innate immune system are utilized in this process, mainly soluble factors which bind to the distinct molecular pattern of apoptotic cells. These cells, unlike necrotic ones, do not induce the expression of inflammatory cytokines in phagocytic cells, they can even inhibit such a response and engage an active signaling process to elicit a direct anti-inflammatory effect. The molecular details of these signaling processes have not been clarified yet. Both professional and "amateur" cells can engulf apoptotic cells and mediate an anti-inflammatory action. Disturbance of these processes have significant roles in development of autoimmune diseases and highly malignant tumors.

The alpha-synuclein immunopositive and chaotrope-insoluble material from human brains with Lewy body pathology was analyzed by mass spectrometry. From the proteinase K-cleavable peripheral fraction of Lewy bodies, which was densely cross-linked by gamma-glutamyl-epsilon-lysine bonds between HspB1 and ubiquitin in a pattern similar to neurofibrillary tangles (Nemes, Z., Devreese, B., Steinert, P. M., Van Beeumen, J., and Fésüs, L. (2004) FASEB J. 18, 1135-1137), 53 proteins were identified. In the core of Lewy bodies only alpha-synuclein was found, and it contained a low amount of intramolecular cross-links between Gln-99 and Lys-58. In vitro cross-linking of alpha-synuclein by transglutaminases 1-3 and 5 produced a heterogeneous population of variably cross-linked alpha-synucleins in solution, which inhibited the aggregation of the protein into amyloid. However, in the presence of phosphatidylserine-rich membranes and micromolar calcium concentrations, the cross-linking by transglutaminases 1, 2, and 5 showed specificity toward the utilization of Gln-99 and Lys-58. As shown by thioflavin T fluorescence monitoring, the formation of this cross-link accelerated the aggregation of native alpha-synuclein. Chemical cross-linking of residues 58-99 triggered amyloid formation, whereas such bonding of residues 99 to 10 was inhibitory. Our findings reveal the pivotal role of membrane attachment and transglutaminase-mediated intermolecular cross-linking for the propagative misfolding and aggregation of alpha-synuclein.

Tissue transglutaminase (TG2) catalyzes the Ca2+-dependent posttranslational modification of proteins via formation of isopeptide bonds between their glutamine and lysine residues. Although substrate specificity of TG2 has been studied repeatedly at the sequence level, no clear consensus sequences have been determined so far. With the use of the extensive structural information on TG2 substrate proteins listed in TRANSDAB Wiki database†, a slight preference of TG2 for glutamine and lysine residues situated in turns could be observed. When the spatial environment of the favored glutamine and lysine residues was analyzed with logistic regression, the presence of specific amino acid patterns was identified. By using the occurrence of the predictor amino acids as selection criteria, several polypeptides were predicted and later identified as novel in vitro substrates for TG2. By studying the sequence of TG2 substrate proteins lacking available crystal structure, the strong favorable influence on substrate selection of the presence of substrate glutamine and lysine residues in intrinsically disordered regions could also be revealed. The collected structural data have provided novel understanding of how this versatile enzyme selects its substrates in various cell compartments and tissues.

Abstract Treatment of acute promyelocytic leukemia (APL) with all-trans-retinoic acid (ATRA) results in terminal differentiation of leukemic cells toward neutrophil granulocytes. Administration of ATRA leads to massive changes in gene expression, including down-regulation of cell proliferation–related genes and induction of genes involved in immune function. One of the most induced genes in APL NB4 cells is transglutaminase 2 (TG2). RNA interference–mediated stable silencing of TG2 in NB4 cells (TG2-KD NB4) coupled with whole genome microarray analysis revealed that TG2 is involved in the expression of a large number of ATRA-regulated genes. The affected genes participate in granulocyte functions, and their silencing lead to reduced adhesive, migratory, and phagocytic capacity of neutrophils and less superoxide production. The expression of genes related to cell-cycle control also changed, suggesting that TG2 regulates myeloid cell differentiation. CC chemokines CCL2, CCL3, CCL22, CCL24, and cytokines IL1B and IL8 involved in the development of differentiation syndrome are expressed at significantly lower level in TG2-KD NB4 than in wild-type NB4 cells upon ATRA treatment. Based on our results, we propose that reduced expression of TG2 in differentiating APL cells may suppress effector functions of neutrophil granulocytes and attenuate the ATRA-induced inflammatory phenotype of differentiation syndrome.

Understanding adipocyte biology and its homeostasis is in the focus of current obesity research. We aimed to introduce a high-content analysis procedure for directly visualizing and quantifying adipogenesis and adipoapoptosis by laser scanning cytometry (LSC) in a large population of cell. Slide-based image cytometry and image processing algorithms were used and optimized for high-throughput analysis of differentiating cells and apoptotic processes in cell culture at high confluence. Both preadipocytes and adipocytes were simultaneously scrutinized for lipid accumulation, texture properties, nuclear condensation, and DNA fragmentation. Adipocyte commitment was found after incubation in adipogenic medium for 3 days identified by lipid droplet formation and increased light absorption, while terminal differentiation of adipocytes occurred throughout day 9-14 with characteristic nuclear shrinkage, eccentric nuclei localization, chromatin condensation, and massive lipid deposition. Preadipocytes were shown to be more prone to tumor necrosis factor alpha (TNFα)-induced apoptosis compared to mature adipocytes. Importantly, spontaneous DNA fragmentation was observed at early stage when adipocyte commitment occurs. This DNA damage was independent from either spontaneous or induced apoptosis and probably was part of the differentiation program. © 2013 International Society for Advancement of Cytometry.

Transglutaminase 2 (TG2) is a multifunctional protein with diverse catalytic activities and biological roles. Its best studied function is the Ca(2+)-dependent transamidase activity leading to formation of γ-glutamyl-ε-lysine isopeptide crosslinks between proteins and γ-glutamyl-amine derivatives. TG2 has a poorly studied isopeptidase activity cleaving these bonds. We have developed and characterised TG2 mutants which are significantly deficient in transamidase activity while have normal or increased isopeptidase activity (W332F) and vice versa (W278F). The W332F mutation led to significant changes of both the K m and the V max kinetic parameters of the isopeptidase reaction of TG2 while its calcium and GTP sensitivity was similar to the wild-type enzyme. The W278F mutation resulted in six times elevated amine incorporating transamidase activity demonstrating the regulatory significance of W278 and W332 in TG2 and that mutations can change opposed activities located at the same active site. The further application of our results in cellular systems may help to understand TG2-driven physiological and pathological processes better and lead to novel therapeutic approaches where an increased amount of crosslinked proteins correlates with the manifestation of degenerative disorders.

Abstract Neutrophil extracellular trap (NET) ejected from activated dying neutrophils is a highly ordered structure of DNA and selected proteins capable to eliminate pathogenic microorganisms. Biochemical determinants of the non-randomly formed stable NETs have not been revealed so far. Studying the formation of human NETs we have observed that polyamines were incorporated into the NET. Inhibition of myeloperoxidase, which is essential for NET formation and can generate reactive chlorinated polyamines through hypochlorous acid, decreased polyamine incorporation. Addition of exogenous primary amines that similarly to polyamines inhibit reactions catalyzed by the protein cross-linker transglutaminases (TGases) has similar effect. Proteomic analysis of the highly reproducible pattern of NET components revealed cross-linking of NET proteins through chlorinated polyamines and ɛ ( γ -glutamyl)lysine as well as bis- γ -glutamyl polyamine bonds catalyzed by the TGases detected in neutrophils. Competitive inhibition of protein cross-linking by monoamines disturbed the cross-linking pattern of NET proteins, which resulted in the loss of the ordered structure of the NET and significantly reduced capacity to trap bacteria. Our findings provide explanation of how NETs are formed in a reproducible and ordered manner to efficiently neutralize microorganisms at the first defense line of the innate immune system.

Differentiation syndrome (DS) is a life-threatening complication arising during retinoid treatment of acute promyelocytic leukemia (APL). Administration of all-trans retinoic acid leads to significant changes in gene expression, among the most induced of which is transglutaminase 2, which is not normally expressed in neutrophil granulocytes. To evaluate the pathophysiological function of transglutaminase 2 in the context of immunological function and disease outcomes, such as excessive superoxide anion, cytokine, and chemokine production in differentiated NB4 cells, we used an NB4 transglutaminase knock-out cell line and a transglutaminase inhibitor, NC9, which inhibits both transamidase- and guanosine triphosphate-binding activities, to clarify the contribution of transglutaminase to the development of potentially lethal DS during all-trans retinoic acid treatment of APL. We found that such treatment not only enhanced cell-surface expression of CD11b and CD11c but also induced high-affinity states; atypical transglutaminase 2 expression in NB4 cells activated the nuclear factor kappa (κ)-light-chain-enhancer of the activated B-cell pathway, driving pathogenic processes with an inflammatory cascade through the expression of numerous cytokines, including tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL-1β), and monocyte chemoattractant protein 1. NC9 decreased the amount of transglutaminase 2, p65/RelA, and p50 in differentiated NB4 cells and their nuclei, leading to attenuated inflammatory cytokine synthesis. NC9 significantly inhibits transglutaminase 2 nuclear translocation but accelerates its proteasomal breakdown. This study demonstrates that transglutaminase 2 expression induced by all-trans retinoic acid treatment reprograms inflammatory signaling networks governed by nuclear factor κ-light-chain-enhancer of activated B-cell activation, resulting in overexpression of TNF-α and IL-1β in differentiating APL cells, suggesting that atypically expressed transglutaminase 2 is a promising target for leukemia treatment.

Abstract Atypically expressed transglutaminase 2 (TG2) has been identified as a poor prognostic factor in a variety of cancers. In this study, we evaluated the contribution of TG2 to the prolonged cell survival of differentiated acute promyelocytic leukaemia (APL) cells in response to the standard treatment with combined retinoic acid (ATRA) and arsenic trioxide (ATO). We report that one advantage of ATRA + ATO treatment compared to ATRA alone diminishes the amount of activated and non-activated CD11b/CD18 and CD11c/CD18 cell surface integrin receptors. These changes suppress ATRA-induced TG2 docking on the cytosolic part of CD18 β2-integrin subunits and reduce cell survival. In addition, TG2 overexpresses and hyperactivates the phosphatidylinositol-3-kinase (PI3K), phospho-AKT S473, and phospho-mTOR S2481 signalling axis. mTORC2 acts as a functional switch between cell survival and death by promoting the full activation of AKT. We show that TG2 presumably triggers the formation of a signalosome platform, hyperactivates downstream mTORC2-AKT signalling, which in turn phosphorylates and inhibits the activity of FOXO3, a key pro-apoptotic transcription factor. In contrast, the absence of TG2 restores basic phospho-mTOR S2481, phospho-AKT S473, PI3K, and PTEN expression and activity, thereby sensitising APL cells to ATO-induced cell death. We conclude, that atypically expressed TG2 may serve as a hub, facilitating signal transduction via signalosome formation by the CD18 subunit with both PI3K hyperactivation and PTEN inactivation through the PI3K-PTEN cycle in ATRA-treated APL cells.

Thymocytes can be induced to undergo apoptotic cell death by activation through the T-cell receptor (TCR). This process requires macromolecular synthesis and has been shown to be inhibited by retinoic acids (RAs). Two groups of nuclear receptors for RAs have been identified: retinoic acid receptors (RARs) and retinoid X receptors (RXRs). All-trans-RA is the high-affinity ligand for RARs, and 9-cis-RA additionally binds to RXRs with high affinity. Because 9-cis-RA is much more potent in inhibiting TCR-mediated death than all-trans-RA, it was suggested that RXRs participate in the process. In the present study various synthetic retinoid analogues were used to address this question further. The results presented suggest that the inhibitory effect of RAs on activation-induced death of thymocytes is mediated via RARα, because (1) it can be reproduced by various RARα analogues both in vitro and in vivo, (2) the effect of RAs can be inhibited by the addition of an RARα antagonist, (3) CD4+CD8+thymocytes, which die on TCR stimulation, express RARα. Stimulation of RARγ, in contrast, enhances the activation-induced death of thymocytes and inhibits its prevention by RARα stimulation. RXR co-stimulation suspends this inhibitory effect of RARγ and permits the preventive function of RARα on activation-induced death. Our results suggest a complex interaction between the various isoforms of retinoid receptors and demonstrate that low (physiological) concentrations of all-trans-RA do not affect the activation-induced death of thymocytes because the RARα-mediated inhibitory and the RARγ-mediated enhancing pathways are in balance, whereas if 9-cis-RA is formed, additional stimulation of RXRs permits the inhibitory action of RARα.

N(epsilon)(gamma-glutamyl)lysine isodipeptide is released from the breakdown of proteins cross-linked by transglutaminase enzymes. Transglutaminase activation is a marker of apoptosis and elevated isodipeptide concentrations in body fluids might correlate with the intensity of apoptotic cell turnover. The concentration of N(epsilon)(gamma-glutamyl)lysine was measured in the cerebrospinal fluid (CSF) of patients with probable Alzheimer's disease (n = 14) and vascular type dementia (n = 11) and compared with not demented surgical controls (n = 17). Baseline levels of 26-62 nM/l (mean 37.9 +/- 8.7 SD) free isodipeptide were detected in control patients. CSF isodipeptide levels showed significant elevation in vascular (mean 95.6 +/- 45.1 SD) as well as Alzheimer patients (176.6 +/- 77.1 SD). Isodipeptide concentrations above 120 nM/l were 72% specific and 77% sensitive to Alzheimer's dementia, although the difference between the two dementias was statistically insignificant (p > 0.05). Determination of CSF N(epsilon)(gamma-glutamyl)lysine isodipeptide concentration offers a novel method for measurement of neurodegeneration in primary and mixed dementias.

The loss of transglutaminase 1 enzyme (TGase 1) activity causes lamellar ichthyosis. Recessive X-linked ichthyosis (XI) results from accumulation of excess cholesterol 3-sulfate (CSO4) in the epidermis but the pathomechanism how elevated epidermal CSO4 causes ichthyosis is largely unknown. Here we provide evidence that XI is also a consequence of TGase 1 dysfunction. TGase 1 is a key component of barrier formation in keratinocytes: it participates in the cross-linking of cell envelope (CE) structural proteins, and also forms the lipid bound envelope by esterification of long chain ω-hydroxyceramides onto CE proteins. Using involucrin and an epidermal ω-hydroxyceramide analog as substrates, kinetic analyses revealed that at membrane concentrations above 4 mol %, CSO4 caused a marked and dose-dependent inhibitory effect on isopeptide and ester bond formation. Sequencing of tryptic peptides from TGase 1-reacted involucrin showed a large increase in deamidation of substrate glutamines. We hypothesize that supraphysiological levels of CSO4 in keratinocyte membranes distort the structure of TGase 1 and facilitate the access of water into its active site causing hydrolysis of substrate glutamine residues. Our findings provide further evidence for the pivotal role of the TGase 1 enzyme in CE formation. The loss of transglutaminase 1 enzyme (TGase 1) activity causes lamellar ichthyosis. Recessive X-linked ichthyosis (XI) results from accumulation of excess cholesterol 3-sulfate (CSO4) in the epidermis but the pathomechanism how elevated epidermal CSO4 causes ichthyosis is largely unknown. Here we provide evidence that XI is also a consequence of TGase 1 dysfunction. TGase 1 is a key component of barrier formation in keratinocytes: it participates in the cross-linking of cell envelope (CE) structural proteins, and also forms the lipid bound envelope by esterification of long chain ω-hydroxyceramides onto CE proteins. Using involucrin and an epidermal ω-hydroxyceramide analog as substrates, kinetic analyses revealed that at membrane concentrations above 4 mol %, CSO4 caused a marked and dose-dependent inhibitory effect on isopeptide and ester bond formation. Sequencing of tryptic peptides from TGase 1-reacted involucrin showed a large increase in deamidation of substrate glutamines. We hypothesize that supraphysiological levels of CSO4 in keratinocyte membranes distort the structure of TGase 1 and facilitate the access of water into its active site causing hydrolysis of substrate glutamine residues. Our findings provide further evidence for the pivotal role of the TGase 1 enzyme in CE formation. cell envelope cholesterol sulfate γ-glutamylputrescine high performance liquid chromatography N-[16-(16-hydroxyhexadecyl)oxypalmitoyl]sphingosine X-linked ichthyosis synthetic lipid vesicles transglutaminase polyacrylamide gel electrophoresis Assembly of an effective epidermal barrier structure is an essential adaptation to terrestrial life. In mammals the outermost bulwark of this barrier is the cornified layer of the epidermis, composed of flattened corneocytes mortared together by orderly lipid laminae. During terminal differentiation, individual corneocytes acquire a specialized cell peripheral structure termed the cornified cell envelope (CE),1 which is responsible for maintenance of mechanical and chemical protection and indirectly contributes to water permeability barrier (see Refs. 1.Nemes Z. Steinert P.M. Exp. Mol. Med. 1999; 3: 5-19Crossref Scopus (441) Google Scholar and2.Ishida-Yamamoto A. Iizuka H. Exp. Dermatol. 1998; 7: 1-10Crossref PubMed Scopus (105) Google Scholar, for reviews). The CE is composed of two parts. The ∼10 nm thick protein envelope is formed by covalent cross-linking of several structural proteins by sulfhydryl oxidases and transglutaminases (TGases). This highly insoluble protein meshwork is coated by the lipid envelope, a ∼5 nm thick layer of ω-hydroxyceramides with uniquely long (C28-C36) fatty acyl moieties (3.Wertz P.W. Downing D.T. Goldsmith L.A. Physiology, Biochemistry and Molecular Biology of the Skin. 1. Oxford University Press, Oxford1991: 205-236Google Scholar). These are covalently attached by ester bonds through their ω-hydroxyl group to selected glutamines to envoplakin, periplakin, and involucrin components of the protein envelope (4.Marekov L.N. Steinert P.M. J. Biol. Chem. 1998; 273: 17763-17770Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). Terminal differentiation of keratinocytes is accompanied by vigorous lipid metabolism and synthesis of keratinization-specific lipids in the granular layer. Newly synthesized lipids are temporarily stored in cytoplasmic lamellar bodies, in which they are arranged as stacks of tetralaminar sheets. The lamellar body lipids consist largely of free fatty acids, (glucosyl)ceramides, cholesterol, and its acyl or sulfate esters (3.Wertz P.W. Downing D.T. Goldsmith L.A. Physiology, Biochemistry and Molecular Biology of the Skin. 1. Oxford University Press, Oxford1991: 205-236Google Scholar). In the uppermost granular layer the lamellar bodies fuse with the cell membrane, and release their contents which assume broad, multilamellar lipid sheets between corneocytes. This process approximately coincides with the initiation of assembly of both the protein envelope and lipid envelope of the CE (5.Wertz P.W. Exper. Suppl. (Basel). 1997; 78: 227-237PubMed Google Scholar). It is thought that the ester-linked long chain ω-hydroxyceramides comprising the lipid bound envelope interdigitate with the interstitial lipid layers and might function in a Velcro-like fashion by fixing the protein envelope to surrounding lipid structures, and vice versa. In this way, the lipid bound envelope contributes to the maintenance of an orderly array of lipid layers during normal wear and tear and mechanical stress of the epidermis. Genetic errors of CE and skin barrier formation can manifest as ichthyosiform symptoms. Some of these diseases have been distinguished on the basis of abnormal metabolism of stratum corneum lipids (6.Steinberg D.S. Stanbury J.B. Wyngaarden J.B. Frederickson D.S. The Metabolic Basis of Inherited Disease. 4th Ed. McGraw-Hill, New York1978: 688-691Google Scholar, 7.De Laurenzi V. Rogers G.R. Hamrock D.J. Marekov L.N. Steinert P.M. Compton J.G. Markova N. Rizzo W.B. Nat. Genet. 1996; 12: 52-57Crossref PubMed Scopus (226) Google Scholar). Some congenital ichthyoses reveal abnormal deposition of apolar or polar lipids or cholesterol in the intercorneocyte lipid layers, and thereby appear to disrupt the normal lipid layerings and composition required for effective epidermal barrier function (8.Anton-Lamprecht I. Papadimitrou J.M. Henderson D.W. Spagnolo D.V. Diagnostic Ultrastructure of Non-neoplastic Diseases. Churchill Livingstone, New York1992: 459-551Google Scholar). These include recessive X-linked ichthyosis (XI) which is caused by an accumulation of excess cholesterol 3-sulfate (CSO4) owing to arylsulfatase C/cholesterol sulfatase enzyme defects (9.Shapiro L.J. Weiss R. Buxman M.M. Vidgoff J. Dimond R.L. Roller J.A. Wells R.S. Lancet. 1978; 2: 756-757Abstract PubMed Scopus (121) Google Scholar). CSO4 is a ubiquitous cholesterol metabolite, the amount of which is determined by the relative activity of cholesterol sulfotransferase and cholesterol sulfatase enzymes (10.Epstein E.H. Williams M.L. Elias P.M. J. Am. Acad. Dermatol. 1984; 10: 866-868Abstract Full Text PDF PubMed Scopus (61) Google Scholar). CSO4 gradually accumulates during epidermal keratinocyte differentiation, peaking normally at levels of 4–5% of total lipids in the upper stratum granulosum and it is hydrolyzed in the cornified layer, so that normal corneocyte scales contain less than 1% CSO4 of total lipids (11.Ranasinghe A.W. Wertz P.W. Downing D.T. Mackenzie I.C. J. Invest. Dermatol. 1986; 86: 187-190Crossref PubMed Scopus (88) Google Scholar, 12.Long S.A. Wertz P.W. Strauss J.S. Downing D.T. Arch Dermatol. Res. 1985; 277: 284-287Crossref PubMed Scopus (172) Google Scholar). In XI the lack of its breakdown results in an elevated CSO4 content in the basal and spinous layers, peaking at >10% (by weight) of total lipids in the stratum corneum (13.Williams M.L. Semin. Dermatol. 1992; 11: 169-175PubMed Google Scholar). However, it is not yet clear how excessive epidermal CSO4diminishes barrier function in the epidermis, and whether the mild increase of epidermal (water) permeability alone is sufficient to account for the severe symptoms of the disease. Several published reports have addressed the alterations of physical properties of corneocyte lipids from excess CSO4 (14.Rehfeld S.J. Williams M.L. Elias P.M. Arch Dermatol. Res. 1986; 278: 259-263Crossref PubMed Scopus (36) Google Scholar, 15.Rehfeld S.J. Plachy W.Z. Williams M.L. Elias P.M. J. Invest. Dermatol. 1988; 91: 499-505Abstract Full Text PDF PubMed Google Scholar, 16.Zettersten E. Man M.Q. Sato J. Denda M. Farrell A. Ghadially R. Williams M.L. Feingold K.R. Elias P.M. J. Invest. Dermatol. 1998; 111: 784-790Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). It has been shown that CSO4 can cause phase separation of cholesterol-fatty acid layers (14.Rehfeld S.J. Williams M.L. Elias P.M. Arch Dermatol. Res. 1986; 278: 259-263Crossref PubMed Scopus (36) Google Scholar) and that the XI phenotype can be ameliorated by topical cholesterol treatment (17.Lykkesfeldt G. Hoyer H. Lancet. 1983; 2: 1337-1338Abstract PubMed Scopus (33) Google Scholar). Thus it was suggested that XI arises due to a defect of intercorneocyte lipid layer formation. In a conceptually related argument, CSO4 was shown to interfere with spontaneous sheet formation of epidermal lipidsin vivo, perhaps due to the strong charge of its sulfate moiety conferring detergent properties to CSO4. Thus it was theorized that CSO4 affects epidermal barrier function both by deranging skin lipid layers and by replacing cholesterol in the lipid sheets (16.Zettersten E. Man M.Q. Sato J. Denda M. Farrell A. Ghadially R. Williams M.L. Feingold K.R. Elias P.M. J. Invest. Dermatol. 1998; 111: 784-790Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar). In another study, it was proposed that since CSO4 has trypsin and chymotrypsin inhibitory propertiesin vitro, it might thereby affect breakdown of desmosomes, thus causing retention hyperkeratosis and abnormal scaling (18.Sato J. Denda M. Nakanishi J. Nomura J. Koyama J. J. Invest. Dermatol. 1998; 111: 189-193Abstract Full Text Full Text PDF PubMed Scopus (101) Google Scholar). Finally, more recently, it was demonstrated that CSO4 can induce TGase 1 expression in cultured keratinocytes (19.Kawabe S. Ikuta T. Ohba M. Chida K. Ueda E. Yamanishi K. Kuroki T. J. Invest. Dermatol. 1998; 111: 1098-1102Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar), but the connection between excess TGase expression and disease etiology remains unclear. CSO4 in keratinocyte membranes was shown to activate the protein kinase C isoforms ε, ζ, and η, presumably by direct allosteric effects on their tertiary structures. As these membrane-bound enzymes are involved in the signaling pathways of keratinocyte differentiation (20.Chida K. Murakami A. Tagawa T. Ikuta T. Kuroki T. Cancer Res. 1995; 55: 4865-4869PubMed Google Scholar, 21.Ikuta T. Chida K. Tajima O. Matsuura Y. Iwamori M. Ueda Y. Mizuno K. Ohno S. Kuroki T. Cell Growth Differ. 1994; 5: 943-947PubMed Google Scholar), CSO4 could induce TGase 1 expression in this way (19.Kawabe S. Ikuta T. Ohba M. Chida K. Ueda E. Yamanishi K. Kuroki T. J. Invest. Dermatol. 1998; 111: 1098-1102Abstract Full Text Full Text PDF PubMed Scopus (45) Google Scholar). Mammalian TGases (glutamyl-amine aminotransferases, EC 2.3.2.13) constitute an evolutionarily related family of Ca2+-dependent enzymes (22.Polakowska R.R. Eickbush T. Falciano V. Razvi F. Goldsmith L.A. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 4476-4480Crossref PubMed Scopus (32) Google Scholar). The catalytic mechanism of TGases involves the release of ammonia from the reactive glutamine residues, and the residual glutamyl moieties form an acyl-enzyme thioester, a labile intermediate susceptible to nucleophilic attack by primary amines, notably ε-amino groups from protein bound lysines (formingN ε-(γ-glutamyl)lysine isopeptide cross-links), or polyamines (resulting inN,N′-bis(γ-glutamyl)polyamine cross-links (23.Folk J.E. Finlayson J.S. Adv. Protein Chem. 1977; 31: 1-133Crossref PubMed Scopus (780) Google Scholar,24.Greenberg C.S. Birckbichler P.J. Rice R.H. FASEB J. 1991; 5: 3071-3077Crossref PubMed Scopus (926) Google Scholar). However, the thioester intermediate can also be transferred to primary alcohols (25.Gross M. Folk J.E. J. Biol. Chem. 1974; 249: 3021-3025Abstract Full Text PDF PubMed Google Scholar, 26.Parameswaran K.N. Lorand L. Biochemistry. 1981; 20: 3703-3711Crossref PubMed Scopus (24) Google Scholar). We have shown that in the epidermis, the terminal (ω) hydroxyl group of ω-hydroxyceramides is an effective substrate for membrane-bound TGase 1, and this route links these lipids to protein-bound glutamines by an ester bond (27.Nemes Z. Marekov L.N. Fésüs L. Steinert P.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8402-8407Crossref PubMed Scopus (218) Google Scholar). Lastly, water can also enter the active site of TGases to attack the acyl-enzyme intermediate, which leads to a net deamidation of a reactive glutamine to a glutamic acid residue (28.Folk J.E. Chung S.I. Methods Enzymol. 1985; 113: 358-375Crossref PubMed Scopus (249) Google Scholar, 29.Folk J.E. Chung S.I. Adv. Enzymol. Relat. Areas Mol. Biol. 1973; 38: 109-191PubMed Google Scholar). Seven members of the TGase family have been identified in the human genome so far, of which four (TGases 1, 2, 3, and X) are expressed in the epidermis (30.Rice R.H. Mehrpouyan M. Qin Q. Phillips M.A. Leigh I.M. Lane E.B. Watt F.M. The Keratinocyte Handbook. Cambridge University Press, Cambridge1994: 259-274Google Scholar, 31.Aeschlimann D. Koeller M.K. Allen-Hoffmann B.L. Mosher D.F. J. Biol. Chem. 1998; 273: 3452-3460Abstract Full Text Full Text PDF PubMed Scopus (86) Google Scholar), although to date only TGases 1 and 3 have verified roles in CE assembly (32.Candi E. Melino G. Mei G. Tarcsa E. Chung S.I. Marekov L.N. Steinert P.M. J. Biol. Chem. 1995; 270: 26382-26390Abstract Full Text Full Text PDF PubMed Scopus (151) Google Scholar, 33.Tarcsa E. Candi E. Kartasova T. Idler W.W. Marekov L.N. Steinert P.M. J. Biol. Chem. 1998; 273: 23297-23303Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). TGase 1 is expressed as a 106-kDa monomeric protein, which is constitutivelyN-myristoylated and S-palmitoylated on its amino-terminal 10-kDa domain, thereby directing the enzyme to plasma membranes (34.Candi E. Melino G. Lahm A. Ceci R. Rossi A. Kim I.G. Ciani B. Steinert P.M. J. Biol. Chem. 1998; 273: 13693-13702Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 35.Steinert P.M. Kim S.Y. Chung S.I. Marekov L.N. J. Biol. Chem. 1996; 271: 26242-26250Abstract Full Text Full Text PDF PubMed Scopus (77) Google Scholar, 36.Rice R.H. Rong X.H. Chakravarty R. Biochem. J. 1990; 265: 351-357Crossref PubMed Scopus (41) Google Scholar). Membrane-bound TGase 1 enzyme is essential for both the assembly of the protein envelope by cross-linking CE structural proteins located in the intimate vicinity of the cellular membrane, and the esterification of the ω-hydroxyceramides to proteins, primarily involucrin (27.Nemes Z. Marekov L.N. Fésüs L. Steinert P.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8402-8407Crossref PubMed Scopus (218) Google Scholar). Genetic defects of TGase 1 cause the often devastating disease lamellar ichthyosis (37.Russell L.J. DiGiovanna J.J. Rogers G.R. Steinert P.M. Hashem N. Compton J.G. Bale S.J. Nat. Genet. 1995; 9: 279-283Crossref PubMed Scopus (320) Google Scholar, 38.Huber M. Rettler I. Bernasconi K. Frenk E. Lavrijsen S.P. Ponec M. Bon A. Lautenschlager S. Schorderet D.F. Hohl D. Science. 1995; 267: 525-528Crossref PubMed Scopus (423) Google Scholar). The homozygous TGase 1 knock-out mice show defective CE assembly and die from dehydration a few hours after birth (39.Matsuki M. Yamashita F. Ishida-Yamamoto A. Yamada K. Kinoshita C. Fushiki S. Ueda E. Morishima Y. Tabata K. Yasuno H. Hashida M. Iizuka H. Ikawa M. Okabe M. Kondoh G. Kinoshita T. Takeda J. Yamanishi K. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 1044-1049Crossref PubMed Scopus (248) Google Scholar). Involucrin is ubiquitously expressed in stratified squamous epithelia, suggesting it is commonly involved in CE formation (40.Eckert R.L. Yaffe M.B. Crish J.F. Murthy S. Rorke E.A. Welter J.F. J. Invest. Dermatol. 1993; 100: 613-617Abstract Full Text PDF PubMed Google Scholar, 41.Steinert P.M. Marekov L.N. J. Biol. Chem. 1997; 272: 2021-2030Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar). Mammalian involucrins evolved by tandem duplications of glutamine and glutamic acid-rich sequences spanning between the evolutionary relatively conserved amino-terminal (“head”) and carboxyl-terminal (“tail”) domains (42.Green H. Djian P. Mol. Biol. Evol. 1992; 9: 977-1017PubMed Google Scholar). Recent in vivo observations indicate that the CE formation may be initiated by the deposition of a monomolecular layer of involucrin on the inner keratinocyte membrane (41.Steinert P.M. Marekov L.N. J. Biol. Chem. 1997; 272: 2021-2030Abstract Full Text Full Text PDF PubMed Scopus (199) Google Scholar, 43.Jarnik M. Simon M.N. Steven A.C. J. Cell Sci. 1998; 111: 1051-1060PubMed Google Scholar). In a previous paper (44.Nemes Z. Marekov L.N. Steinert P.M. J. Biol. Chem. 1999; 274: 11013-11021Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar) we described an in vitromodel system for characterizing the function of TGase 1 on the surface of synthetic lipid vesicles (SLV) of composition similar to eukaryote plasma membranes. Using this model system we have demonstrated that involucrin is absorbed to membranes containing physiological levels of phosphatidylserine at Ca2+ concentrations in the range typically seen in keratinocytes. Applying our SLV experimental system for modeling the earliest stages of CE assembly, we demonstrate here that supraphysiological levels of CSO4 severely interfere with involucrin cross-linking and ω-hydroxyceramide esterification by TGase 1. Our data reveal new insights into the pathophysiology of XI disease. Full-length human TGase 1 and involucrin proteins were expressed and purified exactly as described (44.Nemes Z. Marekov L.N. Steinert P.M. J. Biol. Chem. 1999; 274: 11013-11021Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). A K62N mutant form of human involucrin was made from the pET11a expression plasmid by use of the GCACATGACTGCTGTAACGGGACTGCCTGAGCAAGAATG primer and its reverse strand using the QuickChange (Stratagene) kit, and further processed identically to the wild type. Occasionally, involucrin expression was induced in a LB broth containing 100 nmol (0.5 mCi/liter) of l-[35S]cysteine and 100 nmol (0.5 mCi/liter) of l-[35S]methionine (both from Amersham Pharmacia Biotech). The following mixtures were made in chloroform/methanol (2:1): 55 mol % dimyristoyl phosphatidylcholine, 15 mol % dipalmitoyl phosphatidylserine, 0–10 mol % CSO4, cholesterol up to 99 mol % (all from Sigma), and 1 mol % of the synthetic ceramide analogN-[16-(16-hydroxyhexadecyl)oxypalmitoyl]sphingosine (lipid Z) (27.Nemes Z. Marekov L.N. Fésüs L. Steinert P.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8402-8407Crossref PubMed Scopus (218) Google Scholar). The solvent was evacuated, and the lipids were taken up in aqueous buffer and dispersed by sonication as before (44.Nemes Z. Marekov L.N. Steinert P.M. J. Biol. Chem. 1999; 274: 11013-11021Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). The prepared SLV suspension was equipped with 0.94 pmol (0.1 μg) of TGase 1 and its membrane binding was facilitated by incubating at 37 °C for 15 min prior to adding substrates. SLV (200 μl, 2 μmol of lipid) formulated with 0–10 mol % CSO4 were loaded with TGase 1 as above and 600 pmol (40 μg) of involucrin in the presence of 1 mm CaCl2. They were immediately incubated for 2 h in either the absence or presence of 20 mm putrescine with 100 nCi of [14C]putrescine (NEN Life Science Products Inc., Boston, MA, 110 Ci/mmol). The reactions were stopped by the addition of EDTA to 10 mm. In control experiments we assessed whether the applied concentrations of CSO4 disrupted or aggregated the SLV. SLV confectioned with 0–15 mol % CSO4 and the above ingredients in various combinations were diluted 10-fold in reaction buffer (without isotope) and examined by light scattering at 310 nm. As we found no changes in light scattering for CSO4concentrations below 12 mol %, we routinely used SLV containing ≤10 mol % CSO4. The above reaction mixtures were diluted with SDS-PAGE sample buffer (45.Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (205531) Google Scholar), boiled, and analyzed by autoradiography after transfer onto polyvinylidene difluoride membranes following SDS-PAGE on 4–20% gradient gels (Novex). In some experiments, 0.1 ml of 20% SDS was added to the samples and the mixture was vortexed. This mixture was precipitated and washed three times with acetone/triethylamine/acetic acid (90:5:5) (46.Konigsberg W.H. Henderson L. Methods Enzymol. 1983; 91: 254-259Crossref PubMed Scopus (104) Google Scholar) to remove the SDS and noncovalently bound lipids. After further washing with acetone, the pellet was dried under vacuum and redissolved in 50 mm Tris-HCl (pH 7.5). Quantitation of the N ε-(γ-glutamyl) lysine isopeptide cross-link was done by amino acid analysis following exhaustive proteolytic fragmentation of the products by the nonspecific protease Pronase and a mixture of carboxypeptidases (47.Tarcsa E. Fesus L. Anal. Biochem. 1990; 186: 135-140Crossref PubMed Scopus (41) Google Scholar). V max,K m, and k cat values were determined exactly as described (44.Nemes Z. Marekov L.N. Steinert P.M. J. Biol. Chem. 1999; 274: 11013-11021Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). The tryptic peptides of involucrin reacted with TGase 1 on SLV formulated with 1% lipid Z for 2 h were recovered and quantitated exactly as described (27.Nemes Z. Marekov L.N. Fésüs L. Steinert P.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8402-8407Crossref PubMed Scopus (218) Google Scholar). There are four different outcomes of TGase catalysis of reactive Gln residues in the present experimental system, and are as follows: deamidated (that is, a Glu residue is formed); ester-linked to the synthetic ceramide analog lipid Z; and isopeptide cross-linked, either to theN ε-amino group of an involucrin Lys residue or, where added, to the diamine substrate putrescine forming γ-glutamylputrescine (EP). Finally some substrate glutamine residues are recovered in unmodified form. The following procedures were designed to separately identify and quantitate each of these five end products. Samples of TGase 1-reacted involucrin were freed from SLV lipids as above. The protein was then digested with 2% (by weight) modified trypsin (Roche Molecular Biochemicals). The grossly different chromatographic properties ofN ε-Lys62 cross-linked and lipid Z-linked tryptic involucrin peptides allowed their separation and quantitation by amino acid analysis following acid hydrolysis. In the samples reacted with lipid Z, first the digest was passed through a C4 HPLC column under strongly desorbing solvent conditions as described (27.Nemes Z. Marekov L.N. Fésüs L. Steinert P.M. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 8402-8407Crossref PubMed Scopus (218) Google Scholar), where only the lipopeptides are retarded and all other non-lipid-containing peptides are recovered in the column flow-through (4.Marekov L.N. Steinert P.M. J. Biol. Chem. 1998; 273: 17763-17770Abstract Full Text Full Text PDF PubMed Scopus (179) Google Scholar). The amount of the five lipid Z-ester linked peptides (see Fig. 5 A) was determined by amino acid analysis. The peptide pool recovered from the C4 column flow-through was further separated by C18 HPLC chromatography as described (44.Nemes Z. Marekov L.N. Steinert P.M. J. Biol. Chem. 1999; 274: 11013-11021Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). Here peptides involved in cross-link formation were recovered as distinct peaks (P1 and P2 of Fig. 2 B) when cross-linked to another involucrin peptide. Sequences and cross-linking sites of these peptides were determined by peptide sequencing as before (48.Steinert P.M. Marekov L.N. J. Biol. Chem. 1995; 270: 17702-17711Abstract Full Text Full Text PDF PubMed Scopus (479) Google Scholar). To eliminate interference of overlapping (non-cross-linked) tryptic peptides of involucrin, the absolute molar amount of cross-linked residues was calculated from the Thr content, since Thr was absent from neighboring contaminating peptide peaks and was equimolar with theN-ε(γ-glutamyl)lysine isopeptide present in the cross-linked peptide (Table I).Figure 2Identification of cross-linking sites in involucrin. C18 HPLC profiles of tryptic involucrin peptides were compared before (A) and after (B) reaction with TGase 1 bound to SLV containing no CSO4. Peaks harboring the 5 Gln residues reactive with SLV-bound TGase 1 are indicated with arrows on panel A. For clarity, the same peak numbering system was retained as before (44.Nemes Z. Marekov L.N. Steinert P.M. J. Biol. Chem. 1999; 274: 11013-11021Abstract Full Text Full Text PDF PubMed Scopus (60) Google Scholar). TGase 1-dependent appearance of the novel peaks P1and P2 is noted. The sequences of these peaks are shown in Table I.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Table IAmino acid sequences of peptide peaks from HPLC separation of tryptic involucrin peptides (Fig. 2B) affected by cross-linking by TGase 1 on SLVPeakSequenceSequence position in involucrinPeaks showing decreased area 9HMTAVK63–68 22LLDQQLDQELVK129–140 32QEAQLELPEQQVGQPK486–501Peaks appearing after cross-linking P1 QEEK62 HMTAVK59–63:LLDQQ133LDQELVK129–140 P2QEEK62HMTAVK59–63:QEAQLELPEQQ496VGQPK486–501 Open table in a new tab However, the peptides harboring unmodified, deamidated or putrescine-linked glutamine residues were not resolvable by HPLC but instead were analyzed by peptide sequencing. After Edman degradation, the phenylthiohydantoin-derivatized residues each appeared as a distinct peak in the sequencer's HPLC profile (see Fig. 6). The ratio of deamidation and putrescine cross-linking was determined from the relative intensity of PITC/phenylthiohydantoin-derivatized Gln, Glu, and EP peaks from the sequencing cycles corresponding to each expected Gln residue as four of the reactive Gln residues were preceded by an unreactive Gln, the ratio of the unmodified and deamidated Gln/Glu residues was corrected for carryover from the previous sequencing cycle of Gln, using the formula, Q/E=[Qn−Qn−1·(1−Qn+1/Qn)][1+En−1+En−1)][En−En−1·(1−En+1/En)][1−En−1/(Qn−1+En−1)]Equation 1 where X n denotes the amount of the amino acid released from the sequencing cycle corresponding to the reactive residue position, and X n−1, orX n+1 denote the yield of the same amino acid in the previous or consecutive sequencing cycle. Similarly, the amount of EP was corrected for incomplete cleavage and carryover by the formula, EP−(EPn) 2·(EPn/(EPn−EPn+1)Equation 2 Where EPn denotes the amount of γ-glutamylputrescine in the first cycle of its appearance and EPn+1 is that from the next cycle. Molar absorption of EP was taken equal to that of Lys at the detection wavelength of the Porton 3000 sequencer (268 nm). Thus based on the directly measured absolute amounts of Gln residues occupied by theN ε-(γ-glutamyl)lysine cross-link and the lipid Z ester, we could calculate from the sequencing chromatograms the fate of the remainder of the 600 pmol of the Gln residues of involucrin that was unreacted, deamidated, and in control experiments, putrescine-linked. The data represent the means of three or more independent measurements. Wild type 35S-involucrin was reacted with TGase 1 on the surface of SLV for 2 h in the absence of exogenous glutamyl acceptor substrates. The protein was cross-linked into dimers, trimers, tetramers, and higher oligomers, as evidenced by autoradiography of protein blots after separation by SDS-PAGE (Fig.1 A). Some of the protein showed faster electrophoretic mobility than the monomer, indicative of intramolecular cross-link formation (49.LaCelle P.T. Lambert A. Ekambaram M.C. Robinson N.A. Eckert R.L. Skin Pharmacol. Appl. Skin Physiol. 1998; 11: 214-226Crossref PubMed Scopus (28) Google Scholar). Oligomers larger than tetramers were not separated by the gels used, but remained at the interface of the separation gel. Inclusion of 1 mol % lipid Z into the SLV membranes did not eliminate involucrin cross-linking by TGase 1 (Fig. 1 B), but the addition of 20 mm putrescine as a competitive inhibitor of protein bound lysine ε-amino groups (Fig. 1 C) or omission of Ca2+ (not shown) caused a virtually complete inhibition of oligomer formation. These data indicate that involucrin is a complete substrate for the TGase 1 enzyme bound to SLV, in that it provides both donor Gln and acceptor Lys residues, and confirm a similar conclusion for the reaction of crude TGase 1 with involucrin in solution assays (49.LaCelle P.T. Lambert A. Ekambaram M.C. Robinson N.A. Eckert R.L. Skin Ph

Tissue transglutaminase (tTG) expression was found to be induced in rat liver following in vivo retinoic acid (RA) treatment (Piacentini et al. (1988) Biochem. J. 253, 33-38). Here we show that the increased enzyme expression in rat liver is at least partially the result of the action of RA in parenchymal cells. In fact, (a) when hepatocytes are isolated from RA-treated animals their transglutaminase protein content is much higher than in similarly isolated control cells; (b) higher tTG protein level is also found by immunoelectronmicroscopy in the hepatocytes of the RA-treated rats as compared with the very low amount detected in the controls; (c) RA induces tTG in hepatocytes under culture conditions as well. One of the functions of tTG is to form a protein polymer in dying apoptotic cells by epsilon(gamma-glutamyl)lysine and, specifically gamma-glutamylpolyamine cross-links (Fesus et al. (1989) FEBS Lett. 245, 150-154). Noteworthy, after in vivo and in vitro RA-treatment we could not determine any increase (there was even a slight decrease) in the number of the cross-linked apoptotic envelopes. In keeping with this is the significant reduction of protein bound gamma-glutamylpolyamine detected in hepatocytes exposed to RA in culture. These findings suggest that the RA-induced tTG in parenchimal cells is an inactive form.

epsilon(gamma-Glutamyl)lysine isodipeptide, the end-product of proteolytic digestion of proteins cross-linked by transglutaminase, was detected in culture fluid of neonatal rat hepatocytes and plasma of adult rats. The concentration of the isodipeptide was significantly increased in both when high rate of apoptosis with phagocytosis of dying hepatocytes was produced either by epidermal growth factor in the culture or by lead nitrate-induced hyperplasia with subsequent involution in rats. Specific induction of tissue transglutaminase and the consequent formation of highly cross-linked protein envelopes in apoptotic cells have been previously demonstrated by us in both systems.

A sensitive, reproducible high-performance liquid chromatographic method is reported for the determination of the ϵ(γ-glutamyl)lysine isopeptide bond, which is usually formed by protein-crosslinking transglutaminases between polypeptide chains. The procedure is based on the separation and quantitation of ϵ(γ-glutamyl)lysine isodipeptide following exhaustive proteolytic digestion of the crosslinked peptide. It involves preliminary separation steps on a cation exchanger resin and a silica HPLC column, precolumn derivatization with phenylisothiocyanate, and reversed-phase high-pressure liquid chromatographic separation on a C18 column. The derivatized isodipeptide gave a linear concentration-response relationship, with a detection limit of 10 pmol/mg of protein. The combination of the preliminary separation steps and the sensitive detection system permits the determination of the ϵ(γ-glutamyl)lysine crosslink in complex biological systems including total tissue homogenates.

Abstract We have designed a new kinetic assay for estimating Factor XIII in plasma. Plasma fibrinogen is removed by treatment with bentonite (colloidal aluminum silicate) before measurement. During the lag phase, Factor XIII is transformed by thrombin and Ca2+ into active transglutaminase (EC 2.3.2.13), which attaches the substrate ethylamine to a glutamine residue in acetylated, dephosphorylated beta-casein. During the reaction, ammonia is released, which can be continuously monitored in an NADPH-dependent indicator reaction catalyzed by glutamate dehydrogenase (EC 1.4.1.4). We determined the optimal concentrations of substrate and activator and found that, to eliminate the clottable fibrinogen from the plasma samples, bentonite treatment was more advantageous than the traditional heat treatment. Results by the method correlate well with those by the most widely used amine incorporation and immunoinhibition assays for Factor XIII. We established a reference interval of 12.1-22.7 U/L; at optimal conditions, the variance of the method was less than 3% within this range. The method has several theoretical and practical advantages over traditional determinations of Factor XIII.

Vitamin A deficiency is known to be accompanied with immune deficiency and susceptibility to a wide range of infectious diseases. Experimental evidence suggests that the active metabolites of vitamin A that mediate its effects on the immune system are the retinoic acids (RA), which are ligands for the nuclear RA receptor (RAR) family. RA were previously shown both to promote proliferation and to regulate apoptosis of thymocytes. In this study we detected the age-dependent mRNA expression of retinaldehyde dehydrogenases (RALDH1 and 2), cellular RA binding protein-II and CYP26A, proteins responsible for the synthesis, nuclear transport and degradation of RA in the postnatally developing thymus. RALDH1 was located in thymic epithelial cells. However, the amount of all-trans RA in thymic homogenates was close to the detection limit, suggesting that in this tissue all-trans RA is not the main RAR-regulating product of retinol metabolism. At the same time, by measuring the induction of a RAR-responsive transgene in two independent transgenic mouse strains, we demonstrated the production of an RAR-activating ligand, which was age and RALDH dependent. Our data provide evidence for the existence of endogenous retinoid synthesis in the thymus and suggest that retinoids similar to glucocorticoids might indeed be involved in the regulation of thymic proliferation and selection processes by being present in the thymus in functionally effective amounts.

ABSTRACT GCs are powerful anti-inflammatory compounds inhibiting inflammatory cell recruitment and production of proinflammatory cytokines. We have recently found that DCs, the key players of T cell priming and polarization, respond to allogeneic apoptotic neutrophils with proinflammatory cytokine release and Th1 cell activation. Here, we show that monocyte-derived human DCs develop their capacity to engulf apoptotic cells by up-regulating a set of apoptophagocytic genes. This gene expression pattern was reprogrammed when differentiation took place in the presence of the synthetic GC Dex, which increased the expression of phagocytosis receptors MERTK and CD14, the bridging molecule C1QA, DNASE2, and ADORA3. The increased phagocytosis was attenuated by the addition of ADORA3 antagonist and could not be observed when bone marrow-derived DCs of ADORA3 KO mice were treated with Dex. The GC-treated human DCs loaded with allogeneic apoptotic neutrophils secreted, in response to LPS and IFN-γ, the inflammatory cytokine TNF-α. Furthermore, the Dex-treated DCs could activate autologous T lymphocytes toward Th1 effector cells, and this was enhanced by their exposure to allogeneic apoptotic neutrophils.

Relationships among GH genotype (AluI polymorphism), parity, metritis and interval from calving to first ovulation, milk production and body condition score (BCS) loss were determined in dairy cows (n=307) on four large-scale farms in Hungary. Cows with systemic signs of puerperal metritis or mastitis were excluded. Time of the first postpartum (PP) ovulation was obtained from milk progesterone profiles. Based on GH genotype determination, groups of leucine homozygous cows (n=246) and valine allele carriers (n=61) were formed. All animals became cyclic during the study period. The average interval to first ovulation was 27.6+/-0.69-d PP (mean+/-S.D.). Genotype had no effect on the commencement of ovarian cyclicity. First ovulation occurred sooner after calving in pluriparous than in primiparous cows. The greater BCS loss cows had during the first 30-d PP, the longer they took to resume cyclic ovarian function. The interval from calving to first ovulation was substantially affected by farm, but not by mild cases of puerperal metritis. Genotype was not related to cumulative 30-d milk yield or BCS loss after calving. Primiparous cows had lower milk yield than pluriparous ones. Cows with metritis lost more body condition than healthy individuals in the first month postpartum. We concluded that, under field conditions, AluI polymorphism of the bovine GH gene had no effect on the interval from calving to first ovulation and could not be directly related to differences in milk yield and to the extent of BCS loss during the first month after calving in Holstein-Friesian cows.

Glucocorticoid-induced apoptosis of thymocytes is one of the first recognized forms of programmed cell death. It was shown to require gene activation induced by the glucocorticoid receptor (GR) translocated into the nucleus following ligand binding. In addition, the necessity of the glucocorticoid-induced, but transcription-independent phosphorylation of phosphatidylinositol-specific phospholipase C (PI-PLC) has also been shown. Here we report that retinoic acids, physiological ligands for the nuclear retinoid receptors, enhance glucocorticoid-induced death of mouse thymocytes both in vitro and in vivo. The effect is mediated by retinoic acid receptor (RAR) alpha/retinoid X receptor (RXR) heterodimers, and occurs when both RARα and RXR are ligated by retinoic acids. We show that the ligated RARα/RXR interacts with the ligated GR, resulting in an enhanced transcriptional activity of the GR. The mechanism through which this interaction promotes GR-mediated transcription does not require DNA binding of the retinoid receptors and does not alter the phosphorylation status of Ser232, known to regulate the transcriptional activity of GR. Phosphorylation of PI-PLC was not affected. Besides thymocytes, retinoids also promoted glucocorticoid-induced apoptosis of various T-cell lines, suggesting that they could be used in the therapy of glucocorticoid-sensitive T-cell malignancies.

Thermogenic brown and beige adipocytes oxidize metabolic substrates producing heat, mainly by the mitochondrial uncoupling protein UCP1, and can thus counteract obesity. Masked beige adipocytes possess white adipocyte-like morphology, but can be made thermogenic by adrenergic stimuli. We investigated the regulation of mitophagy upon thermogenic activation of human masked and mature beige adipocytes. Human primary abdominal subcutaneous adipose-derived stromal cells (hASCs) and Simpson–Golabi–Behmel syndrome (SGBS) preadipocytes were differentiated to white and beige adipocytes, then their cAMP-induced thermogenic potential was assessed by detecting increased expressions of UCP1, mitochondrial DNA content and respiratory chain complex subunits. cAMP increased the thermogenic potential of white adipocytes similarly to beige ones, indicating the presence of a masked beige population. In unstimulated conditions, a high autophagic flux and mitophagy rates (demonstrated by LC3 punctae and TOM20 co-immunostaining) were observed in white adipocytes, while these were lower in beige adipocytes. Silencing and gene expression experiments showed that the ongoing mitophagy was Parkin-independent. cAMP treatment led to the downregulation of mitophagy through PKA in both types of adipocytes, resulting in more fragmented mitochondria and increased UCP1 levels. Our data indicates that mitophagy is repressed upon encountering a short-term adrenergic stimulus, as a fast regulatory mechanism to provide high mitochondrial content for thermogenesis.

Thermogenic brown and beige adipocytes might open up new strategies in combating obesity. Recent studies in rodents and humans have indicated that these adipocytes release cytokines, termed "batokines". Irisin was discovered as a polypeptide regulator of beige adipocytes released by myocytes, primarily during exercise. We performed global RNA sequencing on adipocytes derived from human subcutaneous and deep-neck precursors, which were differentiated in the presence or absence of irisin. Irisin did not exert an effect on the expression of characteristic thermogenic genes, while upregulated genes belonging to various cytokine signaling pathways. Out of the several upregulated cytokines, CXCL1, the highest upregulated, was released throughout the entire differentiation period, and predominantly by differentiated adipocytes. Deep-neck area tissue biopsies also showed a significant release of CXCL1 during 24 h irisin treatment. Gene expression data indicated upregulation of the NFκB pathway upon irisin treatment, which was validated by an increase of p50 and decrease of IκBα protein level, respectively. Continuous blocking of the NFκB pathway, using a cell permeable inhibitor of NFκB nuclear translocation, significantly reduced CXCL1 release. The released CXCL1 exerted a positive effect on the adhesion of endothelial cells. Together, our findings demonstrate that irisin stimulates the release of a novel adipokine, CXCL1, via upregulation of NFκB pathway in neck area derived adipocytes, which might play an important role in improving tissue vascularization.

The aim of the present study was the characterization of the ovine aromatase cytochrome P450 encoding gene (Cyp19) and the analysis of its tissue-specific expression. Two loci with considerable sequence identity were found (Cyp19 and Cyp19b). From Cyp19, tissue-specific transcript variants with different untranslated first exons but identical coding regions could be identified. Cyp19b transcripts were not detected. In the sheep brain and ovarian granulosa cells transcript variants, starting with the untranslated exons 1.4 and 2, respectively, were preferentially found. Exons 1.2 and 1.3 which had been described in bovines could not be detected in sheep and the major 5' untranslated region of the bovine placental transcript, exon 1.1, was also not found to predominate in the sheep placenta. However this exon frequently was combined with a new untranslated exon (exon 1.1a) thus generating an alternative splice variant. The main placental transcripts in sheep had a different first exon (exon 1.5). Two alternatively spliced variants of this transcript were found with tissue-specific preference. From the present data it can be concluded: (a) that the ovine genome contains two copies of Cyp19 of which only one is transcribed and may encode a functional protein; and (b) that in spite of being closely related species, sheep and cattle have remarkable differences concerning tissue-specific transcript distribution and presumable promoter usage.

Fluorescence resonance energy transfer (FRET) data, in accordance with lateral mobility measurements, suggested the existence of class I HLA dimers and oligomers at the surface of live human cells, including the B lymphoblast cell line (JY) used in the present study. Intra- and intermolecular class I HLA epitope distances were measured on JY B cells by FRET using fluorophore-conjugated Ag-binding fragments of mAbs W6/32 and L368 directed against structurally well-characterized heavy and light chain epitopes, respectively. Out-of-plane location of these epitopes relative to the membrane-bound BODIPY-PC (2-(4,4-difluoro-5-(4-phenyl-1,3-butadienyl)-4-bora-3a,4a-diaza-s-indacene-3-pentanoyl)-1-hexadecanoyl-sn-glycero-3-phosphocholine) was also determined by FRET. Computer-simulated docking of crystallographic structures of class I HLA and epitope-specific Ag-binding fragments, with experimentally determined interepitope and epitope to cell surface distances as constraints, revealed several sterically allowed and FRET-compatible class I HLA dimeric and tetrameric arrangements. Extension of the tetrameric class I HLA model with interacting TCR and CD8 resulted in a model of a supramolecular cluster that may exist physiologically and serve as a functionally significant unit for a network of CD8-HLA-I complexes providing enhanced signaling efficiency even at low MHC-peptide concentrations at the interface of effector and APCs.

© 1997 Federation of European Biochemical Societies.

For the purpose of developing a transglutaminase inhibitor which could be effective in physiological and pharmacological studies, a series of phenylthiourea derivatives of alpha, omega-diaminoalkanes were designed, synthesized, and evaluated kinetically as inhibitors of transglutaminases. A homologous series of compounds of the structure phenylthiourea-(CH2)n-NH2, where n = 2, 3, 4, 5, and 6, were tested for the inhibition of both guinea pig liver transglutaminase-catalyzed amine incorporation into various glutamine-containing substrates and plasma transglutaminase (factor XIIIa)-catalyzed amine incorporation into fibrin and fibrin cross-linking. It was found that the inhibitory activity of the compounds increases with increasing number of methylene groups in the side chain up to a maximum of n = 5. A further increase in the length of the methylene side chain to n = 6 results in decreased activity. The Ki value (4.9 X 10(-5) M) of 1-(5-aminopentyl)-3-phenylthiourea (PPTU) (n = 5) for the inhibition of guinea pig transglutaminase-catalyzed amine incorporation into the B chain of oxidized insulin is in close agreement to its Km(app) value (7.1 X 10(-5) M) obtained using 14C-labeled PPTU. PPTU was also found to be a potent inhibitor of plasma transglutaminase-catalyzed fibrin cross-linking. The finding that the specificity of the alkylamines for inhibition is correlated with the length of their methyl side chains is compatible with those reported for aliphatic amines and monodansylcadaverine analogues (where dansyl is 5-dimethylaminonaphthalene-1-sulfonyl). The phenylthiourea derivatives, however, are far less toxic in mice than monodansylcadaverine as indicated by their LD50 values: PPTU, 400 +/- 25 mg/kg; and monodansylcadaverine, 160 +/- 20 mg/kg.

A sandwich ELISA system has been developed to quantitate transglutaminase in human cell extracts. It utilizes affinity-purified rabbit anti-human transglutaminase as the capture antibody and a mouse monoclonal anti-transglutaminase (Birckbichler et al., 1985) as the indicator antibody (together with peroxidase-labeled anti-mouse immunoglobulin). The sensitivity of the assay was less than 1.0 ng/mg cellular protein. Significantly higher concentrations of the enzyme were found in resting versus proliferating or transformed fibroblasts in good agreement with previous activity measurements. The levels of transglutaminase in normal T and B lymphocytes, malignant lymphoid cells and monocytes were also determined.

Incubation of purified human beta 2-microglobulin (B2-m) with tissue transglutaminase (Tgase) resulted in the formation of high molecular weight polymers revealed by sodium dodecyl sulfate polyacrylamide gel electrophoresis. In the presence of 30 mM [14C]methylamine, the polymer formation was prevented, but incorporation of methylamine into beta 2-m (equal to 1 methylamine per 1 molecule) could be observed. From the sheddings of peripheral blood mononuclear cells occurring in the presence of Tgase, it is apparent that anti-beta 2-m immunoadsorbent removed, in addition to human leukocyte antigen (HLA) and beta 2-m, some other proteins. The enzyme could incorporate [14C]methylamine into beta 2-m of the shedding cells. On addition of rabbit anti-human beta 2-m antibody, followed by fluoresceine-labeled goat anti-rabbit IgG antibody to human mononuclear blood cells, the otherwise homogeneous distribution of fluorescence turned into spots and patches on cells previously incubated with Tgase or Ca2+-ionophore A23187.

Tissue transglutaminase (TG2) facilitates phosphatidylserine exposure and calpain activity in calcium-induced death of erythrocytes

Transglutaminase 2 (TG2) is a protein crosslinking enzyme with several additional biochemical functions.Loss of TG2 in vivo results in impaired phagocytosis of apoptotic cells and altered proinflammatory cytokine production by macrophages engulfing apoptotic cells leading to autoimmunity.It has been proposed that TG2 acts as an integrin 3 coreceptor in the engulfment process, while altered proinflammatory cytokine production is related to the lack of latent TGF activation by TG2 null macrophages.Here we report that TG2 null macrophages respond to lipopolysaccharide treatment by elevated IL-6 and TNF production.Though TGF has been proposed to act as a feed back regulator of proinflammatory cytokine production in LPS-stimulated macrophages, this phenomenon is not related to the lack of active TGF production.Instead, in the absence of TG2 integrin 3 maintains an elevated basal Src family kinase activity in macrophages, which leads to enhanced phosphorylation and degradation of the I B Low basal levels of I B explain the enhanced sensitivity of TG2 null macrophages to signals that regulate NF-B.Our data suggest that TG2 null macrophages bear a proinflammatory phenotype, which might contribute to the enhanced susceptibility of these mice to develop autoimmunity and atherosclerosis.

Inefficient removal of dying retinal pigment epithelial (RPE) cells by professional phagocytes can result in debris formation and development of age-related macular degeneration (AMD). Chronic oxidative stress and inflammation play an important role in AMD pathogenesis. Only a few well-established in vitro phagocytosis assay models exist. We propose human embryonic stem cell-derived-RPE cells as a new model for studying RPE cell removal by professional phagocytes. The characteristics of human embryonic stem cells-derived RPE (hESC-RPE) are similar to native RPEs based on their gene and protein expression profile, integrity, and barrier properties or regarding drug transport. However, no data exist about RPE death modalities and how efficiently dying hESC-RPEs are taken upby macrophages, and whether this process triggers an inflammatory responses. This study demonstrates hESC-RPEs can be induced to undergo anoikis or autophagy-associated cell death due to extracellular matrix detachment or serum deprivation and hydrogen-peroxide co-treatment, respectively, similar to primary human RPEs. Dying hESC-RPEs are efficiently engulfed by macrophages which results in high amounts of IL-6 and IL-8 cytokine release. These findings suggest that the clearance of anoikic and autophagy-associated dying hESC-RPEs can be used as a new model for investigating AMD pathogenesis or for testing the in vivo potential of these cells in stem cell therapy.

White adipocytes contribute to energy storage, accumulating lipid droplets, whereas brown and beige adipocytes mainly function in dissipating energy as heat primarily via the action of uncoupling protein 1 (UCP1). Bone morphogenic protein 7 (BMP7) was shown to drive brown adipocyte differentiation in murine interscapular adipose tissue. Here, we performed global RNA-sequencing and functional assays on adipocytes obtained from subcutaneous (SC) and deep-neck (DN) depots of human neck and differentiated with or without BMP7. We found that BMP7 did not influence differentiation but upregulated browning markers, including UCP1 mRNA and protein in SC and DN derived adipocytes. BMP7 also enhanced mitochondrial DNA content, levels of oxidative phosphorylation complex subunits, along with PGC1α and p-CREB upregulation, and fragmentation of mitochondria. Furthermore, both UCP1-dependent proton leak and UCP1-independent, creatine-driven substrate cycle coupled thermogenesis were augmented upon BMP7 addition. The gene expression analysis also shed light on the possible role of genes unrelated to thermogenesis thus far, including ACAN, CRYAB, and ID1, which were among the highest upregulated ones by BMP7 treatment in both types of adipocytes. Together, our study shows that BMP7 strongly upregulates thermogenesis in human neck area derived adipocytes, along with genes, which might have a supporting role in energy expenditure.