Katsuyuki Tamai

The p53 tumor suppressor protein is activated and phosphorylated on serine-15 in response to various DNA damaging agents. The gene product mutated in ataxia telangiectasia, ATM, acts upstream of p53 in a signal transduction pathway initiated by ionizing radiation. Immunoprecipitated ATM had intrinsic protein kinase activity and phosphorylated p53 on serine-15 in a manganese-dependent manner. Ionizing radiation, but not ultraviolet radiation, rapidly enhanced this p53-directed kinase activity of endogenous ATM. These observations, along with the fact that phosphorylation of p53 on serine-15 in response to ionizing radiation is reduced in ataxia telangiectasia cells, suggest that ATM is a protein kinase that phosphorylates p53 in vivo.

Chk1, an evolutionarily conserved protein kinase, has been implicated in cell cycle checkpoint control in lower eukaryotes. By gene disruption, we show that CHK1 deficiency results in a severe proliferation defect and death in embryonic stem (ES) cells, and peri-implantation embryonic lethality in mice. Through analysis of a conditional CHK1 -deficient cell line, we demonstrate that ES cells lacking Chk1 have a defective G 2 /M DNA damage checkpoint in response to γ-irradiation (IR). CHK1 heterozygosity modestly enhances the tumorigenesis phenotype of WNT-1 transgenic mice. We show that in human cells, Chk1 is phosphorylated on serine 345 (S345) in response to UV, IR, and hydroxyurea (HU). Overexpression of wild-type Atr enhances, whereas overexpression of the kinase-defective mutant Atr inhibits S345 phosphorylation of Chk1 induced by UV treatment. Taken together, these data indicate that Chk1 plays an essential role in the mammalian DNA damage checkpoint, embryonic development, and tumor suppression, and that Atr regulates Chk1.

Our recent work has shown that activation of the Ras/Raf/ERK pathway extends the half-life of the Myc protein and thus enhances the accumulation of Myc activity. We have extended these observations by investigating two N-terminal phosphorylation sites in Myc, Thr 58 and Ser 62, which are known to be regulated by mitogen stimulation. We now show that the phosphorylation of these two residues is critical for determining the stability of Myc. Phosphorylation of Ser 62 is required for Ras-induced stabilization of Myc, likely mediated through the action of ERK. Conversely, phosphorylation of Thr 58, likely mediated by GSK-3 but dependent on the prior phosphorylation of Ser 62, is associated with degradation of Myc. Further analysis demonstrates that the Ras-dependent PI-3K pathway is also critical for controlling Myc protein accumulation, likely through the control of GSK-3 activity. These observations thus define a synergistic role for multiple Ras-mediated phosphorylation pathways in the control of Myc protein accumulation during the initial stage of cell proliferation.

Through direct cloning of p53 binding sequences from human genomic DNA, we have isolated a novel gene, designated p53AIP1 (p53-regulated Apoptosis-Inducing Protein 1), whose expression is inducible by wild-type p53. Ectopically expressed p53AIP1, which is localized within mitochondria, leads to apoptotic cell death through dissipation of mitochondrial A(psi)m. We have found that upon severe DNA damage, Ser-46 on p53 is phosphorylated and apoptosis is induced. In addition, substitution of Ser-46 inhibits the ability of p53 to induce apoptosis and selectively blocks expression of p53AIP1. Our results suggest that p53AIP1 is likely to play an important role in mediating p53-dependent apoptosis, and phosphorylation of Ser-46 regulates the transcriptional activation of this apoptosis-inducing gene.

Upon DNA damage, the amino terminus of p53 is phosphorylated at a number of serine residues including S20, a site that is particularly important in regulating stability and function of the protein. Because no known kinase has been identified that can modify this site, HeLa nuclear extracts were fractionated and S20 phosphorylation was followed. We discovered that a S20 kinase activity copurifies with the human homolog of the Schizosaccharomyces pombe checkpoint kinase, Chk1 (hCHK1). We confirmed that recombinant hCHK1, but not a kinase-defective version of hCHK1, can phosphorylate p53 in vitro at S20. Additional inducible amino- and carboxy-terminal sites in p53 are also phosphorylated by hCHK1, indicating that this is an unusually versatile protein kinase. It is interesting that hCHK1 strongly prefers tetrameric to monomeric p53 in vitro, consistent with our observation that phosphorylation of amino-terminal sites in vivo requires that p53 be oligomeric. Regulation of the levels and activity of hCHK1 in transfected cells is directly correlated with the levels of p53; expression of either a kinase-defective hCHK1 or antisense hCHK1 leads to reduced levels of cotransfected p53, whereas overexpression of wild-type hCHK1 or the kinase domain of hCHK1 results in increased levels of expressed p53 protein. The human homolog of the second S. pombe checkpoint kinase, Cds1 (CHK2/hCds1), phosphorylates tetrameric p53 but not monomeric p53 in vitro at sites similar to those phosphorylated by hCHK1 kinase, suggesting that both checkpoint kinases can play roles in regulating p53 after DNA damage.

The protein kinase Chk2, the mammalian homolog of the budding yeast Rad53 and fission yeast Cds1 checkpoint kinases, is phosphorylated and activated in response to DNA damage by ionizing radiation (IR), UV irradiation, and replication blocks by hydroxyurea (HU). Phosphorylation and activation of Chk2 are ataxia telangiectasia-mutated (ATM) dependent in response to IR, whereas Chk2 phosphorylation is ATM-independent when cells are exposed to UV or HU. Here we show that in vitro, ATM phosphorylates the Ser-Gln/Thr-Gln (SQ/TQ) cluster domain (SCD) on Chk2, which contains seven SQ/TQ motifs, and Thr68 is the major in vitro phosphorylation site by ATM. ATM- and Rad3-related also phosphorylates Thr68 in addition to Thr26 and Ser50, which are not phosphorylated to a significant extent by ATM in vitro. In vivo, Thr68 is phosphorylated in an ATM-dependent manner in response to IR, but not in response to UV or HU. Substitution of Thr68 with Ala reduced the extent of phosphorylation and activation of Chk2 in response to IR, and mutation of all seven SQ/TQ motifs blocked all phosphorylation and activation of Chk2 after IR. These results suggest that in vivo, Chk2 is directly phosphorylated by ATM in response to IR and that Chk2 is regulated by phosphorylation of the SCD.

We have isolated and characterized the cDNA encoding a novel protein designated DJ-1. DJ-1, sharing no significant homology with the sequences so far reported, did not show transactivation activity in the Gal4 recombinant system, but transformed mouse NIH3T3 cells by itself. Furthermore, DJ-1 showed a cooperative transforming activity with H-Ras, more than 3 times as strong as the activity of ras/myc combination. DJ-1 was ubiquitously expressed in various human tissues, and the expression was induced by growth stimuli. Moreover, DJ-1 translocated from cytoplasm to nuclei in the S phase of the cell cycle. DJ-1 is thus suggested to be a novel mitogen-dependent oncogene product involved in a Ras-related signal transduction pathway.

Cyclin D-Cdk4/6 and cyclin A/E-Cdk2 are suggested to be involved in phosphorylation of the retinoblastoma protein (pRB) during the G1/S transition of the cell cycle. However, it is unclear why several Cdks are needed and how they are different from one another. We found that the consensus amino acid sequence for phosphorylation by cyclin D1-Cdk4 is different from S/T-P-X-K/R, which is the consensus sequence for phosphorylation by cyclin A/E-Cdk2 using various synthetic peptides as substrates. Cyclin D1-Cdk4 efficiently phosphorylated the G1 peptide, RPPTLS780PIPHIPR that contained a part of the sequence of pRB, while cyclins E-Cdk2 and A-Cdk2 did not. To determine the phosphorylation state of pRB in vitro and in vivo, we raised the specific antibody against phospho-Ser780 in pRB. We confirmed that cyclin D1-Cdk4, but not cyclin E-Cdk2, phosphorylated Ser780 in recombinant pRB. The Ser780 in pRB was phosphorylated in the G1 phase in a cell cycle-dependent manner. Furthermore, we found that pRB phosphorylated at Ser780 cannot bind to E2F-1 in vivo. Our data show that cyclin D1-Cdk4 and cyclin A/E Cdk2 phosphorylate different sites of pRB in vivo.

<h2>Abstract</h2> DNA double-strand breaks represent the most potentially serious damage to a genome; hence, many repair proteins are recruited to nuclear damage sites by as yet poorly characterized sensor mechanisms. Here, we show that NBS1, the gene product defective in Nijmegen breakage syndrome (NBS) [1–3], physically interacts with histone, rather than damaged DNA, by direct binding to γ-H2AX. We also demonstrate that NBS1 binding can occur in the absence of interaction with hMRE11 or BRCA1. Furthermore, this NBS1 physical interaction was reduced when anti-γ-H2AX antibody was introduced into normal cells and was also delayed in AT cells, which lack the kinase activity for phosphorylation of H2AX. NBS1 has no DNA binding region but carries a combination of the fork-head associated (FHA) and the BRCA1 C-terminal domains (BRCT) [4]. We show that the FHA/BRCT domain of NBS1 is essential for this physical interaction, since NBS1 lacking this domain failed to bind to γ-H2AX in cells, and a recombinant FHA/BRCT domain alone can bind to recombinant γ-H2AX. Consequently, the FHA/BRCT domain is likely to have a crucial role for both binding to histone and for relocalization of hMRE11/hRAD50 nuclease complex to the vicinity of DNA damage.

Cdc7 kinase, conserved from yeasts to human, plays important roles in DNA replication. However, the mechanisms by which it stimulates initiation of DNA replication remain largely unclear. We have analyzed phosphorylation of MCM subunits during cell cycle by examining mobility shift on SDS-PAGE. MCM4 on the chromatin undergoes specific phosphorylation during S phase. Cdc7 phosphorylates MCM4 in the MCM complexes as well as the MCM4 N-terminal polypeptide. Experiments with phospho-amino acid-specific antibodies indicate that the S phase-specific mobility shift is due to the phosphorylation at specific N-terminal (S/T)(S/T)P residues of the MCM4 protein. These specific phosphorylation events are not observed in mouse ES cells deficient in Cdc7 or are reduced in the cells treated with siRNA specific to Cdc7, suggesting that they are mediated by Cdc7 kinase. The N-terminal phosphorylation of MCM4 stimulates association of Cdc45 with the chromatin, suggesting that it may be an important phosphorylation event by Cdc7 for activation of replication origins. Deletion of the N-terminal non-conserved 150 amino acids of MCM4 results in growth inhibition, and addition of amino acids carrying putative Cdc7 target sequences partially restores the growth. Furthermore, combination of MCM4 N-terminal deletion with alanine substitution and deletion of the N-terminal segments of MCM2 and MCM6, respectively, which contain clusters of serine/threonine and are also likely targets of Cdc7, led to an apparent nonviable phenotype. These results are consistent with the notion that the N-terminal phosphorylation of MCM2, MCM4, and MCM6 may play functionally redundant but essential roles in initiation of DNA replication. Cdc7 kinase, conserved from yeasts to human, plays important roles in DNA replication. However, the mechanisms by which it stimulates initiation of DNA replication remain largely unclear. We have analyzed phosphorylation of MCM subunits during cell cycle by examining mobility shift on SDS-PAGE. MCM4 on the chromatin undergoes specific phosphorylation during S phase. Cdc7 phosphorylates MCM4 in the MCM complexes as well as the MCM4 N-terminal polypeptide. Experiments with phospho-amino acid-specific antibodies indicate that the S phase-specific mobility shift is due to the phosphorylation at specific N-terminal (S/T)(S/T)P residues of the MCM4 protein. These specific phosphorylation events are not observed in mouse ES cells deficient in Cdc7 or are reduced in the cells treated with siRNA specific to Cdc7, suggesting that they are mediated by Cdc7 kinase. The N-terminal phosphorylation of MCM4 stimulates association of Cdc45 with the chromatin, suggesting that it may be an important phosphorylation event by Cdc7 for activation of replication origins. Deletion of the N-terminal non-conserved 150 amino acids of MCM4 results in growth inhibition, and addition of amino acids carrying putative Cdc7 target sequences partially restores the growth. Furthermore, combination of MCM4 N-terminal deletion with alanine substitution and deletion of the N-terminal segments of MCM2 and MCM6, respectively, which contain clusters of serine/threonine and are also likely targets of Cdc7, led to an apparent nonviable phenotype. These results are consistent with the notion that the N-terminal phosphorylation of MCM2, MCM4, and MCM6 may play functionally redundant but essential roles in initiation of DNA replication. DNA replication proceeds through series of staged reactions involving various protein-DNA and protein-protein interactions on template DNA. In eukaryotes, origin recognition complexes are believed to play central roles in recognition of replication origins and to function as landing pads for other essential replication factors including MCM (minichromosome maintenance proteins) (1Bell S.P. Dutta A. Annu. Rev. Biochem. 2002; 71: 333-374Crossref PubMed Scopus (1385) Google Scholar, 2Bell S.P. Stillman B. Nature. 1992; 357: 128-134Crossref PubMed Scopus (983) Google Scholar). The initiation of DNA replication is under strict regulation of G1 cell cycle signals, which are activated or suppressed by extracellular growth or differentiation signals, respectively (3Aguda B.D. Chaos. 2001; 11: 269-276Crossref PubMed Scopus (19) Google Scholar). The G1 cell cycle signals regulate Cdkcyclins and ultimately activate E2F, leading to activation of various components of replication machinery as well as protein kinases (4Nevins J.R. Cell Growth Differ. 1998; 9: 585-593PubMed Google Scholar). Cdk2-cyclinE and Cdc7-Dbf4 kinase are among those activated by the G1 signals and are known to play critical roles in activation of DNA replication origins (5Coverley D. Laman H. Laskey R.A. Nat. Cell Biol. 2002; 4: 523-528Crossref PubMed Scopus (237) Google Scholar, 6Jares P. Blow J.J. Genes Dev. 2000; 14: 1528-1540PubMed Google Scholar, 7Masai H. Arai K. J. Cell. Physiol. 2002; 190: 287-296Crossref PubMed Scopus (148) Google Scholar, 8Masai H. Miyake T. Arai K. EMBO J. 1995; 14: 3094-3104Crossref PubMed Scopus (124) Google Scholar, 9Sato N. Arai K. Masai H. EMBO J. 1997; 16: 4340-4351Crossref PubMed Scopus (121) Google Scholar, 10Sclafani R.A. J. Cell Sci. 2000; 113: 2111-2117Crossref PubMed Google Scholar, 11Woo R.A. Poon R.Y. Cell Cycle. 2003; 2: 316-324Crossref PubMed Scopus (169) Google Scholar). The critical targets of these kinases in initiation of DNA replication are not well understood, but subunits of the MCM complexes, which may play a critical role in origin activation as well as in the elongation stage of DNA replication (12Aparicio O.M. Weinstein D.M. Bell S.P. Cell. 1997; 91: 59-69Abstract Full Text Full Text PDF PubMed Scopus (637) Google Scholar, 13Ishimi Y. J. Biol. Chem. 1997; 272: 24508-24513Abstract Full Text Full Text PDF PubMed Scopus (457) Google Scholar, 14Maine G.T. Sinha P. Tye B.K. Genetics. 1984; 106: 365-385Crossref PubMed Google Scholar), are likely to be among the important substrates of these kinases (9Sato N. Arai K. Masai H. EMBO J. 1997; 16: 4340-4351Crossref PubMed Scopus (121) Google Scholar, 15Lei M. Kawasaki Y. Young M.R. Kihara M. Sugino A. Tye B.K. Genes Dev. 1997; 11: 3365-3374Crossref PubMed Scopus (244) Google Scholar). Among them, MCM2 has been shown to be phosphorylated by Cdc7 kinase both in vivo and in vitro in yeasts as well as in Xenopus egg extracts and mammalian cells (16Brown G.W. Kelly T.J. J. Biol. Chem. 1998; 273: 22083-22090Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar, 17Cho W.H. Lee Y.J. Kong S.I. Hurwitz J. Lee J.K. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 11521-11526Crossref PubMed Scopus (74) Google Scholar, 18Ishimi Y. Komamura-Kohno Y. Arai K. Masai H. J. Biol. Chem. 2001; 276: 42744-42752Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 19Masai H. Matsui E. You Z. Ishimi Y. Tamai K. Arai K. J. Biol. Chem. 2000; 275: 29042-29052Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 20Montagnoli A. Valsasina B. Brotherton D. Troiani S. Rainoldi S. Tenca P. Molinari A. Santocanale C. J. Biol. Chem. 2006; 281: 10281-10290Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar, 21Takahashi T.S. Walter J.C. Genes Dev. 2005; 19: 2295-2300Crossref PubMed Scopus (55) Google Scholar, 22Takeda T. Ogino K. Matsui E. Cho M.K. Kumagai H. Miyake T. Arai K. Masai H. Mol. Cell. Biol. 1999; 19: 5535-5547Crossref PubMed Scopus (93) Google Scholar, 23Takeda T. Ogino K. Tatebayashi K. Ikeda H. Arai K. Masai H. Mol. Biol. Cell. 2001; 12: 1257-1274Crossref PubMed Scopus (88) Google Scholar, 24Walter J.C. J. Biol. Chem. 2000; 275: 39773-39778Abstract Full Text Full Text PDF PubMed Scopus (128) Google Scholar). In fission yeast, Hsk1 kinase, the homologue of budding yeast Cdc7 kinase, was shown to phosphorylate MCM4 in the MCM2-MCM4-MCM6-MCM7 complex (25Lee J.K. Seo Y.S. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2334-2339Crossref PubMed Scopus (74) Google Scholar). However, precise Cdc7-mediated phosphorylation sites on the MCM subunits are not known, except for a recent report on the N-terminal segment of MCM2 (17Cho W.H. Lee Y.J. Kong S.I. Hurwitz J. Lee J.K. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 11521-11526Crossref PubMed Scopus (74) Google Scholar, 20Montagnoli A. Valsasina B. Brotherton D. Troiani S. Rainoldi S. Tenca P. Molinari A. Santocanale C. J. Biol. Chem. 2006; 281: 10281-10290Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar), nor is the significance of these phosphorylation events known. Only recently, a potential role of phosphorylation of MCM2 N-terminal segment was reported in human cells (48Tsuji T. Ficarro S.B. Jiang W. Mol. Biol. Cell. 2006; 17: 4459-4472Crossref PubMed Scopus (89) Google Scholar). In this report, we have analyzed phosphorylation of the MCM4 protein in vivo and discovered that Cdc7 is required for this phosphorylation. We have further identified phosphorylation sites on MCM4, which are mediated by Cdc7, and have shown that Cdc7-mediated phosphorylation may play important roles in loading of Cdc45 onto the chromatin. We also show the data suggesting that the phosphorylation of the N-terminal serine/threonine clusters of MCM subunits by Cdc7 may play important but redundant roles in initiation of DNA replication. Cell Synchronization and Preparation of Cell Lysates—HeLa cells were arrested at the G1/S boundary by two successive incubation in the medium containing 2.5 mm thymidine (24 h for each) with an interval of 12 h of growth without thymidine. Cells were then released into medium without thymidine and were harvested at each time point. Cells were also arrested at early S with 0.5 mm mimosine for 24 h, 2 mm HU 2The abbreviations used are: HU, hydroxyurea; siRNA, small interfering RNA; GST, glutathione S-transferase; PCNA, proliferating cell nuclear antigen; HA, hemagglutinin; FACS, fluorescence-activated cell sorter; tg, transgene. for 12 h, respectively, followed by fractionation into Triton-soluble and -insoluble (chromatin-enriched) fractions, as described previously (26Fujita M. Kiyono T. Hayashi Y. Ishibashi M. J. Biol. Chem. 1997; 272: 10928-10935Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 27Yoshizawa-Sugata N. Ishii A. Taniyama C. Matsui E. Arai K. Masai H. J. Biol. Chem. 2005; 280: 13062-13070Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). The whole cell extract was the soluble supernatant of the cells sonicated in CSK buffer (26Fujita M. Kiyono T. Hayashi Y. Ishibashi M. J. Biol. Chem. 1997; 272: 10928-10935Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar) containing 0.1% Triton X-100. Each fraction was applied on 7.5% SDS-PAGE and MCM2 protein was detected by Western blotting. Synchronization of cell cycle was monitored by flow cytometry analyses of the cells stained with propidium iodine. Small Interfering RNA (siRNA) and Transfection—Transfection of siRNA, purchased from Japan Bio Services (Saitama, Japan), was conducted by using Oligofectamine (Invitrogen). The siRNA for Cdc7 were Cdc7-1 (27Yoshizawa-Sugata N. Ishii A. Taniyama C. Matsui E. Arai K. Masai H. J. Biol. Chem. 2005; 280: 13062-13070Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar), Cdc7-D (28Montagnoli A. Tenca P. Sola F. Carpani D. Brotherton D. Albanese C. Santocanale C. Cancer Res. 2004; 64: 7110-7116Crossref PubMed Scopus (113) Google Scholar), or Cdc7-nc (guaaccccuuagcuggcauTT/augccagcuaagggguuacTT). Construction of Expression Plasmids of Mutant MCM Proteins—The mouse wild-type Mcm4 cDNA was used as a template for PCR mutagenesis to mutate each conserved serine and threonine residues to alanine or glutamic acid. The 6AA or 6EE mutant of MCM4 represents those MCM mutants in which serine and threonine residues of (S/T)(S/T)P at the positions 2-4, 6-8, 30-32, 52-54, 69-71, and 86-88 were replaced with alanine (Ala) or glutamic acid (Glu). Alanine or glutamine mutants of fission yeast MCM2(Cdc19) and MCM4(Cdc21) were constructed in a similar manner. The mutant constructions were verified by DNA sequencing. Each mutant form of mouse MCM4 was expressed on a baculovirus expression vector expressing both MCM4 and MCM6. This virus and the virus expressing MCM2-MCM7 (29You Z. Komamura Y. Ishimi Y. Mol. Cell. Biol. 1999; 19: 8003-8015Crossref PubMed Scopus (171) Google Scholar) were used for coinfection of insect cells to express a MCM2-MCM4-MCM6-MCM7 complex, which was purified as described for the wild-type MCM2 protein preparation (19Masai H. Matsui E. You Z. Ishimi Y. Tamai K. Arai K. J. Biol. Chem. 2000; 275: 29042-29052Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar). Immunofluorescence Analyses—Cells, grown on cover slides, were washed twice with phosphate-buffered saline, fixed with 4% paraformaldehyde, and permeabilized with 0.5% Triton X-100. DNA was stained with propidium iodide. For immunofluorescence, antibody was used at 1 μg/ml, and secondary antibody (Alexa Fluor 546-labeled goat anti-mouse IgG) was used at 1:250 dilution. Development of Phosphopeptide Antibodies and Other Antibodies—Antibodies were developed in rabbit against oligopepetides CMSSPASTPSRRGSRRG (1st to 16th amino acid of human or mouse MCM4), in which the 7th threonine or both 6th serine and 7th threonine were phosphorylated (T7 or S6T7 antibody, respectively). Antibodies were affinity-purified using non-phosphorylated oligonucleotides to remove the antibody reacting with the nonphosphorylated polypeptide. Anti-MCM4 antibody was developed in rabbit against GST-fused C-terminal polypeptide of mouse MCM4 (683-861) and were affinity-purified against the same polypeptide fused to histidine tag. Anti-Cdc45 antibody was developed against the recombinant GST-Cdc45 protein expressed in Escherichia coli and affinity-purified using the His-Cdc45 protein expressed in insect cells. 3K. Tamai, unpublished data. Anti-MCM3 and MCM5 antibodies were prepared in rabbit against bacterially expressed recombinant proteins. Goat anti-MCM2 antibody (sc-9831), goat anti-Cdc6 antibody (sc-6316), mouse monoclonal anti-PCNA antibody (sc-56), and goat anti-LaminB antibody (sc-6217) were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Anti-HA antibody (mouse monoclonal antibody, 16B12) was from Babco. Anti-α-tubulin antibody (mouse monoclonal, B-5-1-2) was from Sigma. Anti-RPA (9H8) antibody was from NeoMarkers (Fremont, CA). Antibodies against fission yeast MCM4(Cdc21) and MCM5(Nda4) proteins were from Dr. Susan Forsburg and that against MCM6(Mis5) protein was from Dr. Hisao Masukata. Anti-Cdt1 antibody was from Dr. Hideo Nishitani. Yeast Strains and Plasmids—Methods for genetic and biochemical analyses of fission yeast have been described previously (30Matsumoto S. Ogino K. Noguchi E. Russell P. Masai H. J. Biol. Chem. 2005; 280: 42536-42542Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). The following strains were used for this study: NI740 (h+ ade6-M210 ura4-D18 leu1-32), NI284 (h+ ade6-M216 ura4-D18 leu1-32 cdc21-M68), CHP429 (h- ade6-M216 ura4 leu1 his7), MS190 (h- ura4 leu1 his7 cdc19-P1), MS210 (h- ade6-M216 ura4 leu1 his7 Δcdc21::[Pnmt-cdc21:his7+]), MS211 (h- ade6 ura4 leu1 his7 Δcdc21::[Pnmt-Δ67cdc21:his7+]), MS213 (h- ade6 ura4 leu1 his7 Δcdc21::[Pnmt-Δ130cdc21:his7+]), MS240 (h+ ade6-M210 ura4 leu1 his7 Δ47mis5:kan), MS242 (h+ ade6-M210 ura4 leu1 his7 mis5:kan), and Goa1-HA (h- goa1-HA3 ura4-D14 leu1-32 ade6-M26) and Goa1-HA hsk1-89 (h- goa1-HA3 leu1-32 ade6-M210 ura4-D18 hsk1-89:ura4+). Cdc19-A10 or Cdc19-E10 is a Cdc19 (MCM2) mutant in which 10 serine and threonine residues present within its N-terminal 35-amino acid segment were replaced with alanine or glutamic acid, respectively. pREP41-cdc19, pREP41-cdc19-A10, and pREP41-cdc19-E10 are pREP41 derivatives expressing Cdc19 wild-type, Cdc19-A10, and Cdc19-E10, respectively, fused with a C-terminal RGSHis-tag. REP41X-AAP7cdc21 or REP41X-EEP7cdc21 are a pREP41 derivative expressing mutant Cdc21 (MCM4) in which all the seven (S/T)(S/T)P sequences in the N-terminal 129-amino acid segment of Cdc21 were replaced with AAP or EEP sequence, respectively, fused with a C-terminal 3×FLAG-tag. REP41X-Δ67cdc21, REP41X-Δ130cdc21, REP41X-Δ150cdc21, and REP41X-Δ200cdc21 are pREP41 derivatives expressing mutant Cdc21-3FLAG in which N-terminal 67, 130, 150, and 200 amino acids are deleted, respectively. Δ47mis5 is a MCM6 mutant lacking the N-terminal 47 amino acids containing 12 serine and threonine residues. REP41X-mcm6NΔ150cdc21 carries the N-terminal 42 amino acids of fission yeast MCM6 at the N-terminal deletion end point of REP41X-Δ150cdc21-3FLAG. The MCM6 N-terminal fragment was amplified by PCR using the following primers: SpMCM6-N(XhoI) ccgctcgagatgtcttctcttgcatctcag and SpMCM-6-(47-41, XhoI) gctatgctcgaggatgatgga. Cell Cycle-dependent Phosphorylation of Human MCM4 Protein—MCM4 protein was previously reported to be a phosphoprotein (31Fujita M. Yamada C. Tsurumi T. Hanaoka F. Matsuzawa K. Inagaki M. J. Biol. Chem. 1998; 273: 17095-17101Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 32Pereverzeva I. Whitmire E. Khan B. Coue M. Mol. Cell. Biol. 2000; 20: 3667-3676Crossref PubMed Scopus (38) Google Scholar). Therefore, we have examined the phosphorylation of MCM4 protein during the cell cycle. HeLa cells were synchronized by release from double thymidine block, which arrests the cells at the G1-S boundary. The synchronous progression of the cell cycle was confirmed by FACS analyses of the DNA stained with propidium iodide (Fig. 1A). Immediately after release, the cells entered S phase, completing it in 8 h. They underwent mitosis at 10-14 h and reentered the next S phase at 18-24 h. We have prepared Triton-soluble and -insoluble extracts from the cells at each stage and analyzed the profiles of various proteins by Western blotting. The former contains the cytoplasmic and nuclear soluble proteins and the latter chromatin-associated or insoluble proteins. The PCNA protein, known to associate with replication forks (33Morris G.F. Mathews M.B. J. Biol. Chem. 1989; 264: 13856-13864Abstract Full Text PDF PubMed Google Scholar), was detected in the Triton-insoluble fractions only during the S phase, until 6 h after release and at 18 h and later on (Fig. 1B). Cdt1 was detected in the Triton-soluble fractions mainly during G1 phase at 12-18 h after release (34Nishitani H. Taraviras S. Lygerou Z. Nishimoto T. J. Biol. Chem. 2001; 276: 44905-44911Abstract Full Text Full Text PDF PubMed Scopus (218) Google Scholar). α-Tubulin, a marker for the cytoplasmic protein, was constitutively detected at a constant level in the Triton-soluble fractions, whereas the LaminB protein was constitutively detected in the chromatinenriched fractions, verifying the fractionation procedure. A portion of MCM4 was detected in the insoluble fractions at the time of release but its level decreased as the S phase progressed. Other MCM proteins also behaved in a similar manner; about a half-population associates with chromatin during G1 and dissociates from the chromatin in late S to G2/M phase, whereas the remainder is detected in the Triton-soluble fraction throughout the cell cycle. This is consistent with the previous results in the Xenopus egg extracts and mammalian cells that MCM is released from the chromatin during the S phase (31Fujita M. Yamada C. Tsurumi T. Hanaoka F. Matsuzawa K. Inagaki M. J. Biol. Chem. 1998; 273: 17095-17101Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 32Pereverzeva I. Whitmire E. Khan B. Coue M. Mol. Cell. Biol. 2000; 20: 3667-3676Crossref PubMed Scopus (38) Google Scholar). MCM4 displays characteristic mobility shift on SDS-PAGE during the cell cycle. At the time 0-6 h after the release, slow migrating bands were detected in the insoluble fractions and they appeared again at 16-20 h after the release. This mobility shift was eliminated by prior treatment with phosphatase (data not shown), indicating that it is caused by phosphorylation. In the Triton-soluble fractions, highly mobility-shifted and slow migrating forms accumulated at late S through M phase (6-14 h after release). This phosphorylation was previously reported and was shown to be caused by Cdc2 kinase, as a part of the strategies to ensure the inhibition of the rereplication (31Fujita M. Yamada C. Tsurumi T. Hanaoka F. Matsuzawa K. Inagaki M. J. Biol. Chem. 1998; 273: 17095-17101Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). In Vitro Phosphorylation of MCM4—We have examined whether MCM4 is phosphorylated by Cdc7 in vitro. We have used the mouse MCM2-MCM4-MCM6-MCM7 complex as a substrate for the in vitro phosphorylation reactions. As reported previously, MCM2 in the MCM2-MCM4-MCM6-MCM7 was efficiently phosphorylated by Cdc7, and its mobility on SDS-PAGE shifted downward (16Brown G.W. Kelly T.J. J. Biol. Chem. 1998; 273: 22083-22090Abstract Full Text Full Text PDF PubMed Scopus (102) Google Scholar, 17Cho W.H. Lee Y.J. Kong S.I. Hurwitz J. Lee J.K. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 11521-11526Crossref PubMed Scopus (74) Google Scholar, 19Masai H. Matsui E. You Z. Ishimi Y. Tamai K. Arai K. J. Biol. Chem. 2000; 275: 29042-29052Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 20Montagnoli A. Valsasina B. Brotherton D. Troiani S. Rainoldi S. Tenca P. Molinari A. Santocanale C. J. Biol. Chem. 2006; 281: 10281-10290Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar; Fig. 2A). We also observed phosphorylation of MCM4 (as well as MCM6 to a lower extent) in vitro by Cdc7. This phosphorylation caused the mobility shift of MCM4 (Fig. 2A), similar to the one observed in mammalian cells. The level of MCM4 (and MCM6) phosphorylation in the MCM2-MCM4-MCM6-MCM7 complex is lower, compared with that of MCM2 protein (∼4 molecules or 1 molecule of ATP incorporated at max on an average per molecule of MCM2 or MCM4 + MCM6, respectively; see supplemental Fig. S1). This may be due to lack of other factors, such as MCM10, which may enhance the phosphorylation reaction by Cdc7 kinase (25Lee J.K. Seo Y.S. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 2334-2339Crossref PubMed Scopus (74) Google Scholar). The N-terminal region of MCM4 contains the clusters of serine/threonine residues (see Fig. 7A). Some of these are the targets of Cdk, since they are present as a part of the S/TPXR motif. In vitro and in vivo phosphorylation of these serine/threonine residues by Cdk has been in fact demonstrated (31Fujita M. Yamada C. Tsurumi T. Hanaoka F. Matsuzawa K. Inagaki M. J. Biol. Chem. 1998; 273: 17095-17101Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar, 35Ishimi Y. Komamura-Kohno Y. J. Biol. Chem. 2001; 276: 34428-34433Abstract Full Text Full Text PDF PubMed Scopus (69) Google Scholar). We noticed the repeated presence of (S/T)(S/T)P sequences in the N-terminal segments of MCM4 protein across the species and speculated that they may be phosphorylated by Cdc7. Therefore, we have generated mutant MCM4 in which these serine/threonine residues have been replaced by alanine. The “6AA” mutant carries alanine substitutions at the six (S/T)(S/T)P sequences at positions 2-4, 6-8, 30-32, 52-54, 69-71, and 86-88 of mouse MCM4 protein. MCM4(6AA) was expressed as a MCM2-MCM4-MCM6-MCM7 complex in insect cells. The mutation did not affect the complex formation, and the complex could be purified. Although Cdc7 could phosphorylate the MCM2 protein in the MCM2-MCM4(6AA)-MCM6-MCM7 complex, the mobility shift by the phosphorylation of MCM4 was largely eliminated, as indicated by the loss of the labeled and mobility-shifted form of MCM4 (Fig. 2A, top and bottom panels, lanes 1-3 and 6-8). Interestingly, the 6EE mutant form of MCM4, in which the same sets of serine/threonine residues were replaced with glutamic acid to generate the mutant protein mimicking the phosphorylated state, migrated anomalously on SDS-PAGE, similar to the phosphorylated forms of MCM4 (Fig. 2A, lanes 11-15). Next, the N-terminal 198-amino acid polypeptide of MCM4 was used as a substrate for kinase reaction by Cdc2-CyclinB and Cdc7-ASK in vitro. Both Cdc7 and Cdc2 phosphorylate the N-terminal polypeptide (Fig. 2B, lanes 1 and 5). The level of phosphorylation was reduced with the 6AA mutant form of the same polypeptide (compare lanes 9 and 10 in Fig. 2B), suggesting that these (S/T)(S/T)P sequences are targets of phosphorylation by Cdk and Cdc7. However, a significant level of phosphorylation by Cdc7 was still observed with the 6AA mutant (Fig. 2B, lane 2), indicating that the other residues within the N-terminal region of MCM4 (see Fig. 7A) can be phosphorylated by Cdc7. The level of phosphorylation significantly increased in the presence of both Cdc7 and Cdc2 kinases (Fig. 2B, compare lanes 1, 5, and 9), suggesting the concerted action of the two kinases. Similar stimulatory effect of Cdk on phosphorylation of MCM2 was previously reported (17Cho W.H. Lee Y.J. Kong S.I. Hurwitz J. Lee J.K. Proc. Natl. Acad. Sci. U. S. A. 2006; 103: 11521-11526Crossref PubMed Scopus (74) Google Scholar, 19Masai H. Matsui E. You Z. Ishimi Y. Tamai K. Arai K. J. Biol. Chem. 2000; 275: 29042-29052Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 20Montagnoli A. Valsasina B. Brotherton D. Troiani S. Rainoldi S. Tenca P. Molinari A. Santocanale C. J. Biol. Chem. 2006; 281: 10281-10290Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar). However, the efficacy of MCM4 phosphorylation in the MCM4N polypeptide was significantly lower than that of MCM4 in the MCM2-MCM4-MCM6-MCM7 complex (∼0.2 molecule of ATP incorporated at maximum per molecule of MCM4), suggesting that the MCM4 segment outside the N-terminal tail and/or other MCM subunits facilitate the substrate recognition by Cdc7 kinase. These results indicate that the N-terminal segment of MCM4 contains multiple Cdc7-mediated phosphorylation sites, some of which are stimulated by prior phosphorylation by Cdk. The N-terminal Segment of MCM4 Is Phosphorylated by Cdc7 in Vivo—We then generated an antibody that specifically recognizes the phosphorylated forms of MCM4 at one of the above (S/T)(S/T)P residues (serine 6 and threonine 7). We have designed the phosphopeptide, which carries a phosphoserine and a phosphothreonine at the 6th and 7th position, respectively, as well as the one which carries only a phosphothreonine at the 7th position. The S6T7 antibody strongly reacted with MCM4N protein, when it was incubated with Cdc2-CyclinB and Cdc7 kinases (Fig. 2C, lane 3). The Western blotting of the cell cycle synchronized extract showed that the S6T7 antibody detected the mobility-shifted form of MCM4 in the Tritoninsoluble fraction at 0-6 h and 18-24 h after the release from double thymidine block, suggesting that S6T7 is indeed phosphorylated on the chromatin during the S phase (Fig. 1B). Phosphorylation was also detected with the S6T7 antibody in the Triton-soluble fractions at 12-14 h and 24 h after the release. This represents the phosphorylation of S6T7 in nuclear soluble or cytoplasm fractions during M phase and may be mediated by Cdc7-ASKL1/Drf1 present in the Triton-soluble fractions during G2-M (27Yoshizawa-Sugata N. Ishii A. Taniyama C. Matsui E. Arai K. Masai H. J. Biol. Chem. 2005; 280: 13062-13070Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). In contrast, the T7 antibody, developed against the polypeptide carrying only the phosphothreonine 7, detected the mobility-shifted forms of MCM4 specifically in the Triton-soluble fractions, the amount of which peaked at 10-14 h or 24 h after release. This phosphorylation is most likely mediated by Cdc2 kinase, as was reported previously (31Fujita M. Yamada C. Tsurumi T. Hanaoka F. Matsuzawa K. Inagaki M. J. Biol. Chem. 1998; 273: 17095-17101Abstract Full Text Full Text PDF PubMed Scopus (76) Google Scholar). Immunoprecipitation of chromatin-enriched fraction of HU-treated HeLa cells with MCM2 or MCM4 antibody indicates interaction between these two MCM subunits. Immunoprecipitation with S6T7 antibody indicates the selective precipitation of the phosphorylated forms of MCM4 and coimmunoprecipitation of lower band of MCM2 (Fig. 1C), which is generated by phosphorylation by Cdc7 kinase (19Masai H. Matsui E. You Z. Ishimi Y. Tamai K. Arai K. J. Biol. Chem. 2000; 275: 29042-29052Abstract Full Text Full Text PDF PubMed Scopus (129) Google Scholar, 20Montagnoli A. Valsasina B. Brotherton D. Troiani S. Rainoldi S. Tenca P. Molinari A. Santocanale C. J. Biol. Chem. 2006; 281: 10281-10290Abstract Full Text Full Text PDF PubMed Scopus (166) Google Scholar, 28Montagnoli A. Tenca P. Sola F. Carpani D. Brotherton D. Albanese C. Santocanale C. Cancer Res. 2004; 64: 7110-7116Crossref PubMed Scopus (113) Google Scholar). This suggests that both MCM2 and MCM4 subunits in the MCM complex are phosphorylated by Cdc7 on the chromatin. Since the phosphorylation of MCM4 on the chromatin takes place at the early S phase and continues during the S phase, the kinase responsible for this phosphorylation needs to be active throughout S phase. Cdc7 is known to be activated at the G1/S junction and to stay active during the S phase. In fact, Cdc7 protein is detected in the Triton-insoluble fractions throughout the S phase and even during G2 phases (Fig. 1B). We therefore examined whether the appearance of this mobility-shifted, phosphorylated forms of MCM4 depends on the Cdc7 functions. We used the mutant mouse ES cell line in which the Cdc7 gene can be conditionally inactivated (36Kim J.M. Nakao K. Nakamura K. Saito I. Katsuki M. Arai K. Masai H. EMBO J. 2002; 21: 2168-2179Crossref PubMed Scopus (69) Google Scholar). Inactivation of Cdc7 in ES cells results in increased late S phase population (Fig. 2A). The highly mobility-shifted forms of MCM4, which can be detected in th

AbstractThe tumor suppressor protein p53 acts as a transcriptional activator that can mediate cellular responses to DNA damage by inducing apoptosis and cell cycle arrest. p53 is a nuclear phosphoprotein, and phosphorylation has been proposed to be a means by which the activity of p53 is regulated. The cyclin-dependent kinase (CDK)-activating kinase (CAK) was originally identified as a cellular kinase required for the activation of a CDK-cyclin complex, and CAK is comprised of three subunits: CDK7, cyclin H, and p36MAT1. CAK is part of the transcription factor IIH multiprotein complex, which is required for RNA polymerase II transcription and nucleotide excision repair. Because of the similarities between p53 and CAK in their involvement in the cell cycle, transcription, and repair, we investigated whether p53 could act as a substrate for phosphorylation by CAK. While CDK7-cyclin H is sufficient for phosphorylation of CDK2, we show that p36MAT1 is required for efficient phosphorylation of p53 by CDK7-cyclin H, suggesting that p36MAT1 can act as a substrate specificity-determining factor for CDK7-cyclin H. We have mapped a major site of phosphorylation by CAK to Ser-33 of p53 and have demonstrated as well that p53 is phosphorylated at this site in vivo. Both wild-type and tumor-derived mutant p53 proteins are efficiently phosphorylated by CAK. Furthermore, we show that p36 and p53 can interact both in vitro and in vivo. These studies reveal a potential mechanism for coupling the regulation of p53 with DNA repair and the basal transcriptional machinery.

In the course of gene array studies aimed at identifying IFN-stimulated genes associated with interferon β (IFN-β)-induced apoptosis, we identified X-linked inhibitor of apoptosis-associated factor-1 (<i>XAF1</i>) as a novel IFN-stimulated gene. XAF1 mRNA was up-regulated by IFN-α and IFN-β in all cells examined. However, IFNs induced high levels of XAF1 protein predominantly in cell lines sensitive to the proapoptotic effects of IFN-β. In apoptosis-resistant cells including WM164 melanoma, WM35 melanoma, U937 pro-monocytic leukemia, and HT1080 fibrosarcoma cells, XAF1 mRNA was strongly up-regulated but XAF1 protein was up-regulated only weakly or not at all. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) is a critical mediator of IFN-β-induced apoptosis, but most melanoma cell lines were resistant to recombinant TRAIL protein. For example, A375 melanoma cells were defective in TRAIL induction by IFN-β and were resistant to TRAIL-induced apoptosis. However, IFN-β pretreatment sensitized them to subsequent recombinant TRAIL-induced apoptosis. A375 cells expressing XAF1 constitutively were more sensitive to TRAIL-induced apoptosis compared with empty vector-transfected cells. The degree of sensitization by XAF1 was similar to that provided by IFN pretreatment and was correlated with the level of XAF1 expressed. Furthermore, the overexpression of the zinc-finger portion of XAF1 blocked IFN-dependent sensitization of A375 melanoma cells to the proapoptotic effects of TRAIL. These results suggested that IFN-dependent induction of XAF1 strongly influenced cellular sensitivity to the proapoptotic actions of TRAIL.

Human telomerase is expressed in germ tissues and in the majority of primary tumors. Cell renewal tissues and some pre-cancerous tissues also have weak telomerase activity. Yet, neither the exact location and frequency of telomerase-positive cells nor the changes in telomerase expression during differentiation or carcinogenesis of individual cells are known. This paper reports on the expression of hTERT (telomerase reverse transcriptase) protein in tumor and non-tumor colorectal tissues by Western blotting and tissue sections by immunohistochemistry using antibodies raised against partial peptides of hTERT. Though telomerase activity and hTERT expression at both mRNA and protein levels were generally higher in tumor part than in non-tumor part, these two were not always correlated: expression of hTERT did not always give rise to high telomerase activity. Colonic carcinoma cell nuclei were stained with anti-hTERT antibodies but not with antigen-preabsorbed antibodies. In normal mucosa, hTERT protein was expressed, though weaker than in carcinoma, in all colonic crypt epithelial cells except those at the tip; the expressing-cell distribution was much wider than that of Ki-67 positive cells which were located at the bottom of the crypt. Isolated crypt contained a significant level of hTERT protein revealed by Western blotting, while having very weak telomerase activity. Telomerase activity was detected in epithelial cells only at the bottom half of the crypt. Specific hTERT-staining was positive in tissue lymphocytes but negative in almost all other stromal cells. It is of interest to see whether a significant level of hTERT expression with low telomerase activity is characteristic of physiologically regenerating tissues containing stem cells. In situ detection of the hTERT protein will permit further analysis of cancer diagnosis and stem cell differentiation.

huCdc7 encodes a catalytic subunit for<i>Saccharomyces cerevisae</i> Cdc7-related kinase complex of human. ASK, whose expression is cell cycle-regulated, binds and activates huCdc7 kinase in a cell cycle-dependent manner (Kumagai, H., Sato, N., Yamada, M., Mahony, D., Seghezzi, W., Lees, E., Arai, K., and Masai, H. (1999) <i>Mol. Cell. Biol.</i> 19, 5083–5095). We have expressed huCdc7 complexed with ASK regulatory subunit using the insect cell expression system. To facilitate purification of the kinase complex, glutathione<i>S</i>-transferase (GST) was fused to huCdc7 and GST-huCdc7-ASK complex was purified. GST-huCdc7 protein is inert as a kinase on its own, and phosphorylation absolutely depends on the presence of the ASK subunit. It autophosphorylates both subunits <i>in vitro</i> and phosphorylates a number of replication proteins to different extents. Among them, MCM2 protein, either in a free form or in a MCM2-4-6-7 complex, serves as an excellent substrate for huCdc7-ASK kinase complex<i>in vitro</i>. MCM4 and MCM6 are also phosphorylated by huCdc7 albeit to less extent. MCM2 and -4 in the MCM2-4-6-7 complex are phosphorylated by Cdks as well, and prior phosphorylation of the MCM2-4-6-7 complex by Cdks facilitates phosphorylation of MCM2 by huCdc7, suggesting collaboration between Cdks and Cdc7 in phosphorylation of MCM for initiation of S phase. huCdc7 and ASK proteins can also be phosphorylated by Cdks <i>in vitro</i>. Among four possible Cdk phosphorylation sites of huCdc7, replacement of Thr-376, corresponding to the activating threonine of Cdk, with alanine (T376A mutant) dramatically reduces kinase activity, indicative of kinase activation by phosphorylation of this residue. <i>In vitro</i>, Cdk2-Cyclin E, Cdk2-Cyclin A, and Cdc2-Cyclin B, but not Cdk4-Cyclin D1, phosphorylates the Thr-376 residue of huCdc7, suggesting possible regulation of huCdc7 by Cdks.

Human Lats2, a novel serine/threonine kinase, is a member of the Lats kinase family that includes the Drosophila tumour suppressor lats/warts . Lats1, a counterpart of Lats2, is phosphorylated in mitosis and localized to the mitotic apparatus. However, the regulation, function and intracellular distribution of Lats2 remain unclear. Here, we show that Lats2 is a novel phosphorylation target of Aurora‐A kinase. We first showed that the phosphorylated residue of Lats2 is S83 in vitro . Antibody that recognizes this phosphorylated S83 indicated that the phosphorylation also occurs in vivo . We found that Lats2 transiently interacts with Aurora‐A, and that Lats2 and Aurora‐A co‐localize at the centrosomes during the cell cycle. Furthermore, we showed that the inhibition of Aurora‐A‐induced phosphorylation of S83 on Lats2 partially perturbed its centrosomal localization. On the basis of these observations, we conclude that S83 of Lats2 is a phosphorylation target of Aurora‐A and this phosphorylation plays a role of the centrosomal localization of Lats2.

Transcription factor c-Myb plays important roles in cell survival and differentiation in immature hematopoietic cells. Here we demonstrate that c-Myb is acetylated at the carboxyl-terminal conserved domain by histone acetyltransferase p300 both in vitro and in vivo. The acetylation sites in vivo have been located at the lysine residues of the conserved domain (K471, K480, K485) by the use of the mutant Myb (Myb-KAmut), in which all three lysine residues are substituted into alanine. Electrophoretic mobility shift assay reveals that Myb-KAmut shows higher DNA binding activity than wild type c-Myb and that acetylation of c-Myb in vitro by p300 causes dramatic increase in DNA binding activity. Accordingly, transactivation activity of both mim-1 and CD34 promoters by Myb-KAmut is higher than that driven by wild type c-Myb. Furthermore, the bromodomain of p300, in addition to the histone acetyltransferase (HAT) domain, is required for effective acetylation of c-Myb, and hGCN5 is revealed to be a factor acetyltransferase for c-Myb in vitro. We present a new manner of post-translational modification of the c-Myb protein and the potential significance of the acetylation in c-Myb.

Microinjection of the restriction endonuclease HaeIII, which causes DNA double-strand breaks with blunt ends, induces nuclear accumulation of p53 protein in normal and xeroderma pigmentosum (XP) primary fibroblasts. In contrast, this induction of p53 accumulation is not observed in ataxia telangiectasia (AT) fibroblasts. HaeIII-induced p53 protein in normal fibroblasts is phosphorylated at serine 15, as determined by immunostaining with an antibody specific for phosphorylated serine 15 of p53. This phosphorylation correlates well with p53 accumulation. Treatment with lactacystin (an inhibitor of the proteasome) or heat shock leads to similar levels of p53 accumulation in normal and AT fibroblasts, but the p53 protein lacks a phosphorylated serine 15. Following microinjection of HaeIII into lactacystin-treated normal fibroblasts, lactacystin-induced p53 protein is phosphorylated at serine 15 and stabilized even in the presence of cycloheximide. However, neither stabilization nor phosphorylation at serine 15 is observed in AT fibroblasts under the same conditions. These results indicate the significance of serine 15 phosphorylation for p53 stabilization after DNA double-strand breaks and an absolute requirement for ATM in this phosphorylation process.

The DNA polymerase α-DNA primase complex was purified over 17 000-fold to near homogeneity from calf thymus using an immunoaffinity column. Sodium dodecyl sulfate gel electrophoresis revealed three polypeptides with molecular weights of 140, 50 and 47 kDa, in a ratio of 1:2:0.25. The complex showed a sedimentation coefficient of 9.7 S, a Stokes radius of 56 Å and a native molecular weight of 250–260 kDa. Taken together, the data suggest that the calf thymus dNA polymerase α-DNA primase complex is essentially a heterotrimer of large (140 kDa) and small (50 kDa) subunits in a ratio of 1:2, with a globular conformation. Electron-microscopic studies of the complex revealed a spherical particle of 120 Å in diameter, in agreement with the physicochemical results. The binding of the complex to DNA was also demonstrated.

We have demonstrated that a novel Ste20-related kinase, designated SLK, mediates apoptosis and actin stress fiber dissolution through distinct domains generated by caspase 3 cleavage. Overexpression of SLK in C2C12 myoblasts stimulated the disassembly of actin stress fibers and focal adhesions and induced apoptosis, as determined by annexin V binding and terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling analysis. SLK was cleaved by caspase 3 in vitro and in vivo during c-Myc-, tumor necrosis factor alpha, and UV-induced apoptosis. Furthermore, cleavage of SLK released two domains with distinct activities: an activated N-terminal kinase domain that promoted apoptosis and cytoskeletal rearrangements and a C-terminus domain that disassembled actin stress fibers. Moreover, our analysis has identified a novel conserved region (termed the AT1-46 homology domain) that efficiently promotes stress fiber disassembly. Finally, transient transfection of SLK also activated the c-Jun N-terminal kinase signaling pathway. Our results suggest that caspase-activated SLK represents a novel effector of cytoskeletal remodeling and apoptosis.

DNA polymerase lambda (Pol lambda) was recently identified as a new member of the family X of DNA polymerases in eukaryotic cells. Pol lambda contains a nuclear localization signal (NLS), a BRCA1-C terminal (BRCT) domain, a proline-rich region, helix-hairpin-helix (HhH) and pol X motifs. Since the amino acid sequence for Pol lambda shares a high degree of homology to Pol beta, Pol lambda is considered to have a similar enzymatic nature to Pol beta.Recombinant human Pol lambda was shown to possess template-directed DNA polymerase activity in its monomeric form. Pol lambda required either Mn2+ or Mg2+ as a metal co-factor to catalyse this activity, and optimal activity was detected at pH 8.5-9.0. Pol lambda was insensitive to aphidicolin, but was sensitive to dideoxynucleoside triphosphates or N-ethylmaleimide. By constructing the truncated Pol lambda, the proline rich region was shown to act in a suppression of its polymerization activity. A chimeric enzyme comprised of the Pol lambda N-terminal region and Pol beta also showed a reduced Pol beta activity. Proliferating cell nuclear antigen (PCNA) directly interacts with Pol lambda through its Pol beta like region in vitro.Pol lambda possesses similar enzymatic nature to Pol beta; requirements of cations and optimal conditions for pH and NaCl concentration, aside from sensitivity to N-ethylmaleimide and template preference. The proline rich region of Pol lambda functions as a suppressor domain for its polymerization activity (SDPA). Pol lambda interacts directly with PCNA through its Pol beta like region. The functional consequence of this interaction is the negative regulation of Pol lambda activity.

Duchenne muscular dystrophy is a genetic muscle-wasting disorder characterized by progressive muscle weakness and easy fatigability. Here we examined whether high-intensity interval training (HIIT) in the form of isometric contraction improves fatigue resistance in skeletal muscle from dystrophin-deficient mdx52 mice. Isometric HIIT was performed on plantar flexor muscles in vivo with supramaximal electrical stimulation every other day for 4 weeks (a total of 15 sessions). In the non-trained contralateral gastrocnemius muscle from mdx52 mice, the decreased fatigue resistance was associated with a reduction in the amount of peroxisome proliferator-activated receptor γ coactivator 1-α, citrate synthase activity, mitochondrial respiratory complex II, LC3B-II/I ratio, and mitophagy-related gene expression (i.e. Pink1, parkin, Bnip3 and Bcl2l13) as well as an increase in the phosphorylation levels of Src Tyr416 and Akt Ser473, the amount of p62, and the percentage of Evans Blue dye-positive area. Isometric HIIT restored all these alterations and markedly improved fatigue resistance in mdx52 muscles. Moreover, an acute bout of HIIT increased the phosphorylation levels of AMP-activated protein kinase (AMPK) Thr172, acetyl CoA carboxylase Ser79, unc-51-like autophagy activating kinase 1 (Ulk1) Ser555, and dynamin-related protein 1 (Drp1) Ser616 in mdx52 muscles. Thus, our data show that HIIT with isometric contractions significantly mitigates histological signs of pathology and improves fatigue resistance in dystrophin-deficient muscles. These beneficial effects can be explained by the restoration of mitochondrial function via AMPK-dependent induction of the mitophagy programme and de novo mitochondrial biogenesis. KEY POINTS: Skeletal muscle fatigue is often associated with Duchenne muscular dystrophy (DMD) and leads to an inability to perform daily tasks, profoundly decreasing quality of life. We examined the effect of high-intensity interval training (HIIT) in the form of isometric contraction on fatigue resistance in skeletal muscle from the mdx52 mouse model of DMD. Isometric HIIT counteracted the reduced fatigue resistance as well as dystrophic changes in skeletal muscle of mdx52 mice. This beneficial effect could be explained by the restoration of mitochondrial function via AMP-activated protein kinase-dependent mitochondrial biogenesis and the induction of the mitophagy programme in the dystrophic muscles.

The c-myc proto-oncogene has been suggested to play key roles in cell proliferation, differentiation, transformation and apoptosis. A variety of functions of C-MYC, the product of c-myc, are attributed to protein-protein interactions with various cellular factors including Max, YY1, p107, Bin1 and TBP. Max and YY1 bind to the C-terminal region of C-MYC, while p107, Bin1 and TBP bind to the N-terminal region covering myc boxes. The N-terminal region is involved in all the biological functions of C-MYC, and different proteins are therefore thought to interact with the N-terminal region of C-MYC to display different functions.We cloned two cDNAs which encode a novel C-MYC-binding protein of 11 kDa, designated AMY-1 (Associate of C-MYC). The two cDNAs, AMY-1L and AMY-1S, derived from alternative usage of polyadenylation signals, code for the same protein of 11 kDa. AMY-1 was bound via its C-terminal region to the N-terminal region of C-MYC (amino acids nos 58-148) corresponding to the transactivation domain. AMY-1 was localized in the cytoplasm in cells expressing c-myc at low levels, but in the nucleus in the cells of a high c-myc expression in transiently transfected cells. A similar difference in endogenous AMY-1 localization was observed during the cell cycle: AMY-1 translocated from cytoplasm to nucleus during the S phase when c-myc expression was increased. AMY-1 by itself did not recognize the E-box element, the MYC/Max binding sequence, nor did it transactivate via the element, but stimulated the activation of E-box-regulated transcription by MYC/Max. FISH analyses revealed that the amy-1 gene was located at 1p32.2-1p33 in human genome.AMY-1 is a 11 kDa protein which binds to the N-terminal region of C-MYC and stimulates the activation of E-box-dependent transcription by C-MYC. AMY-1, which mostly localizes in the cytoplasm, translocates into the nucleus in the S phase of the cell cycle upon an increase of c-myc expression, and may thus control the transcriptional activity of C-MYC.

Abstract STK15/Aurora-A is a serine/threonine kinase essential for chromosome segregation and cytokinesis, and is considered to be a cancer susceptibility gene in mice and humans. Two coding single nucleotide polymorphisms in Aurora-A, 91T&amp;gt;A [phenylalanine/isoleucine (F/I)] and 169G&amp;gt;A [valine/isoleucine (V/I)], create four haplotypes, 91T-169G, 91A-169G, 91T-169A, and 91A-169A. We evaluated the association between these coding single nucleotide polymorphisms and esophageal cancer risk by genotyping 197 esophageal cancer cases and 146 controls. Haplotype 91A-169A (I31/I57) was observed to be statistically more frequent in cancer cases (odds ratio, 3.1452; 95% confidence interval, 1.0258-9.6435). Functional differences among the four isoforms were then analyzed to reveal the source of the cancer risk. Kinase activity levels of I31/I57 and F31/I57 were reduced to 15% and 40% compared with I31/V57 in vivo and in vitro. We considered the differences between the kinase activities and divided individuals into four categories of Aurora-A haplotype combination. Category I had 57.5% or less kinase activity compared with the most common category, category III, and had a significantly higher estimated cancer risk (odds ratio, 5.5328; 95% confidence interval, 1.8149-16.8671). Abnormal nuclear morphology, a characteristic of genomic instability, was observed to be 30 to 40 times more frequent in human immortalized fibroblast cells overexpressing I31/I57 or F31/I57 compared with the others. Furthermore, significantly higher levels of chromosomal instability were observed in cancers in category I (homozygote 91T-169A) than those in category III (homozygous 91A-169G). These results indicate that the less kinase active Aurora-A haplotype combinations might induce genomic instability and increase esophageal cancer risk either in a recessive or a dominant manner.

The gonad arms of C. elegans hermaphrodites acquire invariant shapes by guided migrations of distal tip cells (DTCs), which occur in three phases that differ in the direction and basement membrane substrata used for movement. We found that mig-6 encodes long (MIG-6L) and short(MIG-6S) isoforms of the extracellular matrix protein papilin, each required for distinct aspects of DTC migration. Both MIG-6 isoforms have a predicted N-terminal papilin cassette, lagrin repeats and C-terminal Kunitz-type serine proteinase inhibitory domains. We show that mutations affecting MIG-6L specifically and cell-autonomously decrease the rate of post-embryonic DTC migration, mimicking a post-embryonic collagen IV deficit. We also show that MIG-6S has two separable functions - one in embryogenesis and one in the second phase of DTC migration. Genetic data suggest that MIG-6S functions in the same pathway as the MIG-17/ADAMTS metalloproteinase for guiding phase 2 DTC migrations, and MIG-17 is abnormally localized in mig-6class-s mutants. Genetic data also suggest that MIG-6S and non-fibrillar network collagen IV play antagonistic roles to ensure normal phase 2 DTC guidance.

We report here the isolation and functional analysis of the rfc3(+) gene of Schizosaccharomyces pombe, which encodes the third subunit of replication factor C (RFC3). Because the rfc3(+) gene was essential for growth, we isolated temperature-sensitive mutants. One of the mutants, rfc3-1, showed aberrant mitosis with fragmented or unevenly separated chromosomes at the restrictive temperature. In this mutant protein, arginine 216 was replaced by tryptophan. Pulsed-field gel electrophoresis suggested that rfc3-1 cells had defects in DNA replication. rfc3-1 cells were sensitive to hydroxyurea, methanesulfonate (MMS), and gamma and UV irradiation even at the permissive temperature, and the viabilities after these treatments were decreased. Using cells synchronized in early G2 by centrifugal elutriation, we found that the replication checkpoint triggered by hydroxyurea and the DNA damage checkpoint caused by MMS and gamma irradiation were impaired in rfc3-1 cells. Association of Rfc3 and Rad17 in vivo and a significant reduction of the phosphorylated form of Chk1 in rfc3-1 cells after treatments with MMS and gamma or UV irradiation suggested that the checkpoint signal emitted by Rfc3 is linked to the downstream checkpoint machinery via Rad17 and Chk1. From these results, we conclude that rfc3(+) is required not only for DNA replication but also for replication and damage checkpoint controls, probably functioning as a checkpoint sensor.

A CCAAT box-binding protein subunit, CBF-C/NF-YC, was cloned as a protein involved in the c-Myc complex formed on the G 1 -specific enhancer in the human hsp70 gene.CBF-C/NF-YC directly bound to c-Myc in vitro and in vivo in cultured cells.The CBF/NF-Y⅐c-Myc complex required the HSP-MYC-B element as well as CCAAT in the hsp70 G 1 -enhancer, while the purified CBF subunits recognized only CCAAT even in the presence of c-Myc.Both the HSP-MYC-B and CCAAT elements were also required for the enhancer activity.In transient transfection experiments, the CBF/NF-Y⅐c-Myc complex, as well as transcription due to the G 1 -enhancer, was increased by the introduction of c-Myc at low doses but decreased at high doses.The repression of both complex formation and transcription by c-Myc at high doses was abrogated by the introduction of CBF/NF-Y in a dose-dependent manner.Furthermore, the CBF/NF-Y⅐c-Myc complex bound to the G 1 -enhancer appeared in the early G 1 phase of the cell cycle when c-Myc was not higly expressed and gradually disappeared after the c-Myc expression reached its maximum.The results indicate that the cell cycle-dependent expression of the hsp70 gene is regulated by the intracellular amount of c-Myc through the complex formation states between CBF/ NF-Y and c-Myc.The human heat shock 70 (hsp70) gene is induced by various stresses, including heat shock (for reviews, see Refs.1-3).Without stress, the hsp70 gene is expressed in a cell cycle-dependent manner, namely in the G 1 and the S phases (4 -7).In addition to the heat shock element, several transcriptional regulatory elements, including the sites for Sp1, AP2, ATF, and CTF, have been found to contribute to a basal level of hsp70 gene expression in the hsp70 gene promoter region.CTF is a CCAAT box-binding protein, and two CCAAT boxes are present in the hsp70 gene promoter, at about Ϫ150 and Ϫ90 from the transcription start site (8).Not only CTF (9) but also CBF of 114 kDa (10) have been cloned as binding proteins to these CCAAT sequences.The hsp70 gene expression is also induced

Protooncogene, pim-1, has been reported to be a predisposition for lymphomagenesis along with myc, and its protein product, Pim-1, has been shown to be a serine/threonine protein kinase, whose activity is involved in proliferation and differentiation of blood cells. The signal transduction pathways neither to nor from Pim-1, however, have been clarified. We have cloned a cDNA encoding a novel Pim-1 binding protein, PAP-1, comprising 213 amino acids with a basic amino-acid cluster near the C-terminus. PAP-1 was colocalized with Pim-1 in human HeLa cell nuclei. The in vitro binding assays using GST fusion proteins of the wild-type and various deletion mutants revealed that the whole molecule of Pim-1 is required for the binding activity to PAP-1 and that Pim-1 binds to the region from amino-acid numbers 1-147 of PAP-1, or to two segments in the region. The association of PAP-1 with Pim-1 was also shown in vivo in transfected cells. Furthermore, PAP-1 was phosphorylated in vitro by Pim-1, but not a kinase-negative Pim-1 mutant. The two serine residues of PAP-1 at amino acids 204 and 206 near the C-terminus were phosphorylated by Pim-1. PAP-1 is thus thought to be a target protein for Pim-1 kinase.

Journal Article Characterization of myotonic dystrophy kinase (DMK) protein in human and rodent muscle and central nervous tissue Get access Elisabeth J. Whiting, Elisabeth J. Whiting 1Department of Microbiology and Immunology, University of Ottawa Search for other works by this author on: Oxford Academic PubMed Google Scholar James D. Waring, James D. Waring 2Molecular Genetics, Children's Hospital of Eastern OntarioOttawa, Canada Search for other works by this author on: Oxford Academic PubMed Google Scholar Katsuyuki Tamai, Katsuyuki Tamai 3GenoSPHERE Project, Tohkai University School of MedicineBohseidai, Isehara City, Kanagawa 259– 11, Japan Search for other works by this author on: Oxford Academic PubMed Google Scholar Martin J. Somerville, Martin J. Somerville 2Molecular Genetics, Children's Hospital of Eastern OntarioOttawa, Canada Search for other works by this author on: Oxford Academic PubMed Google Scholar Maxwell Hincke, Maxwell Hincke 4Department of Anatomy and Neurobiology, University of OttawaCanada Search for other works by this author on: Oxford Academic PubMed Google Scholar William A. Staines, William A. Staines 4Department of Anatomy and Neurobiology, University of OttawaCanada Search for other works by this author on: Oxford Academic PubMed Google Scholar Joh-E Ikeda, Joh-E Ikeda 3GenoSPHERE Project, Tohkai University School of MedicineBohseidai, Isehara City, Kanagawa 259– 11, Japan Search for other works by this author on: Oxford Academic PubMed Google Scholar Robert G. Korneluk Robert G. Korneluk * 1Department of Microbiology and Immunology, University of Ottawa2Molecular Genetics, Children's Hospital of Eastern OntarioOttawa, Canada *To whom correspondence should be addressed Search for other works by this author on: Oxford Academic PubMed Google Scholar Human Molecular Genetics, Volume 4, Issue 6, June 1995, Pages 1063–1072, https://doi.org/10.1093/hmg/4.6.1063 Published: 01 June 1995 Article history Received: 13 February 1995 Revision received: 13 March 1995 Accepted: 13 March 1995 Published: 01 June 1995

We previously found new triterpenoid compounds, designated fomitellic acid A and B, which selectively inhibit the activities of mammalian DNA polymerase alpha and beta in vitro. On DNA polymerase beta, the fomitellic acids acted by competing with both the substrate and the template primer, but on DNA polymerase alpha, they acted non-competitively. At least on DNA polymerase beta, the evidence suggests that each of the fomitellic acids bind to the active region competing with the substrate and/or template primer, and subsequently inhibits the catalytic activity. We therefore further investigated the enzyme-binding properties by using DNA polymerase beta and its proteolytic fragments. The 39 kDa enzyme was proteolytically separated into two fragments of the template-primer-binding domain (8 kDa) and the catalytic domain (31 kDa). The fomitellic acids bound tightly to the 8 kDa fragment, but not to the 31 kDa fragment. The immuno-precipitation by antibodies against the enzyme or each of the fragments also proved the binding. These results suggest that the fomitellic acid molecule competes with the template-primer molecule on its 8 kDa binding site, binds to the site, and the fomitellic acid molecule simultaneously disturbs the substrate incorporation into the template primer.

Pim‐1, an oncogene product of serine/threonine kinase, has been found to play roles in apoptosis induction/suppression, cell‐cycle progression and transcriptional regulation by phosphorylating the target proteins involved in these processes. The target proteins phosphorylated by Pim‐1, including p100, Cdc25A, PAP‐1 and heterochromatin protein 1, have been identified. The precise functions of Pim‐1, however, are still poorly understood. In this study, we identified tumor necrosis factor receptor‐associated factor 4‐associated factor 2/sorting nexin 6 (TFAF2/SNX6) as a Pim‐1‐binding protein, and we found that TFAF2/SNX6 was phosphorylated and translocated from the cytoplasm to nucleus by Pim‐1. This translocation of the protein was not affected by Pim‐1‐dependent phosphorylation. Since sorting nexins, including TFAF2/SNX6, have been reported to be located in the cytoplasm or membrane by association with several receptors of tyrosine‐ or serine/threonine‐kinase, this is the first report of TFAF2/SNX6 being located in the nucleus after binding to Pim‐1.

ATR/Rad3-like kinases promote the DNA damage checkpoint through regulating Chk1 that restrains the activation of cyclin-dependent kinases. In fission yeast, Crb2, a BRCT-domain protein that is similar to vertebrate 53BP1, plays a crucial role in establishing this checkpoint. We report here that Crb2 regulates DNA damage checkpoint through temporal and dynamic interactions with Rad3, Chk1 and replication factor Cut5. The active complex formation between Chk1 and Crb2 is regulated by Rad3 and became maximal during the checkpoint arrest. Chk1 activation seems to need two steps of interaction changes: the loss of Rad3-Chk1 and Rad3-Crb2 interactions, and the association between hyperphosphorylated forms of Chk1 and Crb2. Chk1 is the major checkpoint kinase for the arrest of DNA polymerase mutants. The in vitro assay of Chk1 showed that its activation requires the presence of Crb2 BRCT. Hyperphosphorylation of Crb2 is also dependent on its intact BRCT. Finally, we show direct interaction between Rad3 and Crb2, which is inhibitory to Rad3 activity. Hence, Crb2 is the first to interact with both Rad3 and Chk1 kinases.

Cytoskeletal regulation is important in cell migration. The Caenorhabditis elegans gonadal distal tip cells (DTCs) offer a simple model with which to investigate the mechanism of cell migration in organogenesis. Here, we report that one of the spectraplakin isoforms, VAB-10B1, plays an essential role in cell and nuclear migration of DTCs by regulating the actin and microtubule (MT) cytoskeleton. In the vab-10(tk27) mutant, which lacks VAB-10B1, alignment of filamentous (F)-actin and MTs was weakly and severely disorganized, respectively, which resulted in a failure to translocate the DTC nucleus and a premature termination of DTC migration. An MT growing-tip marker, EBP-2-GFP, revealed that polarized outgrowth of MTs towards the nuclei of migrating DTCs was strikingly impaired in tk27 animals. A vab-10 mini-gene encoding only the actin- and MT-binding domains significantly rescued the gonadal defects, suggesting that VAB-10B1 has a role in linking actin and MT filaments. These results suggest that VAB-10B1/spectraplakin regulates the polarized alignment of MTs, possibly by linking F-actin and MTs, which enables normal nuclear translocation and cell migration of DTCs.

Muscle weakness and decreased fatigue resistance are key manifestations of systemic autoimmune myopathies (SAMs). We here examined whether high-intensity interval training (HIIT) improves fatigue resistance in the skeletal muscle of experimental autoimmune myositis (EAM) mice, a widely used animal model for SAM.Female BALB/c mice were randomly assigned to control (CNT) or EAM groups (n = 28 in each group). EAM was induced by immunization with three injections of myosin emulsified in complete Freund's adjuvant. The plantar flexor (PF) muscles of mice with EAM were exposed to either an acute bout or 4 weeks of HIIT (a total of 14 sessions).The fatigue resistance of PF muscles was lower in the EAM than in the CNT group (P < 0.05). These changes were associated with decreased activities of citrate synthase and cytochrome c oxidase and increased expression levels of the endoplasmic reticulum stress proteins (glucose-regulated protein 78 and 94, and PKR-like ER kinase) (P < 0.05). HIIT restored all these alterations and increased the peroxisome proliferator-activated receptor γ coactivator-1α (PGC-1α) and the mitochondrial electron transport chain complexes (I, III, and IV) in the muscles of EAM mice (P < 0.05).HIIT improves fatigue resistance in a SAM mouse model, and this can be explained by the restoration of mitochondria oxidative capacity via inhibition of the ER stress pathway and PGC-1α-mediated mitochondrial biogenesis.

The modifying effects of vanillin on the cytotoxicity and 6-thioguanine (6TG)-resistant mutations induced by two different types of chemical mutagens, ethyl methanesulfonate (EMS) and hydrogen peroxide (H2O2), were examined using cultured Chinese hamster V79 cells. The effects of vanillin on H2O2-induced chromosome aberrations were also examined. Vanillin had a dose-dependent enhancing effect on EMS-induced cytotoxicity and 6TG-resistant mutations, when cells were simultaneously treated with vanillin. The post-treatment with vanillin during the mutation expression time of cells after treatment with EMS also showed an enhancement of the frequency of mutations induced by EMS. However, vanillin suppressed the cytotoxicity induced by H2O2 when cells were post-treated with vanillin after H2O2 treatment. Vanillin showed no change in the absence of activity of H2O2 to induce mutations. Post-treatment with vanillin also suppressed the chromosome aberrations induced by H2O2. The differential effects of vanillin were probably due to the quality of mutagen-induced DNA lesions and vanillin might influence at least two different kinds of cellular repair functions. The mechanisms by which vanillin enhances or suppresses chemical-induced cytotoxicity, mutations and chromosome aberrations are discussed.

ABSTRACT DNA polymerase α-primase is a replication enzyme necessary for DNA replication in all eukaryotes examined so far. Mouse DNA polymerase α is made up of four subunits, the largest of which is the catalytic subunit with a molecular mass of 180 kDa (p180). This subunit exists as a tight complex with the second-largest subunit (p68), whose physiological role has remained unclear up until now. We set out to characterize these subunits individually or in combination by using a cDNA expression system in cultured mammalian cells. Coexpression of p68 markedly increased the protein level of p180, with the result that ectopically generated DNA polymerase activity was dramatically increased. Immunofluorescence analysis showed that while either singly expressed p180 or p68 was localized in the cytoplasm, cotransfection of both subunits resulted in colocalization in the nucleus. We identified a putative nuclear localization signal for p180 (residues 1419 to 1437) and found that interaction with p68 is essential for p180 to translocate into the nucleus. These results indicate that association of p180 with p68 is important for both protein synthesis of p180 and translocation into the nucleus, implying that p68 plays a pivotal role in the newly synthesized DNA polymerase α complex.

A recombinant baculovirus containing the complete sequence for the Epstein-Barr virus (EBV) DNA polymerase catalytic subunit, BALF5 gene product, under the control of the baculovirus polyhedrin promoter was constructed. Insect cells infected with the recombinant virus produced a protein of 110 kDa, recognized by anti-BALF5 protein-specific polyclonal antibody. The expressed EBV DNA polymerase catalytic polypeptide was purified from the cytosolic fraction of the recombinant virus-infected insect cells. The purified protein exhibited both DNA polymerase and 3'-to-5' exonuclease activities, which were neutralized by the anti-BALF5 protein-specific antibody. These results indicate that the 3'-to-5' exonuclease activity associated with the EBV DNA polymerase (T. Tsurumi, Virology 182:376-381, 1991) is an inherent feature of the polymerase catalytic polypeptide. The DNA polymerase and the exonuclease activities of the EBV DNA polymerase catalytic subunit were sensitive to ammonium sulfate in contrast to those of the polymerase complex purified from EBV-producing lymphoblastoid cells, which were stimulated by salt. Furthermore, the template-primer preference for the polymerase catalytic subunit was different from that for the polymerase complex. These observations strongly suggest that the presence of EBV DNA polymerase accessory protein, BMRF1 gene product, does influence the enzymatic properties of EBV DNA polymerase catalytic subunit.

The ADAMTS (a disintegrin and metalloprotease with thrombospondin motifs) family of secreted metalloproteases plays important roles in animal development and pathogenesis. However, transcriptional regulation of ADAMTS proteins during development remains largely unexplored. Here we show that basic helix–loop–helix (bHLH) transcription factors regulate the expression of an ADAMTS protease that is required for gonad development in Caenorhabditis elegans. Mutations in the gene mig-24 cause shortened and swollen gonad arms due to a defect in gonadal leader cell migration, although leader cell specification appears to occur normally. The MIG-24 protein is a bHLH transcription factor of the Achaete–Scute family and is specifically expressed in gonadal leader cells. MIG-24 can physically interact with HLH-2, an E/Daughterless family bHLH transcription factor and bind the promoter region of gon-1, which encodes an ADAMTS protease required for gonadal leader cell migration. Mutations or RNA interference of mig-24 and hlh-2 severely impaired gon-1 expression and forced expression of GON-1 in leader cells in mig-24 mutants partially rescued the gonadal elongation defect. We propose that, unlike most previously characterized Achaete–Scute transcription factors that are involved in cell fate specification, MIG-24 acts with HLH-2 in specified cells to control cell migration by activating the expression of the GON-1 ADAMTS protease.

Mutations in the a disintegrin and metalloprotease with thrombospondin motifs (ADAMTS) family of secreted proteases cause diseases linked to ECM abnormalities. However, the mechanisms by which these enzymes modulate the ECM during development are mostly unexplored. The Caenorhabditis elegans MIG-17/ADAMTS protein is secreted from body wall muscle cells and localizes to the basement membrane (BM) of the developing gonad where it controls directional migration of gonadal leader cells. Here we show that specific amino acid changes in the ECM proteins fibulin-1C (FBL-1C) and type IV collagen (LET-2) result in bypass of the requirement for MIG-17 activity in gonadal leader cell migration in a nidogen (NID-1)-dependent and -independent manner, respectively. The MIG-17, FBL-1C and LET-2 activities are required for proper accumulation of NID-1 at the gonadal BM. However, mutant FBL-1C or LET-2 in the absence of MIG-17 promotes NID-1 localization. Furthermore, overexpression of NID-1 in mig-17 mutants substantially rescues leader cell migration defects. These results suggest that functional interactions among BM molecules are important for MIG-17 control of gonadal leader cell migration. We propose that FBL-1C and LET-2 act downstream of MIG-17-dependent proteolysis to recruit NID-1 and that LET-2 also activates a NID-1-independent pathway, thereby inducing the remodeling of the BM required for directional control of leader cell migration.

The genetic defect underlying myotonic dystrophy (DM) has been identified as an unstable CTG trinucleotide repeat amplification in the 3′-untranslated region (3′-UTR) of the DM kinase gene (DMK). Individuals with the most severe congenital form display a marked delay in muscle terminal differentiation. To gain insight into the role of DMK during myogenesis, we have examined the effect of DMK overexpression on the terminal differentiation of the murine myoblast cell line C2C12. We demonstrate that a 4–10-fold constitutive overexpression of DMK mRNA in myoblasts caused a marked inhibition of terminal differentiation. Surprisingly, this activity was mapped to a 239-nucleotide region of the 3′-UTR of the DMK transcript. When the DMK3′-UTR was placed downstream of a reporter gene, the same inhibition of myogenesis was observed. Following the induction of differentiation of myoblast clones overexpressing the DMK 3′-UTR, the levels of myogenin mRNA were reduced by approximately 4-fold, whereas the steady state levels of mef-2c transcripts were not affected. These data suggest that overexpression of the DMK3′-UTR may interfere with the expression of musclespecific mRNAs leading to a delay in terminal differentiation. The genetic defect underlying myotonic dystrophy (DM) has been identified as an unstable CTG trinucleotide repeat amplification in the 3′-untranslated region (3′-UTR) of the DM kinase gene (DMK). Individuals with the most severe congenital form display a marked delay in muscle terminal differentiation. To gain insight into the role of DMK during myogenesis, we have examined the effect of DMK overexpression on the terminal differentiation of the murine myoblast cell line C2C12. We demonstrate that a 4–10-fold constitutive overexpression of DMK mRNA in myoblasts caused a marked inhibition of terminal differentiation. Surprisingly, this activity was mapped to a 239-nucleotide region of the 3′-UTR of the DMK transcript. When the DMK3′-UTR was placed downstream of a reporter gene, the same inhibition of myogenesis was observed. Following the induction of differentiation of myoblast clones overexpressing the DMK 3′-UTR, the levels of myogenin mRNA were reduced by approximately 4-fold, whereas the steady state levels of mef-2c transcripts were not affected. These data suggest that overexpression of the DMK3′-UTR may interfere with the expression of musclespecific mRNAs leading to a delay in terminal differentiation. Myotonic dystrophy (DM), 1The abbreviations used are: DM, myotonic dystrophy; DMK, myotonic dystrophy kinase; UTR, untranslated region; pgk, phosphoglycerate kinase; bp, base pair; CMV, cytomegalovirus. the most common form of inherited neuromuscular disease in adults, affects 1 in 8000 individuals globally. DM is an autosomal dominant and multisystemic disorder characterized mainly by myotonia and progressive muscle weakness and wasting (1Harper P.S. Myotonic Dystrophy. 2nd Ed. W. B. Saunders Co., Philadelphia1989Google Scholar). Importantly, skeletal muscle biopsies from adult DM patients display a marked atrophy and paucity of type I myofibers (1Harper P.S. Myotonic Dystrophy. 2nd Ed. W. B. Saunders Co., Philadelphia1989Google Scholar). Affected individuals present with a highly variable phenotype, ranging from an asymptomatic condition to a severe and frequently fatal congenital form. Congenital DM patients display marked hypotonia, neonatal respiratory distress, and severe mental retardation. Significantly, histochemical studies of muscle cross-sections from these patients have demonstrated the presence of immature myofibers (1Harper P.S. Myotonic Dystrophy. 2nd Ed. W. B. Saunders Co., Philadelphia1989Google Scholar, 2Farkas-Bargeton E. Barbet J.P. Dancea S. Wehrle R. Checouri A. Dulac O. J. Neurol. Sci. 1988; 83: 145-159Abstract Full Text PDF PubMed Scopus (66) Google Scholar, 3Sarnat H.B. Silbert S.W. Arch. Neurol. 1976; 33: 466-474Crossref PubMed Scopus (110) Google Scholar, 4Soussi-Yanicostas N. Chevallay M. Laurent-Winter C. Tome F.M.S. Fardeau M. Butler-Brown G.S. Neuromuscular Disorders. 1991; 1: 103-111Abstract Full Text PDF PubMed Scopus (25) Google Scholar). Furthermore, protein profile analyses have shown an altered content of contractile protein in these muscles, suggesting that the congenital form of DM is associated with a delay or an arrest of muscle maturation (2Farkas-Bargeton E. Barbet J.P. Dancea S. Wehrle R. Checouri A. Dulac O. J. Neurol. Sci. 1988; 83: 145-159Abstract Full Text PDF PubMed Scopus (66) Google Scholar, 3Sarnat H.B. Silbert S.W. Arch. Neurol. 1976; 33: 466-474Crossref PubMed Scopus (110) Google Scholar, 4Soussi-Yanicostas N. Chevallay M. Laurent-Winter C. Tome F.M.S. Fardeau M. Butler-Brown G.S. Neuromuscular Disorders. 1991; 1: 103-111Abstract Full Text PDF PubMed Scopus (25) Google Scholar). The genetic mutation for DM has been identified as an unstable CTG trinucleotide repeat in the 3′-untranslated region (3′-UTR) of a gene that encodes a serine/threonine kinase (5Aslanidis C. Jansen G. Amemiya C. Shutler G. Mahadevan M. Tsilfidis C. Chen C. Alleman J. Wormskamp N.G.M. Vooijs M. Buxton J. Johnson K. Smeets H.J.M. Lennon G.G. Carrano A.V. Korneluk R.G. Wieringa B. de Jong P.J. Nature. 1992; 355: 548-551Crossref PubMed Scopus (458) Google Scholar, 6Brook J.D. McCurrach M.E. Harley H.G. Buckler A.J. Church D. Aburatani H. Hunter K. Stanton V.P. Thirion J.-P. Hudson T. Sohn R. Zemelman B. Snell R.G. Rundle S.A. Crow S. Davies J. Shelbourne P. Buxton J. Jones C. Juvonen V. Johnson K. Harper P. Shaw D.J. Housman D.E. Cell. 1992; 68: 799-808Abstract Full Text PDF PubMed Scopus (2076) Google Scholar, 7Buxton J. Shelbourne P. Davies J. Jones C. Van Tongeren T. Aslanidis C. de Jong P. Jansen G. Anvret M. Riley B. Williamson R. Johnson K. Nature. 1992; 355: 547-548Crossref PubMed Scopus (567) Google Scholar, 8Fu Y.-H. Pizzuti A. Fenwick R.G. King J. Rajnarayan S. Dunne P.W. Dubel J. Nasser G.A. Ashizawa T. de Jong P. Wieringa B. Korneluk R. Perryman M.B. Epstein H.F. Caskey C.T. Science. 1992; 255: 1256-1258Crossref PubMed Scopus (1281) Google Scholar, 9Mahadevan M. Tsilfidis C. Sabourin L. Shutler G. Amemiya C. Jansen G. Neville C. Narang M. Barcelo J. O'Hoy K. Leblond S. Earle-Macdonald J. de Jong P.J. Wieringa B. Korneluk R.G. Science. 1992; 255: 1253-1255Crossref PubMed Scopus (1434) Google Scholar). This repeat has been found to be polymorphic on normal chromosomes, ranging from 5 to approximately 40 triplets. However, in over 98% of DM individuals, this region has been shown to be significantly amplified, ranging from approximately 50, in mild cases, to several thousand repeats in severely affected individuals. The degree of this amplification has been strongly correlated with disease severity (10Barcelo J.M. Mahadevan M.S. Tsilfidis C. Mackenzie A.E. Korneluk R.G. Hum. Mol. Genet. 1993; 2: 705-709Crossref PubMed Scopus (78) Google Scholar, 11Harley H.G. Brook J.D. Rundle S.A. Crow S. Reardon W. Buckler W.J. Harper P.S. Housman D.E. Shaw D.J. Nature. 1992; 355: 545-546Crossref PubMed Scopus (660) Google Scholar, 12Tsilfidis C. Mackenzie A.E. Mettler G. Barcelo J. Korneluk R.G. Nat. Genet. 1992; 1: 192-195Crossref PubMed Scopus (310) Google Scholar). The protein product encoded by the DM gene (DMK) displays high homology to the serine/threonine family of protein kinases (6Brook J.D. McCurrach M.E. Harley H.G. Buckler A.J. Church D. Aburatani H. Hunter K. Stanton V.P. Thirion J.-P. Hudson T. Sohn R. Zemelman B. Snell R.G. Rundle S.A. Crow S. Davies J. Shelbourne P. Buxton J. Jones C. Juvonen V. Johnson K. Harper P. Shaw D.J. Housman D.E. Cell. 1992; 68: 799-808Abstract Full Text PDF PubMed Scopus (2076) Google Scholar, 8Fu Y.-H. Pizzuti A. Fenwick R.G. King J. Rajnarayan S. Dunne P.W. Dubel J. Nasser G.A. Ashizawa T. de Jong P. Wieringa B. Korneluk R. Perryman M.B. Epstein H.F. Caskey C.T. Science. 1992; 255: 1256-1258Crossref PubMed Scopus (1281) Google Scholar, 9Mahadevan M. Tsilfidis C. Sabourin L. Shutler G. Amemiya C. Jansen G. Neville C. Narang M. Barcelo J. O'Hoy K. Leblond S. Earle-Macdonald J. de Jong P.J. Wieringa B. Korneluk R.G. Science. 1992; 255: 1253-1255Crossref PubMed Scopus (1434) Google Scholar, 13Jansen G. Mahadevan M. Amemiya C. Wormskamp N. Segers B. Hendricks W. O'Hoy K. Baird S. Sabourin L. Lennon G. Jap P.L. Iles D. Coerwinkel M. Hofker M. Carrano A.V. de Jong P.J. Korneluk R.G. Wieringa B. Nat. Genet. 1992; 1: 261-266Crossref PubMed Scopus (149) Google Scholar, 14Mahadevan M.S. Amemiya C. Jansen G. Sabourin L. Baird S. Neville C.E. Wormskamp N. Segers B. Batzer M. Lamerdin J. de Jong P. Wieringa B. Korneluk R.G. Hum. Mol. Genet. 1993; 2: 299-304Crossref PubMed Scopus (134) Google Scholar). In agreement with this, it has been shown to have serine/threonine specific kinase activity (15Dunne P.W. Ma L. Casey D.L. Harati Y. Epstein H.F. Cell Motil. Cytoskeleton. 1996; 33: 52-63Crossref PubMed Scopus (32) Google Scholar). The DMK protein has been localized to sites of intercellular contacts such as the neuromuscular junctions in skeletal muscles and to the intercalated disks of heart (16Van der Ven P.F.M. Jansen G. van Kuppevelt T.H.M.S.M. Perryman M.B. Lupa M. Dunne P.W. ter Laak H.J. Jap P.H.K. Veerkamp J.H. Epstein H.F. Wieringa B. Hum. Mol. Genet. 1993; 2: 1889-1894Crossref PubMed Scopus (76) Google Scholar, 17Whiting E.J. Waring J.D. Tamai K. Somerville M.J. Hincke M. Staines W.A. Ikeda J.-E. Korneluk R.G. Hum. Mol. Genet. 1995; 4: 1063-1072Crossref PubMed Scopus (65) Google Scholar), and recently to the triad region of muscle fibers (15Dunne P.W. Ma L. Casey D.L. Harati Y. Epstein H.F. Cell Motil. Cytoskeleton. 1996; 33: 52-63Crossref PubMed Scopus (32) Google Scholar). However, the normal function of the protein is still unknown. In research concerning the expression of the DMK gene, controversial observations have been reported on the effect of CTG amplification. Using different assays, overexpression (18Sabourin L.A. Mahadevan M.S. Narang M. Lee D.S.C. Surh L.C. Korneluk R.G. Nat. Genet. 1993; 4: 233-238Crossref PubMed Scopus (142) Google Scholar) and reduced expression of DMK (19Carango P. Noble J.E. Marks H.G. Funanage V.L. Genomics. 1993; 4: 340-348Crossref Scopus (109) Google Scholar, 20Fu Y.-H. Friedman D.L. Richards S. Pearlman J.A. Gibbs R.A. Pizzuti A. Ashizawa T. Perryman M.B. Scarlato G. Fenwick Jr., R.G. Caskey C.T. Science. 1993; 260: 235-238Crossref PubMed Scopus (291) Google Scholar, 21Hofmann-Radvanyi H. Lavedan C. Rabes J.-P. Savoy D. Duros C. Johnson K. Junien C. Hum. Mol. Genet. 1993; 2: 1263-1266Crossref PubMed Scopus (81) Google Scholar, 22Koga R. Nakao Y. Kurano Y. Tsukahara T. Nakamura A. Ishiura S. Nonaka I. Arahata K. Biochem. Biophys. Res. Commun. 1994; 202: 577-585Crossref PubMed Scopus (52) Google Scholar) have been observed in muscle tissues from congenital and adult DM tissue samples, respectively. Others have reported that the total activity of the DM locus was unaffected in DM patients but that the levels of processed mutant transcripts were decreased (23Krahe R. Ashizawa T. Abbruzzese C. Roeder E. Carango P. Giacanelli M. Funanage V.L. Siciliano M.J. Genomics. 1995; 28: 1-14Crossref PubMed Scopus (129) Google Scholar). In another analysis, Wang et al. (24Wang J. Pegoraro E. Menegazzo E. Gennarelli M. Hoop R.C. Angelini C. Hoffman E.P. Hum. Mol. Genet. 1995; 4: 599-606Crossref PubMed Scopus (167) Google Scholar) have shown that the levels of both mutant and wild typeDMK mRNAs were markedly reduced in poly(A)+RNA samples. These authors have proposed that the expanded CTG repeat may act as a dominant-negative mutation that affects RNA processing intrans. Recently, the expanded repeat has been shown to repress, in cis, the downstream gene DMAHP(25Thorton C.A. Wymer J.P. Simmons Z. McClain C. Moxley III, R.T. Nat. Genet. 1997; 16: 407-409Crossref PubMed Scopus (195) Google Scholar, 26Klesert T.R. Otten A.D. Bird T.D. Tapscott S.J. Nat. Genet. 1997; 16: 402-406Crossref PubMed Scopus (221) Google Scholar), suggesting its involvement in the disease process. However, it has been demonstrated that, when normalized to type I myosin heavy chain, the relative levels of DMK protein were elevated in skeletal muscle from DM individuals (15Dunne P.W. Ma L. Casey D.L. Harati Y. Epstein H.F. Cell Motil. Cytoskeleton. 1996; 33: 52-63Crossref PubMed Scopus (32) Google Scholar). Recently, targeted inactivation of the murine DMK gene has been shown to result in a normal phenotype in one case (27Jansen G. Groenen P.T.J.A. Bachner D. Jap P.H.K. Coerwinkel M. Oerlemans F. van den Broek W. Gohlsch B. Pette D. Plomp J.J. Molenaar P.C. Nederhoff M.G.J. van Echteld C.J.A. Dekker M. Berns A. Hameister H. Wieringa B. Nat. Genet. 1996; 13: 316-324Crossref PubMed Scopus (286) Google Scholar), whereas a late onset progressive muscle weakness has been demonstrated by Reddy et al. (28Reddy S. Smith D.B.J. Rich M.M. Leferovich J.M. Reilly P. Davis B.M. Tran K. Rayburn H. Bronson R. Cros D. Balice-Gordon R.J. Housman D. Nat. Genet. 1996; 13: 325-335Crossref PubMed Scopus (288) Google Scholar). Interestingly, no congenital DM phenotype has been observed in any of the null homozygous mice. Taken together these results suggest that the congenital phenotype is not mediated by a decrease inDMK expression. Therefore, to gain insight into the role of DMK during myogenesis and the mechanism underlying DM, we have characterizedDMK expression during the terminal differentiation of C2C12 myoblasts and investigated the effect of DMK overexpression on myogenesis. Our results show that DMK is expressed in various myoblast cell lines and slightly up-regulated during skeletal myogenesis in vitro. Importantly, a 4–10-foldDMK overexpression markedly inhibits myogenesis. Moreover, we demonstrate that this activity maps to the 3′-UTR of theDMK mRNA. In contrast to previous observations (29Rastinejad F. Blau H. Cell. 1993; 72: 903-917Abstract Full Text PDF PubMed Scopus (222) Google Scholar) where muscle-specific 3′-UTR enhanced differentiation, we show that overexpression of the 3′-UTR may function in a feedback loop and interfere with the expression of muscle-specific mRNAs required for muscle terminal differentiation. DMK expression vectors consisted of full-length or partial DMK cDNAs cloned into pcDNA3 (Invitrogen) using standard cloning protocols (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar). Briefly, pCMV-DMK comprises a full-length DMK cDNA bearing both 5′- and 3′-UTRs in pcDNA3. pDΔ35 was obtained from B. Perryman (University of Colorado, Denver) and was generated by cloning a polymerase chain reaction-amplified fragment corresponding to the coding portion of the full-length DMK cDNA. pDΔ5 was generated by replacing the 5′ KpnI-XhoI portion of pCMV-DMK by the corresponding segment of pDΔ35. Plasmid pK100R was obtained by in vitro mutagenesis of pCMV-DMK using the Muta-gene II kit (Bio-Rad) according to the manufacturer's instructions. A point mutation was introduced at amino acid residue 100, converting the conserved lysine residue of the ATP-binding site to an arginine. To construct HT3′ and HT3′R, a 1.0-kilobase pairBamHI fragment encompassing the DMK 3′-UTR was cloned in both orientations, into the BglII site downstream of the hygromycin-tk hybrid gene encoded by ptgCMV/Hy-tk (31Lupton S.D. Brunton L.L. Kalberg V.A. Overell R.W. Mol. Cell. Biol. 1991; 11: 3374-3378Crossref PubMed Scopus (166) Google Scholar). The control plasmid HT-PGK was generated by cloning a 1.0-kilobase pair XhoI-HindIII fragment, comprising the mouse pgk 3′-UTR, into theSalI-HindIII sites of ptgCMV/Hy-tk. Plasmid pHTΔR was generated by SacII-PstI digestion and religation of HT3′, resulting in deletion of the CTG repeat region. Plasmids pHTΔ3′ and pHTΔ5′ were generated by blunt end cloning of polymerase chain reaction products encompassing nucleotides 2002–2278 and 2204–2726, respectively, of the human DMK cDNA (GenBank accession no. L19268). C3H10T1/2, C2C12, and NIH 3T3 cells were purchased from ATCC. C3H10T1/2 and NIH 3T3 fibroblasts were maintained in α-minimal Eagle's medium supplemented with 10% fetal bovine serum and 2 mmglutamine. C2C12 myoblasts were grown in α-minimal Eagle's medium containing 15% fetal bovine serum and glutamine. All cultures were maintained under 70–80% confluency and grown at 37 °C in a humidified atmosphere containing 5% CO2. For stable transfections, C2C12 cells were plated at 5 × 105 in 100-mm dishes 24 h prior to transfections. The cells were transfected by standard calcium phosphate precipitation (30Sambrook J. Fritsch E.F. Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd Ed. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY1989Google Scholar) for 8 h and then refed with fresh growth medium. Following a 24-h incubation, G418 (Geneticin; Life Technologies, Inc.) or hygromycin B (Sigma) was added at final concentrations of 0.4 or 0.2 mg/ml, respectively. After a 14-day incubation, resistant clones (or pools) were isolated using cloning rings and grown for RNA, protein, and fusion analyses. To avoid the isolation of non-differentiating C2C12 clones, cells that had undergone 15 passages or less were used for each independent transfection experiment. For Northern blotting experiments, total RNA was extracted from confluent cultures of each individual clones and analyzed as described previously (18Sabourin L.A. Mahadevan M.S. Narang M. Lee D.S.C. Surh L.C. Korneluk R.G. Nat. Genet. 1993; 4: 233-238Crossref PubMed Scopus (142) Google Scholar). For analysis of DMKexpression during differentiation, C2C12 cultures were grown to 80% confluency and then transferred to differentiation medium (α-minimal Eagle's medium containing 10% horse serum), and RNA was analyzed forDMK at various times as indicated. For myogenic conversion of 10T1/2 fibroblasts, 2 × 104 cells were plated in 35-mm dishes and grown for a further 24 h. The cultures were then treated with 3 mm 5-azacytidine (Sigma) for 24 h. The cells were then refed with fresh medium (day 0), and DMKexpression was analyzed by Western blotting at different time points. For fusion assays, C2C12 clones overexpressing the various DMK 3′-UTR constructs were plated at 4 × 105 cells in 35-mm dishes and incubated for an additional 16–20 h. The resulting confluent cultures were then washed once with phosphate-buffered saline and incubated for 48 h in differentiation medium. The cultures were then washed with phosphate-buffered saline and fixed in 100% methanol. Following myosin heavy chain staining using the monoclonal antibody MF20 (32Bader D. Masaki T. Fischman D.A. J. Cell Biol. 1982; 95: 763-770Crossref PubMed Scopus (795) Google Scholar) and peroxidase-conjugated anti-mouse antibody, the cultures were counterstained with Giemsa for visualization of the nuclei. In some assays, the fixed cultures were stained with Giemsa only, which was found to preferentially stain myotubes. The fusion index was calculated as the percent ratio of the number of nuclei in myotubes over the total number of nuclei in one field ((number of nuclei in myotubes/total number of nuclei) × 100). For each culture, at least 1500 nuclei were counted from several random fields, and the fusion index was taken as the average ± S.E. of all calculated indices for one culture. The indices for the other cultures were graphed as the average index with the standard error of the proportion. For each clone, the fusion index was determined in at least two separate experiments. The results shown are from one representative experiment. Previous studies have demonstrated that DMK is highly expressed in smooth, skeletal, and cardiac muscle tissues (13Jansen G. Mahadevan M. Amemiya C. Wormskamp N. Segers B. Hendricks W. O'Hoy K. Baird S. Sabourin L. Lennon G. Jap P.L. Iles D. Coerwinkel M. Hofker M. Carrano A.V. de Jong P.J. Korneluk R.G. Wieringa B. Nat. Genet. 1992; 1: 261-266Crossref PubMed Scopus (149) Google Scholar, 18Sabourin L.A. Mahadevan M.S. Narang M. Lee D.S.C. Surh L.C. Korneluk R.G. Nat. Genet. 1993; 4: 233-238Crossref PubMed Scopus (142) Google Scholar). This muscle-specific pattern of expression and the primary involvement of skeletal muscles in DM suggest a functional role for DMK in normal muscle function and development. To begin to investigate this role, several myogenic cell lines were grown, and poly(A)+ RNA was prepared from undifferentiated cells. The analyzed cell lines included the following: the skeletal myoblast line C2C12; BC3H1, a skeletal myoblast line defective for terminal differentiation; the rat myogenic line H9C2, and the multipotent embryocarcinoma cell line P19. Following Northern blot analysis, DMK was found to be expressed at similar levels in the skeletal myoblast lines (Fig.1 A). Interestingly, relative to the pgk control, DMK expression was found to be significantly higher in the cardiac myoblast cell line. In contrast, remarkably low levels of DMK were observed in the multipotent stem cell line P19, suggesting that DMK is up-regulated during myogenic lineage determination. Similarly, NIH 3T3 and C3H10T1/2 fibroblasts expressed very low levels of DMK(data not shown). As a first step into the characterization of DMK expression during myogenesis, we determined DMK mRNA levels during the differentiation of C2C12 myoblasts. Cells were grown to 80% confluency and induced to differentiate in low serum medium. Total RNA was isolated at various times and analyzed for DMKexpression. Northern blot analysis and normalization to pgkmRNA levels showed a modest increase (1.5- to 2-fold) in the steady state levels of DMK transcripts following transfer of the cells to differentiation medium (Fig. 1 B). The major increase in DMK levels occurred 72–96 h following the induction of differentiation, suggesting that up-regulation follows the commitment to myogenic differentiation. Similarly, when the cells were allowed to differentiate following confluency in growth medium,DMK mRNA levels were found to increase approximately 2-fold during differentiation (Fig. 1 C). Under low serum conditions, myoblast fusion was found to be approximately 37 and 60% after 2 and 4 days, respectively, in parallel cultures following myosin heavy chain immunostain (see “Materials and Methods”). For both time courses, myosin light chains 1 and 3 (mlc 1/3) and α-skeletal actin levels (data not shown) increased significantly, indicative of muscle cell terminal differentiation. Our expression results with the various cell lines suggest thatDMK may become up-regulated during myogenic determination (see above). To investigate this possibility, DMK expression was analyzed in the mesodermal precursor cell line C3H10T1/2 that has been demonstrated to differentiate predominantly into myoblasts as well as chondrocytes and adipocytes following a brief treatment with 5-azacytidine (33Konieczny S.F. Emerson Jr., C.P. Cell. 1984; 38: 791-800Abstract Full Text PDF PubMed Scopus (237) Google Scholar). As shown in Fig. 1 D, the presence of the 82-kDa DMK isoform is apparent 4 days after treatment of 10T1/2 cells with 5-azacytidine. Similarly, DMK mRNA was found to be up-regulated following 5-azacytidine treatment, and this induction coincided with an increase in myoD mRNA in these cells (data not shown). The observed low level of DMK protein is presumably due to the fact that only 25% of the cells get converted to myoblasts under these conditions (33Konieczny S.F. Emerson Jr., C.P. Cell. 1984; 38: 791-800Abstract Full Text PDF PubMed Scopus (237) Google Scholar). Myogenic conversion by transient transfection of a myoD expression vector resulted in higher expression of DMK (Fig. 1 D), suggesting that the observed DMK expression in 5-azacytidine-treated cultures is not likely to be due to the presence of the other cell types. Therefore, our observations suggest that DMK is up-regulated during myogenic determination of precursor cells. Supporting this is the recent observation that DMK is expressed in murine somites of day 10.5 embryos (27Jansen G. Groenen P.T.J.A. Bachner D. Jap P.H.K. Coerwinkel M. Oerlemans F. van den Broek W. Gohlsch B. Pette D. Plomp J.J. Molenaar P.C. Nederhoff M.G.J. van Echteld C.J.A. Dekker M. Berns A. Hameister H. Wieringa B. Nat. Genet. 1996; 13: 316-324Crossref PubMed Scopus (286) Google Scholar), at which time the myogenic factorsmyoD and myf-5 are expressed (34Olson E.N. Klein W.H. Genes Dev. 1994; 8: 1-8Crossref PubMed Scopus (606) Google Scholar). Previous histological studies have shown a marked delay of muscle cell terminal differentiation (2Farkas-Bargeton E. Barbet J.P. Dancea S. Wehrle R. Checouri A. Dulac O. J. Neurol. Sci. 1988; 83: 145-159Abstract Full Text PDF PubMed Scopus (66) Google Scholar, 3Sarnat H.B. Silbert S.W. Arch. Neurol. 1976; 33: 466-474Crossref PubMed Scopus (110) Google Scholar, 4Soussi-Yanicostas N. Chevallay M. Laurent-Winter C. Tome F.M.S. Fardeau M. Butler-Brown G.S. Neuromuscular Disorders. 1991; 1: 103-111Abstract Full Text PDF PubMed Scopus (25) Google Scholar). Our laboratory has shown that CTG expansion caused an increase ofDMK mRNA steady state levels in muscle tissues from congenital DM individuals (18Sabourin L.A. Mahadevan M.S. Narang M. Lee D.S.C. Surh L.C. Korneluk R.G. Nat. Genet. 1993; 4: 233-238Crossref PubMed Scopus (142) Google Scholar). These data suggest that DMKoverexpression could directly inhibit or delay myogenesis in these patients. Our working hypothesis, therefore, was that the dominant nature of the disease, and the ultimate effect on myogenesis, was due to the overexpression of the DM kinase gene and/or protein. To this end, an expression vector, carrying a full-length humanDMK cDNA was constructed. The cDNA, bearing 325 bp of 5′-UTR, the coding region, and the entire 3′-UTR, with 11 CTG repeats (14Mahadevan M.S. Amemiya C. Jansen G. Sabourin L. Baird S. Neville C.E. Wormskamp N. Segers B. Batzer M. Lamerdin J. de Jong P. Wieringa B. Korneluk R.G. Hum. Mol. Genet. 1993; 2: 299-304Crossref PubMed Scopus (134) Google Scholar), was introduced into the pcDNA3 expression vector (Invitrogen) to generate pCMV-DMK (Fig.2 A). Transcription is under the control of the human cytomegalovirus promoter (CMV; Ref. 35Seed B. Aruffo A. Proc. Natl. Acad. Sci. U. S. A. 1987; 84: 3365-3369Crossref PubMed Scopus (789) Google Scholar). Plasmid DNA was transfected into C2C12, and 24 G418-resistant clones were randomly isolated and analyzed for DMK mRNA expression. When normalized to pgk, all the clones surveyed displayed a 4–10-fold higher level of DMK mRNA relative to untransfected C2C12 myoblasts (for example, those clones designated B6 and C4 shown in Fig. 3 A) and were morphologically similar to the parent cell line (data not shown). In parallel, all clones were subjected to Western blot analysis and myoblast fusion assays under low serum conditions. Following myosin heavy chain or Giemsa staining of the fixed cultures, the fusion index (number of nuclei in myotubes/total number of nuclei) was calculated from several random fields and used as an indicator of terminal differentiation. Although the mRNA was highly expressed in all clones, DMK protein levels were found to be only slightly elevated (ranging from 1.5- to 2-fold in some clones) or relatively unchanged compared to C2C12 (Fig. 3 B). This could be due to the presence of two other AUGs in the 5′-UTR which may considerably reduce the translational efficiency or, alternatively, the 5′-UTR could play a significant role in the control of DMK mRNA translation in myoblasts. Therefore, the ability of the mRNA transcribed from pCMV-DMK to be translated was verified in COS-1 cells. COS-1 cells transiently transfected with pCMV-DMK expressed extremely low levels of DMK protein, whereas high levels were observed when they were transfected with pDΔ5 (a DMK construct lacking the 5′-UTR; Fig. 2 A), suggesting that the presence of the DMK5′-UTR in pCMV-DMK significantly alters the efficiency of translation (Fig. 3 C).Figure 3Expression of DMK mRNA and protein in myoblast clones and COS-1 cells. A, example of a Northern blot analysis of two independent myoblast clones (B6 and C4) isolated from CMV-DMK-transfected C2C12 cells. Normalization to myoD and pgk showed a 10-fold overexpression of DMK for both clones. Exposure time was for 24 h. B, Western (10 μg of total protein) blot analysis of the same B6 and C4 clones analyzed inA using anti-DMK-2 (17Whiting E.J. Waring J.D. Tamai K. Somerville M.J. Hincke M. Staines W.A. Ikeda J.-E. Korneluk R.G. Hum. Mol. Genet. 1995; 4: 1063-1072Crossref PubMed Scopus (65) Google Scholar). Normalization to a parallel Coomassie Blue-stained gel shows no difference in DMK protein levels between C2C12 and clones overexpressing DMK mRNA.C, anti-DMK-2 immunoblot analysis showing expression of the various DMK constructs in COS-1 cells. COS-1 cells were transiently transfected with the indicated vectors (see Fig. 2) and analyzed for DMK expression 48 h following transfection. Panels I and II show the results of one experiment comparing the relative expression levels ofCMV-DMK, K100R, DΔ35, and DΔ5. MTG-DMKrepresents a myc epitope-tagged DMK vector used in kinase activity assays. The relative expression levels forDΔ5, DΔ35, and K100RΔ5 (a mutant version of DΔ5), obtained in an independent experiment, are shown in panel III. DMK was not found to be expressed from CMV-DMK or K100R but was expressed equally well from all the other constructs. In all panels, DMK was detected with anti-DMK-2. D, fusion index determination of three DMK overexpressing clones. Following the induction of differentiation, C2C12 myoblasts or neomycin-resistant C2C12 clones displayed indices of about 35%, whereas DMK (CMV-DMK) overexpressing clones B6, D2, and C4 showed fusion indices of 6–10%.B6R represents

We have recently shown that spinal muscular atrophy (SMA), an autosomal recessive disorder characterized by motor neuron loss, is associated with deletion of a gene that encodes the neuronal apoptosis inhibitory protein (NAIP). In the present study, we have examined the distribution of NAIP-like immunoreactivity (NAIP-LI) in the rat central nervous system (CNS) by using an affinity-purified polyclonal antibody against NAIP. In the forebrain, immunoreactive neurons were detected in the cortex, the hippocampus (pyramidal cells, dentate granule cells, and interneurons), the striatum (cholinergic interneurons), the basal forebrain (ventral pallidum, medial septal nucleus, and diagonal band), the thalamus (lateral and ventral nuclei), the habenula, the globus pallidus, and the entopenduncular nucleus. In the midbrain, NAIP-LI was located primarily within neurons of the red nucleus, the substantia nigra pars compacta, the oculomotor nucleus, and the trochlear nucleus. In the brainstem, neurons containing NAIP-LI were observed in cranial nerve nuclei (trigeminal, facial, vestibular, cochlear, vagus, and hypoglossal nerves) and in relay nuclei (pontine, olivary, lateral reticular, cuneate, gracile nucleus, and locus coeruleus). In the cerebellum, NAIP-LI was found within both Purkinje and nuclear cells (interposed and lateral nuclei). Finally, within the spinal cord, NAIP-LI was detected in Clarke's column and in motor neurons. Taken together, these results indicate that NAIP-LI is distributed broadly in the CNS. However, high levels of NAIP-LI were restricted to those neuronal populations that have been reported to degenerate in SMA. This anatomical correspondence provides additional evidence for NAIP involvement in the neurodegeneration observed in acute SMA.

Background The c‐ myc oncogene product (c‐Myc) is a transcription factor that forms a complex with Max and recognizes the E‐box sequence. c‐Myc plays key functions in cell proliferation, differentiation and apoptosis. As for its activity towards cell proliferation, it is generally thought that c‐Myc transactivates the E‐box‐containing genes that encode proteins essential to cell‐cycle progression. Despite the characterization of candidate genes regulated by c‐Myc in culture cells, these have still not been firmly recognized as real target genes for c‐Myc. Results We found that c‐Myc directly bound to the N‐terminal region of origin recognition complex‐1 (ORC1), a region that is responsible for gene silencing, in a state of complex containing other ORC subunits and Max in vivo and in vitro . Furthermore, ORC1 inhibited E‐box‐dependent transcription activity of c‐Myc by competitive binding to the C‐terminal region of c‐Myc with SNF5, a component of chromatin remodelling complex SNF/Swi1. Conclusions These results suggest that ORC1 suppresses the transcription activity of c‐Myc by its recruitment into an inactive form of chromatin during some stage of the cell cycle.

DNA polymerase alpha-primase is a replication enzyme necessary for DNA replication in all eukaryotes. Mouse DNA primase is composed of two subunits: a 46 kDa protein (p46), which is the catalytic subunit capable of RNA primer synthesis, and a 54 kDa protein (p54), whose physiological role is not clear. To understand the structure-function relationship of DNA primase, we set out to characterize these two subunits individually or in combination using a cDNA expression system in mammalian cultured cells, and determined the subcellular distribution of ectopically expressed DNA primase. The p54 expressed in COS-1 cells after transfection was predominantly localized in the nucleus, whereas p46 was retained in the cytoplasm as shown by indirect immunofluorescence analysis. Using several mutant proteins with deletions or substitutions as well as chimeric constructs, we identified the nuclear localization signal of p54 as RIRKKLR, encoded near the amino terminus (residues 6-12). Furthermore, co-expression of both p46 and p54 subunits markedly altered the subcellular distribution of p46; co-expressed p46 was transported into the nucleus as efficiently as p54. These results demonstrate that p54 has a nuclear localization signal and is able to be translocated into the nucleus independently of DNA polymerase alpha subunits. In contrast, p46 lacks a nuclear localization signal, and its nuclear translocation is facilitated by interaction with p54. We present here first evidence for a novel role of p54 in the nuclear translocation process, and a piggy-back binding transport mechanism of mouse DNA primase.

Aromatic L-amino acid decarboxylase was purified from bovine brain for the first time by affinity chromatography using a monoclonal antibody to the enzyme, and it was compared with the decarboxylase purified from bovine adrenal medulla by the same procedure. The monoclonal antibody was produced from a hybridoma established for the enzyme highly purified from bovine adrenal medulla. The Mr values of brain and adrenal-medulla enzyme were both estimated to be approx. 100,000 by gel-permeation chromatography. SDS/polyacrylamide-gel electrophoresis revealed a single band with an apparent Mr of 50,000. Western immunoblot analysis showed that the antibody recognized each enzyme. With regard to substrate specificity, pH-dependence and effect of pyridoxal 5'-phosphate as a cofactor, both enzymes were similar.

DNA replication checkpoint, a surveillance mechanism for S-phase progression, plays a crucial role for the maintenance of genome integrity. A variety of factors have been characterized to be involved in the checkpoint signal transduction. Rpa, a single strand DNA binding protein, was found to be responsible for forming a structure that is recognized by checkpoint sensors and then emits the initial signal for the activation of DNA damage checkpoint. Here we use a mutant of rpa1 gene, rfa1-t11, that has defects in recruiting checkpoint sensor proteins to the site of double strand break, to examine the mutant's effects on the activation of DNA replication checkpoint. We found that the mutant cells activated DNA replication checkpoint normally and showed no defects in recruiting ATR–ATRIP, a major sensor complex that is essential for DNA replication/damage checkpoint, to the site of stalled forks. In contrast, the mutant was defective in recruiting 9-1-1 complex, another sensor complex that functions in DNA damage checkpoint signal transduction, to the stalled forks. Moreover we found that sensitivity for HU obviously appeared in rfa1-t11 mutant when Mrc1 was deleted, while deletion of Rad9, an adaptor specific for damage checkpoint, had subtle effect. These data strongly suggest that rfa1-t11 mutant was mainly defective for activating DNA damage checkpoint and molecular requirement for the recruitment of ATR–ATRIP and 9-1-1 to the stressed forks may be different.

We have isolated distinct clones for cellular proteins that bind to the retinoblastoma protein by direct screening of cDNA expression libraries using purified pRB as a probe. The total nucleotide sequence of one of these clones, RBQ-3, was determined and found to encode a protein of 66 kDa localized in the nucleus. The RBQ-3 preferentially binds to underphosphorylated pRB. The region used for binding to this protein was mapped to the E1A-binding pocket B of pRB, which has sequence similarity to the general transcription factor TFIIB. We have mapped the gene to 1q32 using polymerase chain reaction analysis on a human-hamster hybrid cell panel and chromosomal fluorescence in situ hybridization.

Epstein–Barr virus (EBV) BALF2 gene product is one of the essential components in the lytic phase of the EBV DNA replication. The BALF2 protein was purified to near homogeneity from the nuclear extract of B95-8 cells with virus productive cycle induced by chemical agents. SDS–polyacrylamide gel electrophoresis showed the presence of a single polypeptide with a molecular weight of 130 K, which was identified as BALF2 protein by Western immunoblot analysis. On Superose 6 HR 10/30 gel filtration the BALF2 protein eluted at a position corresponding to an apparent molecular mass of approximately 128 K, indicating that the BALF2 protein behaves as a monomer in solution. The purified BALF2 protein bound to single-stranded DNA preferentially over double-stranded DNA or single-stranded RNA. Replication of singly primed M13 single-stranded DNA by the EBV DNA polymerase complex in the absence of the BALF2 protein exhibited a highly processive mode of replication and generated full length products in addition to some bands of pausing sites. Although the addition of the BALF2 protein did not affect the replication rate, the average chain length of the replication products was slightly increased with eliminating bands of pausing sites. Similar effects were observed with the reconstituted polymerase complex composed of the BALF5 and BMRF1 Pol subunits. On the other hand, in the absence of the BALF2 protein, the BALF5 Pol catalytic subunit alone extended the primer slightly and paused at specific sites on M13 ssDNA template where stable secondary structure is predicted. However, addition of the BALF2 protein, in contrast to the case of herpes simplex virus ICP8 which does not affect the overall distribution of length of the replication products synthesized by the HSV Pol catalytic subunit (Gottliebet al.,1990,J. Virol.64, 5976–5987), stimulated DNA synthesis and yielded a distribution of replication products with long lengths in addition to full length products. Although the BALF2 protein behaved as if it converts a low processive enzyme of the EBV Pol catalytic subunit to a highly processive form like the BMRF1 Pol accessory subunit, challenger DNA experiments revealed that the EBV Pol catalytic subunit is transferred to challenger DNA even in the presence of the BALF2 protein. It is therefore likely that the EBV BALF2 protein functions to melt out the regions of secondary structure on the single-stranded DNA template, thereby reducing and eliminating pausing of the EBV DNA polymerase at specific sites. These properties indicate that the EBV BALF2 protein acts as a single-stranded DNA-binding protein during lytic phase of EBV DNA replication.

Epstein–Barr virus (EBV) encodes putative helicase–primase proteins BBLF4, BSLF1 and BBLF2/3, which are essential for the lytic phase of viral DNA replication. The BSLF1, BBLF4 and BBLF2/3 proteins were expressed in B95-8 cells after induction of a virus productive cycle, possessing apparent molecular masses of 89 kDa, 90 kDa and 80 kDa, respectively. The anti-BSLF1 or anti-BBLF2/3 protein-specific antibody, which recognizes its target protein in both Western blotting and immunoprecipitation analyses, immunoprecipitated all of the BSLF1, BBLF4 and BBLF2/3 proteins from the extract of the cells with a virus productive cycle, indicating that these viral proteins are assembled together in vivo . To characterize their protein–protein interactions in detail, recombinant baculoviruses capable of expressing each of these viral gene products in insect cells were constructed. The assembly of the three virus replication proteins was reproduced in insect cells co- infected with the three recombinant baculoviruses, indicating that complex formation does not require other EBV replication proteins. Furthermore, experiments performed by using the extracts from insect cells co-infected with each pair of the recombinant viruses demonstrated that the BSLF1 protein could interact separately with both the BBLF4 and BBLF2/3 proteins and that the BBLF2/3 protein also interacted with the BBLF4 protein. These observations strongly suggest that within the BBLF4–BSLF1–BBLF2/3 complex each component interacts directly with the other two, resulting in helicase–primase enzyme activity.

We report here the isolation of 44 genes that are upregulated after serum starvation and/or contact inhibition. These genes have been termed TIGA, after Transcript Induced by Growth Arrest. We found that there are two kinds of G0 phases caused by serum starvation, namely, the shallow G0 (or G0/G1) and the deep G0 phases. The shallow G0 is induced by only a few hours of serum starvation, while deep G0 is generated after 3 days of serum starvation. We propose that mammalian cells enter deep G0 through a G0 gate, which is only opened on the third day of serum starvation. TIGA1, one of the uncharacterized TIGA genes, encodes a homolog of cyanate permease of bacteria and localizes in mitochondria. This suggests that Tiga1 is involved in the inorganic ion transport and metabolism needed to maintain the deep G0 phase. Ectopic expression of TIGA1 inhibited not only tumor cell proliferation but also anchorage-independent growth of cancer cell lines. A microsatellite marker, ENDL-1, allowed us to detect loss of heterozygosity around the TIGA1 gene region (5q21–22). Further analysis of the TIGA genes we have identified here may help us to better understand the mechanisms that regulate the G0 phase.

In eukaryotes, transcriptional regulation upon stimulation of the adenylate cyclase signalling pathway is mediated by a family of cAMP-responsive nuclear factors. This family consists of a large number of members which may act as activators or repressors. These factors contain the basic domain/leucine zipper motifs and bind as dimers to cAMP-response elements (CRE). The function of CRE-binding proteins is modulated by phosphorylation by several kinases. The ICER (inducible cAMP early repressor) protein is the only inducible member of this family. The induction of this powerful repressor is likely to be important for the transient nature of cAMP-induced gene expression. CRE-binding proteins have been found to play an important role in the physiology of the pituitary gland, in regulating spermatogenesis, in the response to circadian rhythms and in the molecular basis of memory.

Terminal deoxynucleotidyltransferase (TdT) is a DNA polymerase that enhances Ig and TcR gene diversity in the N region in B- and T-cells. TdT is found as a member of a large protein complex in the lysate of the thymocytes. To elucidate the molecular mechanism of the synthesis of the N region, we first attempted to isolate the genes with products that are interacting directly with TdT.Using a yeast two-hybrid system, we isolated a cDNA clone encoding a novel nuclear protein that interacts with TdT. This protein was designated as TdT interacting factor 1 (TdIF1). TdIF1 has a high degree of homology to the transcription factor p65, which belongs to the nuclear receptor superfamily. TdIF1 contains HMG-I and HMG-Y DNA binding domains (AT-hooks) and can bind to single- and double-stranded DNA. TdT and TdIF1 were co-eluted at position 232 kDa by gel filtration of MOLT4 lysate. TdIF1 can enhance TdT activity fourfold in vitro assay system using oligo(dT)16 as primers.TdIF1 binds directly to TdT, both in vitro and in vivo. TdIF1 and TdT exist as the members of a 232 kDa protein complex. TdIF1 can enhance TdT activity maximum fourfold in vitro assay system, suggesting that it positively regulates the synthesis of the N region during V(D)J recombination in the Ig and TcR genes.

The repertoires of Ig and TcR are generated by a combinatorial rearrangement of variable (V), diversity (D), and joining (J) segments (V(D)J recombination) in B- and T-cells. Terminal deoxynucleotidyltransferase (TdT) adds extra nucleotides (N nucleotides) at the junctions of the gene segments to enhance the Ig and TcR genes diversity. Using an anti-TdT antibody column, TdT has been purified as a member of a megadalton protein complex from rat thymus. The N region would be synthesized with the large protein complex.The cDNAs for proliferating cell nuclear antigen (PCNA) were isolated by yeast two-hybrid screening as the gene products which directly interacted with TdT. The interaction between PCNA and TdT was confirmed by co-immunoprecipitation, both in vitro and in vivo. TdT binds directly to a PCNA trimer, as shown by gel filtration. TdT interacts with PCNA in its DNA polymerization domain (DPD), but not in its BRCA-1 C-terminal (BRCT) domain. TdT activity was reduced to 17% of the maximum value by TdT/PCNA complex formation.TdT interacts directly with PCNA through its DPD. A functional consequence of this interaction is the negative regulation of TdT activity. These findings suggest that TdT catalyses the addition of N nucleotides under the negative control of PCNA during V(D)J recombination.

DNA polymerase lambda (Pol λ) was recently identified as a new member of the family X of DNA polymerases. Here, we show that Pol λ directly binds to proliferating cell nuclear antigen (PCNA), an auxiliary protein for DNA replication and repair enzymes, both in vitro and in vivo . A pull‐down assay using deletion mutants of Pol λ showed that the confined C‐terminal region of Pol λ directly binds to PCNA. Furthermore, a synthetic peptide of 20‐mers derived from the C‐terminal region of Pol λ competes with full‐length Pol λ for binding to PCNA. The residues between amino acids 518 and 537 of Pol λ are required for binding to PCNA, and are different from the consensus PCNA interacting motif (PIM). Pol λ associates with PCNA in vivo by immunoprecipitation analysis and EGFP‐tagged Pol λ co‐localizes with PCNA as spots within a nucleus using fluorescent microscopy. Through direct binding, PCNA suppressed the distributive nucleotidyltransferase activity of Pol λ. Pol µ, which also belongs to the family X of DNA polymerases, binds to PCNA by a pivotal amino acid residue.

ATM and rad3-related protein kinase (ATR), a member of the phosphoinositide kinase-like protein kinase family, plays a critical role in cellular responses to DNA structural abnormalities in conjunction with its interacting protein, ATRIP. Here, we show that the amino-terminal portion of ATRIP is relocalized to DNA damage-induced nuclear foci in an RPA-dependent manner, despite its lack of ability to associate with ATR. In addition, ATR-free ATRIP protein can be recruited to the nuclear foci. Our results suggest that the N-terminal domain of the ATRIP protein contributes to the cell cycle checkpoint by regulating the intranuclear localization of ATR.

Abstract This enzymatic method for determination of sialic acid involves use of neuraminidase (EC 3.2.1.18), N-acetylneuraminate lyase (EC 4.1.3.3), acylglucosamine 2-epimerase (EC 5.1.3.8), N-acetylhexosamine oxidase (from Pseudomonas sp.), and peroxidase (EC 1.11.1.7). Because the method does not require pyruvic acid in the assay medium, interference by pyruvic acid in serum can be avoided. This simple, accurate assay is little affected by other substances in serum.

Myotonic dystrophy is caused by the expansion of a CTG repeat found in the 3′-untranslated region of the myotonic dystrophy kinase. The mechanism of disease and the role of the kinase are currently obscure. Here we begin the investigation of domain structure/function correlations to aid in determining its normal function.Expressed full-length protein and protein truncated before a C-terminal hydrophobic domain were compared. In vitro, signal peptide function and protection of kinase by microsomal membranes were absent; thus, it is not translocated, as previously proposed. However, full-length kinase expressed in insect cells was found in fractions enriched for membranes and decorated mitochondria. The truncated form was found primarily in the cytosol. The kinase was present as two self-associated, disulfide-linked complexes. The majority of full-length kinase was found in the larger of the two complexes, while almost all of the truncated form was found in the smaller. Thus, the C-terminal region confers a higher order of self-association. Furthermore, full-length kinase expressed in COS-1 cells was present as high molecular weight complex, while the truncated form was present as monomer species. These experiments indicate that the myotonic dystrophy kinase is not membrane-integrated, but that it may have a molecular organization which favors peripheral association with membranes. Myotonic dystrophy is caused by the expansion of a CTG repeat found in the 3′-untranslated region of the myotonic dystrophy kinase. The mechanism of disease and the role of the kinase are currently obscure. Here we begin the investigation of domain structure/function correlations to aid in determining its normal function. Expressed full-length protein and protein truncated before a C-terminal hydrophobic domain were compared. In vitro, signal peptide function and protection of kinase by microsomal membranes were absent; thus, it is not translocated, as previously proposed. However, full-length kinase expressed in insect cells was found in fractions enriched for membranes and decorated mitochondria. The truncated form was found primarily in the cytosol. The kinase was present as two self-associated, disulfide-linked complexes. The majority of full-length kinase was found in the larger of the two complexes, while almost all of the truncated form was found in the smaller. Thus, the C-terminal region confers a higher order of self-association. Furthermore, full-length kinase expressed in COS-1 cells was present as high molecular weight complex, while the truncated form was present as monomer species. These experiments indicate that the myotonic dystrophy kinase is not membrane-integrated, but that it may have a molecular organization which favors peripheral association with membranes.

Summary— Specific antibodies were prepared against Drosophila DNA polymerase e and DREF, a regulatory factor for DNA replication‐related genes. Using these antibodies together with those for DNA polymerase α and proliferating cell nuclear antigen (PCNA), we examined expression patterns and sub‐cellular distributions of these proteins during Drosophila development. DNA polymerase α, ε and PCNA proteins were maternally stored in unfertilized eggs and maintained at high levels during embryogenesis. With distinct nuclear localization, proteins were observed in embryos at interphase stages throughout the 13 nuclear division cycles, suggesting that they all participate in rapid nuclear DNA replication during these cycles. In contrast, maternal storage of a DREF protein was relatively low and its level increased throughout embryogenesis. Strong nuclear staining with the anti‐DREF antibody was not observed until the nuclear division cycle 8. Immunostaining of various larval tissues from transgenic flies carrying the PCNA gene promoter‐ lacZ fusion gene revealed co‐expression of DREF, PCNA and lacZ , suggesting that DREF regulates the expression of PCNA gene in these tissues. In addition, we detected a relatively high level of DREF in adult males as well as females. Since DNA polymerase α, ε and PCNA are hardly detectable in adult males, DREF very likely regulates genes other than those closely linked to DNA replication in adult males.

Hunter disease, an X-linked recessive lysosomal storage disorder, is caused by a deficiency in iduronate sulfatase activity. Sequence analysis of mRNA of fibroblasts of an intermediate phenotype patient showed a single C1327 to T nucleotide transition. This mutation resulted in a substitution of termination codon for normal arginine at position 443 of the peptide sequence. Expression studies with this abnormal cDNA in fibroblasts from the patient revealed a loss of enzymatic activity and instability of the mutated protein. We posturate that this mutation is probably the cause of the intermediate form of Hunter disease.

We have studied the steroid sulfatase (STS) gene in three Japanese families with X-linked ichthyosis (XLI), using polymerase chain reaction (PCR). PCR was performed using three sets of intraexonic primers covering exons 1, 5 and 10. In affected individuals from two of the families, DNA was not amplified in any of the three exons, suggesting that XLI in these families was due to the complete deletion of the STS gene. In affected individuals in the remaining family, DNA was amplified in predicted sizes in exons 1 and 5, but not in exon 10, suggesting that XLI in this family was due to partial deletion of the STS gene including exon 10. These results suggested that STS gene deficiency is heterogeneous in Japanese families with XLI. PCR is useful for the rapid diagnosis of XLI, the differentiation of XLI from ichthyosis vulgaris, and genetic counseling of XLI families. The PCR method was not applicable for carrier detection.

Abstract: Desmoglein 3 is a cadherin‐like calcium‐dependent cell adhesion molecule expressed primarily in suprabasal keratinocytes of the epidermis. In this study, we have cloned the full‐length cDNA and characterized the entire gene structure for the mouse desmoglein 3 gene (Dsg3). Isolation of overlapping cDNA clones, together with 5′ and 3′ rapid amplification of cDNA ends (RACE), allowed delineation of the entire coding sequence. The transcriptional initiation site was confirmed by primer extension and reverse transcription polymerase chain reaction analysis. The entire cDNA consisted of 6407 bp with an open reading frame of 2979 bp, and the deduced polypeptide contained 993 amino acids. Comparison of mouse and human desmoglein 3 amino acid sequences demonstrated 85.6% homology. Computer analysis suggested the presence of a transmembrane segment, 5 potential calcium binding sites, and a RAL motif which corresponds to the HAV motif, the potential site for homophilic interaction of typical cadherins. The mouse desmoglein 3 gene consisted of 15 exons in chromosome 18. Comparison of the intron–exon organization of Dsg3 with various cadherins from different species revealed remarkable conservation. This relatively high level of conservation both at the protein and genomic level suggests that desmoglein 3 plays an important role in keratinocyte cell–cell adhesion. Note

Terminal deoxynucleotidyltransferase (TdT) is a DNA polymerase that enhances the Ig and TcR gene diversity in the N region at the junctions of variable (V), diversity (D) and joining (J) segments in B- and T-cells. TdT synthesizes the N region in concert with many proteins including DNA-PKcs, Ku70 and Ku86. To elucidate the molecular mechanism of the N region synthesis, we first attempted to isolate the genes with products that directly interact with TdT.Using a yeast two-hybrid system, we isolated a cDNA clone encoding a novel nuclear protein that interacts with TdT. This protein was designated as TdT interacting factor 2 (TdIF2). The confined region of the C-terminal in TdIF2 is involved in specific interaction with the entire C-terminal in TdT. TdIF2 contains an acidic region comprised of 42 residues. TdIF2 was shown to bind specifically to a core histone by pull down assay using specific antibodies against TdIF2. When a TdT/TdIF2 complex was applied on to a DNA-cellulose column, only TdT bound to the column while TdIF2 passed through. TdIF2 reduces the TdT activity to 46% of its maximum value in vitro assay system using activated DNA as primer.TdIF2 binds directly to TdT and core histone. Furthermore, TdT, TdIF2 and core histone form a ternary complex. TdIF2 liberates H2A/H2B from a core histone in correlation with PCNA. The enzymatic consequence of the TdIF2/TdT complex is the reduction of TdT activity in vitro. TdIF2 would function as a chromatin remodeling protein at the N region synthesis.

The fission yeast Schizosaccharomyces pombe has three putative ubiquitin-protein ligases of the Nedd4/Rsp5 family, named Pub1p, Pub2p and Pub3p. Pub1p has been reported to be involved in cell cycle regulation and proliferation under acidic pH conditions. Here we characterize Pub2p, which contains a conserved HECT domain and a WW domain but lacks a C2 domain. Transcription of the pub2(+) gene was constitutive and further enhanced by nitrogen starvation. A pub2-null mutation gave no remarkable phenotypes, but intensified temperature sensitivity in a pub1Delta background. Moderately overexpressed pub2(+) suppressed the temperature sensitivity of pub1Delta cells, which suggests that the function of Pub2p overlaps with that of Pub1p. Overexpression of pub2(+) by a strong nmt1 promoter in wild-type strains caused growth arrest and cell elongation, probably owing to defects in G2 progression or the G2/M transition. Unlike Pub1p, however, overexpression of Pub2p did not reduce the levels of Cdc25p. Pub2-GFP was found throughout the cell, especially at the cell surface in the polar regions. Pub2p contains a conserved cysteine residue (Cys639) in its putative catalytic HECT domain that can be thiol-ubiquitinated. Substitution of Cys639 by alanine (Pub2CA) caused a functional defect, because growth arrest and cell elongation were not induced by overexpression of Pub2CA. A chimeric Pub1 protein, in which the HECT domain was replaced by the Pub2 HECT domain, completely suppressed the temperature sensitivity of pub1Delta cells, suggesting that the HECT domain of Pub2p has the catalytic activity of a ubiquitin ligase. We conclude that Pub2p is a HECT-type ubiquitin-protein ligase that shares partially overlapping function with Pub1p.

We propose a new role of retinoblastoma protein as a cell growth activator in its phosphorylated form. The hyper-phosphorylated retinoblastoma protein generated by the action of cdk2/cyclin E strongly stimulated the activity of DNA polymerase alpha, but did not stimulate DNA polymerases delta, epsilon, or primase. But, cdk4/cyclin D-phosphorylated retinoblastoma protein showed little stimulation. Hyper-phosphorylated retinoblastoma protein interacted with the catalytic subunit of DNA polymerase alpha, and stabilised DNA polymerase alpha from heat inactivation at 45 degrees C. These results suggest that in G1 phase, hypo-phosphorylated retinoblastoma protein suppresses the progression of cell cycle as a transcription inhibitor, but that after phosphorylation by cdk2/cyclin E at the G1/S boundary, hyper-phosphorylated retinoblastoma protein acts as a cell-cycle promoter by optimising the DNA polymerase alpha reaction.

Preconditioning contractions (PCs) have been shown to markedly improve recovery from eccentric contractions (ECCs)-induced force depression. We here examined the mechanism behind the effects of PCs with focusing on the SH3 and cysteine-rich domain 3 (STAC3) that is essential for coupling membrane depolarization to Ca2+ release from the sarcoplasmic reticulum. Rat medial gastrocnemius (MG) muscles were excised immediately (REC0), 1 day (REC1), and 4 days (REC4) after exposure to 100 repeated damaging ECCs in vivo. PCs with 10 repeated nondamaging ECCs were applied 2 days before the damaging ECCs. Damaging ECCs induced in vivo isometric torque depression at 50 and 100 Hz stimulation frequencies, which was accompanied by a significant decrease in the amount of full-length STAC3, an activation of calpain 1, and an increased number of Evans Blue dye-positive fibers in MG muscles at REC1 and REC4. Interestingly, PCs attenuated all these deleterious alterations induced by damaging ECCs. Moreover, mechanistic experiments performed on normal muscle samples exposed to various concentration of Ca2+ showed a Ca2+-dependent proteolysis of STAC3, which was prevented by calpain inhibitor MDL-28170. In conclusion, PCs may improve recovery from force depression after damaging ECCs, in part by inhibiting the loss of STAC3 due to the increased permeability of cell membrane and subsequent activation of calpain 1.NEW & NOTEWORTHY The SH3 and cysteine-rich domain 3 (STAC3) is a skeletal muscle-specific protein that couples membrane depolarization to sarcoplasmic reticulum Ca2+ release. No studies, however, examined the role of STAC3 in protective effects of preconditioning contractions (PCs) against damaging eccentric contractions (ECCs). Here, we demonstrate that PCs may improve recovery from damaging ECCs-induced force depression, in part by an inhibition of Ca2+-dependent proteolysis of STAC3 due to increased membrane permeability and subsequent calpain 1 activation.

Interval training (IT) results in improved fatigue resistance in skeletal muscle mainly due to an increased aerobic capacity, which involves increased muscle mitochondrial content and/or improved mitochondrial function. We hypothesized that IT with high-intensity contractions is more effective in increasing mitochondrial function, and hence fatigue resistance, than low-intensity contractions. To study this hypothesis without interference from differences in muscle fiber recruitment obliged to occur during voluntary contractions, IT was performed with in situ supramaximal electrical stimulation where all muscle fibers are recruited. We compared the effect of IT with repeated low-intensity (20 Hz stimulation, IT20) and high-intensity (100 Hz stimulation, IT100) contractions on fatigue resistance and mitochondrial content and function in mouse plantar flexor muscles. Muscles were stimulated every other day for 4 weeks. The averaged peak torque during IT bouts was 4.2-fold higher with IT100 than with IT20. Both stimulation protocols markedly improved in situ fatigue resistance, although the improvement was larger with IT100. The citrate synthase activity, a biomarker of mitochondrial content, was similarly increased with IT20 and IT100. Conversely, increased expression of mitochondrial respiratory chain (MRC) complexes I, III, and IV was only observed with IT100 and this was accompanied by increases in MRC supercomplex formation and pyruvate-malate-driven state 3 respiration in isolated mitochondria. In conclusion, the IT-induced increase in fatigue resistance is larger with high-intensity than with low-intensity contractions and this is linked to improved mitochondrial function due to increased expression of MRC complexes and assembly of MRC supercomplexes.

A two site enzyme immunoassay which quantitatively identifies types I, II, and III of protein kinase C isozymes has been designed. The soluble protein kinase C isozymes were selectively immobilized by type-specific monoclonal antibodies, MC-1a, -2a, and -3a (H. Hidaka et al., J Biol. Chem., 263: 4523-4526, 1988) which bind to the regulatory domain (NH2-terminal side) of protein kinase C. The amount of each isozyme was then determined using a horseradish peroxidase-conjugated polyclonal antibody raised against the COOH-terminal peptide of protein kinase C. By adding increasing concentrations of the antigen, the range of the assay proved to be 0.51-51, 0.081-8.1, and 0.31-31 nM for types I, II, and III, respectively. This sandwich method was used to determine the level of protein kinase C isozymes in rabbit tissues. Type I was mainly present in the cerebrum and cerebellum; the highest amount of type II isozyme was present in blood platelets [26.0 +/- 3.8 (SE) micrograms/g wet tissue]. We compared the protein kinase C isozyme levels in human normal thyroid gland and thyroid cancer tissues and found that type II protein kinase C specifically increased in thyroid cancer tissues. Immunocytochemical examination using MC-2a revealed that the cytoplasm of the cancer cells showed prominent immunoreactivity for type II isozyme.

Malignant tumor progression is a complex and multi-gene event which can not be easily detected or predicted. The detection of malignant cells using marker genes is hampered by the fact that these markers are only expressed by certain malignancies or lack sensitivity and/or specificity. We have reported a human septin family gene Bradeion, which shows strong cancer-specific expression in colorectal and urologic cancers as a result of carcinogenesis.Diagnostic efficacy and validity of Bradeion gene expression were tested by two independent systems, one is a protein detection method using monoclonal antibody based immuno-chromatographic membrane strip tests (a nitrocellulose test strip assay), and another is a gene expression detection method, quantitative RT-PCR. The technology has been established using Bradeion fusion proteins, in vitro cultivated human cancer cell lines, and also patients' test samples with controls.Bradeion test strip by combination with two monoclonal antibodies are valid for the detection of 1 ng/ml Bradeion, and successfully applied for patient urine samples with no false-positive results. Positive detection rates were over 70% of the patient urine samples so far tested (prostate cancer, renal cell carcinoma, and bladder cancer) in 15 to 30 minutes. Quantitative RT-PCR resulted in significantly high copy numbers of 0.4-3.0-3.0 x 10(5) per microg total RNA in patients' tissue samples, whereas those from normal tissue or other cancers found negative.The present study introduces the practical diagnostic methods using a disease-specific molecular marker, which provides safe, economical, and rapid clinical screening of cancer.

Deficiency in a 94,000-dalton protein in the non-crystallin fraction from the Elo mouse lens was shown. To perform further investigations, we raised an antibody against the 94,000-dalton protein isolated from normal mouse lens. Western blot analysis with the antibody indicated that the protein was only present in the lens and not in the brain, lung, heart, liver, and kidney. In the lens, it was unique to the cortex and nucleus fractions, not being present in the epithelial cells. Furthermore, it was observed in the water-soluble fraction as well as in the urea-soluble fraction. The antibody weakly but clearly reacted with the chick CP97 lens peptide, a fiber cell-specific protein, and anti-CP97 antibody also reacted with the 94,000-dalton protein. From these results, we concluded that the protein corresponds to CP97 cytoskeletal protein in the mouse lens. The protein was deficient in the lenses from Elo mice, but microphthalmic lenses from CTA mice contained a normal level.

High priority stereospecific targeting (SST) featuring selective production of conformation-specific monoclonal antibodies was directed against a native receptor, EphA2 (ephrin type-A receptor 2). A critical point for this technology is selection of sensitized B lymphocytes by antigen-expressing myeloma cells through their B-cell receptors (BCRs). The essential point is that antigens expressed on myeloma cells retain their original three dimensional structures and only these are recognized. Immunization with recombinant plasmid vectors as well as antigen-expressing CHO cells elicits enhanced sensitization of target B lymphocytes generating stereospecific antibodies. More than 24% of hybridoma-positive wells were identified to be cell-ELISA positive, confirming high efficiency. IgG-typed conformation-specific monoclonal antibodies could be also produced by the SST technique. Immunofluorescence analysis confirmed specific binding of sensitized B lymphocytes to antigen-expressing myeloma cells. Furthermore, stereospecific monoclonal antibodies to EphA2 specifically recognized EphA2-expressing cancer cells as demonstrated by Cell-ELISA. In the present study, we were able to develop priority technology for selective production of conformation-specific monoclonal antibodies against an intact receptor EphA2, known to be overexpressed by epithelial tumor cells of multiple cancer types.

Checkpoint pathways ensure that the progression of thecell cycle is restrained while repair is carried out on chromosomes that are damaged by UV or ionized radiation(Hartwell and Weinert 1989). A number of gene productsneeded for establishing the damage checkpoint have beenidentified. Importantly, most checkpoint proteins appearto be conserved through evolution (Elledge 1996). In thispaper, we discuss control of the damage checkpoint in thefission yeast Schizosaccharomyces pombe, an excellentmodel organism for analyses of cell cycle and checkpointcontrol...

Previously we have identified the Drosophila orbit gene whose hypomorphic mutations cause abnormal chromosome segregation (Inoue et al., 2000). The orbit encodes Orbit/Mast, a 165-kDa microtubule-associated protein (MAP) with GTP-binding motifs. Two human homologues of the Orbit/Mast, CLASP1 (hOrbit1) and CLASP2 (hOrbit2) have been identified. Using an antibody to CLASP1/hOrbit1 polypeptide, we confirmed that the polypeptide of about 150 kDa associates with microtubule purified from the porcine brain. Thus, we conjectured that CLASP1 may be a human orthologue of the Drosophila Orbit/Mast, and therefore we named it h (human) Orbit1. We constructed the plasmid for expression of a fusion protein of the putative microtubule-binding domain (1-662 out of 1289 residues) of hOrbit1 and the green fluorescent protein (GFP), and then, transfected the plasmid into Tet off cells derived from HeLa cell. Confocal laser scanning microscopic observation revealed that the GFP-fluorescence associated with short and thin filaments in the perinuclear region during the short period after plasmid transfection, and colocalized with only part of the microtubules. GFP fluorescence was later detected on the abnormally longer and thick bundles of microtubule filaments. Finally the bundles formed networks in the perinuclear region. The results suggest that the GFP-hOrbit1 N-terminal fragment (GFP-hOrbit1 NF) binds to the newly formed microtubules rather than the pre-formed ones, and that displacement of the endogenous hOrbit by the fragment might cause abnormal bundling of microtubules. Interestingly, the expression of the GFP-hOrbit1 NF results in cell death associated with nuclear fragmentation.

Journal Article A Novel Stimulating Protein of Mammalian DNA Polymerase α Get access Shonen Yoshida, Shonen Yoshida 2 Laboratory of Cancer Cell Biology, Research Institute for Disease Mechanism and Control, Nagoya University School of MedicineShowa-ku, Nagoya, Aichi 466 2To whom correspondence should be addressed. Search for other works by this author on: Oxford Academic PubMed Google Scholar Katsuyuki Tamai, Katsuyuki Tamai Laboratory of Cancer Cell Biology, Research Institute for Disease Mechanism and Control, Nagoya University School of MedicineShowa-ku, Nagoya, Aichi 466 Search for other works by this author on: Oxford Academic PubMed Google Scholar Hayato Umekawa, Hayato Umekawa Laboratory of Cancer Cell Biology, Research Institute for Disease Mechanism and Control, Nagoya University School of MedicineShowa-ku, Nagoya, Aichi 466 Search for other works by this author on: Oxford Academic PubMed Google Scholar Motoshi Suzuki, Motoshi Suzuki Laboratory of Cancer Cell Biology, Research Institute for Disease Mechanism and Control, Nagoya University School of MedicineShowa-ku, Nagoya, Aichi 466 Search for other works by this author on: Oxford Academic PubMed Google Scholar Kiyohide Kojima Kiyohide Kojima Laboratory of Cancer Cell Biology, Research Institute for Disease Mechanism and Control, Nagoya University School of MedicineShowa-ku, Nagoya, Aichi 466 Search for other works by this author on: Oxford Academic PubMed Google Scholar The Journal of Biochemistry, Volume 106, Issue 3, September 1989, Pages 389–395, https://doi.org/10.1093/oxfordjournals.jbchem.a122863 Published: 01 September 1989 Article history Received: 27 March 1989 Published: 01 September 1989

The functions of many proteins are likely to be regulated by phosphorylation. Thus, antibodies that can recognize specifically phosphorylated sites on proteins have a wide variety of uses for studying the function and regulation of phosphoproteins. We have improved methods for generation of phosphorylation site-specific antibodies and have successfully obtained antibodies for the analysis of most of the phosphorylation sites on p53 and RB proteins.

山火事の延焼速度予測モデルとして最も一般的に使用されているRothermelモデルと,山火事の物理的強度の指標であるByramの火線強度を,日本の森林の可燃物に適用して,日本で発生する山火事の強度を推定した。火線強度推定のために必要な,可燃物の燃焼特性を示すパラメータ値の相対的な重要度を調べたところ,表面積一体積比以外のパラメータは,可燃物の種類を問わず固定値を用いても問題はないものと考えられた。火線強度は樹林地よりも草原で大きく,斜面の傾斜や風速の影響を強く受けた。日本で発生する山火事の火線強度を推定したところ,林床にコシダが密生するアカマツ林を除いて,いずれも850kWm-1以下とアメリカやカナダの森林で報告されている地表火の火線強度の範囲内(10~15,000kWm-1)にあった。しかし,コシダが密生するアカマツ林の火線強度は20,000kWm-1以上に達していたと推定された。この値は,繰り返し起こる山火事によって維持されていると考えられているフィンボスやチャパラルなど,地中海性気候下の植生での火線強度に匹敵するものであった。

Rb protein was purified from recombinant baculovirus-infected Sf9 cells to apparent homogeneity by a simple solubilization and by immunoaffinity column chromatography. It was mainly obtained as p110Rb, the underphosphorylated form of the Rb protein family. This p110Rb was shown to form a specific complex in vitro with SV40 Tag and to bind to double or single stranded DNA. It could also affect Tag helicase activity in a biphasic-dose dependent manner, due to these two biochemical functions. This purification procedure provides sufficient amounts of native Rb protein to further elucidate its role as an anti-oncogene protein and a negative regulator of the cell cycle.

We previously reported a rat chromosomal origin of DNA replication (oriA1) that encompassed the aldolase B (AldB) gene promoter. Here, we examined utilization of oriA1 in AldB-expressing and non-expressing cells. The results suggested the occurrence of mutually exclusive regulation between DNA replication and transcription. Nascent strand abundance as assayed by competitive polymerase chain reaction using bromodeoxyuridine-labeled nascent DNA indicated that oriA1 is not utilized in AldB-expressing cells, while it is fired in non-expressing cells. In the latter non-expressing cells, the replication fork seemed to slow at 20-22 kb downstream of oriA1.

Phosphorylation of retinoblastoma protein (pRB) by cyclin-dependent kinases (CDKs) at multiple sites leads to activation of transcription of cell-cycle-related genes. Cyclin/CDK complexes thus play a pivotal role in the regulation of progression from G1 to S phase. In the present study, we developed a nonradioactive, sandwich enzyme-linked immunosorbent assay (ELISA) system for measuring activities of cyclin/CDK complexes, in which the immobilized monoclonal antibody works as a trap for phosphorylated pRB containing phosphorylated amino acids at specific sites. For this purpose, we raised monoclonal antibodies that are highly specific to ppRB phosphorylated at Ser780, Thr356, or Ser612 and used them as detectors for the individual reaction products by cyclin/CDK complexes. In particular, this approach proved useful for cyclin D1/CDK4 that specifically recognizes Ser780 in pRB with only very limited phosphorylation of a conventional substrate, histone H1. The study revealed the newly developed sandwich ELISA system to have advantages over the current radioisotope assay in terms of sensitivity, precision, and rapidity. It should find application for inhibitor screening and drug discovery related to CDKs.

Existence of a Mr = 56,000 polypeptide associated with 10S DNA polymerase alpha was shown by production of a monoclonal anti-calf thymus 10S DNA polymerase alpha antibody secreted from a hybridoma line named 3H1. The antibody bound three polypeptides with Mr = 180,000, 56,000 and 32,000 in hydroxylapatite fraction of 10S DNA polymerase alpha by immunoblot. The antibody co-precipitated the polypeptides with the large polypeptide (Mr = 150,000-140,000) of 10S DNA polymerase alpha with the aid of second antibody. Among three polypeptides, the Mr = 56,000 polypeptide was co-purified with DNA polymerase alpha through DNA-cellulose chromatography and repeated sucrose rate-zonal centrifugations. The Mr = 56,000 polypeptide was still associated with 10S DNA polymerase alpha after second sucrose rate-zonal centrifugation, but the amount of it was reduced. The polypeptide was banded at pH 7.2-8.0 and displayed microheterogeneity in respect of isoelectric point by isoelectrofocusing with 7 M urea, and showed weak DNA-binding property after blotting onto a nitrocellulose. The antibody against the polypeptide precipitated DNA polymerase alpha from human, rat, and mouse, and Mr = 56,000 and 32,000 polypeptides were detected in these DNA polymerase alpha fractions by immunoblot. These results suggest that the polypeptide with Mr = 56,000 may take part in the DNA polymerase reaction.

Cytoskeletal regulation is important in cell migration. The Caenorhabditis elegans gonadal distal tip cells (DTCs) offer a simple model with which to investigate the mechanism of cell migration in organogenesis. Here, we report that one of the spectraplakin isoforms, VAB-10B1, plays an essential role in cell and nuclear migration of DTCs by regulating the actin and microtubule (MT) cytoskeleton. In the vab-10(tk27) mutant, which lacks VAB-10B1, alignment of filamentous (F)-actin and MTs was weakly and severely disorganized, respectively, which resulted in a failure to translocate the DTC nucleus and a premature termination of DTC migration. An MT growing-tip marker, EBP-2-GFP, revealed that polarized outgrowth of MTs towards the nuclei of migrating DTCs was strikingly impaired in tk27 animals. A vab-10 mini-gene encoding only the actin- and MT-binding domains significantly rescued the gonadal defects, suggesting that VAB-10B1 has a role in linking actin and MT filaments. These results suggest that VAB-10B1/spectraplakin regulates the polarized alignment of MTs, possibly by linking F-actin and MTs, which enables normal nuclear translocation and cell migration of DTCs.

We report an observation of the decay B^\pm -> \phi \phi K^\pm and evidence for B^0 -> \phi \phi K^0. These results are based on a 414 fb^{-1} data sample collected with the Belle detector at the KEKB asymmetric-energy e^+e^- collider operating at the \Upsilon(4S) resonance. The branching fractions for these decay modes are measured to be Br(B^{\pm} -> \phi \phi K^\pm) = (3.2^{+0.6}_{-0.5} +- 0.3) * 10^{-6} and Br(B^{0} \to \phi \phi K^{0}) = (2.3^{+1.0}_{-0.7} +- 0.2) * 10^{-6} for \phi \phi invariant mass below 2.85 GeV/c^2. The corresponding partial rate asymmetry for the charged B mode is measured to be A_{CP}(B^\pm -> \phi \phi K^\pm) = 0.01^{+0.19}_{-0.16} +- 0.02. We also study the decays B^\pm -> J/\psi K^\pm and B^\pm -> \eta_c K^\pm, where the J/\psi and \eta_c decay to final states with four charged kaons. We find A_{CP}(B^\pm -> \phi \phi K^\pm) with the \phi\phi candidates within the \eta_c mass region is 0.15^{+0.16}_{-0.17} +- 0.02, consistent with no asymmetry.

Abstract Background Muscle weakness and decreased fatigue resistance are key manifestations of idiopathic inflammatory myopathies (IIMs). We here examined whether high-intensity interval training (HIIT) improves fatigue resistance in skeletal muscle of experimental autoimmune myositis (EAM) mice, a widely used animal model for IIM. Methods Female BALB/c mice were randomly assigned to control (CNT) or EAM groups (n = 28 in each group). EAM was induced by immunization with three injections of myosin emulsified in complete Freund’s adjuvant. The plantar flexor (PF) muscles from mice with EAM were exposed to either an acute bout or 4 weeks of HIIT (a total of 14 sessions). Results The fatigue resistance of PF muscles was lower in the EAM than in the CNT group ( P &lt; 0.05). These changes were associated with decreased activities of citrate synthase and cytochrome c oxidase and increased expression levels of the endoplasmic reticulum stress proteins (glucose-regulated protein 78 and 94, and PKR-like ER kinase) ( P &lt; 0.05). HIIT restored all these alterations and increased the peroxisome proliferator activated receptor γ coactivator-1α (PGC-1α) and the mitochondrial electron transport chain complexes (I, III, and IV) in muscles from EAM mice ( P &lt; 0.05). Conclusions HIIT improves fatigue resistance in an IIM mouse model and this can be explained by restoration of mitochondria oxidative capacity via inhibition of the ER stress pathway and PGC-1α-mediated mitochondrial biogenesis.

PURPOSE: Exercise training improves cerebrovascular function. It has been recently speculated that shear-mediated dilation of the internal carotid artery (ICA) is a useful marker of cerebrovascular function. Although exercise intensity is a major factor of exercise prescription, the effects of exercise intensity on shear-mediated dilation of the ICA remain unknown. This study investigated the shear-mediated dilation of the ICA following acute, moderate-, and high-intensity exercise in healthy males. METHODS: Twelve healthy males (22 ± 2 years) completed a 30 min leg cycling exercise at moderate [(55-65% of age-predicted maximal heart rate (HRmax)] and high (75-85% HRmax) intensities. Shear-mediated dilation of the ICA was assessed at pre-exercise (Pre), 5 min (Post5), and 60 min (Post60) after the cessation of exercise. Shear-mediated dilation was induced by 3 min of hypercapnia (target end tidal partial pressure of carbon dioxide +10 mmHg from an individual’s baseline) and calculated as the percent rise of the peak diameter from baseline diameter. Doppler ultrasound was employed to measure the carotid diameter, and blood velocity during exercise, and hypercapnia. Conductance and shear rate (SR) of the ICA at 25 min of exercise was calculated based on the Doppler variables and mean blood pressure. RESULTS: Neither type of exercise altered the SR of the ICA (Interaction effect; P = 0.93, main effect of time; P = 0.14). Conductance decreased during high-intensity exercise (Pre to 25 min; 5.1 ± 1.3 to 3.2±1.0 ml/min/mmHg, P < 0.01) but not during moderate-intensity exercise (5.0 ± 1.3 to 4.0 ± 0.8 ml/min/mmHg, P = 0.11). Shear-mediated dilation immediately declined after high-intensity exercise (Pre to Post5; 6.9 ± 1.7 to 4.0 ± 1.4%, P < 0.01), but not after moderate-intensity exercise (7.2 ± 2.1 to 7.3 ± 1.8%, P = 1.00). Shear-mediated dilation did not show significant changes at Post60 in either exercise intensity (Post 60; Moderate; 8.0 ± 3.1, High; 6.4 ± 2.9%). CONCLUSIONS: The acute decline of shear-mediated dilation in the ICA following high-intensity exercise may have been due to changes in the sympathetic activity and hemodynamics rather than in the SR. Current findings suggest that moderate-intensity exercise is more suitable for promoting cerebrovascular health than high-intensity exercise.

Preconditioning contractions (PCs) have been shown to markedly improve recovery from force depression after damaging eccentric contractions (ECCs). Here, we examined the mechanism underlying the effects of PCs with special focus on the SH3 and cysteine rich domain 3 (STAC3) that is essential for the transduction of action potential to the Ca2+ release from the sarcoplasmic reticulum. Rat medial gastrocnemius (MG) muscles were removed immediately (REC0), 1 d (REC1), and 4 d (REC4) after exposure to 100 repeated in vivo damaging ECCs. PCs with 10 repeated nondamaging ECCs were applied 2 d before the damaging ECCs. Damaging ECCs induced in vivo isometric torque depression at 50 and 100 Hz stimulation frequencies at REC1 and REC4, which was accompanied by a significant reduction in the amount of STAC3, an activation of calpain 1, and an increased number of Evans Blue dye positive fibers in MG muscles. Importantly, PCs attenuated all these deleterious alterations induced by damaging ECCs. Moreover, mechanistic experiments performed on normal muscle tissue exposed to various concentration of Ca2+ showed a Ca2+-dependent proteolysis of STAC3, which was prevented by calpain inhibitor MDL-28170. In conclusion, PCs improve recovery from force depression after damaging ECCs, presumably by inhibiting the loss of STAC3 due to the increased permeability of cell membrane and subsequent activation of calpain 1.