Kathleen Boesze‐Battaglia

Purpose of review: Alkaline phosphatase is an important component in hard tissue formation, highly expressed in mineralized tissue cells. It is appropriate to review the current status of this important enzyme. Recent findings: The mechanism with which this enzyme carries out its function is not completely understood, but it appears to act both to increase the local concentration of inorganic phosphate, a mineralization promoter, and to decrease the concentration of extracellular pyrophosphate, an inhibitor of mineral formation. The enzyme is localized to the outside of the plasma membrane of cells, and of the membrane of matrix vesicles. It is attached to the membrane by a glycophosphatidylinositol anchor, and is found in membrane microdomains known as rafts. Alkaline phosphatase has also been implicated in cardiovascular calcification which appears to proceed by an osteogenic mechanism. Significant interest in alkaline phosphatase expression has also come from tissue engineering experiments, where enzyme expression is a good predictor of neotissue mineralization. Summary: The high level of activity in this field is sure to provide new and important information into the fundamental mechanisms of hard tissue formation, provide therapeutic opportunities for treatment of bone diseases, and enhance our ability to create useful bone biomaterials.

The retinal pigment epithelium (RPE), a monolayer of post-mitotic polarized epithelial cells, strategically situated between the photoreceptors and the choroid, is the primary caretaker of photoreceptor health and function. Dysfunction of the RPE underlies many inherited and acquired diseases that cause permanent blindness. Decades of research have yielded valuable insight into the cell biology of the RPE. In recent years, new technologies such as live-cell imaging have resulted in major advancement in our understanding of areas such as the daily phagocytosis and clearance of photoreceptor outer segment tips, autophagy, endolysosome function, and the metabolic interplay between the RPE and photoreceptors. In this review, we aim to integrate these studies with an emphasis on appropriate models and techniques to investigate RPE cell biology and metabolism, and discuss how RPE cell biology informs our understanding of retinal disease.

Autophagy, a catabolic process by which a cell “eats” itself, turning over its own cellular constituents, plays a key role in cellular homeostasis. In an effort to maintain normal cellular function, autophagy is often up-regulated in response to environmental stresses and excessive organelle damage to facilitate aggregated protein removal. In the eye, virtually all cell types from those comprising the cornea in the front of the eye to the retinal pigment epithelium (RPE) providing a protective barrier for the retina at the back of the eye, rely on one or more aspects of autophagy to maintain structure and/or normal physiological function. In the lens autophagy plays a critical role in lens fiber cell maturation and the formation of the organelle free zone. Numerous studies delineating the role of Atg5, Vsp34 as well as FYCO1 in maintenance of lens transparency are discussed. Corneal endothelial dystrophies are also characterized as having elevated levels of autophagic proteins. Therefore, novel modulators of autophagy such as lithium and melatonin are proposed as new therapeutic strategies for this group of dystrophies. In addition, we summarize how corneal Herpes Simplex Virus (HSV-1) infection subverts the cornea's response to infection by inhibiting the normal autophagic response. Using glaucoma models we analyze the relative contribution of autophagy to cell death and cell survival. The cytoprotective role of autophagy is further discussed in an analysis of photoreceptor cell heath and function. We focus our analysis on the current understanding of autophagy in photoreceptor and RPE health, specifically on the diverse role of autophagy in rods and cones as well as its protective role in light induced degeneration. Lastly, in the RPE we highlight hybrid phagocytosis–autophagy pathways. This comprehensive review allows us to speculate on how alterations in various stages of autophagy contribute to glaucoma and retinal degenerations.

Lysosomal enzymes function optimally in acidic environments, and elevation of lysosomal pH can impede their ability to degrade material delivered to lysosomes through autophagy or phagocytosis. We hypothesize that abnormal lysosomal pH is a key aspect in diseases of accumulation and that restoring lysosomal pH will improve cell function. The propensity of nanoparticles to end up in the lysosome makes them an ideal method of delivering drugs to lysosomes. This study asked whether acidic nanoparticles could traffic to lysosomes, lower lysosomal pH and enhance lysosomal degradation by the cultured human retinal pigmented epithelial cell line ARPE-19. Acidic nanoparticles composed of poly (DL-lactide-co-glycolide) (PLGA) 502 H, PLGA 503 H and poly (DL-lactide) (PLA) colocalized to lysosomes of ARPE-19 cells within 60 min. PLGA 503 H and PLA lowered lysosomal pH in cells compromised by the alkalinizing agent chloroquine when measured 1 hr. after treatment, with acidification still observed 12 days later. PLA enhanced binding of Bodipy-pepstatin-A to the active site of cathepsin D in compromised cells. PLA also reduced the cellular levels of opsin and the lipofuscin-like autofluorescence associated with photoreceptor outer segments. These observations suggest the acidification produced by the nanoparticles was functionally effective. In summary, acid nanoparticles lead to a rapid and sustained lowering of lysosomal pH and improved degradative activity.

Daily, the retinal pigment epithelium (RPE) ingests a bolus of lipid and protein in the form of phagocytized photoreceptor outer segments (OS). The RPE, like the liver, expresses enzymes required for fatty acid oxidation and ketogenesis. This suggests that these pathways play a role in the disposal of lipids from ingested OS, as well as providing a mechanism for recycling metabolic intermediates back to the outer retina. In this study, we examined whether OS phagocytosis was linked to ketogenesis. We found increased levels of β-hydroxybutyrate (β-HB) in the apical medium following ingestion of OS by human fetal RPE and ARPE19 cells cultured on Transwell inserts. No increase in ketogenesis was observed following ingestion of oxidized OS or latex beads. Our studies further defined the connection between OS phagocytosis and ketogenesis in wild-type mice and mice with defects in phagosome maturation using a mouse RPE explant model. In explant studies, the levels of β-HB released were temporally correlated with OS phagocytic burst after light onset. In the <i>Mreg</i>^−/− mouse where phagosome maturation is delayed, there was a temporal shift in the release of β-HB. An even more pronounced shift in maximal β-HB production was observed in the <i>Abca4</i>^−/− RPE, in which loss of the ATP-binding cassette A4 transporter results in defective phagosome processing and accumulation of lipid debris. These studies suggest that FAO and ketogenesis are key to supporting the metabolism of the RPE and preventing the accumulation of lipids that lead to oxidative stress and mitochondrial dysfunction.

Bestrophinopathies, one of the most common forms of inherited macular degenerations, are caused by mutations in the BEST1 gene expressed in the retinal pigment epithelium (RPE). Both human and canine BEST1-linked maculopathies are characterized by abnormal accumulation of autofluorescent material within RPE cells and bilateral macular or multifocal lesions; however, the specific mechanism leading to the formation of these lesions remains unclear. We now provide an overview of the current state of knowledge on the molecular pathology of bestrophinopathies, and explore factors promoting formation of RPE-neuroretinal separations, using the first spontaneous animal model of BEST1-associated retinopathies, canine Best (cBest). Here, we characterize the nature of the autofluorescent RPE cell inclusions and report matching spectral signatures of RPE-associated fluorophores between human and canine retinae, indicating an analogous composition of endogenous RPE deposits in Best Vitelliform Macular Dystrophy (BVMD) patients and its canine disease model. This study also exposes a range of biochemical and structural abnormalities at the RPE-photoreceptor interface related to the impaired cone-associated microvillar ensheathment and compromised insoluble interphotoreceptor matrix (IPM), the major pathological culprits responsible for weakening of the RPE-neuroretina interactions, and consequently, formation of vitelliform lesions. These salient alterations detected at the RPE apical domain in cBest as well as in BVMD- and ARB-hiPSC-RPE model systems provide novel insights into the pathological mechanism of BEST1-linked disorders that will allow for development of critical outcome measures guiding therapeutic strategies for bestrophinopathies.

The retina is one of the most metabolically active tissues in the body and utilizes glucose to produce energy and intermediates required for daily renewal of photoreceptor cell outer segments. Glucose transporter 1 (GLUT1) facilitates glucose transport across outer blood retinal barrier (BRB) formed by the retinal pigment epithelium (RPE) and the inner BRB formed by the endothelium. We used conditional knockout mice to study the impact of reducing glucose transport across the RPE on photoreceptor and Müller glial cells. Transgenic mice expressing Cre recombinase under control of the Bestrophin1 ( Best1) promoter were bred with Glut1 flox/flox mice to generate Tg-Best1-Cre:Glut1 flox/flox mice ( RPEΔGlut1). The RPEΔGlut1 mice displayed a mosaic pattern of Cre expression within the RPE that allowed us to analyze mice with ~50% ( RPEΔGlut1 m ) recombination and mice with &gt;70% ( RPEΔGlut1 h ) recombination separately. Deletion of GLUT1 from the RPE did not affect its carrier or barrier functions, indicating that the RPE utilizes other substrates to support its metabolic needs thereby sparing glucose for the outer retina. RPEΔGlut1 m mice had normal retinal morphology, function, and no cell death; however, where GLUT1 was absent from a span of RPE greater than 100 µm, there was shortening of the photoreceptor cell outer segments. RPEΔGlut1 h mice showed outer segment shortening, cell death of photoreceptors, and activation of Müller glial cells. The severe phenotype seen in RPEΔGlut1 h mice indicates that glucose transport via the GLUT1 transporter in the RPE is required to meet the anabolic and catabolic requirements of photoreceptors and maintain Müller glial cells in a quiescent state.

Photoreceptor rod cells and blood platelets are remarkably different, yet both illustrate a similar phenomenon. Both are strongly affected by membrane cholesterol, and the distribution of cholesterol in the membranes of both cell types is determined by the lipid composition within the membranes. In rod cells, cholesterol strongly inhibits rhodopsin activity. The relatively higher level of cholesterol in the plasma membrane serves to inhibit, and thereby conserve, the activity of rhodopsin, which becomes fully active in the low-cholesterol environment of the disk membranes of these same cells. This physiologically important partitioning of cholesterol between disk membranes and plasma membranes occurs because the disk membranes are enriched with phosphatidylethanolamine, thus providing a thermodynamically unfavorable environment for the sterol. Cholesterol enrichment of platelets renders these cells more responsive to stimuli of aggregation. Stimuli for platelet aggregation cause a rapid transbilayer movement of cholesterol from the outer monolayer. This stimulus-dependent redistribution of cholesterol appears to result from the concomitant movement of phosphatidylethanolamine into the outer monolayer. The attractive, yet still unproven, hypothesis is that cholesterol translocation plays an important role in the overall platelet response and is intimately related to the sensitizing actions of cholesterol on these cells.

Rhodopsin, a prototypical G protein receptor, is found both in the plasma membrane and in discs of bovine rod outer segments. The ability of each of these membranes to activate phosphodiesterase upon stimulation by light in the presence of GTP and cGMP was investigated. The plasma membrane showed little or no activity when compared with disc membranes. The plasma membrane contains approximately 28 mol% cholesterol compared to 8 mol % found in discs. Upon oxidation of at least 70 % of the cholesterol in the plasma membrane to cholestenone, the phosphodiesterase activity in the plasma membrane approached that initiated by the disc membranes. When a 50:50 mixture of disc and plasma membrane rhodopsin was tested for phosphodiesterase activity, the results were found to be additive. Therefore, cholesterol is implicated in regulation of the receptor activity.

The photoreceptor rod outer segment (ROS) provides a unique system in which to investigate the role of cholesterol, an essential membrane constituent of most animal cells. The ROS is responsible for the initial events of vision at low light levels. It consists of a stack of disk membranes surrounded by the plasma membrane. Light capture occurs in the outer segment disk membranes that contain the photopigment, rhodopsin. These membranes originate from evaginations of the plasma membrane at the base of the outer segment. The new disks separate from the plasma membrane and progressively move up the length of the ROS over the course of several days. Thus the role of cholesterol can be evaluated in two distinct membranes. Furthermore, because the disk membranes vary in age it can also be investigated in a membrane as a function of the membrane age. The plasma membrane is enriched in cholesterol and in saturated fatty acids species relative to the disk membrane. The newly formed disk membranes have 6-fold more cholesterol than disks at the apical tip of the ROS. The partitioning of cholesterol out of disk membranes as they age and are apically displaced is consistent with the high PE content of disk membranes relative to the plasma membrane. The cholesterol composition of membranes has profound consequences on the major protein, rhodopsin. Biophysical studies in both model membranes and in native membranes have demonstrated that cholesterol can modulate the activity of rhodopsin by altering the membrane hydrocarbon environment. These studies suggest that mature disk membranes initiate the visual signal cascade more effectively than the newly synthesized, high cholesterol basal disks. Although rhodopsin is also the major protein of the plasma membrane, the high membrane cholesterol content inhibits rhodopsin participation in the visual transduction cascade. In addition to its effect on the hydrocarbon region, cholesterol may interact directly with rhodopsin. While high cholesterol inhibits rhodopsin activation, it also stabilizes the protein to denaturation. Therefore the disk membrane must perform a balancing act providing sufficient cholesterol to confer stability but without making the membrane too restrictive to receptor activation. Within a given disk membrane, it is likely that cholesterol exhibits an asymmetric distribution between the inner and outer bilayer leaflets. Furthermore, there is some evidence of cholesterol microdomains in the disk membranes. The availability of the disk protein, rom-1 may be sensitive to membrane cholesterol. The effects exerted by cholesterol on rhodopsin function have far-reaching implications for the study of G-protein coupled receptors as a whole. These studies show that the function of a membrane receptor can be modulated by modification of the lipid bilayer, particularly cholesterol. This provides a powerful means of fine-tuning the activity of a membrane protein without resorting to turnover of the protein or protein modification.

Hepes, 4-(2-hydroxyethyl)-l-piperazineethanesulfonic acid SUV, small unilamellar vesicles.

Abstract The Actinobacillus actinomycetemcomitans cytolethal distending toxin (Cdt) is a potent immunotoxin that induces G2 arrest in human lymphocytes. We now show that the CdtB subunit exhibits phosphatidylinositol (PI)-3,4,5-triphosphate phosphatase activity. Breakdown product analysis indicates that CdtB hydrolyzes PI-3,4,5-P3 to PI-3,4-P2 and therefore functions in a manner similar to phosphatidylinositol 5-phosphatases. Conserved amino acids critical to catalysis in this family of enzymes were mutated in the cdtB gene. The mutant proteins exhibit reduced phosphatase activity along with decreased ability to induce G2 arrest. Consistent with this activity, Cdt induces time-dependent reduction of PI-3,4,5-P3 in Jurkat cells. Lymphoid cells with defects in SHIP1 and/or ptase and tensin homolog deleted on chromosome 10 (PTEN) (such as Jurkat, CEM, Molt) and, concomitantly, elevated PI-3,4,5-P3 levels were more sensitive to the toxin than HUT78 cells which contain functional levels of both enzymes and low levels of PI-3,4,5-P3. Finally, reduction of Jurkat cell PI-3,4,5-P3 synthesis using the PI3K inhibitors, wortmannin and LY290004, protects cells from toxin-induced cell cycle arrest. Collectively, these studies show that the CdtB not only exhibits PI-3,4,5-P3 phosphatase activity, but also that toxicity in lymphocytes is related to this activity.

Lysosomes contribute to a multitude of cellular processes, and the pH of the lysosomal lumen plays a central mechanistic role in many of these functions. In addition to controlling the rate of enzymatic degradation for material delivered through autophagic or phagocytotic pathways, lysosomal pH regulates events such as lysosomal fusion with autophagosomes and the release of lysosomal calcium into the cytoplasm. Disruption of either the steady state lysosomal pH or of the regulated manipulations to lysosomal pH may be pathological. For example, chloroquine elevates the lysosomal pH of retinal pigmented epithelial (RPE) cells and triggers a retinopathy characterized by the accumulation of lipofuscin-like material in both humans and animals. Compensatory responses to restore lysosomal pH are observed; new data illustrate that chronic chloroquine treatment increases mRNA expression of the lysosomal/autophagy master transcription factor TcFEB and of the vesicular proton pump vHATPase in the RPE/choroid of mice. An elevated lysosomal pH with upregulation of TcFEB and vHATPase resembles the pathology in fibroblasts of patients with mutant presenilin 1 (PS1), suggesting a common link between age-related macular degeneration (AMD) and Alzheimer's disease. While the absolute rise in pH is often small in these disorders, elevations of only a few tenths of a pH unit can have a major impact on both lysosomal function and the accumulation of waste over decades. Accurate measurement of lysosomal pH can be complex, and imprecise measurements have clouded the field. Protocols to optimize pH measurement from fresh and cultured cells are discussed, and indirect measurements to confirm changes in lysosomal pH and degradative capacity are addressed. The ability of reacidifying treatments to restore degradative function confirms the central role of lysosomal pH in these disorders and identifies potential approaches to treat diseases of lysosomal accumulation like AMD and Alzheimer's disease. In summary, various approaches to determine lysosomal pH in fresh and cultured cells, as well as the potential to restore pH levels to an optimal range, can help identify and repair pathologies associated with lysosomal defects in RPE cells and perhaps also suggest new approaches to treat lysosomal storage diseases throughout the body.

This review summarizes the current status and recent advances in our understanding of the role that the cytolethal distending toxin (Cdt) plays as a virulence factor in promoting disease by toxin-producing pathogens. A major focus of this review is on the relationship between structure and function of the individual subunits that comprise the AB2 Cdt holotoxin. In particular, we concentrate on the molecular mechanisms that characterize this toxin and which account for the ability of Cdt to intoxicate multiple cell types by utilizing a ubiquitous binding partner on the cell membrane. Furthermore, we propose a paradigm shift for the molecular mode of action by which the active Cdt subunit, CdtB, is able to block a key signaling cascade and thereby lead to outcomes based upon programming and the role of the phosphatidylinositol 3-kinase (PI-3K) in a variety of cells. Based upon the collective Cdt literature, we now propose that Cdt is a unique and potent virulence factor capable of acting as a tri-perditious toxin that impairs host defenses by: 1) disrupting epithelial barriers; 2) suppressing acquired immunity; 3) promoting pro-inflammatory responses. Thus Cdt plays a key role in facilitating the early stages of infection and the later stages of disease progression by contributing to persistence and impairing host elimination.

ABSTRACT The cytolethal distending toxin (Cdt) is produced from a number of bacteria capable of causing infection and inflammatory disease. Our previous studies with Actinobacillus actinomycetemcomitans Cdt demonstrate not only that the active toxin subunit functions as a phosphatidylinositol-3,4,5-triphosphate (PIP3) phosphatase but also that macrophages exposed to the toxin were stimulated to produce proinflammatory cytokines. We now demonstrate that the Cdt-induced proinflammatory response involves the activation of the NLRP3 inflammasome. Specific inhibitors and short hairpin RNA (shRNA) were employed to demonstrate requirements for NLRP3 and ASC as well as caspase-1. Furthermore, Cdt-mediated inflammasome activation is dependent upon upstream signals, including reactive oxygen species (ROS) generation and Cdt-induced increases in extracellular ATP levels. Increases in extracellular ATP levels contribute to the activation of the P2X 7 purinergic receptor, leading to K + efflux. The relationship between the abilities of the active toxin subunit CdtB to function as a lipid phosphatase, activate the NLRP3 inflammasome, and induce a proinflammatory cytokine response is discussed. These studies provide new insight into the virulence potential of Cdt in mediating the pathogenesis of disease caused by Cdt-producing organisms such as Aggregatibacter actinomycetemcomitans .

Oxidative stress has been implicated in the pathogenesis of age-related macular degeneration, the leading cause of blindness in older adults, with retinal pigment epithelium (RPE) cells playing a key role. To better understand the cytotoxic mechanisms underlying oxidative stress, we used cell culture and mouse models of iron overload, as iron can catalyze reactive oxygen species formation in the RPE. Iron-loading of cultured induced pluripotent stem cell-derived RPE cells increased lysosomal abundance, impaired proteolysis and reduced the activity of a subset of lysosomal enzymes, including lysosomal acid lipase (LIPA) and acid sphingomyelinase (SMPD1). In a liver-specific Hepc (Hamp) knockout murine model of systemic iron overload, RPE cells accumulated lipid peroxidation adducts and lysosomes, developed progressive hypertrophy and underwent cell death. Proteomic and lipidomic analyses revealed accumulation of lysosomal proteins, ceramide biosynthetic enzymes and ceramides. The proteolytic enzyme cathepsin D (CTSD) had impaired maturation. A large proportion of lysosomes were galectin-3 (Lgals3) positive, suggesting cytotoxic lysosomal membrane permeabilization. Collectively, these results demonstrate that iron overload induces lysosomal accumulation and impairs lysosomal function, likely due to iron-induced lipid peroxides that can inhibit lysosomal enzymes.

Lipid processing by the retinal pigment epithelium (RPE) is necessary to maintain retinal health and function. Dysregulation of retinal lipid homeostasis due to normal aging or age-related disease triggers lipid accumulation within the RPE, on Bruch's membrane (BrM), and in the subretinal space. In its role as a hub for lipid trafficking into and out of the neural retina, the RPE packages a significant amount of lipid into lipid droplets for storage and into apolipoprotein B (APOB)-containing lipoproteins (Blps) for export. Microsomal triglyceride transfer protein (MTP), encoded by the MTTP gene, is essential for Blp assembly. Herein we test the hypothesis that MTP expression in the RPE is essential to maintain lipid balance and retinal function using the newly generated RPEΔMttp mouse model. Using non-invasive ocular imaging, electroretinography, and histochemical and biochemical analyses we show that genetic depletion of Mttp from the RPE results in intracellular lipid accumulation, increased photoreceptor-associated cholesterol deposits, and photoreceptor cell death, and loss of rod but not cone function. RPE-specific reduction in Mttp had no significant effect on plasma lipids and lipoproteins. While APOB was decreased in the RPE, most ocular retinoids remained unchanged, with the exception of the storage form of retinoid, retinyl ester. Thus suggesting that RPE MTP is critical for Blp synthesis and assembly but is not directly involved in plasma lipoprotein metabolism. These studies demonstrate that RPE-specific MTP expression is necessary to establish and maintain retinal lipid homeostasis and visual function.

Actinobacillus actinomycetemcomitans produces a leukotoxin (Ltx) that kills leukocyte function-associated antigen-1 (LFA-1)-bearing cells from man, the Great Apes and Old World monkeys. The unique specificity of Ltx for the beta2 integrin, LFA-1, suggests it is capable of providing insight into the pathogenic mechanisms of Ltx and other RTX toxins. Using the Jurkat T cell line and an LFA-1-deficient Jurkat mutant (Jbeta2.7) as models, we found the initial effect of Ltx is to elevate cytosolic Ca2+ [Ca2+]c, an event that is independent of the Ltx/LFA-1 interaction. [Ca2+]c increases initiate a series of events that involve the activation of calpain, talin cleavage, mobilization to, and subsequent clustering of, LFA-1 in cholesterol and sphingolipid-rich regions of the plasma membrane known as lipid rafts. The association of Ltx and LFA-1 within lipid rafts is essential for cell lysis. Jbeta2.7 cells fail to accumulate Ltx in their raft fractions and are not killed, while cholesterol depletion experiments demonstrate the necessity of raft integrity for Ltx function. We propose that toxin-induced Ca2+ fluxes mobilize LFA-1 to lipid rafts where it associates with Ltx. These findings suggest that Ltx utilizes the raft to stimulate an integrin signalling pathway that leads to apoptosis of target cells.

We have previously shown that Actinobacillus actinomycetemcomitans cytolethal-distending toxin (Cdt) is a potent immunosuppressive agent that induces G2/M arrest in human lymphocytes. In this study, we explored the possibility that Cdt-mediated immunotoxicity involves lipid membrane microdomains. We first determined that following treatment of Jurkat cells with Cdt holotoxin all three Cdt subunits localize to these microdomains. Laser confocal microscopy was employed to colocalize the subunits with GM1-enriched membrane regions which are characteristic of membrane rafts. Western blot analysis of isolated lipid rafts also demonstrated the presence of Cdt peptides. Cholesterol depletion, using methyl beta-cyclodextrin, protected cells from the ability of the Cdt holotoxin to induce G2 arrest. Moreover, cholesterol depletion reduced the ability of the toxin to associate with Jurkat cells. Thus, lipid raft integrity is vital to the action of Cdt on host cells. The implications of our observations with respect to Cdt mode of action are discussed.

Induction of cell cycle arrest in lymphocytes after exposure to the Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) is dependent upon the integrity of lipid membrane microdomains. In this study we further demonstrate that the association of Cdt with lymphocyte plasma membranes is dependent upon binding to cholesterol. Depletion of cholesterol resulted in reduced toxin binding, whereas repletion of cholesterol-depleted cells restored binding. We employed fluorescence resonance energy transfer and surface plasmon resonance to demonstrate that toxin association with model membranes is dependent upon the concentration of cholesterol; moreover, these interactions were cholesterol-specific as the toxin failed to interact with model membranes containing stigmasterol, ergosterol, or lanosterol. Further analysis of the toxin indicated that the CdtC subunit contains a cholesterol recognition/interaction amino acid consensus (CRAC) region. Mutation of the CRAC site resulted in decreased binding of the holotoxin to cholesterol-containing model membranes as well as to the surface of Jurkat cells. The mutant toxin also exhibited reduced capacity for intracellular transfer of the active toxin subunit, CdtB, as well as reduced toxicity. Collectively, these observations indicate that membrane cholesterol serves as an essential ligand for Cdt and that this association can be blocked by either depleting membranes of cholesterol or mutation of the CRAC site.

Binding of the talin-1 FERM (4.1/ezrin/radixin/moesin) domain to the β3 cytosolic tail causes activation of the integrin αIIbβ3. The FERM domain also binds to acidic phospholipids. Although much is known about the interaction of talin-1 with integrins and lipids, the relative contribution of each interaction to integrin regulation and possible synergy between them remain to be clarified. Here, we examined the thermodynamic interplay between FERM domain binding to phospholipid bilayers and to its binding sites in the β3 tail. We found that although both the F0F1 and F2F3 subdomains of the talin-1 FERM domain bind acidic bilayers, the full-length FERM domain binds with an affinity similar to F2F3, indicating that F0F1 contributes little to the overall interaction. When free in solution, the β3 tail has weak affinity for the FERM domain. However, appending the tail to acidic phospholipids increased its affinity for the FERM domain by three orders of magnitude. Nonetheless, the affinity of the FERM for the appended tail was similar to its affinity for binding to bilayers alone. Thus, talin-1 binding to the β3 tail is a ternary interaction dominated by a favorable surface interaction with phospholipid bilayers and set by lipid composition. Nonetheless, interactions between the FERM domain, the β3 tail, and lipid bilayers are not optimized for a high-affinity synergistic interaction, even at the membrane surface. Instead, the interactions appear to be tuned in such a way that the equilibrium between inactive and active integrin conformations can be readily regulated.

A main requisite in the phagocytosis of ingested material is a coordinated series of maturation steps which lead to the degradation of ingested cargo. Photoreceptor outer segment (POS) renewal involves phagocytosis of the distal disk membranes by the retinal pigment epithelium (RPE). Previously, we identified melanoregulin (MREG) as an intracellular cargo-sorting protein required for the degradation of POS disks. Here, we provide evidence that MREG-dependent processing links both autophagic and phagocytic processes in LC3-associated phagocytosis (LAP). Ingested POS phagosomes are associated with endogenous LC3 and MREG. The LC3 association with POSs exhibited properties of LAP; it was independent of rapamycin pretreatment, but dependent on Atg5. Loss of MREG resulted in a decrease in the extent of LC3-POS association. Studies using DQ-BSA suggest that loss of MREG does not compromise the association and fusion of LC3-positive phagosomes with lysosomes. Furthermore, the mechanism of MREG action is likely through a protein complex that includes LC3, as determined by colocalization and immunoprecipitation in both RPE cells and macrophages. We posit that MREG participates in coordinating the association of phagosomes with LC3 for content degradation with the loss of MREG leading to phagosome accumulation.

The Aggregatibactor actinomycetemcomitans cytolethal distending toxin (Cdt) induces G2 arrest and apoptosis in lymphocytes; these toxic effects are due to the active subunit, CdtB, which functions as a phosphatidylinositol-3,4,5-triphosphate (PIP3) phosphatase. We now extend our investigation and demonstrate that Cdt is able to perturb human macrophage function. THP-1- and monocyte-derived macrophages were found not to be susceptible to Cdt-induced apoptosis. Nonetheless, the toxin was capable of binding to macrophages and perturbing PI-3K signalling resulting in decreased PIP3 levels and reduced phosphorylation of Akt and GSK3β; these changes were accompanied by concomitant alterations in kinase activity. Exposure of monocytes and macrophages to Cdt resulted in pro-inflammatory cytokine production including increased expression and release of IL-1β, TNFα and IL-6. Furthermore, treatment of cells with either TLR-2, -3 or -4 agonists in the presence of Cdt resulted in an augmented pro-inflammatory response relative to agonist alone. GSK3β inhibitors blocked the Cdt-induced pro-inflammatory cytokine response suggesting a pivotal role for PI-3K blockade, concomitant decrease in GSK3β phosphorylation and increased kinase activity. Collectively, these studies provide new insight into the virulence potential of Cdt in mediating the pathogenesis of disease caused by Cdt-producing organisms.

<i>Aggregatibacter actinomycetemcomitans</i> produces a repeats-in-toxin (RTX) leukotoxin (LtxA) that selectively kills human immune cells. Binding of LtxA to its β₂ integrin receptor (lymphocyte function-associated antigen-1 (LFA-1)) results in the clustering of the toxin·receptor complex in lipid rafts. Clustering occurs only in the presence of LFA-1 and cholesterol, and LtxA is unable to kill cells lacking either LFA-1 or cholesterol. Here, the interaction of LtxA with cholesterol was measured using surface plasmon resonance and differential scanning calorimetry. The binding of LtxA to phospholipid bilayers increased by 4 orders of magnitude in the presence of 40% cholesterol relative to the absence of cholesterol. The affinity was specific to cholesterol and required an intact secondary structure. LtxA contains two cholesterol recognition/amino acid consensus (CRAC) sites; CRAC³³⁶ (³³³LEEYSKR³³⁹) is highly conserved among RTX toxins, whereas CRAC⁵⁰³ (⁵⁰¹VDYLK⁵⁰⁵) is unique to LtxA. A peptide corresponding to CRAC³³⁶ inhibited the ability of LtxA to kill Jurkat (Jn.9) cells. Although peptides corresponding to both CRAC³³⁶ and CRAC⁵⁰³ bind cholesterol, only CRAC³³⁶ competitively inhibited LtxA binding to this sterol. A panel of full-length LtxA CRAC mutants demonstrated that an intact CRAC³³⁶ site was essential for LtxA cytotoxicity. The conservation of CRAC³³⁶ among RTX toxins suggests that this mechanism may be conserved among RTX toxins. Background: A repeats-in-toxin (RTX) leukotoxin and its integrin receptor aggregate in cholesterol-rich lipid rafts. Results: The affinity of the toxin to cholesterol is driven by a cholesterol recognition/amino acid consensus (CRAC) motif. Conclusion: Leukotoxin cytotoxicity is regulated by the CRAC motif. Significance: Other RTX toxins contain this CRAC motif, suggesting a role for cholesterol recognition in RTX cytolysis.

There is increasing evidence documenting the critical role played by autophagic and autophagy-associated processes in maintaining cell homeostasis and overall systemic health. Autophagy is considered a degradative as well as a recycling pathway that relies on encapsulated intracellular components trafficking to and fusing with degradative compartments, including lysosomes. In this chapter, we describe the use of DQ™-BSA to study autophagosome–lysosome fusion as well as a means by which to analyze hybrid autophagic pathways. Such noncanonical pathways include LC3-associated phagocytosis, better known as LAP. Both autophagosomes and LAPosomes (LC3-associated phagosomes) deliver cargo for degradation. The use of fluorescent DQ™-BSA in conjugation with autophagic makers and biomarkers of hybrid autophagy offers a reliable technique to monitor the formation of autolysosomes and LAPo-lysosomes in both fixed- and live-cell studies. This technique relies on cleavage of the self-quenched DQ™ Green- or DQ™ Red BSA protease substrates in an acidic compartment to generate a highly fluorescent product.

Recently, we reported that oral-epithelial cells (OE) are unique in their response to Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) in that cell cycle arrest (G2/M) occurs without leading to apoptosis. We now demonstrate that Cdt-induced cell cycle arrest in OE has a duration of at least 7 days with no change in viability. Moreover, toxin-treated OE develops a new phenotype consistent with cellular senescence; this includes increased senescence-associated β-galactosidase (SA-β-gal) activity and accumulation of the lipopigment, lipofuscin. Moreover, the cells exhibit a secretory profile associated with cellular senescence known as the senescence-associated secretory phenotype (SASP), which includes IL-6, IL-8 and RANKL. Another unique feature of Cdt-induced OE senescence is disruption of barrier function, as shown by loss of transepithelial electrical resistance and confocal microscopic assessment of primary gingival keratinocyte structure. Finally, we demonstrate that Cdt-induced senescence is dependent upon the host cell protein cellugyrin, a homologue of the synaptic vesicle protein synaptogyrin. Collectively, these observations point to a novel pathogenic outcome in oral epithelium that we propose contributes to both A. actinomycetemcomitans infection and periodontal disease progression.

Peripherin/rds plays an essential role in the maintenance of photoreceptor rod cell disk membrane structure. The purification of this protein to homogeneity [Boesze-Battaglia, K., et al. (1997) Biochemistry 36, 6835−6846] has allowed us to characterize the functional role of peripherin/rds in the maintenance of rod outer segment (ROS) membrane fusion processes. Utilizing a cell-free fusion assay system, we report that the fusion of R18-labeled ROS plasma membrane (R18-PM) with disk membranes or peripherin/rds-enriched large unilammellar vesicles (LUVs) is inhibited upon trypsinolysis of peripherin/rds. To understand this phenomenon, we tested the ability of a series of overlapping synthetic C-terminal peripherin/rds peptides to mediate model membrane fusion. Within the 63 amino acid long region of the C-terminus, we identified a minimal 15 residue long amino acid sequence (PP-5), which is necessary to promote membrane fusion. PP-5 was able to inhibit R18-PM disk membrane fusion and promoted ANTS/DPX contents mixing in a pure vesicle system. This peptide (PP-5) promoted calcium-induced vesicle aggregation of phosphatidylethanolamine:phosphatidylserine LUVs. FTIR analysis confirmed the structural prediction of this peptide as α-helical. When modeled as an α-helix, this peptide is amphiphilic with a hydrophobicity index of 0.75 and a hydrophobic moment of 0.59. PP-5 has substantial biochemical and functional homology with other well-characterized membrane fusion proteins. These results demonstrate the necessity for peripherin/rds in ROS membrane fusion, specifically the requirement for an intact C-terminal region of this protein.

The retinal pigment epithelium-photoreceptor interphase is renewed each day in a stunning display of cellular interdependence. While photoreceptors use photosensitive pigments to convert light into electrical signals, the RPE supports photoreceptors in their function by phagocytizing shed photoreceptor tips, regulating the blood retina barrier, and modulating inflammatory responses, as well as regenerating the 11-cis-retinal chromophore via the classical visual cycle. These processes involve multiple protein complexes, tightly regulated ligand-receptors interactions, and a plethora of lipids and protein-lipids interactions. The role of lipids in maintaining a healthy interplay between the RPE and photoreceptors has not been fully delineated. In recent years, novel technologies have resulted in major advancements in understanding several facets of this interplay, including the involvement of lipids in phagocytosis and phagolysosome function, nutrient recycling, and the metabolic dependence between the two cell types. In this review, we aim to integrate the complex role of lipids in photoreceptor and RPE function, emphasizing the dynamic exchange between the cells as well as discuss how these processes are affected in aging and retinal diseases.

The initial events of visual transduction occur on disc membranes which are sequestered within the photoreceptor outer segment. In rod cells, the discs are stacked in the outer segment. Discs are formed at the base of the rod outer segment (ROS) from evaginations of the plasma membrane. As new discs form, older discs move toward the apical tip of the rod, from which they are eventually shed and subsequently phagocytosed by the adjacent pigment epithelium. Thus, disc membranes within a given rod cell are not of uniform age. We have recently shown that disc membranes are not homogeneous with respect to cholesterol content (Boesze-Battaglia, K., Hennessey, T., and Albert, A. D. (1989) J. Biol. Chem. 264, 8151-8155). In the present study, freshly isolated bovine retinas were incubated with [3H]leucine for 4 h in order to allow sufficient time for the radiolabeled proteins to become incorporated into the basal-most (newest) discs. Osmotically intact discs were then isolated. After the addition of digitonin, the discs were fractionated based on cholesterol content, and radioactivity (indicative of newly synthesized protein) was measured. Discs which exhibited high cholesterol content also exhibited high radio-activity. These results demonstrate that the cholesterol heterogeneity of ROS disc membranes is related to the age, and thus the position, of the discs in the ROS.

Time-resolved fluorescence anisotropy of the sterol analogue, cholestatrienol, and 13C nuclear magnetic resonance (NMR) spin lattice relaxation time (T1c) measurements of [13C4] labeled cholesterol were exploited to determine the correlation times characterizing the major modes of motion of cholesterol in unsonicated phospholipid multilamellar liposomes. Two modes of motion were found to be important: (a) rotational diffusion and (b) time dependence of the orientation of the director for axial diffusion, or "wobble." From the time-resolved fluorescence anisotropy decays of cholestatrienol in egg phosphatidylcholine (PC) bilayers, a value for tau perpendicular, the correlation time for wobble, of 0.9 x 10(-9) s and a value for S perpendicular, the order parameter characterizing the same motion, of 0.45 s were calculated. Both tau perpendicular and S perpendicular were relatively insensitive to temperature and cholesterol content of the membranes. The T1c measurements of [13C4] labeled cholesterol did not provide a quantitative determination of tau parallel, the correlation time for axial diffusion. T1c from the lipid hydrocarbon chains suggested a value for tau perpendicular similar to that for cholesterol. Steady-state anisotropy measurements and time-resolved anisotropy measurements of cholestatrienol were used to probe sterol behavior in a variety of pure and mixed lipid multilamellar liposomes. Both the lipid headgroups and the lipid hydrocarbons chains contributed to the determination of the sterol environment in the membrane, as revealed by these fluorescence measurements. In particular, effects of the phosphatidylethanolamine (PE) headgroup and of multiple unsaturation in the lipid hydrocarbon chains were observed. However, while the steady-state anisotropy was sensitive to these factors, the time-resolved fluorescence analysis indicated that tau perpendicular was not strongly affected by the lipid composition of the membrane. S perpendicular may be increased by the presence of PE. Both steady-state anisotropy measurements and time-resolved anisotropy measurements of cholestatrienol were used to probe sterol behavior in three biological membranes: bovine rod outer segment (ROS) disk membranes, human erythrocyte plasma membranes, and light rabbit muscle sarcoplasmic reticulum membranes. In the ROS disk membranes the value for S perpendicular was marginally higher than in the PC membranes, perhaps reflecting the influence of PE. The dramatic difference noted was in the value for tau perpendicular. In both the ROS disk membranes and the erythrocyte membranes, tau perpendicular was one-third to one-fifth of tau perpendicular in the phospholipid bilayers. This result may reveal an influence of membrane proteins on sterol behavior.

Like other neurons, retinal cells utilize autophagic pathways to maintain cell homeostasis. The mammalian retina relies on heterophagy and selective autophagy to efficiently degrade and metabolize ingested lipids with disruption in autophagy associated degradation contributing to age related retinal disorders. The retinal pigment epithelium (RPE) supports photoreceptor cell renewal by daily phagocytosis of shed photoreceptor outer segments (OS). The daily ingestion of these lipid-rich OS imposes a constant degradative burden on these terminally differentiated cells. These cells rely on Microtubule-Associated Protein 1 Light Chain 3 (LC3) family of proteins for phagocytic clearance of the ingested OS. The LC3 family comprises of three highly homologous members, MAP1LC3A (LC3A), MAP1LC3B (LC3B) and MAP1LC3C (LC3C). The purpose of this study was to determine whether the LC3B isoform plays a specific role in maintaining RPE lipid homeostasis. We examined the RPE and retina of the LC3B-/- mouse as a function of age using in vivo ocular imaging and electroretinography coupled with ex vivo, lipidomic analyses of lipid mediators, assessment of bisretinoids as well as imaging of lipid aggregates. Deletion of LC3B resulted in defects within the RPE including increased phagosome accumulation, decreased fatty acid oxidation and a subsequent increase in RPE and sub-RPE lipid deposits. Age-dependent RPE changes included elevated levels of oxidized cholesterol, deposition of 4-HNE lipid peroxidation products, bisretinoid lipofuscin accumulation, and subretinal migration of microglia, collectively likely contributing to loss of retinal function. These observations are consistent with a critical role for LC3B-dependent processes in the maintenance of normal lipid homeostasis in the aging RPE, and suggest that LC3 isoform specific disruption in autophagic processes contribute to AMD-like pathogenesis.

The rod outer segment (ROS) of retinal photoreceptor cells consists of disk membranes surrounded by the plasma membrane. It is a relatively uncomplicated system in which to investigate cholesterol distribution and its functional consequences in biologically relevant membranes. The light sensitive protein, rhodopsin is the major protein in both membranes, but the lipid compositions are significantly different in the disk and plasma membranes. Cholesterol is high in the ROS plasma membrane. Disk membranes are synthesized at the base of the ROS and are also high in cholesterol. However, cholesterol is rapidly depleted as the disks are apically displaced. During this apical displacement the disk phospholipid fatty acyl chains become progressively more unsaturated, which creates an environment unfavorable to cholesterol. Membrane cholesterol has functional consequences. The high cholesterol found in the plasma membrane and in newly synthesized disks inhibits the activation of rhodopsin. As disks are apically displaced and cholesterol is depleted rhodopsin becomes more responsive to light. This effect of cholesterol on rhodopsin activation has been shown in both native and reconstituted membranes. The modulation of activity can be at least partially explained by the effect of cholesterol on bulk lipid properties. Cholesterol decreases the partial free volume of the hydrocarbon region of the bilayer and thereby inhibits rhodopsin conformational changes required for activation. However, cholesterol binds to rhodopsin and may directly affect the protein also. Furthermore, cholesterol stabilizes rhodopsin to thermal denaturation. The membrane must provide an environment that allows rhodopsin conformational changes required for activation while also stabilizing the protein to thermal denaturation. Cholesterol thus plays a complex role in modulating the activity and stability of rhodopsin, which have implications for other G-protein coupled receptors.

Cell migration and extracellular matrix remodeling underlie normal mammalian development and growth as well as pathologic tumor invasion. Skeletal muscle is no exception, where satellite cell migration replenishes nuclear content in damaged tissue and extracellular matrix reforms during regeneration. A key set of enzymes that regulate these processes are matrix metalloproteinases (MMP)s. The collagenase MMP-13 is transiently upregulated during muscle regeneration, but its contribution to damage resolution is unknown. The purpose of this work was to examine the importance of MMP-13 in muscle regeneration and growth in vivo and to delineate a satellite cell specific role for this collagenase.Mice with total and satellite cell specific Mmp13 deletion were utilized to determine the importance of MMP-13 for postnatal growth, regeneration after acute injury, and in chronic injury from a genetic cross with dystrophic (mdx) mice. We also evaluated insulin-like growth factor 1 (IGF-1) mediated hypertrophy in the presence and absence of MMP-13. We employed live-cell imaging and 3D migration measurements on primary myoblasts obtained from these animals. Outcome measures included muscle morphology and function.Under basal conditions, Mmp13-/- mice did not exhibit histological or functional deficits in muscle. However, following acute injury, regeneration was impaired at 11 and 14 days post injury. Muscle hypertrophy caused by increased IGF-1 was blunted with minimal satellite cell incorporation in the absence of MMP-13. Mmp13-/- primary myoblasts displayed reduced migratory capacity in 2D and 3D, while maintaining normal proliferation and differentiation. Satellite cell specific deletion of MMP-13 recapitulated the effects of global MMP-13 ablation on muscle regeneration, growth and myoblast movement.These results show that satellite cells provide an essential autocrine source of MMP-13, which not only regulates their migration, but also supports postnatal growth and resolution of acute damage.

Late-onset retinal degeneration (L-ORD) is an autosomal dominant disorder caused by a missense substitution in CTRP5. Distinctive clinical features include sub-retinal pigment epithelium (RPE) deposits, choroidal neovascularization, and RPE atrophy. In induced pluripotent stem cells-derived RPE from L-ORD patients (L-ORD-iRPE), we show that the dominant pathogenic CTRP5 variant leads to reduced CTRP5 secretion. In silico modeling suggests lower binding of mutant CTRP5 to adiponectin receptor 1 (ADIPOR1). Downstream of ADIPOR1 sustained activation of AMPK renders it insensitive to changes in AMP/ATP ratio resulting in defective lipid metabolism, reduced Neuroprotectin D1(NPD1) secretion, lower mitochondrial respiration, and reduced ATP production. These metabolic defects result in accumulation of sub-RPE deposits and leave L-ORD-iRPE susceptible to dedifferentiation. Gene augmentation of L-ORD-iRPE with WT CTRP5 or modulation of AMPK, by metformin, re-sensitize L-ORD-iRPE to changes in cellular energy status alleviating the disease cellular phenotypes. Our data suggests a mechanism for the dominant behavior of CTRP5 mutation and provides potential treatment strategies for L-ORD patients.

This study reports the isolation and characterization of a Triton X-100-resistant membrane fraction from homogenates of rod outer segment (ROS) disk membranes purified free of the surrounding plasma membrane. A portion of the ROS disk membrane was found to be resistant to Triton X-100 extraction at 4 °C. This detergent-resistant fraction was isolated as a low buoyant density band on sucrose density gradients and exhibited an increase in light scattering detected at 600 nm. Biochemical analysis of the Triton X-100-resistant fraction showed it to be enriched in cholesterol and sphingomyelin relative to phospholipid and in phospholipid relative to protein compared with the soluble fraction. The Triton X-100-resistant membranes described herein did not arise simply from partial solubilization of the ROS disk membranes because detergent-treated low buoyant density fractions isolated from homogenates with octyl glucopyranoside had cholesterol and sphingomyelin content indistinguishable from that of solubilized ROS disk homogenates. Analysis of proteins associated with the Triton X-100-resistant fraction showed it to be enriched in the rim-specific protein ROM-1 and caveolin; surprisingly, the fusion protein peripherin/rds (where rds is retinal degeneration slow), also localized to the disk rim, was entirely absent from the membrane raft domain. The lipid profiles of the Triton X-100-resistant membranes were virtually identical in preparations homogenized in either the light or dark. Slightly more ROM-1 was recovered from samples prepared in the light (23%) than from samples prepared in the dark (13%), but peripherin/rds could not be detected in either preparation. When the Triton X-100-resistant membranes were treated with methyl-β-cyclodextran to deplete membrane cholesterol, the resultant membranes contained slightly lower levels of ROM-1, specifically in the dimeric form. Cholesterol depletion also resulted in the collapse of the large caveolin complex to monomeric caveolae. The results presented herein characterize a pool of ROM-1, a photoreceptor tetraspanin protein, that may play a regulatory role in peripherin/rds-dependent fusion.

The light sensor of vertebrate scotopic (low-light) vision, rhodopsin, is a G-protein-coupled receptor comprising a polypeptide chain with bound chromophore, 11-cis-retinal, that exhibits remarkable physicochemical properties. This photopigment is extremely stable in the dark, yet its chromophore isomerises upon photon absorption with 70% efficiency, enabling the activation of its G-protein, transducin, with high efficiency. Rhodopsin's photochemical and biochemical activities occur over very different time-scales: the energy of retinaldehyde's excited state is stored in <1 ps in retinal-protein interactions, but it takes milliseconds for the catalytically active state to form, and many tens of minutes for the resting state to be restored. In this review, we describe the properties of rhodopsin and its role in rod phototransduction. We first introduce rhodopsin's gross structural features, its evolution, and the basic mechanisms of its activation. We then discuss light absorption and spectral sensitivity, photoreceptor electrical responses that result from the activity of individual rhodopsin molecules, and recovery of rhodopsin and the visual system from intense bleaching exposures. We then provide a detailed examination of rhodopsin's molecular structure and function, first in its dark state, and then in the active Meta states that govern its interactions with transducin, rhodopsin kinase and arrestin. While it is clear that rhodopsin's molecular properties are exquisitely honed for phototransduction, from starlight to dawn/dusk intensity levels, our understanding of how its molecular interactions determine the properties of scotopic vision remains incomplete. We describe potential future directions of research, and outline several major problems that remain to be solved.

The effect of cholesterol on rhodopsin stability has been investigated in intact disk membranes. Because cholesterol readily equilibrates between membranes, the disk membrane cholesterol content can be altered by incubation with cholesterol/phospholipid vesicles. The effect of membrane cholesterol on rhodopsin was investigated using three independent techniques: thermal bleaching, differential scanning calorimetry (DSC) and activation of the cGMP cascade. Rhodopsin exhibited an increased resistance to thermally induced bleaching as the membrane cholesterol level was increased. DSC also indicated that the protein is stabilized by cholesterol in that the Tm increased in response to higher membrane cholesterol. A similar degree of stabilization was observed in both the unbleached and bleached states in the DSC experiments. These results suggest that cholesterol affects the disk membrane properties such that thermally induced unfolding is inhibited, thus stabilizing the rhodopsin structure. Furthermore, high membrane cholesterol inhibited the activation of the cGMP cascade. This is consistent with the stabilization of the metarhodopsin I photointermediate relative to the metarhodopsin II intermediate.

Melanoregulin (MREG), the product of the Mreg(dsu) gene, is a small highly charged protein, hypothesized to play a role in organelle biogenesis due to its effect on pigmentation in dilute, ashen, and leaden mutant mice. Here we provide evidence that MREG is required in lysosome-dependent phagosome degradation. In the Mreg(-/-) mouse, we show that loss of MREG function results in phagosome accumulation due to delayed degradation of engulfed material. Over time, the Mreg(-/-) mouse retinal pigment epithelial cells accumulate the lipofuscin component, A2E. MREG-deficient human and mouse retinal pigment epithelial cells exhibit diminished activity of the lysosomal hydrolase, cathepsin D, due to defective processing. Moreover, MREG localizes to small intracellular vesicles and associates with the endosomal phosphoinositide, phosphatidylinositol 3,5-biphosphate. Collectively, these studies suggest that MREG is required for lysosome maturation and support a role for MREG in intracellular trafficking.

J. Neurochem. (2012) 122 , 823–833. Abstract: Optimal neuronal activity requires that supporting cells provide both efficient nutrient delivery and waste disposal. The incomplete processing of engulfed waste by their lysosomes can lead to accumulation of residual material and compromise their support of neurons. As most degradative lysosomal enzymes function best at an acidic pH, lysosomal alkalinization can impede enzyme activity and increase lipofuscin accumulation. We hypothesize that treatment to reacidify compromised lysosomes can enhance degradation. Here, we demonstrate that degradation of ingested photoreceptor outer segments by retinal pigmented epithelial cells is increased by stimulation of D5 dopamine receptors. D1/D5 receptor agonists reacidified lysosomes in cells alkalinized by chloroquine or tamoxifen, with acidification dependent on protein kinase A. Knockdown with siRNA confirmed acidification was mediated by the D5 receptor. Exposure of cells to outer segments increased lipofuscin‐like autofluorescence, but SKF 81297 reduced autofluorescence. Likewise, SKF 81297 increased the activity of lysosomal protease cathepsin D in situ . D5DR stimulation also acidified lysosomes of retinal pigmented epithelial cells from elderly ABCA4 −/− mice, a model of recessive Stargardt’s retinal degeneration. In conclusion, D5 receptor stimulation lowers compromised lysosomal pH, enhancing degradation. The reduced accumulation of lipofuscin‐like autofluorescence implies the D5 receptor stimulation may enable cells to better support adjacent neurons.

The Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) induces G2 arrest and apoptosis in lymphocytes and other cell types. We have shown that the active subunit, CdtB, exhibits phosphatidylinositol-3,4,5-triphosphate (PIP3) phosphatase activity, leading us to propose that Cdt toxicity is the result of PIP3 depletion and perturbation of phosphatidylinositol-3-kinase (PI-3K)/PIP3/Akt signalling. To further explore this relationship, we have focused our analysis on identifying residues that comprise the catalytic pocket and are critical to substrate binding rather than catalysis. In this context, we have generated several CdtB mutants and demonstrate that, in each instance, the ability of the toxin to induce cell cycle arrest correlates with retention of phosphatase activity. We have also assessed the effect of Cdt on downstream components of the PI-3K signalling pathway. In addition to depletion of intracellular concentrations of PIP3, toxin-treated lymphocytes exhibit decreases in pAkt and pGSK3β. Further analysis indicates that toxin-treated cells exhibit a concomitant loss in Akt activity and increase in GSK3β kinase activity consistent with observed changes in their phosphorylation status. We demonstrate that cell susceptibility to Cdt is dependent upon dephosphorylation and concomitant activation of GSK3β. Finally, we demonstrate that, in addition to lymphocytes, HeLa cells exposed to a CdtB mutant that retains phosphatase activity and not DNase activity undergo G2 arrest in the absence of H2AX phosphorylation. Our results provide further insight into the mode of action by which Cdt may function as an immunotoxin and induce cell cycle arrest in target cells such as lymphocytes.

The multifunctional role of lipids as structural components of membranes, signaling molecules, and metabolic substrates makes them an ideal partner for pathogens to hijack host cell processes for their own survival. The properties and composition of unique membrane micro-domains such as membrane rafts make these regions a natural target for pathogens as it affords them an opportunity to hijack cell signaling and intracellular trafficking pathways. Cytolethal distending toxins (Cdts), members of the AB2 family of toxins are comprised of three subunits, the active, CdtB unit, and the binding, CdtA-CdtC unit. Cdts are cyclomodulins leading to cell cycle arrest and apoptosis in a wide variety of cell types. Cdts from several species share a requirement for membrane rafts, and often cholesterol specifically for cell binding and CdtB mediated cytotoxicity. In this review we focus on how host-cell membrane bilayer organization contributes to the cell surface association, internalization, and action of bacteria derived cytolethal distending toxins (Cdts), with an emphasis on Aggregatibacter actinomycetemcomitans Cdt.

Summary The leukotoxin (LtxA) produced by Aggregatibacter actinomycetemcomitans kills host immune cells, allowing the bacterium to establish an ecological niche in the upper aerodigestive tract of its human host. The interaction of LtxA with human immune cells is both complex and multifaceted, involving membrane lipids as well as cell‐surface proteins. In the initial encounter with the host cell, LtxA associates with lymphocyte function‐associated antigen‐1, a cell surface adhesion glycoprotein. However, we have also demonstrated that the toxin associates strongly with the plasma membrane lipids, specifically cholesterol. This association with cholesterol is regulated by a cholesterol recognition amino acid consensus (CRAC) motif, with a sequence of 334 LEEYSKR 340 , in the N‐terminal region of the toxin. Here, we have demonstrated that removal of cholesterol from the plasma membrane or mutation of the LtxA CRAC motif inhibits the activity of the toxin in THP‐1 cells. To inhibit LtxA activity, we designed a short peptide corresponding to the CRAC 336 motif of LtxA (CRAC 336WT ). This peptide binds to cholesterol and thereby inhibits the toxicity of LtxA in THP‐1 cells. Previously, we showed that this peptide inhibits LtxA toxicity against Jn.9 (Jurkat) cells, indicating that peptides derived from the cholesterol‐binding site of LtxA may have a potential clinical applicability in controlling infections of repeats‐in‐toxin‐producing organisms.

Cross-reactions between innate immunity, lysosomal function, and purinergic pathways may link signaling systems in cellular pathologies. We found activation of toll-like receptor 3 (TLR3) triggers lysosomal ATP release from both astrocytes and retinal pigmented epithelial (RPE) cells. ATP efflux was accompanied by lysosomal acid phosphatase and beta hexosaminidase release. Poly(I:C) alkalinized lysosomes, and lysosomal alkalization with bafilomycin or chloroquine triggered ATP release. Lysosomal rupture with glycyl-L-phenylalanine-2-naphthylamide (GPN) eliminated both ATP and acid phosphatase release. Secretory lysosome marker LAMP3 colocalized with VNUT, while MANT-ATP colocalized with LysoTracker. Unmodified membrane-impermeant 21-nt and "non-targeting" scrambled 21-nt siRNA triggered ATP and acid phosphatase release, while smaller 16-nt RNA was ineffective. Poly(I:C)-dependent ATP release was reduced by TBK-1 block and in TRPML1-/- cells, while TRPML activation with ML-SA1 was sufficient to release both ATP and acid phosphatase. The ability of poly(I:C) to raise cytoplasmic Ca2+ was abolished by removing extracellular ATP with apyrase, suggesting ATP release by poly(I:C) increased cellular signaling. Starvation but not rapamycin prevented lysosomal ATP release. In summary, stimulation of TLR3 triggers lysosomal alkalization and release of lysosomal ATP through activation of TRPML1; this links innate immunity to purinergic signaling via lysosomal physiology, and suggests even scrambled siRNA can influence these pathways.

Age-related macular degeneration (AMD) is a complex disease with increasing numbers of individuals being afflicted and treatment modalities limited. There are strong interactions between diet, age, the metabolome, and gut microbiota, and all of these have roles in the pathogenesis of AMD. Communication axes exist between the gut microbiota and the eye, therefore, knowing how the microbiota influences the host metabolism during aging could guide a better understanding of AMD pathogenesis. While considerable experimental evidence exists for a diet-gut-eye axis from murine models of human ocular diseases, human diet-microbiome-metabolome studies are needed to elucidate changes in the gut microbiome at the taxonomic and functional levels that are functionally related to ocular pathology. Such studies will reveal new ways to diminish risk for progression of- or incidence of- AMD. Current data suggest that consuming diets rich in dark fish, fruits, vegetables, and low in glycemic index are most retina-healthful during aging.

Visual transduction begins with the detection of light within the photoreceptor cell layer of the retina. Within this layer, specialized cells, termed rods and cones, contain the proteins responsible for light capture and its transduction to nerve impulses. The phototransductive proteins reside within an outer segment region that is connected to an inner segment by a thin stalk rich in cytoskeletal elements. A unique property of the outer segments is the presence of an elaborate intracellular membrane system that holds the phototransduction proteins and provides the requisite lipid environment. The maintenance of normal physiological function requires that these postmitotic cells retain the unique structure of the outer segment regions—stacks of membrane saccules in the case of rods and a continuous infolding of membrane in the case of cones. Both photoreceptor rod and cone cells achieve this through a series of coordinated steps. As new membranous material is synthesized, transported, and incorporated into newly forming outer segment membranes, a compensatory shedding of older membranous material occurs, thereby maintaining the segment at a constant length. These processes are collectively referred to as ROS (rod outer segment) or COS (cone outer segment) renewal. We review the cellular and molecular events responsible for these renewal processes and present the recent but compelling evidence, drawn from molecular genetic, biochemical, and biophysical approaches, pointing to an essential role for a unique tetraspanning membrane protein, called peripherin/rds, in the processes of disk morphogenesis.

Aggregatibacter actinomycetemcomitans, a common inhabitant of the human upper aerodigestive tract, produces a repeat in toxin (RTX), leukotoxin (LtxA). The LtxA is transcribed as a 114-kDa inactive protoxin with activation being achieved by attachment of short chain fatty acyl groups to internal lysine residues. Methyl esters of LtxA that were isolated from A. actinomycetemcomitans strains JP2 and HK1651 and subjected to gas chromatography/mass spectrometry contained palmitoyl (C16:0, 27–29%) and palmitolyl (C16:1 cis Δ9, 43–44%) fatty acyl groups with smaller quantities of myristic (C14:0, 14%) and stearic (C18:0, 12–14%) fatty acids. Liquid chromatography/mass spectrometry of tryptic peptides from acylated and unacylated recombinant LtxA confirmed that Lys562 and Lys687 are the sites of acyl group attachment. During analysis of recombinant LtxA peptides, we observed peptide spectra that were not observed as part of the RTX acylation schemes of either Escherichia coliα-hemolysin or Bordetella pertussis cyclolysin. Mass calculations of these spectra suggested that LtxA was also modified by the addition of monohydroxylated forms of C14 and C16 acyl groups. Multiple reaction monitoring mass spectrometry identified hydroxymyristic and hydroxypalmitic acids in wild-type LtxA methyl esters. Single or tandem replacement of Lys562 and Lys687 with Arg blocks acylation, resulting in a >75% decrease in cytotoxicity when compared with wild-type toxin, suggesting that these post-translational modifications are playing a critical role in LtxA-mediated target cell cytotoxicity.

A homozygous mutation in STK38L in dogs impairs the late phase of photoreceptor development, and is followed by photoreceptor cell death (TUNEL) and proliferation (PCNA, PHH3) events that occur independently in different cells between 7–14 weeks of age. During this period, the outer nuclear layer (ONL) cell number is unchanged. The dividing cells are of photoreceptor origin, have rod opsin labeling, and do not label with markers specific for macrophages/microglia (CD18) or Müller cells (glutamine synthetase, PAX6). Nestin labeling is absent from the ONL although it labels the peripheral retina and ciliary marginal zone equally in normals and mutants. Cell proliferation is associated with increased cyclin A1 and LATS1 mRNA expression, but CRX protein expression is unchanged. Coincident with photoreceptor proliferation is a change in the photoreceptor population. Prior to cell death the photoreceptor mosaic is composed of L/M- and S-cones, and rods. After proliferation, both cone types remain, but the majority of rods are now hybrid photoreceptors that express rod opsin and, to a lesser extent, cone S-opsin, and lack NR2E3 expression. The hybrid photoreceptors renew their outer segments diffusely, a characteristic of cones. The results indicate the capacity for terminally differentiated, albeit mutant, photoreceptors to divide with mutations in this novel retinal degeneration gene.

The Gram-negative bacterium, Aggregatibacter actinomycetemcomitans, is a common inhabitant of the human upper aerodigestive tract. The organism produces an RTX (Repeats in ToXin) toxin (LtxA) that kills human white blood cells. LtxA is believed to be a membrane-damaging toxin, but details of the cell surface interaction for this and several other RTX toxins have yet to be elucidated. Initial morphological studies suggested that LtxA was bending the target cell membrane. Because the ability of a membrane to bend is a function of its lipid composition, we assessed the proficiency of LtxA to release of a fluorescent dye from a panel of liposomes composed of various lipids. Liposomes composed of lipids that form nonlamellar phases were susceptible to LtxA-induced damage while liposomes composed of lipids that do not form non-bilayer structures were not. Differential scanning calorimetry demonstrated that the toxin decreased the temperature at which the lipid transitions from a bilayer to a nonlamellar phase, while 31P nuclear magnetic resonance studies showed that the LtxA-induced transition from a bilayer to an inverted hexagonal phase occurs through the formation of an isotropic intermediate phase. These results indicate that LtxA cytotoxicity occurs through a process of membrane destabilization.

ABSTRACT Porphyromonas gingivalis is a keystone pathogen that contributes to periodontal pathogenesis by disrupting host-microbe homeostasis and promoting dysbiosis. The virulence of P. gingivalis likely reflects an alteration in the lipid A composition of its lipopolysaccharide (LPS) from the penta-acylated ( Pg LPS 1690 ) to the tetra-acylated ( Pg LPS 1435/1449 ) form. Mast cells play an important role in periodontitis, but the mechanisms of their activation and regulation remain unknown. The expression of epithelium- and neutrophil-derived host defense peptides (HDPs) (LL-37 and human β-defensin-3), which activate mast cells via Mas-related G protein-coupled receptor X2 (MRGPRX2), is increased in periodontitis. We found that MRGPRX2-expressing mast cells are present in normal gingiva and that their numbers are elevated in patients with chronic periodontitis. Furthermore, HDPs stimulated degranulation in a human mast cell line (LAD2) and in RBL-2H3 cells stably expressing MRGPRX2 (RBL-MRGPRX2). Pg LPS 1690 caused substantial inhibition of HDP-induced mast cell degranulation, but Pg LPS 1435/1449 had no effect. A fluorescently labeled HDP (FAM-LL-37) bound to RBL-MRGPRX2 cells, and Pg LPS 1690 inhibited this binding, but Pg LPS 1435/1449 had no effect. These findings suggest that low-level inflammation induced by HDP/MRGPRX2-mediated mast cell degranulation contributes to gingival homeostasis but that sustained inflammation due to elevated levels of both HDPs and MRGPRX2-expressing mast cells promotes periodontal disease. Furthermore, differential regulation of HDP-induced mast cell degranulation by Pg LPS 1690 and Pg LPS 1435/1449 may contribute to the modulation of disease progression.

Autophagy is a catabolic self-degradative pathway that promotes the degradation and recycling of intracellular material through the lysosomal compartment. Although first believed to function in conditions of nutritional stress, autophagy is emerging as a critical cellular pathway, involved in a variety of physiological and pathophysiological processes. Autophagy dysregulation is associated with an increasing number of diseases, including ocular diseases. On one hand, mutations in autophagy-related genes have been linked to cataracts, glaucoma, and corneal dystrophy; on the other hand, alterations in autophagy and lysosomal pathways are a common finding in essentially all diseases of the eye. Moreover, LC3-associated phagocytosis, a form of non-canonical autophagy, is critical in promoting visual cycle function. This review collects the latest understanding of autophagy in the context of the eye. We will review and discuss the respective roles of autophagy in the physiology and/or pathophysiology of each of the ocular tissues, its diurnal/circadian variation, as well as its involvement in diseases of the eye.

During endochondral ossification, growth plate chondrocytes release plasma membrane (PM) derived matrix vesicles (MV), which are the site of initial hydroxyapatite crystal formation. MV constituents which facilitate the mineralization process include the integral membrane ectoenzymes alkaline phosphatase (ALPase) and nucleotide pyrophosphatase phosphodiesterase (NPP1/PC-1), along with a phosphatidylserine- (PS-) rich membrane surface that binds annexins and calcium, resulting in enhanced calcium entry into MV. In this study, we determined that chick growth plate MV were highly enriched in membrane raft microdomains containing high levels of cholesterol, glycophosphatidylinositol- (GPI-) anchored ALPase, and phosphatidylserine (PS) localized to the external leaflet of the bilayer. To determine how such membrane microdomains arise during chondrocyte maturation, we explored the role of PM cholesterol-dependent lipid assemblies in regulating the activities of lipid translocators involved in the externalization of PS. We first isolated and determined the composition of detergent-resistant membranes (DRMs) from chondrocyte PM. DRMs isolated from chondrocyte PM were enhanced in ganglioside 1 (GM1) and cholesterol as well as GPI-anchored ALPase. Furthermore, these membrane domains were enriched in PS (localized to the external leaflet of the bilayer) and had significantly higher ALPase activity than non-cholesterol-enriched domains. To understand the role of cholesterol-dependent lipid assemblies in the externalization of PS, we measured the activities of two lipid transporters involved in PS externalization, aminophospholipid translocase (APLT) and phospholipid scramblase (PLSCR1), during maturation of a murine chondrocytic cell line, N1511. In this report, we provide the first evidence that maturing chondrocytes express PLSCR1 and have scramblase activity. We propose that redistribution of PS is dependent on an increase in phospholipid scramblase activity and a decrease in APLT activity. Lastly, we show that translocator activity is most likely to be modulated by membrane cholesterol levels through a membrane raft microdomain.

Peripherin-2, the product of the rds gene, is a tetraspanin protein. In this study, we show that peripherin-2 forms a complex with melanoregulin (MREG), the product of the Mreg locus. Genetic studies suggest that MREG is involved in organelle biogenesis. In this study, we explore the role of this protein in processes associated with the formation of disk membranes, specialized organelles of photoreceptor rod cells. MREG antibodies were generated and found to be immunoreactive with a 28 kDa protein in retinal extracts, bovine OS, ARPE-19 cells, and rat RPE. MREG colocalized with peripherin-2 in WT (CB6F1/J) and in rds+/− retinas. Western blots of serial tangential sections confirmed the close association of these two proteins within the IS and basal outer segment of rods. Immunoprecipitation (IP) of OS extracts showed formation of a complex between MREG and peripherin-2−ROM-1 hetero-oligomers. This interaction was confirmed with pulldown analyses in which the GST−PerCter protein selectively pulled down His-MREG and His-MREG selectively pulled down PerCter. Biacore analysis using peptide inhibitors and per-2 truncation mutant studies allowed us to map the MREG binding site on per-2 to the last five residues of the C-terminus (Gln341−Gly346), and kinetic data predicted a KD of 80 nM for PerCter−MREG binding. Finally, the effect of MREG on photoreceptor specific membrane fusion was assayed using a disk−plasma membrane cell free assay. Preincubation of target membranes with MREG resulted in a dose-dependent inhibition of fusion with an IC50 in the submicromolar range. Collectively, these results suggest that this newly identified protein regulates peripherin-2 function.

Summary Porphyromonas gingivalis often subverts host cell autophagic processes for its own survival. Our previous studies document the association of the cargo sorting protein, melanoregulin (MREG), with its binding partner, the autophagic protein, microtubule‐associated protein 1 light chain 3 (LC3) in macrophages incubated with P. gingivalis (strain 33277). Differences in the lipid A moiety of lipopolysaccharide (LPS) affect the virulence of P. gingivalis ; penta‐acylated LPS 1690 is a weak Toll‐like receptor 4 agonist compared with Escherichia coli LPS, whereas tetra‐acylated LPS 1435/1449 acts as an LPS 1690 antagonist. To determine how P. gingivalis LPS 1690 affects autophagy we assessed LC3‐dependent and MREG‐dependent processes in green fluorescent protein (GFP)‐LC3‐expressing Saos‐2 cells. LPS 1690 stimulated the formation of very large LC3‐positive vacuoles and MREG puncta. This LPS 1690 ‐mediated LC3 lipidation decreased in the presence of LPS 1435/1449 . When Saos‐2 cells were incubated with P. gingivalis the bacteria internalized but did not traffic to GFP‐LC3‐positive structures. Nevertheless, increases in LC3 lipidation and MREG puncta were observed. Collectively, these results suggest that P. gingivalis internalization is not necessary for LC3 lipidation. Primary human gingival epithelial cells isolated from patients with periodontitis showed both LC3II and MREG puncta whereas cells from disease‐free individuals exhibited little co‐localization of these two proteins. These results suggest that the prevalence of a particular LPS moiety may modulate the degradative capacity of host cells, so influencing bacterial survival.

The Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) is a heterotrimeric AB2 toxin capable of inducing cell cycle arrest and apoptosis in lymphocytes and other cell types. Recently, we have demonstrated that human macrophages are resistant to Cdt-induced apoptosis but are susceptible to toxin-induced pro-inflammatory cytokine response involving activation of the NLRP3 inflammasome. Exposure to Cdt results in binding to the cell surface followed by internalization and translocation of the active subunit, CdtB, to intracellular compartments. Internalization involves hijacking of retrograde pathways; treatment of cells with Retro-2 leads to a decrease in CdtB–Golgi association. These events are dependent upon toxin binding to cholesterol in the context of lipid rich membrane microdomains often referred to as lipid rafts. We now demonstrate that within one hr of exposure to Cdt, CdtB is internalized and found primarily within lipid rafts; concurrently, cellugyrin (synaptogyrin-2) also translocates into lipid rafts. Further analysis by immunoprecipitation indicates that CdtB associates with complexes containing both cellugyrin and derlin-2. Moreover, a human macrophage cell line deficient in cellugyrin expression (THP-1Cg-) challenged with Cdt failed to internalize CdtB and was resistant to the Cdt-induced pro-inflammatory response. We propose that lipid rafts along with cellugyrin play a critical role in the internalization and translocation of CdtB to critical intracellular target sites in human macrophages. These studies provide critical new insight into the mechanism by which Cdt, and in particular, CdtB is able to induce toxicity.

Photoreceptors consume glucose supplied by the choriocapillaris to support phototransduction and outer segment (OS) renewal. Reduced glucose supply underlies photoreceptor cell death in inherited retinal degeneration and age-related retinal disease. We have previously shown that restricting glucose transport into the outer retina by conditional deletion of Slc2a1 encoding GLUT1 resulted in photoreceptor loss and impaired OS renewal. However, retinal neurons, glia, and the retinal pigment epithelium play specialized, synergistic roles in metabolite supply and exchange, and the cell-specific map of glucose uptake and utilization in the retina is incomplete. In these studies, we conditionally deleted Slc2a1 in a pan-retinal or rod-specific manner to better understand how glucose is utilized in the retina. Using non-invasive ocular imaging, electroretinography, and histochemical and biochemical analyses we show that genetic deletion of Slc2a1 from retinal neurons and Müller glia results in reduced OS growth and progressive rod but not cone photoreceptor cell death. Rhodopsin levels were severely decreased even at postnatal day 20 when OS length was relatively normal. Arrestin levels were not changed suggesting that glucose uptake is required to synthesize membrane glycoproteins. Rod-specific deletion of Slc2a1 resulted in similar changes in OS length and rod photoreceptor cell death. These studies demonstrate that glucose is an essential carbon source for rod photoreceptor cell OS maintenance and viability.

The proteins peripherin/rds and rom-1 form a protein complex in the rims of photoreceptor outer segment disk membranes. Peripherin/rds plays an essential role in the morphogenesis and maintenance of disk membrane structure, with peripherin/rds gene mutations resulting in photoreceptor cell degeneration. We report two different chromatographic procedures for the purification of native peripherin/rds from bovine photoreceptor cell outer segments and show that the protein is a phosphoprotein that promotes membrane fusion in vitro. During one procedure, peripherin/rds was copurified in association with rom-1 by hyroxylapatite and Mono Q FPLC. During the other, it was purified free from rom-1 by concanavalin-A affinity chromatography and chromatofocusing. Analysis of homogeneous peripherin/rds from the second procedure showed that exposure of photoreceptor outer segments to light resulted in the incorporation of nearly 2 mol of phosphate per mole of peripherin/rds and a concomitant shift in the isoelectric point of the protein. In addition, we found that recombination of purified peripherin/rds into lipid vesicles increased membrane fusion, with more rapid fusion detected with phosphorylated peripherin/rds. In conclusion, studies with purified peripherin/rds reveal that the protein undergoes light-dependent phosphorylation and that it may function in membrane fusion.

Smith-Lemli-Opitz syndrome (SLOS) is caused by an inherited defect in the last step in cholesterol (Chol) biosynthesis, leading to abnormal accumulation of 7-dehydrocholesterol and decreased Chol levels. Progressive retinal degeneration occurs in an animal model of SLOS, induced by treating rats with AY9944, a selective inhibitor of the enzyme affected in SLOS. Here we evaluated alterations in the biochemical and physical properties of retinal rod outer segment (ROS) membranes in this animal model. At 1 month of AY9944 treatment, there were modest alterations in fatty acid composition, but no significant differences in cis-parinaric acid (cPA) spectroscopic parameters in ROS membranes from treated versus control rats. However, at 3 months, ROS docosahexaenoic acid (DHA) content was dramatically reduced, and cPA fluorescence anisotropy values were decreased, relative to controls. Also, 1,6-diphenyl-1,3,5-hexatriene exhibited decreased rotational motion and increased orientational order in ROS membranes from 3 month-old AY9944-treated rats, relative to controls. No significant changes in protein:lipid ratios were observed; however, rhodopsin regenerability was compromised by 3 months of treatment. These findings are consistent with reduced ROS membrane fluidity in the SLOS rat model, relative to controls, primarily due to the dramatic reduction in membrane DHA levels, rather than altered sterol composition. Smith-Lemli-Opitz syndrome (SLOS) is caused by an inherited defect in the last step in cholesterol (Chol) biosynthesis, leading to abnormal accumulation of 7-dehydrocholesterol and decreased Chol levels. Progressive retinal degeneration occurs in an animal model of SLOS, induced by treating rats with AY9944, a selective inhibitor of the enzyme affected in SLOS. Here we evaluated alterations in the biochemical and physical properties of retinal rod outer segment (ROS) membranes in this animal model. At 1 month of AY9944 treatment, there were modest alterations in fatty acid composition, but no significant differences in cis-parinaric acid (cPA) spectroscopic parameters in ROS membranes from treated versus control rats. However, at 3 months, ROS docosahexaenoic acid (DHA) content was dramatically reduced, and cPA fluorescence anisotropy values were decreased, relative to controls. Also, 1,6-diphenyl-1,3,5-hexatriene exhibited decreased rotational motion and increased orientational order in ROS membranes from 3 month-old AY9944-treated rats, relative to controls. No significant changes in protein:lipid ratios were observed; however, rhodopsin regenerability was compromised by 3 months of treatment. These findings are consistent with reduced ROS membrane fluidity in the SLOS rat model, relative to controls, primarily due to the dramatic reduction in membrane DHA levels, rather than altered sterol composition. Inborn errors of cholesterol (Chol) biosynthesis comprise a constellation of typically severe, often lethal, human hereditary diseases having distinct genetic, biochemical, and phenotypic characteristics, yet sharing the common feature of abnormally low Chol levels in all tissues (as reviewed in Refs. 1Kelley R.I. Hermann G.E. Inborn errors of sterol biosynthesis.Annu. Rev. Genomics Hum. Genet. 2001; 2: 299-341Crossref PubMed Scopus (151) Google Scholar, 2Porter F.D. Human malformation syndromes due to inborn errors of cholesterol synthesis.Curr. Opin. Pediatr. 2003; 15: 607-613Crossref PubMed Scopus (100) Google Scholar). The Smith-Lemli-Opitz syndrome (SLOS) is an autosomal recessive disorder with associated multiple congenital anomalies (3Smith D.L. Lemli L. Opitz J.M. A newly recognized syndrome of multiple congenital anomalies.J. Pediatr. 1964; 64: 210-217Abstract Full Text PDF PubMed Scopus (539) Google Scholar), and is caused by an enzymatic defect in the last step of the Chol biosynthetic pathway (as reviewed in Ref. 4Correa-Cerro L.S. Porter F.D. 3Beta-hydroxysterol delta7-reductase and the Smith-Lemli-Opitz syndrome.Mol. Genet. Metab. 2005; 84: 112-126Crossref PubMed Scopus (75) Google Scholar). The typical biochemical signature of this syndrome is elevated levels of 7-dehydrocholesterol (7DHC) together with reduced levels of Chol in blood and other tissues, relative to the levels found in normal individuals. These abnormalities are the consequence of mutations in the DHCR7 gene, which encodes the enzyme DHCR7 (3β-hydroxy-sterol-Δ7-reductase; EC 1.3.1.21) (4Correa-Cerro L.S. Porter F.D. 3Beta-hydroxysterol delta7-reductase and the Smith-Lemli-Opitz syndrome.Mol. Genet. Metab. 2005; 84: 112-126Crossref PubMed Scopus (75) Google Scholar); the mutant enzyme inefficiently catalyzes the conversion of 7DHC to Chol. The central nervous system, in particular, is often profoundly affected in SLOS patients, as manifested by moderate to severe mental retardation and autism (1Kelley R.I. Hermann G.E. Inborn errors of sterol biosynthesis.Annu. Rev. Genomics Hum. Genet. 2001; 2: 299-341Crossref PubMed Scopus (151) Google Scholar, 2Porter F.D. Human malformation syndromes due to inborn errors of cholesterol synthesis.Curr. Opin. Pediatr. 2003; 15: 607-613Crossref PubMed Scopus (100) Google Scholar, 4Correa-Cerro L.S. Porter F.D. 3Beta-hydroxysterol delta7-reductase and the Smith-Lemli-Opitz syndrome.Mol. Genet. Metab. 2005; 84: 112-126Crossref PubMed Scopus (75) Google Scholar). Retinal dysfunction also appears to be an associated feature of the disease, evidenced by rod photoreceptor electrophysiological defects (5Elias E.R. Hansen R.M. Irons M. Quinn N.B. Fulton A.B. Rod photoreceptor responses in children with Smith-Lemli-Opitz syndrome.Arch. Ophthalmol. 2003; 121: 1738-1743Crossref PubMed Scopus (29) Google Scholar).A pharmacologically induced animal model of SLOS has been developed by treating rats with AY9944, a selective inhibitor of DHCR7 (6Kolf-Klauw M. Chevy F. Wolf C. Siliart B. Citadelle D. Roux C. Inhibition of 7-dehydrocholesterol reductase by the teratogen AY9944: a rat model for Smith-Lemli-Opitz syndrome.Teratology. 1996; 54: 115-125Crossref PubMed Scopus (58) Google Scholar, 7Fliesler S.J. Richards M.J. Miller C-Y. Peachey N.S. Marked alteration of sterol metabolism and composition without compromising retinal development or function.Invest. Ophthalmol. Vis. Sci. 1999; 40: 1792-1801PubMed Google Scholar, 8Fliesler S.J. Peachey N.S. Richards M.J. Nagel B.A. Vaughan D.K. Retinal degeneration in a rodent model of Smith-Lemli-Opitz syndrome: electrophysiologic, biochemical, and morphologic features.Arch. Ophthalmol. 2004; 122: 1190-1200Crossref PubMed Scopus (53) Google Scholar). We previously described a progressive (age-dependent) retinal degeneration in such an animal model, with associated biochemical, histological, and electrophysiological abnormalities involving both rod and cone photoreceptors (7Fliesler S.J. Richards M.J. Miller C-Y. Peachey N.S. Marked alteration of sterol metabolism and composition without compromising retinal development or function.Invest. Ophthalmol. Vis. Sci. 1999; 40: 1792-1801PubMed Google Scholar, 8Fliesler S.J. Peachey N.S. Richards M.J. Nagel B.A. Vaughan D.K. Retinal degeneration in a rodent model of Smith-Lemli-Opitz syndrome: electrophysiologic, biochemical, and morphologic features.Arch. Ophthalmol. 2004; 122: 1190-1200Crossref PubMed Scopus (53) Google Scholar). By 1 postnatal month, although retinal histology and electrophysiological competence in AY9944-treated rats appeared grossly unaffected, the mole ratio of 7DHC:Chol in the retina was nearly 4:1, whereas the normal rat retina contains virtually no 7DHC (7Fliesler S.J. Richards M.J. Miller C-Y. Peachey N.S. Marked alteration of sterol metabolism and composition without compromising retinal development or function.Invest. Ophthalmol. Vis. Sci. 1999; 40: 1792-1801PubMed Google Scholar). In striking contrast, by 3 postnatal months, retinas of AY9944-treated rats had 7DHC:Chol mole ratios typically >5:1, and exhibited concomitant histological degeneration along with rod and cone electrophysiological abnormalities (8Fliesler S.J. Peachey N.S. Richards M.J. Nagel B.A. Vaughan D.K. Retinal degeneration in a rodent model of Smith-Lemli-Opitz syndrome: electrophysiologic, biochemical, and morphologic features.Arch. Ophthalmol. 2004; 122: 1190-1200Crossref PubMed Scopus (53) Google Scholar). Subsequently, in the course of lipidomic analysis of whole retinas from age-matched control and AY9944-treated rats, we recently documented a marked decline in docosahexaenoic acid (DHA; 22:6n3) content of the major retinal glycerophospholipid molecular species in the SLOS rat model, relative to controls (9Ford D.A. Monda J.K. Brush R.S. Anderson R.E. Richards M.J. Fliesler S.J. Lipidomic analysis of the retina in a rat model of Smith-Lemli-Opitz syndrome: alterations in docosahexaenoic acid content of phospholipid molecular species.J. Neurochem. 2008; 105: 1032-1047Crossref PubMed Scopus (41) Google Scholar). However, under the conditions employed, the DHA levels in serum and liver were not lower than those found in normal controls, indicating that there was no generalized, systemic n3 fatty acid deficiency.In the present study, we performed subcellular fractionation of retinas from AY9944-treated and age-matched control rats to obtain purified rod outer segment (ROS) membranes, and then analyzed their fatty acid content and membrane fluidity, the latter by fluorescence spectroscopy using two independent, naturally fluorescent probes: cis-parinaric acid (cPA; 9Z,11E,13E,15Z-octadecatetraenoic acid) and 1,6-diphenyl-1,3,5-hexatriene (DPH). These linear fluorescent fatty acid probes are useful in detecting and quantifying gel–fluid heterogeneity in lipid bilayers (as reviewed in Ref. 10Lentz B.R. Use of fluorescent probes to monitor molecular order and motions within liposome bilayers.Chem. Phys. Lipids. 1993; 64: 99-116Crossref PubMed Scopus (331) Google Scholar). cPA is a fluorescent n3 PUFA that serves as one of the closest structural analogs to endogenous membrane lipids. This probe is routinely used to evaluate molecular packing density and as a peroxidation indicator (11Drummen G.P.C. Op den Kamp J.A.F. Post J. Validation of the peroxidative indicators, cis-parinaric acid and parinaroyl-phospholipids, in a model system and cultured cardiac myocytes.Biochim. Biophys. Acta. 1999; 1436: 370-382Crossref PubMed Scopus (36) Google Scholar). DPH, one of the most commonly used fluorescent membrane probes, is an extremely hydrophobic, symmetrical, rod-like trans-polyene that penetrates into the hydrophobic core of the bilayer, where its fluorescence intensity is over 10,000 times higher than in water (as reviewed in Ref. 12Trevors J.T. Fluorescent probes for bacterial cytoplasmic membrane research.J. Biochem. Biophys. Methods. 2003; 57: 87-103Crossref PubMed Scopus (82) Google Scholar). It is widely employed for assessing membrane phase and fluidity using both steady-state and time-resolved fluorescence spectroscopy. Time-resolved measurements enable discrimination between simultaneous changes in probe lifetime, probe motion, and angular distribution in the membrane hydrophobic core. DPH fluorescence lifetime is exquisitely sensitive to changes in local dielectric properties, making it ideal for assessing changes in transient water penetration into the membrane (13Zannoni C. Argioni A. Cavatorta P. Fluorescence depolarization in liquid crystals and membrane bilayers.Chem. Phys. Lipids. 1983; 32: 179-250Crossref Scopus (203) Google Scholar), and time-resolved fluorescence depolarization of DPH can provide detailed information about membrane orientational order and dynamics (13Zannoni C. Argioni A. Cavatorta P. Fluorescence depolarization in liquid crystals and membrane bilayers.Chem. Phys. Lipids. 1983; 32: 179-250Crossref Scopus (203) Google Scholar, 14van der Meer B.W. Pottel H. Herreman W. Ameloot M. Hendricks H. Schroder H. Effect of orientational order on the decay of the fluorescence anisotropy in membrane suspensions.Biophys. J. 1984; 46: 515-523Abstract Full Text PDF PubMed Scopus (104) Google Scholar).Here we show that the fluidity of ROS membranes is significantly reduced in the SLOS rat model, relative to controls, concomitant with the timing of retinal degeneration in that model. We provide correlative evidence and a rationale that supports the conclusion that the marked decrease in membrane lipid unsaturation, largely due to losses in DHA, rather than to alterations in the sterol profile, accounts for the altered membrane fluidity. Furthermore, the efficiency of rhodopsin regeneration is compromised in the SLOS rat model, relative to controls, even in the presence of excess chromophore (11-cis retinaldehyde). The results are discussed within the context of how such changes may impact the efficiency of phototransduction in the rod cell and the overall electrophysiological competence of the retina, with relevance to visual defects observed in the SLOS rat model as well as in SLOS patients.EXPERIMENTAL PROCEDURESMaterialsAY9944 (trans-1,4-bis(2-chlorobenzylamino-methyl)cyclohexanedihydrochloride) was custom synthesized, and matched the spectroscopic and physical properties of an authentic sample of AY9944 (kindly provided by Wyeth-Ayerst Laboratories, Monmouth, NJ). All organic solvents were of HPLC grade, and used as purchased from Fisher Scientific (Pittsburgh, PA). Fatty acid standards were used as purchased from Nu-Chek Prep, Inc. (Elysian, MN). Sterol standards were obtained from Steraloids, Inc. (Newport, RI); 7DHC was periodically recrystallized from methanol-water and its purity verified by HPLC prior to use. Anti-opsin monoclonal antibody (mAb 4D2) was a generous gift from Dr. Robert Molday (University of British Columbia, Vancouver, BC). HRP-conjugated secondary antibodies were obtained from Amersham Biosciences (Piscataway, NJ). Protein molecular weight standards were obtained from BioRad (Hercules, CA). 11-cis Retinal was kindly provided by Dr. Rosalie Crouch (Medical College of South Carolina, Charleston, SC). cPA (9Z,11E,13E,15Z-octatetradecanoic acid) and DPH were purchased from Molecular Probes/Invitrogen (Carlsbad, CA). Unless otherwise specified, all other reagents were used as purchased from Sigma/Aldrich (St. Louis, MO). Alzet® osmotic pumps (Model 2ML4) were purchased from Durect Corporation (Cupertino, CA).AnimalsAll procedures involving animals were approved by the Saint Louis University IACUC and conformed to the National Institutes of Health's Guide for the Care and Use of Laboratory Animals and the Association for Research in Vision and Ophthalmology's Statement for the Use of Animals in Ophthalmic and Visual Research. Adult female Sprague-Dawley rats (pregnant, 6 days sperm-positive) were obtained from Harlan (Indianapolis, IN). Rats were fed a standard rat chow (Purina Mills TestDiet, Richmond, IN) and were provided continuous access to water, ad libitum. In-house analysis confirmed that the chow was essentially Chol-free (data not shown). Rats were treated with AY9944 as previously described (8Fliesler S.J. Peachey N.S. Richards M.J. Nagel B.A. Vaughan D.K. Retinal degeneration in a rodent model of Smith-Lemli-Opitz syndrome: electrophysiologic, biochemical, and morphologic features.Arch. Ophthalmol. 2004; 122: 1190-1200Crossref PubMed Scopus (53) Google Scholar, 15Fliesler S.J. Vaughan D.K. Jenewein E.C. Richards M.J. Nagel B.A. Peachey N.S. Partial rescue of retinal function and sterol steady-state in a rat model of Smith-Lemli-Opitz syndrome.Pediatr. Res. 2007; 61: 273-278Crossref PubMed Scopus (22) Google Scholar). In brief, pregnant rats were implanted subcutaneously with Alzet® osmotic pumps containing AY9944 (in PBS solution, 1.5 mg/ml), so as to provide continuous delivery of AY9944 at a uniform rate (0.37 mg/kg/day, at 2.5 μl/h), beginning on gestational day 7 and continuing through the second postnatal week. Control dams received the same food and water ad libitum, but received no other treatment. Starting on postnatal day 1, the progeny of AY9944-treated dams were injected subcutaneously on alternating days, three times per week, with AY9944 (30 mg/kg, in PBS); treatment continued over a 3 month time course.ROS membrane preparationROS membranes were prepared from dark-adapted rat retinas (four pooled retinas per preparation) by discontinuous sucrose density ultracentrifugation, essentially as described previously (16Fliesler S.J. Florman R. Keller R.K. Isoprenoid lipid metabolism in the retina: dynamics of squalene and cholesterol incorporation and turnover in frog rod outer segment membranes.Exp. Eye Res. 1995; 60: 57-69Crossref PubMed Scopus (21) Google Scholar), with the modifications detailed in (17Fliesler S.J. Richards M.J. Miller C.Y. Cenedella R.J. Cholesterol synthesis in the vertebrate retina: effects of U18666A on rat retinal structure, photoreceptor membrane assembly, and sterol metabolism and composition.Lipids. 2000; 35: 289-296Crossref PubMed Scopus (20) Google Scholar). All procedures were performed in darkness or under dim red light (15W incandescent light bulbs with Wratten #2 filters; Eastman Kodak, Rochester, NY). Membranes were washed twice with ice-cold Tris-Mg buffer (10 mM Tris-acetate, pH 7.4, containing 5 mM MgCl2) containing diethylene triamine pentaacetic acid (0.1 mM), butylated hydroxytoluene (0.01 mg/ml), and SnCl2 (0.01 mg/ml) to retard lipid peroxidation, by ultracentrifugation (Beckman TLA-45 rotor, 10 min at 100,000 g, 4°C; Beckman Optima-TL centrifuge; Beckman Instruments, Palo Alto, CA). The membrane pellets were resuspended by brief probe sonication in ice-chilled HEPES-buffered saline (10 mM HEPES, pH 7.4, containing 100 mM NaCl) and flash frozen (in capped microcentrifuge tubes, flushed with argon) in liquid nitrogen, then wrapped in aluminum foil and stored in darkness at −80°C until used for analysis.Rhodopsin regeneration studiesROS membranes (resuspended in HEPES-buffered saline containing 10 mM hydroxylamine hydrochloride) were bleached by continuous illumination using a light source equipped with an orange filter, as previously described (18Cusanovich M. Kinetics and mechanism of rhodopsin regeneration with 11-cis-retinal.Methods Enzymol. 1982; 81: 443-447Crossref PubMed Scopus (14) Google Scholar). Routinely greater than 90% of the total rhodopsin was bleached under these conditions. In all experiments, the duration of bleaching was adjusted such that the same total amount of rhodopsin was bleached in the membranes being compared. The bleached membranes were washed twice in 10 mM HEPES, pH 7.4 and centrifuged, and the supernatant containing the excess hydroxylamine was discarded. Rhodopsin was regenerated from the apoprotein opsin by the addition of a 2–3-fold molar excess of 11-cis retinal, prepared in ethanol, such that the final ethanol concentration was 0.5% (v/v). The samples were incubated in the dark at 37°C, and aliquots were removed for spectrophotometric analysis at 2.5, 4, and 24 h. The extent of rhodopsin regeneration was measured spectrophotometrically as an increase in absorbance at 500 nm, using a Perkin-Elmer Lambda 25 UV/Vis spectrophotometer (PerkinElmer Life and Analytical Sciences, Inc.; Waltham, MA) equipped with a temperature-controlled microcuvette holder. The percent rhodopsin regenerated was calculated based on the amount of rhodopsin bleached in each sample analyzed.SDS-PAGE and immunoblottingDetergent-solubilized ROS membranes from control and AY9944-treated rats were prepared as described previously (19Boesze-Battaglia K. Song H. Sokolov M. Lillo C. Pankoski-Walker L. Gretzula C. Gallagher B. Rachel R.A. Jenkins N.A. Copeland N.G. et al.The tetraspanin protein peripherin-2 forms a complex with melanoregulin, a putative membrane fusion regulator.Biochemistry. 2007; 46: 1256-1272Crossref PubMed Scopus (33) Google Scholar); proteins were separated on 12% SDS-PAGE under reducing conditions and immunoblotted essentially per the method of Towbin, Staehelin, and Gordon (20Towbin H. Staehelin T. Gordon J. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.Proc. Natl. Acad. Sci. USA. 1979; 76: 4350-4354Crossref PubMed Scopus (44709) Google Scholar), normalized to total lipid phosphorus load (1 mg) per lane. Western blots were probed with a 1:1,000 dilution of mouse anti-opsin mAb 4D2, followed by a 1:1,000 dilution of sheep anti-mouse, HRP-conjugated secondary antibody. Immunoblots were visualized using an enhanced chemifluorescence detection system (Amersham Biosciences; Arlington Heights, IL), which allegedly (per the manufacturer) provides better signal linearity than some commonly used chemiluminescent detection systems. Digital analysis of blots was performed using a Kodak Image Station 440CF. To determine the relative amount of opsin present in each ROS membrane specimen, the densitometric intensity of all of the immunostained components in each lane was determined and the total value was normalized to total protein load (in micrograms).Lipid phosphorus and protein quantificationAliquots of resuspended ROS membranes were assayed for total lipid phosphorus as described (21Bartlett G.R. Phosphorus assay in column chromatography.J. Biol. Chem. 1959; 234: 466-468Abstract Full Text PDF PubMed Google Scholar). Total protein content was determined using a micro-bicinchoninic acid kit, per the directions of the manufacturer (Pierce; Rockford, IL).RNA isolation and quantitative RT-PCR analysisTotal RNA was isolated using TRI reagent (Molecular Research Center, Inc.; Cincinnati, OH). RNA yield was determined by absorbance at 260 nm, and integrity was confirmed by gel electrophoresis. Total RNA (5 μg) was converted into cDNA using the SuperScript® first-strand synthesis system for RT-PCR (Invitrogen). The cDNA samples were amplified in a Smart Cycler (Cepheid, Inc.; Sunnyvale, CA) with LightCycler® Fast-Start DNA Master SYBR Green I reagent (Roche Molecular Biochemicals; Mannheim, Germany), using specific primers (Sigma/Aldrich). Gene expression was normalized using rat GAPDH primers (F, forward primer; R, reverse primer): (F) gtcatcatctccgcccctt, (R) tttctcgtggttcacaccca. Specific primers for opsin and peripherin/rds (per-2) were designed as follows: opsin, (F) gttcgtggtccacttcacca, (R) ttggagccctggtgggtaaa; per-2, (F) gggctgttcctgaagattga, (R) ggagcatgtcgatggtcttt. The results from RT-PCR were obtained as crossing points, indicating the number of cycles required for fluorescence of the PCR product to increase above threshold value. These crossing points were converted to arbitrary units of mRNA assuming a concentration-dependent straight line for a semilog plot, with a value of 3.5 for the fold change in mRNA/cycle (slope), and the crossing point cycle number with no template as an estimate of the y-intercept. A final melt curve from 60°C to 95°C was performed to confirm the specificity of the PCR, and the identities of PCR products were checked by gel electrophoresis. Results were compared using a two-way ANOVA and Tukey test, with P < 0.050 indicating statistically significant differences.Membrane fluidity measurementscPA studiesMembrane fluidity was determined from steady-state anisotropy measurements as described previously (22Sklar L.A. Hudson B.S. Petersen M. Diamond J. Conjugated polyene fatty acids as fluorescent probes: spectroscopic characterization.Biochemistry. 1977; 16: 813-819Crossref PubMed Scopus (225) Google Scholar, 23T Calafut Dix, and A. Verkman J. Fluorescence depolarization of cis-and trans-parinaric acids in artificial and red cell membranes.Biochemistry. 1989; 21: 5051-5058Google Scholar). cPA was introduced into ROS membrane by incubation of a membrane suspension (5.0 ml) with cPA in ethanol such that the final concentration of the fluorescent probe was 0.5 mol% relative to membrane phospholipid. Samples were incubated with probe or ethanol alone for 15 min at 37°C. Fluorescence anisotropy assays the rotational diffusion of a molecule from the decorrelation of polarization in fluorescence, i.e., between the exciting and emitted (fluorescent) photons. Steady-state fluorescence of cPA-containing ROS was recorded on a Perkin-Elmer LS55B spectrofluorimeter, equipped with polarizers, as a function of increasing temperature (28–37°C). Fluorescence intensity was recorded at λex = 324 nm, λem = 415 nm with the excitation and emission slit-widths set at 10 and 5 nm, respectively. Unlabeled ROS preparations were used as a scattering blank. Fluorescence signal due to this scattering was subtracted from cPA-containing samples.Fluorescence anisotropy was calculated using the following equation: Anisotropy (r) = (Iv − Ih)/(Iv + 2Ih),where Iv is the intensity parallel to the excitation plane and Ih is the emission perpendicular to the excitation plane.DPH studiesMembranes were suspended in HEPES-buffered saline at a phospholipid concentration of 0.15 mM. A DPH stock solution was prepared in tetrahydrofuran, and 0.5 μl was added to membrane suspensions at a phospholipid:DPH mole ratio of 300:1. Fluorescence lifetime and differential polarization measurements were performed with a K2 multifrequency cross-correlation phase fluorometer (ISS; Urbana, IL). Excitation at 351 nm was provided by an Innova 307 argon ion laser (Coherent; Santa Clara, CA). Lifetime and differential polarization data were acquired at 37°C at 15 modulation frequencies, logarithmically spaced from 5 to 150 MHz. All lifetime measurements were made with the emission polarizer at the magic angle of 54.7° relative to the vertically polarized excitation beam and with 1,4-bis(5-phenyloxazol-2-yl)benzene in absolute ethanol in the reference cuvette. For each differential polarization measurement, the instrumental polarization factors were measured, found to be between 1.00 and 1.05, and the appropriate correction factor applied. All measurements were repeated with each sample a minimum of three times. Total fluorescence intensity decays were analyzed with the sum of three exponential decays. Reported values are the intensity-weighted average, <τ>, of the resulting three exponential time constants. Measured polarization-dependent differential phases and modulation ratios for each sample were combined with the measured total intensity decay to yield the anisotropy decay, r(t). All anisotropy decay data were analyzed using the Brownian rotational diffusion (BRD) model (14van der Meer B.W. Pottel H. Herreman W. Ameloot M. Hendricks H. Schroder H. Effect of orientational order on the decay of the fluorescence anisotropy in membrane suspensions.Biophys. J. 1984; 46: 515-523Abstract Full Text PDF PubMed Scopus (104) Google Scholar, 24Mitchell D.C. Litman B.J. Molecular order and dynamics in bilayers consisting of highly polyunsaturated phospholipids.Biophys. J. 1998; 74: 879-891Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar) and the results were interpreted in terms of an angular distribution function of DPH, ƒ(ϕ), which is symmetric about ϕ = π/2. Relative phospholipid acyl chain packing was quantified using the disorder parameter, ƒv, which is proportional to the overlap of the DPH orientational probability distribution, ƒ(ϕ)sinϕ, with randomly oriented DPH (24Mitchell D.C. Litman B.J. Molecular order and dynamics in bilayers consisting of highly polyunsaturated phospholipids.Biophys. J. 1998; 74: 879-891Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 25Straume M. Litman B.J. Equilibrium and dynamic structure of large, unilamellar, unsaturated acyl chain phosphatidylcholine vesicles. Higher order analysis of 1,6-diphenyl-1,3,5-hexatriene and 1-[4-(trimethylammonio) phenyl]-6-phenyl-1,3,5-hexatriene anisotropy decay.Biochemistry. 1987; 26: 5113-5120Crossref PubMed Scopus (112) Google Scholar). The BRD model quantifies probe motion in terms of the diffusion coefficient for DPH rotation about its long axis, Dperp. Fluorescence anisotropy decays were also analyzed using an empirical sum-of-three-exponentials model. In this analysis, probe orientation is summarized by the order parameter S, where S = (r∞/ro)1/2 (26Heyn M.P. Determination of lipid order parameters and rotational correlation times from fluorescence depolarization experiments.FEBS Lett. 1979; 108: 359-364Crossref PubMed Scopus (327) Google Scholar), and uncorrelated rotational motion is characterized by the three rotational time constants, φi. The three rotational time constants and their associated preexponential factors were used to calculate the weighted average rotational correlation time, <φ>. All analyses of time-resolved differential polarization data were performed with NONLIN, with subroutines specifying the fitting function written by one of the authors (D.C.M.).Lipid extraction and fatty acid analysisROS membranes were protected from exposure to light as much as possible throughout processing. After thawing, a mixture containing known amounts of pentadecanoic acid (15:0), heptadecanoic acid (17:0), and heneicosanoic acid (21:0) was added to each sample as internal standards, and total lipids were extracted essentially per the Bligh–Dyer method (27Bligh E.J. Dyer W.J. A rapid method of total lipid extraction and purification.Can. J. Biochem. Physiol. 1959; 37: 911-917Crossref PubMed Scopus (42178) Google Scholar), with minor modifications, as described previously (28Martin R.E. Elliott M.H. Brush R.S. Anderson R.E. Detailed characterization of the lipid composition of detergent-resistant membranes from photoreceptor rod outer segment membranes.Invest. Ophthalmol. Vis. Sci. 2005; 46: 1147-1154Crossref PubMed Scopus (79) Google Scholar). Lipid extracts were dried under a stream of nitrogen, and fatty acids were derivatized to form the corresponding methyl esters (FAMEs), prior to analysis by gas–liquid chromatography, essentially as described previously (28Martin R.E. Elliott M

Induction of cell cycle arrest in lymphocytes following exposure to the Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) is dependent upon the integrity of lipid membrane microdomains. Moreover, we have previously demonstrated that the association of Cdt with target cells involves the CdtC subunit which binds to cholesterol via a cholesterol recognition amino acid consensus sequence (CRAC site). In this study, we demonstrate that the active Cdt subunit, CdtB, also is capable of binding to large unilamellar vesicles (LUVs) containing cholesterol. Furthermore, CdtB binding to cholesterol involves a similar CRAC site as that demonstrated for CdtC. Mutation of the CRAC site reduces binding to model membranes as well as toxin binding and CdtB internalization in both Jurkat cells and human macrophages. A concomitant reduction in Cdt-induced toxicity was also noted, indicated by reduced cell cycle arrest and apoptosis in Jurkat cells and a reduction in the proinflammatory response in macrophages (interleukin 1β [IL-1β] and tumor necrosis factor alpha [TNF-α] release). Collectively, these observations indicate that membrane cholesterol serves as an essential ligand for both CdtC and CdtB and, further, that this binding is necessary for both internalization of CdtB and subsequent molecular events leading to intoxication of cells.

Summary Studies have suggested that Aggregatibacter actinomycetemcomitans leukotoxin (LtxA) kills human lymphocyte function‐associated antigen 1 (LFA‐1; CD11a/CD18)‐bearing immune cells through a lysosomal‐mediated mechanism. Lysosomes are membrane‐bound cellular organelles that contain an array of acid hydrolases that are capable of breaking down biomolecules. The lysosomal membrane bilayer confines the pH‐sensitive enzymes within an optimal acidic (pH 4.8) environment thereby protecting the slightly basic cytosol (pH 6.8–7.5). In the current study, we have probed the effect of LtxA‐induced cytolysis on lysosomal integrity in two different K562 erythroleukemia cell lines. K562‐puro/LFA‐1 cells were stably transfected with CD11a and CD18 cDNA to express LFA‐1 on the cell surface while K562‐puro, which does not express LFA‐1, served as a control. Following treatment with 100 ng ml −1 LtxA cells were analyzed by live cell imaging in conjunction with time‐lapse confocal microscopy and by flow cytometry. Using a pH‐sensitive indicator (pHrodo ® ) we demonstrated that the toxin causes a decrease in the intracellular pH in K562‐puro/LFA‐1 cells that is noticeable within the first 15 min of treatment. This process correlated with the disappearance of lysosomes in the cytosol as determined by both acridine orange and LysoTracker ® Red DND‐99 staining. These changes were not observed in K562‐puro cells or when heat inactivated toxin was added to K562‐puro/LFA‐1. Our results suggest that LtxA induces lysosomal damage, cytosol acidification, which is followed by cell death in K562‐puro/LFA‐1 cells.

Microtubule-associated protein 1 light chain 3 (MAP1LC3), a human homologue of yeast Atg8, is an essential component of autophagy. LC3 plays a critical role in hybrid degradation pathways in which some but not all components of autophagy are coupled with phagocytosis in a process known as LC3-associated phagocytosis (LAP). LC3 exists as three highly homologous isoforms in human (LC3A, LC3B, and LC3C) with two of these (LC3A and LC3B) in mouse. LC3B predominated in both fetal and adult human retinal pigment epithelium (RPE) relative to LC3A and LC3C, while in mouse RPE and neural retina, LC3A and LC3B were expressed at approximately equivalent levels. In situ hybridization studies localized LC3A and LC3B transcripts in the retina and RPE. LC3B protein was detected in C57Bl6/J RPE and retinal lysates and was absent in the LC3BKO mouse.

Human lymphocytes exposed to Aggregatibacter actinomycetemcomitans (Aa) cytolethal distending toxin (Cdt) undergo cell cycle arrest and apoptosis. In previous studies, we demonstrated that the active Cdt subunit, CdtB, is a potent phosphatidylinositol (PI) 3,4,5-triphosphate phosphatase. Moreover, AaCdt-treated cells exhibit evidence of PI-3-kinase (PI-3K) signaling blockade characterized by reduced levels of PIP3, pAkt, and pGSK3β. We have also demonstrated that PI-3K blockade is a requisite of AaCdt-induced toxicity in lymphocytes. In this study, we extended our observations to include assessment of Cdts from Haemophilus ducreyi (HdCdt) and Campylobacter jejuni (CjCdt). We now report that the CdtB subunit from HdCdt and CjCdt, similar to that of AaCdt, exhibit potent PIP3 phosphatase activity and that Jurkat cells treated with these Cdts exhibit PI-3K signaling blockade: reduced levels of pAkt and pGSK3β. Since non-phosphorylated GSK3β is the active form of this kinase, we compared Cdts for dependence on GSK3β activity. Two GSK3β inhibitors were employed, LY2090314 and CHIR99021; both inhibitors blocked the ability of Cdts to induce cell cycle arrest. We have previously demonstrated that AaCdt induces increases in the CDK inhibitor, p21 CIP1/WAF1 , and, further, that this was a requisite for toxin-induced cell death via apoptosis. We now demonstrate that HdCdt and CjCdt also share this requirement. It is also noteworthy that p21 CIP1/WAF1 was not involved in the ability of the three Cdts to induce cell cycle arrest. Finally, we demonstrate that, like AaCdt, HdCdt is dependent upon the host cell protein, cellugyrin, for its toxicity (and presumably internalization of CdtB); CjCdt was not dependent upon this protein. The implications of these findings as they relate to Cdt’s molecular mode of action are discussed.

The fluorescent analog NBD-phosphatidylethanolamine and the analogs of cholesterol NBD-cholesterol and cholestatrienol were used to study the distribution of these lipids within the plasma membrane bilayer of human platelets. The probes were incorporated into platelets using phosphatidylcholine donor vesicles. The distribution of NBD lipid and of cholestatrienol in the platelet plasma membrane bilayer was followed by quenching with dithionite and TNBS, respectively. The t1/2 of cholestatrienol incorporation into platelet membranes was 39 min, and approximately 65% of the probe was quenched by addition of TNBS. When platelets were exposed to collagen or to ADP, a portion of the probe became inaccessible to quenching. Within 2 min of stimulation by collagen (10 micrograms/mL), the percentage of cholestatrienol fluorescence quenched by TNBS decreased to 45%. The fluorescent probe was not found to be associated either with the intracellular membranes or in the extracellular media after collagen stimulation. Similar data were obtained with NBD-cholesterol, but the decrease in accessibility of this probe to quenching was considerably slower. The redistribution of endogenous membrane cholesterol was also measured using cholesterol oxidase. Exposure of platelets to collagen decreased the accessibility of endogenous membrane cholesterol to enzymatic oxidation with cholesterol oxidase. Taken together, the foregoing observations are consistent with the stimulus-dependent translocation of cholesterol out of the outer monolayer. Coincident with the redistribution of cholesterol is the reciprocal movement of NBD-phosphatidylethanolamine into the outer monolayer. In the presence of the chaotropic agents urea and guanidine HCl, the movement of cholestatrienol upon collagen stimulation was prevented, but the redistribution of NBD-phosphatidylethanolamine was still detected. We propose that cholesterol translocates to the inner platelet monolayer following collagen stimulation, but the possibility that the sterol moves laterally within the outer membrane monolayer cannot be rigorously excluded.

Photoreceptor rod cells contain a unique tetraspanin fusion protein known as peripherin/rds. This protein is important in membrane fusion events hypothesized to be essential to disk membrane morphogenesis and disk shedding. In vivo and in vitro fusogenic activity has been mapped to the C-terminal domain of peripherin/rds. Moreover, a fusion peptide domain localized to a 15 amino acid long region (residues 311-325) is essential for mediating lipid bilayer fusion of model membranes. To address the functional and structural properties required for peripherin/rds dependent membrane fusion, constructs of the entire C-terminal domain (residues 284-346) were generated and polypeptides expressed. A wild type-peripherin/rds C-terminal GST fusion construct that included the entire C-terminus (PERCTER) or a C-terminal truncation mutant (PERCTN) were engineered with a thrombin cleavage site. Protein expression was induced in E. coli with IPTG, expressed proteins cleaved from the GST with thrombin and purified to homogeneity on a Superdex 75 column. Purity was confirmed by SDS-PAGE and Western blot analysis. The purified wt C-terminal protein resolved as a monomer under reducing conditions on SDS-PAGE (15%) and was immunoreactive with anti peripherin/rds antibody 2B6 (gift from Dr R. Molday). The purified polypeptide promoted the requisite steps of fusion, membrane destabilization, lipid mixing and aqueous contents mixing. Conversely, the truncation mutant lacking a portion of the fusion domain was unable to promote these steps. A common feature of most membrane fusion proteins is a change in conformation upon membrane association. Structural changes in the C-terminal polypeptide were investigated using far UV CD. The far UV CD spectra of the purified C-terminal polypeptide indicated substantial alpha-helical content in the wt peptide in isotonic aqueous buffer. An increase in intensity of 208 and 222 nm CD bands upon addition of DPC vesicles indicated an increase in alpha-helical content of the polypeptide. These results demonstrate that a purified soluble form of the C-terminus of peripherin/rds can interact with biological phospholipids; moreover, this interaction promotes a conformational change that is most consistent with an increase in alpha-helical content.

It is well established that many cell functions are controlled by the PI-3K signaling pathway and the signaling lipid, phosphatidylinositol-3,4,5-triphosphate (PIP3). This is particularly true for mast cells which play a key regulatory role in allergy and inflammation through activation via high-affinity IgE receptors (FcɛRI) leading to activation of signaling cascades and subsequent release of histamine and other pro-inflammatory mediators. A pivotal component of this cascade is the activation of PI-3K and a rise in intracellular levels of PIP3. In this study, we developed a novel chimeric toxin that selectively binds to mast cells and which functions as a PIP3 phosphatase. Specifically, the chimeric toxin was composed of the FcɛRI binding region of IgE and the active subunit of the cytolethal distending toxin, CdtB, which we have recently demonstrated to function as a PIP3 phosphatase. We demonstrate that the chimeric toxin retains PIP3 phosphatase activity and selectively binds to mast cells. Moreover, the toxin is capable of altering intracellular levels of PIP3, block antigen-induced Akt phosphorylation and degranulation. These studies provide further evidence for the pivotal role of PIP3 in regulating mast cell activation and for this signaling lipid serving as a novel target for therapeutic intervention of mast cell-mediated disease. Moreover, these studies provide evidence for the utilization of CdtB as a novel therapeutic agent for targeting the PI-3K signaling pathway.

Purpose.: Canine cone–rod dystrophy 1 (cord1) has been previously mapped to CFA15, and a homozygous 44-bp insertion in exon 2 (Ins44) of canine RPGRIP1 (cRPGRIP1Ins/Ins ) has been associated with the disease. However, from the recent identification of a significant discordance in genotype–phenotype association, we have reexamined the role of cRPGRIP1 in cord1. Methods.: Retinal structure and function was assessed by clinical retinal examination, noninvasive imaging, electroretinography, and histopathology/immunohistochemistry. cRPGRIP1 splicing was analyzed by RT-PCR. Retinal gene expression was determined by quantitative RT-PCR (qRT-PCR). Five markers spanning the entire cRPGRIP1 were identified and used for haplotyping. Results.: Electroretinography demonstrated that cone responses were absent or present in cRPGRIP1Ins/Ins individuals. Moreover, performance in vision testing and optical coherence tomography (OCT) were comparable in cRPGRIP1Ins/Ins dogs, regardless of the cone ERG status. While histologic changes in retinal structure were minimal, immunohistochemistry demonstrated a lack of cone opsin labeling in cRPGRIP1Ins/Ins dogs. cDNA analysis revealed that Ins44 disrupts a putative exonic splicing enhancer that allows for skipping of exon 2, while retaining the functional RPGR-interacting domain (RID) of the protein. New cRPGRIP1 sequence changes were identified, including a 3-bp deletion affecting the 3′ acceptor splice site of alternative exon 19c. The extended haplotype spanning cRPGRIP1 was identical in cRPGRIP1Ins/Ins dogs with and without retinal degeneration. Gene expression analysis showed that expression levels were not associated with Ins44 genotype. Conclusions.: The results indicated that cRPGRIP1 Ins44 is an unlikely primary cause of cord1, and that the causal gene and mutation are likely located elsewhere in the critical disease interval.

The retinal pigment epithelium (RPE) supports the outer retina through essential roles in the retinoid cycle, nutrient supply, ion exchange, and waste removal. Each day the RPE removes the oldest ~10% of photoreceptor outer segment (OS) disk membranes through phagocytic uptake, which peaks following light onset. Impaired degradation of phagocytosed OS material by the RPE can lead to toxic accumulation of lipids, oxidative tissue damage, inflammation, and cell death. OSs are rich in very long chain fatty acids, which are preferentially catabolized in peroxisomes. Despite the importance of lipid degradation in RPE function, the regulation of peroxisome number and activity relative to diurnal OS ingestion is relatively unexplored. Using immunohistochemistry, immunoblot analysis, and catalase activity assays, we investigated peroxisome abundance and activity at 6 AM, 7 AM (light onset), 8 AM, and 3 PM, in wild-type (WT) mice and mice lacking microtubule-associated protein 1 light chain 3B ( Lc3b), which have impaired phagosome degradation. We found that catalase activity, but not the amount of catalase protein, is 50% higher in the morning compared with 3 PM, in RPE of WT, but not Lc3b −/− , mice. Surprisingly, we found that peroxisome abundance was stable during the day in RPE of WT mice; however, numbers were elevated overall in Lc3b −/− mice, implicating LC3B in autophagic organelle turnover in RPE. Our data suggest that RPE peroxisome function is regulated in coordination with phagocytosis, possibly through direct enzyme regulation, and may serve to prepare RPE peroxisomes for daily surges in ingested lipid-rich OS.

Cytolethal distending toxins (Cdt) are a family of toxins produced by several human pathogens which infect mucocutaneous tissue and induce inflammatory disease. We have previously demonstrated that the Aggregatibacter actinomycetemcomitans Cdt induces a pro-inflammatory response from human macrophages which involves activation of the NLRP3 inflammasome. We now demonstrate that in addition to activating caspase-1 (canonical inflammasome), Cdt treatment leads to caspase-4 activation and involvement of the noncanonical inflammasome. Cdt-treated cells exhibit pyroptosis characterised by cleavage of gasdermin-D (GSDMD), release of HMGB1 at 24 hr and LDH at 48 hr. Inhibition of either the canonical (caspase-1) or noncanonical (caspase-4) inflammasome blocks both Cdt-induced release of IL-1β and induction of pyroptosis. Analysis of upstream events indicates that Cdt induces Syk phosphorylation (activation); furthermore, blockade of Syk expression and inhibition of pSyk activity inhibit both Cdt-induced cytokine release and pyroptosis. Finally, we demonstrate that increases in pSyk are dependent upon Cdt-induced activation of GSK3β. These studies advance our understanding of Cdt function and provide new insight into the virulence potential of Cdt in mediating the pathogenesis of disease caused by Cdt-producing organisms such as A. actinomycetemcomitans.

cytolethal distending toxin (Cdt) is capable of intoxicating lymphocytes macrophages, mast cells and epithelial cells. Following Cdt binding to cholesterol, in the region of membrane lipid rafts, the CdtB and CdtC subunits are internalized and traffic to intracellular compartments. These events are dependent upon, cellugyrin, a critical component of synaptic like microvesicles (SLMV

Inherited defects in the <i>RDS</i> gene cause a multiplicity of progressive retinal diseases in humans. The gene product, peripherin/rds (P/rds), is a member of the tetraspanin protein family required for normal vertebrate photoreceptor outer segment (OS) architecture. Although its molecular function remains uncertain, P/rds has been suggested to catalyze membrane fusion events required for the OS renewal process. This study investigates the importance of two charged residues within a predicted C-terminal helical region for protein biosynthesis, localization, and interaction with model membranes. Targeted mutagenesis was utilized to neutralize charges at Glu³²¹ and Lys³²⁴ individually and in combination to generate three mutant variants. Studies were conducted on variants expressed as 1) full-length P/rds in COS-1 cells, 2) glutathione <i>S</i>-transferase fusion proteins in <i>Escherichia coli</i>, and 3) membrane-associated green fluorescent protein fusion proteins in transgenic <i>Xenopus laevis</i>. None of the mutations affected biosynthesis of full-length P/rds in COS-1 cells as assessed by Western blotting, sedimentation velocity, and immunofluorescence microscopy. Although all mutations reside within a recently identified localization signal, none altered the ability of this region to direct OS targeting in transgenic <i>X. laevis</i> retinas. In contrast, individual or simultaneous neutralization of the charged amino acids Glu³²¹ and Lys³²⁴ abolished the ability of the C-terminal domain to promote model membrane fusion as assayed by lipid mixing. These results demonstrate that, although overlapping, C-terminal determinants responsible for OS targeting and fusogenicity are separable and that fusogenic activity has been uncoupled from other protein properties. The observation that subunit assembly and OS targeting can both proceed normally in the absence of fusogenic activity suggests that properly assembled and targeted yet functionally altered proteins could potentially generate pathogenic effects within the vertebrate photoreceptor.

The Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) is a heterotrimeric AB2 toxin capable of inducing lymphocytes, and other cell types, to undergo cell cycle arrest and apoptosis. Exposure to Cdt results in binding to the cell surface followed by internalization and translocation of the active subunit, CdtB, to intracellular compartments. These events are dependent upon toxin binding to cholesterol in the context of lipid rich membrane microdomains often referred to as lipid rafts. We now demonstrate that, in addition to binding to the plasma membrane of lymphocytes, another early and critical event initiated by Cdt is the translocation of the host cell protein, cellugyrin (synaptogyrin-2) to the same cholesterol-rich microdomains. Furthermore, we demonstrate that cellugyrin is an intracellular binding partner for CdtB as demonstrated by immunoprecipitation. Using CRISPR/cas9 gene editing we established a Jurkat cell line deficient in cellugyrin expression (JurkatCg-); these cells were capable of binding Cdt, but unable to internalize CdtB. Furthermore, JurkatCg- cells were not susceptible to Cdt-induced toxicity; these cells failed to exhibit blockade of the PI-3K signaling pathway, cell cycle arrest or cell death. We propose that cellugyrin plays a critical role in the internalization and translocation of CdtB to critical intracellular target sites. These studies provide critical new insight into the mechanism by which Cdt, and in particular, CdtB is able to induce toxicity.

Repeats-in-toxin leukotoxin (LtxA) produced by the oral bacterium Aggregatibacter actinomycetemcomitans kills human leukocytes in a lymphocyte function-associated antigen 1 (LFA-1, integrin αL/β2)-dependent manner, although the mechanism for this interaction has not been identified. The LtxA internalisation by LFA-1-expressing cells was explored with florescence resonance energy transfer (FRET) microscopy using a cell line that expresses LFA-1 with a cyan fluorescent protein-tagged cytosolic αL domain and a yellow fluorescent protein-tagged β2 domain. Phorbol 12-myristate 13-acetate activation of LFA-1 caused transient cytosolic domain separation. However, addition of LtxA resulted in an increase in FRET, indicating that LtxA brings the cytosolic domains closer together, compared with the inactive state. Unlike activation, this effect was not transient, lasting more than 30 min. Equilibrium constants of LtxA binding to the cytoplasmic domains of both αL and β2 were determined using surface plasmon resonance. LtxA has a strong affinity for the cytosolic domains of both the αL and β2 subunits (Kd = 15 and 4.2 nM, respectively) and a significantly lower affinity for the cytoplasmic domains of other integrin αM, αX, and β3 subunits (Kd = 400, 180, and 230 nM, respectively), used as controls. Peptide fragments of αL and β2 show that LtxA binds membrane-proximal domain of αL and intermediate domain of β2.

Peripherin-2 (also known as peripherin/rds), a photoreceptor specific tetraspanin protein, is required to maintain normal cell structure through its role in renewal processes requiring membrane fusion. It is the first tetraspanin fusogen and has been shown to directly mediate fusion between disk membranes and opposing membranes to maintain the highly ordered structure of rod outer segments. Localized to the C terminus of human, bovine, and murine peripherin-2 is an amphiphilic fusion peptide domain (residues 312–326) and a highly conserved region upstream of this domain that we hypothesize is essential for fusogenic function. Our previous studies indicated that substitution of a threonine for a proline at position 296 within this highly conserved region enhanced fusion activity. In this study we wanted to determine whether this proline is essential with the introduction of three additional substitutions of proline with alanine, leucine, and glutamic acid. Wild type, P296T, P296A, P296L, and P296E mutants of peripherin-2 were expressed as His6-tagged full-length proteins in Madin-Darby canine kidney (MDCK) cells. All of the proteins were localized to intracellular membranes and detected as 42-kDa monomers by Western blot analysis. The wild type, P296A, and P296L assembled into core tetramers; in contrast the P296T and P296E formed higher order oligomers. Fusogenic activity of full-length protein expressed in MDCK membranes and purified protein reconstituted in model membrane liposomes was determined using fluorescence quenching techniques. Fusion activity was decreased in the P296L, P296A, and P296E mutants both in endogenous MDCK membranes and in model liposomes. Collectively, these results suggest that the proline at position 296 is necessary for optimal function. Peripherin-2 (also known as peripherin/rds), a photoreceptor specific tetraspanin protein, is required to maintain normal cell structure through its role in renewal processes requiring membrane fusion. It is the first tetraspanin fusogen and has been shown to directly mediate fusion between disk membranes and opposing membranes to maintain the highly ordered structure of rod outer segments. Localized to the C terminus of human, bovine, and murine peripherin-2 is an amphiphilic fusion peptide domain (residues 312–326) and a highly conserved region upstream of this domain that we hypothesize is essential for fusogenic function. Our previous studies indicated that substitution of a threonine for a proline at position 296 within this highly conserved region enhanced fusion activity. In this study we wanted to determine whether this proline is essential with the introduction of three additional substitutions of proline with alanine, leucine, and glutamic acid. Wild type, P296T, P296A, P296L, and P296E mutants of peripherin-2 were expressed as His6-tagged full-length proteins in Madin-Darby canine kidney (MDCK) cells. All of the proteins were localized to intracellular membranes and detected as 42-kDa monomers by Western blot analysis. The wild type, P296A, and P296L assembled into core tetramers; in contrast the P296T and P296E formed higher order oligomers. Fusogenic activity of full-length protein expressed in MDCK membranes and purified protein reconstituted in model membrane liposomes was determined using fluorescence quenching techniques. Fusion activity was decreased in the P296L, P296A, and P296E mutants both in endogenous MDCK membranes and in model liposomes. Collectively, these results suggest that the proline at position 296 is necessary for optimal function. Tetraspanins belong to a growing family of transmembrane proteins, with over 40 family members identified in mammals, Drosophila, and Caenorhabditis elegans (1Hemler M.E. Annu. Rev. Cell Dev. Biol. 2003; 19: 397-422Crossref PubMed Scopus (652) Google Scholar). Similar to other transmembrane 4 superfamily proteins, tetraspanins contain four transmembrane domains. Mutations of tetraspanin genes are associated with various degenerative diseases. For example, the human tetraspanin, TMS4SF/A15, is associated with mental retardation (2Zemni R. Bienvenu T. Vinet M.C. Sefiani A. Carrie A. Billuart P. McDonell N. Couvert P. Francis F. Chafey P. Fauchereau F. Friocourt G. des Portes V. Cardona A. Frints S. Meindl A. Brandau O. Ronce N. Moraine C. van Bokhoven H. Ropers H.H. Sudbrak R. Kahn A. Fryns J.P. Beldjord C. Chelly J. Nat. Genet. 2000; 24: 167-170Crossref PubMed Scopus (205) Google Scholar); furthermore over 60 mutations of the photoreceptor-specific tetraspanin, peripherin-2, result in a variety of retinal degenerative disorders (3Kohl S. Giddings I. Besch D. Apfelstedt-Sylla E. Zrenner E. Wissinger B. Acta Anatomica. 1998; 162: 75-84Crossref PubMed Google Scholar). The unique structural and functional domains of this protein family includes four to six highly conserved cysteine residues linked into two to three disulfide bonds in a highly conserved EC-2 domain. Mutations within this domain result in retinal degeneration and mental retardation. Tetraspanins also contain polar residues in the first, third, and fourth transmembrane domains postulated to be involved in protein-protein interactions necessary to form signaling complexes (4Boucheix C. Rubinstein E. Cell Mol. Life Sci. 2001; 58: 1189-1205Crossref PubMed Scopus (540) Google Scholar, 5Berditchevski F. J. Cell Sci. 2001; 114: 4143-4151Crossref PubMed Google Scholar, 6Todres E. Nardi J.B. Robertson H.M. Insect Mol. Biol. 2000; 9: 581-590Crossref PubMed Scopus (71) Google Scholar, 7Hemler M.E. J. Cell Biol. 2001; 155: 1103-1107Crossref PubMed Scopus (331) Google Scholar, 8Stipp C.S. Kolesnikova T.V. Hemler M.E. Trends Biochem. Sci. 2003; 28: 106-112Abstract Full Text Full Text PDF PubMed Scopus (359) Google Scholar). Thus tetraspanins form homo- and hetero-oligomers resulting in large multiple protein complexes or tetraspanin webs that are involved in the regulation of cell motility, fertilization, cell signaling, and fusion processes. Work in our laboratory has focused on elucidating the role of photoreceptor peripherin-2 as a membrane fusion protein. Although peripherin-2 is first the tetraspanin protein that is directly involved in promoting fusion, several other tetraspanins have important, although poorly defined, functional roles in membrane fusion. CD-9-deficient mice showed impaired egg-sperm fusion (9Le Naour F. Charrin S. Labas V. Le Caer J.P. Boucheix C. Rubinstein E. Cancer Immunol. Immunother. 2004; 53: 148-152Crossref PubMed Scopus (26) Google Scholar, 10Miyado K. Mekada E. Kobayashi K. Tanpakushitsu Kakusan Koso. 2000; 45: 1728-1734PubMed Google Scholar). Interestingly, injection of CD81 mRNA into CD9 null mouse oocytes rescued membrane fusion, suggesting that in some instances tetraspanins may functionally substitute for each other. CD81 has also been implicated in human leukemia virus 1 fusion but not HIV 1The abbreviations used are: HIV, human immunodeficiency virus; MDCK, Madin-Darby canine kidney; wt, wild type; PBS, phosphate-buffered saline; ROS, rod outer segment; PM, plasma membrane; SNARE, soluble N-ethylmaleimide-sensitive factor attachment protein receptors. fusion. More recently, both CD9 and CD81 have been shown to promote muscle cell fusion (11Tachibana I. Hemler M.E. J. Cell Biol. 1999; 146: 893-904Crossref PubMed Scopus (203) Google Scholar). The mechanism by which these proteins participate in fusion is not clear; however, the notion that these tetraspanins may have intrinsic fusogenic function has not been ruled out. Photoreceptor cells contain a unique set of tetraspanin proteins known as peripherin-2 and its nonglycosylated homologue rom-1 (12Wright M.D. Tomlinson M.G. Immunol. Today. 1994; 15: 588-594Abstract Full Text PDF PubMed Scopus (333) Google Scholar, 13Arikawa K. Molday L.L. Molday R.S. Williams D.S. J. Cell Biol. 1992; 116: 659-667Crossref PubMed Scopus (230) Google Scholar, 14Wrigley J.D. Ahmed T. Nevett C.L. Findlay J.B. J. Biol. Chem. 2000; 275: 13191-13194Abstract Full Text Full Text PDF PubMed Scopus (67) Google Scholar, 15Bascom R.A. Manara S. Collins L. Molday R.S. Kalnins V.I. McInnes R.R. Neuron. 1992; 8: 1171-1184Abstract Full Text PDF PubMed Scopus (205) Google Scholar, 16Connell G.J. Molday R.S. Biochemistry. 1990; 29: 4691-4698Crossref PubMed Scopus (141) Google Scholar). Purified peripherin-2 promotes membrane fusion with ROS plasma membrane in a cell-free assay system (17Boesze-Battaglia K. Kong F. Lamba O.P. Stefano F.P. Williams D.S. Biochemistry. 1997; 36: 6835-6846Crossref PubMed Scopus (43) Google Scholar, 18Boesze-Battaglia K. Lamba O.P. Napoli Jr., A.A. Sinha S. Guo Y. Biochemistry. 1998; 37: 9477-9487Crossref PubMed Scopus (73) Google Scholar). This system serves as a model for two key fusion-dependent events in rod cell renewal: disk morphogenesis and disk shedding (19Boesze-Battaglia K. Goldberg A.F. Int. Rev. Cytol. 2002; 217: 183-225Crossref PubMed Scopus (48) Google Scholar). Fusion is mediated through a fusion peptide domain within the C-terminal domain of peripherin-2 corresponding to residues 312–326. The amphiphilic, α-helical structure of the fusion peptide is necessary for the formation of a fusogenic oligomer of the peptide to promote the requisite steps in membrane fusion (20Boesze-Battaglia K. Stefano F.P. Fenner M. Napoli Jr., A.A. Biochim. Biophys. Acta. 2000; 1463: 343-354Crossref PubMed Scopus (25) Google Scholar, 21Stefano F.P. Krouse J. Marta P. Boesze-Battaglia K. Exp. Eye Res. 2002; 74: 267-283Crossref PubMed Scopus (8) Google Scholar). Homology among human, murine, bovine, Xenopus, and avian forms of the protein in a region upstream of the fusion peptide, residues 294–314, suggests functional importance within this region of the C terminus. A P296T substitution in this region was previously shown to enhance fusion, although the contribution of subunit assembly to the fusogenicity of that mutant was not addressed (22Cohen A.I. Invest. Ophthalmol. Vis. Sci. 1983; 24: 832-843PubMed Google Scholar). The role of peripherin-2 as a membrane fusion protein is evident in the phenotypes observed in a series of animal models of retinal degeneration. Initially, the rds (retinal degeneration slow) mouse model confirmed that disruption of the RDS tetraspanin gene caused retinal degeneration. rds homozygotes fail to develop photoreceptor outer segments and have limited phototransduction capability, and consequently, the photoreceptors undergo a slow, progressive apoptosis (23Jansen H.G. Sanyal S. J. Comp. Neurol. 1984; 224: 71-84Crossref PubMed Scopus (134) Google Scholar, 24Kedzierski W. Weng J. Travis G.H. J. Biol. Chem. 1999; 274: 29181-29187Abstract Full Text Full Text PDF PubMed Scopus (31) Google Scholar). Mice heterozygous for the rds defect develop shortened outer segments, which are abnormally phagocytosed. In vivo evidence in support of a peripherin-2 C-terminally mediated function comes from three mouse models of RDS action. Data from a chimeric mouse line expressing the D-2 loop of peripherin-2 in the context of rom-1 suggests that functional efficacy is not restricted to the D-2 loop (26Goldberg A.F. Molday R.S. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13726-13730Crossref PubMed Scopus (105) Google Scholar). The dominant negative phenotype of the codon 307-del mouse model of RP, in which the C-terminal domain is altered, shows a more rapid retinopathy than the rds –/–, suggesting that the C terminus of peripherin-2 contains a unique functional domain that contributes to the degenerative process (25McNally N. Kenna P.F. Rancourt D. Ahmed T. Stitt A. Colledge W.H. Lloyd D.G. Palfi A. O'Neill B. Humphries M.M. Humphries P. Farrar G.J. Hum. Mol. Genet. 2002; 11: 1005-1016Crossref PubMed Scopus (41) Google Scholar). Lastly, the haplo-insufficiency mouse model argues that two functional alleles are necessary to assemble the ROS. Collectively, although the phenotypes are complex, these in vivo studies coupled with in vitro work (18Boesze-Battaglia K. Lamba O.P. Napoli Jr., A.A. Sinha S. Guo Y. Biochemistry. 1998; 37: 9477-9487Crossref PubMed Scopus (73) Google Scholar, 19Boesze-Battaglia K. Goldberg A.F. Int. Rev. Cytol. 2002; 217: 183-225Crossref PubMed Scopus (48) Google Scholar, 20Boesze-Battaglia K. Stefano F.P. Fenner M. Napoli Jr., A.A. Biochim. Biophys. Acta. 2000; 1463: 343-354Crossref PubMed Scopus (25) Google Scholar, 21Stefano F.P. Krouse J. Marta P. Boesze-Battaglia K. Exp. Eye Res. 2002; 74: 267-283Crossref PubMed Scopus (8) Google Scholar) provide support for the classification of peripherin-2 as the first tetraspanin fusion protein. In this study we have advanced our hypothesis that the C-terminal domain of peripheirn-2 is a unique functional domain of this protein and possibly other tetraspanins. In this regard we have shown that a single amino acid substitution at position 296 from a proline to an alanine, leucine, or glutamic acid inhibits membrane fusion, whereas substitution to threonine enhances fusion but abrogates normal subunit assembly. Collectively, these studies suggest that this highly conserved region of peripherin-2 may play a role in regulating fusion activity. Preparation of Human Peripherin-2 cDNA Mutants and Expression Constructs—Human peripherin-2 cDNA flanked by NotI restriction sites was subcloned into the multiple cloning site of pGEMEX-2 bacterial expression vector (Promega). Single amino acid substitutions were made using the GeneEditor in vitro site-directed mutagenesis system (Promega). wt template DNA was prepared through transformation of JM109 competent Escherichia coli cells (Promega) with 10 ng of the peripherin-2 pGemex-2 construct and subsequent plasmid DNA purification using a Qiaprep spin miniprep kit (Qiagen). Custom primers were obtained from Integrated DNA Technologies, Inc. as 100-nmol oligonucleotides using standard desalting. Mutagenic oligonucleotides were designed corresponding to the coding strand of peripherin-2 to contain ∼50% GC content and a Tm of <75 °C. The mutagenic primers used to change the proline at position 296 to alanine and leucine are indicated by the sequences 5′-GTGTCCAACGCCGAGGAATC-3′ and 5′-GTCCAACCTCGAGGAATC-3′. Generation of the P296E mutant required a 27-base primer: 5′GGTGTGTCCAACGAGGAGGAATCTGAG-3′. The mutagenic primers were 5′-phosphorylated and used in combination with the bottom strand selection oligonucleotide provided in the GeneEditor kit. The mutations were verified by sequence analysis (Davis Sequencing). The 1.1-kb wt and mutant peripherin-2 cDNA NotI fragments were subcloned into the NotI site of the multiple cloning site of the pcDNA 3.1 His B mammalian expression vector (Invitrogen). The correct orientation of the peripherin-2 NotI fragments in the vector was confirmed through restriction enzyme analysis by digestion with SstI (New England Biolabs). Cell Culture and DNA Transfections—MDCK strain II cells (ATCC) were maintained in Eagle's minimum essential media containing Eagle's salts and l-glutamine, supplemented with 10% fetal bovine serum, 100 units/ml penicillin, 100 μg/ml streptomycin, 1 mm sodium pyruvate, and 1% nonessential amino acids at 37 °C in 5% CO2 (all reagents from Sigma). The cells were seeded 2 days before transient transfections in 150-cm2 tissue culture flasks, allowing the cells to reach 70–80% confluency at the time of transfection. Transfections were performed using Optimem I media with no serum or antibiotics. Peripherin-2 used for fusion analyses was obtained from cells transfected with Lipofectamine (Invitrogen). For each transfection, 10 μg of DNA and 23 μl of Lipofectamine 2000 (Invitrogen) was used. The cells were incubated for 3 h at 37 °C with the transfection complexes, and the medium was replaced with the complete culture medium. Proteins for sedimentation velocity assay were isolated from cells transfected with FuGENE (Roche Applied Science). 12 μg of DNA and 108 μl of FuGENE were added followed by incubation for 5 h. Then the Optimem I medium with transfection complexes was replaced with the complete culture medium. In both cases, the cells were harvested by scraping in PBS 48 h post-transfection. Purification of Peripherin-2—Five confluent 150-cm2 flasks of MDCK cells expressing either wt or the proline 296 mutants of peripherin-2 were harvested in PBS, pelleted, and resuspended in native binding buffer consisting of 20 mm sodium phosphate, 500 mm NaCl, and 30 mm octylglucoside, pH 7.4. The cell lysates were sonicated three times for 10 s each time, and His-tagged peripherin-2 His6-peripherin/rds was purified using the Xpress purification system under native conditions (protocol as provided by Invitrogen). Protein was eluted from the column with increasing concentrations of imidazole (50, 200, 350, and 500 mm). The eluted fractions were concentrated using Centricon 30 concentrators to 1 ml. Typically the yield of Xpress peripherin-2 from five confluent 150-cm2 flasks cells was between 0.4 and 1.0 mg. The purity of the protein was confirmed by SDS-PAGE and Western blot analysis using anti-Xpress antibody. Velocity Sedimentation Assay—Sedimentation coefficient (S20,w) estimates were made in a Beckman Optima LE-80K ultracentrifuge using a SW 50.1 rotor essentially as described by Goldberg and Molday (26Goldberg A.F. Molday R.S. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 13726-13730Crossref PubMed Scopus (105) Google Scholar), with the following modifications. The purified Xpress tagged wild type peripherin-2 and P296T, P296A, P296L, and P296E mutant samples were loaded onto a 5–20% (w/w) sucrose gradient and centrifuged for 20 h at 40,000 rpm. Sucrose gradient fractions (∼250 μl) were collected from the bottom of the gradient by peristaltic elution through the capillary micropipette. Sedimentation profiles of fractionated sucrose gradients were determined by chemiluminescent Western blotting using anti-X-press antibody (Invitrogen). Digital analysis of Western blots was performed using Kodak Image Station 440CF. The following equations (27Martin R.G. Ames B.N. J. Biol. Chem. 1961; 236: 1372-1379Abstract Full Text PDF PubMed Google Scholar) were used to calculate the sedimentation coefficient,STm=(dr/dt)/ω2r (Eq. 1) in which STm is the sedimentation coefficient S at a given temperature T in a solvent, dr/dt is the distance traveled by the sample over time in mm/s, ω is the angular velocity of the rotor in radians/s, and r is the distance from the axis of rotation in mm. S20,w=STmηTm(1/ω−ρ20,w)η20,w(1/ω−ρTm)(Eq. 2) where S20,w is the sedimentation coefficient ST corrected to the “standard state” of water at 20 °C, ηTm and ρTm are the viscosity and density, respectively, of the medium m at the temperature T of the experiment, and η20,w and ρ20,w are the viscosity and density of water at 20 °C. Partial specific volume (ν) of the analyzed proteins were assumed to be 0.83 ml/g (28Goldberg A.F. Loewen C.J. Molday R.S. Biochemistry. 1998; 37: 680-685Crossref PubMed Scopus (102) Google Scholar). Preparation of F18-labeled Recombinant Liposomes—Vesicles consisting of phosphatidylcholine:phosphatidylethanolamine:phosphatidylserine:cholesterol in a 4:4:1:1 mole ratio and 1 mol % F18 were prepared as described (29Struck D.K. Hoekstra D. Pagano R.E. Biochemistry. 1981; 20: 4093-4099Crossref PubMed Scopus (1138) Google Scholar, 30Boesze-Battaglia K. Albert A.D. Yeagle P.L. Biochemistry. 1992; 31: 3733-3738Crossref PubMed Scopus (18) Google Scholar, 31Bartlett G.R. J. Biol. Chem. 1959; 234: 466-468Abstract Full Text PDF PubMed Google Scholar). The lipids were cosolubilized in chloroform, dried under N2, lyophilized, and resuspended in 10 mm Hepes, pH 7.4. The lipid suspension was sonicated three times for 3 min each using a probe sonicator to form small unilamellar vesicles. A final volume of 1 ml of vesicles was added to purified Xpress peripherin-2, which was detergent solubilized in 20 mm octylglucoside while vortexing (32Boesze-Battaglia K. Albert A.D. Exp. Eye Res. 1989; 49: 699-701Crossref PubMed Scopus (66) Google Scholar). A 1:100 nmol ratio of purified protein:vesicle phospholipid was used for all recombinants. The recombined membranes were dialyzed for 72 h against 10 mm Hepes, 100 mm NaCl and for 10 h in the presence of Bio-Beads (Sigma) to remove all traces of detergent. The recombined membranes were separated from unincorporated proteins and pure lipid vesicles on a 5–40% (w/w) sucrose density gradient spun at 25,000 rpm overnight at 4 °C. The Xpress peripherin-2-LUV recombinants were isolated from the sucrose gradients. These recombinants were spun down at 60,000 K for 20 min and resuspended in 10 mm Hepes, pH 7.4, prior to fusion assays. All of the recombinants were assayed for total phosphate (33Partearroyo M.A. Cabezon E. Nieva J.L. Alonso A. Goni F.M. Biochim. Biophys. Acta. 1994; 1189: 175-180Crossref PubMed Scopus (8) Google Scholar) and protein (Bio-Rad). Preparation of F18-labeled Total Cell Membranes from Peripherin-2-transfected MDCK Cells—Five confluent 150-cm2 flasks of MDCK cells were transfected with wt and mutant peripherin-2 as described above. The cells were harvested by scraping in homogenizing buffer (100 mm monobasic sodium phosphate, 1 mm dithiothreitol, 1 μg/ml of leupeptin, and 2 μg/ml of aprotinin, pH 7.4), pelleted (1,000 rpm for 5 min), and resuspended in 4 ml of homogenizing buffer. The cells were then lysed by passage through a 26-gauge needle twice and sonicated three times for 10 s. Homogenized cell lysates were layered onto a single layer 30% sucrose gradient (30% sucrose (w/w) in homogenizing buffer) and spun at 25,000 rpm for 20 min at 4 °C in a SW28 Beckman ultracentrifuge rotor. The plasma membrane fraction was collected from the first interface and pelleted by centrifugation (50,000 rpm for 30 min at 4 °C), and the membranes were resuspended in 1 ml of 10 mm Hepes, pH 7.4. The membranes were labeled with 1 mol % F18 (1 mg/ml in ethanol) while vortexing and incubated at 37 °C for 30 min in subdued light. Unincorporated label was removed with the addition of 500 μl of 2% bovine serum albumin incubating for 10 min at 37 °C and recovering labeled membranes by spinning at 50,000 rpm for 30 min at 4 °C. The pellets were resuspended in 500 μl of 10 mm Hepes, pH 7.4. Preparation R18-labeled of Rod Outer Segment Plasma Membranes (ROS-PMs)—Bovine ROS plasma membrane vesicles were isolated in the dark from frozen bovine retinas (Lawson, Lincoln, NE) as described previously (34Goldberg A.F. Fales L.M. Hurley J.B. Khattree N. J. Biol. Chem. 2001; 276: 42700-42706Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). Purified plasma membrane was resuspended in 2 ml of 10 mm Hepes, 0.5 m NaCl and labeled with 50 μl of R18 (2 mg/ml solution in ethanol) while vortexing and then incubated at 37 °C for 1 h to incorporate the fluorescent label. Unincorporated R18 label was separated from labeled PM on a Sephadex G-50 size exclusion column as described (31Bartlett G.R. J. Biol. Chem. 1959; 234: 466-468Abstract Full Text PDF PubMed Google Scholar). Resonance Energy Transfer Fusion Assay—Fusion between R18-labeled plasma membrane and F18-labeled cell membranes or F18-labeled recombinant vesicles was measured using a fluorescence resonance energy transfer assay (35Goldberg A.F. Moritz O.L. Molday R.S. Biochemistry. 1995; 34: 14213-14219Crossref PubMed Scopus (97) Google Scholar) at room temperature on a PerkinElmer Life Sciences 50B spectrofluorometer (Gaithersburg, MD). Fusion was initiated with the addition of R18-labeled plasma membranes to F18-labeled membranes already present in the well. Fluorescence intensity was measured at λex = 460 nm (F18 excitation) and at λem = 524 nm (F18 emission) and λem = 592 nm (R18 emission) over a 2-min period. The extent of fusion was calculated as the change in R18 intensity over time as described (36Loewen C.J. Molday R.S. J. Biol. Chem. 2000; 275: 5370-5378Abstract Full Text Full Text PDF PubMed Scopus (103) Google Scholar). The change in R18 intensity (ΔR) at a given time was computed as follows. ΔR=(I592/I524+I592)T−(I592/I524+I592)I (Eq. 3) I524 and I592 are the fluorescence intensities at 524 and 592 nm, respectively. The subscripts T and I represent a given time point and the initial time point of each sample, respectively. The percentage of change in R18, indicated in the graphs as the percentage of fusion, was determined by multiplying each ΔR value by 100. The fusion values were normalized for peripherin-2 content. Total cell membrane fusion values represent total fusion/mg of peripherin-2 as determined by densitometry of anti-Xpress Western blots of isolated MDCK cell membranes. In the figures, the percentage of fusion values are normalized to the total percentage of fusion seen with wild type, which is set at 100% of wild type fusion. Western Blot Analysis—MDCK cell lysates, purified peripherin-2, and total cell membranes isolated from MDCK cells were mixed in a 1:1 ratio with 2× SDS sample buffer and separated on 10–15% SDS-PAGE and transferred to nitrocellulose for Western blot analysis. For trypsin treatment of total cell membrane fractions, total protein content of the membranes was determined, and a 3× excess μg amount of trypsin was added, followed by incubation at 37 °C for 30 min. Western blots were probed with a 1:2500 dilution of anti-Xpress primary antibody and a 1:1000 dilution of goat anti-mouse IgG horseradish peroxidase-conjugated secondary antibody (Amersham Biosciences). Western blots were visualized by enhanced chemiluminescence (Supersignal ECL; Pierce). Immunohistochemistry of Peripherin-2-transfected MDCK Cells—For immunohistochemistry, MDCK cells were seeded on sterilized glass coverslips in 6-well plates and grown for 24 h. The cells were transiently transfected with wt or mutant peripherin-2 using Lipofectamine 2000 as described above. Twenty-four hours post-transfection, the cells were washed in PBS containing 2 mm MgCl2 and 0.2 mm CaCl2 (PBS-C/M). For surface staining, the intact cells were incubated with a 1:500 dilution of anti-Xpress antibody for 1 h. The cells were then fixed in 2% paraformaldehyde for 30 min at 4 °C, rinsed in PBS-C/M, quenched with 50 mm glycine for 10 min at 4 °C, and rinsed in PBS-C/M. The cells were subsequently incubated for 1 h with goat anti-mouse IgG Alexa Fluor 488 secondary antibody at a concentration of 10 μg/ml (Molecular Probes). For permeabilized cell staining, the cells were fixed in a 1:1 methanol/acetone solution for 2 min prior to the 1-h incubation with anti-Xpress primary antibody. The cells were rinsed with PBS-C/M and then incubated with secondary antibody as described above. The samples were analyzed on a Zeiss AXIOSKOP fluorescent microscope, capturing images at the magnifications indicated in the figures. Statistical Analysis—Analysis of variance was first performed to test whether there is any difference among groups. When a significant difference was found from analysis of variance, pairwise, post-hoc t testing (Dunnett's t test) of each mutant with wild type peripherin-2 was performed while controlling for the overall type I error. All of these statistical analyses were perform using SAS 9.1 (SAS Institute, Cary, NC). Peripherin-2 and Pro296 Mutants Are Heterologously Expressed in and Localized to Intracellular Membranes of MDCK Cells—To determine whether regions upstream of the fusion peptide are necessary for fusogenic function, we generated four human peripherin-2 mutants bearing single amino acid substitutions of proline at position 296. These substitutions include P296T, P296A, P296L, and P296E and were chosen to alter the polarity, size, and charge of this region. The mutants contained an N-terminal Xpress epitope tag and a poly-His6 tag at the N terminus to allow for detection and purification of the proteins. Each of the four Pro296 mutant expression plasmids was transiently transfected individually into MDCK cells. The His6-tagged proteins were purified by nickel column chromatography, and protein expression was assessed by Western blot analysis using anti-Xpress antibody. As shown in Fig. 1, wt peripherin-2 migrated as an 84–86-kDa dimer under nonreducing conditions, with the majority reduced to a 41–43-kDa monomer in the presence of β-mercaptoethanol. Similarly, the four mutants typically migrated as 84–86-kDa dimers under nonreducing denaturing conditions. A fraction of the dimers was reduced to 41–43-kDa monomers in all cases, with all of the expressed P296E protein reduced to the monomeric form. Two mutants, the P296T and the P296L proteins, showed slower migrating proteins consistent with higher order aggregates in the range of 120–220 kDa. Similar pattern of higher order complex formation is not unexpected and was observed in case of insertional mutants: IM5, IM7, and IM11 expressed in COS-1 cells (37Epand R.M. Biochim. Biophys. Acta. 2003; 1614: 116-121Crossref PubMed Scopus (226) Google Scholar). Thus peripherin-2 was successfully expressed in MDCK cells, and peripherin-2 mutants form disulfide-linked dimers. These observations are consistent with data from other investigations of the protein in vivo and in other cell expression systems (38Travis G.H. Sutcliffe J.G. Bok D. Neuron. 1991; 6: 61-70Abstract Full Text PDF PubMed Scopus (242) Google Scholar, 39Ritter L.M. Boesze-Battaglia K. Tam B.M. Moritz O.L. Khattree N. Chen S.-C. Goldberg A.F. J. Biol. Chem. 2004; 279: 39958-39967Abstract Full Text Full Text PDF PubMed Scopus (23) Google Scholar). We next focused our attention on the localization pattern of wt and Pro296 mutants in MDCK cells. As shown in Fig. 2, MDCK cells transfected with wt and Xpress peripherin-2 Pro296 mutants all show a distinct subcellular localization pattern. Peripherin-2, the P296A, P296L, and P296E mutants all exhibited a stereotypical Golgi localization pattern, forming a small cap over the nuclei of expressing MDCK cells. In contrast t

The C-terminus of the intracellular retinal rod outer segment disk protein peripherin-2 binds to membranes, adopts a helical conformation, and promotes membrane fusion, which suggests an analogy to the structure and function of viral envelope fusion proteins. Nuclear magnetic resonance (NMR) data and fluorescence data show that a 63-residue polypeptide comprising the C-terminus of bovine peripherin-2 (R284−G346) binds to the membrane mimetic, dodecylphosphocholine micelles. High-resolution NMR studies reveal that although this C-terminal fragment is unstructured in solution, the same fragment adopts helical structure when bound to the micelles. The C-terminus may be a member of the class of intrinsically unstructured protein domains. Using methods developed for the G-protein coupled receptor rhodopsin, a model for the structure of the transmembrane domain of peripherin-2 was constructed. Previously published data showed that both peripherin-2 and viral fusion proteins are transmembrane proteins that promote membrane fusion and have a fusion peptide sequence within the protein that independently promotes membrane fusion. Furthermore, the fusion-active sequence of peripherin-2 exhibits a sequence motif that matches the viral fusion peptide of influenza hemagglutinin (HA). These observations collectively suggest that the mechanism of intracellular membrane fusion induced by peripherin-2 and the mechanism of enveloped viral fusion may have features in common.

Numerous biochemical and morphological studies have provided insight into the distribution pattern of caveolin-1 and the presence of membrane rafts in the vertebrate retina. To date however, studies have not addressed the localization profile of raft specific proteins during development. Therefore the purpose of our studies was to follow the localization pattern of caveolin-1, phospho-caveolin-1 and c-src in the developing retina and compare it to that observed in adults. Specific antibodies were used to visualize the distribution of caveolin-1, c-src, a kinase phosphorylating caveolin-1, and phospho-caveolin-1. The labeling pattern of this scaffolded complex was compared to those of rhodopsin and rhodopsin kinase. Samples were analyzed at various time points during postnatal development and compared to adult retinas. The immunocytochemical studies were complemented with immunoblots and immunoprecipitation studies. In the mature retina caveolin-1 and c-src localized mainly to the cell body and IS of photoreceptors, with only very weakly labeled OS. In contrast, phospho-caveolin-1 was only detectable in the OS of photoreceptors. During development we followed the expression and distribution profile of these proteins in a temporal sequence with special attention to the period when OS formation is most robust. Double labeling immunocytochemistry and immunoprecipitation showed rhodopsin to colocalize and co-immunoprecipitate with caveolin-1 and c-src. Individual punctate structures between the outer limiting membrane and the outer plexiform layer were seen at P10 to be labeled by both rhodopsin and caveolin-1 as well as by rhodopsin and c-src, respectively. These studies suggest that membrane raft specific proteins are co-distributed during development, thereby pointing to a role for such complexes in OS formation. In addition, the presence of small punctate structures containing caveolin-1, c-src and rhodopsin raise the possibility that these proteins may transport together to OS during development and that caveolin-1 exists predominantly in a phosphorylated form in the OS.

It is well established that mast cells play a key regulatory role in allergy and inflammation involving engagement of antigen with IgE bound to high-affinity IgE receptors (FcεRI). The most aggressive efforts in regulating mast cell function have focused on selectively inhibiting cell activation and subsequent mediator synthesis and release, or alternatively, blocking the action of proinflammatory mediators in order to prevent or reduce disease severity. More recently, the goal for rationally designed pharmacotherapy has shifted focus to targeting and disrupting signaling pathways leading to inhibition of specific cell function(s). In this context, the PI-3K/PIP3/Akt pathway represents a potent target for pharmacologic intervention in mast cell-mediated inflammatory disorders. A pivotal component of this cascade is the activation of phosphatidylinositol-3-kinase (PI-3K) leading to a rise in intracellular levels of phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 has broad effects on mast cell signaling and function as well as on proliferation and survival. We propose that PIP3 represents a potent target for developing therapeutic approaches to down regulate mast cell function and, in turn, reduce the severity of mast cell dependent disease. In this article we review approaches that have been taken to regulate the PI-3K pathway in mast cells. Moreover, we review a novel approach to target the signaling lipid, PIP3, and deplete intracellular levels of this phosphoinositol using a chimeric toxin composed of the FcεRI binding region of IgE and the active subunit of the cytolethal distending toxin, CdtB, which we have recently demonstrated to function as a PIP3 phosphatase.

The Aggregatibacteractinomycetemcomitans cytolethal distending toxin (Cdt) induces lymphocytes to undergo cell-cycle arrest and apoptosis; toxicity is dependent upon the active Cdt subunit, CdtB. We now demonstrate that p21CIP1/WAF1 is critical to Cdt-induced apoptosis. Cdt induces increases in the levels of p21CIP1/WAF1 in lymphoid cell lines, Jurkat and MyLa, and in primary human lymphocytes. These increases were dependent upon CdtB's ability to function as a phosphatidylinositol (PI) 3,4,5-triphosphate (PIP3) phosphatase. It is noteworthy that Cdt-induced increases in the levels of p21CIP1/WAF1 were accompanied by a significant decline in the levels of phosphorylated p21CIP1/WAF1. The significance of Cdt-induced p21CIP1/WAF1 increase was assessed by preventing these changes with a two-pronged approach; pre-incubation with the novel p21CIP1/WAF1 inhibitor, UC2288, and development of a p21CIP1/WAF1-deficient cell line (Jurkatp21-) using clustered regularly interspaced short palindromic repeats (CRISPR)/cas9 gene editing. UC2288 blocked toxin-induced increases in p21CIP1/WAF1, and JurkatWT cells treated with this inhibitor exhibited reduced susceptibility to Cdt-induced apoptosis. Likewise, Jurkatp21- cells failed to undergo toxin-induced apoptosis. The linkage between Cdt, p21CIP1/WAF1, and apoptosis was further established by demonstrating that Cdt-induced increases in levels of the pro-apoptotic proteins Bid, Bax, and Bak were dependent upon p21CIP1/WAF1 as these changes were not observed in Jurkatp21- cells. Finally, we determined that the p21CIP1/WAF1 increases were dependent upon toxin-induced increases in the level and activity of the chaperone heat shock protein (HSP) 90. We propose that p21CIP1/WAF1 plays a key pro-apoptotic role in mediating Cdt-induced toxicity.

Photoreceptor peripherin/rds promotes membrane fusion, through a putative fusion domain located within the C-terminus (Boesze-Battaglia et al., Biochemistry 37 (1998) 9477-9487). A peptide analogue to this region, PP-5, competitively inhibits peripherin/rds mediated fusion in a cell free assay system. To characterize how this region is involved in the fusion process we investigated two of the individual steps in membrane fusion, membrane adhesion and membrane destabilization inferred from depolarization studies. Membrane depolarization was measured as the collapse of a valinomycin induced K(+) diffusion potential in model membranes, using a potential sensitive fluorescent probe, diS-C(2)-5. PP-5 induced membrane depolarization in a concentration dependent manner. PP-5 has been shown by Fourier transform infrared spectroscopy to be an amphiphilic alpha-helix. Therefore, the requirement for an amphiphilic alpha-helix to promote depolarization was tested using two mutant peptides designed to disrupt either the amphiphilic nature of PP-5 (PP-5AB) or the alpha-helical structure (PP-5HB). PP-5AB inhibited PP-5 induced depolarization when added in an equimolar ratio to PP-5. Neither mutant peptide alone or in combination with PP-5 had any effect on calcium dependent vesicle aggregation. Using non-denaturing gel electrophoresis and size exclusion chromatography techniques PP-5 was shown to form a tetrameric complex. Equimolar mixtures of PP-5 and PP-5AB formed a heterotetramer which was unable to promote membrane depolarization. The hypothesis that PP-5 tetramers promote membrane depolarization is consistent with the calculated Hill coefficient of 3.725, determined from a Hill analysis of the depolarization data.

Peripherin/rds (p/rds), an integral membrane protein from the transmembrane 4 (TMF4) superfamily, possesses a multi-functional C-terminal domain that plays crucial roles in rod outer segment (ROS) disk renewal and structure. Here, we report that the calcium binding protein calmodulin (CaM) binds to the C-terminal domain of p/rds. Fluorescence spectroscopy reveals Ca2+-dependent association of CaM with a polypeptide corresponding to the C-terminal domain of p/rds. The fluorescence anisotropy of the polypeptide upon CaM titration yields a dissociation constant (KD) of 320 ± 150 nM. The results of the fluorescence experiments were confirmed by GST-pull down analyses in which a GST-p/rds C-terminal domain fusion protein was shown to pull down CaM in a calcium-dependent manner. Moreover, molecular modeling and sequence predictions suggest that the CaM binding domain resides in a p/rds functional hot spot, between residues E314 and G329. Predictions were confirmed by peptide competition studies and a GST-p/rds C-terminal domain construct in which the putative Ca2+/CaM binding site was scrambled. This GST-polypeptide did not associate with Ca2+/CaM. This putative calmodulin domain is highly conserved between human, mouse, rat, and bovine p/rds. Finally, the binding of Ca2+/CaM inhibited fusion between ROS disk and ROS plasma membranes as well as p/rds C-terminal-domain-induced fusion in model membrane studies. These results offer a new mechanism for the modulation of p/rds function.

Humans with Hermansky-Pudlak Syndrome (HPS) or ocular albinism (OA1) display abnormal aspects of organelle biogenesis. The multigenic disorder HPS displays broad defects in biogenesis of lysosome-related organelles including melanosomes, platelet dense granules, and lysosomes. A phenotype of ocular pigmentation in OA1 is a smaller number of macromelanosomes, in contrast to HPS, where in many cases the melanosomes are smaller than normal. In these studies we define the role of the Mreg(dsu) gene, which suppresses the coat color dilution of Myo5a, melanophilin, and Rab27a mutant mice in maintaining melanosome size and distribution. We show that the product of the Mreg(dsu) locus, melanoregulin (MREG), interacts both with members of the HPS BLOC-2 complex and with Oa1 in regulating melanosome size. Loss of MREG function facilitates increase in the size of micromelanosomes in the choroid of the HPS BLOC-2 mutants ruby, ruby2, and cocoa, while a transgenic mouse overexpressing melanoregulin corrects the size of retinal pigment epithelium (RPE) macromelanosomes in Oa1(ko/ko) mice. Collectively, these results suggest that MREG levels regulate pigment incorporation into melanosomes. Immunohistochemical analysis localizes melanoregulin not to melanosomes, but to small vesicles in the cytoplasm of the RPE, consistent with a role for this protein in regulating membrane interactions during melanosome biogenesis. These results provide the first link between the BLOC pathway and Oa1 in melanosome biogenesis, thus supporting the hypothesis that intracellular G-protein coupled receptors may be involved in the biogenesis of other organelles. Furthermore these studies provide the foundation for therapeutic approaches to correct the pigment defects in the RPE of HPS and OA1.

Aggregatibacter actinomycetemcomitans is a common inhabitant of the upper aerodigestive tract of humans and non-human primates and is associated with disseminated infections, including lung and brain abscesses, pediatric infective endocarditis, and localized aggressive periodontitis. Aggregatibacter actinomycetemcomitans secretes a repeats-in-toxin protein, leukotoxin, which exclusively kills lymphocyte function-associated antigen-1-bearing cells. The toxin's pathological mechanism is not fully understood; however, experimental evidence indicates that it involves the association with and subsequent destabilization of the target cell's plasma membrane. We have long hypothesized that leukotoxin secondary structure is strongly correlated with membrane association and destabilization. In this study, we tested this hypothesis by analysing lipid-induced changes in leukotoxin conformation. Upon incubation of leukotoxin with lipids that favor leukotoxin-membrane association, we observed an increase in leukotoxin α-helical content that was not observed with lipids that favor membrane destabilization. The change in leukotoxin conformation after incubation with these lipids suggests that membrane binding and membrane destabilization have distinct secondary structural requirements, suggesting that they are independent events. These studies provide insight into the mechanism of cell damage that leads to disease progression by A. actinomycetemcomitans.

Summary The Aggregatibacter actinomycetemcomitans cytolethal distending toxin (Cdt) induces G2 arrest and apoptosis in lymphocytes and other cell types. We have shown that the active subunit, CdtB, exhibits phosphatidylinositol‐3,4,5‐triphosphate ( PIP 3) phosphatase activity and depletes lymphoid cells of PIP 3. Hence we propose that Cdt toxicity results from depletion of this signaling lipid and perturbation of phosphatidylinositol‐3‐kinase ( PI ‐3K)/ PIP 3/Akt signaling. We have now focused on the relationship between cell susceptibility to CdtB and differences in the status of baseline PIP 3 levels. Our studies demonstrate that the baseline level of PIP 3, and likely the dependence of cells on steady‐state activity of the PI ‐3K signaling pathway for growth and survival, influence cell susceptibility to the toxic effects of Cdt. Jurkat cells with known defects in both PIP 3 degradative enzymes, PTEN and SHIP 1, not only contain high baseline levels of PIP 3, pA kt, and pGSK 3β, but also exhibit high sensitivity to Cdt. In contrast, HUT 78 cells, with no known defects in this pathway, contain low levels of PIP 3, pA kt, and pGSK 3β and likely minimal dependence on the PI ‐3K signaling pathway for growth and survival, and exhibit reduced susceptibility to Cdt. These differences in susceptibility to Cdt cannot be explained by differential toxin binding or internalization of the active subunit. Indeed, we now demonstrate that Jurkat and HUT 78 cells bind toxin at comparable levels and internalize relatively equal amounts of CdtB. The relevance of these observations to the mode of action of Cdt and its potential role as a virulence factor is discussed.

Ameloblastoma is an aggressive odontogenic jaw neoplasm. Its unlimited growth confers high potential for malignant transformation and recurrence. It is unclear why ameloblastoma is highly recurrent despite surgical resection with a wide margin of normal tissue. While canonical autophagy can be used to degrade and eliminate damaged cellular components, it is also a protective mechanism that provides energy and vital metabolites for cell survival. We used ameloblastoma-derived cells to test the hypothesis that autophagic processes play a role in survival and reactivation of ameloblastoma. Primary epithelial (EP-AMCs) and mesenchymal (MS-AMCs) ameloblastoma-derived cells were established from tissue samples of solid multicystic ameloblastoma. Clonogenic capacity and basal autophagic capacity were assessed in ameloblastoma-derived cells relative to human odontoma-derived cells (HODCs) and maxilla-mesenchymal stem cells (MX-MSCs). Ability of ameloblastoma-derived cells to survive and form new ameloblastoma was assessed in mouse tumor xenografts. EP-AMCs were highly clonogenic (p < 0.0001) and demonstrated enhanced basal levels of autophagic proteins microtubule-associated protein 1-light chain 3 (LC3) (p < 0.01), p62 (Sequestosome 1, SQSTM1) (p < 0.01), and the LC3-adapter, melanoregulin (MREG) (p < 0.05) relative to controls. EP-AMCs xenografts regenerated solid ameloblastoma-like tumor with histological features of columnar ameloblast-like cells, loose stellate reticulum-like cells and regions of cystic degeneration characteristic of follicular variant of solid multicystic ameloblastoma. The xenografts also displayed stromal epithelial invaginations strongly reactive to LC3 and p62 suggestive of epithelial-mesenchymal transition and neoplastic odontogenic epithelium. EP-AMCs exhibit altered autophagic processes that can support survival and recurrence of post-surgical ameloblastoma cells.

Visual function depends on the intimate structural, functional and metabolic interactions between the retinal pigment epithelium (RPE) and the neural retina. The daily phagocytosis of the photoreceptor outer segment tips by the overlaying RPE provides essential nutrients for the RPE itself and photoreceptors through intricate metabolic synergy. Age-related retinal changes are often characterized by metabolic dysregulation contributing to increased lipid accumulation and peroxidation as well as the release of proinflammatory cytokines. LGM2605 is a synthetic lignan secoisolariciresinol diglucoside (SDG) with free radical scavenging, antioxidant and anti-inflammatory properties demonstrated in diverse in vitro and in vivo inflammatory disease models. In these studies, we tested the hypothesis that LGM2605 may be an attractive small-scale therapeutic that protects RPE against inflammation and restores its metabolic capacity under lipid overload. Using an in vitro model in which loss of the autophagy protein, LC3B, results in defective phagosome degradation and metabolic dysregulation, we show that lipid overload results in increased gasdermin cleavage, IL-1 β release, lipid accumulation and decreased oxidative capacity. The addition of LGM2605 resulted in enhanced mitochondrial capacity, decreased lipid accumulation and amelioration of IL-1 β release in a model of defective lipid homeostasis. Collectively, these studies suggest that lipid overload decreases mitochondrial function and increases the inflammatory response, with LGM2605 acting as a protective agent.

Royal College of Surgeons (RCS) rats exhibit an hereditary defect in phagocytosis of the tips of the photoreceptor cell rod outer segments (ROS) which leads to degeneration of the retinal visual cells. The lipid composition of outer segment membranes of these rats was analysed and compared to those of normal rats to determine whether there are differences between the normal and mutant rat ROS. The cholesterol distribution in ROS disk membranes from normal and RCS rats was investigated using a digitonin induced change in membrane density. Normal rat ROS disks varied in cholesterol to phospholipid mole ratio from 0·36 to 0·03. The disk membranes from RCS rats, however, do not exhibit the same marked cholesterol heterogeneity. The mean molar ratio of cholesterol to phospholipid in the disk membranes of normal rats is 0·11 while that found in the RCS rats is 0·14. The ROS plasma membrane of dystrophic rats also has a lower cholesterol to phospholipid ratio (0·20) than is found in the normal rat (0·40). The phospholipid headgroup composition of RCS disks and plasma membrane were determined, RCS disks were shown to differ from those of normal animals. The cholesterol content of ROS disks may be governed by the phospholipid composition.

Traditionally, lipid rafts have been defined by their insolubility in ice-cold Triton X-100 and low-buoyant density. These low-density membrane microdomains have been referred to as detergent-resistant membranes, Triton-insoluble membranes, and Triton-insoluble floating fraction. They are enriched in cholesterol, often sphingomyelin and various gangliosides (GMI, GM2, and GM3). The ability of the B-subunit of cholera toxin to bind GMI has been exploited to visualize membrane rafts by confocal microscopy in patching and capping experiments. Biochemically, membrane rafts are isolated by solubolization in ice-cold Triton X-100 and separation of the low-buoyant density fractions from soluble material on sucrose density gradients. We describe the isolation of Jurkat cell-specific membrane rafts using 2% Triton X-100. This procedure yielded a consistent raft product that was enriched in cholesterol, gangliosides sphingomyelin and membrane raft protein markers including lck and lat 1. Moreover, rafts were visualized using Alexa Fluor 647 cholera toxin capped with anti-cholera toxin antibody. Co-localization of the C subunit of cytolethal distending toxin to rafts was determined using patching techniques.

Photoreceptor outer segment (OS) renewal requires a series of tightly regulated membrane fusion events which are mediated by a fusion complex containing protein and lipid components. The best characterized of these components, is a unique photoreceptor specific tetraspanin, peripherin/rds (P/rds, a.k.a., peripherin-2, Rds and Prph). In these studies we investigated the role of peripherin's non-glycosylated homolog, ROM-1, in OS fusion using a COS cell heterologous expression system and a well characterized cell free fusion assay system. Membranes isolated from COS-7 cells transfected with either FLAG-tagged P/rds or HA-tagged ROM-1 or both proteins were assayed for their ability to merge with fluorescently labeled OS plasma membrane (PM). Such membrane merger is one measure of membrane fusogenicity. The highest percent fusion was observed when the proteins were co-expressed. Furthermore detailed analysis of the fusion kinetics between fluorescently labeled PM and proteo-liposomes containing either, pure P/rds, pure ROM-1 or the ROM-1-P/rds complex clearly demonstrated that optimal fusion requires an ROM-1/P/rds complex. Proteo-liposomes composed of ROM-1 alone were not fusogenic. Peptide competition studies suggest that optimization of fusion may be due to the formation of a fusion competent peripherin/rds C-terminus in the presence of ROM-1. These studies provide further support for the hypothesis that a P/rds dependent membrane fusion complex is involved in photoreceptor renewal processes.

Abstract Cathepsin-D (Cat-D) is a major proteolytic enzyme in phagocytic cells. In the retinal pigment epithelium (RPE), it is responsible for the daily degradation of photoreceptor outer segments (POSs) to maintain retinal homeostasis. Melanoregulin (MREG)-mediated loss of phagocytic capacity has been linked to diminished intracellular Cat-D activity. Here, we demonstrate that loss of MREG enhances the secretion of intermediate Cat-D (48 kDa), resulting in a net enhancement of extracellular Cat-D activity. These results suggest that MREG is required to maintain Cat-D homeostasis in the RPE and likely plays a protective role in retinal health. In this regard, in the Mreg dsu/dsu mouse, we observe increased basal laminin. Loss of the Mreg dsu allele is not lethal and therefore leads to slow age-dependent changes in the RPE. Thus, we propose that this model will allow us to study potential dysregulatory functions of Cat-D in retinal disease.

Cytolethal distending toxins (Cdt) are a family of toxins produced by several human pathogens which infect mucocutaneous tissue and induce inflammatory disease. Human macrophages exposed to Aggregatibacter actinomycetemcomitans (Aa) Cdt respond through canonical and non-canonical inflammasome activation to stimulate cytokine release. The inflammatory response is dependent on PI3K signaling blockade via the toxin's phosphatidylinositol-3,4,5-triphosphate (PIP3) phosphatase activity; converting PIP3 to phosphatidylinsoitol-3,4-diphosphate (PI3,4P2) thereby depleting PIP3 pools. Phosphoinositides, also play a critical role in phagosome trafficking, serving as binding domains for effector proteins during phagosome maturation and subsequent fusion with lysosomes. We now demonstrate that AaCdt manipulates the phosphoinositide (PI) pools of phagosome membranes and alters Rab5 association. Exposure of macrophages to AaCdt slowed phagosome maturation and decreased phago-lysosome formation, thereby compromising macrophage phagocytic function. Moreover, macrophages exposed to Cdt showed decreased bactericidal capacity leading to increase in Aggregatibacter actinomycetemcomitans survival. Thus, Cdt may contribute to increased susceptibility to bacterial infection. These studies uncover an underexplored aspect of Cdt function and provide new insight into the virulence potential of Cdt in mediating the pathogenesis of disease caused by Cdt-producing organisms such as Aa.

The oral bacterium, Aggregatibacter actinomycetemcomitans, which is associated with localized aggressive periodontitis, as well as systemic infections including endocarditis, produces numerous virulence factors, including a repeats-in-toxin (RTX) protein called leukotoxin (LtxA), which kills human immune cells. The strains of A. actinomycetemcomitans most closely associated with disease have been shown to produce the most LtxA, suggesting that LtxA plays a significant role in the virulence of this organism. LtxA, like many of the RTX toxins, can be divided into four functional domains: an N-terminal hydrophobic domain, which contains a significant fraction of hydrophobic residues and has been proposed to play a role in the membrane interaction of the toxin; the central domain, which contains two lysine residues that are the sites of post-translational acylation; the repeat domain that is characteristic of the RTX toxins, and a C-terminal domain thought to be involved in secretion. In its initial interaction with the host cell, LtxA must bind to both cholesterol and an integrin receptor, lymphocyte function-associated antigen-1 (LFA-1). While both interactions are essential for toxicity, the domains of LtxA involved remain unknown. We therefore undertook a series of experiments, including tryptophan quenching and trypsin digestion, to characterize the structure of LtxA upon interaction with membranes of various lipid compositions. Our results demonstrate that LtxA adopts a U-shaped conformation in the membrane, with the N- and C-terminal domains residing outside of the membrane.

Ameloblastoma is a locally aggressive odontogenic tumor. Etiopathogenesis and locally aggressive growth properties of ameloblastoma can be attributed to a hypoxic microenvironment conducive to tumor cell survival. Epithelial-derived follicular ameloblastoma cells (EP-AMCs) display enhanced basal autophagy, but the interplay of hypoxia and autophagy in EP-AMCs survival and ameloblastoma recurrence is unclear. We evaluated differential expression of autophagic markers in primary and recurrent ameloblastomas and hypothesized that hypoxia-induced autophagy supports EP-AMC survival. Primary and recurrent ameloblastomas were comparatively assessed for expression levels of pan-cytokeratin, Vimentin, and autophagic markers SQSTM1/p62, LC3, and pS6. EP-AMCs compared with human odontoma-derived cells (HODCs) were subjected to severe hypoxia to determine the interplay of hypoxia and autophagic process in posthypoxia survival. Pan-cytokeratin and SQSTM1/p62 were expressed by both primary and recurrent ameloblastoma epithelial cells while the ameloblastoma connective tissues displayed weak reactivity to vimentin. Under hypoxia, EP-AMC expression levels of hypoxia-inducible factor (HIF)-1α, p62, and LC3 were increased while pS6 was decreased posthypoxia. The combined decrease in pS6 and enhanced LC3 in EP-AMCs under hypoxia indicate that EP-AMCs re-establish basal autophagy under hypoxia. Taken together, these suggest a possible role of LC3-associated phagocytosis (LAP) in ameloblastoma cell survival.

Disk membranes and plasma membrane vesicles were prepared from bovine retinal rod outer segments (ROS). The plasma membrane vesicles were labeled with the fluorescent probe octadecylrhodamine B chloride (R18) to a level at which the R18 fluorescence was self-quenched. At pH 7.4 and 37 degrees C and in the presence of micromolar calcium, an increase in R18 fluorescence with time was observed when R18-labeled plasma membrane vesicles were introduced to a suspension of disks. This result was interpreted as fusion between the disk membranes and the plasma membranes, the fluorescence dequenching resulting from dilution of the R18 into the unlabeled membranes as a result of lipid mixing during membrane fusion. While the disk membranes exposed exclusively their cytoplasmic surface, plasma membrane vesicles were found with both possible orientations. These vesicles were fractionated into subpopulations with homogeneous orientation. Plasma membrane vesicles that were oriented with the cytoplasmic surface exposed were able to fuse with the disk membranes in a Ca(2+)-dependent manner. Fusion was not detected between disk membranes and plasma membrane vesicles oriented such that the cytoplasmic surface was on the interior of the vesicles. ROS plasma membrane-disk membrane fusion was stimulated by calcium, inhibited by EGTA, and unaffected by magnesium. Rod photoreceptor cells of vertebrate retinas undergo diurnal shedding of disk membranes containing the photopigment rhodopsin. Membrane fusion is required for the shedding process.

Membrane fusion is defined as the consolidation of two membrane bilayers and a subsequent mixing of the two previously separated aqueous compartments. Membrane fusion processes are mediated and regulated by a growing family of soluble and integral membrane proteins termed fusion proteins. Within retinal photoreceptor rod cells membrane fusion is a component step of at least three essential cellular processes. Fusion is necessary for the delivery of proteins and lipids in vesicles from the rod inner segment (site of synthesis) to the rod outer segment (ROS). Two additional fusion processes preserve the unique architecture of the outer segment by maintaining the outer segment at a constant length. Fusion during disk packet formation is documented in microscopy studies in which an analysis of dye penetration into distinct regions of the ROS found that large molecules do not enter the narrow bands of the dye-stained region of the ROS, suggesting a fusion of the plasma membrane with the disk membranes. This fusion is mediated by a fusion protein unique to photoreceptors: peripherin/rds. This chapter describes the protocols used in photoreceptor cell-free fusion assays and the characterization of peripherin/rds as a rod cell-specific fusion protein.

The C-terminal region of peripherin/rds contains three predicted alpha-helical domains. One of these domains, corresponding to amino acids 311-322, form an amphiphilic alpha-helix previously shown to promote membrane fusion. The present studies were conducted to determine how the additional alpha-helical regions of the peripherin/rds C-terminus affect complex formation with rom-1, glycosylation, intracellular localization and membrane fusion properties. Bovine peripherin/rds and rom-1 were epitope tagged with an amino-terminal FLAG-tag or amino-terminal hemagglutinin (HA)-tag, respectively, and cloned into the pCI-neo expression vector for transient transfection into COS cells. Similarly, four C-terminal peripherin/rds truncation mutants (Delta1, Delta2, Delta3 and Delta4), corresponding to deletions of -19, -29, -39 and -59 amino acids were designed to disrupt the alpha-helical domains. Immunofluorescence microscopy and enzymatic digestions demonstrated that full-length peripherin/rds and the four C-terminal deletion mutants were localized to intracellular membranes and were all Endo-H sensitive. Western blotting and immunoprecipitation studies showed that the FLAG-tagged bovine peripherin/rds (full-length) was expressed as a 76kDa dimer, which associates with HA-tagged rom-1 to form a higher order complex. The deletion mutants were also able to associate with rom-1. However, when analyzed using non-denaturing tricine electrophoresis, full-length peripherin/rds and the Delta1, Delta2 and Delta3 mutants formed homo-oligomeric complexes, while the Delta4 mutant appeared to form only homodimers suggesting a region upstream of amino acid 300 may be involved in C-terminal interactions. Membrane fusion was then evaluated using fluorescence resonance energy transfer (RET) techniques. Intracellular COS cell membranes containing full-length peripherin/rds fused with rod outer segment plasma membrane vesicles. This fusion was inhibited with the addition of a synthetic peptide (PP-5) corresponding to the fusion domain of peripherin/rds. In contrast, fusion was negligible with any of the C-terminal truncation mutants. Collectively, these results suggest that in addition to the fusion domain, other regions of the peripherin/rds C-terminus are required for fusion. Most interesting is the observation that the last 19amino acids, a region downstream of the fusion peptide that is deleted in the Delta1 mutant, appear to be necessary for fusion. This region corresponds to the epitope for anti-peripherin/rds monoclonal antibody 2B6, which is shown to partially inhibit peripherin/rds mediated membrane fusion.

The objectives of the present study were to determine whether serum hypercholesterolemia (HC) promotes the development of spontaneous and angioplasty-induced lesions and whether amlodipine inhibits these lesions and cellular processes underlying their genesis. Rabbits were fed normal, 0.5%, or 2% cholesterol diets for 9 wk, which resulted in the development of increasing HC. After week one, balloon dilation of the abdominal aorta was performed while the thoracic aorta was not disturbed and monitored for the development of spontaneous lesions. Lesion size increased with the degree of HC and was accompanied by increased collagen synthesis and smooth muscle cell (SMC) proliferation at each site. Amlodipine (5 mg/kg p.o.) inhibited lesion size by 50% (P < 0.01) at both sites in cholesterol-fed animals but not at angioplasty sites in animals on a normal diet. Local collagen synthesis was inhibited at both sites by amlodipine in the diet animals. The increase in HC was accompanied by a 1.7-fold increase in basal Ca2+ uptake in SMCs in the thoracic aorta, which was not altered by amlodipine, nifedipine, Ni2+, or La3+, revealing an uninhibitable calcium leak during atherogenesis. In culture, cholesterol enrichment increased SMC proliferation, collagen synthesis, and the secretion of a soluble SMC mitogen, which were inhibited by amlodipine (10(-9) M). Finally, in SMC membranes, amlodipine uniquely restored the cholesterol-expanded membrane bilayer width without any effect on membrane fluidity. This study establishes a causal role between serum HC and the development of spontaneous and angioplasty-induced lesions and the ability of amlodipine to disrupt this action by a novel remodelling action on the SMC membrane.

Leukotoxin (LtxA), from oral pathogen Aggregatibacter actinomycetemcomitans, is a secreted membrane-damaging protein. LtxA is internalized by β2 integrin LFA-1 (CD11a/CD18)-expressing leukocytes and ultimately causes cell death; however, toxin localization in the host cell is poorly understood and these studies fill this void. We investigated LtxA trafficking using multi-fluor confocal imaging, flow cytometry and Rab5a knockdown in human T lymphocyte Jurkat cells. Planar lipid bilayers were used to characterize LtxA pore-forming activity at different pHs. Our results demonstrate that the LtxA/LFA-1 complex gains access to the cytosol of Jurkat cells without evidence of plasma membrane damage, utilizing dynamin-dependent and presumably clathrin-independent mechanisms. Upon internalization, LtxA follows the LFA-1 endocytic trafficking pathways, as identified by co-localization experiments with endosomal and lysosomal markers (Rab5, Rab11A, Rab7, and Lamp1) and CD11a. Knockdown of Rab5a resulted in the loss of susceptibility of Jurkat cells to LtxA cytotoxicity, suggesting that late events of LtxA endocytic trafficking are required for toxicity. Toxin trafficking via the degradative endocytic pathway may culminate in the delivery of the protein to lysosomes or its accumulation in Rab11A-dependent recycling endosomes. The ability of LtxA to form pores at acidic pH may result in permeabilization of the endosomal and lysosomal membranes.

Cytolethal distending toxins (Cdt) are produced by a diverse group of pathogens. One Cdt-producing organism, Aggregatibacter actinomycetemcomitans, plays a critical role in the pathogenesis of a unique form of periodontitis, formerly referred to as localized aggressive periodontitis. The active Cdt subunit, CdtB, is a potent phosphatidylinositol (PI) 3,4,5-triphosphate phosphatase capable of inducing PI-3-kinase signaling blockade, a requisite for Cdt-induced toxicity in lymphocytes. In this study, we extended our observations to include the oral keratinocyte response to AaCdt using cell lines and primary gingival keratinocytes. All three exhibited G2/M arrest when exposed to AaCdt toxin within 24 h. Toxin-treated cells exhibited reduced levels of pAkt and pGSK3β within 6 h. Pre-treatment with GSK3β kinase inhibitors, LY2090314, CHIR99021 and Tideglusib, abrogated Cdt-induced G2/M arrest. None of the oral epithelial cells exhibited evidence of apoptosis. Cells remained arrested in the G2/M phase for at least 72 h without evidence of DNA damage response activation (H2AX phosphorylation). Cdt-treated cells displayed increased phosphorylation of the cyclin dependent kinase 1 (CDK1); moreover, the GSK3 inhibitors blocked this increase and reduced total CDK1 levels. This study further clarifies the potential mechanism(s) contributing to Cdt toxicity and toxin-mediated pathogenesis.

Disk membranes from the bovine retinal rod outer segments (ROS) were found to fuse with vesicles made of lipids extracted from unbleached ROS disk membranes, using a lipid mixing assay for membrane fusion (relief of self-quenching of R18, octadecylrhodamine B chloride). If the retinal chromophore of rhodopsin was reductively linked to opsin before lipid extraction, the vesicles made of the extracted lipids were not suitable targets for fusion of the disk membranes. The addition of retinal and retinol to these vesicles restored their ability to fuse. Therefore, the presence of all-trans retinal was implicated in promoting membrane fusion in this system. To test this possibility, the ability of retinal and retinol to influence the phase behavior and the fusion capability of large unilamellar vesicles (LUV) of N-methyl dioleoylphosphatidylethanolamine (N-methyl-DOPE) was examined. Both retinal and retinol stimulated the fusion of vesicles of N-methyl-DOPE (contents mixing with ANTS, 1-aminonaphthalene-3,6,8-trisulfonic acid; DPX, p-xylylene bis(pyridinium bromide)). Both compounds reduced the onset temperature for isotropic resonances in the 31P-NMR spectra of N-methyl-DOPE dispersions and the onset temperature, TH, for formation of hexagonal II phase. These results were consistent with previous studies in which the onset temperature for the 31P-NMR isotropic resonances were correlated with stimulation of membrane fusion. These data suggested that both retinal and retinol may stimulate membrane fusion by destabilizing the bilayers of membranes.

Canine bestrophinopathy (cBest) is an important translational model for BEST1-associated maculopathies in man that recapitulates the broad spectrum of clinical and molecular disease aspects observed in patients. Both human and canine bestrophinopathies are characterized by focal to multifocal separations of the retina from the RPE. The lesions can be macular or extramacular, and the specific pathomechanism leading to formation of these lesions remains unclear. We used the naturally occurring canine BEST1 model to examine factors that underlie formation of vitelliform lesions and addressed the susceptibility of the macula to its primary detachment in BEST1-linked maculopathies.

Aggregatibacter actinomycetemcomitans is a gram-negative microbe involved in periodontitis. Strains with varying degrees of virulence have been identified, in healthy and periodontally compromised individuals alike. Hosts mount differential immune responses to its various serotypes and virulence factors. Studies have explored host immune response in terms of antibody titers, leukocyte responses, and specific inflammatory mediators, questioning the ways in which the infectious microorganism survives. This mini-review will identify the key themes in immune response patterns of individuals both affected by and free from aggressive periodontal disease, thereby using it to understand various forms of periodontitis.

No abstract