Luisa Bernardinelli

Using the ImmunoChip custom genotyping array, we analyzed 14,498 subjects with multiple sclerosis and 24,091 healthy controls for 161,311 autosomal variants and identified 135 potentially associated regions (P < 1.0 × 10(-4)). In a replication phase, we combined these data with previous genome-wide association study (GWAS) data from an independent 14,802 subjects with multiple sclerosis and 26,703 healthy controls. In these 80,094 individuals of European ancestry, we identified 48 new susceptibility variants (P < 5.0 × 10(-8)), 3 of which we found after conditioning on previously identified variants. Thus, there are now 110 established multiple sclerosis risk variants at 103 discrete loci outside of the major histocompatibility complex. With high-resolution Bayesian fine mapping, we identified five regions where one variant accounted for more than 50% of the posterior probability of association. This study enhances the catalog of multiple sclerosis risk variants and illustrates the value of fine mapping in the resolution of GWAS signals.

We conducted a genome-wide association study testing single nucleotide polymorphisms (SNPs) and copy number variants (CNVs) for association with early-onset myocardial infarction in 2,967 cases and 3,075 controls. We carried out replication in an independent sample with an effective sample size of up to 19,492. SNPs at nine loci reached genome-wide significance: three are newly identified (21q22 near MRPS6-SLC5A3-KCNE2, 6p24 in PHACTR1 and 2q33 in WDR12) and six replicated prior observations (9p21, 1p13 near CELSR2-PSRC1-SORT1, 10q11 near CXCL12, 1q41 in MIA3, 19p13 near LDLR and 1p32 near PCSK9). We tested 554 common copy number polymorphisms (>1% allele frequency) and none met the pre-specified threshold for replication (P < 10(-3)). We identified 8,065 rare CNVs but did not detect a greater CNV burden in cases compared to controls, in genes compared to the genome as a whole, or at any individual locus. SNPs at nine loci were reproducibly associated with myocardial infarction, but tests of common and rare CNVs failed to identify additional associations with myocardial infarction risk.

We analyzed genetic data of 47,429 multiple sclerosis (MS) and 68,374 control subjects and established a reference map of the genetic architecture of MS that includes 200 autosomal susceptibility variants outside the major histocompatibility complex (MHC), one chromosome X variant, and 32 variants within the extended MHC. We used an ensemble of methods to prioritize 551 putative susceptibility genes that implicate multiple innate and adaptive pathways distributed across the cellular components of the immune system. Using expression profiles from purified human microglia, we observed enrichment for MS genes in these brain-resident immune cells, suggesting that these may have a role in targeting an autoimmune process to the central nervous system, although MS is most likely initially triggered by perturbation of peripheral immune responses.

Jeanette Erdmann and colleagues identify a locus on chromosome 3q22.3 associated with coronary artery disease. The SNP with the strongest association is in MRAS, which encodes a membrane-anchored GTP-binding protein. We present a three-stage analysis of genome-wide SNP data in 1,222 German individuals with myocardial infarction and 1,298 controls, in silico replication in three additional genome-wide datasets of coronary artery disease (CAD) and subsequent replication in ∼25,000 subjects. We identified one new CAD risk locus on 3q22.3 in MRAS (P = 7.44 × 10−13; OR = 1.15, 95% CI = 1.11–1.19), and suggestive association with a locus on 12q24.31 near HNF1A-C12orf43 (P = 4.81 × 10−7; OR = 1.08, 95% CI = 1.05–1.11).

Abstract The analysis of variation of risk for a given disease in space and time is a key issue in descriptive epidemiology. When the data are scarce, maximum likelihood estimates of the area‐specific risk and of its linear time‐trend can be seriously affected by random variation. In this paper, we propose a Bayesian model in which both area‐specific intercept and trend are modelled as random effects and correlation between them is allowed for. This model is an extension of that originally proposed for disease mapping. It is illustrated by the analysis of the cumulative prevalence of insulin dependent diabetes mellitus as observed at the military examination of 18‐year‐old conscripts born in Sardinia during the period 1936–1971. Data concerning the genetic differentiation of the Sardinian population are used to interpret the results.

This paper presents a statistical approach, originally developed for mapping disease risk, to ecological regression analysis in the presence of spatial autocorrelated extra-Poisson variation. An insight into the effect of allowing for spatial autocorrelation on the relationship between disease rates and explanatory variables is given. Examples based on cancer frequency in Scotland and Sardinia are used to illustrate the interpretation of regression coefficient and further methodological issues.

Abstract This paper reviews methods for mapping geographical variation in disease incidence and mortality. Recent results in Bayesian hierarchical modelling of relative risk are discussed. Two approaches to relative risk estimation, along with the related computational procedures, are described and compared. The first is an empirical Bayes approach that uses a technique of penalized log‐likelihood maximization; the second approach is fully Bayesian, and uses an innovative stochastic simulation technique called the Gibbs sampler. We chose to map geographical variation in breast cancer and Hodgkin's disease mortality as observed in all the health care districts of Sardinia, to illustrate relevant problems, methods and techniques.

Abstract In the fully Bayesian (FB) approach to disease mapping the choice of the hyperprior distribution of the dispersion parameter is a key issue. In this context we investigated the sensitivity of the rate ratio estimates to the choice of the hyperprior via a simulation study. We also compared the performance of the FB approach to mapping disease risk to the conventional approach of mapping maximum likelihood (ML) estimates and p ‐values. The study was modelled on the incidence data of insulin dependent diabetes mellitus (IDDM) as observed in the communes of Sardinia.

Endothelial nitric oxide synthase (eNOS) variants were previously demonstrated in cardiovascular disease. To evaluate whether eNOS gene variants are associated with insulin resistance and type 2 diabetes, we evaluated polymorphisms in Exon7 (E298D), intron 18 (IVS18 + 27A-->C), and intron 23 (IVS23 + 10G-->T) in 159 type 2 diabetic patients without macrovascular complications and in 207 healthy control subjects. Samples for all hormonal and metabolic variables were obtained after an overnight fast. The D298 and IVS18 + 27C alleles, but not the IVS23 + 10G-->T variant, were significantly more frequent in type 2 diabetic patients than in control subjects. The two- and three-loci haplotype analysis showed that there is a statistically significant association between the eNOS variants and type 2 diabetes. No significant differences were observed in the clinical characteristics of type 2 diabetic patients according to genotypes (except for visceral obesity [waist-to-hip ratio], which was significantly more present in D298 homozygotes). Healthy control subjects homozygous for both D298 and IVS18 + 27C presented higher insulin, C-peptide, and nitric oxide levels, as well as higher HOMA (homeostasis model assessment) values than the double wild-type homozygotes, with values superimposable on those found in type 2 diabetic patients. In conclusion, we described a significant association between eNOS gene polymorphisms and type 2 diabetes, suggesting a new genetic susceptibility factor for hyperinsulinemia, insulin resistance, and type 2 diabetes.

Multiple sclerosis is a complex neurological disease, with ∼20% of risk heritability attributable to common genetic variants, including >230 identified by genome-wide association studies. Multiple strands of evidence suggest that much of the remaining heritability is also due to additive effects of common variants rather than epistasis between these variants or mutations exclusive to individual families. Here, we show in 68,379 cases and controls that up to 5% of this heritability is explained by low-frequency variation in gene coding sequence. We identify four novel genes driving MS risk independently of common-variant signals, highlighting key pathogenic roles for regulatory T cell homeostasis and regulation, IFNγ biology, and NFκB signaling. As low-frequency variants do not show substantial linkage disequilibrium with other variants, and as coding variants are more interpretable and experimentally tractable than non-coding variation, our discoveries constitute a rich resource for dissecting the pathobiology of MS.

Objective To estimate the prevalence of enuresis in schoolchildren in Italy. Subjects and methods The Italian Club of Nocturnal Enuresis promoted a prevalence study of nocturnal enuresis using a self‐administered questionnaire in seven cities in Northern, Central and Southern Italy. The association between enuresis and potential risk factors, e.g. a family history of enuresis, stress, socio‐economic status and abnormal diurnal voiding habits, was investigated. The perceived impact on the child and on the family was also evaluated. A random‐cluster sampling scheme was used to obtain a sample of primary and secondary schoolchildren from each city. One primary school and one secondary school for each socio‐economic level was sampled in each city, giving a total of 42 schools surveyed; 9086 children were covered by the survey. In a cluster sampling method, the variance of prevalence is divided into two components, binomial and extra‐binomial variability. Both the DSM III and DSM IV definitions of enuresis were used because at present, there is no consensus on the diagnostic criteria. Results Completed questionnaires were received from 7012 children, an overall response rate of 77.2%. Those aged 6–14 years were analysed, restricting the sample to 6892 children. There were 250 enuretic children using the DSM III definition of enuresis and 112 using the DSM IV definition. The overall prevalence was 3.8% and showed a decreasing trend with increasing age. Bedwetting was more frequent in boys than in girls. The prevalence of enuresis was higher when the child was from a family of low socio‐economic status despite the child’s age group. The logistic analysis showed that familiality, stress, birthweight, age of attaining diurnal continence, soiling and, for girls, menstruation, were statistically significant variables and thus contributed to predicting the probability of bedwetting, confirming the findings of previous studies. There was a large difference in prevalence using the two DSM definitions; a high percentage of DSM III enuretic children had more than two wet nights per week. Conclusion It is important that a consensus about the ‘working definitions’ of enuresis is reached to avoid bias in the recruitment step, to carry out comparable epidemiological studies and to obtain adequate therapeutic responses.

Acid-sensing ion channels (ASICs) generate H(+) -gated Na(+) currents that contribute to neuronal function and animal behavior. Like ASIC1, ASIC2 subunits are expressed in the brain and multimerize with ASIC1 to influence acid-evoked currents and facilitate ASIC1 localization to dendritic spines. To better understand how ASIC2 contributes to brain function, we localized the protein and tested the behavioral consequences of ASIC2 gene disruption. For comparison, we also localized ASIC1 and studied ASIC1(-/-) mice. ASIC2 was prominently expressed in areas of high synaptic density, and with a few exceptions, ASIC1 and ASIC2 localization exhibited substantial overlap. Loss of ASIC1 or ASIC2 decreased freezing behavior in contextual and auditory cue fear conditioning assays, in response to predator odor and in response to CO2 inhalation. In addition, loss of ASIC1 or ASIC2 increased activity in a forced swim assay. These data suggest that ASIC2, like ASIC1, plays a key role in determining the defensive response to aversive stimuli. They also raise the question of whether gene variations in both ASIC1 and ASIC2 might affect fear and panic in humans.

The purpose of this study was to test whether the 9p21.3 variant rs1333040 influences the occurrence of new cardiovascular events and coronary atherosclerosis progression after early-onset myocardial infarction.9p21.3 genetic variants are associated with ischemic heart disease, but it is not known whether they influence prognosis after an acute coronary event.Within the Italian Genetic Study of Early-onset Myocardial Infarction, we genotyped rs1333040 in 1,508 patients hospitalized for a first myocardial infarction before the age of 45 years who underwent coronary angiography without index event coronary revascularization. They were followed up for major cardiovascular events and angiographic coronary atherosclerosis progression.Over 16,599 person-years, there were 683 cardiovascular events and 492 primary endpoints: 77 cardiovascular deaths, 223 reoccurrences of myocardial infarction, and 383 coronary artery revascularizations. The rs1333040 genotype had a significant influence (p = 0.01) on the primary endpoint, with an adjusted hazard ratio of 1.19 (95% confidence interval [CI]: 1.08 to 1.37) for heterozygous carriers and 1.41 (95% CI: 1.06 to 1.87) for homozygous carriers. Analysis of the individual components of the primary endpoints provided no significant evidence that the rs1333040 genotype influenced the hazard of cardiovascular death (p = 0.24) or the reoccurrence of myocardial infarction (p = 0.57), but did provide significant evidence that it influenced on the hazard of coronary revascularization, with adjusted heterozygous and homozygous ratios of 1.38 (95% CI: 1.17 to 1.63) and 1.90 (95% CI: 1.36 to 2.65) (p = 0.00015), respectively. It also significantly influenced the angiographic endpoint of coronary atherosclerosis progression (p = 0.002).In early-onset myocardial infarction, the 9p21.3 variant rs1333040 affects the progression of coronary atherosclerosis and the probability of coronary artery revascularization during long-term follow-up.

Abstract: We assembled and analyzed genetic data of 47,351 multiple sclerosis (MS) subjects and 68,284 control subjects and establish a reference map of the genetic architecture of MS that includes 200 autosomal susceptibility variants outside the major histocompatibility complex (MHC), one chromosome X variant, and 32 independent associations within the extended MHC. We used an ensemble of methods to prioritize up to 551 potentially associated MS susceptibility genes, that implicate multiple innate and adaptive pathways distributed across the cellular components of the immune system. Using expression profiles from purified human microglia, we do find enrichment for MS genes in these brain - resident immune cells. Thus, while MS is most likely initially triggered by perturbation of peripheral immune responses the functional responses of microglia and other brain cells are also altered and may have a role in targeting an autoimmune process to the central nervous system. One Sentence Summary: We report a detailed genetic and genomic map of multiple sclerosis, and describe the role of putatively affected genes in the peripheral immune system and brain resident microglia.

Genome-wide association studies (GWAS) have identified more than 50,000 unique associations with common human traits. While this represents a substantial step forward, establishing the biology underlying these associations has proven extremely difficult. Even determining which cell types and which particular gene(s) are relevant continues to be a challenge. Here, we conduct a cell-specific pathway analysis of the latest GWAS in multiple sclerosis (MS), which had analyzed a total of 47,351 cases and 68,284 healthy controls and found more than 200 non-MHC genome-wide associations. Our analysis identifies pan immune cell as well as cell-specific susceptibility genes in T cells, B cells and monocytes. Finally, genotype-level data from 2,370 patients and 412 controls is used to compute intra-individual and cell-specific susceptibility pathways that offer a biological interpretation of the individual genetic risk to MS. This approach could be adopted in any other complex trait for which genome-wide data is available.

Abstract Pressures and responsibilities of medical school put a strain on medical student's personal wellbeing, leading among all to high rates of anxiety, emotional discomfort and stress. In this work we evaluated the effectiveness of a comprehensive Mindfulness-Based Intervention (MBI) in reducing this load. The intervention comprised 10 twice-a-week Integral Meditation classes, dietary advice, and brief yoga sessions. We performed a randomized trial on two cohort of medical students from Italian universities: 239 in cohort 1 (106 treated and 133 controls), and 123 in cohort 2 (68 treated and 55 control) for a total sample of 362 students. Nine questionnaires for evaluating the effectiveness of our intervention on stress (PSS), state anxiety (STAIX-1), well-being (WEMWBS), mind-wandering (MW-S), overall distress (PANAS), emotion regulation (DERS), resilience (RS-14), and attentional control (ACS-C and ACS-D) were collected both pre and post intervention. Linear mixed effect models were run on the whole sample showing that, after multiple testing correction, our intervention was effective in reducing perceived stress (β = − 2.57 [− 4.02; − 1.12], p = 0.004), improving mental well-being (β = 2.82 [1.02; 4.63], p = 0.008) and emotional regulation (β = − 8.24 [− 12.98; − 3.51], p = 0.004), resilience (β = 3.79 [1.32; 6.26], p = 0.008), reducing the tendency to wander with the mind (β = − 0.70 [− 0.99; − 0.39], p = 0.0001), ameliorating the ability to maintain attention (AC-S (β = − 0.23 [− 0.44; − 0.02], p = 0.04) and AC-D (β = − 0.19 [− 0.36; − 0.01], p = 0.04)), and the overall distress (β = 1.84 [0.45; 3.23], p = 0.02).

In this paper we discuss a number of issues that are pertinent to the analysis of disease mapping data. As an illustrative example we consider the mapping of larynx cancer across electoral wards in the North West Thames region of the U.K. Bayesian hierarchical models are now frequently employed to carry out such mapping. In a typical situation, a three-stage hierarchical model is specified in which the data are modelled as a function of area-specific relative risks at stage one; the collection of relative risks across the study region are modelled at stage two; and at stage three prior distributions are assigned to parameters of the stage two distribution. Such models allow area-specific disease relative risks to be 'smoothed' towards global and/or local mean levels across the study region. However, these models contain many structural and functional assumptions at different levels of the hierarchy; we aim to discuss some of these assumptions and illustrate their sensitivity. When relative risks are the endpoint of interest, it is common practice to assume that, for each of the age-sex strata of a particular area, there is a common multiplier (the relative risk) acting upon each of the stratum-specific risks in that area; we will examine this proportionality assumption. We also consider the choices of models and priors at stages two and three of the hierarchy, the effect of outlying areas, and an assessment of the level of smoothing that is being carried out. For inference, we concentrate on the description of the spatial variability in relative risks and on the association between the relative risks of larynx cancer and an area-level measure of socio-economic status.

Contrasting data have been reported on the association between the presence of anti-phospholipid antibodies (aPL) and arterial thrombotic events, particularly those in coronary arteries. This discrepancy is perhaps related to the confounding effect of traditional risk factors. Among them, coronary atherosclerosis appears to be the most important in studies conducted in middle-aged and elderly patients.To minimize such confounding effects, a multicenter case-control study on the association between aPL and myocardial infarction (MI) was carried out in a rare cohort of young premenopausal women.We evaluated 172 cases hospitalized for a first MI before the age of 45 years and 172 controls individually matched with cases for age, sex and geographical origin. Clinical and laboratory data were collected and levels of anti-cardiolipin (aCL), anti-beta2 glycoprotein I (anti-beta2GPI) and anti-nuclear antibodies (ANA) were measured.A significant association between MI and IgG/IgM anti-beta2GPI antibodies was observed; the results were confirmed after adjusting for smoking and hypertension (anti-beta2GPI IgG OR = 2.47, 95% CI 1.81-3.38; anti-beta2GPI IgM 4th quartile OR 3.68, 95% CI 1.69-8.02). The association between anti-beta2GPI antibodies and MI was detected in both subgroups with and without coronary artery stenosis. Whereas the association of aCL IgG with MI was modest, ANA showed no significant association with MI. No aPL were found in unselected patients (mainly males) who recently developed acute MI.Anti-beta2GPI antibodies are a significant risk factor for MI in young premenopausal women independently of other risk factors, including the degree of coronary artery stenosis.

We propose a Bayesian approach to Mendelian randomization (MR), where instruments are allowed to exert pleiotropic (i.e. not mediated by the exposure) effects on the outcome. By having these effects represented in the model by unknown parameters, and by imposing a shrinkage prior distribution that assumes an unspecified subset of the effects to be zero, we obtain a proper posterior distribution for the causal effect of interest. This posterior can be sampled via Markov chain Monte Carlo methods of inference to obtain point and interval estimates. The model priors require a minimal input from the user. We explore the performance of our method by means of a simulation experiment. Our results show that the method is reasonably robust to the presence of directional pleiotropy and moderate correlation between the instruments. One section of the article elaborates the model to deal with two exposures, and illustrates the possibility of using MR to estimate direct and indirect effects in this situation. A main objective of the article is to create a basis for developments in MR that exploit the potential offered by a Bayesian approach to the problem, in relation with the possibility of incorporating external information in the prior, handling multiple sources of uncertainty, and flexibly elaborating the basic model.

The construction of disease maps has been a central problem of descriptive epidemiology throughout its history. There are two main classes of disease maps: maps of standardized rates, and maps of statistical significance of the difference between risk in each area and the overall risk averaged over the entire map. This chapter focuses on the mapping problem with particular attention to smoothing maps of rates computed for small areas. The use of spatial correlation structure along with Bayesian concepts suggests ways of smoothing these maps.

The Sardinian type 1 diabetes register represented the basis to determine the most recent trends and the age distribution of type 1 diabetes incidence among Sardinians <15 years of age during 1989-1999. Part of the data (1989-1998) has been already published by the EURODIAB Group with a lower completeness of ascertainment (87%). The geographical distribution of type 1 diabetes risk was also investigated.The new cases of type 1 diabetes in children aged 0-14 years in Sardinia were prospectively registered from 1989 to 1999 according to the EURODIAB ACE criteria. The completeness of ascertainment calculated applying the capture-recapture method was 91%. Standardized incidence rates and 95% CI were calculated assuming the Poisson distribution. Trend of type 1 diabetes incidence was analyzed using the Poisson regression model. Maps of the geographical distribution of type 1 diabetes risk for the whole time period and separately for 1989-1994 and 1995-1999 were produced applying a Bayesian method.A total of 1214 type 1 diabetic patients were registered yielding to an overall age- and sex-standardized incidence rate of 38.8/100000 (95% CI 36.7-41.1). There was a male excess with an overall male-to-female ratio of 1.4 (1.3-1.8). The increase of incidence during the 11 years analyzed was statistically significant (P = 0.002) with a yearly increasing rate of 2.8% (1.0-4.7). No evidence of an effect of age and sex on this trend has been found. The geographical distribution of type 1 diabetes relative risk (RR) showed that the highest risk areas are located in the southern and central-eastern part of the island and the lowest risk in the northeastern part, even if most of these differences were not statistically significant. This geographical distribution seemed to remain mainly the same between 1989-1994 and 1995-1999.The homogeneity of diabetes risk and the increase of incidence over the age-groups in the Sardinian population stress the role of an environmental factor uniformly distributed among the genetically high-risk Sardinians.

Background Epidemiological studies support the role for a strong genetic component in the occurrence of early-onset myocardial infarction (MI), although the specific genetic variants responsible for familial clustering remain largely unknown. Methods The Italian study of early-onset MI is a nationwide case-control study involving 1864 case patients <45 years old who were hospitalized for a first MI, and age/sex/place of origin-matched controls (n = 1864). We investigated the association between early-onset MI, lipid levels and 20 single nucleotide polymorphisms (SNPs) in the candidate genes ADIPOQ, APOA5, ALOX5AP, CYBA, IL6, LPL, PECAM1, PLA2G2A and PLA2G7, chosen because of previously reported associations with Coronary Heart Disease (CHD) or with CHD risk factors. Results Of all the SNPs investigated, APOA5-1131T>C [(rs662799), minor allele frequency 0.084 (95% confidence interval (CI) 0.07–0.09)] alone showed a statistically significant association with risk of early-onset MI (p = 6.7 × 10−5), after Bonferroni correction, with a per C allele odds ratio of 1.44 (95% CI 1.23–1.69). In controls, APOA5-1131T>C was significantly associated with raised plasma triglyceride levels (p = 0.001), compared with non-carriers, the per C allele increase being 11.4% (95% CI 4–19%), equivalent to 0.15 mmol/L (95% CI 0.11–0.20 mmol/L). In cases, the association with early MI risk remained statistically significant after adjustment for triglycerides (p = 0.006). Conclusions The APOA5-1131C allele, associated with higher fasting triglyceride levels, strongly affects the risk for early-onset MI, even after adjusting for triglycerides. This raises the possibility that APOA5-1131T>C may affect the risk of early MI over and above effects mediated by triglycerides.

Sleep of inadequate quantity and quality is increasing in the present 24 h society, with a negative impact on physical and mental health. Mindfulness-based interventions (MBIs) generate a state of calm behavior that can reduce hyperactivity and improve sleep. We hypothesized that our specific MBI, administered online, may improve sleep quality and foster emotion regulation and mindfulness. The Pittsburgh Sleep Quality Index (PSQI), Sleep Condition Indicator (SCI), Arousal Predisposition Scale (APS), Ford Insomnia Response to Stress Test (FIRST), Sleep Hygiene Index (SHI) and Insomnia Severity Index (ISI) were used to measure sleep quality and stability. Emotion regulation and mindfulness were measured via the Emotion Regulation Questionnaire (ERQ) and Five Facet Mindfulness Questionnaire (FFMQ). Our MBI included 12 biweekly integral meditation (IM) classes, recorded IM training for individual practice, and dietary advice to promote sleep regulation. Fifty-six voluntary poor sleepers with a PSQI score of >5 were randomly allocated to treated (n = 28) and control (n = 28) groups. Linear mixed models were used to estimate the effectiveness of the intervention. Statistically significant results were observed in the FFMQ sub-domain non-reactivity to inner experience (β = 0.29 [0.06; -0.52], p = 0.01), PSQI (β = -1.93 [-3.43; -0.43], p = 0.01), SCI (β = 3.39 [0.66; 6.13], p = 0.02) and ISI (β = -3.50 [-5.86; -1.14], p = 0.004). These results confirm our hypothesis regarding the beneficial effects of our intervention on sleep quality.

Genome-wide association studies (GWASs) perform per-SNP association tests to identify variants involved in disease or trait susceptibility. However, such an approach is not powerful enough to unravel genes that are not individually contributing to the disease/trait, but that may have a role in interaction with other genes as a group. Pathway analysis is an alternative way to highlight such group of genes. Using SNP association P-values from eight multiple sclerosis (MS) GWAS data sets, we performed a candidate pathway analysis for MS susceptibility by considering genes interacting in the cell adhesion molecule (CAMs) biological pathway using Cytoscape software. This network is a strong candidate, as it is involved in the crossing of the blood-brain barrier by the T cells, an early event in MS pathophysiology, and is used as an efficient therapeutic target. We drew up a list of 76 genes belonging to the CAM network. We highlighted 64 networks enriched with CAM genes with low P-values. Filtering by a percentage of CAM genes up to 50% and rejecting enriched signals mainly driven by transcription factors, we highlighted five networks associated with MS susceptibility. One of them, constituted of ITGAL, ICAM1 and ICAM3 genes, could be of interest to develop novel therapeutic targets.

An increased incidence of imprint-associated disorders has been reported in babies born from assisted reproductive technology (ART). However, previous studies supporting an association between ART and an altered DNA methylation status of the conceived babies have been often conducted on a limited number of methylation sites and without correction for critical potential confounders. Moreover, all the previous studies focused on the identification of methylation changes shared among subjects while an evaluation of stochastic differences has never been conducted. This study aims to evaluate the effect of ART and other common behavioral or environmental factors associated with pregnancy on stochastic epigenetic variability using a multivariate approach.DNA methylation levels of cord blood from 23 in vitro and 41 naturally conceived children were analyzed using the Infinium HumanMethylation450 BeadChips. After multiple testing correction, no statistically significant difference emerged in the number of cord blood stochastic epigenetic variations or in the methylation levels between in vitro- and in vivo-conceived babies. Conversely, four multiple factor analysis dimensions summarizing common phenotypic, behavioral, or environmental factors (cord blood cell composition, pre or post conception supplementation of folates, birth percentiles, gestational age, cesarean section, pre-gestational mother's weight, parents' BMI and obesity status, presence of adverse pregnancy outcomes, mother's smoking status, and season of birth) were significantly associated with stochastic epigenetic variability. The stochastic epigenetic variation analysis allowed the identification of a rare imprinting defect in the locus GNAS in one of the babies belonging to the control population, which would not have emerged using a classical case-control association analysis.We confirmed the effect of several common behavioral or environmental factors on the epigenome of newborns and described for the first time an epigenetic effect related to season of birth. Children born after ART did not appear to have an increased risk of genome-wide changes in DNA methylation either at specific loci or randomly scattered throughout the genome. The inability to identify differences between cases and controls suggests that the number of stochastic epigenetic variations potentially induced by ART was not greater than that naturally produced in response to maternal behavior or other common environmental factors.

Polycystic Ovary Syndrome (PCOS) is the most frequent endocrine disease in females of reproductive age and is characterized by multifactorial unhealthy conditions related to hormonal unbalance and also to dysmetabolism and inflammation. Recently, increasing evidence has shown that natural plant-based products may play a role in PCOS management. The aim of this one-group pretest-post-test explanatory study was to evaluate, in normal-overweight PCOS women with normal menses, the effectiveness of berberine on: Insulin resistance (IR) by Homeostasis Model Assessment (HOMA); Inflammation by C-Reactive Protein (CRP), Tumor Necrosis Factor α (TNF-α); Lipid metabolism; Sex hormone profile and symptoms correlated to hyperandrogenism, such as acne, by Global Acne Grading System (GAGS) and Cardiff Acne Disability Index (CADI); Body composition by DXA. Finally, adverse effects were assessed by liver and kidney functions and creatine phosphokinase (CPK). All these parameters were collected at baseline and 60 days after supplementation with a new bioavailable and safe berberine formulation. Twelve females (aged 26.6 ± 4.9, BMI 25.3 ± 3.6) were supplied for 60 days with two tablets/day (550 mg/table) of the bioavailable berberine. Results showed a statistically significant decrease in HOMA, CRP, TNF-α, Triglycerides, testosterone, Body Mass Index (BMI), Visceral Adipose Tissue (VAT), fat mass, GAGS and CADI scores, and a statistically significant increase in sex hormone-binding globulin (SHBG). Liver and kidney functions and CPK are not statistically significantly different. Therefore, berberine can represent a safe novel dietary supplement, helpful in treatment strategy for PCOS.

Multiple genome screens have been performed to identify regions in linkage or association with Multiple Sclerosis (MS, OMIM 126200), but little overlap has been found among them. This may be, in part, due to a low statistical power to detect small genetic effects and to genetic heterogeneity within and among the studied populations. Motivated by these considerations, we studied a very special population, namely that of Nuoro, Sardinia, Italy. This is an isolated, old, and genetically homogeneous population with high prevalence of MS. Our study sample includes both nuclear families and unrelated cases and controls. A multi-stage study design was adopted. In the first stage, microsatellites were typed in the 17q11.2 region, previously independently found to be in linkage with MS. One significant association was found at microsatellite D17S798. Next, a bioinformatic screening of the region surrounding this marker highlighted an interesting candidate MS susceptibility gene: the Amiloride-sensitive Cation Channel Neuronal 1 (ACCN1) gene. In the second stage of the study, we resequenced the exons and the 3' untranslated (UTR) region of ACCN1, and investigated the MS association of Single Nucleotide Polymorphisms (SNPs) identified in that region. For this purpose, we developed a method of analysis where complete, phase-solved, posterior-weighted haplotype assignments are imputed for each study individual from incomplete, multi-locus, genotyping data. The imputed assignments provide an input to a number of proposed procedures for testing association at a microsatellite level or of a sequence of SNPs. These include a Mantel-Haenszel type test based on expected frequencies of pseudocase/pseudocontrol haplotypes, as well as permutation based tests, including a combination of permutation and weighted logistic regression analysis. Application of these methods allowed us to find a significant association between MS and the SNP rs28936 located in the 3' UTR segment of ACCN1 with p = 0.0004 (p = 0.002, after adjusting for multiple testing). This result is in tune with several recent experimental findings which suggest that ACCN1 may play an important role in the pathogenesis of MS.

We performed a citation analysis of the literature about mindfulness aimed at describing the most significant topics and the impact of more relevant papers.We classified 128 systematic reviews about mindfulness-based intervention retrieved in Scopus according to their object, the population included and the type of mindfulness proposed. The citation counting was reported. The cumulative citation numbers per chronological years and article life were analyzed thorough a linear regression model.1) We observed a general increase in the number of reviews published from 2003 to 2016; 2) two reviews collected the 33% of the overall citations; 3) citation counting for clinical and mixed population collected the 90% of total citations; 4) clinical reviews had higher cumulative citation per publication/year growth.As mindfulness research advances, higher attention should be given to the mechanisms by which mindfulness interventions work so as to provide fruitful insights for future research.

A recent study by Wang et al. (2016a) claims that the low-frequency variant NR1H3 p.Arg415Gln is sufficient to cause multiple sclerosis in certain individuals and determines a patient's likelihood of primary progressive disease. We sought to replicate this finding in the International MS Genetics Consortium (IMSGC) patient collection, which is 13-fold larger than the collection of Wang et al. (2016a), but we find no evidence that this variant is associated with either MS or disease subtype. Wang et al. (2016a) also report a common variant association in the region, which we show captures the association the IMSGC reported in 2013. Therefore, we conclude that the reported low-frequency association is a false positive, likely generated by insufficient sample size. The claim of NR1H3 mutations describing a Mendelian form of MS-of which no examples exist-can therefore not be substantiated by data. This Matters Arising paper is in response to Wang et al. (2016a), published in Neuron. See also the related Matters Arising paper by Minikel and MacArthur (2016) and the response by Wang et al. (2016b), published in this issue.

<h2>Abstract</h2> This meta-analysis aimed to offer a general picture of the available data on the effects of early-life factors on the risk of developing endometriosis in adult life. An advanced, systematic search of the online medical databases PubMed, EMBASE and CINAHL was limited to full-length manuscripts published in English in peer-reviewed journals up to February 2019. Log of relative risk (RR) was employed to calculate the pooled effect sizes using both fixed and random effects modelling and <i>I</i>-squared tests to assess heterogeneity. Funnel plots were used to investigation publication bias. The meta-analysis was registered in PROSPERO (ID CRD42019138668). Six studies that included a total of 2360 women affected by endometriosis were analysed. The pooled results showed that the risk of developing endometriosis in adult life was significantly increased by being born prematurely (logRR 0.21, 95% CI –0.03 to 0.40), having a low birthweight (logRR 0.35, 95% CI –0.15 to 0.54), being formula-fed (logRR 0.65, 95% CI –0.35 to 0.95) and having been exposed to diethylstilbestrol (DES) <i>in utero</i> (logRR 0.65, 95% CI 0.26 to 1.04. Among intrauterine and early neonatal exposures, prematurity, birthweight, formula feeding and DES were risk factors for the development of endometriosis in adult life.

Impaired fasting glucose (IFG) is a condition that precedes diabetes and increases the risk of developing it. Studies support the hypoglycemic effect of Cynarascolymus (Cs) extracts due to the content of chlorogenic acid, which is a potent inhibitor of glucose 6-phosphate translocase and of dicaffeoylquinic acid derivatives that modulate the activity of alpha-glucosidase. Given this background, we investigated whether a new highly standardized Cs extract could improve glycemic control, insulin sensitivity and other metabolic parameters (total cholesterol (TC), low-density lipoprotein-cholesterol (LDL-C), high-density lipoprotein-cholesterol (HDL-C) Triglycerides, Apolipo protein B (ApoB), Apolipo protein A (ApoA), waist circumference, visceral adipose tissue (VAT) by dual-energy X-ray absorptiometry (DXA) in overweight subjects with newly diagnosed IFG. Fifty-four subjects (females/males 26/28, mean ± SD age 51.5 ± 6.2) were randomly assigned to the supplemented group (n = 27) and placebo (n = 27). After multiple testing correction, statistically significant interactions between time and group were observed for the primary endpoint glycemia (β = 0.36, p &lt; 0.0001) and for the secondary endpoints HDL (β = −0.10, p &lt; 0.0001), total cholesterol/HDL (β = 0.27, p &lt; 0.0001), LDL (β = 0.15, p = 0.005), LDL/HDL (β = 0.23, p = 0.001), insulin (β = 1.28, p = 0.04), glycated hemoglobin (β = 0.21, p = 0.0002), A1c-derived average glucose (β = 0.34, p = 0.0002), ApoB (β = 6.00, p = 0.01), ApoA (β = −4.50, p = 0.04), ApoB/ApoA (β = 0.08, p = 0.003), waist circumference (β = 1.89, p = 0.05), VATβ = 222.37, p = 0.005). In conclusion, these results confirm that Cs supplementation has a significant effect on metabolic parameters in IFG patients.

Abstract Mendelian randomization (MR) is a powerful approach for assessing the causal effect of putative risk factors on an outcome, using genetic variants as instrumental variables. The methodology and application developed in the framework of MR have been dramatically improved, taking advantage of the many public genome‐wide association study (GWAS) data. The availability of summary‐level data allowed to perform numerous MR studies especially for complex diseases, pinpointing modifiable exposures causally related to increased or decreased disease risk. Multiple sclerosis (MS) is a complex multifactorial disease whose aetiology involves both genetic and non‐genetic risk factors and their interplay. Previous observational studies have revealed associations between candidate modifiable exposures and MS risk; although being prone to confounding, and reverse causation, these studies were unable to draw causal conclusions. MR analysis addresses the limitations of observational studies and allows to establish reliable and accurate causal conclusions. Here, we systematically reviewed the studies evaluating the causal effect, through MR, of genetic and non‐genetic exposures on MS risk. Among 107 papers found, only 42 were eligible for final evaluation and qualitative synthesis. We found that, above all, low vitamin D levels and high adult body mass index (BMI) appear to be uncontested risk factors for increased MS risk.

Analysis of the geographical variation of risk for a disease is a key issue in descriptive epidemiology and may provide useful suggestions for planning further studies to identify the underlying causes. We adopted a Bayesian approach to investigate the geographical distribution of insulin-dependent diabetes mellitus (IDDM) incidence rate across Sardinia. Data on incidence of IDDM in children aged under 15 years (619 IDDM cases) in Sardinia was obtained by the Sardinian Eurodiab ACE register. The overall completeness of ascertainment was: 91.3%. The average yearly standardized incidence rate for the years 1989-1994 was 33.24 per 100000 (95% C.I. 30.60, 35.88), which is the second highest in Europe after Finland. Sex and age-specific risks were higher in males than in females. Considering the variation of IDDM risk according to the age at diagnosis, the risk profile increased up to the 13th year of age for both sexes, being steeper in males. The degree of geographical variation in IDDM risk was small with a slight difference between the highest and the lowest standardized rate across the map. Indeed, even the municipalities at lowest risk in Sardinia showed a risk higher than most European countries. The Sardinian population is genetically atypical, characterized by genetic homogeneity and marked susceptibility to autoimmune diseases. Our finding of a small geographical variation within the island coupled with a marked temporal trend previously observed in data on military conscripts could be interpreted as evidence of a relatively recent environmental aetiological factor that was uniformly distributed across the island and had its effect in a genetically predisposed population.

Summary. Women who develop acute myocardial infarction (AMI) at a young age have fewer classical risk factors and less coronary stenosis than older women. In this rare population, it is plausible that a heightened hemostatic system may play an important mechanistic role in thrombus formation and in the development of AMI. We chose to investigate whether or not there is an association between premature AMI and the plasma concentrations of five hemostatic measurements that had been previously established as risk factors for AMI, and of the inflammation marker C-reactive protein (CRP). Women who had survived AMI at the age of 45 years or less (n = 141) were drawn from those admitted to 125 Italian coronary care units over a 3-year period. In them, and in an equal number of controls, plasma levels of immunoreactive tissue plasminogen activator (tPA), plasminogen activation inhibitor 1 (PAI-1), von Willebrand factor (VWF), fibrinogen, D-dimer and CRP were measured. Higher levels of VWF, fibrinogen, CRP and tPA were associated with AMI. After adjustment for both classical and hemostatic risk factors, only tPA maintained an independent association with AMI: the odds ratios (taken as an index of relative risk) for tPA values in the middle and higher tertiles were 2.86 (CI 1.63–5.02) and 8.18 (CI 2.66–25.20), respectively. In conclusion, there is a strong association between non-fatal AMI and increased plasma levels of tPA antigen. This finding is thought to be the expression of a reduced rather than enhanced fibrinolytic activity.

The diagnosis of Marfan spectrum includes a large number of clinical criteria. Although the identification of pathogenic variants contributes to the diagnostic process, its value to the prediction of clinical outcomes is still limited. An important novelty of the present study is represented by the statistical approach adopted to investigate genotype-phenotype correlation. The analysis has been improved considering the extended genetic information obtained by Next Generation Sequencing (NGS) and combining the effects of both rare and common genetic variants in an inclusive model. To this aim a cohort of 181 patients were analyzed with a NGS panel including 11 genes associated with Marfan spectrum. The genotype-phenotype correlation was also investigated considering the possibility to predict presence of a pathological mutation in Marfan syndrome (MFS) main genes based only on the analysis of phenotypic traits. Results obtained indicate that information about clinical traits can be summarized in a new variable that resulted significantly associated with the probability to find a pathological mutation in MFS main genes. This is important since the choice of the genetic test is often influenced by the phenotypic characterization of patients. Moreover, both rare and common variants were found to significantly contribute to clinical spectrum and their combination allowed to increase the percentage of phenotype variability that could be explained based on genetic factors. Results highlight the opportunity to take advantage of the overall genetic information obtained by NGS data to have a better clinical classification of patients.

To evaluate the efficacy of a new food-grade lecithin formulation of standardized extracts of Zingiber officinale and Acmella oleracea on pain and inflammation.Pilot study with one-group pretest-posttest quasi-experimental design in which 50 subjects with moderate knee osteoarthritis (OA) (mean age: 62.46±8.45) were supplied for four weeks with two tablets/day.Primary outcomes were 1) the evaluation of pain intensity, by a 30-day visual analogue scale (VAS) and 2) the assessment of knee function by WOMAC (Western Ontario and McMaster Universities Arthritis) Index and by Tegner Lysholm Knee Scoring collected at baseline, at 15 and 30 days after treatment. Secondary outcomes were 3) health-related quality of life, by the ShortForm36 (SF-36); 4) inflammation grade by C-reactive protein (CRP) and erythrocyte sedimentation rate (ESR); and 5) body composition by dual-energy X-ray absorptiometry (DXA) measured at baseline and 30 days after treatment. Data showed significant effects of supplement intake for WOMAC (β=-3.27, p<0.0001), Lysholm (β=1.06, p=0.0003), CRP (β=-0.13, p=0.006), ESR (β=-3.09, p=0.004), physical activity (β=4.3, p=0.009) and fat-free mass (β=376.7, p=0.046). A significant VAS's decrease over time was observed in both knees (left: β=-0.08, p<0.0001; right: β=-0.07, p<0.0001).The tested formulation seems to be effective and also free of side effects.

Bloating is a symptom frequently reported by subjects with irritable bowel syndrome (IBS) and small bowel dysbiosis, and Low FODMAP’s diet (LFD) has been used to treat them. Extracts of Curcumalonga and Boswelliaserrata share anti-inflammatory and antimicrobial effects that could be useful in the management of these clinical conditions. The aim of this study was to evaluate the efficacy of curcumin and boswellia extracts (as Curcumin Boswellia Phytosome, CBP) and LFD on the relief of abdominal bloating in IBS subjects with small bowel dysbiosis, in comparison to LFD alone, in a 30-day supplementation, randomized trial. IBS participants were randomized to either the intervention (500 mg bid of CBP and LFD) or control arm (LFD). Small bowel dysbiosis has been defined by an increase of urinary indican with normal urinary skatole. A total of 67 subjects were recruited. The intervention group (33 subjects) showed a significant decrease (p < 0.0001) of bloating, abdominal pain, and indican values at the end of the study, when compared to the control group (34 subjects). Moreover, the subjects of the intervention group showed a significantly better (p < 0.0001) global assessment of efficacy (GAE) as compared to controls. In conclusion, in subjects with IBS and small bowel dysbiosis, abdominal bloating can be successfully reduced with a supplementation with CBP and LFD.

Association and linkage studies have established the importance of the major histocompatibility complex (MHC) in the susceptibility for multiple sclerosis (MS). We carried out a case-control study to investigate the ancestral haplotype A30B18DR3 and MS in the Nuoro population of Sardinia, which is isolated and genetically distinct from other populations in the Mediterranean basin and characterized by genetic homogeneity, high level of inbreeding, low migration, high prevalence of MS, high frequency of the relevant haplotype, and high past malaria prevalence. Cases and controls were serologically typed for the currently recognized HLA-A, B, and DR antigens. We used a log-linear approach to fit a wide class of models. We tested our hypothesis comparing different models via a likelihood ratio test. We overcame the complication due to unknown gametic phase using expectation-maximization (EM) algorithm as the estimation method. We estimated confidence intervals for odds ratio by using a profile likelihood approach. We found that: (1) the ancestral haplotype A30B18DR3 was associated to MS after allowing for a possible stratification in cases and controls; (2) DR3 allele was conditional independent on disease status, given A30B18 haplotype; (3) there was a tendency for ORs for the high-risk haplotypes to be higher in the high malaria strata; however, this indication did not achieve statistical significance (P = 0.11).

The geographical analysis of a disease risk is particularly difficult when the disease is non-frequent and the area units are small. The practical use of the Bayesian modelling, instead of the classical frequentist one, is applied to study the geographical variation of multiple sclerosis (MS) across the province of Pavia, Northern Italy. 464 MS-affected individuals resident in the province of Pavia were identified on December 31st 2000. The overall prevalence was 94 per 100,000 inhabitants. This estimate indicates an increasing MS prevalence in the province, in accordance with the vast majority of the Italian areas where prevalence studies have been repeated. We mapped the geographical variation of MS prevalence across the 190 communes of the province both with a classical approach and a Bayesian approach. The frequentist approach produced an extremely dishomogeneous map, while the Bayesian map was much smoother and more interpretable. Our study underlines the usefulness of Bayesian methods to obtain reliable maps of disease prevalence and to identify possible clusters of disease where to carry out further epidemiological investigations.

Background Conflicting information exists about whether sex differences affect long-term outcomes in patients undergoing primary percutaneous coronary intervention (PCI). Methods This retrospective study enrolled consecutive patients with ST-elevation myocardial infarction undergoing primary PCI within 24 hours from symptom onset. Hazard ratios (HRs) of events with 95% confidence interval (CI) were calculated in the overall population and in a propensity score matched cohort of women and men. Results Among 481 patients, median age 66 years old, 138 (28.7%) were women. Women were older than men (72 vs 63 years, P < 0.001), had a higher prevalence of hypertension (68% vs 54%, P = 0.006), diabetes (27% vs 19%, P = 0.04), and Killip class ≥ 3 at admission (19% vs 10%, P = 0.007). After a median follow-up of 1041 days women experienced a significant higher incidence of the composite of death, nonfatal myocardial infarction, and hospitalization for heart failure (31.9% vs 18.4%, unadjusted HR 1.86; 95% CI, 1.26-2.74; P = 0.002), driven mainly by heart failure (unadjusted HR 2.47; 95% CI, 1.12-5.41; P = 0.024), without significant differences in death (unadjusted HR 1.49; 95% CI, 0.88-2.53; P = 0.13), or nonfatal myocardial infarction (unadjusted HR 1.59; 95% CI, 0.78-3.27; P = 0.19) and no increase in target lesion revascularization (9.4% vs 12.5%, unadjusted HR 0.77; 95% CI, 0.42-1.44; P = 0.42). After propensity score matching the hazard of the composite endpoint was largely attenuated (HR 1.32; 95% CI, 0.84-2.06; P = 0.23). Conclusions Women undergoing primary PCI experience worse long-term outcomes than men, but this difference is largely explained by their more adverse baseline cardiovascular profile.

Abstract Acid‐sensing ion channels ( ASIC s) are proton‐gated channels involved in multiple biological functions such as: pain modulation, mechanosensation, neurotransmission, and neurodegeneration. Earlier, we described the genetic association, within the Nuoro population, between Multiple Sclerosis ( MS ) and rs28936, located in ASIC 2 3′ UTR . Here we investigated the potential involvement of ASIC 2 in MS inflammatory process. We induced experimental autoimmune encephalomyelitis ( EAE ) in wild‐type ( WT ), knockout Asic1 −/− and Asic2 −/− mice and observed a significant reduction of clinical score in Asic1 −/− mice and a significant reduction in the clinical score in Asic2 −/− mice in a limited time window (i.e., at days 20–23 after immunization). Immunohistochemistry confirmed the reduction in adaptive immune cell infiltrates in the spinal cord of EAE Asic1 −/− mice. Analysis of mechanical allodynia, showed a significant higher pain threshold in Asic2 −/− mice under physiological conditions, before immunization, as compared to WT mice and Asic1 −/− . A significant reduction in pain threshold was observed in all three strains of mice after immunization. More importantly, analysis of human autoptic brain tissue in MS and control samples showed an increase of ASIC 2 mRNA in MS samples. Subsequently, in vitro luciferase reporter gene assays, showed that ASIC 2 expression is under possible mi RNA regulation, in a rs28936 allele‐specific manner. Taken together, these findings suggest a potential role of ASIC 2 in the pathophysiology of MS .

Bergamot has been traditionally used for the relief of diseases related to oxidative stress. Our aim was to investigate the effect of bergamot phytosome on visceral adipose tissue (VAT) and on metabolic profile, in overweight and obese subjects with mild hypercholesterolemia. A total of 64 participants were randomized into two groups for 12 weeks: a supplemented group (33 individuals, BMI 27 ± 3 kg/m 2 receiving 500 mg of bergamot phytosome, two daily tablets) and placebo group (31 subjects, BMI 28 ± 3 kg/m 2 , two daily tablets). As to the within differences, the parameters of VAT, total and LDL‐cholesterol were significantly decreased in the bergamot phytosome group, but not in the placebo group. As to between‐group differences, a statistically significant interaction between time and group, that is, the change in score over time differs between the two groups was observed 30 days after supplementation for VAT ( p ‐value = .005), total cholesterol ( p ‐value &lt;.0002), and LDL ( p = .004) in respect to placebo. The other parameters (glucose, insulin, Homeostasis Model Assessment, high‐density lipoprotein cholesterol, triglycerides, fat free mass, fat mass) were not significant. In conclusion, this clinical study gives evidence that bergamot phytosome provides beneficial effects, such as decrease of VAT and modulation of metabolic alterations, after just 30 days of supplementation, resulting a very promising protection of cardiovascular health.

Objectives Being able to predict which patients with COVID-19 are going to deteriorate is important to help identify patients for clinical and research practice. Clinical prediction models play a critical role in this process, but current models are of limited value because they are typically restricted to baseline predictors and do not always use contemporary statistical methods. We sought to explore the benefits of incorporating dynamic changes in routinely measured biomarkers, non-linear effects and applying ‘state-of-the-art’ statistical methods in the development of a prognostic model to predict death in hospitalised patients with COVID-19. Design The data were analysed from admissions with COVID-19 to three hospital sites. Exploratory data analysis included a graphical approach to partial correlations. Dynamic biomarkers were considered up to 5 days following admission rather than depending solely on baseline or single time-point data. Marked departures from linear effects of covariates were identified by employing smoothing splines within a generalised additive modelling framework. Setting 3 secondary and tertiary level centres in Greater Manchester, the UK. Participants 392 hospitalised patients with a diagnosis of COVID-19. Results 392 patients with a COVID-19 diagnosis were identified. Area under the receiver operating characteristic curve increased from 0.73 using admission data alone to 0.75 when also considering results of baseline blood samples and to 0.83 when considering dynamic values of routinely collected markers. There was clear non-linearity in the association of age with patient outcome. Conclusions This study shows that clinical prediction models to predict death in hospitalised patients with COVID-19 can be improved by taking into account both non-linear effects in covariates such as age and dynamic changes in values of biomarkers.

Modifiable risk factors for Parkinson's disease (PD) are poorly known.The aim is to evaluate independent associations of different nutritional components, physical activity, and sedentary behavior and metabolic factors with the risk of PD.In this population-based prospective cohort study using the data of the United Kingdom Biobank (from 2006-2010), 502,017 men and women who were free from PD (International Classification of Diseases 10th edition; "G20") at baseline were included. We implemented a Cox proportion hazard's model to evaluate the associations of different levels of physical activity, sitting time, sleep habits, diet quality, alcohol and coffee consumption, smoking, and body mass index with PD risk, adjusting for several confounding variables.During a median follow-up of 12.8 years, lifestyle factors including vigorous physical activity (hazard ration [HR] = 0.84; 95% confidence interval [CI], 0.75-0.94), low-to-moderate sitting time (HR = 0.89; 95% CI, 0.81-0.97), and high sleep quality (HR = 0.89; 95% CI, 0.80-0.99) were associated with a reduced risk of PD. Small amounts of coffee (HR = 0.88; 95% CI, 0.82-0.95), red meat (HR = 0.86; 95% CI, 0.76-0.97), and current smoking (HR = 0.65; 95% CI, 0.56-0.75) were also associated with a lower risk of PD, whereas alcohol intake (HR = 1.29; 95% CI, 1.06-1.56) with higher PD risk. Secondary analysis, including metabolic risk factors, confirmed these findings and highlighted the potential protective effect of plasma vitamin D and uric acid, but of low-density lipoprotein-cholesterol, triglycerides, and C-reactive protein as well.Vigorous physical activity, reduced sitting time, good sleep quality together with small coffee intake and vitamin D supplementation are potentially neuroprotective lifestyle interventions for the prevention of PD. © 2024 International Parkinson and Movement Disorder Society.

Temporary anchorage devices (TADs) have been introduced into orthodontic clinical practice in order to allow tooth movements while avoiding strain on adjacent teeth. Miniscrews are available in the market with different diameters and materials. Accordingly, the purpose of the present report was to measure and compare the forces to bend and fracture different mini implants. Ti-6Al-4V titanium and stainless steel TADs of different manufacturers (Spider ScrewHDC; Mini Implants&ndash;Leone; Benefit&ndash;Orteam; Storm&ndash;Kristal) were evaluated. Two different diameters (1.5 mm and 2.0 mm) were tested. The sample included 10 unused specimens for each group, blocked in an Instron Universal Testing Machine, and a shear load was applied at the neck of the miniscrew. The force to bend the miniscrew was measured at 0.1 mm and 0.2 mm deflections. Also, the maximum force before screw fracture was recorded. Data were submitted for statistical analysis. Results showed significantly higher forces for 2.0 mm than 1.5 mm screws, both at 0.1 mm and 0.2 mm deflections and at maximum load. Moreover, no significant differences were reported between titanium and stainless steel miniscrews of equal diameters.

Multiple Sclerosis (MS) exhibits considerable heterogeneity in phenotypic expression, course, prognosis and response to therapy. This suggests this disease involves multiple, as yet poorly understood, causal mechanisms. In this work we assessed the possible causal link between gene expression level of five selected genes related to the pro-inflammatory NF-κB signaling pathway (i.e., CCL2, NFKB1, MAPK14, TNFRSF1A, CXCL10) in ten different brain tissues (i.e., cerebellum, frontal cortex, hippocampus, medulla, occipital cortex, putamen, substantia nigra, thalamus, temporal cortex and intralobular white matter) and MS. We adopted a two-stage Mendelian Randomization (MR) approach for the estimation of the causal effects of interest, based on summary-level data from 20 multiplex Sardinian families and data provided by the United Kingdom Brain Expression Consortium (UKBEC). Through Radial-MR and Cochrane's Q statistics we identified and removed genetic variants which are most likely to be invalid instruments. To estimate the total causal effect, univariable MR was carried out separately for each gene and brain region. We used Inverse-Variance Weighted estimator (IVW) as main analysis and MR-Egger Regression estimator (MR-ER) and Weighted Median Estimator (WME) as sensitivity analysis. As these genes belong to the same pathway and thus they can be closely related, we also estimated their direct causal effects by applying IVW and MR-ER within a multivariable MR (MVMR) approach using set of genetic instruments specific and common (composite) to each multiple exposures represented by the expression of the candidate genes. Univariate MR analysis showed a significant positive total causal effect for CCL2 and NFKB1 respectively in medulla and cerebellum. MVMR showed a direct positive causal effect for NFKB1 and TNFRSF1A, and a direct negative causal effect for CCL2 in cerebellum; while in medulla we observed a direct positive causal effect for CCL2. Since in general we observed a different magnitude for the gene specific causal effect we hypothesize that in cerebellum and medulla the effect of each gene expression is direct but also mediated by the others. These results confirm the importance of the involvement of NF-κB signaling pathway in brain tissue for the development of the disease and improve our understanding in the pathogenesis of MS.

Preterm birth (PTB) can be defined as the endpoint of a complex process that could be influenced by maternal and environmental factors. Epigenetics recently emerged as an interesting field of investigation since it represents an important mechanism of regulation. This study evaluates epigenetic impact of preterm birth on DNA methylation. Genome-wide DNAm was measured using the Illumina 450K array in cord blood samples obtained from 72 full term and 18 preterm newborns. Lymphocyte composition was calculated based on specific epigenetic markers that are present on the 450k array. Differential methylation analysis was performed both at site and region level; moreover, stochastic epigenetic mutations (SEMs) were also evaluated. The study showed significant differences in blood cell composition between the two groups. Moreover, after multiple testing correction, statistically significant differences in DNA methylation levels emerged between the two groups both at site and region levels. Results obtained were compared to those reported by previous EWAS, leading to a list of more consistent genes associated with PTB. Finally, the SEMs analysis revealed that the burden of SEMs resulted significantly higher in the preterm group. In conclusion, PTB resulted associated to specific epigenetic signatures that involve immune system. Moreover, SEMs analysis revealed an increased epigenetic drift at birth in the preterm group.

Mindfulness-based interventions (MBIs) are known for their beneficial effects on positive and negative psychological factors. When applied in an occupational context, MBIs might help workers to cope with stress, increase their professional outcomes and wellbeing.In this two-groups pre-post experimental design we tested the effect of our MBI, called Integral Meditation (IM), among the employers of an Italian service company by measuring positive and negative aspects of psychological wellbeing related to mindfulness and workplace functioning through eight self-report questionnaires (CORE-OM, FFMQ, WEMWBS, MAIA, PSS, PANAS, STAI-X1, SCS).Forty-two voluntary non-clinical employers of the company, randomly assigned to the experimental or the control group, were analyzed. The experimental group underwent our IM program, which consists of 12 weekly meditation classes given after the afternoon shift, while the control group did not receive any intervention. Data was analyzed via linear mixed models.Statistically significant results were obtained for FFMQ observing subscale (β= 0.49, p = 0.014), WEMWBS (β= 5.31, p = 0.02), PSS (β= -3.31, p = 0.03), the whole scale of SCS (β= 0.47, p = 0.01) and self-judgment (β= 0.68, p = 0.003) and isolation (β= -0.66, p = 0.01) SCS subscales. Statistically significant results were also found in four out of eight subscales of MAIA: emotional awareness (β= 1.26, p < 0.001), self-regulation (β= 1.28, p < 0.001), body listening (β= 1.08, p < 0.001) and trusting (β= 1.1, p < 0.001).Our intervention has demonstrated to bring beneficial effects in a mindfulness subdomain, in perceived stress, self-compassion, interoception and psychological wellbeing. Based on our results, we conclude that our intervention was effective in increasing the positive aspects of wellbeing and in reducing stress.

To limit the first spread of COVID-19 in March 2020, the Italian government imposed strict lockdown measures to the population. Despite necessary to reduce the virus transmission and the burden to the hospitals, social isolation has caused detrimental effects on psychological wellbeing and mental health. Moreover, during this period, it was also difficult to deliver psychological treatments and psychiatric assistance. A short (a weekly session for 9 weeks) mindfulness-based meditation program, named Integral Meditation (IM), was administered entirely online to healthy adults from Italy. This is a two-groups pre–post-quasi-experimental study in which the two groups, treated and control, were not randomized. Through matching procedures aimed at overcoming the absence of randomization, we analyzed a sample of 84 subjects (42 for each group). By applying linear mixed effect models, we tested the hypothesis of a beneficial effect of IM on wellbeing, perceived stress, and state anxiety, as measured by three self-reported questionnaires (WEMWBS, PSS, and STAI-X1, respectively), assuming that this effect could be different according to the level of baseline trait anxiety, as measured by STAI-X2. The results showed a statistically significant effect of STAI-X1 (β = −8.24 [95%CI −15.39; −1.09], p = 0.02) and WEMWBS (β = 4.61 [95%CI 0.94; 8.29], p = 0.01) in the higher trait anxiety subgroup only. No statistically significant effect of IM was observed for PSS. These results suggest that our IM, delivered online, may increase mental wellbeing and decrease anxiety specifically in subjects with higher trait anxiety.

We carried out an ecological study in the most archaic area of Sardinia to obtain a reliable estimate of the prevalence of multiple sclerosis (MS) and to investigate the geographical variation in the prevalence across the 100 administrative communes. To estimate the area-specific prevalence rate, we adopted a Bayesian approach that makes it possible to filter out the random variation from the estimates and to obtain a map that reflects the true geographical variation in MS prevalence. 428 resident cases were identified by the case register, including 69 multiplex families. The overall prevalence was 157 per 100,000 inhabitants. The Bayesian area-specific prevalence ranged from 143 to 262/100,000. The high prevalence and its moderate geographical variation in a genetically homogeneous population, as well as the high number of multiplex families observed in the communes with the highest prevalence, could be interpreted as representing a high susceptibility of the population to MS.

Background An inherited predisposition is an important factor in the etiology of myocardial infarction (MI) at a young age. However, the extent of the risk for early-onset MI in relatives of young patients is still unclear, due to the paucity of family history data. Hence familial aggregation of early-onset MI was investigated in a cohort of relatives of Italian patients who had survived MI who occurred at the age of 45 or earlier. Methods In the framework of a case–control study, lifetime data and early-onset MI status for 11,696 relatives of cases and 8897 relatives of controls were collected using a standardized questionnaire. Results Occurrence of early-onset MI in females was very uncommon (Kaplan–Meier risk=0.6%, 95% confidence interval (CI): 0.38–0.82%, for female case relatives), and significantly lower than that for male case relatives (5.0%, 95% CI: 4.41–5.56%). The hazard ratio (HR) for case relatives was approximately 3-fold greater than that for control aunts (taken as reference category). Risk for early-onset MI to siblings (HR=1.7, 95% CI: 1.33–2.18) was significantly different from that to parents (HR=0.9, 95% CI: 0.71–1.16). The familial risk ratio λR was 2.6 (95% CI: 2.30–2.89) for case relatives, using control parents as reference population for early-onset MI risk estimates (i.e. 37 per 100,000 in fathers and 7 per 100,000 in mothers). Conclusion We evaluated the risk of early-onset MI by category of relatives, obtaining evidence for familial aggregation of the disease in this Italian sample and providing figures for genetic counselling and planning genetic epidemiological studies.

Background: A wealth of single-nucleotide polymorphisms (SNPs) responsible for multiple sclerosis (MS) susceptibility have been identified; however, they explain only a fraction of MS heritability. Objectives: We contributed to discovery of new MS susceptibility SNPs by studying a founder population with high MS prevalence. Methods: We analyzed ImmunoChip data from 15 multiplex families and 94 unrelated controls from the Nuoro Province, Sardinia, Italy. We tested each SNP for both association and linkage with MS, the linkage being explored in terms of identity-by-descent (IBD) sharing excess and using gene dropping to compute a corresponding empirical p-value. By targeting regions that are both associated and in linkage with MS, we increase chances of identifying interesting genomic regions. Results: We identified 486 MS-associated ( p &lt; 1 × 10 –4 ) and 18,426 MS-linked ( p &lt; 0.05) SNPs. A total of 111 loci were both linked and associated with MS, 18 of them pointing to 14 non-major histocompatibility complex (MHC) genes, and 93 of them located in the MHC region. Conclusion: We discovered new suggestive signals and confirmed some previously identified ones. We believe this to represent a significant step toward an understanding of the genetic basis of MS.

Abstract Acute and transient psychotic disorders (ATPDs) include short-lived psychotic episodes with a high probability of developing psychotic recurrences. Clinical care for ATPD is currently limited by the inability to predict outcomes. Real-world electronic health record (EHR)-based retrospective cohort study STROBE/RECORD compliant included all individuals accessing the South London and Maudsley NHS Trust between 2006 and 2017 and receiving a first diagnosis of ATPD (F23, ICD-10). After imputing missing data, stepwise and LASSO Cox regression methods employing a priori predictors (n = 23) were compared to develop and internally validate an individualized risk prediction model to forecast the risk of psychotic recurrences following TRIPOD guidelines. The primary outcome was prognostic accuracy (area under the curve [AUC]). 3018 ATPD individuals were included (average age = 33.75 years, 52.7% females). Over follow-up (average 1042 ± 1011 days, up to 8 years) there were 1160 psychotic recurrences (events). Stepwise (n = 12 predictors) and LASSO (n = 17 predictors) regression methods yielded comparable prognostic accuracy, with an events per variable ratio &amp;gt;100 for both models. Both models showed an internally validated adequate prognostic accuracy from 4 years follow-up (AUC 0.70 for both models) and good calibration. A refined model was adapted in view of the new ICD-11 criteria on 307 subjects with polymorphic ATPD, showing fair prognostic accuracy at 4 years (AUC: stepwise 0.68; LASSO 0.70). This study presents the first clinically based prediction model internally validated to adequately predict long-term psychotic recurrence in individuals with ATPD. The model can be automatable in EHRs, supporting further external validations and refinements to improve its prognostic accuracy.

Studies of twins, adoptees, half siblings, and familial recurrence risk have shown that genetic and non-genetic factors are involved in multiple sclerosis (MS) etiology. Age at onset, gender, and parental MS status seem to influence sibling risk. We studied the recurrence risk in siblings of MS patients in an isolated population of Sardinia, Italy, which is genetically homogeneous, inbred, and very stable, with a high MS frequency. The Aalen-Nelson estimate of the recurrence risk in siblings is 4.7%, and the risk ratio compared with the general population is 31. Proportional hazards models were used to investigate the effect of sibling sex, sex, and age at onset of the proband, and number of affected relatives on a sibling's predicted MS risk. Sib's risk is influenced by age at onset (P = 0.02), and possibly by sex of the proband (P = 0.08). There is also a borderline significant interaction (P = 0.05) between the sex and age at onset of the proband: early age at onset influences sib's risk only if the proband is female. The number of affected relatives in the family is not found to influence sibling risk, but the power is lacking (95% CI 0.50-2.62). This result is consistent with a single dominant gene with an extremely low penetrance, a model that has not yet been disproved as a possible inheritance model for MS.

The purpose of the study was to describe the mortality experience of an Italian cohort of rubber workers and an attempt was made to identify any occupational cancer hazards that might currently be affecting men employed in this type of work. A total of 4917 male workers who first started working in a large rubber factory between 1962 and 1972 have been followed up until 31 January 1983. The number of deaths from all causes and from malignant neoplasms was determined and compared with the expected number of deaths calculated from mortality rates for the province in which the population of the plant lived. Mortality from all causes was 85% of that expected. A slight overall excess of deaths from cancer (SMR = 119) was found; this was entirely due to the excess mortality in the 35-44 age group. In order further to evaluate the possible existence of a cancer risk SMRs were analysed by duration of exposure, time since first exposure, and for specific sites of cancer. A trend in SMR with duration of exposure was found for employees with 10 years of follow up or more. A high risk for some tumour sites emerged.

Dental hygienists are often faced with patients wearing lingual orthodontic therapy, as ultrasonic instrumentation (UI) is crucial for oral health. As the application of external forces can lead to premature bonding failure, the aim of this study was to evaluate the effect of UI on shear bond strength (SBS) and on adhesive remnant index (ARI) of different lingual orthodontic brackets. 200 bovine incisors were divided into 10 groups. Four different lingual (STB, Ormco; TTR, Rocky Mountain Orthodontics; Idea, Leone; 2D, Forestadent) and vestibular control (Victory, 3M) brackets were bonded. UI was performed in half of specimens, whereas the other half did not receive any treatment. All groups were tested with a universal testing machine. SBS and ARI values were recorded. Statistical analysis was performed (significance: <mml:math xmlns:mml="http://www.w3.org/1998/Math/MathML" id="M1"><mml:mi>P</mml:mi><mml:mo>=</mml:mo><mml:mn fontstyle="italic">0.05</mml:mn></mml:math>). TTR, Idea, and 2D lingual brackets significantly lowered SBS after UI, whereas for other braces no effect was recorded. Appliances with lower mesh area significantly reduced their adhesion capacity after UI. Moreover groups subjected to UI showed higher ARI scores than controls. UI lowered SBS of lingual appliances of small dimensions so particular care should be posed avoiding prolonged instrumentation around bracket base during plaque removal. Moreover, UI influenced also ARI scores.

The practice of meditation has been historically linked to beneficial effects, not only in terms of spirituality but also in terms of well-being, general improvement of psychophysiological conditions and quality of life. The present study aims to assess the beneficial effects of a short-term intervention (a combination of 12 practical 1-h sessions of meditation, called Integral Meditation, and lectures on neuroscience of meditation) on psychological indicators of well-being in subjects from the general population. We used a one-group pretest-posttest quasi-experimental design, in which all participants (n = 41, 17 men and 24 women, with a mean age of 41.1 years) underwent the same intervention. Out of these, 24 had already experienced meditation practice, but only 12 in a continuative way. Effects were assessed by the standardized Italian version of three self-report questionnaires: Core Outcome in Routine Evaluation-Outcome Measure (CORE-OM), Five-Facet Mindfulness Questionnaire (FFMQ), and Emotion Regulation Questionnaire (ERQ). The questionnaires were filled in at baseline and immediately after the last meditation session. Linear mixed effect models were used to evaluate pre-post treatment changes on each outcome. Participants showed a general, close to a statistically significant threshold, improvement in the total score of CORE-OM and its different domains. The total score of FFMQ (β = 0.154, p = 0.012) indicates a statistically significant increase in the level of mindfulness as well as in the domains acting with awareness (β = 0.212, p = 0.024), and non-judging of inner experiences (β = 0.384, p < 0.0001). Lastly, we observed a statistically significant improvement in the cognitive reappraisal ERQ domain (β = 0.541, p = 0.0003). Despite some limitations (i.e., small sample size, lack of a randomised control group and sole use of "soft" measurements, such as self-report questionnaires), this study offers promising results regarding the within-subject effectiveness of our intervention that includes a meditation practice on psychological indicators, thus providing interesting preliminary results.

The benefits of mindfulness meditation among clinical and non-clinical populations have been largely reported in literature. Existing mindfulness-based programs are particularly useful in targeting specific populations while researchers have pointed out the possibility of developing programs adapted to the audience and the context. In this two-groups pre-post experimental design we developed a mindfulness-based social intervention program to target individuals from the general population. Here we present a two-groups pre-post experimental design to investigate its effectiveness on participants’ psychological functioning assessed by eight self-reported questionnaires (CORE-OM, FFMQ, SWLS, PANAS, PSS, SCS, WEMWBS, SHS) which encompass different domains of well-being, mindfulness and emotional functioning. Participants, recruited on voluntary basis, were randomly allocated to treated or passive control groups and were aware of group allocation. The intervention comprises a 12-week meditation training in a big group that represents the social aspect of meditation. Data were analysed via a linear mixed effect model and intention to treat. Statistically significant results were obtained for global score of CORE-OM (β = −0.20 [−0.30; −0.10], p = 0.0002), FFMQ (β = 0.20 [0.12; −0.28], p &lt; 0.0001), SWLS (β = 1.43 [0.42; 2.45], p = 0.006), positive PANAS (β = 1.99 [0.95; 3.04], p = 0.0002), negative PANAS (β = −1.67 [−2.92; −0.43], p = 0.009), PSS (β = −2.98 [−4.25; −1.71], p &lt; 0.0001), WEMWBS (β = 4.38 [2.93; 5.83], p &lt; 0.0001) and SHS (β = 1.43 [0.42; 2.45], p = 0.006). Our intervention is causally associated with an improvement of the psychological functioning and hence can be considered as a preventive measure that may potentially reduce the risk of developing psychological problems and improve the subject’s general well-being. Given the voluntary recruitment, our inference only applies to those individuals who have decided to experience meditation as a way to well-being and not to a random person from the general population.

Multiple Sclerosis (MS) is a complex multifactorial autoimmune disease, whose sex- and age-adjusted prevalence in Sardinia (Italy) is among the highest worldwide. To date, 233 loci were associated with MS and almost 20% of risk heritability is attributable to common genetic variants, but many low-frequency and rare variants remain to be discovered. Here, we aimed to contribute to the understanding of the genetic basis of MS by investigating potentially functional rare variants. To this end, we analyzed thirteen multiplex Sardinian families with Immunochip genotyping data. For five families, Whole Exome Sequencing (WES) data were also available. Firstly, we performed a non-parametric Homozygosity Haplotype analysis for identifying the Region from Common Ancestor (RCA). Then, on these potential disease-linked RCA, we searched for the presence of rare variants shared by the affected individuals by analyzing WES data. We found: (i) a variant (43181034 T > G) in the splicing region on exon 27 of CUL9; (ii) a variant (50245517 A > C) in the splicing region on exon 16 of ATP9A; (iii) a non-synonymous variant (43223539 A > C), on exon 9 of TTBK1; (iv) a non-synonymous variant (42976917 A > C) on exon 9 of PPP2R5D; and v) a variant (109859349-109859354) in 3'UTR of MYO16.

Errors in genotyping can greatly affect family-based association studies. If a mendelian inconsistency is detected, the family is usually removed from the analysis. This reduces power, and may introduce bias. In addition, a large proportion of genotyping errors remain undetected, and these also reduce power. We present a Bayesian framework for performing association studies with SNP data on samples of trios consisting of parents with an affected offspring, while allowing for the presence of both detectable and undetectable genotyping errors. This framework also allows for the inclusion of missing genotypes. Associations between the SNP and disease were modelled in terms of the genotypic relative risks. The performances of the analysis methods were investigated under a variety of models for disease association and genotype error, looking at both power to detect association and precision of genotypic relative risk estimates. As expected, power to detect association decreased as genotyping error probability increased. Importantly, however, analyses allowing for genotyping error had similar power to standard analyses when applied to data without genotyping error. Furthermore, allowing for genotyping error yielded relative risk estimates that were approximately unbiased, together with 95% credible intervals giving approximately correct coverage. The methods were also applied to a real dataset: a sample of schizophrenia cases and their parents genotyped at SNPs in the dysbindin gene. The analysis methods presented here require no prior information on the genotyping error probabilities, and may be fitted in WinBUGS.

The human leukocyte antigen (HLA) complex on chromosome 6p21 has been unambiguously associated with multiple sclerosis (MS). The complex features of the HLA region, especially its high genic content, extreme polymorphism, and extensive linkage disequilibrium, has prevented to resolve the nature of HLA association in MS. We performed a family based association study on the isolated population of the Nuoro province (Sardinia) to clarify the role of HLA genes in MS. The main stage of our study involved an analysis of the ancestral haplotypes A2Cw7B58DR2DQ1 and A30Cw5B18DR3DQ2. On the basis of a multiplicative model, the effect of the first haplotype is protective with an odds ratio (OR) = 0.27 (95% confidence interval CI 0.13-0.57), while that of the second is deleterious, OR 1.78 (95% CI 1.26-2.50). We found both class I (A, Cw, B) and class II (DR, DQ) loci to have an effect on MS susceptibility, but we saw that they act independently from each other. We also performed an exploratory analysis on a set of 796 SNPs in the same HLA region. Our study supports the claim that Class I and Class II loci act independently on MS susceptibility and this has a biological explanation. Also, the analysis of SNPs suggests that there are other HLA genes involved in MS, but replication is needed. This opens up new perspective on the study of MS.

We examined the role of ultraviolet radiation (UVR) in persons diagnosed with multiple sclerosis (MS) in four different populations, Italians, Danish, White and African Americans. We tested whether variation in UVR as determined by seasons (short term variation) and solar cycles (long term variation) is related to MS birth month and to survival as measured by lifespan. Cases were selected from three Italian MS Case Registries (2,737); from the United States National Center for Health Statistics (56,020); and from the Danish Multiple Sclerosis registry (15,900). Chi-square tests were used to study the pattern of month of birth distribution in patients with MS comparing with general population data. T-tests were employed to study solar cycles association with lifespan. A surplus of births was observed in June for White Americans. A decrease of births in October and November, though not significant after multiple testing correction, was observed in the three populations. In White American with MS overall, males and females, we found that solar cycle is associated with lifespan. We found that season and solar cycles have some role in MS susceptibility and life duration. However, this is an exploratory analysis and further work is needed to discern the association.

Magnetic resonance imaging (MRI) is a widely used diagnostic technique. Patients wearing orthodontic appliances are often requested to remove their appliances, even when the MRI exam involves anatomical areas far from mouth, in order to avoid heating of the metal and detachment of the appliance. The purpose of the present investigation was to measure and compare temperature changes and orthodontic appliances’ adhesion to enamel after different MRIs. A total of 220 orthodontic brackets were bonded on bovine incisors and wires with different materials (stainless steel and nickel titanium). Moreover, various sizes (0.014″ and 0.019″ × 0.025″) were engaged. Appliances were submitted to MRI at two different powers (1.5 T and 3 T). The temperatures of brackets and wires were measured before and after MRI. Subsequently, the shear bond strength (SBS) and adhesive remnant index (ARI) scores were recorded. Statistical analysis was performed. After MRI, a significant increase in the temperature was found for both the brackets and wires in some groups, even if the mean temperature increase was clinically insignificant, as the temperature ranged between 0.05 °C and 2.4 °C for brackets and between 0.42 °C and 1.74 °C for wires. The MRI did not condition bracket adhesion in any group. No differences were reported when comparing the 1.5 T with 3 T groups. The ARI Scores were also significantly lower after MRI. The results of the present report show that, under MRI, orthodontic appliances present a low temperature rise and no debonding risk. Therefore, the removal of orthodontic appliance is not recommended routinely, but is suggested only in the case of a void risk or potential interference in image quality.

Individuals who deviate from social norms by committing crimes may have reduced facial emotion recognition abilities. Nevertheless, a specific category of offenders – i.e. organised crime (OC) members – is characterised by hierarchically organised social networks and a tendency to manipulate others to reach their illicit goals. Since recognising emotions is crucial to building social networks, OC members may be more skilled in recognising the facial emotion expressions of others to use this information for their criminal purposes. Evidence of a difference between OC and non-organised crime (NOC) offenders in terms of facial emotion recognition is still lacking. To fill this gap in the literature, we tested 50 OC, 50 NOC offenders, and 50 non-offender controls for their ability to identify six basic emotions (happiness, sadness, fear, anger, disgust, and surprise). All participants underwent a cognitive and psychological evaluation to avoid alternative explanations. Results show that OC members were more able to detect the expression of fear in others as compared to NOC. We interpreted this finding in light of the social context and the behavioural criminal attitude of OC members.

Berberine is a plant alkaloid known to exert positive metabolic effects. Human studies have confirmed its ability to improve the lipid and glycemic profile. This study aimed to evaluate the potential benefit of oral supplementation of Berberine PhytosomeTM (2 tablets/day, 550 mg/tablet) on the metabolic profile of subjects with impaired fasting blood glucose (IFG).A total of 49 overweight subjects, 28 females and 21 males, were randomly assigned to either the supplemented group (n=24) or placebo (n=25). We considered glycemia as the primary endpoint and total cholesterol, high-density lipoprotein (HDL), total cholesterol/HLD, low-density lipoprotein (LDL), LDL/HDL, triglycerides, insulin, glycated hemoglobin, Homeostasis Model Assessment (HOMA), ApoA, ApoB, ApoB/ApoA, androgen suppression treatment (AST), alternative lengthening of telomeres (ALT), gamma-glutamyl transferase (GGT), creatinine, and body composition by dual-energy X-ray absorptiometry (DXA) as secondary endpoints. These parameters have been assessed at baseline, after 30 days, and after 60 days.After two months of treatment, through the use of linear mixed effect models, a statistically significant difference between supplemented and placebo groups was observed for glycemia [β=-0.2495% C.I. (-0.47; -0.06), p=0.004], total cholesterol [β=-0.25, 95% C.I. (-0.45; -0.04), p=0.05], total cholesterol/HDL [β=-0.25, 95% C.I. (-0.43; -0.06), p=0.04], triglycerides [β=-0.14, 95% C.I. (-0.25; -0.02), p=0.05], insulin [β=-1.78, 95% C.I. (-2.87; -0.66), p=0.009], ApoB/ApoA [β=-0.08, 95% C.I. (-0.13; -03), p=0.004], Visceral adipose tissue (VAT) [β=-91.50, 95% C.I. (-132.60; -48.19), p<0.0001] and fat mass [β=-945.56, 95% C.I. (-1,424.42; -441.57), p=0.004].The use of berberine had no adverse events, supporting its use as a natural alternative to pharmacological therapies in the case of IFG.

Multiple sclerosis (MS) is a chronic, inflammatory, disabling disease of the central nervous system, known for its complex interplay between genetic and environmental factors. We used life table techniques to calculate age-adjusted recurrence risks for different categories of relatives of MS patients from Central Sardinia (Italy), a genetically homogeneous, stable population with a high degree of consanguinity. We included 313 probands and a total of 12,717 relatives in the analysis. The overall age-adjusted recurrence risk for relatives of MS probands is 1.90% [95% confidence interval (CI): 1.57-2.30]. The age-adjusted recurrence risk in parents was 1.26% (95% CI 0.60-2.63), in children 2.33% (95% CI 0.09-5.56), in sibs 4.76% (95% CI 3.57-6.32), in second-degree relatives 0.72% (95% CI 0.42-1.22), and in third-degree relatives 1.79% (95% CI 1.27-2.51). The sex of the probands (male) and of the relatives (female), and the number of affected relatives in the family significantly increase the risk of MS in relatives.

In genetic association studies, a single marker is often associated with multiple, correlated phenotypes (e.g., obesity and cardiovascular disease, or nicotine dependence and lung cancer). A pervasive question is then whether that marker exerts independent effects on all phenotypes. In this paper, we address this question by assessing whether there is a genetic effect on one phenotype that is not mediated through the other ones, so called direct genetic effect. Answering such question may represent an important step in the elucidation of the underlying biological mechanism. Under rather restrictive conditions, such direct genetic effects are known to be estimable by standard regression methods. Under more lenient conditions, in a prospective or unmatched case‐control study, these effects can be estimated by using a previously proposed G ‐estimation method (Vansteelandt [2009] Epidemiology 20, 851–860). The present paper extends this method to matched case‐control studies, and investigates the conditions under which this extension is valid. We illustrate the method on data from a matched case‐control study, which we use to elucidate the pathway implications of a detected association between myocardial infarction and a genetic locus in the chromosomal region of the FTO gene.

The list of genomic loci associated with multiple sclerosis (MS) susceptibility outside the major histocompatibility complex (MHC) in patients of Northern European (NE) ancestry has increased to 103. Despite the extraordinarily high MS prevalence in the isolated Sardinian population, the contribution of genetic risk factors to MS in Sardinia is largely not understood.The objective of this paper is to examine the relevance of non-MHC MS susceptibility variants in Sardinia.We examined a log-additive MS-specific genetic burden score (MSGB) using 110 NE-derived risk alleles in a dataset of 75 Sardinian cases, 346 Sardinian controls and 177 cases and 1967 controls from the United States (US).Sardinian cases demonstrate a heavier non-MHC MSGB load than Sardinian controls and US cases (p = 2E-06, p = 1E-06, respectively). Furthermore, Sardinian controls carry a heavier burden than US controls (p = 2E-14). Our results confirm the limited ability of the 110-SNP MSGB to predict disease status in Sardinia (AUROC = 0.629).Risk alleles discovered in samples of NE ancestry are relevant to MS in Sardinia. Our results suggest a general enrichment of MS susceptibility alleles in Sardinians, encouraging the pursuit of further studies of MS in this population.

For this study we consulted the Bone Marrow Donors' Registry of Lombardy (Italy) and analyzed 43937 HLA‐A,B phenotypes and 13922 HLA‐A,B,DR phenotypes. We estimated the HLA‐A,B and HLA‐A,B,DR haplotype frequencies via the maximum‐likelihood method. We analyzed the genetic structure of the 11 provinces of Lombardy by means of Principal Component Analysis and Correspondence Analysis, and estimated the variety of the different haplotypes at provincial level and the percentage of unique phenotypes at village level. We found 11189 different HLA‐A,B phenotypes, 661 different HLA‐A,B haplotypes and more than 4000 different HLA‐A,B,DR haplotypes. We identified 20 villages, in Western Lombardy, very rich in unique/rare phenotypes. Here we report a formula which allows the identification of a putative donor matched for two haplotypes with a recipient. This result may be of great importance for the genetic study of the population of Lombardy and, even more, for bone marrow transplantation programs.

(Cell 175, 1679–1687.e1–e7; November 29, 2018) It has come to our attention that in preparing the final version of this article, the authors inadvertently misspelled the last name of author Charlotte E. Teunissen as “Charlotte E. Theunissen.” This error has been corrected in the article online. In the Editorial Note (Cell 178, 262, June 27, 2019), the editors refer to the original version of the published manuscript. That version contained a misspelled name, and as that has now been corrected, we are updating the Editorial Note as well. Low-Frequency and Rare-Coding Variation Contributes to Multiple Sclerosis RiskMitrovič et al.CellJune 27, 2019In Brief(Cell 175, 1679–1687.e1–e7; November 29, 2018) Full-Text PDF Open AccessLow-Frequency and Rare-Coding Variation Contributes to Multiple Sclerosis RiskMitrovič et al.CellOctober 18, 2018In BriefIn a large multi-cohort study, unexplained heritability for multiple sclerosis is detected in low-frequency coding variants that are missed by GWAS analyses, further underscoring the role of immune genes in MS pathology. Full-Text PDF Open Access

Here we investigate protein levels in 69 multiple sclerosis (MS) cases and 143 healthy controls (HC) from twenty Sardinian families to search for promising biomarkers in plasma. Using antibody suspension bead array technology, the plasma levels of 56 MS-related proteins were obtained. Differences between MS cases and HC were estimated using Linear Mixed Models or Linear Quantile Mixed Models. The proportion of proteins level variability, explained by a set of 119 MS-risk SNPs as to the literature, was also quantified. Higher plasma C9 and CYP24A1 levels were found in MS cases compared to HC (p < 0.05 after Holm multiple testing correction), with protein level differences estimated as, respectively, 0.53 (95% CI: 0.25, 0.81) and 0.42 (95% CI: 0.19, 0.65) times plasma level standard deviation measured in HC. Furthermore, C9 resulted in both statistically significantly higher relapsing-remitting MS (RRMS) and secondary-progressive MS (SPMS) compared to HC, with SPMS showing the highest differences. Instead, CYP24A1 was statistically significantly higher only in RRMS as compared to HC. Respectively, 26% (95% CI: 10%, 44%) and 16% (95% CI: 9%, 39%) of CYP24A1 and C9 plasma level variability was explained by known MS-risk SNPs. Our results highlight C9 and CYP24A1 as potential biomarkers in plasma for MS and allow us to gain insight into molecular disease mechanisms.

Menopause is characterized by weight gain and increased visceral fat, which acts as an endocrine organ secreting proinflammatory adipocytokines, with consequent increased risk of metabolic disorders. The aim of this double-blind, placebo-controlled randomized trial was to evaluate the effects of a 60-day dietary supplementation using Camellia sinensis leaf extract on adipose tissue dysfunction in overweight or class I obese post-menopausal, sedentary women. Primary endpoints were the respiratory quotient (RQ), the percentage of carbohydrates (%CHO), the percentage of fat oxidation (%FAT), and the resting energy expenditure (REE) measured by indirect calorimetry. Secondary endpoints included body composition, by dual x-ray absorptiometry (DXA), glucose profile, lipid profile, inflammatory state, liver and kidney function, hormonal status regarding satiety, and status of catecholamines. Twenty-eight women were randomized into two groups: 14 (BMI 31.1 ± 3.5) were supplemented and 14 (BMI 31.9 ± 2.2) received placebo. In regards to the between-group differences over time (β), a statistically significant difference between the supplemented and placebo group was observed for: RQ (β = −0.04, p = 0.009), % fat oxidation (β = 11.04, p = 0.0006), insulin (β = −1.74, p = 0.009), HOMA (β = −0.31, p = 0.02), waist circumference (β = −1.07, p = 0.007), REE (β = 83.21, p = 0.009), and CRP (β = −0.14, p = 0.02). These results demonstrate that a 60-day green tea extract supplementation counteracts the dysfunction of adipose tissue in overweight post-menopausal and class I obese women.

Background: A previous analysis of the Sardinian Conscript Type 1 Diabetes Registry indicated an abrupt increase in the risk for type 1 diabetes (T1D) among Sardinian male cohorts starting from the 1946 one. Objective: The aim of this study was to update the point prevalence of T1D among Sardinian male army conscripts aged 18 yr from 1992 to 1997 described in the previous survey and to update its secular trend. It also looked at the geographical distribution of prevalence. Subjects and methods: All male Italian citizens must appear before the Conscript Board for a clinical examination prior to military service. T1D patients are rejected with T1D listed as the reason. We examined, retrospectively, a total of 83 807 Sardinian males aged 18, born between 1 January 1974 and 31 December 1979. They virtually represent the whole Sardinian population of that age and sex. Results: A total of 307 subjects with T1D were identified. T1D point prevalence for the birth cohorts 1974–1979 was 3.66/1000 (95% CI 3.28–4.09). Bayesian analysis of the geographical distribution of prevalence shows the highest rate in the Southern part of the island (Cagliari province) and the lowest in the north-western part (Sassari province). A similar picture was produced by data from the Eurodiab Registry in Sardinia (1989 ongoing). No significant temporal trend of prevalence was seen in the 6 yr examined in the current study; pooling these recent birth cohorts with the previous ones, the increasing trend of prevalence was confirmed. Conclusions: Our data confirmed the South to North gradient of T1D and the progressive increase of T1D risk among males in Sardinia.

(Cell 175, 1679–1687.e1–e7; November 29, 2018) We the editors of Cell have been informed by the Lead Contact and corresponding author of this paper, Dr. Chris Cotsapas, that further analyses following the publication of the paper have indicated that two variants (rs61999302 encoding PRKRA.D33G and rs62176112 encoding PRKRA.P11L) reported in this paper to be associated with MS risk were in fact spurious associations due to the presence of a dispersed duplication event, in which this region of chromosome 2 is duplicated in the MHC region of chromosome 6. The potential for this dispersed duplication to lead to spurious associations has been previously documented (Wellcome Trust Case Control Consortium et al., 2010Craddock N. Hurles M.E. Cardin N. Pearson R.D. Plagnol V. Robson S. Vukcevic D. Barnes C. Conrad D.F. Giannoulatou E. et al.Wellcome Trust Case Control ConsortiumGenome-wide association study of CNVs in 16,000 cases of eight common diseases and 3,000 shared controls.Nature. 2010; 464: 713-720Google Scholar). Upon learning of the potential problems associated with signals in this region, the authors used the data reported in this paper to impute classical HLA alleles and amino acid variants using SNP2HLA (Jia et al., 2013Jia X. Han B. Onengut-Gumuscu S. Chen W.M. Concannon P.J. Rich S.S. Raychaudhuri S. de Bakker P.I.W. Imputing amino acid polymorphisms in human leukocyte antigens.PLoS ONE. 2013; 8: e64683Google Scholar) and found that the two reported variants in PRKRA showed extensive linkage disequilibrium with genotyped and imputed HLA variants, including known MS risk alleles. Conditioning on any of these known variants was sufficient to explain the reported association, leading to the conclusion that these two signals are driven by the duplication and are not true associations of the reported variants with MS risk. With this note, we and the authors would like to alert readers to this issue. The remaining findings in the paper are unchanged, as are the main conclusions of the paper. The authors would also like to thank Dr. Matthew Hurles (Wellcome Sanger Institute) for bringing this issue to their attention. Furthermore, in the printed version of the experimental model and subject details section of the STAR methods, Köln is listed as one of the patient recruitment centers, but Düsseldorf should have been listed instead. One of the authors, Dr. Clemens Warnke, although currently based in Köln, in fact contributed patient samples collected in Düsseldorf to the study. This has been corrected in the article online, and the authors apologize for any confusion these issues may have caused. Low-Frequency and Rare-Coding Variation Contributes to Multiple Sclerosis RiskMitrovič et al.CellOctober 18, 2018In BriefIn a large multi-cohort study, unexplained heritability for multiple sclerosis is detected in low-frequency coding variants that are missed by GWAS analyses, further underscoring the role of immune genes in MS pathology. Full-Text PDF Open AccessLow-Frequency and Rare-Coding Variation Contributes to Multiple Sclerosis RiskMitrovič et al.CellJanuary 23, 2020In Brief(Cell 175, 1679–1687.e1–e7; November 29, 2018) Full-Text PDF Open Access

The effect of renin-angiotensin system inhibitors (RASIs) on mortality in patients with coronavirus disease (Covid-19) is debated. From a cohort of 1352 consecutive patients admitted with Covid-19 to Papa Giovanni XXIII Hospital in Bergamo, Italy, between February and April 2020, we selected and studied hypertensive patients to assess whether antecedent (prior to hospitalization) use of RASIs might affect mortality from Covid-19 according to age.Arterial hypertension was present in 688 patients. Overall mortality (in-hospital or shortly after discharge) was 35% (N = 240). After adjusting for 26 medical history variables via propensity score matching, antecedent use of RASIs (N = 459, 67%) was associated with a lower mortality in older hypertensive patients (age above the median of 68 years in the whole series), whereas no evidence of a significant effect was found in the younger group of the same population (P interaction = 0.001). In an analysis of the subgroup of 432 hypertensive patients older than 68 years, we considered two RASI drug subclasses, angiotensin-converting enzyme inhibitors (ACEIs, N = 156) and angiotensin receptor blockers (ARBs, N = 140), and assessed their respective effects by taking no-antecedent-use of RASIs as reference. This analysis showed that both antecedent use of ACEIs and antecedent use of ARBs were associated with a lower Covid-19 mortality (odds ratioACEI = 0.57, 95% confidence interval 0.36--0.91, P = 0.018) (odds ratioARB = 0.49, 95% confidence interval 0.29--0.82, P = 0.006).In the population of over-68 hypertensive Covid-19 patients, antecedent use of ACEIs or ARBs was associated with a lower all-cause mortality, whether in-hospital or shortly after discharge, compared with no-antecedent-use of RASIs.

Of interest here is the problem of determining to what extent combinations of parameters derived from the EMG signal allow 1) discriminating two subclasses of neurogenic myopathies, and 2) recognizing different morphologies of the motor unit action potential underlying a measured EMG signal. EMG signals measured on clinical subjects and computer-simulated EMG signals were collected in a database and used cooperatively in this study. Suitable statistical models were developed which allow testing hypotheses on the role of accepted EMG parameters for the two purposes named above, and deriving new suitable combinations of EMG parameters. Results support the hypothesis that frequency-domain parameters are very clearly related to the morphology of the motor unit action potential. However, the attempt to use them in order to discriminate the two pathologic subclasses considered appears to be jeopardized by the fact that the signal may be measured in territories which do not reflect the morphology of the motor unit action potential dominant in such subclasses. On the basis of time-domain parameters, a significant discrimination was obtained between the two subclasses, and such discrimination is related mainly to a time-domain parameter which has already proved successful in the discrimination between myopathic and normal subjects. Data corroborate the hypothesis that the diagnostic yield improves when time-domain EMG parameters are measured at recruitment.

Several studies have evaluated whether or not there is an association between atherothrombotic disease and polymorphic variants of genes encoding proteins involved in that hemostatic system [1Voetsch B. Loscalzo J. Genetic determinants of arterial thrombosis.Arterioscler Thromb Vasc Biol. 2004; 24: 216-29Crossref PubMed Scopus (143) Google Scholar, 2Humphries S.E. Ridker P.M. Talmud P.J. Genetic testing for cardiovascular disease susceptibility: a useful clinical management tool or possible misinformation?.Arterioscler Thromb Vasc Biol. 2004; 24: 628-36Crossref PubMed Scopus (85) Google Scholar]. One of the most studied genes is the encoding coagulation factor VII (FVII). FVII polymorphisms were previously found to be associated with increased or decreased levels of FVII in plasma (reviewed by Lane and Grant) [3Lane D.A. Grant P.J. Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease.Blood. 2000; 95: 1517-32Crossref PubMed Google Scholar]. Some [4Iacoviello L. Di Castelnuovo A. De Knijff P. D'Orazio A. Amore C. Arboretti R. Kluft C. Donafi M.B. Polymorphisms in the coagulation factor VII gene and the risk of myocardial infarction.N Engl J Med. 1998; 338: 79-85Crossref PubMed Scopus (296) Google Scholar, 5Girelli D. Russo C. Ferraresi P. Olivieri O. Pinotti M. Friso S. Manzato F. Mazzucco A. Bernardi F. Corrocher R. Polymorphisms in the factor VII gene and the risk of myocardial infarction in patients with coronary artery disease.N Engl J Med. 2000; 343: 774-80Crossref PubMed Scopus (212) Google Scholar], but not all [6Lane A. Green F. Scarabin P.Y. Nicaud V. Bara L. Humphries S. Evans A. Luc G. Cambou J.P. Arveiler D. Cambien F. Factor VII Arg/Gln353 polymorphism determines factor VII coagulant activity in patients with myocardial infarction (MI) and control subjects in Belfast and in France but is not a strong indicator of MI risk in the ECTIM study.Atherosclerosis. 1996; 119: 119-27Abstract Full Text PDF PubMed Scopus (117) Google Scholar, 7Doggen C.J. Manger C.V. Bertina R.M. Reitsma P.H. Vandenbroucke J.P. Rosendaal F.R. A genetic propensity to high factor VII is not associated with the risk of myocardial infarction in men.Thromb Haemost. 1998; 80: 281-5Crossref PubMed Scopus (103) Google Scholar, 8Ardissino D. Mannucci P.M. Merlini P.A. Duca F. Fetiveau R. Tagliabue L. Tubaro M. Galvani M. Ottani F. Ferrario M. Corral J. Margaglione M. Prothrombotic genetic risk factors in young survivors of myocardial infarction.Blood. 1999; 94: 46-51Crossref PubMed Google Scholar], retrospective case–control studies have shown that carriers of polymorphic alleles associated with lower FVII levels (353Q, the H7H7 VNTR in intron 7 and a 10‐base‐pair insertion at position −323) have a decreased risk of acute myocardial infarction (AMI). On the other hand, Carew et al. [9Carew J.A. Basso F. Miller G.J. Hawe E. Jackson A.A. Humphries S.E. Bauer K.A. A functional haplotype in the 5′ flanking region of the factor VII gene is associated with an increased risk of coronary heart disease.J Thromb Haemost. 2003; 1: 2179-85Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar] showed that carriers of a FVII promoter haplotype associated with higher plasma levels of FVII (−670C, −630G and −402 A) have an increased risk for a first coronary event, particularly AMI. In this study, we chose to investigate the relationship between FVII polymorphisms and AMI by investigating women who developed AMI at a young age (less than 45 years of age). These rare patients usually have less traditional risk factors and coronary artery stenosis than older women and men with ischemic heart disease, so that it is biologically plausible that in them hypercoagulability plays an important role in the pathogenesis of thrombus formation and AMI. Moreover, genetic effects are usually more prominent in the young because cumulative environmental factors have not yet had time to modify phenotypes. With this as background, we studied the effect of seven FVII polymorphisms (− 670A/C, − 630 A/G, − 402G/A, − 401G/T, 10bpIns, the intron 7 VNTR and R353Q) on the risk of premature AMI in the frame of a case–control study, that included 98 women who had survived an AMI before the age of 45 years and had been admitted between January 1998 and January 2001 to coronary care units in Italy. They are a subset of a larger study carried out to assess the association of hemostasis gene polymorphisms with premature AMI in men and women [10Atherosclerosis, Thrombosis and Vascular Biology Italian Study Group.No evidence of association between prothrombotic gene polymorphisms and the development of acute myocardial infarction at a young age.Circulation. 2003; 107: 1117-22Crossref PubMed Scopus (204) Google Scholar]. Venous blood was obtained during a period ranging between a minimum of 3 months and a maximum of 12 months after AMI. The criteria used to diagnose AMI, to define the presence of significant or non‐significant stenosis on coronary angiography and the presence or absence of classical risk factors for AMI were previously reported [10Atherosclerosis, Thrombosis and Vascular Biology Italian Study Group.No evidence of association between prothrombotic gene polymorphisms and the development of acute myocardial infarction at a young age.Circulation. 2003; 107: 1117-22Crossref PubMed Scopus (204) Google Scholar, 11Mannucci P.M. Bernardinelli L. Foco L. Galli M.R. Ribichini F. Tubaro M. Peyvandi F. Tissue plasminogen activator antigen is strongly associated with myocardial infarction in young women.J Thromb Haemost. 2005; 3: 280-6Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar]. Ninety‐eight healthy women, enrolled from the staff of the same participating hospitals, were invited to act as controls and were matched with cases for age and geographic area of origin. For cases, data was collected from medical records at the time of the subjects’ AMI; for controls, data was collected at the time of evaluation prior to their enrollment. Citrated plasma (0.129 mol L−1) and buffy coats were prepared by centrifugation at 2500 × g for 20 min, immediately snap frozen and stored at − 70 °C. Plasma FVII antigen (FVII:Ag) was measured by enzyme immunoassay (Stago Laboratories, Asnieres, France). DNA was extracted from whole blood using a standard salting out method. Analysis for intron 7 VNTR, 10bpIns and R353Q was carried out using previously described methods [4Iacoviello L. Di Castelnuovo A. De Knijff P. D'Orazio A. Amore C. Arboretti R. Kluft C. Donafi M.B. Polymorphisms in the coagulation factor VII gene and the risk of myocardial infarction.N Engl J Med. 1998; 338: 79-85Crossref PubMed Scopus (296) Google Scholar, 5Girelli D. Russo C. Ferraresi P. Olivieri O. Pinotti M. Friso S. Manzato F. Mazzucco A. Bernardi F. Corrocher R. Polymorphisms in the factor VII gene and the risk of myocardial infarction in patients with coronary artery disease.N Engl J Med. 2000; 343: 774-80Crossref PubMed Scopus (212) Google Scholar]. Genotype analyses for −401G/T, −402G/A, −630A/G and −670A/C were performed using a single fragment of polymerase chain reaction (PCR) amplified by primers 5′‐AGGTGGAGGTTGCAGTGAGATTGCAC‐3′ and 5′‐GTGGCACCAAAACACTTC AAATACG‐3′, followed by sequencing on the ABI PRISM™ 310 Genetic Analyzer (Applied Biosystems, Foster City, CA, USA) using the same primers for the amplification reactions. The effect of polymorphisms on FVII:Ag plasma levels was evaluated by linear regression. An analysis of the association of polymorphisms with AMI was performed by means of logistic regression and the relative risks were expressed as odds ratios (OR) with corresponding 95% confidence intervals (CI). For each polymorphism we tested the hypothesis of a multiplicative effect on the risk of AMI, the risk of the heterozygote genotype being half way between the risk of the wild‐type and mutant homozygotes. If the hypothesis of a multiplicative effect was not rejected we estimated the OR under the multiplicative model. Otherwise, the OR for the heterozygote and homozygote genotypes were compared with that of the homozygote wild‐type, which was taken as reference. Pair‐wise linkage disequilibrium between the studied polymorphisms was first evaluated using the D′ measure. Since −402G/A and −630A/G were in complete linkage disequilibrium (D′ = 1) with −670A/C, and 10bpIns was in complete LD with −401G/T, we chose to exclude −402G/A, −630A/G and the 10bpIns from the analysis. The distribution of genotypes for the polymorphisms was in Hardy–Weinberg equilibrium in controls. As previously reported by others [3Lane D.A. Grant P.J. Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease.Blood. 2000; 95: 1517-32Crossref PubMed Google Scholar, 9Carew J.A. Basso F. Miller G.J. Hawe E. Jackson A.A. Humphries S.E. Bauer K.A. A functional haplotype in the 5′ flanking region of the factor VII gene is associated with an increased risk of coronary heart disease.J Thromb Haemost. 2003; 1: 2179-85Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar], the −670C polymorphic allele was significantly associated with higher FVII:Ag levels in plasma, whereas the −401T and 353Q alleles were associated with lower FVII:Ag levels (data not shown). Table 1 shows the unadjusted OR and 95% CI for each of the polymorphisms and for the traditional risk factors, as obtained by fitting a logistic conditional regression. For the −401G/T and −670A/C polymorphisms, a multiplicative model was fitted. Thus, the OR reported for these polymorphisms represent the OR of the heterozygote genotype compared with the wild‐type homozygote and the OR of the mutant homozygote genotype compared with the heterozygote. None of the polymorphisms was associated with AMI at the nominal 5% significance level. Table 1 also shows that classical risk factors were associated with AMI in these women, whereas FVII:Ag levels were not.Table 1The effect of FVII polymorphisms and of classical risk factors in 98 young women with acute myocardial infarction and their matched controlsVariableOdds ratio95% CI−401G/T polymorphism1.610.89–2.90−670A/C polymorphism1.280.69–2.37R353Q polymorphism1.530.80–2.94Intron 7 VNTR:H6H61 (ref)–H7H71.260.49–3.26H6H6 + H5H7 + H6H71.530.83–2.82Factor VII antigen0.990.99–1.01Hypertension4.331.12–15.21Smoking3.001.56–5.77Estrogen use2.211.18–4.16Body mass index1.081.01–1.17Alcohol0.870.48–1.58Physical exercise0.500.26–0.95Total cholesterol1.011.00–1.01Triglycerides1.021.01–1.03 Open table in a new tab In conclusion, none of the FVII polymorphisms were associated with the development of AMI in young premenopausal women, in spite of the fact that these polymorphisms were evaluated in a population of patients with AMI characterized by a high likelihood of a pivotal mechanistic role for hypercoagulability and heightened thrombus formation.

Recent advances in data analysis methods based on principles of Mendelian Randomisation, such as Egger regression and the weighted median estimator, add to the researcher's ability to infer cause-effect links from observational data. Now is the time to gauge the potential of these methods within specific areas of biomedical research. In this paper, we choose a study in metabolomics as an illustrative testbed. We apply Mendelian Randomisation methods in the analysis of data from the DILGOM (Dietary, Lifestyle and Genetic determinants of Obesity and Metabolic syndrome) study, in the context of an effort to identify molecular pathways of cardiovascular disease. In particular, our illustrative analysis addresses the question whether body mass, as measured by body mass index (BMI), exerts a causal effect on the concentrations of a collection of 137 cardiometabolic markers with different degrees of atherogenic power, such as the (highly atherogenic) lipoprotein metabolites with very low density (VLDLs) and the (protective) high density lipoprotein metabolites.We found strongest evidence of a positive BMI effect (that is, evidence that an increase in BMI causes an increase in the metabolite concentration) on those metabolites known to represent strong risk factors for coronary artery disease, such as the VLDLs, and evidence of a negative effect on protective biomarkers.The methods discussed represent a useful scientific tool, although they assume the validity of conditions that are (at best) only partially verifiable. This paper provides a rigorous account of such conditions. The results of our analysis provide a proof-of-concept illustration of the potential usefulness of Mendelian Randomisation in genomic biobank studies aiming to dissect the molecular causes of disease, and to identify candidate pharmacological targets.

An amendment to this paper has been published and can be accessed via a link at the top of the paper.

Abstract Since the recruitment process, Italian Mafias impose on their members a strict code of conduct. These rigid rules regulate their private and public behavior, implying a total adhesion to the group’s values. Such juridical and social aspects substantially distinguish organized crime (OC) from ordinary crime. It is still unknown whether these two categories of offenders also show distinctive cognitive traits. Here we investigated the frontal lobe cognitive functions of 50 OC prisoners from the Mafia and 50 non-OC prisoners based on the performance of 50 non-prisoner controls. We found that OC members were more likely to show pathological risk-propensity than non-OC prisoners. We interpret this finding as the result of the internal dynamics of Mafia groups. OC is a worldwide threat, and the identification of cognitive traits behind criminal behavior will help in devising focused prevention policies.

The aim of the present study is to evaluate the effects of 60-day artichoke leaf extract (ALE) supplementation (250mg, twice daily) on cytokines levels, natural killer cell (NK) response, and lipo-metabolic profile (HDL, LDL, and total-cholesterol, triglycerides (TG), ApoB, ApoA, lipid accumulation product (LAP), glucose, insulin, and homeostasis model assessment of insulin resistance (HOMA-IR)) in twenty adults (9/11 males/females, age=49.10 ± 13.74 years, and BMI=33.12 ± 5.14 kg/m 2 ) with low HDL-C and mild hypercholesterolemia. Hierarchical generalized linear model, adjusted for sex, BMI, and age, has been used to evaluate pre-post treatment changes. A significant increase for HDL-C ( β =0.14, p=0.0008) and MCP-1 ( β =144.77, p=0.004) and a significant decrease for ApoB/ApoA ( β =-0.07, p=0.03), total-C/HDL-C ratio ( β =-0.58, p&lt;0.001), and NK response at stimulus low ( β =0.43, p=0.04), medium ( β =0.40, p&lt;0.001), and high ( β =0.42, p=0.001) have been found. These results support the benefits of ALE supplementation on metabolic profile.

The treatment of symptomatic uncomplicated colonic diverticular disease (SUDD) is still under debate, and new data show a pathogenic role of dysbiosis and low-grade inflammation in intestinal mucosa. Recent research has highlighted the anti-inflammatory effects of botanical extracts such as Curcuma longa L. and Boswellia serrata Roxb. ex Colebr. The aim of this work is to investigate the potential role of a new delivery formulation of the association of curcumin and boswellia phytosome extracts (CBP) in SUDD.In a 30-day one-group longitudinal explanatory study, patients (men and women) were treated with an innovative association of CBP standardized extracts, 500 mg bid.Treatment of SUDD with the association of CBP was followed by a significant decrease in abdominal pain (p<0.0001). The study group showed that CBP supplementation was efficacious within 10 days and that efficacy was maintained almost constant until the 30th day of intervention.A phytosome of curcumin and boswellia extracts may be useful for the relief of SUDD pain. However, controlled studies should be performed for final conclusions to be drawn.

Dysphagic patients are not always able to meet their energy, micro and macronutrients needs for various causes and therefore are at high risk of malnutrition. The aim of the present study was to evaluate the effectiveness on satisfaction of the meal (by a 10-cm visuo-analogical scale), food intake (by visual estimation of food waste), nutritional status (anthropometric measures, mini nutritional assessment [MNA], vitamin D, B12, folic acid), functional (handgrip) and blood chemistry metabolic parameters of a tailored texture-modified sous-vide cooking meals (TTMSVC), well balanced in macro and micronutrients, in elderly women suffering from oropharyngeal dysphagia at long-term care facilities.A 12-week intervention study was conducted on female elderly subjects affected by oropharyngeal dysphagia of level 3-5. The treated group received TTMSVC with the consistencies standardized using viscosimeter (5000-10000 mP/s). The control group maintained pureed hospital diet.50 subjects, 25 in treatment group and 25 in control group, with mean±SD age 89.12±4.18 and mini mental state examination (MMSE) 20.58±1.63 were enrolled. The treatment and control groups were similar at baseline. The changes over time between the two groups showed significant differences for food intake, meal appreciation, Body Mass Index (BMI), calf circumference, arm circumference, MNA, prealbumin, albumin, folic acid, vitamin D, ionized calcium, C-Reactive Protein (CRP), Tumor Necrosis Factor (TNF-α), handgrip. Significant positive correlations were observed in the treatment group between the meal appreciation and prealbumin and vitamin D.This study demonstrated that elderly dysphagic women at long-term care facilities can eat better and increase nutritional status by eating 12-week tailored appealing TTMSVC.

Our Bayesian approach to Mendelian Randomisation uses multiple instruments to assess the putative causal effect of an exposure on an outcome. The approach is robust to violations of the (untestable) Exclusion Restriction condition, and hence it does not require instruments to be independent of the outcome conditional on the exposure and on the confounders of the exposure-outcome relationship. The Bayesian approach offers a rigorous handling of the uncertainty (e.g. about the estimated instrument-exposure associations), freedom from asymptotic approximations of the null distribution and the possibility to elaborate the model in any direction of scientific relevance. We illustrate the last feature with the aid of a study of the metabolic mediators of the disease-inducing effects of obesity, where we elaborate the model to investigate whether the causal effect of interest interacts with a covariate. The proposed model contains a vector of unidentifiable parameters, $β$, whose $j$th element represents the pleiotropic (i.e., not mediated by the exposure) component of the association of instrument $j$ with the outcome. We deal with the incomplete identifiability by assuming that the pleiotropic effect of some instruments is null, or nearly so, formally by imposing on $β$ Carvalho's horseshoe shrinkage prior, in such a way that different components of $β$ are subjected to different degrees of shrinking, adaptively and in accord with the compatibility of each individual instrument with the hypothesis of no pleiotropy. This prior requires a minimal input from the user. We present the results of a simulation study into the performance of the proposed method under different types of pleiotropy and sample sizes. Comparisons with the performance of the weighted median estimator are made. Choice of the prior and inference via Markov chain Monte Carlo are discussed.

COVID-19 may induce short- and long-term cognitive failures after recovery, but the underlying risk factors are still controversial. Here, we investigated whether (i) the odds of experiencing persistent cognitive failures differ based on the patients’ disease course severity and sex at birth; and (ii) the patients’ electrolytic profile in the acute stage represents a risk factor for persistent cognitive failures. We analysed data from 204 patients suffering from COVID-19 and hospitalised during the first pandemic wave. According to the 7-point WHO-OS scale, their disease course was classified as severe or mild. We investigated the presence of persistent cognitive failures collected after hospital discharge, while electrolyte profiles were collected during hospitalisation. The results showed that females who suffered from a mild course compared to a severe course of COVID-19 had a higher risk of presenting with persistent mental fatigue after recovery. Furthermore, in females who suffered from a mild course of COVID-19, persistent mental fatigue was related to electrolyte imbalance, in terms of both hypo- and hypernatremia, during hospitalisation in the acute phase. These findings have important implications for the clinical management of hospitalised COVID-19 patients. Attention should be paid to potential electrolyte imbalances, mainly in females suffering from mild COVID-19.

Heritability studies represent an important tool to investigate the main sources of variability for complex diseases, whose etiology involves both genetics and environmental factors. In this paper, we aimed to estimate multiple sclerosis (MS) narrow-sense heritability (h2), on a liability scale, using extended families ascertained from affected probands sampled in the Sardinian province of Nuoro, Italy. We also investigated the sources of MS liability variability among shared environment effects, sex, and categorized year of birth (&lt;1946, ≥1946). The latter can be considered a proxy for different early environmental exposures. To this aim, we implemented a Bayesian liability threshold model to obtain posterior distributions for the parameters of interest adjusting for ascertainment bias. Our analysis highlighted categorized year of birth as the main explanatory factor, explaining ~70% of MS liability variability (median value = 0.69, 95% CI: 0.64, 0.73), while h2 resulted near to 0% (median value = 0.03, 95% CI: 0.00, 0.09). By performing a year of birth-stratified analysis, we found a high h2 only in individuals born on/after 1946 (median value = 0.82, 95% CI: 0.68, 0.93), meaning that the genetic variability acquired a high explanatory role only when focusing on this subpopulation. Overall, the results obtained highlighted early environmental exposures, in the Sardinian population, as a meaningful factor involved in MS to be further investigated.

We used publicly available population data from 1 January 2019 up to 31 December 2022, to investigate mortality trends in Italy during the COVID-19 pandemic, evaluating changes in life expectancy (LE) at birth within provinces and the impact of COVID-19 vaccinations.Aggregate data analysis.Annual period life tables were used to estimate sex-specific LEs within provinces from 2019 to 2022. We used Arriaga decomposition to analyze the contribution of age groups (<60 years and ≥60 years) to annual LE changes. We implemented a Quasi-Poisson regression model to estimate the number of averted deaths by the achieved COVID-19 vaccination rates from January 2021 up to December 2022, simulating a counterfactual scenario where vaccine doses were not administered.The results revealed geographical heterogeneity in annual LE changes across Italian provinces during the pandemic. By the end of 2022, LE was below the prepandemic levels in 88% of provinces for females and in 76% for males. In addition, we estimated that the achieved vaccination rates averted 460,831 deaths (95% confidence interval: 250,976-707,920), corresponding to a 25% reduction in expected all-cause mortality.Overall, the study highlighted the significant role of COVID-19 vaccinations in averting a considerable number of deaths and improving LE. However, by the end of 2022, LE had not fully recovered to prepandemic levels in many provinces. This could be attributed to concurrent factors, including enduring COVID-19 pandemic effects, intense summer heat waves and early onset of seasonal flu. Further research and continuous monitoring are essential to fully comprehend long-term mortality trends and optimize public health strategies.

In response to public concern about an increase in the incidence of leukemia among children in southwestern Sardinia (Italy), incident cases of childhood cancer (ages 0-14) were ascertained among residents in the province of Cagliari, which comprises all of southern Sardinia, in 1974-89. Completeness of the ascertainment of leukemia cases was validated by comparison with estimates derived from official statistics of mortality and survival curves. A significant excess risk of childhood acute lymphoblastic leukemia (cALL) was found for children residing in the town of Carbonia. The risk was highest in 1983-85, when seven cases occurred versus 0.8 expected. No birth-cohort effect was observed. The cALL incidence rate was significantly higher among children born and residing in Carbonia than among children born in Carbonia but residing elsewhere. However, the cALL cases did not cluster within the town of Carbonia. The proximity of the largest industrial settlement in the region of Sardinia raised the suspicion that environmental pollution was responsible for the observed excess. Information about industrial emissions from this settlement prior to the appearance of the cALL cluster was not sufficient to reject or confirm the hypothesis.

From the EMG signal measured in four groups of pathologies, time and frequency domain parameters were obtained. Separation of the four groups by means of these parameters was attempted on the basis of a multivariate approach. Use of Discriminant Analysis provided evidence of the superiority of the time domain to frequency domain parameters and showed, however, that the use of time and frequency parameters jointly, highly improved discrimination. It also allowed one to suggest a three-step strategy for classification of cases of unknown ethiopathology.

Abstract This chapter describes a Bayesian hierarchical model and applies it to a new dataset on insulin-dependent diabetes mellitus (IDDM) prevalence among 18-year-old males born in Sardinia between 1936 and 1973, using malaria prevalence in 1938–40 as the ecological covariate. It shows how to deal with the potential bias associated with using such a proxy by extending the Bayesian model to allow for covariate measurement error. It provides a method for choosing the hyperprior distributions for the spatial variation parameters of the model, and discusses the sensitivity of the results to different choices.

Abstract Multiple sclerosis is a common, complex neurological disease, where almost 20% of risk heritability can be attributed to common genetic variants, including &gt;230 identified by genome-wide association studies (Patsopoulos et al., 2017). Multiple strands of evidence suggest that the majority of the remaining heritability is also due to the additive effects of individual variants, rather than epistatic interactions between these variants, or mutations exclusive to individual families. Here, we show in 68,379 cases and controls that as much as 5% of this heritability is explained by low-frequency variation in gene coding sequence. We identify four novel genes driving MS risk independently of common variant signals, which highlight a key role for regulatory T cell homeostasis and regulation, IFNγ biology and NFκB signaling in MS pathogenesis. As low-frequency variants do not show substantial linkage disequilibrium with other variants, and as coding variants are more interpretable and experimentally tractable than non-coding variation, our discoveries constitute a rich resource for dissecting the pathobiology of MS.

Rice germ (RG) may be a safe and effective dietary supplement for obesity in menopause, considering its high protein content and considerable amounts of essential amino acids, good fatty acids, and fiber. This pilot randomized, blinded, parallel-group, placebo-controlled pilot trial investigated the effectiveness of 4-weeks RG supplementation (25 g twice a day) on body composition, as primary outcome, measured by Dual Energy X-Ray Absorptiometry (DXA), and metabolic parameters, as secondary outcomes, like amino acid profiles and satiating capacity, in obese postmenopausal women following a tailored hypocaloric diet (25–30% less than daily energy requirements). Twenty-seven women were randomly assigned to the supplemented group (14) or placebo group (13). There was a significant interaction between time and group for body mass index (BMI) (p &lt; 0.0001), waist (p = 0.002) and hip circumferences (p = 0.01), total protein (0.008), albumin (0.005), Homeostasis Model Assessment index score (p = 0.04), glycine (p = 0.002), glutamine (p = 0.004), and histidine (p = 0.007). Haber’s means over time showed a clearly greater feeling of satiety for the supplemented compared to the placebo group. These findings indicate that RG supplementation in addition to a tailored diet counterbalanced the metabolic changes typical of menopause, with improvements in BMI, body composition, insulin resistance, amino acid profiles, and satiety.

We propose a Bayesian approach to Mendelian Randomization studies based on a set of instruments, $Z$. The approach allows some instruments to violate the (untestable) no-pleiotropy condition, that $Z$ be independent of the (continuous) response $Y$, conditional on the (continuous) exposure $X$ and on the confounders of the relationship between $X$ and $Y$. However, it assumes that no instrument be associated with the confounders. Our approach introduces a vector $\beta$ representing the unknown pleiotropic associations between $Z$ and $Y$. This makes the model unidentifiable from the likelihood. We make the posterior distribution proper by imposing on $\beta$ a biologically justified prior that assumes some pleiotropic associations to be zero. This we do by imposing on $\beta$ Carvalho's horseshoe shrinkage prior, which will shrink the components of this vector towards zero, but to different degrees, adaptively, without requiring the user to specify numerical values for the hyperparameters. Conditional on a particular value of the causal effect of interest, $\theta$, this prior will allow instruments irreconcilable with the no-pleiotropy hypothesis to have their corresponding components of $\beta$ unshrunk, so as to prevent the estimate of $\theta$ from being corrupted by their presence. The components of $\beta$ for the remaining instruments will be heavily shrunk towards zero, so that the information they provide will be used to estimate $\theta$. Computational aspects of the method are discussed. We perform a simulation study to assess the type-I error probability and the power of our method to detect the causal effect of interest, relative to those of the weighted median estimator. Next we generalize the model by allowing instrument-exposure interactions, and assess performance in this case, too.

Acute diarrhea is a frequent problem worldwide, mostly due to gastrointestinal infections or food poisoning. Boswellia serrata could be active in the treatment of acute diarrhea due to its anti-inflammatory, antispasmodic, and antimicrobial activity. In this randomized, double-blind, placebo-controlled clinical study, 49 adults with acute diarrhea were randomly allocated to receive 250 mg of a lecithin-based delivery form of Boswellia serrata (CASP) or placebo for 5 days. The time it took to become healthy with stoppage of diarrhea (primary end point) was significantly shorter in the intervention group (3.08 vs. 4.44 days: p-value < 0.0001). The probability of subjects treated with CASP to recover sooner was equal to 80.2%. A significantly lower number of stools was observed in the CASP group over time (β = −0.17, p-value < 0.0001). A significant difference was observed between the two groups for abdominal pain, nausea, and GAE (global assessment of efficacy). In conclusion, the lecithin-based delivery form of Boswellia serrata extract could be a useful addition to the treatment of acute diarrhea in adults. CASP is safe and reduces the time it takes to become healthy, the frequency of stools, the abdominal pain and nausea of subjects with acute diarrhea. Further studies are needed to confirm these promising results.

Alzheimer's disease (AD) is widely identified as the most common cause of sporadic dementia. Its aetiology is still debated, as despite several hypotheses, different factors seem to play a role in its establishment and development. Recent studies have proposed a possible preventing role of nutrition. The weight loss typical of earlier phase of disease and the finding of malnutrition as a common trait between patients leads to hypothesize that a supplementation of specific nutrients seems to be useful and effective in terms of improvement of cognitive functions. Malnourished patients show also altered parameters when investigating inflammation markers: for example, hyperhomocysteinemia is a typical finding in elderly affected by dementia, and it can be prevented and corrected by using a proper nutrients supplementation. Pro-inflammatory state can be reduced with supplementation of polyunsaturated fatty acids, vitamins of the group B and phosphatidylserine, that can act reducing IL-1β (pro-inflammatory cytokine) and improving IL-10 (anti-inflammatory cytokine) synthesis. While investigating the role of nutrition, it seems to be deeply linked with genetic; a genetic onset AD-related could be latent and can be influenced by nutritional attitude. AD can be considered a sort of latent clinical condition that would disclose or not, depending also on micro-environment and nutritional parameters. The genetic expression can be influenced by assumptions or not of specific nutrients, with the promotion of different pro- or anti-inflammatory settings. The specific role of each micronutrient (in particular vitamins) and trace elements still needs to be punctuated, as they are involved in a pool of different reactions. Also genes acts not independently but in an interconnected pattern, in which the role of a single gene needs to be cleared, depending on others. This complex system of predisposing conditions and a possible role of nutrition as modulator of the inflammatory state is the object of this review.

In genetic association studies, a single marker is often associated with multiple, correlated phenotypes (e.g., obesity and cardiovascular disease, or nicotine dependence and lung cancer). A pervasive question is then whether that marker has independent effects on all phenotypes. In this article, we address this question by assessing whether there is a direct genetic effect on one phenotype that is not mediated through the other phenotypes. In particular, we investigate how to identify and estimate such direct genetic effects on the basis of (matched) case-control data. We discuss conditions under which such effects are identifiable from the available (matched) case-control data. We find that direct genetic effects are sometimes estimable via standard regression methods, and sometimes via a more general G-estimation method, which has previously been proposed for random samples and unmatched case-control studies (Vansteelandt, 2009) and is here extended to matched case-control studies. The results are used to assess whether the FTO gene is associated with myocardial infarction other than via an effect on obesity.

This chapter contains sections titled: Introduction Background The scientific hypothesis Data A simple preliminary analysis Testing for qualitative interaction Discussion Acknowledgments References