Leonidas Stefanis

Aberrant alpha-synuclein degradation is implicated in Parkinson's disease pathogenesis because the protein accumulates in the Lewy inclusion bodies associated with the disease. Little is known, however, about the pathways by which wild-type alpha-synuclein is normally degraded. We found that wild-type alpha-synuclein was selectively translocated into lysosomes for degradation by the chaperone-mediated autophagy pathway. The pathogenic A53T and A30P alpha-synuclein mutants bound to the receptor for this pathway on the lysosomal membrane, but appeared to act as uptake blockers, inhibiting both their own degradation and that of other substrates. These findings may underlie the toxic gain-of-function by the mutants.

α-Synuclein is a presynaptic neuronal protein that is linked genetically and neuropathologically to Parkinson's disease (PD). α-Synuclein may contribute to PD pathogenesis in a number of ways, but it is generally thought that its aberrant soluble oligomeric conformations, termed protofibrils, are the toxic species that mediate disruption of cellular homeostasis and neuronal death, through effects on various intracellular targets, including synaptic function. Furthermore, secreted α-synuclein may exert deleterious effects on neighboring cells, including seeding of aggregation, thus possibly contributing to disease propagation. Although the extent to which α-synuclein is involved in all cases of PD is not clear, targeting the toxic functions conferred by this protein when it is dysregulated may lead to novel therapeutic strategies not only in PD, but also in other neurodegenerative conditions, termed synucleinopathies.

alpha-Synuclein is central in Parkinson's disease pathogenesis. Although initially alpha-synuclein was considered a purely intracellular protein, recent data suggest that it can be detected in the plasma and CSF of humans and in the culture media of neuronal cells. To address a role of secreted alpha-synuclein in neuronal homeostasis, we have generated wild-type alpha-synuclein and beta-galactosidase inducible SH-SY5Y cells. Soluble oligomeric and monomeric species of alpha-synuclein are readily detected in the conditioned media (CM) of these cells at concentrations similar to those observed in human CSF. We have found that, in this model, alpha-synuclein is secreted by externalized vesicles in a calcium-dependent manner. Electron microscopy and liquid chromatography-mass spectrometry proteomic analysis demonstrate that these vesicles have the characteristic hallmarks of exosomes, secreted intraluminar vesicles of multivesicular bodies. Application of CM containing secreted alpha-synuclein causes cell death of recipient neuronal cells, which can be reversed after alpha-synuclein immunodepletion from the CM. High- and low-molecular-weight alpha-synuclein species, isolated from this CM, significantly decrease cell viability. Importantly, treatment of the CM with oligomer-interfering compounds before application rescues the recipient neuronal cells from the observed toxicity. Our results show for the first time that cell-produced alpha-synuclein is secreted via an exosomal, calcium-dependent mechanism and suggest that alpha-synuclein secretion serves to amplify and propagate Parkinson's disease-related pathology.

α-Synuclein (ASYN) is crucial in Parkinson disease (PD) pathogenesis. Increased levels of wild type (WT) ASYN expression are sufficient to cause PD in humans. The manner of post-transcriptional regulation of ASYN levels is controversial. Previously, we had shown that WT ASYN can be degraded by chaperone-mediated autophagy (CMA) in isolated liver lysosomes. Whether this occurs in a cellular and, in particular, in a neuronal cell context is unclear. Using a mutant ASYN form that lacks the CMA recognition motif and RNA interference against the rate-limiting step in the CMA pathway, Lamp2a, we show here that CMA is indeed involved in WT ASYN degradation in PC12 and SH-SY5Y cells, and in primary cortical and midbrain neurons. However, the extent of involvement varies between cell types, potentially because of differences in compensatory mechanisms. CMA inhibition leads to an accumulation of soluble high molecular weight and detergent-insoluble species of ASYN, suggesting that CMA dysfunction may play a role in the generation of such aberrant species in PD. ASYN and Lamp2a are developmentally regulated in parallel in cortical neuron cultures and in vivo in the central nervous system, and they physically interact as indicated by co-immunoprecipitation. In contrast to previous reports, inhibition of macroautophagy, but not the proteasome, also leads to WT ASYN accumulation, suggesting that this lysosomal pathway is also involved in normal ASYN turnover. These results indicate that CMA and macroautophagy are important pathways for WT ASYN degradation in neurons and underline the importance of CMA as degradation machinery in the nervous system. α-Synuclein (ASYN) is crucial in Parkinson disease (PD) pathogenesis. Increased levels of wild type (WT) ASYN expression are sufficient to cause PD in humans. The manner of post-transcriptional regulation of ASYN levels is controversial. Previously, we had shown that WT ASYN can be degraded by chaperone-mediated autophagy (CMA) in isolated liver lysosomes. Whether this occurs in a cellular and, in particular, in a neuronal cell context is unclear. Using a mutant ASYN form that lacks the CMA recognition motif and RNA interference against the rate-limiting step in the CMA pathway, Lamp2a, we show here that CMA is indeed involved in WT ASYN degradation in PC12 and SH-SY5Y cells, and in primary cortical and midbrain neurons. However, the extent of involvement varies between cell types, potentially because of differences in compensatory mechanisms. CMA inhibition leads to an accumulation of soluble high molecular weight and detergent-insoluble species of ASYN, suggesting that CMA dysfunction may play a role in the generation of such aberrant species in PD. ASYN and Lamp2a are developmentally regulated in parallel in cortical neuron cultures and in vivo in the central nervous system, and they physically interact as indicated by co-immunoprecipitation. In contrast to previous reports, inhibition of macroautophagy, but not the proteasome, also leads to WT ASYN accumulation, suggesting that this lysosomal pathway is also involved in normal ASYN turnover. These results indicate that CMA and macroautophagy are important pathways for WT ASYN degradation in neurons and underline the importance of CMA as degradation machinery in the nervous system. α-Synuclein (ASYN) 3The abbreviations used are:ASYNα-synucleinCMAchaperone-mediated autophagydoxdoxycyclineLamplysososome-associated membrane proteinRNAiRNA interferenceWTwild type3-MA3-methyladenineEGFPenhanced green fluorescent proteinPBSphosphate-buffered salineBisTris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolFBSfetal bovine serumRTreverse transcriptionsiRNAsmall interfering RNACNScentral nervous systemANOVAanalysis of variancescrscrambledGAPDHglyceraldehyde-3-phosphate dehydrogenaseshRNAsmall hairpin RNAm.o.i.multiplicity of infectionepxepoxomicinERKextracellular signal-regulated kinaseAbantibodyTHtyrosine hydroxylase. 3The abbreviations used are:ASYNα-synucleinCMAchaperone-mediated autophagydoxdoxycyclineLamplysososome-associated membrane proteinRNAiRNA interferenceWTwild type3-MA3-methyladenineEGFPenhanced green fluorescent proteinPBSphosphate-buffered salineBisTris2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diolFBSfetal bovine serumRTreverse transcriptionsiRNAsmall interfering RNACNScentral nervous systemANOVAanalysis of variancescrscrambledGAPDHglyceraldehyde-3-phosphate dehydrogenaseshRNAsmall hairpin RNAm.o.i.multiplicity of infectionepxepoxomicinERKextracellular signal-regulated kinaseAbantibodyTHtyrosine hydroxylase. is central in Parkinson disease (PD) pathogenesis. Point mutations in the gene encoding ASYN, as well as multiplications of the gene locus, are identified in rare cases of familial PD (1Kruger R. Kuhn W. Muller T. Woitalla D. Graeber M. Kosel S. Przuntek H. Epplen J.T. Schols L. Riess O. Nat. Genet. 1998; 18: 106-108Crossref PubMed Scopus (3235) Google Scholar, 2Polymeropoulos M.H. Lavedan C. Leroy E. Ide S.E. Dehejia A. Dutra A. Pike B. Root H. Rubenstein J. Boyer R. Stenroos E.S. Chandrasekharappa S. Athanassiadou A. Papapetropoulos T. Johnson W.G. Lazzarini A.M. Duvoisin R.C. Di Iorio G. Golbe L.I. Nussbaum R.L. Science. 1997; 276: 2045-2047Crossref PubMed Scopus (6441) Google Scholar, 3Singleton A. Gwinn-Hardy K. Lancet. 2004; 364: 1105-1107Abstract Full Text Full Text PDF PubMed Scopus (73) Google Scholar). Genetic polymorphic variants within the ASYN locus that may be associated with increased production of ASYN, confer an increased risk for sporadic PD (4Maraganore D.M. de Andrade M. Elbaz A. Farrer M.J. Ioannidis J.P. Kruger R. Rocca W.A. Schneider N.K. Lesnick T.G. Lincoln S.J. Hulihan M.M. Aasly J.O. Ashizawa T. Chartier-Harlin M.C. Checkoway H. Ferrarese C. Hadjigeorgiou G. Hattori N. Kawakami H. Lambert J.C. Lynch T. Mellick G.D. Papapetropoulos S. Parsian A. Quattrone A. Riess O. Tan E.K. Van Broeckhoven C. J. Am. Med. Assoc. 2006; 296: 661-670Crossref PubMed Scopus (424) Google Scholar). These data suggest that modulation of wild type (WT) ASYN levels is critical for PD pathogenesis. Control of protein levels is in part achieved by differential degradation that modulates cellular protein half-life. The subject of ASYN degradation is controversial. α-synuclein chaperone-mediated autophagy doxycycline lysososome-associated membrane protein RNA interference wild type 3-methyladenine enhanced green fluorescent protein phosphate-buffered saline 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol fetal bovine serum reverse transcription small interfering RNA central nervous system analysis of variance scrambled glyceraldehyde-3-phosphate dehydrogenase small hairpin RNA multiplicity of infection epoxomicin extracellular signal-regulated kinase antibody tyrosine hydroxylase. α-synuclein chaperone-mediated autophagy doxycycline lysososome-associated membrane protein RNA interference wild type 3-methyladenine enhanced green fluorescent protein phosphate-buffered saline 2-[bis(2-hydroxyethyl)amino]-2-(hydroxymethyl)propane-1,3-diol fetal bovine serum reverse transcription small interfering RNA central nervous system analysis of variance scrambled glyceraldehyde-3-phosphate dehydrogenase small hairpin RNA multiplicity of infection epoxomicin extracellular signal-regulated kinase antibody tyrosine hydroxylase. Initial studies showed that ASYN accumulated in cells upon proteasomal inhibition, suggesting that the proteasome was responsible for ASYN degradation (5Bennett M.C. Bishop J.F. Leng Y. Chock P.B. Chase T.N. Mouradian M.M. J. Biol. Chem. 1999; 274: 33855-33858Abstract Full Text Full Text PDF PubMed Scopus (382) Google Scholar, 6Imai Y. Soda M. Takahashi R. J. Biol. Chem. 2000; 275: 35661-35664Abstract Full Text Full Text PDF PubMed Scopus (645) Google Scholar). This has also been shown in more recent work (7Webb J.L. Ravikumar B. Atkins J. Skepper J.N. Rubinsztein D.C. J. Biol. Chem. 2003; 278: 25009-25013Abstract Full Text Full Text PDF PubMed Scopus (1122) Google Scholar, 8Tofaris G.K. Layfield R. Spillantini M.G. FEBS Lett. 2001; 509: 22-26Crossref PubMed Scopus (324) Google Scholar). Other studies however, including our own, failed to detect accumulation of endogenous or overexpressed ASYN with proteasomal inhibition (9Ancolio K. Alves da Costa C. Ueda K. Checler F. Neurosci. Lett. 2000; 285: 79-82Crossref PubMed Scopus (103) Google Scholar, 10Rideout H.J. Larsen K.E. Sulzer D. Stefanis L. J. Neurochem. 2001; 78: 899-908Crossref PubMed Scopus (251) Google Scholar, 11Rideout H.J. Stefanis L. Mol. Cell. Neurosci. 2002; 21: 223-238Crossref PubMed Scopus (114) Google Scholar, 12Paxinou E. Chen Q. Weisse M. Giasson B.I. Norris E.H. Rueter S.M. Trojanowski J.Q. Lee V.M. Ischiropoulos H. J. Neurosci. 2001; 21: 8053-8061Crossref PubMed Google Scholar). In contrast, ASYN appeared to accumulate with general lysosomal inhibition (12Paxinou E. Chen Q. Weisse M. Giasson B.I. Norris E.H. Rueter S.M. Trojanowski J.Q. Lee V.M. Ischiropoulos H. J. Neurosci. 2001; 21: 8053-8061Crossref PubMed Google Scholar, 13Cuervo A.M. Stefanis L. Fredenburg R. Lansbury P.T. Sulzer D. Science. 2004; 305: 1292-1295Crossref PubMed Scopus (1511) Google Scholar). In lysosomes, degradation of cytoplasmic components is achieved through distinct types of autophagic pathways as follows: chaperone-mediated autophagy (CMA), microautophagy, and macroautophagy (14Levine B. Klionsky D.J. Dev. Cell. 2004; 6: 463-477Abstract Full Text Full Text PDF PubMed Scopus (3103) Google Scholar, 15Cuervo A.M. Trends Cell Biol. 2004; 14: 70-77Abstract Full Text Full Text PDF PubMed Scopus (699) Google Scholar). CMA involves the selective targeting of proteins containing a KFERQ peptide motif to lysosomes. This requires binding to the lysosomal receptor, Lamp2a, the rate-limiting step in CMA (16Cuervo A.M. Dice J.F. Science. 1996; 273: 501-503Crossref PubMed Scopus (679) Google Scholar, 17Majeski A.E. Dice J.F. Int. J. Biochem. Cell Biol. 2004; 36: 2435-2444Crossref PubMed Scopus (301) Google Scholar, 18Massey A. Kiffin R. Cuervo A.M. Int. J. Biochem. Cell Biol. 2004; 36: 2420-2434Crossref PubMed Scopus (149) Google Scholar). Microautophagy involves the pinocytosis of small quantities of cytosol directly by lysosomes (18Massey A. Kiffin R. Cuervo A.M. Int. J. Biochem. Cell Biol. 2004; 36: 2420-2434Crossref PubMed Scopus (149) Google Scholar, 19Muller O. Sattler T. Flotenmeyer M. Schwarz H. Plattner H. Mayer A. J. Cell Biol. 2000; 151: 519-528Crossref PubMed Scopus (136) Google Scholar). Macroautophagy involves the sequestration of cytosolic regions into autophagosomes that deliver their contents to late endosomal and lysosomal compartments for degradation (20Shintani T. Klionsky D.J. Science. 2004; 306: 990-995Crossref PubMed Scopus (2110) Google Scholar). Direct assessment of the contribution of macroautophagy to WT ASYN degradation was performed in two studies using the selective macroautophagy inhibitor 3-methyladenine (3-MA). In both cases (7Webb J.L. Ravikumar B. Atkins J. Skepper J.N. Rubinsztein D.C. J. Biol. Chem. 2003; 278: 25009-25013Abstract Full Text Full Text PDF PubMed Scopus (1122) Google Scholar, 8Tofaris G.K. Layfield R. Spillantini M.G. FEBS Lett. 2001; 509: 22-26Crossref PubMed Scopus (324) Google Scholar), 3-MA application failed to enhance ASYN levels, suggesting the lack of involvement of macroautophagy in normal ASYN turnover. ASYN contains the pentapeptide motif KFERQ that could target it to the CMA pathway. Analysis in an in vitro system of purified liver lysosomes confirmed that ASYN can be degraded by CMA. Coupled with cellular data, which indicated that rat ASYN is degraded in ventral midbrain cultures by a lysosomal pathway, we had proposed that CMA may be the major pathway used for WT ASYN degradation (13Cuervo A.M. Stefanis L. Fredenburg R. Lansbury P.T. Sulzer D. Science. 2004; 305: 1292-1295Crossref PubMed Scopus (1511) Google Scholar). However, there is no direct proof that CMA is responsible for ASYN degradation in cells, and in particular neuronal cells; rather this hypothesis is based on the in vitro data with purified liver lysosomes and the exclusion of other degradation pathways. Therefore, molecular techniques targeted specifically toward CMA are needed to prove or disprove the hypothesis that CMA represents a major route for WT ASYN degradation in cellular systems. Ideally, such experiments should be performed in neuronal cells, and particularly those that are most relevant to PD. This is all the more prescient, as the rate-limiting step in CMA, the levels of Lamp2a, have been reported to be very low in the CNS (21Konecki D.S. Foetisch K. Zimmer K.P. Schlotter M. Lichter-Konecki U. Biochem. Biophys. Res. Commun. 1995; 215: 757-767Crossref PubMed Scopus (84) Google Scholar, 22Furuta K. Yang X.L. Chen J.S. Hamilton S.R. August J.T. Arch. Biochem. Biophys. 1999; 365: 75-82Crossref PubMed Scopus (46) Google Scholar). Accordingly, we have undertaken the present study to ascertain whether CMA is indeed responsible for WT ASYN degradation in neuronal cells. Because of the controversy surrounding the issues of proteasomal and macroautophagy-dependent degradation of WT ASYN, we have also examined the contribution of these pathways in various neuronal cell culture systems. Animals—Wistar rats and wild type control or double transgenic C57BI/C3H mice expressing human A53T ASYN under the control of the prion promoter were used. The generation and phenotype of these mice have been described previously (23Giasson B.I. Duda J.E. Quinn S.M. Zhang B. Trojanowski J.Q. Lee V.M. Neuron. 2002; 34: 521-533Abstract Full Text Full Text PDF PubMed Scopus (887) Google Scholar). The mice were purchased from The Jackson Laboratories (Bar Harbor, ME) and were housed in the animal facility of the Biomedical Research Foundation of the Academy of Athens in a room with a controlled light-dark cycle (12 h light-12 h dark) and free access to food and water. For immunoprecipitation and Western immunoblotting experiments, the animals were sacrificed by cervical dislocation; brains were harvested, dissected on ice to obtain the region of interest, and immediately frozen. All animals were processed in a similar manner. Tissue was stored at –80 °C until further use. Genotyping was performed by quantitative Southern dot blot analysis with a 32P-labeled oligonucleotide-primed ASYN DNA probe as described previously (23Giasson B.I. Duda J.E. Quinn S.M. Zhang B. Trojanowski J.Q. Lee V.M. Neuron. 2002; 34: 521-533Abstract Full Text Full Text PDF PubMed Scopus (887) Google Scholar). All efforts were made to minimize animal suffering and to reduce the number of the animals used, according to the European Communities Council Directive (86/609/EEC) guidelines for the care and use of laboratory animals. All animal experiments were approved by the Institutional Animal Care and Use Committee of Biomedical Research Foundation of the Academy of Athens. Generation of Stable Cell Lines and Transfections—We generated the ΔDQ mutation in the ASYN open reading frame by substituting the amino acids DQ at positions 98–99 with AA, using PCR-based site-directed mutagenesis, as described previously (13Cuervo A.M. Stefanis L. Fredenburg R. Lansbury P.T. Sulzer D. Science. 2004; 305: 1292-1295Crossref PubMed Scopus (1511) Google Scholar). Human ASYN in pcDNA3 was used as template (24Stefanis L. Larsen K.E. Rideout H.J. Sulzer D. Greene L.A. J. Neurosci. 2001; 21: 9549-9560Crossref PubMed Google Scholar). Naive SH-SY5Y cells were transfected overnight with the Tet-Off vector (10 μg) (Clontech) using the Lipofectamine 2000 reagent (Invitrogen). Selection was performed with 500 μg/ml G418 (Calbiochem). Growth medium was changed every 2 days. G418-resistant colonies were picked. Inducibility of each clone was determined by transient transfection of a pTRE-LUC vector, in the presence or absence of doxycycline (dox, 2 μg/ml) TET-approved medium (Clontech). Two clones were finally chosen for tight regulation. Maintenance of the clones was in 250 μg/ml G418. One of the clones was further used for generation of stable pTRE-ASYN expression as described below. Mutant ΔDQ/WT ASYN was generated by PCR from human WT ASYN. PCR products were then cloned into a TOPO-pCRII vector (Invitrogen). WT, ΔDQ/WT ASYN were subcloned into the HindIII and XbaI sites of the pTRE-tight vector (Clontech) and transfected along with the pTK-hygromycin vector (Clontech) using Lipofectamine 2000, following the manufacturer's recommendations. Selection was with 200 μg/ml G418 and 25 μg/ml (for PC12 cells) or 50 μg/ml (for SH-SY5Y cells) hygromycin B (Roche Diagnostics). Single colonies were isolated and maintained in medium with/without dox (2 μg/ml for PC12 or 3 μg/ml for SH-SY5Y cells) for 4 days. The clones were tested for ASYN expression by immunocytochemistry and Western blot analysis. Resistant clones were picked, and ASYN inducibility was examined by immunofluorescence in the presence or absence of dox (2 μg/ml added for 4 days) in Tet-Off approved medium using the monoclonal antibody Syn 211 sc-12767 (Santa Cruz Biotechnology, Santa Cruz, CA). Clones with the tightest regulation were further confirmed by Western immunoblotting with the same antibody. Cell Culture—PC12 cells were cultured in RPMI 1640 medium (Invitrogen) with 10% horse serum (Biowest, Nuaillé, France) and 5% fetal bovine serum (FBS, Biowest, France) on rat tail collagen-coated plates. SH-SY5Y cells were cultured in RPMI 1640 medium with 10% FBS. Stable cell lines were co-cultured with 200 μg/ml G418 and 25 μg/ml (for PC12 cells) or 50 μg/ml (for SH-SY5Y cells) hygromycin B. For pharmacological studies, 3-methyladenine (3-MA, Sigma), NH4Cl (Sigma), epoxomicin (epx, Sigma), and dox (Clontech) were added at indicated times and concentrations. Serum deprivation in SH-SY5Y cells was in RPMI 1640 medium + 0.5% FBS. All plasticware was from Greiner (Greiner, Bio One GmbH, Germany). RNAi—A 21-nucleotide, small interfering RNA was designed against the rat Lamp2a mRNA (GenBank™ accession number NM_017068) according to the criteria of Elbashir et al. (25Elbashir S.M. Harborth J. Lendeckel W. Yalcin A. Weber K. Tuschl T. Nature. 2001; 411: 494-498Crossref PubMed Scopus (8018) Google Scholar) and Reynolds et al. (26Reynolds A. Leake D. Boese Q. Scaringe S. Marshall W.S. Khvorova A. Nat. Biotechnol. 2004; 22: 326-330Crossref PubMed Scopus (1612) Google Scholar). The nucleotide sequence targeting rat Lamp2a was 5′-AAGCGCCATCATACTGGATAT-3′ (L1) and was subjected to a BLAST search to verify specificity. As a control, we used a scrambled (scr) siRNA containing the 21-nucleotide sequence 5′-AATTTAGCCGATACTGCCTAG-3′. Briefly, PC12 cells were grown in 12-well dishes, and siRNAs (L1 and scr) at a concentration of 25 nm were delivered with Lipofectamine 2000 (Invitrogen) following the manufacturer's instructions. Six hours later, the medium was removed and replaced with normal culture medium. Lamp2a down-regulation was assessed 24 and 48 h post-transfection. Primary Neuronal Cultures—Cultures of rat (embryonic day 18, E18) or mouse (E16) cortical neurons were prepared as described previously (27Stefanis L. Park D.S. Friedman W.J. Greene L.A. J. Neurosci. 1999; 19: 6235-6247Crossref PubMed Google Scholar, 28Dietrich P. Rideout H.J. Wang Q. Stefanis L. Mol. Cell. Neurosci. 2003; 24: 430-441Crossref PubMed Scopus (37) Google Scholar). Dissociated cells were plated onto poly-d-lysine-coated 6-well or 12-well dishes at a density of ∼150,000–200,000/cm2. Cells were maintained in Neurobasal medium (Invitrogen), with B27 serum-free supplements (Invitrogen), l-glutamine (0.5 mm), and penicillin/streptomycin (1%). More than 98% of the cells cultured under these conditions represent post-mitotic neurons (11Rideout H.J. Stefanis L. Mol. Cell. Neurosci. 2002; 21: 223-238Crossref PubMed Scopus (114) Google Scholar). Rat midbrain cultures derived from postnatal day 1 were prepared using standard procedures (13Cuervo A.M. Stefanis L. Fredenburg R. Lansbury P.T. Sulzer D. Science. 2004; 305: 1292-1295Crossref PubMed Scopus (1511) Google Scholar) with modifications. Briefly, material dissected form the ventral portion of the midbrain was cleaned free of meningeal tissue, minced, and enzymatically dissociated in a mixture of trypsin/DNase. Dissociated cells were plated at a density of ∼200,000 cells per cm2 on poly-d-lysine-coated plates. The neurons were maintained in neurobasal A medium with B27 serum-free supplements. Intracellular Protein Degradation—Total protein degradation in cultured cells (PC12 cells, cortical neurons) was measured by pulse-chase experiments (13Cuervo A.M. Stefanis L. Fredenburg R. Lansbury P.T. Sulzer D. Science. 2004; 305: 1292-1295Crossref PubMed Scopus (1511) Google Scholar, 29Franklin J.L. Johnson E.M. J. Cell Biol. 1998; 142: 1313-1324Crossref PubMed Scopus (43) Google Scholar) with modifications. Briefly, confluent PC12 cells or cortical neurons (day 7 in culture) were labeled with [3H]leucine (2 μCi/ml) (leucine, L-3,4,5; PerkinElmer Life Sciences) at 37 °C for 48 or 24 h respectively. The cultures were then extensively washed with medium and returned in complete growth medium containing 2 mm of unlabeled leucine for 6 h. This medium containing mainly short lived proteins was removed and replaced with fresh medium containing cold leucine, and/or the general lysosomal inhibitor NH4Cl (30Hart P.D. Young M.R. J. Exp. Med. 1991; 174: 881-889Crossref PubMed Scopus (123) Google Scholar), or the inhibitor of macroautophagy 3-MA (31Seglen P.O. Gordon P.B. Proc. Natl. Acad. Sci. U. S. A. 1982; 79: 1889-1892Crossref PubMed Scopus (1159) Google Scholar) at indicated concentrations. Aliquots of the medium were taken at different times (14 h for PC12 cells and 12 and 24 h after labeling for cortical neurons), and proteins in the medium were precipitated with 20% trichloroacetic acid for 20 min on ice and centrifuged (10,000 × g, 10 min, 4 °C). Radioactivity in the supernatant (representing degraded proteins) and pellet (representing undegraded proteins) was measured in a liquid scintillation counter (Wallac T414, PerkinElmer Life Sciences). At the last time point, cells were lysed with 0.1% NaOH. Proteolysis was expressed as the percentage of the initial total acid-precipitable radioactivity (protein) in the cell lysates transformed to acid-soluble radioactivity (amino acids and small peptides) in the medium during the incubation. Total radioactivity incorporated in cellular proteins was determined in triplicate samples as the amount of acid-precipitable radioactivity in labeled cells. Measurement of Half-lives of WT (Endogenous and Over-expressed) and ΔDQ/WT Synucleins—85% confluent cell cultures were grown in methionine/cysteine-deprived RPMI 1640 medium (Sigma) for 10 min and then labeled with [35S]methionine/cysteine mixture (0.2 mCi/ml) (Express Labeling Mix, PerkinElmer Life Sciences) for 2 h. For cortical neurons the radiolabeling was performed for 24 h in Neurobasal medium without previous amino acid starvation. After extensive washing with medium, cells were maintained in complete or serum-deprived medium (0.5% FBS) and at the indicated times lysed in RIPA buffer (150 mm NaCl, 50 mm Tris, pH 7.6, 0.1% SDS, 1% Triton X-100, 2 mm EDTA, and 0.1% deoxycholate) with protease inhibitors (complete mini, Roche Diagnostics) and subjected to immunoprecipitation with an antibody against ASYN. The antibodies used were the sc-7011 (C-20) rabbit polyclonal antibody (Santa Cruz Biotechnology) for PC12 and SH-SY5Y cells and the monoclonal Syn 1 antibody (BD Biosciences) for cortical cultures. Protein G+-agarose beads were from Santa Cruz Biotechnology. Immunoprecipitates were resolved by SDS-PAGE (12%), and the gels were dried and then exposed on a PhosphorImager Screen and quantified using Gel Analyzer version 1.0 software (Biosure, Greece). Western Immunoblotting—PC12 cells, SH-SY5Y cells, and primary neurons were washed twice in cold PBS and then harvested in lysis buffer (150 mm NaCl, 50 mm Tris, pH 7.6, 0.1% SDS, 1% Triton X-100, 2 mm EDTA) with protease inhibitors. Lysates were centrifuged at 10,000 × g for 10 min at 4 °C. The detergent-insoluble pellets were washed twice in PBS and resuspended in 2× Laemmli buffer. Protein concentrations in soluble fractions were determined using the Bradford or Lowry methods (Bio-Rad). Proteins were resolved on 12% SDS-polyacrylamide gels or 4–12% BisTris NuPAGE gels (Invitrogen) and transferred onto nitrocellulose membranes. Blots were probed with antibodies directed against the following: 1) ASYN, monoclonal Syn 1 (1:1000; BD Biosciences), polyclonal C20 (1:1000; Santa Cruz Biotechnology); 2) polyclonal Lamp2a (Igp96), (1:1000; Zymed Laboratories Inc.); 3) monoclonal Lamp1 (1:1000; Santa Cruz Biotechnology); 4) polyclonal ERK (loading control; 1:5000; Santa Cruz Biotechnology); 5) monoclonal GAPDH (1:1000; Chemicon); 6) monoclonal ubiquitin (1:750; Chemicon); 7) monoclonal GFP (1:500, Santa Cruz Biotechnology); 8) monoclonal β-actin (1:20,000; Sigma); and 9) polyclonal TH (1:1000, Chemicon). Blots were probed with horseradish peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch), visualized with Western Lightning® (PerkinElmer Life Sciences), and exposed to Super RX film (Fuji Film). After scanning the images, the intensity of each immunoreactive band was estimated by densitometric quantification using the Gel Analyzer version 1.0 software. Immunocytochemistry—Cortical or ventral midbrain neurons grown on 24-well plates were fixed in freshly prepared 3.7% formaldehyde for 45 min. Blocking was with 10% normal goat serum, 0.4% Triton X-100 for 1 h at room temperature. Mouse anti-ASYN (1:200; BD Biosciences) and rabbit anti-tyrosine hydroxylase (TH, 1:500; Calbiochem) antibodies were applied overnight at 4 °C. Fluorescent secondary antibodies (mouse Cy3, 1:250; rabbit Cy2, 1:150, Jackson ImmunoResearch) were added for 1 h. The fluorescent marker Hoechst 33258 (1 μm; Sigma) was used to assess cell nuclei. RT-PCR—Total RNA was extracted from cortical neurons 48 and 72 h after infection with the lentiviruses bearing the L1 or the scrambled siRNAs using TRIzol (Invitrogen), and cDNA was generated with the reverse transcription system (Invitrogen), according to the manufacturer's instructions. RT-PCR was performed using the cDNA as template. All primer pairs were optimized to be in the log -exponential phase of amplification. The following primers were used: 1) ASYN-forward, ttctgcggaagcctagagag, and ASYN-reverse, tcctccaacatttgtcacttgc (product size = 253 bp); 2) β-actin-forward, tcaccatggatgatgatatcgcc, and β-actin-reverse, ccacacgcagctcattgtagaagg (product size = 282 bp); all primers were from Clough and Stefanis (32Clough R.L. Stefanis L. FASEB J. 2007; 21: 596-607Crossref PubMed Scopus (42) Google Scholar). Products were subsequently resolved on 1% agarose gels and stained with ethidium bromide, and the signal intensity was quantified using Gel Analyzer version 1.0 software. Design of siRNAs and Cloning of Small Hairpin RNAs—A stem-loop structure incorporating the 21-nucleotide targeting rat Lamp2a sequence was created based on Rubinson et al. (33Rubinson D.A. Dillon C.P. Kwiatkowski A.V. Sievers C. Yang L. Kopinja J. Rooney D.L. Zhang M. Ihrig M.M. McManus M.T. Gertler F.B. Scott M.L. Van Parijs L. Nat. Genet. 2003; 33: 401-406Crossref PubMed Scopus (1336) Google Scholar), so that small hairpin RNA (shRNA) could be produced from the lentiviral vector PLL3.7 gift from Dr. Dimitrios Thanos (Laboratory for Molecular Biology, Biomedical Research Foundation of the Academy of Athens). Complementary oligonucleotides encoding the shRNAs were synthesized, annealed, and cloned into pLL3.7 vector by ligation into HpaI- and XhoI-digested vector (L1 vector). The pLL3.7 vector carries loxP sites, a cytomegalovirus promoter driving expression of EGFP, and the mouse U6 promoter with downstream restriction sites (HpaI and XhoI) to allow efficient introduction of oligonucleotides encoding shRNAs. Lentivirus Production—The lentiviruses were generated by co-transfection of human embryonic kidney (HEK) 293T cells with three plasmids using the calcium phosphate method (34Dull T. Zufferey R. Kelly M. Mandel R.J. Nguyen M. Trono D. Naldini L. J. Virol. 1998; 72: 8463-8471Crossref PubMed Google Scholar). We cultured HEK 293T cells in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% FBS and 1% penicillin/streptomycin. For transfection, 107 cells were plated into 150-cm2 flasks. The next day, the 293T cells were transfected with 50 μg of vector DNA (PLL3.7-L1, PLL3.7-scr), 17.5 μgof pMDG2 (env), and 32.5 μg of R8 91 (gag/pol) plasmids, using calcium-phosphate precipitation (all the plasmids for lentiviral vector packaging were kindly provided by Dr. Dimitrios Thanos). After 16 h, the medium was removed, and the cells were washed twice with PBS and returned to the normal culture medium. Medium containing recombinant lentivectors was collected at 24, 48, and 72 h post-transfection and centrifuged (400 × g, 10 min, 4 °C) to remove cellular debris. After filtration through 0.45-μm filter unit (Millipore), the supernatant from each time point was centrifuged at 75,000 × g or 90 min at 4 °C in Sorvall Discovery TH641 swing bucket rotor. The supernatant was discarded, and the virus (pellet) was resuspended in 50 μl/tube of PBS supplemented with 0.5% bovine serum albumin, aliquoted, and stored at –80 °C. Lentiviral titers for the viruses collected each day were determined by seeding HeLa cells in 12-well plates at 5 × 104 cells per well, 3–4 h before infection with serial dilutions of the concentrated viral stock. After incubation for 2 days, the medium was removed, and the EGFP-expressing cells were identified using a fluorescence-activated cell sorter. Titers ranged from 3 to 6 × 107 infectious units (IU/m

Alpha-synuclein mutations have been identified in certain families with Parkinson's disease (PD), and alpha-synuclein is a major component of Lewy bodies. Other genetic data indicate that the ubiquitin-dependent proteolytic system is involved in PD pathogenesis. We have generated stable PC12 cell lines expressing wild-type or A53T mutant human alpha-synuclein. Lines expressing mutant but not wild-type alpha-synuclein show: (1) disruption of the ubiquitin-dependent proteolytic system, manifested by small cytoplasmic ubiquitinated aggregates and by an increase in polyubiquitinated proteins; (2) enhanced baseline nonapoptotic death; (3) marked accumulation of autophagic-vesicular structures; (4) impairment of lysosomal hydrolysis and proteasomal function; and (5) loss of catecholamine-secreting dense core granules and an absence of depolarization-induced dopamine release. Such findings raise the possibility that the primary abnormality in these cells may involve one or more deficits in the lysosomal and/or proteasomal degradation pathways, which in turn lead to loss of dopaminergic capacity and, ultimately, to death. These cells may serve as a model to study the effects of aberrant alpha-synuclein on dopaminergic cell function and survival.

Increased numbers of autophagosomes/autophagic vacuoles are seen in a variety of physiological and pathological states in the nervous system. In many cases, it is unclear if this phenomenon is the result of increased autophagic activity or decreased autophagosome-lysosome fusion. The functional significance of autophagy and its relationship to cell death in the nervous system is also poorly understood. In this review, we have considered these issues in the context of acute neuronal injury and a range of chronic neurodegenerative conditions, including the Lurcher mouse, Alzheimer's, Parkinson's, Huntington's and prion diseases. While many issues remain unresolved, these conditions raise the possibility that autophagy can have either deleterious or protective effects depending on the specific situation and stage in the pathological process.

α-Synuclein (α-syn), a protein implicated in Parkinson's disease pathogenesis, is a presynaptic protein suggested to regulate transmitter release. We explored how α-syn overexpression in PC12 and chromaffin cells, which exhibit low endogenous α-syn levels relative to neurons, affects catecholamine release. Overexpression of wild-type or A30P mutant α-syn in PC12 cell lines inhibited evoked catecholamine release without altering calcium threshold or cooperativity of release. Electron micrographs revealed that vesicular pools were not reduced but that, on the contrary, a marked accumulation of morphologically “docked” vesicles was apparent in the α-syn-overexpressing lines. We used amperometric recordings from chromaffin cells derived from mice that overexpress A30P or wild-type (WT) α-syn, as well as chromaffin cells from control and α-syn null mice, to determine whether the filling of vesicles with the transmitter was altered. The quantal size and shape characteristics of amperometric events were identical for all mouse lines, suggesting that overexpression of WT or mutant α-syn did not affect vesicular transmitter accumulation or the kinetics of vesicle fusion. The frequency and number of exocytotic events per stimulus, however, was lower for both WT and A30P α-syn-overexpressing cells. The α-syn-overexpressing cells exhibited reduced depression of evoked release in response to repeated stimuli, consistent with a smaller population of readily releasable vesicles. We conclude that α-syn overexpression inhibits a vesicle “priming” step, after secretory vesicle trafficking to “docking” sites but before calcium-dependent vesicle membrane fusion.

The mechanisms through which aberrant alpha-synuclein (ASYN) leads to neuronal death in Parkinson's disease (PD) are uncertain. In isolated liver lysosomes, mutant ASYNs impair Chaperone Mediated Autophagy (CMA), a targeted lysosomal degradation pathway; however, whether this occurs in a cellular context, and whether it mediates ASYN toxicity, is unknown. We have investigated presently the effects of WT or mutant ASYN on the lysosomal pathways of CMA and macroautophagy in neuronal cells and assessed their impact on ASYN-mediated toxicity.Novel inducible SH-SY5Y and PC12 cell lines expressing human WT and A53T ASYN, as well as two mutant forms that lack the CMA-targeting motif were generated. Such forms were also expressed in primary cortical neurons, using adenoviral transduction. In each case, effects on long-lived protein degradation, LC3 II levels (as a macroautophagy index), and cell death and survival were assessed. In both PC12 and SH-SY5Y cycling cells, induction of A53T ASYN evoked a significant decrease in lysosomal degradation, largely due to CMA impairment. In neuronally differentiated SH-SH5Y cells, both WT and A53T ASYN induction resulted in gradual toxicity, which was partly dependent on CMA impairment and compensatory macroautophagy induction. In primary neurons both WT and A53T ASYN were toxic, but only in the case of A53T ASYN did CMA dysfunction and compensatory macroautophagy induction occur and participate in death.Expression of mutant A53T, and, in some cases, WT ASYN in neuronal cells leads to CMA dysfunction, and this in turn leads to compensatory induction of macroautophagy. Inhibition of these lysosomal effects mitigates ASYN toxicity. Therefore, CMA dysfunction mediates aberrant ASYN toxicity, and may be a target for therapeutic intervention in PD and related disorders. Furthermore, macroautophagy induction in the context of ASYN over-expression, in contrast to other settings, appears to be a detrimental response, leading to neuronal death.

Substantial genetic, neuropathological, and biochemical evidence implicates the presynaptic neuronal protein α-synuclein in Parkinson's disease and related Lewy body disorders. How dysregulation of α-synuclein leads to neurodegeneration is, however, unclear. Soluble oligomeric, but not fully fibrillar, α-synuclein is thought to be toxic. The major neuronal target of aberrant α-synuclein might be the synapse. The effects of aberrant α-synuclein might include alteration of calcium homoeostasis or mitochondrial fragmentation and, in turn, mitochondrial dysfunction, which could link α-synuclein dysfunction to recessive and toxin-induced parkinsonism. α-Synuclein also seems to be linked to other genetic forms of Parkinson's disease, such as those linked to mutations in GBA or LRRK2, possibly through common effects on autophagy and lysosomal function. Finally, α-synuclein is physiologically secreted, and this extracellular form could lead to the spread of pathological accumulations and disease progression. Consequently, factors that regulate the levels, post-translational modifications, specific aberrant cellular effects, or secretion of α-synuclein might be targets for therapy.

Background Background The leucine-rich repeat kinase 2 gene (LRRK2) harbours highly penetrant mutations that are linked to familial parkinsonism. However, the extent of its polymorphic variability in relation to risk of Parkinson's disease (PD) has not been assessed systematically. We therefore assessed the frequency of LRRK2 exonic variants in individuals with and without PD, to investigate the role of the variants in PD susceptibility. Methods LRRK2 was genotyped in patients with PD and controls from three series (white, Asian, and Arab–Berber) from sites participating in the Genetic Epidemiology of Parkinson's Disease Consortium. Genotyping was done for exonic variants of LRRK2 that were identified through searches of literature and the personal communications of consortium members. Associations with PD were assessed by use of logistic regression models. For variants that had a minor allele frequency of 0·5% or greater, single variant associations were assessed, whereas for rarer variants information was collapsed across variants. Findings 121 exonic LRRK2 variants were assessed in 15 540 individuals: 6995 white patients with PD and 5595 controls, 1376 Asian patients and 962 controls, and 240 Arab–Berber patients and 372 controls. After exclusion of carriers of known pathogenic mutations, new independent risk associations were identified for polymorphic variants in white individuals (M1646T, odds ratio 1·43, 95% CI 1·15–1·78; p=0·0012) and Asian individuals (A419V, 2·27, 1·35–3·83; p=0·0011). A protective haplotype (N551K-R1398H-K1423K) was noted at a frequency greater than 5% in the white and Asian series, with a similar finding in the Arab–Berber series (combined odds ratio 0·82, 0·72–0·94; p=0·0043). Of the two previously reported Asian risk variants, G2385R was associated with disease (1·73, 1·20–2·49; p=0·0026), but no association was noted for R1628P (0·62, 0·36–1·07; p=0·087). In the Arab–Berber series, Y2189C showed potential evidence of risk association with PD (4·48, 1·33–15·09; p=0·012). Interpretation The results for LRRK2 show that several rare and common genetic variants in the same gene can have independent effects on disease risk. LRRK2, and the pathway in which it functions, is important in the cause and pathogenesis of PD in a greater proportion of patients with this disease than previously believed. These results will help discriminate those patients who will benefit most from therapies targeted at LRRK2 pathogenic activity. Funding Michael J Fox Foundation and National Institutes of Health.

ABSTRACT Evidence from human postmortem material, transgenic mice, and cellular/animal models of PD link alpha‐synuclein accumulation to alterations in the autophagy lysosomal pathway. Conversely, alpha‐synuclein mutations related to PD pathogenesis, as well as post‐translational modifications of the wild‐type protein, result in the generation of aberrant species that may impair further the function of the autophagy lysosomal pathway, thus generating a vicious cycle leading to neuronal death. Moreover, PD‐linked mutations in lysosomal‐related genes, such as glucocerebrosidase, have been also shown to contribute to alpha‐synuclein accumulation and related toxicity, indicating that lysosomal dysfunction may, in part, account for the neurodegeneration observed in synucleinopathies. In the current review, we summarize findings related to the inter‐relationship between alpha‐synuclein and lysosomal proteolytic pathways, focusing especially on recent experimental strategies based on the manipulation of the autophagy lysosomal pathway to counteract alpha‐synuclein‐mediated neurotoxicity in vivo. Pinpointing the factors that regulate alpha‐synuclein association to the lysosome may represent potential targets for therapeutic interventions in PD and related synucleinopathies. © 2016 International Parkinson and Movement Disorder Society

Variants of UNC13A, a critical gene for synapse function, increase the risk of amyotrophic lateral sclerosis and frontotemporal dementia1-3, two related neurodegenerative diseases defined by mislocalization of the RNA-binding protein TDP-434,5. Here we show that TDP-43 depletion induces robust inclusion of a cryptic exon in UNC13A, resulting in nonsense-mediated decay and loss of UNC13A protein. Two common intronic UNC13A polymorphisms strongly associated with amyotrophic lateral sclerosis and frontotemporal dementia risk overlap with TDP-43 binding sites. These polymorphisms potentiate cryptic exon inclusion, both in cultured cells and in brains and spinal cords from patients with these conditions. Our findings, which demonstrate a genetic link between loss of nuclear TDP-43 function and disease, reveal the mechanism by which UNC13A variants exacerbate the effects of decreased TDP-43 function. They further provide a promising therapeutic target for TDP-43 proteinopathies.

Amyotrophic lateral sclerosis (ALS) is a fatal neurodegenerative disease characterized by the progressive loss of motor neurons. While several pathogenic mutations have been identified, the vast majority of ALS cases have no family history of disease. Thus, for most ALS cases, the disease may be a product of multiple pathways contributing to varying degrees in each patient. Using machine learning algorithms, we stratify the transcriptomes of 148 ALS postmortem cortex samples into three distinct molecular subtypes. The largest cluster, identified in 61% of patient samples, displays hallmarks of oxidative and proteotoxic stress. Another 19% of the samples shows predominant signatures of glial activation. Finally, a third group (20%) exhibits high levels of retrotransposon expression and signatures of TARDBP/TDP-43 dysfunction. We further demonstrate that TDP-43 (1) directly binds a subset of retrotransposon transcripts and contributes to their silencing in vitro, and (2) pathological TDP-43 aggregation correlates with retrotransposon de-silencing in vivo.

α-Synuclein levels are critical to Parkinson's disease pathogenesis. Wild-type α-synuclein is degraded partly by chaperone-mediated autophagy, and aberrant α-synuclein may act as an inhibitor of the pathway. To address whether the induction of chaperone-mediated autophagy may represent a potential therapy against α-synuclein-induced neurotoxicity, we overexpressed lysosomal-associated membrane protein 2a, the rate-limiting step of chaperone-mediated autophagy, in human neuroblastoma SH-SY5Y cells, rat primary cortical neurons in vitro, and nigral dopaminergic neurons in vivo. Overexpression of the lysosomal-associated membrane protein 2a in cellular systems led to upregulation of chaperone-mediated autophagy, decreased α-synuclein turnover, and selective protection against adenoviral-mediated wild-type α-synuclein neurotoxicity. Protection was observed even when the steady-state levels of α-synuclein were unchanged, suggesting that it occurred through the attenuation of α-synuclein-mediated dysfunction of chaperone-mediated autophagy. Overexpression of the lysosomal receptor through the nigral injection of recombinant adeno-associated virus vectors effectively ameliorated α-synuclein-induced dopaminergic neurodegeneration by increasing the survival of neurons located in the substantia nigra as well as the axon terminals located in the striatum, which was associated with a reduction in total α-synuclein levels and related aberrant species. We conclude that induction of chaperone-mediated autophagy may provide a novel therapeutic strategy in Parkinson's disease and related synucleinopathies through two different mechanisms: amelioration of dysfunction of chaperone-mediated autophagy and lowering of α-synuclein levels.

ABSTRACT Background The International Parkinson and Movement Disorder Society recently introduced a methodology for probability score calculation for prodromal PD. Objectives To assess the probability of prodromal PD in an older population and investigate its possible association with Mediterranean diet adherence. Methods Data from a population‐based cohort study of older adults (HEllenic Longitudinal Investigation of Aging and Diet) in Greece were used. Probability of prodromal PD was calculated according to International Parkinson and Movement Disorder Society research criteria. A detailed food frequency questionnaire was used to evaluate dietary intake and calculate Mediterranean diet adherence score, ranging from 0 to 55, with higher scores indicating higher adherence. Results Median probability of prodromal PD was 1.9%, ranging from 0.2 to 96.7% in 1,731 PD‐free individuals aged ≥ 65 (41% male). Lower probability for prodromal PD ( P < 0.001) in the higher Mediterranean diet adherence groups was noted, driven mostly by nonmotor markers of prodromal PD, depression, constipation, urinary dysfunction, and daytime somnolence. Each unit increase in Mediterranean diet score was associated with a 2% decreased probability for prodromal PD ( P < 0.001). Compared to participants in the lowest quartile of Mediterranean diet adherence, those in the highest quartile were associated with a ∼21% lower probability for prodromal PD. Conclusions Adherence to the Mediterranean diet is associated with lower probability of prodromal PD in older people. Further studies are needed to elucidate the potential causality of this association, potential relation of the Mediterranean diet to delayed onset or lower incidence of PD, as well as the underlying neurobiological mechanisms. © 2018 International Parkinson and Movement Disorder Society

Abstract The levels and conformers of alpha‐synuclein are critical in the pathogenesis of Parkinson's Disease and related synucleinopathies. Homeostatic mechanisms in protein degradation and secretion have been identified as regulators of alpha‐synuclein at different stages of its intracellular trafficking and transcellular propagation. Here we review pathways involved in the removal of various forms of alpha‐synuclein from both the intracellular and extracellular environment. Proteasomes and lysosomes are likely to play complementary roles in the removal of intracellular alpha‐synuclein species, in a manner that depends on alpha‐synuclein post‐translational modifications. Extracellular alpha‐synuclein is cleared by extracellular proteolytic enzymes, or taken up by neighboring cells, especially microglia and astrocytes, and degraded within lysosomes. Exosomes, on the other hand, represent a vehicle for egress of excess burden of the intracellular protein, potentially contributing to the transfer of alpha‐synuclein between cells. Dysfunction in any one of these clearance mechanisms, or a combination thereof, may be involved in the initiation or progression of Parkinson's disease, whereas targeting these pathways may offer an opportunity for therapeutic intervention. image This article is part of the Special Issue “Synuclein”.

With the advent of the genetic era in Parkinson's disease (PD) research in 1997, α-synuclein was identified as an important player in a complex neurodegenerative disease that affects >10 million people worldwide. PD has been estimated to have an economic impact of $51.9 billion in the US alone. Since the initial association with PD, hundreds of researchers have contributed to elucidating the functions of α-synuclein in normal and pathological states, and these remain critical areas for continued research. With this position paper the authors strive to achieve two goals: first, to succinctly summarize the critical features that define α-synuclein's varied roles, as they are known today; and second, to identify the most pressing knowledge gaps and delineate a multipronged strategy for future research with the goal of enabling therapies to stop or slow disease progression in PD.

Proteasomal dysfunction has been recently implicated in the pathogenesis of several neurodegenerative diseases, including Parkinson's disease and diffuse Lewy body disease. We have developed an in vitro model of proteasomal dysfunction by applying pharmacological inhibitors of the proteasome, lactacystin or ZIE[O-tBu]-A-leucinal (PSI), to dopaminergic PC12 cells. Proteasomal inhibition caused a dose-dependent increase in death of both naive and neuronally differentiated PC12 cells, which could be prevented by caspase inhibition or CPT-cAMP. A percentage of the surviving cells contained discrete cytoplasmic ubiquitinated inclusions, some of which also contained synuclein-1, the rat homologue of human alpha-synuclein. However the total level of synuclein-1 was not altered by proteasomal inhibition. The ubiquitinated inclusions were present only within surviving cells, and their number was increased if cell death was prevented. We have thus replicated, in this model system, the two cardinal pathological features of Lewy body diseases, neuronal death and the formation of cytoplasmic ubiquitinated inclusions. Our findings suggest that inclusion body formation and cell death may be dissociated from one another.

Here, we compare the pathways by which DNA-damaging agents, NGF deprivation, and superoxide dismutase 1 (SOD1) depletion evoke apoptosis of sympathetic neurons. Previous work raised the hypothesis that cell cycle signaling plays a required role in neuronal apoptosis elicited by NGF deprivation and the DNA-damaging agent camptothecin. To test this hypothesis, we extended our investigation of DNA-damaging agents to cytosine arabinoside (AraC) and UV irradiation. As with NGF deprivation and camptothecin treatment, the cyclin-dependent kinase inhibitors flavopiridol and olomoucine protected neurons from apoptosis induced by AraC and UV treatment. These observations support the model that camptothecin, AraC, and UV treatment cause DNA damage, which leads to apoptosis by a mechanism that, as in the case of NGF deprivation, includes activation of cell cycle components. Flavopiridol and olomoucine, however, had no effect on death induced by SOD1 depletion, suggesting that CDKs do not play a role in this paradigm of neuronal death. To compare further the mechanisms of death evoked by NGF withdrawal, SOD1 depletion, and DNA-damaging agents, we investigated their responses to inhibitors of cysteine aspartases, elements of apoptotic pathways. The V-ICE inh and BAF, two peptide inhibitors of cysteine aspartases, protected neurons in all three death paradigms. In contrast, the cysteine aspartase inhibitory peptide zVAD-fmk conferred protection from NGF withdrawal and SOD1 depletion, but not DNA-damaging agents, whereas acYVAD-cmk protected only from SOD1 depletion. Taken together, these findings indicate that three different apoptotic stimuli activate separate pathways of death in the same neuron type.

alpha-Synuclein is an abundant presynaptic protein implicated in neuronal plasticity and neurodegenerative diseases. Although the function of alpha-synuclein is not thoroughly elucidated, we found that alpha-synuclein regulates dopamine synthesis by binding to and inhibiting tyrosine hydroxylase, the rate limiting enzyme in dopamine synthesis. Understanding alpha-synuclein function in dopaminergic cells should add to our knowledge of this key protein, which is implicated in Parkinson's disease and other disorders. Herein, we report a mechanism by which alpha-synuclein diminishes tyrosine hydroxylase phosphorylation and activity in stably transfected dopaminergic cells. Short-term regulation of tyrosine hydroxylase depends on the phosphorylation of key seryl residues in the amino-terminal regulatory domain of the protein. Of these, Ser40 contributes significantly to tyrosine hydroxylase activation and dopamine synthesis. We observed that alpha-synuclein overexpression caused reduced Ser40 phosphorylation in MN9D cells and inducible PC12 cells. Ser40 is phosphorylated chiefly by the cyclic AMP-dependent protein kinase PKA and dephosphorylated almost exclusively by the protein phosphatase, PP2A. Therefore, we measured the impact of alpha-synuclein overexpression on levels and activity of PKA and PP2A in our cells. PKA was unaffected by alpha-synuclein. PP2A protein levels also were unchanged, however, the activity of PP2A increased in parallel with alpha-synuclein expression. Inhibition of PP2A dramatically increased Ser40 phosphorylation only in alpha-synuclein overexpressors in which alpha-synuclein was also found to co-immunoprecipitate with PP2A. Together the data reveal a functional interaction between alpha-synuclein and PP2A that leads to PP2A activation and underscores a key role for alpha-synuclein in protein phosphorylation.

Previous studies indicate that activation of c-Jun kinase (JNK) is necessary for apoptosis of trophic factor-deprived PC12 cells and that death in this system is suppressed by multiple agents, including BCL2, inhibitors of the interleukin-1-converting enzyme (ICE) family of proteases, blockers of transcription, and a variety of small molecules with differing modes of action. Here, we determine the order in which these agents block apoptosis relative to JNK activation. Overexpression of BCL2 promotes PC12 cell survival and blocks JNK activation caused by trophic factor withdrawal. Similarly, the survival-promoting agents aurintricarboxylic acid, <i>N</i>-acetylcysteine, the nitric oxide generator diethylenetriamine nitric oxide, 8-bromo-cGMP, and 8-(4-chlorophenylthio)-cAMP act upstream to inhibit JNK activation. In contrast, zVAD-fluoromethylketone (a permeant ICE family inhibitor), actinomycin D, and the G₁/S cell cycle inhibitor deferoxamine, all promote survival after trophic factor withdrawal, but do not affect JNK activation. These findings are consistent with the presence of an ordered cell death pathway triggered by trophic factor deprivation in which 1) BCL2 and a number of survival-promoting agents act upstream of JNK, 2) ICE family protease actions, regulated genes required for cell death, and certain cell cycle blockers lie either downstream of JNK or on independent pathways required for apoptotic death.

This study investigates the mechanisms underlying death of cultured embryonic cortical neurons exposed to the DNA-damaging agent camptothecin and in particular the interdependence of the roles of cyclin-dependent kinases (Cdks), caspases, and mitochondrial function. Camptothecin evokes rapid neuronal death that exhibits nuclear features of apoptosis. This death is accompanied by loss of cytochrome c and mitochondrial transmembrane potential as well as by induction of caspase-3-like activity and caspase-2 processing. The Cdk inhibitor flavopiridol provides long-term rescue from death and prevents loss of cytochrome c and mitochondrial transmembrane potential as well as caspase activation and processing. General caspase inhibitors rescue neurons from this rapid apoptotic death but do not prevent them from undergoing delayed death in which nuclear features of apoptosis are absent. Moreover, the caspase inhibitors do not affect early cytochrome c release and delay but do not prevent the loss of transmembrane potential. Agents that directly disrupt mitochondrial function without inducing cytochrome c release lead to a caspase-independent death. These observations favor a model in which (1) DNA damage leads to Cdk activation, which lies upstream of release of cytochrome c and caspase activation; (2) cytochrome c release is caspase-independent and may occur upstream of caspase activation; (3) early apoptotic death requires caspases; and (4) delayed nonapoptotic death that occurs in the presence of caspase inhibitors is a consequence of prolonged loss of mitochondrial function. These findings shed light on the mechanisms by which DNA damage kills neurons and raise questions regarding the general utility of caspase inhibitors as neurotherapeutic agents.

We compare here the mechanisms of apoptotic death of PC12 cells induced by down-regulation of Cu2+,Zn2+ superoxide dismutase (SOD1) and withdrawal of trophic support (serum/nerve growth factor). Our previous results indicated that the initiating causes of death are different in each paradigm. However, bcl-2 rescues cells in either paradigm, suggesting common downstream elements to the cell death pathway. To determine whether the ICE [interleukin 1beta converting enzyme] family of proteases, which is required for apoptosis on trophic factor withdrawal, is also required for apoptosis induced by oxidative stress, we have developed a novel peptide inhibitor that mimics the common catalytic site of these enzymes and thereby blocks their access to substrates. This differs from the more usual pseudosubstrate approach to enzyme inhibition. Blockade of ICE family proteases by either this inhibitor or by a permeant competitive ICE family antagonist rescues PC12 cells from apoptotic death following apoptosis induced by down-regulation of SOD1, as well as from trophic factor/nerve growth factor deprivation. SOD1 down-regulation results in an increase in interleukin 1beta (IL- 1beta) production by the cells, and cell death under these conditions can be prevented by either blocking antibodies against IL-1beta or the IL-1 receptor antagonist (IL-1Ralpha). In contrast, trophic factor withdrawal does not increase IL-1beta secretion, and the blocking antibody failed to protect PC12 cells from trophic factor withdrawal, whereas the receptor antagonist was only partially protective at very high concentrations. There were substantial differences in the concentrations of pseudosubstrate inhibitors which rescued cells from SOD1 down-regulation and trophic factor deprivation. These results suggest the involvement of different members of the ICE family, different substrates, or both in the two different initiating causes of cell death.

Proteasomal dysfunction may play a role in neurodegenerative conditions and protein aggregation. Overexpression in neuronal cells of α-synuclein, a molecule linked to Parkinson's Disease, may lead to proteasomal dysfunction. Using PC12 cells stably expressing wild-type or mutant α-synuclein and gel filtration, we demonstrate that soluble, intermediate size oligomers of α-synuclein co-elute with the 26S proteasome. These soluble oligomers associate with the 26S proteasome and are significantly increased following treatment with proteasomal, but not lysosomal, inhibitors, indicating specific degradation of these particular species by the 26S proteasome. Importantly, expression of α-synuclein resulted in a significant inhibition of all proteasomal activities without affecting the levels or assembly of the 26S proteasome. Pharmacological dissociation of α-synuclein oligomers restored proteasomal function and reduced polyubiquitinated protein load in intact cells. Our findings suggest a model where only a subset of specific soluble cell-derived α-synuclein oligomers is targeted to the 26S proteasome for degradation, and simultaneously inhibit its function, likely by impeding access of other proteasomal substrates.

Ubiquitinated inclusions are a common feature of many neurodegenerative conditions. We have proposed that, at least in part, such inclusions may be formed due to dysfunction of the proteasome. We have modeled such proteasomal dysfunction by applying pharmacological inhibitors to cultured embryonic rat cortical neurons. This treatment leads to neuronal death and formation of ubiquitin/α-synuclein-positive cytoplasmic inclusions. At late time points following proteasomal inhibition such inclusions are no longer discerned. Instead, many neurons accumulate small ubiquitinated aggregates, which may represent remnants of the inclusions. In this work we have examined a potential mechanism for inclusion dissolution. Electron microscopy images showed activation of macroautophagy at late time points after proteasomal inhibition. Labeling with LysoTracker Red, a dye that accumulates in acidic compartments, or immunostaining for the lysosomal enzyme Cathepsin D, showed an increase in globular staining. Cathepsin D co-localized partially with small ubiquitinated aggregates, but not inclusions. Application of an inhibitor of macroautophagy or of the vacuolar ATPase led to an increase in the number of inclusions and a decrease in small aggregates, whereas an activator of autophagy had the opposite effects. There was no significant change in apoptotic death following these manipulations. We conclude that, following proteasomal inhibition of cultured cortical neurons, there is activation of macroautophagy and of the lysosomal pathway. This activation results in dissolution of ubiquitinated inclusions into small aggregates, without directly impacting neuronal cell death. These data further support the idea that in this model inclusions and neuronal cell death are independent processes.

<h3>Objective:</h3> Eleven genetic loci have reached genome-wide significance in a recent meta-analysis of genome-wide association studies in Parkinson disease (PD) based on populations of Caucasian descent. The extent to which these genetic effects are consistent across different populations is unknown. <h3>Methods:</h3> Investigators from the Genetic Epidemiology of Parkinson9s Disease Consortium were invited to participate in the study. A total of 11 SNPs were genotyped in 8,750 cases and 8,955 controls. Fixed as well as random effects models were used to provide the summary risk estimates for these variants. We evaluated between-study heterogeneity and heterogeneity between populations of different ancestry. <h3>Results:</h3> In the overall analysis, single nucleotide polymorphisms (SNPs) in 9 loci showed significant associations with protective per-allele odds ratios of 0.78–0.87 (<i>LAMP3</i>, <i>BST1</i>, and <i>MAPT</i>) and susceptibility per-allele odds ratios of 1.14–1.43 (<i>STK39</i>, <i>GAK</i>, <i>SNCA</i>, <i>LRRK2</i>, <i>SYT11</i>, and <i>HIP1R</i>). For 5 of the 9 replicated SNPs there was nominally significant between-site heterogeneity in the effect sizes (<i>I</i>² estimates ranged from 39% to 48%). Subgroup analysis by ethnicity showed significantly stronger effects for the <i>BST1</i> (rs11724635) in Asian vs Caucasian populations and similar effects for <i>SNCA</i>, <i>LRRK2</i>, <i>LAMP3</i>, <i>HIP1R</i>, and <i>STK39</i> in Asian and Caucasian populations, while <i>MAPT</i> rs2942168 and SYT11 rs34372695 were monomorphic in the Asian population, highlighting the role of population-specific heterogeneity in PD. <h3>Conclusion:</h3> Our study allows insight to understand the distribution of newly identified genetic factors contributing to PD and shows that large-scale evaluation in diverse populations is important to understand the role of population-specific heterogeneity. <i>Neurology</i>® 2012;79:659–667

Significance Parkinson’s disease (PD) is an incurable neurodegenerative disorder characterized by motor and nonmotor deficits, including cognitive decline and dementia. The protein αSyn is strongly associated with PD pathogenesis, whereas αSyn mutations, such as p.A53T, cause familial forms of PD. Animal models are crucial for understanding PD pathogenesis, but there are limitations in the extent to which these models reproduce faithfully the human disease. Cell-reprogramming technologies allow the generation of human neurons from patients with PD, but it has proven difficult to identify cellular pathologies in induced pluripotent stem cell–derived neurons. In this study, we created a robust p.A53T patient–derived model of PD that captures disease-related phenotypes under basal conditions, thus providing a unique system for studies of disease mechanisms and development of therapeutics.

Abstract Lewy body diseases share clinical, pathological, genetic and biochemical signatures, and are regarded as a highly heterogeneous group of neurodegenerative disorders. Inclusive of Parkinson's disease ( PD ), Parkinson's disease dementia ( PDD ) and dementia with Lewy bodies ( DLB ), controversy still exists as to whether they should be considered as separate disease entities or as part of the same disease continuum. Here we discuss emerging knowledge relating to both clinical, and neuropathological differences and consider current biomarker strategies as we try to improve our diagnostic capabilities and design of disease modifying therapeutics for this group of debilitating neurodegenerative disorders. image This article is part of the Special Issue “Synuclein”.

In the present study, we investigated the role of the main intracellular energy sensor, AMP-activated protein kinase (AMPK), in the in vitro neurotoxicity of α-synuclein (ASYN), one of the key culprits in the pathogenesis of Parkinson's disease. The loss of viability in retinoic acid-differentiated SH-SY5Y human neuroblastoma cells inducibly overexpressing wild-type ASYN was associated with the reduced activation of AMPK and its activator LKB1, as well as AMPK target Raptor. ASYN-overexpressing rat primary neurons also displayed lower activity of LKB1/AMPK/Raptor pathway. Restoration of AMPK activity by metformin or AICAR reduced the in vitro neurotoxicity of ASYN overexpression, acting independently of the prosurvival kinase Akt or the induction of autophagic response. The conditioned medium from ASYN-overexpressing cells, containing secreted ASYN, as well as dopamine-modified or nitrated recombinant ASYN oligomers, all inhibited AMPK activation in differentiated SH-SY5Y cells and reduced their viability, but not in the presence of metformin or AICAR. The RNA interference-mediated knockdown of AMPK increased the sensitivity of SH-SY5Y cells to the harmful effects of secreted ASYN. AMPK-dependent protection from extracellular ASYN was also observed in rat neuron-like pheochromocytoma cell line PC12. These data demonstrate the protective role of AMPK against the toxicity of both intracellular and extracellular ASYN, suggesting that modulation of AMPK activity may be a promising therapeutic strategy in Parkinson's disease.

Two recent studies identified a mutation (p.Asp620Asn) in the vacuolar protein sorting 35 gene as a cause for an autosomal dominant form of Parkinson disease . Although additional missense variants were described, their pathogenic role yet remains inconclusive.We performed the largest multi-center study to ascertain the frequency and pathogenicity of the reported vacuolar protein sorting 35 gene variants in more than 15,000 individuals worldwide. p.Asp620Asn was detected in 5 familial and 2 sporadic PD cases and not in healthy controls, p.Leu774Met in 6 cases and 1 control, p.Gly51Ser in 3 cases and 2 controls. Overall analyses did not reveal any significant increased risk for p.Leu774Met and p.Gly51Ser in our cohort.Our study apart from identifying the p.Asp620Asn variant in familial cases also identified it in idiopathic Parkinson disease cases, and thus provides genetic evidence for a role of p.Asp620Asn in Parkinson disease in different populations worldwide.

Chaperone-mediated autophagy (CMA) involves the selective lysosomal degradation of cytosolic proteins such as SNCA (synuclein α), a protein strongly implicated in Parkinson disease (PD) pathogenesis. However, the physiological role of CMA and the consequences of CMA failure in the living brain remain elusive. Here we show that CMA inhibition in the adult rat substantia nigra via adeno-associated virus-mediated delivery of short hairpin RNAs targeting the LAMP2A receptor, involved in CMA's rate limiting step, was accompanied by intracellular accumulation of SNCA-positive puncta, which were also positive for UBIQUITIN, and in accumulation of autophagic vacuoles within LAMP2A-deficient nigral neurons. Strikingly, LAMP2A downregulation resulted in progressive loss of nigral dopaminergic neurons, severe reduction in striatal dopamine levels/terminals, increased astro- and microgliosis and relevant motor deficits. Thus, this study highlights for the first time the importance of the CMA pathway in the dopaminergic system and suggests that CMA impairment may underlie PD pathogenesis.

Alpha-synuclein (α-syn) aggregation represents the pathological hallmark of α-synucleinopathies like Parkinson's disease (PD), dementia with Lewy bodies (DLB), and multiple system atrophy (MSA). Toll-like receptors (TLRs) are a family of highly conserved molecules that recognize pathogen-associated molecular patterns and define the innate immunity response. It was previously shown that TLR4 plays a role in the clearance of α-syn, suggesting that TLR4 up-regulation in microglia may be a natural mechanism to improve the clearance of α-syn. However, administration of TLR4 ligands could also lead to dangerous adverse effects associated with the induction of toxic inflammatory responses. Monophosphoryl lipid A (MPLA) is a TLR4 selective agonist and a potent inducer of phagocytosis which does not trigger strong toxic inflammatory responses as compared to lipopolysaccharide (LPS). We hypothesize that MPLA treatment will lead to increased clearance of α-syn inclusions in the brain of transgenic mice overexpressing α-syn in oligodendrocytes under the proteolipid protein promoter (PLP-α-syn mouse model of MSA), without triggering toxic cytokine release, thus leading to a general amelioration of the pathology.Six month old PLP-α-syn mice were randomly allocated to four groups and received weekly intraperitoneal injections of MPLA (50 or 100 μg), LPS or vehicle. After a 12-week treatment period, motor behavior was assessed with the pole test. Brains and plasma samples were collected for neuropathological and immunological analysis.Chronic systemic MPLA treatment of PLP-α-syn mice led to increased uptake of α-syn by microglial cells, a significant motor improvement, rescue of nigral dopaminergic and striatal neurons and region-specific reduction of the density of oligodendroglial α-syn cytoplasmic inclusions in the absence of a marked systemic inflammatory response.Our findings demonstrate beneficial effects of chronic MPLA treatment in transgenic PLP-α-syn mice. MPLA appears to be an attractive therapeutic candidate for disease modification trials in MSA and related α-synucleinopathies.

Because of the highly penetrant gene mutation and clinical features consistent with idiopathic Parkinson's disease, carriers of the autosomal dominant Ala53Thr (A53T; 209G→A) point mutation in the α-synuclein (SNCA) gene are an ideal population to study the premotor phase and evolution of Parkinson's pathology. Given the known neurochemical changes in the serotonergic system and their association with symptoms of Parkinson's disease, we hypothesised that carriers of the A53T SNCA mutation might show abnormalities in the serotonergic neurotransmitter system before the diagnosis of Parkinson's disease, and that this pathology might be associated with measures of Parkinson's burden.In this cross-sectional study, we recruited carriers of the A53T SNCA mutation from specialist Movement Disorders clinics in Athens, Greece, and Salerno, Italy, and a cohort of healthy controls with no personal or family history of neurological or psychiatric disorders from London, UK (recruited via public advertisement) who were age matched to the A53T SNCA carriers. We also recruited one cohort of patients with idiopathic Parkinson's disease (cohort 1) from Movement Disorders clinics in London, UK, and retrieved data on a second cohort of such patients (cohort 2; n=40) who had been scanned with a different scanner. 7-day continuous recording of motor function was used to determine the Parkinson's disease status of the A53T carriers. To assess whether serotonergic abnormalities were present, we used [11C]DASB PET non-displaceable binding to quantify serotonin transporter density. We constructed brain topographic maps reflecting Braak stages 1-6 and used these as seed maps to calculate [11C]DASB non-displaceable binding potential in our cohort of A53T SNCA carriers. Additionally, all participants underwent a battery of clinical assessments to determine motor and non-motor symptoms and cognitive status, and [123I]FP-CIT single-photon emission CT (SPECT) to assess striatal dopamine transporter binding and MRI for volumetric analyses to assess whether pathology is associated with measures of Parkinson's disease burden.Between Sept 1, 2016, and Sept 30, 2018, we recruited 14 A53T SNCA carriers, 25 healthy controls, and 25 patients with idiopathic Parkinson's disease. Seven (50%) of 14 A53T SCNA carriers were confirmed to have motor symptoms and confirmed to have Parkinson's disease, and the absence of motor symptoms was confirmed in seven (50%) A53T SCNA carriers (ie, premotor), in whom [123I]FP-CIT SPECT confirmed the absence of striatal dopaminergic deficits. Compared with healthy controls, premotor A53T SNCA carriers showed loss of [11C]DASB non-displaceable binding potential in the ventral (p<0·0001) and dorsal (p=0·0002) raphe nuclei, caudate (p=0·00015), putamen (p=0·036), thalamus (p=0·00074), hypothalamus (p<0·0001), amygdala (p=0·0041), and brainstem (p=0·046); and in A53T SNCA carriers with Parkinson's disease this loss was extended to the hippocampus (p=0·0051), anterior (p=0·022) and posterior cingulate (p=0·036), insula (p=0·0051), frontal (p=0·0016), parietal (p=0·019), temporal (p<0·0001), and occipital (p=0·0053) cortices. A53T SNCA carriers with Parkinson's disease showed a loss of striatal [123I]FP-CIT-specific binding ratio compared with healthy controls (p<0·0001). Premotor A53T SNCA carriers had loss of [11C]DASB non-displaceable binding potential in brain areas corresponding to Braak stages 1-3, whereas [11C]DASB non-displaceable binding potential was largely preserved in areas corresponding to Braak stages 4-6. Except for one participant who was diagnosed with Parkinson's disease in the past year, all A53T SNCA carriers with Parkinson's disease had decreases in [11C]DASB non-displaceable binding potential in brain areas corresponding to Braak stages 1-6. Decreases in [11C]DASB non-displaceable binding potential in the brainstem were associated with increased Movement Disorder Score-Unified Parkinson's Disease Rating Scale total scores in all A53T SNCA carriers (r -0·66, 95% CI -0·88 to -0·20; p=0·0099), idiopathic Parkinson's disease cohort 1 (r -0·66, -0·84 to -0·36; p=0·00031), and idiopathic Parkinson's disease cohort 2 (r -0·71, -0·84 to -0·52; p<0·0001).The presence of serotonergic pathology in premotor A53T SNCA carriers preceded development of dopaminergic pathology and motor symptoms and was associated with disease burden, highlighting the potential early role of serotonergic pathology in the progression of Parkinson's disease. Our findings provide evidence that molecular imaging of serotonin transporters could be used to visualise premotor pathology of Parkinson's disease in vivo. Future work might establish whether serotonin transporter imaging is suitable as an adjunctive tool for screening and monitoring progression for individuals at risk or patients with Parkinson's disease to complement dopaminergic imaging, or as a marker of Parkinson's burden in clinical trials.Lily Safra Hope Foundation and National Institute for Health Research (NIHR) Biomedical Research Centre at King's College London.

Transcriptome analysis has identified a plethora of long non-coding RNAs (lncRNAs) expressed in the human brain and associated with neurological diseases. However, whether lncRNAs expression levels correlate with Parkinson’s disease (PD) pathogenesis remains unknown. Herein, we show that a number of lncRNA genes encompassing transcriptional units in close proximity to PD-linked protein-coding genes, including SNCA, LRRK2, PINK1, DJ-1, UCH-L1, MAPT and GBA1, are expressed in human dopaminergic cells and post-mortem material, such as cortex, Substantia Nigra and cerebellum. Interestingly, these lncRNAs are upregulated during neuronal differentiation of SH-SY5Y cells and of dopaminergic neurons generated from human fibroblast-derived induced pluripotent stem cells. Importantly, six lncRNAs are found under-expressed in the nigra and three in the cerebellum of PD patients compared to controls. Simultaneously, SNCA mRNA levels are increased in the nigra, while LRRK2 and PINK1 mRNA levels are decreased both in the nigra and the cerebellum of PD subjects compared to controls, indicating a possible correlation between the expression profile of the respective lncRNAs with their adjacent coding genes. Interestingly, all dysregulated lncRNAs are also detected in human peripheral blood mononuclear cells and four of them in exosomes derived from human cerebrospinal fluid, providing initial evidence for their potential use as diagnostic tools for PD. Our data raise the intriguing possibility that these lncRNAs may be involved in disease pathogenesis by regulating their neighboring PD-associated genes and may thus represent novel targets for the diagnosis and/or treatment of PD or related diseases.

The SNCA gene encoding α-synuclein (αSyn) is the first gene identified to cause autosomal-dominant Parkinson's disease (PD).We report the identification of a novel heterozygous A30G mutation of the SNCA gene in familial PD and describe clinical features of affected patients, genetic findings, and functional consequences.Whole exome sequencing was performed in the discovery family proband. Restriction digestion with Bbvl was used to screen SNCA A30G in two validation cohorts. The Greek cohort included 177 familial PD probands, 109 sporadic PD cases, and 377 neurologically healthy controls. The German cohort included 136 familial PD probands, 380 sporadic PD cases, and 116 neurologically healthy controls. We also conducted haplotype analysis using 13 common single nucleotide variants around A30G to determine the possibility of a founder effect for A30G. We then used biophysical methods to characterize A30G αSyn.We identified a novel SNCA A30G (GRCh37, Chr4:90756730, c.89 C>G) mutation that co-segregated with the disease in five affected individuals of three Greek families and was absent from controls. A founder effect was strongly suggested by haplotype analysis. The A30G mutation had a local effect on the intrinsically disordered structure of αSyn, slightly perturbed membrane binding, and promoted fibril formation.Based on the identification of A30G co-segregating with the disease in three families, the absence of the mutation in controls and population databases, and the observed functional effects, we propose SNCA A30G as a novel causative mutation for familial PD. © 2021 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

New noninvasive and affordable molecular approaches that will complement current practices and increase the accuracy of Parkinson's disease (PD) diagnosis are urgently needed. Circular RNAs (circRNAs) are stable noncoding RNAs that accumulate with aging in neurons and are increasingly shown to regulate all aspects of neuronal development and function.Τhe aims of this study were to identify differentially expressed circRNAs in blood mononuclear cells of patients with idiopathic PD and explore the competing endogenous RNA networks affected.Eighty-seven circRNAs were initially selected based on relatively high gene expression in the human brain. More than half of these were readily detectable in blood mononuclear cells using real-time reverse transcription-polymerase chain reaction. Comparative expression analysis was then performed in blood mononuclear cells from 60 control subjects and 60 idiopathic subjects with PD.Six circRNAs were significantly down-regulated in patients with PD. The classifier that best distinguished PD consisted of four circRNAs with an area under the curve of 0.84. Cross-linking immunoprecipitation-sequencing data revealed that the RNA-binding proteins bound by most of the deregulated circRNAs include the neurodegeneration-associated FUS, TDP43, FMR1, and ATXN2. MicroRNAs predicted to be sequestered by most deregulated circRNAs have the Gene Ontology categories "protein modification" and "transcription factor activity" mostly enriched.This is the first study that identifies specific circRNAs that may serve as diagnostic biomarkers for PD. Because they are highly expressed in the brain and are derived from genes with essential brain functions, they may also hint on the PD pathways affected. © 2021 Biomedical Research Foundation, Academy of Athens. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

Considerable heterogeneity exists in the literature concerning genetic determinants of the age at onset (AAO) of Parkinson disease (PD), which could be attributed to a lack of well-powered replication cohorts. The previous largest genome-wide association studies (GWAS) identified SNCA and TMEM175 loci on chromosome (Chr) 4 with a significant influence on the AAO of PD; these have not been independently replicated. This study aims to conduct a meta-analysis of GWAS of PD AAO and validate previously observed findings in worldwide populations.A meta-analysis was performed on PD AAO GWAS of 30 populations of predominantly European ancestry from the Comprehensive Unbiased Risk Factor Assessment for Genetics and Environment in Parkinson's Disease (COURAGE-PD) Consortium. This was followed by combining our study with the largest publicly available European ancestry dataset compiled by the International Parkinson Disease Genomics Consortium (IPDGC).The COURAGE-PD Consortium included a cohort of 8,535 patients with PD (91.9%: Europeans and 9.1%: East Asians). The average AAO in the COURAGE-PD dataset was 58.9 years (SD = 11.6), with an underrepresentation of females (40.2%). The heritability estimate for AAO in COURAGE-PD was 0.083 (SE = 0.057). None of the loci reached genome-wide significance (p < 5 × 10-8). Nevertheless, the COURAGE-PD dataset confirmed the role of the previously published TMEM175 variant as a genetic determinant of the AAO of PD with Bonferroni-corrected nominal levels of significance (p < 0.025): (rs34311866: β(SE)COURAGE = 0.477(0.203), pCOURAGE = 0.0185). The subsequent meta-analysis of COURAGE-PD and IPDGC datasets (Ntotal = 25,950) led to the identification of 2 genome-wide significant association signals on Chr 4, including the previously reported SNCA locus (rs983361: β(SE)COURAGE+IPDGC = 0.720(0.122), pCOURAGE+IPDGC = 3.13 × 10-9) and a novel BST1 locus (rs4698412: β(SE)COURAGE+IPDGC = -0.526(0.096), pCOURAGE+IPDGC = 4.41 × 10-8).Our study further refines the genetic architecture of Chr 4 underlying the AAO of the PD phenotype through the identification of BST1 as a novel AAO PD locus. These findings open a new direction for the development of treatments to delay the onset of PD.

Previous studies showed that lifestyle behaviors (cigarette smoking, alcohol, coffee) are inversely associated with Parkinson's disease (PD). The prodromal phase of PD raises the possibility that these associations may be explained by reverse causation.To examine associations of lifestyle behaviors with PD using two-sample Mendelian randomisation (MR) and the potential for survival and incidence-prevalence biases.We used summary statistics from publicly available studies to estimate the association of genetic polymorphisms with lifestyle behaviors, and from Courage-PD (7,369 cases, 7,018 controls; European ancestry) to estimate the association of these variants with PD. We used the inverse-variance weighted method to compute odds ratios (ORIVW) of PD and 95%confidence intervals (CI). Significance was determined using a Bonferroni-corrected significance threshold (p = 0.017).We found a significant inverse association between smoking initiation and PD (ORIVW per 1-SD increase in the prevalence of ever smoking = 0.74, 95%CI = 0.60-0.93, p = 0.009) without significant directional pleiotropy. Associations in participants ≤67 years old and cases with disease duration ≤7 years were of a similar size. No significant associations were observed for alcohol and coffee drinking. In reverse MR, genetic liability toward PD was not associated with smoking or coffee drinking but was positively associated with alcohol drinking.Our findings are in favor of an inverse association between smoking and PD that is not explained by reverse causation, confounding, and survival or incidence-prevalence biases. Genetic liability toward PD was positively associated with alcohol drinking. Conclusions on the association of alcohol and coffee drinking with PD are hampered by insufficient statistical power.

TDP-43 (TAR DNA-binding protein 43) aggregation and redistribution are recognised as a hallmark of amyotrophic lateral sclerosis and frontotemporal dementia. As TDP-43 inclusions have recently been described in the muscle of inclusion body myositis patients, this highlights the need to understand the role of TDP-43 beyond the central nervous system. Using RNA-seq, we directly compare TDP-43-mediated RNA processing in muscle (C2C12) and neuronal (NSC34) mouse cells. TDP-43 displays a cell-type-characteristic behaviour targeting unique transcripts in each cell-type, which is due to characteristic expression of RNA-binding proteins, that influence TDP-43's performance and define cell-type specific splicing. Among splicing events commonly dysregulated in both cell lines, we identify some that are TDP-43-dependent also in human cells. Inclusion levels of these alternative exons are altered in tissues of patients suffering from FTLD and IBM. We therefore propose that TDP-43 dysfunction contributes to disease development either in a common or a tissue-specific manner.

Abstract Background As gene‐targeted therapies are increasingly being developed for Parkinson's disease (PD), identifying and characterizing carriers of specific genetic pathogenic variants is imperative. Only a small fraction of the estimated number of subjects with monogenic PD worldwide are currently represented in the literature and availability of clinical data and clinical trial‐ready cohorts is limited. Objective The objectives are to (1) establish an international cohort of affected and unaffected individuals with PD‐linked variants; (2) provide harmonized and quality‐controlled clinical characterization data for each included individual; and (3) further promote collaboration of researchers in the field of monogenic PD. Methods We conducted a worldwide, systematic online survey to collect individual‐level data on individuals with PD‐linked variants in SNCA , LRRK2 , VPS35 , PRKN , PINK1 , DJ‐1 , as well as selected pathogenic and risk variants in GBA and corresponding demographic, clinical, and genetic data. All registered cases underwent thorough quality checks, and pathogenicity scoring of the variants and genotype–phenotype relationships were analyzed. Results We collected 3888 variant carriers for our analyses, reported by 92 centers (42 countries) worldwide. Of the included individuals, 3185 had a diagnosis of PD (ie, 1306 LRRK2 , 115 SNCA , 23 VPS35 , 429 PRKN , 75 PINK1 , 13 DJ‐1 , and 1224 GBA ) and 703 were unaffected (ie, 328 LRRK2 , 32 SNCA , 3 VPS35 , 1 PRKN , 1 PINK1 , and 338 GBA ). In total, we identified 269 different pathogenic variants; 1322 individuals in our cohort (34%) were indicated as not previously published. Conclusions Within the MJFF Global Genetic PD Study Group, we (1) established the largest international cohort of affected and unaffected individuals carrying PD‐linked variants; (2) provide harmonized and quality‐controlled clinical and genetic data for each included individual; (3) promote collaboration in the field of genetic PD with a view toward clinical and genetic stratification of patients for gene‐targeted clinical trials. © 2023 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

Two recent, high-profile manuscripts reported negative results with two parallel approaches of passive immunization targeting α-synuclein in a population of patients with early Parkinson's disease (PD). These phase II studies failed to show a bona fide disease-modifying neuroprotective effect on PD progression, despite the evidence that these antibodies effectively bind native α-synuclein in human serum. Here, we discuss the possible reasons that could help explain the lack of clinical efficacy. In particular, we highlight (1) the wealth of evidence supporting the notion of α-synuclein as a valid therapeutic target; (2) the lack of evidence of target engagement in the aforementioned studies, especially of the elusive oligomeric species, the likely culprits in disease pathogenesis and/or its propagation; (3) the limitations, especially in terms of timing passive immunization, of preclinical models, where the same α-synuclein antibodies succeeded in mitigating disease manifestations; (4) the consideration of possibly intervening at an even earlier stage of disease in future trials; and (5) the multitude of strategies beyond passive immunization that could be used to combat α-synuclein-mediated neurodegeneration, if in the end the current approach is not fruitful. Overall, our perception is that converging developments in the field, among them novel bioassays and biomarkers, improved cellular and animal models and objective measurements of motor activities integrated into clinical trials, if further optimized, will gradually move the momentum of the field forward. This, to better test the concept of whether α-synuclein-targeting therapies can indeed deliver the "holy grail" of neuroprotection to the benefit of the PD community. © 2023 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

More than 200 years after James Parkinsondescribed a clinical syndrome based on his astute observations, Parkinson's disease (PD) has evolved into a complex entity, akin to the heterogeneity of other complex human syndromes of the central nervous system such as dementia, motor neuron disease, multiple sclerosis, and epilepsy. Clinicians, pathologists, and basic science researchers evolved arrange of concepts andcriteria for the clinical, genetic, mechanistic, and neuropathological characterization of what, in their best judgment, constitutes PD. However, these specialists have generated and used criteria that are not necessarily aligned between their different operational definitions, which may hinder progress in solving the riddle of the distinct forms of PD and ultimately how to treat them.This task force has identified current in consistencies between the definitions of PD and its diverse variants in different domains: clinical criteria, neuropathological classification, genetic subtyping, biomarker signatures, and mechanisms of disease. This initial effort for "defining the riddle" will lay the foundation for future attempts to better define the range of PD and its variants, as has been done and implemented for other heterogeneous neurological syndromes, such as stroke and peripheral neuropathy. We strongly advocate for a more systematic and evidence-based integration of our diverse disciplines by looking at well-defined variants of the syndrome of PD.Accuracy in defining endophenotypes of "typical PD" across these different but interrelated disciplines will enable better definition of variants and their stratification in therapeutic trials, a prerequisite for breakthroughs in the era of precision medicine. © 2023 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

Lifestyle factors have been implicated in the long-lasting neurodegenerative process in prodromal Parkinson's disease (pPD). The aim was to investigate the associations between adherence to a Mediterranean diet (MeDi) and longitudinal changes of pPD probability and the development of Parkinson's disease (PD) or pPD in a Mediterranean older population.Data from the Hellenic Longitudinal Investigation of Aging and Diet cohort (community-dwelling individuals, aged ≥ 65 years) were used. A detailed food frequency questionnaire was used to evaluate dietary intake and calculate MeDi adherence score, ranging from 0 to 55, with higher scores indicating higher adherence. The probability of pPD was calculated according to the updated Movement Disorder Society research criteria.In all, 1047 non-PD/dementia with Lewy bodies (DLB) participants were followed for 3 ± 1 years. MeDi adherence was associated with lower increase in pPD probability over time (b = -0.003, 95% confidence interval -0.006 to -0.001, p = 0.010). Forty-nine participants had incident possible/probable pPD (i.e., pPD probability ≥ 30%). Compared to the participants in the lowest quartile of MeDi adherence, those in the higher quartiles had an approximately 60%-70% lower risk for possible/probable pPD (p for trend 0.003). MeDi-pPD associations were driven by both motor and non-motor pPD markers and not from risk markers. Also, 21 participants were diagnosed with PD/DLB at follow-up. For each unit increase in the MeDi score, there was a 9%-10% lower risk for PD/DLB (hazard ratio 0.906 [95% confidence interval 0.823-0.997], p = 0.044).Mediterranean diet adherence is associated with lower increase in pPD probability over time and lower possible/probable pPD and PD/DLB incidence in older Mediterranean people. More studies are needed to confirm our results in other populations.

Molecular mechanisms of apoptosis may participate in motor neuron degeneration produced by mutant copper/zinc superoxide dismutase (mSOD1), the only proven cause of amyotrophic lateral sclerosis (ALS). Consistent with this, herein we show that the spinal cord of transgenic mSOD1 mice is the site of the sequential activation of caspase-1 and caspase-3. Activated caspase-3 and its produced β-actin cleavage fragments are found in apoptotic neurons in the anterior horn of the spinal cord of affected transgenic mSOD1 mice; although such neurons are few, their scarcity should not undermine the potential importance of apoptosis in the overall mSOD1-related neurodegeneration. Overexpression of the anti-apoptotic protein Bcl-2 attenuates neurodegeneration and delays activation of the caspases and fragmentation of β-actin. These data demonstrate that caspase activation occurs in this mouse model of ALS during neurodegeneration. Our study also suggests that modulation of caspase activity may provide protective benefit in the treatment of ALS, a view that is consistent with our recent demonstration of caspase inhibition extending the survival of transgenic mSOD1 mice.

We review here recent reports pertaining to the issue of apoptosis in neurodegenerative diseases. Tissue culture models, animal models and human pathological studies are discussed. At present, there is supportive, but not definitive, evidence for apoptosis in a number of neurodegenerative disorders.

Activation of cysteine aspartases (caspases) seems to be a required element of apoptotic death in many paradigms. We have shown previously that general inhibitors of cysteine aspartases block apoptosis of PC12 cells and sympathetic neurons evoked by either trophic factor (nerve growth factor and/or serum) deprivation or superoxide dismutase (SOD1) downregulation. Moreover, activation of a caspase family member similar or equivalent to the interleukin-1beta-converting enzyme (ICE) was implicated for death caused by SOD1 downregulation, but not withdrawal of trophic support. The experiments presented here demonstrate that diminished expression of the cysteine aspartase Nedd2 in PC12 cells and sympathetic neurons induced by an appropriate vector peptide-linked antisense oligonucleotide rescues them from death caused by trophic factor deprivation without inhibiting apoptosis in the same cell types evoked by SOD1 downregulation. Neither the level (as revealed by Western immunoblotting) nor the cellular distribution (as revealed immunohistochemically) of Nedd2 was altered demonstrably by trophic factor deprivation. However, evidence for proteolytic processing of Nedd2 (consistent with commencement of activation) was observed in PC12 cells after withdrawal of trophic support. These findings indicate that neuronal death triggered by different initial causes may be mediated by distinct members of the cysteine aspartase family.

Inhibitors of interleukin-1β converting enzyme (ICE) and a related group of cysteine aspartases of the ICE/ced-3 family inhibit cell death in a variety of settings, including in PC12 cells and sympathetic neurons following withdrawal of trophic support. To assess the particular member(s) of the ICE/ced-3 family that are relevant to cell death and to position their activation within the apoptotic pathway, we have used specific substrates to measure ICE-like and CPP32-like enzymatic activity in naive and neuronally differentiated PC12 cells that had been deprived of trophic support (nerve growth factor and/or serum). Rapid induction of CPP32-like, but not ICE-like, activity was observed. c-Jun kinase activation and the action of bcl-2 and other survival agents, such as cell cycle blockers, a NO generator, N-acetylcysteine, aurintricarboxylic acid, and actinomycin D occurred at a point further upstream in the apoptotic pathway compared with the aspartase activation. In living cells, zVAD-FMK, a pseudosubstrate aspartase inhibitor, blocked the activity/activation of the aspartase at concentrations about one order of magnitude lower than those required to promote survival, raising the possibility that the CPP32-like aspartase is not the main death effector in this model. Inhibitors of interleukin-1β converting enzyme (ICE) and a related group of cysteine aspartases of the ICE/ced-3 family inhibit cell death in a variety of settings, including in PC12 cells and sympathetic neurons following withdrawal of trophic support. To assess the particular member(s) of the ICE/ced-3 family that are relevant to cell death and to position their activation within the apoptotic pathway, we have used specific substrates to measure ICE-like and CPP32-like enzymatic activity in naive and neuronally differentiated PC12 cells that had been deprived of trophic support (nerve growth factor and/or serum). Rapid induction of CPP32-like, but not ICE-like, activity was observed. c-Jun kinase activation and the action of bcl-2 and other survival agents, such as cell cycle blockers, a NO generator, N-acetylcysteine, aurintricarboxylic acid, and actinomycin D occurred at a point further upstream in the apoptotic pathway compared with the aspartase activation. In living cells, zVAD-FMK, a pseudosubstrate aspartase inhibitor, blocked the activity/activation of the aspartase at concentrations about one order of magnitude lower than those required to promote survival, raising the possibility that the CPP32-like aspartase is not the main death effector in this model.

Caspases are cysteine proteases that mediate apoptotic death in a variety of cellular systems, including neurons. Caspases are activated through extrinsic or intrinsic pathways. The latter is used by most neurons in most situations. In this pathway, release of mitochondrial cytochrome c into the cytoplasm induces formation of the apoptosome, which leads to the activation of caspase 9 and subsequently other caspases. Recent data demonstrate that when caspase activation is inhibited at or downstream of the apoptosome, neurons undergo a delayed, caspase-independent death. Furthermore, there are instances, most notably following excitotoxic injury and calcium overload, in which the direct cell death pathway elicited differs from classical apoptosis. The molecular and biochemical features of such caspase-independent, nonapoptotic forms of neuronal death are just beginning to be elucidated, but alterations at the level of the mitochondria and noncaspase proteases play significant roles. Mitochondrial alterations in caspase-independent death may include energy depletion, generation of free radicals, opening of the permeability transition pore, and release of cytotoxic proteins, such as apoptosis-inducing factor. The particular mechanisms employed can be context dependent. In disease states, in which a combination of apoptotic and nonapoptotic death occurs, therapeutic strategies need to take into account both caspase-dependent and -independent pathways.

Increasing evidence suggests that proteasomal dysfunction plays a role in the pathogenesis of Lewy body diseases. We have used pharmacological inhibitors of the proteasome to model proteasomal dysfunction in cultured rat cortical neurons. Proteasomal inhibition induced apoptotic death and formation of cytoplasmic ubiquitinated inclusions, which were present only in viable neurons. Actinomycin D, but not a caspase inhibitor, prevented inclusion formation, whereas both agents inhibited cell death. α-Synuclein and thioflavin S staining were found within the inclusions. α-Synuclein, however, did not appear to be ubiquitinated or aggregated. A dominant-negative mutant of an E2 ubiquitin-conjugating enzyme, cdc34, prevented inclusion formation and attenuated cell death. Our results suggest that in cortical neurons: (a) proteasomal dysfunction plays a role in formation of ubiquitin/α-synuclein-positive inclusions, (b) inclusion formation is an active cell process requiring transcription, and (c) ubiquitination of certain proteins is required for inclusion formation and may participate in neuronal death.

Abstract Neurofilament light gene mutations have been linked to a subset of patients with Charcot‐Marie‐Tooth disease, the most common inherited motor and sensory neuropathy. We have previously shown that Charcot‐Marie‐Tooth‐linked mutant neurofilament light assembles abnormally in non‐neuronal cells. In this study, we have characterized the effects of expression of mutant neurofilament light proteins on axonal transport in a neuronal cell culture model. We demonstrated that the Charcot‐Marie‐Tooth‐linked neurofilament light mutations: (i) affect the axonal transport of mutant neurofilaments; (ii) have a dominant‐negative effect on the transport of wild‐type neurofilaments; (iii) affect the transport of mitochondria and the anterograde axonal transport marker human amyloid precursor protein; (iv) result in alterations of retrograde axonal transport and (v) cause fragmentation of the Golgi apparatus. Increased neuritic degeneration was observed in neuronal cells overexpressing neurofilament light mutants. Our results suggest that these generalized axonal transport defects could be responsible for the neuropathy in Charcot‐Marie‐Tooth disease.

Alpha-synuclein (ASYN) is central in Parkinson's disease pathogenesis. Converging pieces of evidence suggest that the levels of ASYN expression play a critical role in both familial and sporadic Parkinson's disease. To elucidate the mechanism underlying wild type (WT) ASYN-mediated neurotoxicity, we have generated a novel Tet-Off SHSY-5Y cell line, conditionally expressing WT ASYN. Induction of human WT ASYN in retinoic acid-differentiated SHSY-5Y cells leads to accumulation of soluble ASYN oligomers, in the absence of inclusions, and to gradual cellular degeneration. Morphologically, the death observed is non-apoptotic. Caspases other than caspase 3, including caspase 9, are activated and caspase inhibition diminishes death by acting at a point upstream of cytochrome c release. Application of Scyllo-inositol, an oligomer-stabilizing compound, prevents neuronal death in this model. These findings are consistent with a model in which oligomeric ASYN triggers the initial activation of the apoptotic pathway, which is however blocked downstream of the mitochondrial checkpoint, thus leading to a death combining in a unique fashion both apoptotic and non-apoptotic features. This novel inducible cell model system may prove valuable in the deciphering of WT ASYN-induced pathogenic effects and in the assessment and screening of potential therapeutic strategies.

The autophagy-lysosomal pathway is a major proteolytic pathway that in mammalian systems mainly comprises of macroautophagy and chaperone-mediated autophagy. The former is relatively non-selective and involves bulk degradation of proteins and organelles, whereas the latter is selective for certain cytosolic proteins. These autophagy pathways are important in development, differentiation, cellular remodeling and survival during nutrient starvation. Autophagy is crucial for neuronal homeostasis and acts as a local housekeeping process, since neurons are post-mitotic cells and require effective protein degradation to prevent accumulation of toxic aggregates. A growing body of evidence now suggests that dysfunction of autophagy causes accumulation of abnormal proteins and/or damaged organelles. Such accumulation has been linked to synaptic dysfunction, cellular stress and neuronal death. Abnormal autophagy may be involved in the pathology of both chronic nervous system disorders, such as proteinopathies (Alzheimer's, Parkinson's, Huntington's disease) and acute brain injuries. Although autophagy is generally beneficial, its aberrant activation may also exert a detrimental role in neurological diseases depending on the environment and the insult, leading to autophagic neuronal death. In this review we summarize the current knowledge regarding the role of autophagy-lysosomal pathway in the central nervous system and discuss the implication of autophagy dysregulation in human neurological diseases and animal models.

Abstract Objective: We studied the independent and joint effects of the genes encoding alpha‐synuclein ( SNCA ) and microtubule‐associated protein tau ( MAPT ) in Parkinson disease (PD) as part of a large meta‐analysis of individual data from case–control studies participating in the Genetic Epidemiology of Parkinson's Disease (GEO‐PD) consortium. Methods: Participants of Caucasian ancestry were genotyped for a total of 4 SNCA (rs2583988, rs181489, rs356219, rs11931074) and 2 MAPT (rs1052553, rs242557) single nucleotide polymorphism (SNPs). Individual and joint effects of SNCA and MAPT SNPs were investigated using fixed‐ and random‐effects logistic regression models. Interactions were studied on both a multiplicative and an additive scale, and using a case–control and case‐only approach. Results: Fifteen GEO‐PD sites contributed a total of 5,302 cases and 4,161 controls. All 4 SNCA SNPs and the MAPT H1‐haplotype–defining SNP (rs1052553) displayed a highly significant marginal association with PD at the significance level adjusted for multiple comparisons. For SNCA , the strongest associations were observed for SNPs located at the 3′ end of the gene. There was no evidence of statistical interaction between any of the 4 SNCA SNPs and rs1052553 or rs242557, neither on the multiplicative nor on the additive scale. Interpretation: This study confirms the association between PD and both SNCA SNPs and the H1 MAPT haplotype. It shows, based on a variety of approaches, that the joint action of variants in these 2 loci is consistent with independent effects of the genes without additional interacting effects. ANN NEUROL 2011

The neuronal protein alpha-synuclein is thought to be central in the pathogenesis of Parkinson's disease (PD). Excessive wild type alpha-synuclein levels can lead to PD in select familial cases and alpha-synuclein protein accumulation occurs in sporadic PD. Therefore, elucidation of the mechanisms that control alpha-synuclein levels is critical for PD pathogenesis and potential therapeutics. The subject of alpha-synuclein degradation has been controversial. Previous work shows that, in an assay with isolated liver lysosomes, purified wild type alpha-synuclein is degraded by the process of chaperone-mediated autophagy (CMA). Whether this actually occurs in a cellular context has been unclear. In our most recent work, we find that wild type alpha-synuclein, but not the closely related protein beta-synuclein, is indeed degraded by CMA in neuronal cells, including primary postnatal ventral midbrain neurons. Macroautophagy, but not the proteasome, also contributes to alpha-synuclein degradation. Therefore, two separate lysosomal pathways, CMA and macroautophagy, degrade wild type alpha-synuclein in neuronal cells. It is hypothesized that impairment of either of these two pathways, or of more general lysosomal function, may be an initiating factor in alpha-synuclein accumulation and sporadic PD pathogenesis.

Macroautophagy and chaperone-mediated autophagy (CMA) are the two main mammalian lysosomal proteolytic systems. In macroautophagy, double-membrane structures engulf organelles and other intracellular constituents through a highly regulated process that involves the formation of autophagic vacuoles and their fusion with lysosomes. In CMA, selected proteins are targeted through a nonvesicular pathway to a transport complex at the lysosomal membrane, through which they are threaded into the lysosomes and degraded. Autophagy is important in development, differentiation, cellular remodelling and survival during nutrient starvation. Increasing evidence suggests that autophagic dysregulation causes accumulation of abnormal proteins or damaged organelles, which is a characteristic of chronic neurodegenerative conditions, such as Parkinson disease (PD). Evidence from post-mortem material, transgenic mice, and animal and cellular models of PD suggests that both major autophagic pathways are malfunctioning. Numerous connections exist between proteins genetically linked to autosomal dominant PD, in particular α-synuclein and LRRK2, and autophagic pathways. However, proteins involved in recessive PD, such as PINK1 and Parkin (PINK2), function in the process of mitophagy, whereby damaged mitochondria are selectively engulfed by macroautophagy. This wealth of new data suggests that both autophagic pathways are potential targets for therapeutic intervention in PD and other related neurodegenerative conditions.

<h2>Abstract</h2><h3>Introduction</h3> <i>ADCY5</i> mutations have been recently identified as an important cause of early-onset hyperkinetic movement disorders. The phenotypic spectrum associated with mutations in this gene is expanding. However, the <i>ADCY5</i> mutational frequency in cohorts of paediatric patients with hyperkinetic movement disorders has not been evaluated. <h3>Methods</h3> We performed a screening of the entire <i>ADCY5</i> coding sequence in 44 unrelated subjects with genetically undiagnosed childhood-onset hyperkinetic movement disorders, featuring chorea alone or in combination with myoclonus and dystonia. All patients had normal CSF analysis and brain imaging and were regularly followed-up in tertiary centers for paediatric movement disorders. <h3>Results</h3> We identified five unrelated subjects with <i>ADCY5</i> mutations (11% of the cohort). Three carried the p. R418W mutation, one the p. R418Q and one the p. R418G mutation. Mutations arose <i>de novo</i> in four cases, while one patient inherited the mutation from his similarly affected father. All patients had delayed motor and/or language milestones with or without axial hypotonia and showed generalized chorea and dystonia, with prominent myoclonic jerks in one case. Episodic exacerbations of the baseline movement disorder were observed in most cases, being the first disease manifestation in two patients. The disease course was variable, from stability to spontaneous improvement during adolescence. <h3>Conclusion</h3> Mutations in <i>ADCY5</i> are responsible for a hyperkinetic movement disorder that can be preceded by episodic attacks before the movement disorder becomes persistent and is frequently misdiagnosed as dyskinetic cerebral palsy. A residual degree of neck hypotonia and a myopathy-like facial appearance are frequently observed in patients with <i>ADCY5</i> mutations.

Since the first discovery of a specific genetic defect in the SNCA gene, encoding for α-synuclein, as a causative factor for Parkinson's disease 20 years ago, a multitude of other genes have been linked to this disease in rare cases with Mendelian inheritance. Furthermore, the genetic contribution to the much more common sporadic disease has been demonstrated through case control association studies and, more recently, genome-wide association studies. Interestingly, some of the genes with Mendelian inheritance, such as SNCA, are also relevant to the sporadic disease, suggesting common pathogenetic mechanisms. In this review, we place an emphasis on Mendelian forms, and in particular genetic defects which present predominantly with Parkinsonism. We provide details into the particular phenotypes associated with each genetic defect, with a particular emphasis on nonmotor symptoms. For genetic defects for whom a sufficient number of patients has been assessed, there are evident genotype–phenotype correlations. However, it should be noted that patients with the same causative mutation may present with distinctly divergent phenotypes. This phenotypic variability may be due to genetic, epigenetic or environmental factors. From a clinical and genetic point of view, it will be especially interesting in the future to identify genetic factors that modify disease penetrance, the age of onset or other specific phenotypic features.

α-Synuclein (AS) plays a crucial role in Parkinson's disease pathogenesis. AS is normally secreted from neuronal cells and can thus exert paracrine effects. We have previously demonstrated that naturally secreted AS species, derived from SH-SY5Y cells inducibly overexpressing human wild type AS, can be toxic to recipient neuronal cells. In the current study, we show that application of secreted AS alters membrane fluidity and increases calcium (Ca2+) entry. This influx is reduced on pharmacological inhibition of voltage-operated Ca2+ channels. Although no change in free cytosolic Ca2+ levels is observed, a significantly increased mitochondrial Ca2+ sequestration is found in recipient cells. Application of voltage-operated Ca2+ channel blockers or Ca2+ chelators abolishes AS-mediated toxicity. AS-treated cells exhibit increased calpain activation, and calpain inhibition greatly alleviates the observed toxicity. Collectively, our data suggest that secreted AS exerts toxicity through engagement, at least in part, of the Ca2+ homeostatic machinery. Therefore, manipulating Ca2+ signaling pathways might represent a potential therapeutic strategy for Parkinson's disease.

ABSTRACT Background G209A SNCA mutation carriers represent an important group of genetic PD. We describe motor and nonmotor features of G209A SNCA mutation carriers. Methods Longitudinal clinical assessments over 2 years were collected in 22 symptomatic and 8 asymptomatic G209A SNCA mutation carriers. Motor and nonmotor rating scales were administered. Correlations were performed between clinical variables and disease duration or age. Penetrance was calculated using Kaplan‐Meier survival curves. Results Asymptomatic carriers did not manifest clear premotor symptoms, but symptomatic carriers often reported that olfactory dysfunction and rapid eye movement sleep behavior disorder preceded motor symptoms. Prominent motor decline and deterioration of autonomic and cognitive function occurred at follow‐up; such nonmotor features correlated with disease duration, but not age. Disease penetrance was estimated at around 90%. Conclusions This study may help to inform clinical trials and provide the basis for studies of disease modifiers in genetic synucleinopathy cohorts. © 2016 International Parkinson and Movement Disorder Society

Glucocerebrosidase gene (GBA) mutations are the most common genetic contributor to Parkinson’s disease (PD) and are associated with decreased glucocerebrosidase (GCase) enzymatic activity in PD. PD patients without GBA mutations also exhibit lower levels of GCase activity in the central nervous system suggesting a potential contribution of the enzyme activity in disease pathogenesis, possibly by alteration of lysosomal function. α-synuclein (ASYN), a protein with a central role in PD pathogenesis, has been shown to be secreted partly in association with exosomes. It is possible that a dysfunction of the endocytic pathway through GCase may result in altered exosome release of ASYN. The aim of this study was to examine whether manipulating GCase activity in vivo and in vitro could affect ASYN accumulation and secretion. GCase overexpression in vitro resulted in a significant decrease of exosome secretion. Chronic inhibition of GCase activity in vivo, by administration of the covalent inhibitor conduritol-B epoxide in A53T-synuclein alpha gene Tg mice significantly elevated intracellular oligomeric ASYN species. Importantly, GCase inhibition, induced a profound increase in the number of brain exosomes released, as well as exosome-associated ASYN oligomers. Finally, virus-mediated expression of mutant GBA in the mouse striatum increased ASYN secretion in the same region. Together, these results provide for the first time evidence that a decrease of GCase or overexpression of mutant GCase in a chronic in vivo setting can affect ASYN secretion. Such effects may mediate enhanced propagation of ASYN, driving pathology in GBA-associated PD.

The major lysosomal proteolytic pathways essential for maintaining proper cellular homeostasis are macroautophagy, chaperone-mediated autophagy (CMA) and microautophagy. What differentiates CMA from the other types of autophagy is the fact that it does not involve vesicle formation; the unique feature of this pathway is the selective targeting of substrate proteins containing a CMA-targeting motif and the direct translocation into the lysosomal lumen, through the aid of chaperones/co-chaperones localized both at the cytosol and the lysosomes. CMA operates at basal conditions in most mammalian cell models analyzed so far, but it is mostly activated in response to stressors, such as trophic deprivation or oxidative stress. The activity of CMA has been shown to decline with age and such decline, correlating with accumulation of damaged/oxidized/aggregated proteins, may contribute to tissue dysfunction and, possibly, neurodegeneration. Herein, we review the recent knowledge regarding the molecular components, regulation and physiology of the CMA pathway, the contribution of impaired CMA activity to poor cellular homeostasis and inefficient response to stress during aging, and discuss the therapeutic opportunities offered by the restoration of CMA-dependent proteolysis in age-associated degenerative diseases.

Multiple system atrophy (MSA) is a rapidly progressive neurodegenerative disorder characterized by widespread oligodendroglial cytoplasmic inclusions of filamentous α-synuclein, and neuronal loss in autonomic centres, basal ganglia and cerebellar circuits. It has been suggested that primary oligodendroglial α-synucleinopathy may represent a trigger in the pathogenesis of MSA, but the mechanisms underlying selective vulnerability and disease progression are unclear. The post-mortem analysis of MSA brains provides a static final picture of the disease neuropathology, but gives no clear indication on the sequence of pathogenic events in MSA. Therefore, alternative methods are needed to address these issues. We investigated selective vulnerability and disease progression in the transgenic PLP-α-syn mouse model of MSA characterized by targeted oligodendroglial α-synuclein overexpression aiming to provide a neuropathological correlate of motor deterioration. We show progressive motor deficits that emerge at 6 months of age and deteriorate up to 18 months of follow-up. The motor phenotype was associated with dopaminergic cell loss in the substantia nigra pars compacta at 6 months, followed by loss of striatal dopaminergic terminals and DARPP32-positive medium sized projection neurons at 12 months. Olivopontocerebellar motor loops remained spared in the PLP-α-syn model of MSA. These findings replicate progressive striatonigral degeneration underlying Parkinson-variant MSA. The initiation of the degenerative process was linked to an increase of soluble oligomeric α-synuclein species between 2 and 6 months. Early region-specific α-synuclein-associated activation profile of microglia was found in MSA substantia nigra. The role of abnormal neuroinflammatory signalling in disease progression was further supported by increased levels of CD68, CCL3, CCL5 and M-CSF with a peak in aged PLP-α-syn mice. In summary, transgenic PLP-α-syn mice show a distinctive oligodendroglial α-synucleinopathy that is associated with progressive striatonigral degeneration linked to abnormal neuroinflammatory response. The model provides a relevant tool for preclinical therapeutic target discovery for human Parkinson-variant MSA.

Multiple system atrophy (MSA) is characterized by the presence of distinctive glial cytoplasmic inclusions (GCIs) within oligodendrocytes that contain the neuronal protein alpha-synuclein (aSyn) and the oligodendroglia-specific phosphoprotein TPPP/p25α. However, the role of oligodendroglial aSyn and p25α in the formation of aSyn-rich GCIs remains unclear. To address this conundrum, we have applied human aSyn (haSyn) pre-formed fibrils (PFFs) to rat wild-type (WT)-, haSyn-, or p25α-overexpressing oligodendroglial cells and to primary differentiated oligodendrocytes derived from WT, knockout (KO)-aSyn, and PLP-haSyn-transgenic mice. HaSyn PFFs are readily taken up by oligodendroglial cells and can recruit minute amounts of endogenous aSyn into the formation of insoluble, highly aggregated, pathological assemblies. The overexpression of haSyn or p25α accelerates the recruitment of endogenous protein and the generation of such aberrant species. In haSyn PFF-treated primary oligodendrocytes, the microtubule and myelin networks are disrupted, thus recapitulating a pathological hallmark of MSA, in a manner totally dependent upon the seeding of endogenous aSyn. Furthermore, using oligodendroglial and primary cortical cultures, we demonstrated that pathology-related S129 aSyn phosphorylation depends on aSyn and p25α protein load and may involve different aSyn "strains" present in oligodendroglial and neuronal synucleinopathies. Importantly, this hypothesis was further supported by data obtained from human post-mortem brain material derived from patients with MSA and dementia with Lewy bodies. Finally, delivery of haSyn PFFs into the mouse brain led to the formation of aberrant aSyn forms, including the endogenous protein, within oligodendroglia and evoked myelin decompaction in WT mice, but not in KO-aSyn mice. This line of research highlights the role of endogenous aSyn and p25α in the formation of pathological aSyn assemblies in oligodendrocytes and provides in vivo evidence of the contribution of oligodendroglial aSyn in the establishment of aSyn pathology in MSA.

Abstract Background A minimally invasive test for early detection and monitoring of Parkinson's disease (PD) is a highly unmet need for drug development and planning of patient care. Blood plasma represents an attractive source of biomarkers. MicroRNAs (miRNAs) are conserved noncoding RNA molecules that serve as posttranscriptional regulators of gene expression. As opposed to ubiquitously expressed miRNAs that control house‐keeping processes, brain‐enriched miRNAs regulate diverse aspects of neuron development and function. These include neuron‐subtype specification, axonal growth, dendritic morphogenesis, and spine density. Backed by a large number of studies, we now know that the differential expression of neuron‐enriched miRNAs leads to brain dysfunction. Objectives The aim was to identify subsets of brain‐enriched miRNAs with diagnostic potential for familial and idiopathic PD as well as specify the molecular pathways deregulated in PD. Methods Initially, brain‐enriched miRNAs were selected based on literature review and validation studies in human tissues. Subsequently, real‐time reverse transcription polymerase chain reaction was performed in the plasma of 100 healthy controls and 99 idiopathic and 53 genetic (26 alpha‐synuclein A53T and 27 glucocerebrosidase) patients. Statistical and bioinformatics analyses were carried out to pinpoint the diagnostic biomarkers and deregulated pathways, respectively. Results An explicit molecular fingerprint for each of the 3 PD cohorts was generated. Although the idiopathic PD fingerprint was different from that of genetic PD, the molecular pathways deregulated converged between all PD subtypes. Conclusions The study provides a group of brain‐enriched miRNAs that may be used for the detection and differentiation of PD subtypes. It has also identified the molecular pathways deregulated in PD. © 2019 International Parkinson and Movement Disorder Society

Introduction: Timely recognition of mild cognitive impairment (MCI) is essential in optimizing prevention and treatment for Alzheimer disease. Because of the paucity of data on MCI epidemiology in Greece and the variability of worldwide published results, we investigated the prevalence and determinants of MCI in the elderly population in Greece. Methods: As part of the Hellenic Epidemiological Longitudinal Investigation of Aging and Diet (HELIAD), we randomly selected 1960 individuals 65 years and older to undergo full neurological and neuropsychological assessment by a multidisciplinary team. MCI was diagnosed according to the Petersen criteria. Results: The age-standardized and gender-standardized prevalence of MCI in people aged 65 years and older in Greece is 13.11%. The amnestic and multidomain MCI subtypes are more common than their nonamnestic and single-domain counterparts, respectively. Almost two thirds of cases are because of suspected Alzheimer disease. Every additional year of age increases the odds of prevalent MCI by 7.4%, every additional year of education decreases the odds of MCI by 6.3%, and apolipoprotein E ( APOE-ε4 ) carriage increases the odds of MCI by 57.9%. Conclusions: MCI prevalence in the elderly population in Greece is on par with previously reported rates. Prospective studies with robust methodology will enhance our understanding of the dementia continuum.

There is a pressing need to identify and validate, minimally invasive, molecular biomarkers that will complement current practices and increase the diagnostic accuracy in Parkinson's disease (PD). Brain-enriched miRNAs regulate all aspects of neuron development and function; importantly, they are secreted by neurons in amounts that can be readily detected in the plasma. Τhe aim of the present study was to validate a set of previously identified brain-enriched miRNAs with diagnostic potential for idiopathic PD and recognize the molecular pathways affected by these deregulated miRNAs.RT-qPCR was performed in the plasma of 92 healthy controls and 108 idiopathic PD subjects. Statistical and in silico analyses were used to validate deregulated miRNAs and pathways in PD, respectively.miR-22-3p, miR-124-3p, miR-136-3p, miR-154-5p, and miR-323a-3p levels were found to be differentially expressed between healthy controls and PD patients. miR-330-5p, miR-433-3p, and miR-495-3p levels were overall higher in male subjects. Most of these miRNAs are clustered at Chr14q32 displaying CREB1, CEBPB, and MAZ transcription factor binding sites. Gene Ontology annotation analysis of deregulated miRNA targets revealed that "Protein modification," "Transcription factor activity," and "Cell death" terms were over-represented. Kyoto Encyclopedia of Genes and Genome analysis revealed that "Long-term depression," "TGF-beta signaling," and "FoxO signaling" pathways were significantly affected.We validated a panel of brain-enriched miRNAs that can be used along with other measures for the detection of PD, revealed molecular pathways targeted by these deregulated miRNAs, and identified upstream transcription factors that may be directly implicated in PD pathogenesis.

This article recapitulates the evidence on the role of mammalian targets of rapamycin (mTOR) complex pathways in multiple sclerosis (MS). Key biological processes that intersect with mTOR signaling cascades include autophagy, inflammasome activation, innate (e.g., microglial) and adaptive (B and T cell) immune responses, and axonal and neuronal toxicity/degeneration. There is robust evidence that mTOR inhibitors, such as rapamycin, ameliorate the clinical course of the animal model of MS, experimental autoimmune encephalomyelitis (EAE). New, evolving data unravel mechanisms underlying the therapeutic effect on EAE, which include balance among T-effector and T-regulatory cells, and mTOR effects on myeloid cell function, polarization, and antigen presentation, with relevance to MS pathogenesis. Radiologic and preliminary clinical data from a phase 2 randomized, controlled trial of temsirolimus (a rapamycin analogue) in MS show moderate efficacy, with significant adverse effects. Large clinical trials of indirect mTOR inhibitors (metformin) in MS are lacking; however, a smaller prospective, non-randomized study shows some potentially promising radiological results in combination with ex vivo beneficial effects on immune cells that might warrant further investigation. Importantly, the study of mTOR pathway contributions to autoimmune inflammatory demyelination and multiple sclerosis illustrates the difficulties in the clinical application of animal model results. Nevertheless, it is not inconceivable that targeting metabolism in the future with cell-selective mTOR inhibitors (compared to the broad inhibitors tried to date) could be developed to improve efficacy and reduce side effects.

Previous prospective studies highlighted dairy intake as a risk factor for Parkinson's disease (PD), particularly in men. It is unclear whether this association is causal or explained by reverse causation or confounding.The aim is to examine the association between genetically predicted dairy intake and PD using two-sample Mendelian randomization (MR).We genotyped a well-established instrumental variable for dairy intake located in the lactase gene (rs4988235) within the Courage-PD consortium (23 studies; 9823 patients and 8376 controls of European ancestry).Based on a dominant model, there was an association between genetic predisposition toward higher dairy intake and PD (odds ratio [OR] per one serving per day = 1.70, 95% confidence interval = 1.12-2.60, P = 0.013) that was restricted to men (OR = 2.50 [1.37-4.56], P = 0.003; P-difference with women = 0.029).Using MR, our findings provide further support for a causal relationship between dairy intake and higher PD risk, not biased by confounding or reverse causation. Further studies are needed to elucidate the underlying mechanisms. © 2022 International Parkinson and Movement Disorder Society.

Leucine-rich repeat kinase 2 (LRRK2) is a kinase involved in different cellular functions, including autophagy, endolysosomal pathways, and immune function. Mutations in LRRK2 cause autosomal-dominant forms of Parkinson's disease (PD). Heterozygous mutations in GBA1, the gene encoding the lysosomal enzyme glucocerebrosidase (GCase), are the most common genetic risk factors for PD. Moreover, GCase function is altered in idiopathic PD and in other genetic forms of the disease. Recent work suggests that LRRK2 kinase activity can regulate GCase function. However, both a positive and a negative correlation have been described. To gain insights into the impact of LRRK2 on GCase, we performed a comprehensive analysis of GCase levels and activity in complementary LRRK2 models, including (i) LRRK2 G2019S knock in (GSKI) mice, (ii) peripheral blood mononuclear cell (PBMCs), plasma, and fibroblasts from PD patients carrying LRRK2 G2019S mutation, (iii) patient iPSCs-derived neurons; (iv) endogenous and overexpressed cell models. In some of these models we found a positive correlation between the activities of LRRK2 and GCase, which was further confirmed in cell lines with genetic and pharmacological manipulation of LRRK2 kinase activity. GCase protein level is reduced in GSKI brain tissues and in G2019S iPSCs-derived neurons, but increased in fibroblasts and PBMCs from patients, suggesting cell-type-specific effects. Overall, our study indicates that LRRK2 kinase activity affects both the levels and the catalytic activity of GCase in a cell-type-specific manner, with important implications in the context of therapeutic application of LRRK2 inhibitors in GBA1-linked and idiopathic PD.

Abstract: Programmed cell death has been proposed to play a role in the death of neurons in acute and chronic degenerative neurologic disease. There is now evidence that the caspases, a family of cysteine proteases, mediate programmed cell death in various cells. In neurons, caspase‐3 (CPP32/Yama/apopain), in particular, has been proposed to play a role. We examined the expression of caspase‐3 in three models of programmed cell death affecting neurons of the substantia nigra in the rat: natural developmental neuron death and induced developmental death following either striatal target injury with quinolinic acid or dopamine terminal lesion with intrastriatal injection of 6‐hydroxydopamine. Using an antibody to the large (p17) subunit of activated caspase‐3, we have found that activated enzyme is expressed in apoptotic profiles in all models. Increased p17 immunostaining correlated with increased enzyme activity. The sub‐cellular distribution of activated caspase‐3 differed among the models: In natural cell death and the target injury model, it was strictly nuclear, whereas in the toxin model, it was also cytoplasmic. We conclude that p17 immunostaining is a useful marker for programmed cell death in neurons of the substantia nigra.

We have previously shown that caspase-2 (Nedd-2) is required for apoptosis induced by withdrawal of trophic support from PC12 cells and sympathetic neurons. Here, we examine the relationship of caspase-2 processing and cell death to induction of caspase-3 (CPP32)-like activity in PC12 cells. Caspase-2 processing, at a site tentatively identified as D333, led to the formation of an N-terminal 37 kDa product. This processing correlated temporally with induction of caspase-3-like activity. Agents previously shown to inhibit caspase-3-like activation, such as bcl-2 and the Cdk inhibitor flavopiridol, also acted upstream of caspase-2 processing. The general caspase inhibitors BAF and zVAD-FMK inhibited N-terminal caspase-2 processing. In contrast, the more selective caspase inhibitor DEVD-FMK inhibited the induction of caspase-3-like activity but did not affect caspase-2 processing or significantly suppress death in PC12 cells or sympathetic neurons. This indicates that caspase-3-like activity is not required for either caspase-2 processing or apoptosis in this paradigm. An antisense oligonucleotide to caspase-2 inhibited cell death but did not affect caspase-3-like activity, indicating that caspase-2 is not upstream of this activity and that activation of caspase-3-like caspases is not sufficient for death. Thus, in our paradigm, caspase-2 processing and caspase-3-like activity are induced independently of each other. Moreover, although death requires caspase-2, caspase-3-like activity is neither necessary nor sufficient for death.

Growing evidence suggests that the proteasome may be dysfunctional in a number of neurodegenerative disorders, including Lewy body diseases. We have reported previously that application of pharmacological inhibitors of the proteasome to cultured cortical neurons leads to apoptotic death and formation of ubiquitinated cytoplasmic inclusions. A number of cell cycle regulatory proteins are known to be degraded by the proteasome. In light of the emerging role of aberrant cell-cycle activation in neuronal cell death, we have assessed the involvement of cell-cycle components in the effects induced by proteasomal inhibitors in cortical neurons. Death and mitochondrial dysfunction induced by lactacystin and other pharmacological inhibitors of the proteasome were prevented by flavopiridol, a specific inhibitor of cyclin-dependent kinases (Cdks). Molecular expression of the Cdk inhibitors p16 or p27, or of dominant-negative Cdk2, Cdk4, or Cdk6 was also protective against lactacystin-induced death. Flavopiridol blocked the induction of retinoblastoma protein (pRb) phosphorylation that occurred after lactacystin application, and expression of a mutant pRb that lacked phosphorylation sites was neuroprotective. These results suggest that in cortical neurons, proteasomal inhibition leads to a cell death pathway that is dependent on Cdk activation and pRb inactivation. Although cyclins D1 and E were sequestered within the ubiquitinated inclusions formed at late time points after lactacystin application, the formation of ubiquitinated inclusions was unaffected by Cdk inhibition. This suggests that there are parallel pathways regulating neuronal death and inclusion formation elicited by proteasomal inhibition in cortical neurons.

DNA damage has been implicated as one important initiator of cell death in neuropathological conditions such as stroke. Accordingly, it is important to understand the signaling processes that control neuronal death induced by this stimulus. Previous evidence has shown that the death of embryonic cortical neurons treated with the DNA-damaging agent camptothecin is dependent on the tumor suppressor p53 and cyclin-dependent kinase (CDK) activity and that the inhibition of either pathway alone leads to enhanced and prolonged survival. We presently show that p53 and CDKs are activated independently on parallel pathways. An increase in p53 protein levels, nuclear localization, and DNA binding that result from DNA damage are not affected by the inhibition of CDK activity. Conversely, no decrease in retinoblastoma protein (pRb) phosphorylation was observed in p53-deficient neurons that were treated with camptothecin. However, either p53 deficiency or the inhibition of CDK activity alone inhibited Bax translocation, cytochrome c release, and caspase-3-like activation. Taken together, our results indicate that p53 and CDK are activated independently and then act in concert to control Bax-mediated apoptosis.

Cultured rat embryonic cortical neurons undergo apoptosis when treated with the topoisomerase-I inhibitor camptothecin. Pharmacological or molecular caspase inhibition prevents apoptosis, but the neurons still die in a delayed nonapoptotic manner. Here we examine the mechanisms leading to such caspase-independent death, focusing on events related to mitochondrial malfunction, which accompanies this delayed death. Given that mitochondria are the major source of ATP in primary neurons, we examined the cellular energy state. Mitochondrially generated ATP was specifically reduced in neurons treated with camptothecin and Boc-aspartyl-fluoromethylketone. Augmentation of cellular ATP by manipulation of the glucose content in the cultures led to an increase in survival specifically in delayed caspase-independent but not early caspase-dependent death. As another possible consequence of mitochondrial malfunction, we found an induction of reactive oxygen species in delayed death. The free radical scavenger Tempol, but not other classes of antioxidants, reduced oxidative stress and promoted survival. Other potential events known to be a direct or indirect consequence of mitochondrial dysfunction, such as the induction of autophagy, release of apoptosis-inducing factor, or opening of the mitochondrial permeability transition pore, were not found to play a significant role in caspase-independent neuronal death. Combining the strategies of increasing intracellular ATP and reducing free radicals led to an additive increase in neuronal survival. We conclude that energy failure and free radical generation contribute to caspase-independent neuronal death. Both could represent potential targets for therapeutic interventions complementary to caspase inhibition.

α-Synuclein is a neuronal presynaptic protein that regulates neurotransmitter release. Genetic, neuropathological, biochemical and animal model data indicate that it plays a major role in Parkinson's disease and other neurodegenerative disorders, acting through a toxic gain of function. Although the mechanism of the toxic function of α-Synuclein is not yet certain, it may involve multiple intracellular targets of the aberrantly misfolded, aggregated protein. It is generally thought that specific soluble oligomeric α-Synuclein species are the offending toxic agents. The total amount of α-Synuclein is a significant factor that determines its toxicity. α-Synuclein can also be secreted and can thus affect neuronal and glial function. Propagation of α-Synuclein pathology via neuron-to-neuron transmission and seeding may also contribute to Parkinson's disease pathogenesis.Key mechanisms of deregulation of α-Synuclein that could be relevant to neurodegeneration, and could offer opportunities for therapeutic intervention.Counteracting intracellular and extracellular effects of α-Synuclein represents a valid therapeutic target in neurodegeneration. In particular, strategies that target α-Synuclein through limitation of its burden at the transcriptional and post-transcriptional level, inhibition of its aggregation or of aberrant phosphorylation states, immunization or attenuation of its secretion and propagation may be therapeutic options.

Although the first mutation associated with Parkinson's disease (PD) was identified several years ago in the alpha-synuclein (SNCA) gene in families of Greek and Italian ancestry, a more systematic study of this and other known PD mutations has not been performed in the Greek population.A genetic analysis in 111 familial or sporadic with early-onset (≤50 years, EO) PD patients was performed for the presence of the A53T SNCA mutation. In separate subgroups of these patients, further mutations in the SNCA, LRRK2, Parkin, PINK1 and DJ-1 genes were searched for. Additionally, a subgroup of familial cases was analysed for mutations in the glucocerebrosidase (GBA) gene.In total, five patients (4.5% of our whole population) were identified with the A53T SNCA mutation, two with a heterozygote dosage mutation and one with a heterozygote point mutation in the Parkin gene, and seven patients (10.3% of our familial cohort) with GBA gene mutations.The A53T mutation in the SNCA gene, although uncommon, does represent a cause of PD in the Greek population, especially of familial EOPD with autosomal dominant inheritance. GBA mutations in the familial cohort tested here were as common as in a cohort of sporadic cases previously examined from the same centres. For the remainder of the genes, genetic defects that could definitively account for the disease were not identified. These results suggest that further Mendelian traits that lead to PD in the Greek population remain to be identified.

Lysosomal protein 2 (LIMP2), the product of the scavenger receptor class B member 2 (SCARB2) gene, is a ubiquitously expressed transmembrane protein that is the mannose-6-phosphate-independent receptor for glucocerebrosidase (β-GCase); a deficiency in this protein causes Gaucher disease. Several studies have shown a link between mutations in the β-GCase gene and diseases characterized clinically by Parkinsonism and by the presence of Lewy body-related pathology. We hypothesized that genetic variants in the SCARB2 gene could be risk factors for Parkinson's disease (PD). A candidate-gene study of 347 Greek patients with sporadic PD and 329 healthy controls was conducted to investigate the association between 5 polymorphisms in the SCARB2 gene (rs6824953, rs6825004, rs4241591, rs9991821, and rs17234715) and the development of PD. The single-locus analysis for the 5 polymorphisms revealed an association only for the rs6825004 polymorphism: the generalized odds ratio (OR(G) ) was 0.68 (95% confidence interval [CI], 0.51-0.90), and the OR for the allelic test was OR = 0.71 (95% CI, 0.56-0.90). Haplotype analysis showed an association for the GCGGT haplotype (P < .01). Our study supports a genetic contribution of the SCARB2 locus to PD; future studies in larger cohorts are necessary to verify this finding.

ABSTRACT Background Reduced expression of lysosomal‐associated membrane protein 2a and heatshock‐cognate 70 proteins, involved in chaperone‐mediated autophagy and of glucocerebrosidase, is reported in PD brains. The aim of this study was to identify systemic alterations in lysosomal‐associated membrane protein 2a, heatshock cognate‐70, and glucocerebrosidase levels/activity in peripheral blood mononuclear cells from PD patients. Methods Protein/mRNA levels were assessed in PD patients from genetically undetermined background, alpha‐synuclein (G209A/A53T), or glucocerebrosidase mutation carriers and age‐/sex‐matched controls. Results Heatshock cognate 70 protein levels were reduced in all PD groups, whereas its mRNA levels were decreased only in the genetically undetermined group. Glucocerebrosidase protein levels were decreased only in the genetic PD groups, whereas increased mRNA levels and decreased activity were detected only in the glucocerebrosidase mutation group. Conclusions Reduced heatshock cognate‐70 levels are suggestive of an apparent systemic chaperone‐mediated autophagy dysfunction irrespective of genetic background. Glucocerebrosidase activity may serve as a screening tool to identify glucocerebrosidase mutation carriers with PD. © 2015 International Parkinson and Movement Disorder Society

To date, a plethora of studies have provided evidence favoring an association between Gaucher disease (GD) and Parkinson's disease (PD). GD, the most common lysosomal storage disorder, results from the diminished activity of the lysosomal enzyme β-glucocerebrosidase (GCase), caused by mutations in the β-glucocerebrosidase gene (GBA). Alpha-synuclein (ASYN), a presynaptic protein, has been strongly implicated in PD pathogenesis. ASYN may in part be degraded by the lysosomes and may itself aberrantly impact lysosomal function. Therefore, a putative link between deficient GCase and ASYN, involving lysosomal dysfunction, has been proposed to be responsible for the risk for PD conferred by GBA mutations. In this current work, we aimed to investigate the effects of pharmacological inhibition of GCase on ASYN accumulation/aggregation, as well as on lysosomal function, in differentiated SH-SY5Y cells and in primary neuronal cultures. Following profound inhibition of the enzyme activity, we did not find significant alterations in ASYN levels, or any changes in the clearance or formation of its oligomeric species. We further observed no significant impairment of the lysosomal degradation machinery. These findings suggest that additional interaction pathways together with aberrant GCase and ASYN must govern this complex relation between GD and PD.

One of the main pathways of lysosomal proteolysis is chaperone-mediated autophagy (CMA), which represents a selective mechanism for the degradation of specific soluble proteins within lysosomes. Along with the other two lysosomal pathways, macro- and micro-autophagy, CMA contributes to cellular quality control through the removal of damaged or malfunctioning proteins. The two intrinsic characteristics of CMA are the selective targeting and the direct translocation of substrate proteins into the lysosomal lumen, in a fine-tuned manner through the orchestrated action of a chaperone/co-chaperone complex localized both at the cytosol and the lysosomes. Even though CMA was originally identified as a stress-induced pathway, basal CMA activity is detectable in most cell types analyzed so far, including neurons. Additionally, CMA activity declines with age and this may become a major aggravating factor contributing to neurodegeneration. More specifically, it has been suggested that CMA impairment may underlie the accumulation of misfolded/aggregated proteins, such as alpha-synuclein or LRRK2, whose levels or conformations are critical to Parkinson's disease pathogenesis. On the other hand, CMA induction might accelerate clearance of pathogenic proteins and promote cell survival, suggesting that CMA represents a viable therapeutic target for the treatment of various proteinopathies. In the current review, we provide an overview of the current state of knowledge regarding the role of CMA under physiological and pathological conditions of the nervous system and discuss the implications of these findings for therapeutic interventions for Parkinson's disease and other neurodegenerative disorders. This article is part of Special Issue entitled "Neuronal Protein"

Corticobasal degeneration (CBD) is a rare neurodegenerative disorder. The most common presentation of CBD is the corticobasal syndrome (CBS), which is a constellation of cortical and extrapyramidal symptoms and signs. Clinical-pathological studies have illustrated that CBD can present with diverse clinical phenotypes, including a non-fluent, agrammatic primary progressive aphasia syndrome, a behavioral, dysexecutive and visuospatial syndrome, as well as a progressive supranuclear palsy-like syndrome. Conversely, multiple pathologies, such as CBD, Alzheimer's disease and progressive supranuclear palsy may underlie a patient with CBS. This clinical-pathological overlap emphasizes the need for biomarkers that will assist in the accurate diagnosis of patients with CBS. This review presents an overview of the pathological, genetic, clinical and therapeutic characteristics of CBD, with an emphasis on the imaging (structural and functional) and biochemical (cerebrospinal fluid) biomarkers of CBD.

Given the limited information on cognitive function before Parkinson disease (PD) clinical onset in the general population, we sought to assess prodromal PD (pPD) probability and relate it to detailed cognitive performance in a community cohort.In a population-based cohort of 1,629 dementia-free and PD-free participants ≥65 years of age in Greece, we assessed probability of pPD according to the International Parkinson and Movement Disorder Society's criteria. Clinical cognitive diagnoses (cognitively unimpaired, mild cognitive impairment [MCI], dementia) considering neuropsychological testing and functional status were assigned in consensus conferences. Cognitive performance in 5 cognitive domains was assessed by a detailed neuropsychological battery and summarized in the form of z scores. We investigated associations between pPD probability (and its individual constituents) and cognitive outcomes.The median probability of pPD was 1.81% (0.2%-96.7%). Participants with MCI had higher probability of pPD compared to those with normal cognition (p < 0.001). Higher probability of pPD was related to lower performance in all cognitive domains (memory, language, executive, attention, and visuospatial function) (p < 0.001). Lower cognitive performance was further associated with certain nonmotor markers of pPD, such as daytime somnolence, depression, urinary dysfunction, constipation, and subthreshold parkinsonism (p < 0.001).Higher probability of pPD was associated with lower cognitive performance in all domains and higher probability of MCI. This may reflect a widespread pathologic process although future studies are warranted to infer causality. These results suggest to clinicians that they should assess cognition early, and to researchers that they should further look into the possible mechanisms that may underlie this observation.

Parkinson's disease (PD) is a neurodegenerative disease, mostly presenting with characteristic motor symptoms. Organochlorines (OC) are a class of widely-used pesticides that have been included among the list of environmental factors incriminated in PD pathogenesis. However, most studies reporting this association are based on questionnaires, and few have reported exposure data.To examine the relationship between OC blood concentrations and PD risk.In the present study, we studied the concentrations of 8 OC compounds (hexachlorobenzene, heptachlor, hepachlor epoxide, c-chlordane, a-chlordane, p,p'-DDE, DDD, DDT) in 104 Greek PD patients and 110 healthy controls.All substances studied were present in at least one sample. The most frequently detected (above the level of quantification) pesticides were p,p'-DDE (n = 214, 100 % of both groups) and hexachlorobenzene, HCB (n = 189, cases 46.5 %, controls 53.5 %). Higher levels of DDE were detected among PD patients in comparison to controls by using logistic regression analysis to control for confounders [Odds Ratio, OR (95 % confidence interval, C.I.)]: 2.592,(1.29-5.21)], whilst lower levels of HCB were detect among PD patients [OR,95 %CI:0.176(0.09-0.35)].Our data suggest that exposure to specific OCs is related to the risk of PD. Further studies, using real exposure data, are needed in order to confirm and extend these findings.

Neurodegenerative diseases are challenging for systems biology because of the lack of reliable animal models or patient samples at early disease stages. Induced pluripotent stem cells (iPSCs) could address these challenges. We investigated DNA, RNA, epigenetics, and proteins in iPSC-derived motor neurons from patients with ALS carrying hexanucleotide expansions in C9ORF72. Using integrative computational methods combining all omics datasets, we identified novel and known dysregulated pathways. We used a C9ORF72 Drosophila model to distinguish pathways contributing to disease phenotypes from compensatory ones and confirmed alterations in some pathways in postmortem spinal cord tissue of patients with ALS. A different differentiation protocol was used to derive a separate set of C9ORF72 and control motor neurons. Many individual -omics differed by protocol, but some core dysregulated pathways were consistent. This strategy of analyzing patient-specific neurons provides disease-related outcomes with small numbers of heterogeneous lines and reduces variation from single-omics to elucidate network-based signatures.

Background and Objectives: Dementia affects more than 55 million patients worldwide, with a significant societal, economic, and psychological impact. However, many patients with Alzheimer’s disease (AD) and other related dementias have limited access to effective and individualized treatment. Care provision for dementia is often unequal, fragmented, and inefficient. The COVID-19 pandemic accelerated telemedicine use, which holds promising potential for addressing this important gap. In this narrative review, we aim to analyze and discuss how telemedicine can improve the quality of healthcare for AD and related dementias in a structured manner, based on the seven dimensions of healthcare quality defined by the World Health Organization (WHO), 2018: effectiveness, safety, people-centeredness, timeliness, equitability, integrated care, and efficiency. Materials and Methods: MEDLINE and Scopus databases were searched for peer-reviewed articles investigating the role of telemedicine in the quality of care for patients with dementia. A narrative synthesis was based on the seven WHO dimensions. Results: Most studies indicate that telemedicine is a valuable tool for AD and related dementias: it can improve effectiveness (better access to specialized care, accurate diagnosis, evidence-based treatment, avoidance of preventable hospitalizations), timeliness (reduction of waiting times and unnecessary transportation), patient-centeredness (personalized care for needs and values), safety (appropriate treatment, reduction of infection risk),integrated care (interdisciplinary approach through several dementia-related services), efficiency (mainly cost-effectiveness) and equitability (overcoming geographical barriers, cultural diversities). However, digital illiteracy, legal and organizational issues, as well as limited awareness, are significant potential barriers. Conclusions: Telemedicine may significantly improve all aspects of the quality of care for patients with dementia. However, future longitudinal studies with control groups including participants of a wide educational level spectrum will aid in our deeper understanding of the real impact of telemedicine in quality care for this population.

Parkinson's disease is a progressive neurodegenerative disorder characterized by the accumulation of misfolded alpha-synuclein in intraneuronal inclusions known as Lewy bodies and Lewy neurites. Multiple studies strongly implicate the levels of alpha-synuclein as a major risk factor for the onset and progression of Parkinson's disease. Alpha-synuclein pathology spreads progressively throughout interconnected brain regions but the precise molecular mechanisms underlying the seeding of alpha-synuclein aggregation are still unclear. Here, using stable cell lines expressing alpha-synuclein, we examined the correlation between endogenous alpha-synuclein levels and the seeding propensity by exogenous alpha-synuclein preformed fibrils. We applied biochemical approaches and imaging methods in stable cell lines expressing alpha-synuclein and in primary neurons to determine the impact of alpha-synuclein levels on seeding and aggregation. Our results indicate that the levels of alpha-synuclein define the pattern and severity of aggregation and the extent of p-alpha-synuclein deposition, likely explaining the selective vulnerability of different cell types in synucleinopathies. The elucidation of the cellular processes involved in the pathological aggregation of alpha-synuclein will enable the identification of novel targets and the development of therapeutic strategies for Parkinson's disease and other synucleinopathies.

Epidemiological studies that examined the association between Parkinson's disease (PD) and cancers led to inconsistent results, but they face a number of methodological difficulties.We used results from genome-wide association studies (GWASs) to study the genetic correlation between PD and different cancers to identify common genetic risk factors.We used individual data for participants of European ancestry from the Courage-PD (Comprehensive Unbiased Risk Factor Assessment for Genetics and Environment in Parkinson's Disease; PD, N = 16,519) and EPITHYR (differentiated thyroid cancer, N = 3527) consortia and summary statistics of GWASs from iPDGC (International Parkinson Disease Genomics Consortium; PD, N = 482,730), Melanoma Meta-Analysis Consortium (MMAC), Breast Cancer Association Consortium (breast cancer), the Prostate Cancer Association Group to Investigate Cancer Associated Alterations in the Genome (prostate cancer), International Lung Cancer Consortium (lung cancer), and Ovarian Cancer Association Consortium (ovarian cancer) (N comprised between 36,017 and 228,951 for cancer GWASs). We estimated the genetic correlation between PD and cancers using linkage disequilibrium score regression. We studied the association between PD and polymorphisms associated with cancers, and vice versa, using cross-phenotypes polygenic risk score (PRS) analyses.We confirmed a previously reported positive genetic correlation of PD with melanoma (Gcorr = 0.16 [0.04; 0.28]) and reported an additional significant positive correlation of PD with prostate cancer (Gcorr = 0.11 [0.03; 0.19]). There was a significant inverse association between the PRS for ovarian cancer and PD (odds ratio [OR] = 0.89 [0.84; 0.94]). Conversely, the PRS of PD was positively associated with breast cancer (OR = 1.08 [1.06; 1.10]) and inversely associated with ovarian cancer (OR = 0.95 [0.91; 0.99]). The association between PD and ovarian cancer was mostly driven by rs183211 located in an intron of the NSF gene (17q21.31).We show evidence in favor of a contribution of pleiotropic genes to the association between PD and specific cancers. © 2023 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society. This article has been contributed to by U.S. Government employees and their work is in the public domain in the USA.

Background: Alzheimer’s disease dementia (ADD) may manifest with atypical phenotypes, resembling behavioral variant frontotemporal dementia (bvFTD) and corticobasal syndrome (CBS), phenotypes which typically have an underlying frontotemporal lobar degeneration with tau proteinopathy (FTLD-tau), such as Pick’s disease, corticobasal degeneration (CBD), progressive supranuclear palsy (PSP), or FTLD with TDP-43 proteinopathy (FTLD-TDP). CSF biomarkers total and phosphorylated tau (τT and τP-181), and amyloid beta with 42 and 40 amino acids (Aβ42 and Aβ40) are biomarkers of AD pathology. The primary aim of this study was to compare the diagnostic accuracy of Aβ42 to Aβ42/Aβ40 ratio in: (a) differentiating ADD vs. frontotemporal dementias; (b) patients with AD pathology vs. non-AD pathologies; (c) compare biomarker ratios and composite markers to single CSF biomarkers in the differentiation of AD from FTD; Methods: In total, 263 subjects were included (ADD: n = 98; bvFTD: n = 49; PSP: n = 50; CBD: n = 45; controls: n = 21). CSF biomarkers were measured by commercially available ELISAs (EUROIMMUN). Multiple biomarker ratios (Aβ42/Aβ40; τT/τP-181; τT/Aβ42; τP-181/Aβ42) and composite markers (t-tau: τT/(Aβ42/Aβ40); p-tau: τP-181/(Aβ42/Aβ40) were calculated. ROC curve analysis was performed to compare AUCs of Aβ42 and Aβ42/Aβ40 ratio and relevant composite markers between ADD and FTD, as defined clinically. BIOMARKAPD/ABSI criteria (abnormal τT, τP-181 Aβ42, and Aβ42/Aβ40 ratio) were used to re-classify all patients into AD pathology vs. non-AD pathologies, and ROC curve analysis was repeated to compare Aβ42 and Aβ42/Aβ40; Results: Aβ42 did not differ from Aβ42/Aβ40 ratio in the differentiation of ADD from FTD (AUCs 0.752 and 0.788 respectively; p = 0.212). The τT/Aβ42 ratio provided maximal discrimination between ADD and FTD (AUC:0.893; sensitivity 88.8%, specificity 80%). BIOMARKAPD/ABSI criteria classified 60 patients as having AD pathology and 211 as non-AD. A total of 22 had discrepant results and were excluded. Aβ42/Aβ40 ratio was superior to Aβ42 in the differentiation of AD pathology from non-AD pathology (AUCs: 0.939 and 0.831, respectively; p &lt; 0.001). In general, biomarker ratios and composite markers were superior to single CSF biomarkers in both analyses. Conclusions: Aβ42/Aβ40 ratio is superior to Aβ42 in identifying AD pathology, irrespective of the clinical phenotype. CSF biomarker ratios and composite markers provide higher diagnostic accuracy compared to single CSF biomarkers.

Fragile X-associated tremor/ataxia syndrome (FXTAS) is a late-onset, X-linked, neurodegenerative disorder that affects premutation carriers of the FMR1 gene. FXTAS is often misdiagnosed as spinocerebellar ataxia (SCA) or Parkinson's disease (PD). Herein, we sought to investigate the frequency, genotypic and phenotypic profile of FXTAS in two cohorts of Greek patients with late-onset movement disorders, one with cerebellar ataxia and the other with PD. In total, 90 index patients with late-onset cerebellar ataxia and 171 with PD were selected. None of the cases had male-to-male transmission. Genetic screening for the FMR1 premutation was performed using standard methodology. The FMR1 premutation was detected in two ataxia patients (2.2%) and two PD patients (1.2%). Additional clinical features in FXTAS patients from the ataxia cohort included neuropathy, mild parkinsonism, cognitive impairment and pyramidal signs. The FXTAS patients from the PD cohort had typical PD. We conclude that, in the Greek population, the FMR1 premutation is an important, albeit rare, cause of late-onset movement disorders. Routine premutation screening should be considered in SCA panel-negative late-onset ataxia cases. Directed premutation screening should be considered in all ataxia and PD cases with additional features suggestive of FXTAS. Our study highlights the importance of FMR1 genetic testing in the diagnosis of late-onset movement disorders.

A pathogenic GAA repeat expansion in the first intron of the fibroblast growth factor 14 gene (FGF14) has been recently identified as the cause of spinocerebellar ataxia 27B (SCA27B). We herein screened 160 Greek index cases with late-onset cerebellar ataxia (LOCA) for FGF14 repeat expansions using a combination of long-range PCR and bidirectional repeat-primed PCRs. We identified 19 index cases (12%) carrying a pathogenic FGF14 GAA expansion, a diagnostic yield higher than that of previously screened repeat-expansion ataxias in Greek LOCA patients. The age at onset of SCA27B patients was 60.5 ± 12.3 years (range, 34-80). Episodic onset (37%), downbeat nystagmus (32%) and vertigo (26%) were significantly more frequent in FGF14 expansion-positive cases compared to expansion-negative cases. Beyond typical cerebellar signs, SCA27B patients often displayed hyperreflexia (47%) and reduced vibration sense in the lower extremities (42%). The frequency and phenotypic profile of SCA27B in Greek patients was similar to most other previously studied populations. We conclude that FGF14 GAA repeat expansions are the commonest known genetic cause of LOCA in the Greek population and recommend prioritizing testing for FGF14 expansions in the diagnostic algorithm of patients with LOCA.

Pathogenic variants in parkin (PRKN gene) are the second most prevalent known monogenic cause of Parkinson's disease (PD). How monoallelic or biallelic pathogenic variants in the PRKN gene may affect its transcription in patient-derived biological material has not been systematically studied.PRKN mRNA expression levels were measured with real-time polymerase chain reaction (RT-PCR) in peripheral blood mononuclear cells (PBMCs). PBMCs were derived from PRKN-mutated PD patients (PRKN-PD) (n = 12), sporadic PD (sPD) (n = 21) and healthy controls (n = 21). Six of the PRKN-PD patients were heterozygous, four were compound heterozygous, and two were homozygous for PRKN variants.A statistically significant decrease in PRKN expression levels was present, compared to healthy controls and sPD, in heterozygous (P = 0.019 and 0.031 respectively) and biallelic (P < 0.001 for both) PRKN-PD. PRKN expression levels in biallelic PD patients were uniformly very low and were reduced, albeit not significantly, compared to heterozygotes. Based on receiver operating characteristic analysis, low PRKN expression levels were a sensitive and extremely specific indicator for the presence of PRKN pathogenic variants.Assessment of PRKN mRNA levels in PBMCs may be a useful way to screen for biallelic pathogenic variants in the PRKN gene. Suspicion for certain variants in a heterozygous state may also be raised based on low PRKN mRNA levels. © 2024 The Authors. Movement Disorders published by Wiley Periodicals LLC on behalf of International Parkinson and Movement Disorder Society.

The management of blood pressure variability (BPV) in acute stroke presents a complex challenge with profound implications for patient outcomes. This narrative review examines the role of BPV across various stages of acute stroke care, highlighting its impact on treatment strategies and prognostic considerations. In the prehospital setting, while guidelines lack specific recommendations for BP management, emerging evidence suggests a potential link between BPV and outcomes. Among ischaemic stroke patients who are ineligible for reperfusion therapies, BPV independently influences functional outcomes, emphasising the need for individualised approaches to BP control. During intravenous thrombolysis and endovascular therapy, the intricate interplay between BP levels, recanalisation status, and BPV is evident. Striking a balance between aggressive BP lowering and avoiding hypoperfusion-related complications is essential. Intracerebral haemorrhage management is further complicated by BPV, which emerges as a predictor of mortality and disability, necessitating nuanced BP management strategies. Finally, among patients with acute subarachnoid haemorrhage, increased BPV may be correlated with a rebleeding risk and worse outcomes, emphasizing the need for BPV monitoring in this population. Integration of BPV assessment into clinical practice and research protocols is crucial for refining treatment strategies that are tailored to individual patient needs. Future studies should explore novel interventions targeting BPV modulation to optimise stroke care outcomes.

Previous reports have shown that DNA-damage-evoked death of embryonic cortical neurons is delayed by general caspase inhibitors and is accompanied by an increase in DEVD-AFC cleavage activity. We show here that this cleavage activity is lacking in camptothecin-treated caspase 3-deficient neurons. Moreover, we report that death of camptothecin-treated caspase 3-deficient neurons cultured from E16 embryos is delayed and that no significant increase in survival is observed with cotreatment with the general caspase inhibitor BAF. These results indicate that caspase-dependent death of camptothecin-treated cortical neurons requires caspase 3 activity. The delay in death is accompanied by impairment of DNA fragmentation. However, Bax-dependent cytochrome c release still occurs in camptothecin-treated caspase 3-deficient cortical neurons. Accordingly, we hypothesize that the delayed death which occurs in the absence of caspase 3 activity may be due to mitochondrial dysfunction. Finally, we show that the delay in death observed with E16 caspase 3-deficient neurons does not occur in neurons cultured from E19 embryos. This suggests that the requirement for caspase 3 in death of neurons evoked by DNA damage may differ depending upon the developmental state of the cell.

Mutations in the alpha-synuclein gene have recently been identified in families with inherited Parkinson's disease and the protein product of this gene is a component of Lewy bodies, indicating that alpha-synuclein is involved in Parkinson's disease pathogenesis. A role for normal alpha-synuclein in synaptic function, apoptosis or plasticity responses has been suggested. We show here that in rat pheochromocytoma PC12 cells synuclein-1, the rat homolog of human alpha-synuclein, is highly and selectively up-regulated at the mRNA and protein levels after 7 days of nerve growth factor treatment. Synuclein-1 expression appears neither sufficient nor necessary for the neuritic sprouting that occurs within 1-2 days of nerve growth factor treatment. Rather, it likely represents a component of a late neuronal maturational response. Synuclein-1 redistributes diffusely within the cell soma and the neuritic processes in nerve growth factor-treated PC12 cells. Cultured neonatal rat sympathetic neurones express high levels of synuclein-1, with a diffuse intracellular distribution, similar to neuronal PC12 cells. These results suggest that levels of synuclein-1 may be regulated by neurotrophic factors in the nervous system and reinforce a role for alpha-synuclein in plasticity-maturational responses. In contrast, there is no correlation between synuclein expression and apoptotic death following trophic deprivation.

Dysfunction of the ubiquitin-dependent protein degradation system, either at the level of the proteasome itself, or at the level of ubiquitination, may play a role in the pathogenesis of Parkinson's disease (PD) and other related neurodegenerative disorders. We have employed a cellular model of this dysfunction in which lactacystin or epoxomicin, selective pharmacological inhibitors of the proteasome, are applied to primary cultures of embryonic rat ventral midbrain. Proteasomal inhibition with either agent led to apoptotic death specifically within phenotypically defined tyrosine hydroxylase (TH)-positive dopaminergic neurons, with little or no apoptotic death induced in GABAergic neurons. Inhibition of the proteasome also led to the formation of ubiquitin and alpha-synuclein-positive cytoplasmic inclusions in TH-positive and TH-negative neurons. Inclusions were observed in viable as well as apoptotic neurons, and required new or ongoing transcription. Tyrosine hydroxylase immunolabeling was often present within the inclusions. Such mislocalization may lead to dysfunction of dopamine biosynthesis. Interestingly, dopaminergic neurons, unlike other neurons within these cultures or cultured cortical neurons, failed to induce the chaperone Hsp70 in response to proteasomal inhibition. This failure may explain in part the increased sensitivity of these neurons to proteasomal inhibitors.