Jerrold M. Ward

To delineate specific developmental roles of transforming growth factor beta 1 (TGF-beta 1) we have disrupted its cognate gene in mouse embryonic stem cells by homologous recombination to generate TGF-beta 1 null mice. These mice do not produce detectable amounts of either TGF-beta 1 RNA or protein. After normal growth for the first 2 weeks they develop a rapid wasting syndrome and die by 3-4 weeks of age. Pathological examination revealed an excessive inflammatory response with massive infiltration of lymphocytes and macrophages in many organs, but primarily in heart and lungs. Many lesions resembled those found in autoimmune disorders, graft-vs.-host disease, or certain viral diseases. This phenotype suggests a prominent role for TGF-beta 1 in homeostatic regulation of immune cell proliferation and extravasation into tissues.

Mice lacking the nuclear bile acid receptor FXR/BAR developed normally and were outwardly identical to wild-type littermates. FXR/BAR null mice were distinguished from wild-type mice by elevated serum bile acid, cholesterol, and triglycerides, increased hepatic cholesterol and triglycerides, and a proatherogenic serum lipoprotein profile. FXR/BAR null mice also had reduced bile acid pools and reduced fecal bile acid excretion due to decreased expression of the major hepatic canalicular bile acid transport protein. Bile acid repression and induction of cholesterol 7α-hydroxylase and the ileal bile acid binding protein, respectively, did not occur in FXR/BAR null mice, establishing the regulatory role of FXR/BAR for the expression of these genes in vivo. These data demonstrate that FXR/BAR is critical for bile acid and lipid homeostasis by virtue of its role as an intracellular bile acid sensor.

MT1-MMP is a membrane-bound matrix metalloproteinase (MT-MMP) capable of mediating pericellular proteolysis of extracellular matrix components. MT1-MMP is therefore thought to be an important molecular tool for cellular remodeling of the surrounding matrix. To establish the biological role of this membrane proteinase we generated MT1-MMP-deficient mice by gene targeting. MT1-MMP deficiency causes craniofacial dysmorphism, arthritis, osteopenia, dwarfism, and fibrosis of soft tissues due to ablation of a collagenolytic activity that is essential for modeling of skeletal and extraskeletal connective tissues. Our findings demonstrate the pivotal function of MT1-MMP in connective tissue metabolism, and illustrate that modeling of the soft connective tissue matrix by resident cells is essential for the development and maintenance of the hard tissues of the skeleton.

The thyroid-specific enhancer-binding protein (T/ebp) gene was disrupted by homologous recombination in embryonic stem cells to generate mice lacking T/EBP expression. Heterozygous animals developed normally, whereas mice homozygous for the disrupted gene were born dead and lacked the lung parenchyma. Instead, they had a rudimentary bronchial tree associated with an abnormal epithelium in their pleural cavities. Furthermore, the homozygous mice had no thyroid gland but had a normal parathyroid. In addition, extensive defects were found in the brain of the homozygous mice, especially in the ventral region of the forebrain. The entire pituitary, including the anterior, intermediate, and posterior pituitary, was also missing. In situ hybridization showed that the T/ebp gene is expressed in the normal thyroid, lung bronchial epithelium, and specific areas of the forebrain during early embryogenesis. These results establish that the expression of T/EBP, a transcription factor known to control thyroid-specific gene transcription, is also essential for organogenesis of the thyroid, lung, ventral forebrain, and pituitary.

The numerous functions of the liver are controlled primarily at the transcriptional level by the concerted actions of a limited number of hepatocyte-enriched transcription factors (hepatocyte nuclear factor 1alpha [HNF1alpha], -1beta, -3alpha, -3beta, -3gamma, -4alpha, and -6 and members of the c/ebp family). Of these, only HNF4alpha (nuclear receptor 2A1) and HNF1alpha appear to be correlated with the differentiated phenotype of cultured hepatoma cells. HNF1alpha-null mice are viable, indicating that this factor is not an absolute requirement for the formation of an active hepatic parenchyma. In contrast, HNF4alpha-null mice die during embryogenesis. Moreover, recent in vitro experiments using tetraploid aggregation suggest that HNF4alpha is indispensable for hepatocyte differentiation. However, the function of HNF4alpha in the maintenance of hepatocyte differentiation and function is less well understood. To address the function of HNF4alpha in the mature hepatocyte, a conditional gene knockout was produced using the Cre-loxP system. Mice lacking hepatic HNF4alpha expression accumulated lipid in the liver and exhibited greatly reduced serum cholesterol and triglyceride levels and increased serum bile acid concentrations. The observed phenotypes may be explained by (i) a selective disruption of very-low-density lipoprotein secretion due to decreased expression of genes encoding apolipoprotein B and microsomal triglyceride transfer protein, (ii) an increase in hepatic cholesterol uptake due to increased expression of the major high-density lipoprotein receptor, scavenger receptor BI, and (iii) a decrease in bile acid uptake to the liver due to down-regulation of the major basolateral bile acid transporters sodium taurocholate cotransporter protein and organic anion transporter protein 1. These data indicate that HNF4alpha is central to the maintenance of hepatocyte differentiation and is a major in vivo regulator of genes involved in the control of lipid homeostasis.

The aryl hydrocarbon (Ah) receptor (AHR) mediates many carcinogenic and teratogenic effects of environmentally toxic chemicals such as dioxin. An AHR-deficient (Ahr-/-) mouse line was constructed by homologous recombination in embryonic stem cells. Almost half of the mice died shortly after birth, whereas survivors reached maturity and were fertile. The Ahr-/- mice showed decreased accumulation of lymphocytes in the spleen and lymph nodes, but not in the thymus. The livers of Ahr-/- mice were reduced in size by 50 percent and showed bile duct fibrosis Ahr-/- mice were also nonresponsive with regard to dioxin-mediated induction of genes encoding enzymes that catalyze the metabolism of foreign compounds. Thus, the AHR plays an important role in the development of the liver and the immune system.

Although cyclin-dependent kinase 5 (Cdk5) is closely related to other cyclin-dependent kinases, its kinase activity is detected only in the postmitotic neurons. Cdk5 expression and kinase activity are correlated with the extent of differentiation of neuronal cells in developing brain. Cdk5 purified from nervous tissue phosphorylates neuronal cytoskeletal proteins including neurofilament proteins and microtubule-associated protein tau in vitro. These findings indicate that Cdk5 may have unique functions in neuronal cells, especially in the regulation of phosphorylation of cytoskeletal molecules. We report here generation of Cdk5(-/-) mice through gene targeting and their phenotypic analysis. Cdk5(-/-) mice exhibit unique lesions in the central nervous system associated with perinatal mortality. The brains of Cdk5(-/-) mice lack cortical laminar structure and cerebellar foliation. In addition, the large neurons in the brain stem and in the spinal cord show chromatolytic changes with accumulation of neurofilament immunoreactivity. These findings indicate that Cdk5 is an important molecule for brain development and neuronal differentiation and also suggest that Cdk5 may play critical roles in neuronal cytoskeleton structure and organization.

Acute exposure of mammals to the environmental pollutant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) results in a diverse set of toxicologic and pathologic effects. The mechanism of some of these effects has been studied extensively in vitro and correlative studies have indicated the involvement of a transcription factor known as the aryl hydrocarbon receptor (AHR). However, a definitive association of the AHR with TCDD-mediated toxicity has been difficult to establish due to the diversity of effects and the ubiquitous expression of this receptor. In an effort to distinguish AHR-mediated TCDD toxicities from those resulting from alternative pathways, we have made use of the recently described AHR-deficient mouse that was generated by locus-specific homologous recombination in embryonic stem cells. Present studies demonstrate that AHR-deficient mice are relatively unaffected by doses of TCDD (2000 micrograms/kg) 10-fold higher than that found to induce severe toxic and pathologic effects in littermates expressing a functional AHR. Analyses of liver, thymus, heart, kidney, pancreas, spleen, lymph nodes, and uterus from AHR-deficient mice identified no significant TCDD-induced lesions. The resistance of AHR-deficient mice to TCDD-induced thymic atrophy appears restricted to processes involving AHR since the corticosteroid dexamethasone rapidly and efficiently induced cortical depletion in both AHR-deficient and normal littermate control mice. Taken together these results suggest that the pathological changes induced by TCDD in the liver and thymus are mediated entirely by the AHR. However, it is important to note that at high doses of TCDD, AHR-deficient mice displayed limited vasculitis and scattered single cell necrosis in their lungs and livers, respectively. The mechanism(s) responsible for these apparently receptor-independent processes remain unclear but may involve novel, alternative pathways for TCDD-induced toxicity.

Abstract Although several CXC chemokines have been shown to induce angiogenesis and play roles in tumor growth, to date, no member of the CC chemokine family has been reported to play a direct role in angiogenesis. Here we report that the CC chemokine, monocyte chemotactic protein 1 (MCP-1), induced chemotaxis of human endothelial cells at nanomolar concentrations. This chemotactic response was inhibited by a monoclonal antibody to MCP-1. MCP-1 also induced the formation of blood vessels in vivo as assessed by the chick chorioallantoic membrane and the matrigel plug assays. As expected, the angiogenic response induced by MCP-1 was accompanied by an inflammatory response. With the use of a rat aortic sprouting assay in the absence of leukocytic infiltrates, we ruled out the possibility that the angiogenic effect of MCP-1 depended on leukocyte products. Moreover, the direct effect of MCP-1 on angiogenesis was consistent with the expression of CCR2, the receptor for MCP-1, on endothelial cells. Assessment of supernatant from a human breast carcinoma cell line demonstrated the production of MCP-1. Treatment of immunodeficient mice bearing human breast carcinoma cells with a neutralizing antibody to MCP-1 resulted in significant increases in survival and inhibition of the growth of lung micrometastases. Taken together, our data indicate that MCP-1 can act as a direct mediator of angiogenesis. As a chemokine that is abundantly produced by some tumors, it can also directly contribute to tumor progression. Therefore, therapy employing antagonists of MCP-1 in combination with other inhibitors of angiogenesis may achieve more comprehensive inhibition of tumor growth.

ABSTRACT To determine the physiological roles of peroxisome proliferator-activated receptor β (PPARβ), null mice were constructed by targeted disruption of the ligand binding domain of the murine PPARβ gene. Homozygous PPARβ-null term fetuses were smaller than controls, and this phenotype persisted postnatally. Gonadal adipose stores were smaller, and constitutive mRNA levels of CD36 were higher, in PPARβ-null mice than in controls. In the brain, myelination of the corpus callosum was altered in PPARβ-null mice. PPARβ was not required for induction of mRNAs involved in epidermal differentiation induced by O -tetradecanoylphorbol-13-acetate (TPA). The hyperplastic response observed in the epidermis after TPA application was significantly greater in the PPARβ-null mice than in controls. Inflammation induced by TPA in the skin was lower in wild-type mice fed sulindac than in similarly treated PPARβ-null mice. These results are the first to provide in vivo evidence of significant roles for PPARβ in development, myelination of the corpus callosum, lipid metabolism, and epidermal cell proliferation.

The Pathological Classification of Prostate Lesions in Genetically Engineered Mice (GEM) is the result of a directive from the National Cancer Institute Mouse Models of Human Cancer Consortium Prostate Steering Committee to provide a hierarchical taxonomy of disorders of the mouse prostate to facilitate classification of existing and newly created mouse models and the translation to human prostate pathology. The proposed Bar Harbor Classification system is the culmination of three meetings and workshops attended by various members of the Prostate Pathology Committee of the Mouse Models of Human Cancer Consortium. A 2-day Pathology Workshop was held at The Jackson Laboratory in Bar Harbor, Maine, in October 2001, in which study sets of 93 slides from 22 GEM models were provided to individual panel members. The comparison of mouse and human prostate anatomy and disease demonstrates significant differences and considerable similarities that bear on the interpretation of the origin and natural history of their diseases. The recommended classification of mouse prostate pathology is hierarchical, and includes developmental, inflammatory, benign proliferative, and neoplastic disorders. Among the neoplastic disorders, preinvasive, microinvasive, and poorly differentiated neoplasms received the most attention. Specific criteria were recommended and will be discussed. Transitions between neoplastic states were of particular concern. Preinvasive neoplasias of the mouse prostate were recognized as focal, atypical, and progressive lesions. These lesions were designated as mouse prostatic intraepithelial neoplasia (mPIN). Some atypical lesions were identified in mouse models without evidence of progression to malignancy. The panel recommended that mPIN lesions not be given histological grades, but that mPIN be further classified as to the absence or presence of documented associated progression to invasive carcinoma. Criteria for recognizing microinvasion, for classification of invasive gland-forming adenocarcinomas, and for characterizing poorly differentiated tumors, including neuroendocrine carcinomas, were developed and are discussed. The uniform application of defined terminology is essential for correlating results between different laboratories and models. It is recommended that investigators use the Bar Harbor Classification system when characterizing new GEM models or when conducting experimental interventions that may alter the phenotype or natural history of lesion progression in existing models.

To elucidate the function of PPARγ in leptin-deficient mouse (ob/ob) liver, a PPARγ liver-null mouse on an ob/ob background, ob/ob-PPARγ(fl/fl)AlbCre + , was produced using a floxed PPARγ allele, PPARγ(fl/fl), and Cre recombinase under control of the albumin promoter (AlbCre).The liver of ob/ob-PPARγ(fl/fl)AlbCre + mice had a deletion of exon 2 and a corresponding loss of full-length PPARγ mRNA and protein.The PPARγ-deficient liver in ob/ob mice was smaller and had a dramatically decreased triglyceride (TG) content compared with equivalent mice lacking the AlbCre transgene (ob/ob-PPARγ(fl/fl)AlbCre -).Messenger RNA levels of the hepatic lipogenic genes, fatty acid synthase, acetyl-CoA carboxylase, and stearoyl-CoA desaturase-1, were reduced in ob/ob-PPARγ(fl/fl)AlbCre + mice, and the levels of serum TG and FFA in ob/ob-PPARγ(fl/fl)AlbCre + mice were significantly higher than in the control ob/ob-PPARγ(fl/fl)AlbCre -mice.Rosiglitazone treatment exacerbated the fatty liver in ob/ob-PPARγ(fl/fl)AlbCre -mice compared with livers from nonobese Cre -mice; there was no effect of rosiglitazone in ob/ob-PPARγ(fl/fl)AlbCre + mice.The deficiency of hepatic PPARγ further aggravated the severity of diabetes in ob/ob mice due to decreased insulin sensitivity in muscle and fat.These data indicate that hepatic PPARγ plays a critical role in the regulation of TG content and in the homeostasis of blood glucose and insulin resistance in steatotic diabetic mice.

Nucleic acid-binding innate immune receptors such as Toll-like receptor 7 (TLR7) and TLR9 have been implicated in the development of some autoimmune pathologies. The Y chromosome-linked genomic modifier Yaa, which correlates with a duplication of Tlr7 and 16 other genes, exacerbates lupus-like syndromes in several mouse strains. Here we demonstrated that duplication of the Tlr7 gene was the sole requirement for this accelerated autoimmunity, because reduction of Tlr7 gene dosage abolished the Yaa phenotype. Further, we described new transgenic lines that overexpressed TLR7 alone and found that spontaneous autoimmunity developed beyond a 2-fold increase in TLR7 expression. Whereas a modest increase in Tlr7 gene dosage promoted autoreactive lymphocytes with RNA specificities and myeloid cell proliferation, a substantial increase in TLR7 expression caused fatal acute inflammatory pathology and profound dendritic cell dysregulation. These results underscore the importance of tightly regulating expression of TLR7 to prevent spontaneous triggering of harmful autoreactive and inflammatory responses.

The INHAND Project (International Harmonization of Nomenclature and Diagnostic Criteria for Lesions in Rats and Mice) is a joint initiative of the Societies of Toxicologic Pathology from Europe (ESTP), Great Britain (BSTP), Japan (JSTP) and North America (STP) to develop an internationally-accepted nomenclature for proliferative and non-proliferative lesions in laboratory animals. The purpose of this publication is to provide a standardized nomenclature and differential diagnosis for classifying microscopic lesions observed in the hepatobiliary system of laboratory rats and mice, with color microphotographs illustrating examples of some lesions. The standardized nomenclature presented in this document is also available for society members electronically on the internet (http://goreni.org). Sources of material included histopathology databases from government, academia, and industrial laboratories throughout the world. Content includes spontaneous and aging lesions as well as lesions induced by exposure to test materials. A widely accepted and utilized international harmonization of nomenclature for lesions of the hepatobiliary system in laboratory animals will decrease confusion among regulatory and scientific research organizations in different countries and provide a common language to increase and enrich international exchanges of information among toxicologists and pathologists.

Neoplastic and nonneoplastic lesions in untreated F344 rats used as controls in carcinogenesis tests were tabulated and evaluated. The most common neoplasms in 1794 male rats were testicular interstitial cell tumors, leukemias, pituitary adenomas, and adrenal pheochromocytomas. In 1754 female rats, common tumors were pituitary adenomas, mammamary fibroadenomas, uterine endometrial stromal polyps, and leukemias. A variety of less common and rare tumors were seen in almost every tissue. A few malignant neoplasms were metastatic. Nonneoplastic lesions included nephropathy, cardiomypathy, focal hyperplasias in a variety of tissues, and inflammatory lesions of the uterus. The focal hyperplasias were suggestive of the early stages of neoplasia in lung, liver, pituitary, adrenal, thyroid, and testis.

GASTROENTEROLOGY 2003;124:762-777

Transforming growth factors, which are polypeptides that induce the transformed phenotype in nonneoplastic cells, have been isolated in bulk amounts from bovine salivary gland and kidney. In experiments in which wound healing chambers were implanted subcutaneously in the backs of rats, these bovine transforming growth factors accelerated the accumulation of total protein, collagen, and DNA in treated chambers. These studies thus show an effect of an isolated transforming growth factor in vivo.

A bacterium with a spiral shape and bipolar, single, sheathed flagella was isolated from the livers of mice with active, chronic hepatitis. The bacteria also colonized the cecal and colonic mucosae of mice. The bacterium grew at 37 degrees C under microaerophilic and anaerobic conditions, rapidly hydrolyzed urea, was catalase and oxidase positive, reduced nitrate to nitrite, and was resistant to cephalothin metronidazole. On the basis of 16S rRNA gene sequence analysis, the organism was classified as a novel helicobacter, Helicobacter hepaticus. This new helicobacter, like two other murine Helicobacter species, H. muridarum and "H. rappini," is an efficient colonizer of the gastrointestinal tract, but in addition, it has the pathogenic potential to elicit persistent hepatitis in mice.

Mice rendered deficient in interleukin-10 (IL-10) by gene targeting (IL-10(-/-) mice) develop chronic enterocolitis resembling human inflammatory bowel disease (IBD) when maintained in conventional animal facilities. However, they display a minimal and delayed intestinal inflammatory response when reared under specific-pathogen-free (SPF) conditions, suggesting the involvement of a microbial component in pathogenesis. We show here that experimental infection with a single bacterial agent, Helicobacter hepaticus, induces chronic colitis in SPF-reared IL-10(-/-) mice and that the disease is accompanied by a type 1 cytokine response (gamma interferon [IFN-gamma], tumor necrosis factor alpha, and nitric oxide) detected by restimulation of spleen and mesenteric lymph node cells with a soluble H. hepaticus antigen (Ag) preparation. In contrast, wild-type (WT) animals infected with the same bacteria did not develop disease and produced IL-10 as the dominant cytokine in response to Helicobacter Ag. Strong H. hepaticus-reactive antibody responses as measured by Ag-specific total immunoglobulin G (IgG), IgG1, IgG2a, IgG2b, IgG3, and IgA were observed in both WT and IL-10(-/-) mice. In vivo neutralization of IFN-gamma or IL-12 resulted in a significant reduction of intestinal inflammation in H. hepaticus-infected IL-10(-/-) mice, suggesting an important role for these cytokines in the development of colitis in the model. Taken together, these microbial reconstitution experiments formally establish that a defined bacterial agent can serve as the immunological target in the development of large bowel inflammation in IL-10(-/-) mice and argue that in nonimmunocompromised hosts IL-10 stimulated in response to intestinal flora is important in preventing IBD.

Multiple endocrine neoplasia type 1 (MEN1) is an autosomal dominant cancer syndrome, characterized primarily by multiple tumors in the parathyroid glands, endocrine pancreas, and anterior pituitary. Other tumors, including gastrinoma, carcinoid, adrenal cortical tumors, angiofibroma, collagenoma, and lipoma, also occur in some patients. Individuals with MEN1 almost always have loss-of-function mutations in the MEN1 gene on chromosome 11, and endocrine tumors arising in these patients usually show somatic loss of the remaining wild-type allele. To examine the role of MEN1 in tumor formation, a mouse model was generated through homologous recombination of the mouse homolog Men1. Homozygous mice die in utero at embryonic days 11.5-12.5, whereas heterozygous mice develop features remarkably similar to those of the human disorder. As early as 9 months, pancreatic islets show a range of lesions from hyperplasia to insulin-producing islet cell tumors, and parathyroid adenomas are also frequently observed. Larger, more numerous tumors involving pancreatic islets, parathyroids, thyroid, adrenal cortex, and pituitary are seen by 16 months. All of the tumors tested to date show loss of the wild-type Men1 allele, further supporting its role as a tumor suppressor gene.

Abstract The hematopathology subcommittee of the Mouse Models of Human Cancers Consortium recognized the need for a classification of murine hematopoietic neoplasms that would allow investigators to diagnose lesions as well-defined entities according to accepted criteria. Pathologists and investigators worked cooperatively to develop proposals for the classification of lymphoid and nonlymphoid hematopoietic neoplasms. It is proposed here that nonlymphoid hematopoietic neoplasms of mice be classified in 4 broad categories: nonlymphoid leukemias, nonlymphoid hematopoietic sarcomas, myeloid dysplasias, and myeloid proliferations (nonreactive). Criteria for diagnosis and subclassification of these lesions include peripheral blood findings, cytologic features of hematopoietic tissues, histopathology, immunophenotyping, genetic features, and clinical course. Differences between murine and human lesions are reflected in the terminology and methods used for classification. This classification will be of particular value to investigators seeking to develop, use, and communicate about mouse models of human hematopoietic neoplasms.

Background : In the autumn of 1992, a novel form of chronic, active hepatitis of unknown etiology was discovered in mice at the national Cancer Institute-Frederick Cancer Research and Development Center (NCI-FCRDC), Frederick, Md. A high incidence of Hepatocellular tumors occured in affected animals. The disease entity was orginally identified in A/JCr mice that were untreated controls in a long-term toxicologic study. Purpose: Our original purpose was to determine the orgin and etiology of the chronic hepatitis and to quantify its association with hepatocellular tumors in mice of low liver tumor incidence strains. After a helical microorganism was discovered in hepatic parenchyma of diseased mice, we undertook charcterization of the organism and investigation of its relationship to the disease process. Methods: Hepatic histopathology of many strains of mice and rats, as well as guinea pigs and Syrian hamsters, in our research and animal production facilities was reviewed. Steiner's modification of the Warthin-Starry stain and transmission electron microscopy were used to indentify bacteria in the liver. We transmitted the hepatitis with liver suspensions from affected mice and by inoculation with bacterial cultures. Bacteria were cultivated on blood agar plates maintained under anaerobic or microaerophilic conditions and characterized morphologically, biochemically, and by 16S rRNA sequence. Results: We report here the isolation of a new species of Helicobacter (provisionally designated helicobacter hepaticus sp. nov.) that selectively and persistently colonizes the hepatic bile canaliculi of mice (and possibly the intrahepatic biliary system and large bowel), causing a morphologically distinctive pattern of chronic, active hepatitis and associated with a high incidence of hepatocellular neoplasms in infected animals. Conclusions: The novel Helicpbacter is a likely candidate for the etiology of hepatocellular tumors in our mice.The Helicobacter associated chronic active hepatitis represents a new model to study mechanisms of carcinogenesis by genus of bacteria.implications: Adenocarcinoma of the stomach, the second most prevalent of all human malignancies worldwide, is associated with infection at an early age with helicobacter pylori. Infection leads to several distinctive forms of gastritis, including chronic atrophic gastritis, which is a precursor of adenocarcinoma. H. hepaticus infection in mice constitutes the only other parllel association between a persistent bacterial infection and tumor development known to exist naturally. Study of the H. Hepaticus syndrome of chronic activehepatitis and liver tumors in mice may yield insights into the role of H. pylori in human stomach cancer and gastric lymphoma [J. NatL Cancer Inst 86: 1222–1227, 1994]

CYP1B1-null mice, created by targeted gene disruption in embryonic stem cells, were born at the expected frequency from heterozygous matings with no observable phenotype, thus establishing that CYP1B1 is not required for mouse development. CYP1B1 was not detectable in cultured embryonic fibroblast (EF) or in different tissues, such as lung, of the CYP1B1-null mouse treated with the aryl hydrocarbon receptor agonist 2,3,7,8-tetrachlorodibenzo- p -dioxin whereas the equivalent wild-type EF cells express basal and substantial inducible CYP1B1 and lung expresses inducible CYP1B1. CYP1A1 is induced to far higher levels than CYP1B1 in liver, kidney, and lung in wild-type mice and is induced to a similar extent in CYP1B1-null mice. 7,12-dimethylbenz[ a ]anthracene (DMBA) was toxic in wild-type EFs that express CYP1B1 but not CYP1A1. These cells effectively metabolized DMBA, consistent with CYP1B1 involvement in producing the procarcinogenic 3,4-dihydrodiol as a major metabolite, whereas CYP1B1-null EF showed no significant metabolism and were resistant to DMBA-mediated toxicity. When wild-type mice were administered high levels of DMBA intragastrically, 70% developed highly malignant lymphomas whereas only 7.5% of CYP1B1-null mice had lymphomas. Skin hyperplasia and tumors were also more frequent in wild-type mice. These results establish that CYP1B1, located exclusively at extrahepatic sites, mediates the carcinogenicity of DMBA. Surprisingly, CYP1A1, which has a high rate of DMBA metabolism in vitro , is not sufficient for this carcinogenesis, which demonstrates the importance of extrahepatic P450s in determining susceptibility to chemical carcinogens and validates the search for associations between P450 expression and cancer risk in humans.

Inheritance of an inactivated form of the VHL tumor suppressor gene predisposes patients to develop von Hippel-Lindau disease, and somatic VHL inactivation is an early genetic event leading to the development of sporadic renal cell carcinoma. The VHL gene was disrupted by targeted homologous recombination in murine embryonic stem cells, and a mouse line containing an inactivated VHL allele was generated. While heterozygous VHL (+/-) mice appeared phenotypically normal, VHL -/- mice died in utero at 10.5 to 12.5 days of gestation (E10.5 to E12.5). Homozygous VHL -/- embryos appeared to develop normally until E9.5 to E10.5, when placental dysgenesis developed. Embryonic vasculogenesis of the placenta failed to occur in VHL -/- mice, and hemorrhagic lesions developed in the placenta. Subsequent hemorrhage in VHL -/- embryos caused necrosis and death. These results indicate that VHL expression is critical for normal extraembryonic vascular development.

We have analyzed the possible role of the aryl-hydrocarbon receptor (AHR) in the aging process of mice using a homozygous null mouse (Ahr-/-) line as a model. We studied 52 male and female Ahr-/- mice aged from 6-13 months. Forty-six percent died or were ill by 13 months of age. Ahr-/- mice developed age-related lesions in several organs, some of which were apparent after only 9 months of age. Cardiovascular alterations included cardiomyopathy (100%) with hypertrophy and focal fibrosis. Vascular hypertrophy and mild fibrosis were found in the portal areas of the liver (81%), and vascular hypertrophy and mineralization were common in the uterus (70%). Gastric hyperplasia that progressed with age into polyps was evident in the pylorus of 71% of the mice over 9 months of age. Ahr-/- mice had T-cell deficiency in their spleens but not in other lymphoid organs. The immune system deficiency described previously could be the origin for the rectal prolapse found in 48% of the null mice, associated with Helicobacter hepaticus infection. In the dorsal skin (53% incidence), severe, localized, interfollicular and follicular epidermal hyperplasia, with hyperkeratosis and acanthosis, and marked dermal fibrosis, associated with the presence of anagenic hair follicles, were also evident. None of these lesions were found in 42 control (Ahr +/+ or +/-) mice of similar ages. These observations suggest that the AHR protein, in the absence of an apparent exogenous (xenobiotic) ligand, plays an important role in physiology and homeostasis in major organs in mice, and further supports an evolutionary conserved role for this transcription factor.

Arsenic is a known human carcinogen, but development of rodent models of inorganic arsenic carcinogenesis has been problematic. Since gestation is often a period of high sensitivity to chemical carcinogenesis, we performed a transplacental carcinogenicity study in mice using inorganic arsenic. Groups (n = 10) of pregnant C3H mice were given drinking water containing sodium arsenite (NaAsO(2)) at 0 (control), 42.5, and 85 ppm arsenite ad libitum from day 8 to 18 of gestation. These doses were well tolerated and body weights of the dams during gestation and of the offspring subsequent to birth were not reduced. Dams were allowed to give birth, and offspring were weaned at 4 weeks and then put into separate gender-based groups (n = 25) according to maternal exposure level. The offspring received no additional arsenic treatment. The study lasted 74 weeks in males and 90 weeks in females. A complete necropsy was performed on all mice and tissues were examined by light microscopy in a blind fashion. In male offspring, there was a marked increase in hepatocellular carcinoma incidence in a dose- related fashion (control, 12%; 42.5 ppm, 38%; 85 ppm, 61%) and in liver tumor multiplicity (tumors per liver; 5.6-fold over control at 85 ppm). In males, there was also a dose-related increase in adrenal tumor incidence and multiplicity. In female offspring, dose-related increases occurred in ovarian tumor incidence (control, 8%; 42.5 ppm, 26%; 85 ppm, 38%) and lung carcinoma incidence (control, 0%; 42.5 ppm, 4%; 85 ppm, 21%). Arsenic exposure also increased the incidence of proliferative lesions of the uterus and oviduct. These results demonstrate that oral inorganic arsenic exposure, as a single agent, can induce tumor formation in rodents and establishes inorganic arsenic as a complete transplacental carcinogen in mice. The development of this rodent model of inorganic arsenic carcinogenesis has important implications in defining the mechanism of action for this common environmental carcinogen.

Rapid advances in generating new mouse genetic models for lung neoplasia provide a continuous challenge for pathologists and investigators. Frequently, phenotypes of new models either have no precedents or are arbitrarily attributed according to incongruent human and mouse classifications. Thus, comparative characterization and validation of novel models can be difficult. To address these issues, a series of discussions was initiated by a panel of human, veterinary, and experimental pathologists during the Mouse Models of Human Cancers Consortium (NIH/National Cancer Institute) workshop on mouse models of lung cancer held in Boston on June 20-22, 2001. The panel performed a comparative evaluation of 78 cases of mouse and human lung proliferative lesions, and recommended development of a new practical classification scheme that would (a) allow easier comparison between human and mouse lung neoplasms, (b) accommodate newly emerging mouse neoplasms, and (c) address the interpretation of benign and preinvasive lesions of the mouse lung. Subsequent discussions with additional experts in pulmonary pathology resulted in the current proposal of a new classification. It is anticipated that this classification, as well as the complementary digital atlas of virtual histological slides, will help investigators and pathologists in their characterization of new mouse models, as well as stimulate further research aimed at a better understanding of proliferative lesions of the lung.

The farnesoid X receptor (FXR) controls the synthesis and transport of bile acids (BAs). Mice lacking expression of FXR, designated Fxr-null, have elevated levels of serum and hepatic BAs and an increase in BA pool size. Surprisingly, at 12 months of age, male and female Fxr-null mice had a high incidence of degenerative hepatic lesions, altered cell foci and liver tumors including hepatocellular adenoma, carcinoma and hepatocholangiocellular carcinoma, the latter of which is rarely observed in mice. At 3 months, Fxr-null mice had increased expression of the proinflammatory cytokine IL-1beta mRNA and elevated beta-catenin and its target gene c-myc. They also had increased cell proliferation as revealed by increased PCNA mRNA and BrdU incorporation. These studies reveal a potential role for FXR and BAs in hepatocarcinogenesis.

Abstract Animal models, particularly mouse models, play a central role in the study of the etiology, prevention, and treatment of human prostate cancer. While tissue culture models are extremely useful in understanding the biology of prostate cancer, they cannot recapitulate the complex cellular interactions within the tumor microenvironment that play a key role in cancer initiation and progression. The National Cancer Institute (NCI) Mouse Models of Human Cancers Consortium convened a group of human and veterinary pathologists to review the current animal models of prostate cancer and make recommendations about the pathologic analysis of these models. More than 40 different models with 439 samples were reviewed, including genetically engineered mouse models, xenograft, rat, and canine models. Numerous relevant models have been developed over the past 15 years, and each approach has strengths and weaknesses. Analysis of multiple genetically engineered models has shown that reactive stroma formation is present in all the models developing invasive carcinomas. In addition, numerous models with multiple genetic alterations display aggressive phenotypes characterized by sarcomatoid carcinomas and metastases, which is presumably a histologic manifestation of epithelial–mesenchymal transition. The significant progress in development of improved models of prostate cancer has already accelerated our understanding of the complex biology of prostate cancer and promises to enhance development of new approaches to prevention, detection, and treatment of this common malignancy. Cancer Res; 73(9); 2718–36. ©2013 AACR.

Pancreatic cancer is one of the most deadly cancers affecting the Western world. Because the disease is highly metastatic and difficult to diagnosis until late stages, the 5-y survival rate is around 5%. The identification of molecular cancer drivers is critical for furthering our understanding of the disease and development of improved diagnostic tools and therapeutics. We have conducted a mutagenic screen using Sleeping Beauty (SB) in mice to identify new candidate cancer genes in pancreatic cancer. By combining SB with an oncogenic Kras allele, we observed highly metastatic pancreatic adenocarcinomas. Using two independent statistical methods to identify loci commonly mutated by SB in these tumors, we identified 681 loci that comprise 543 candidate cancer genes (CCGs); 75 of these CCGs, including Mll3 and Ptk2, have known mutations in human pancreatic cancer. We identified point mutations in human pancreatic patient samples for another 11 CCGs, including Acvr2a and Map2k4. Importantly, 10% of the CCGs are involved in chromatin remodeling, including Arid4b, Kdm6a, and Nsd3, and all SB tumors have at least one mutated gene involved in this process; 20 CCGs, including Ctnnd1, Fbxo11, and Vgll4, are also significantly associated with poor patient survival. SB mutagenesis provides a rich resource of mutations in potential cancer drivers for cross-comparative analyses with ongoing sequencing efforts in human pancreatic adenocarcinoma.

The neuroinflammatory autoimmune disease Aicardi-Goutières syndrome (AGS) develops from mutations in genes encoding several nucleotide-processing proteins, including RNase H2. Defective RNase H2 may induce accumulation of self-nucleic acid species that trigger chronic type I interferon and inflammatory responses, leading to AGS pathology. We created a knock-in mouse model with an RNase H2 AGS mutation in a highly conserved residue of the catalytic subunit, Rnaseh2aG37S/G37S (G37S), to understand disease pathology. G37S homozygotes are perinatal lethal, in contrast to the early embryonic lethality previously reported for Rnaseh2b- or Rnaseh2c-null mice. Importantly, we found that the G37S mutation led to increased expression of interferon-stimulated genes dependent on the cGAS–STING signaling pathway. Ablation of STING in the G37S mice results in partial rescue of the perinatal lethality, with viable mice exhibiting white spotting on their ventral surface. We believe that the G37S knock-in mouse provides an excellent animal model for studying RNASEH2-associated autoimmune diseases.

A consensus system for classification of mouse lymphoid neoplasms according to their histopathologic and genetic features has been an elusive target for investigators involved in understanding the pathogenesis of spontaneous cancers or modeling human hematopoietic diseases in mice. An international panel of scientists with expertise in mouse and human hematopathology joined with the hematopathology subcommittee of the Mouse Models for Human Cancers Consortium to develop criteria for definition and classification of these diseases together with a standardized nomenclature. The fundamental elements contributing to the scheme are clinical features, morphology, immunophenotype, and genetic characteristics. The resulting classification has numerous parallels to the World Health Organization classification of human lymphoid tumors while recognizing differences that may be species specific. The classification should facilitate communications about mouse models of human lymphoid diseases.

Acetaminophen (APAP) hepatotoxicity is due to its biotransformation to a reactive metabolite,N-acetyl-p-benzoquinone imine (NAPQI), that is capable of binding to cellular macromolecules. At least two forms of cytochrome P450, CYP2E1 and CYP1A2, have been implicated in this reaction in mice. To test the combined roles of CYP1A2 and CYP2E1 in an intact animal model, a double-null mouse line lacking functional expression of CYP1A2 and CYP2E1 was produced by cross-breedingCyp1a2−/− mice withCyp2e1−/− mice. Animals deficient in the expression of both P450s developed normally and exhibited no obvious phenotypic abnormalities. Comparison of the dose–response to APAP (200–1200 mg/kg) indicated that double-null animals were highly resistant to APAP-induced toxicity whereas the wild-type animals were sensitive. Administration of 600 to 800 mg/kg of this drug to male wild-type animals resulted in increased plasma concentrations of liver enzymes (alanine aminotransferase, sorbitol dehydrogenase), lipidosis, hepatic necrosis, and renal tubular necrosis. In contrast, when APAP of equivalent or higher dose was administered to the double-null mice, plasma levels of liver enzymes and liver histopathology were normal. However, administration of 1200 mg of APAP/kg to the double-null mice resulted in infrequent liver lipidosis and mild kidney lesions. Consistent with the protection from hepatotoxicity, the expected depletion of hepatic glutathione (GSH) content was significantly retarded and APAP covalent binding to hepatic cytosolic proteins was not detectable in the double-null mice. Likewise,in vitroactivation of APAP by liver microsomes from the double-null mice was approximately one tenth of that in microsomes from wild-type mice. Thus, the protection against APAP toxicity afforded by deletion of both CYP2E1 and CYP1A2 likely reflects greatly diminished production of the toxic electrophile, NAPQI.

ABSTRACT Targeted disruption of the homeobox gene T/ebp (Nkx2.1, Ttf1, Titf1) in mice results in ablation of the pituitary. Paradoxically, while T/ebp is expressed in the ventral diencephalon during forebrain formation, it is not expressed in Rathke’s pouch or in the pituitary gland at any time of embryogenesis. Examination of pituitary development in the T/ebp homozygous null mutant embryos revealed that a pouch rudiment is initially formed but is eliminated by programmed cell death before formation of a definitive pouch. In the diencephalon of the mutant, Bmp4 expression is maintained, whereas Fgf8 expression is not detectable. These data and additional genetic and molecular observations suggest that Rathke’s pouch develops in a two-step process that requires at least two sequential inductive signals from the diencephalon. First, BMP4 is required for induction and formation of the pouch rudiment, a role confirmed by analysis of Bmp4 homozygous null mutant embryos. Second, FGF8 is necessary for activation of the key regulatory gene Lhx3 and subsequent development of the pouch rudiment into a definitive pouch. This study provides firm molecular genetic evidence that morphogenesis of the pituitary primordium is induced in vivo by signals from the adjacent diencephalon.

Meis1 and Hoxa9 expression is upregulated by retroviral integration in murine myeloid leukemias and in human leukemias carrying MLL translocations. Both genes also cooperate to induce leukemia in a mouse leukemia acceleration assay, which can be explained, in part, by their physical interaction with each other as well as the PBX family of homeodomain proteins. Here we show that Meis1-deficient embryos have partially duplicated retinas and smaller lenses than normal. They also fail to produce megakaryocytes, display extensive hemorrhaging, and die by embryonic day 14.5. In addition, Meis1-deficient embryos lack well-formed capillaries, although larger blood vessels are normal. Definitive myeloerythroid lineages are present in the mutant embryos, but the total numbers of colony-forming cells are dramatically reduced. Mutant fetal liver cells also fail to radioprotect lethally irradiated animals and they compete poorly in repopulation assays even though they can repopulate all hematopoietic lineages. These and other studies showing that Meis1 is expressed at high levels in hematopoietic stem cells (HSCs) suggest that Meis1 may also be required for the proliferation/self-renewal of the HSC.

The nuclear receptors, farnesoid X receptor (FXR) and pregnane X receptor (PXR), are important in maintaining bile acid homeostasis. Deletion of both FXR and PXR in vivo by cross-breeding B6;129-Fxrtm1Gonz (FXR-null) and B6;129-Pxrtm1Glaxo-Wellcome (PXR-null) mice revealed a more severe disruption of bile acid, cholesterol, and lipid homeostasis in B6;129-Fxrtm1Gonz Pxrtm1Glaxo-Wellcome (FXR-PXR double null or FPXR-null) mice fed a 1% cholic acid (CA) diet. Hepatic expression of the constitutive androstane receptor (CAR) and its target genes was induced in FXR- and FPXR-null mice fed the CA diet. To test whether up-regulation of CAR represents a means of protection against bile acid toxicity to compensate for the loss of FXR and PXR, animals were pretreated with CAR activators, phenobarbital or 1,4-bis[2-(3,5-dichlorpyridyloxy)]benzene (TCPOBOP), followed by the CA diet. A role for CAR in protection against bile acid toxicity was confirmed by a marked reduction of serum bile acid and bilirubin concentrations, with an elevation of the expression of the hepatic genes involved in bile acid and/or bilirubin metabolism and excretion (CYP2B, CYP3A, MRP2, MRP3, UGT1A, and glutathione S-transferase α), following pretreatment with phenobarbital or TCPOBOP. In summary, the current study demonstrates a critical and combined role of FXR and PXR in maintaining not only bile acid but also cholesterol and lipid homeostasis in vivo. Furthermore, FXR, PXR, and CAR protect against hepatic bile acid toxicity in a complementary manner, suggesting that they serve as redundant but distinct layers of defense to prevent overt hepatic damage by bile acids during cholestasis. The nuclear receptors, farnesoid X receptor (FXR) and pregnane X receptor (PXR), are important in maintaining bile acid homeostasis. Deletion of both FXR and PXR in vivo by cross-breeding B6;129-Fxrtm1Gonz (FXR-null) and B6;129-Pxrtm1Glaxo-Wellcome (PXR-null) mice revealed a more severe disruption of bile acid, cholesterol, and lipid homeostasis in B6;129-Fxrtm1Gonz Pxrtm1Glaxo-Wellcome (FXR-PXR double null or FPXR-null) mice fed a 1% cholic acid (CA) diet. Hepatic expression of the constitutive androstane receptor (CAR) and its target genes was induced in FXR- and FPXR-null mice fed the CA diet. To test whether up-regulation of CAR represents a means of protection against bile acid toxicity to compensate for the loss of FXR and PXR, animals were pretreated with CAR activators, phenobarbital or 1,4-bis[2-(3,5-dichlorpyridyloxy)]benzene (TCPOBOP), followed by the CA diet. A role for CAR in protection against bile acid toxicity was confirmed by a marked reduction of serum bile acid and bilirubin concentrations, with an elevation of the expression of the hepatic genes involved in bile acid and/or bilirubin metabolism and excretion (CYP2B, CYP3A, MRP2, MRP3, UGT1A, and glutathione S-transferase α), following pretreatment with phenobarbital or TCPOBOP. In summary, the current study demonstrates a critical and combined role of FXR and PXR in maintaining not only bile acid but also cholesterol and lipid homeostasis in vivo. Furthermore, FXR, PXR, and CAR protect against hepatic bile acid toxicity in a complementary manner, suggesting that they serve as redundant but distinct layers of defense to prevent overt hepatic damage by bile acids during cholestasis. Bile acids, the amphipathic end products of cholesterol metabolism, are critical for the absorption of dietary fats and fat-soluble vitamins, as well as regulation of bile flow and biliary lipid secretion that facilitate the excretion of conjugated drugs and endogenous waste products. Bile acid production also represents a major route for the elimination of excess cholesterol (1Hofmann A.F. Ital. J. Gastroenterol. 1995; 27: 106-113PubMed Google Scholar). Because disturbances of bile acid biosynthesis, metabolism, or transport cause diseases in the liver, biliary tree, and intestine (2Salen G. Batta A.K. Gastroenterol. Clin. North. Am. 1999; 28: 173-193Abstract Full Text Full Text PDF PubMed Scopus (8) Google Scholar), bile acid homeostasis needs to be tightly controlled. The farnesoid X receptor (FXR 1The abbreviations used are: FXR, farnesoid X receptor; PXR, pregnane X receptor; CAR, constitutive androstane receptor; CA, cholic acid; LCA, lithocholic acid; PB, phenobarbital; FPLC, fast protein liquid chromatography; HDL, high density lipoprotein; VLDL, very low density lipoprotein; IDL, intermediate density lipoprotein; LDL, low density lipoprotein; LCAT, lecithin-cholesterol acyltransferase; SRB1, scavenger receptor B-I; ABC, ATP-binding cassette; ALAS1, aminolevulinic acid synthase 1; UGT1A1, UDP-glucuronosyltransferase 1A1; GSTα, glutathione S-transferase alpha; CYP3A, cytochrome P450 3A; CYP2B, cytochrome P450 2B; BSEP, bile salt efflux protein; MDR1a, multidrug resistance protein 1a; MRP2, multidrug resistance-related protein 2; MRP3, multidrug resistance-related protein 3; WT, wild type; TG, triglycerides; PL, phospholipids; TCPOBOP, 1,4-bis-[2-(3,5-dichlorpyridyloxy)]benzene.; NR1H4; see Refs. 3Forman B.M. Goode E. Chen J. Oro A.E. Bradley D.J. Perlmann T. Noonan D.J. Burka L.T. McMorris T. Lamph W.W. Evans R.W. Weinberger C. Cell. 1995; 81: 687-693Abstract Full Text PDF PubMed Scopus (973) Google Scholar and 4Seol W. Choi H.S. Moore D.D. Mol. Endocrinol. 1995; 9: 72-85Crossref PubMed Google Scholar), a member of the nuclear receptor superfamily, was identified as a sensor for bile acids (5Parks D.J. Blanchard S.G. Bledsoe R.K. Chandra G. Consler T.G. Kliewer S.A. Stimmel J.B. Willson T.M. Zavacki A.M. Moore D.D. Lehmann J.M. Science. 1999; 284: 1365-1368Crossref PubMed Scopus (1843) Google Scholar, 6Makishima M. Okamoto A.Y. Repa J.J. Tu H. Learned R.M. Luk A. Hull M.V. Lustig K.D. Mangelsdorf D.J. Shan B. Science. 1999; 284: 1362-1365Crossref PubMed Scopus (2164) Google Scholar, 7Wang H. Chen J. Hollister K. Sowers L.C. Forman B.M. Mol. Cell. 1999; 3: 543-553Abstract Full Text Full Text PDF PubMed Scopus (1298) Google Scholar). It is strongly activated by bile acids, such as chenodeoxycholic acid, CA, deoxycholic acid, and lithocholic acid (LCA). Activated FXR forms a heterodimer with retinoid X receptor α and binds to its response elements found upstream of FXR target genes (6Makishima M. Okamoto A.Y. Repa J.J. Tu H. Learned R.M. Luk A. Hull M.V. Lustig K.D. Mangelsdorf D.J. Shan B. Science. 1999; 284: 1362-1365Crossref PubMed Scopus (2164) Google Scholar, 8Grober J. Zaghini I. Fujii H. Jones S.A. Kliewer S.A. Willson T.M. Ono T. Besnard P. J. Biol. Chem. 1999; 274: 29749-29754Abstract Full Text Full Text PDF PubMed Scopus (289) Google Scholar, 9Goodwin B. Jones S.A. Price R.R. Watson M.A. McKee D.D. Moore L.B. Galardi C. Wilson J.G. Lewis M.C. Roth M.E. Maloney P.R. Willson T.M. Kliewer S.A. Mol. Cell. 2000; 6: 517-526Abstract Full Text Full Text PDF PubMed Scopus (1515) Google Scholar, 10Urizar N.L. Dowhan D.H. Moore D.D. J. Biol. Chem. 2000; 275: 39313-39317Abstract Full Text Full Text PDF PubMed Scopus (208) Google Scholar, 11Kast H.R. Nguyen C.M. Sinal C.J. Jones S.A. Laffitte B.A. Reue K. Gonzalez F.J. Willson T.M. Edwards P.A. Mol. Endocrinol. 2001; 15: 1720-1728Crossref PubMed Scopus (224) Google Scholar). Disruption of the FXR gene in mice clearly demonstrated that FXR serves as a central coordinator for bile acid biosynthesis, metabolism, and transport (12Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar). Several lines of evidence indicate that bile acids bind and activate nuclear receptors other than FXR. In FXR-null mice, cyp3a11, a target gene of the pregnane X receptor (PXR; NR1I2) encoding a cytochrome P450 enzyme that facilitates bile acid metabolism and elimination, was significantly up-regulated (13Schuetz E.G. Strom S. Yasuda K. Lecureur V. Assem M. Brimer C. Lamba J. Kim R.B. Ramachandran V. Komoroski B.J. Venkataramanan R. Cai H. Sinal C.J. Gonzalez F.J. Schuetz J.D. J. Biol. Chem. 2001; 276: 39411-39418Abstract Full Text Full Text PDF PubMed Scopus (349) Google Scholar). PXR was recently identified as another bile acid sensor and is bound and activated by LCA, deoxycholic acid, and chenodeoxycholic acid (14Xie W. Radominska-Pandya A. Shi Y. Simon C.M. Nelson M.C. Ong E.S. Waxman D.J. Evans R.M. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3375-3380Crossref PubMed Scopus (683) Google Scholar, 15Staudinger J.L. Goodwin B. Jones S.A. Hawkins-Brown D. MacKenzie K.I. LaTour A. Liu Y. Klaassen C.D. Brown K.K. Reinhard J. Willson T.M. Koller B.H. Kliewer S.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3369-3374Crossref PubMed Scopus (1139) Google Scholar). LCA and its major metabolites also activate the vitamin D receptor (NR1I1 (see Ref. 16Makishima M. Lu T.T. Xie W. Whitfield G.K. Domoto H. Evans R.M. Haussler M.R. Mangelsdorf D.J. Science. 2002; 296: 1313-1316Crossref PubMed Scopus (976) Google Scholar)). Activation of PXR and vitamin D receptor by bile acids leads to the induction of hepatic and/or enteric phase I and phase II metabolizing enzymes, such as CYP3A11 and sulfotransferase (17Sonoda J. Xie W. Rosenfeld J.M. Barwick J.L. Guzelian P.S. Evans R.M. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 13801-13806Crossref PubMed Scopus (254) Google Scholar), indicating the existence of alternative pathways for metabolism and excretion of bile acids. In order to determine, in vivo, whether there is a combined role for FXR and PXR in maintaining bile acid, cholesterol, and lipid homeostasis, the FXR-null mice were cross-bred with PXR-null mice to create FPXR-null mice. FPXR-null mice exhibited a marked disruption of bile acid and cholesterol homeostasis when fed a 1% CA diet. Moreover, CAR and its target genes were induced in FXR- or FPXR-null mice fed the CA diet, and pretreatment with CAR activators, PB or TCPOBOP, resulted in a marked reduction in serum bile acid and bilirubin levels in these animals. This study therefore demonstrates a critical and combined role for FXR and PXR as bile acid sensors and further revealed that induction of CAR provided an additional hepatic defense to maintain bile acid and cholesterol homeostasis. Materials—All chemicals were obtained from Sigma, and all enzymes for molecular biology were purchased from Invitrogen unless otherwise indicated. [32P]CTP was from PerkinElmer Life Sciences. Generation of FXR and PXR Double Null Mice—B6;129-Fxrtm1Gonz (FXR-null) mice (12Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar) and B6;129-Pxrtm1Glaxo-Wellcome (PXR-null) mice (15Staudinger J.L. Goodwin B. Jones S.A. Hawkins-Brown D. MacKenzie K.I. LaTour A. Liu Y. Klaassen C.D. Brown K.K. Reinhard J. Willson T.M. Koller B.H. Kliewer S.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3369-3374Crossref PubMed Scopus (1139) Google Scholar) were cross-bred to generate wild type (WT), FXR-null, PXR-null, and Fxrtm1Gonz Pxrtm1Glaxo-Wellcome (FXR-PXR double null or FPXR-null) mice. The primer sequences and reaction conditions used for genotyping the FXR-null allele were reported previously (12Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar). The primer sets used for genotyping the PXR-null mice were as follows: PXR-F1 (5′-CTG GTC ATC ACT GTT GCT GTA CCA-3′), PXR-R2 (5′-GCA GCA TAG GAC AAG TTA TTC TAG AG-3′), and PXR-R3 (5′-CTA AAG CGC ATG CTC CAG ACT GC-3′). Amplification of the PXR WT allele produced a 348-bp product, whereas amplification of the null allele produced a 265-bp product. Diets, Sample Collection, and Histological Analysis—Mice were housed in a pathogen-free animal facility under standard 12-h light/ 12-h dark cycle with access to chow and water ad libitum. All protocols and procedures were approved by the NCI Animal Care and Use Committee and are in accordance with the National Institutes of Health and ALAC Guidelines. All diets were prepared by Bioserv (Frenchtown, NJ) and were based on a standard AIN-93G rodent diet (58.6% carbohydrate, 18.1% protein, 7.2% fat, 0.1% cholesterol, 5.1% fiber, 3.4% ash, and 10% moisture) (12Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar). The 1% CA diet consisted of the control diet supplemented with 1% (w/w) CA. Groups of 8–12-week-old males were used for all experiments. At the end of the study, animals were fasted for 4 h in the morning and anesthetized with avertin. Following blood collection from the orbital plexus, animals were euthanized. Tissues were weighed, snap-frozen in liquid nitrogen, and stored at –80 °C until use. Plasma Chemistry—Serum was prepared from whole blood by centrifugation at 6,000 × g using Microtainer serum separator tubes (BD Biosciences). Serum levels of total bile acids, total and direct bilirubin, were measured colorimetrically using corresponding Sigma diagnostics analysis kits. Total cholesterol and triglyceride (Sigma) as well as free cholesterol and phospholipid (Wako, Osaka, Japan) concentrations were measured from 12-μl aliquots of serum using commercial kits and the Hitachi 911 automated chemistry analyzer (Roche Applied Science). Fast protein liquid chromatography (FPLC) separation of serum lipoproteins from pooled plasma samples (60 μl; n = 4–7) was achieved by gel filtration using two Superose 6HR 10/30 columns (Amersham Biosciences) in series as described previously (12Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar, 18Lambert G. Amar M.J. Martin P. Fruchart-Najib J. Foger B. Shamburek R.D. Brewer Jr., H.B. Santamarina-Fojo S. J. Lipid Res. 2000; 41: 667-672Abstract Full Text Full Text PDF PubMed Google Scholar). Mouse apoA-1, apoA-II, apoE, and apoB were identified by Western blot as described previously (12Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar), using polyclonal rabbit anti-mouse IgG raised against the purified apolipoproteins. Plasma lecithin-cholesterol acyltransferase (LCAT) activity was measured as described previously (19Chen C.H. Albers J.J. J. Lipid Res. 1982; 23: 680-691Abstract Full Text PDF PubMed Google Scholar). Biliary Bile Acid and Lipid Secretion—Mice were fasted for 4 h in the morning following a 1% CA diet for 4 days. Animals were weighed, anesthetized by avertin (2.5%), and their abdominal cavities opened under sterile conditions. The cystic duct was ligated, and the common bile duct was cannulated. The hepatic bile was collected by gravity for 45 min. Biliary cholesterol, phospholipids, and bile acids (Sigma diagnostic kit) were measured immediately after bile collection. Cloning and Analysis of Gene Expression—Total RNA was prepared using Trizol reagent (Amersham Biosciences) and analyzed by electrophoresis in 0.22 m formaldehyde-containing 1% agarose gels. The cDNA probes and detailed Northern blot analysis procedures were described previously (12Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1426) Google Scholar, 20Lambert G. Marcelo J.A. Amar G.G. Brewer Jr., H.B. Gonzalez F.J. Sinal C.J. J. Biol. Chem. 2003; 278: 2563-2570Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar), except for ALAS1 (composed of 820–1426 bp of ALAS1 cDNA with accession number NM020559 and recognizes ALAS1), UGT1A (composed of 578–947 bp of UGT 1A1 cDNA with accession number L27122 and recognizes the UGT1A family), and GSTα (composed of 203–592 bp of GSTα1 cDNA with accession number NM008181 and recognizes the GSTα family). Probes were 32P-labeled by the random primer method using Ready-to-Go DNA labeling beads (Amersham Biosciences). Western Blot Analysis—Hepatic microsomal proteins were prepared as described previously (21Guo G.L. Choudhuri S. Klaassen C.D. J. Pharmacol. Exp. Ther. 2002; 300: 206-212Crossref PubMed Scopus (52) Google Scholar), and 1 μg of protein was subjected to 10% SDS-PAGE and transferred by electroblotting to GeneScreen Plus membranes (PerkinElmer Life Sciences). The membranes were incubated with monoclonal anti-rat CYP3A1/2 or polyclonal anti-rat CYP2B antibody (N-19, Santa Cruz Biotechnology, Santa Cruz, CA) for 4 h at room temperature, followed by incubation with horseradish peroxidase-conjugated goat anti-mouse IgG for CYP3A1/2 or goat anti-rabbit IgG for CYP2B (Sigma). Bands were visualized with ECL Western blotting detection reagents (Amersham Biosciences). Statistics—Unless otherwise stated, all values were expressed as the mean ± S.E. All data were analyzed by the unpaired Student's t test for statistical significance between each group. Deletion of Both FXR and PXR Results in Severe CA-induced Toxicity—The nuclear receptors, FXR and PXR, play important roles in maintaining bile acid homeostasis. However, the combined role of FXR and PXR in vivo has not been studied, thus FXR-PXR double null mice were generated by cross-breeding PXR-null with FXR-null mice to abolish both FXR and PXR expression in vivo. Under standard housing and dietary conditions, there was no external difference among FPXR-, FXR-, PXR-nulls, or WT mice. However, upon feeding a 1% CA diet for 4 days, FPXR-null mice exhibited the most severe body weight loss, followed by FXR-, PXR-nulls, and WTs (Fig. 1A). Serum bile acids and total and direct bilirubin levels were highest in FPXR-followed by FXR-, PXR-null mice, and WTs fed the CA diet. The serum levels of direct bilirubin or conjugated bilirubin, a direct indicator for hepatic function, were statistically higher in FPXR-null mice than those in FXR-null mice, but there was no statistical significance between FPXR- and FXR-nulls for bile acid and total bilirubin levels (Fig. 1, B–D). Histological examination of the livers by hematoxylin and eosin revealed more fatty metamorphosis in FPXR-, FXR-, and PXR-null mice than WT mice fed the CA diet, but the degree was similar (data not shown). Disruption of Serum Cholesterol and Lipid Homeostasis in FPXR-null Mice—Because bile acid synthesis and excretion represents the major pathway for elimination of cholesterol, we examined cholesterol and lipid levels in these animals. On a control diet, the plasma levels of cholesterol were highest in FXR-null mice, followed by FPXR- and PXR-null mice, compared with WT mice; and plasma triglycerides (TG) and phospholipids (PL) were elevated in both FXR- and FPXR-null mice followed by PXR-null and WT mice. The CA diet lowered the plasma lipid levels in FXR-null and PXR-null mice but increased those of FPXR-null mice (Fig. 2A). The serum contents of cholesterol and lipid were further analyzed by fast protein liquid chromatography (FPLC) using pooled serum samples. This revealed that the dramatic hyperlipidemia observed in FXR- and FPXR-null mice on a control diet was mostly due to increased quantities of very low density lipoprotein (VLDL), intermediate density lipoprotein (IDL), low density lipoprotein (LDL), and large HDL1 particles (Fig. 2B, panels A and B), accompanied by an increase in plasma apoE and apoB100 (Fig. 2B, panel A, inset). The plasma FPLC profiles of WT and PXR-null mice predominantly consisted of HDL particles that were only slightly affected by the CA diet. In contrast, the CA diet resulted in a dramatic shift in the elution of VLDL and IDL/LDL in FPXR-nulls and to a lesser degree in FXR-nulls (Fig. 2B, panels C and D). There was a virtual absence of HDL particles in the plasma of FPXR-null mice fed the CA diet. Consistent with these data, plasma apoA-I and apoA-II levels were reduced, whereas levels of apoB100 were increased in FPXR-null mice fed the CA diet (Fig. 2B, panel C, inset). The PL elution profiles were similar to those of total cholesterol, and the TG profiles were similar to those of free cholesterol in all groups and for both diets (data not shown). Biliary Excretion of Bile Acids, Cholesterol, and Phospholipids—Because FXR and PXR regulate many genes encoding hepatic canalicular transporters, biliary excretion of bile acids, cholesterol, and phospholipids was determined in WTs, PXR-, FXR-, and FPXR-null mice fed the 1% CA diet for 4 days to saturated their hepatic biliary secretion ability, as described previously (20Lambert G. Marcelo J.A. Amar G.G. Brewer Jr., H.B. Gonzalez F.J. Sinal C.J. J. Biol. Chem. 2003; 278: 2563-2570Abstract Full Text Full Text PDF PubMed Scopus (315) Google Scholar). Under these experimental conditions, the flow of biliary cholesterol and phospholipid, measured after cannulation of the common bile duct, was dramatically reduced in FPXR-nulls, followed by FXR-nulls but unchanged in PXR-nulls, compared with WTs (Fig. 3, A and B). The bile acid output was similar in WTs, PXR-, and FXR-nulls but dramatically reduced in FPXR-nulls (Fig. 3C), indicating that loss of both PXR and FXR in mice leads to the most severe impairment of biliary excretion. Expression of the Major Genes Involved in Cholesterol and Lipid Metabolism—To understand the molecular mechanisms responsible for the severe disturbances of lipoprotein homeostasis in FPXR-nulls, especially after CA feeding, the hepatic expression levels of the major genes involved in cholesterol and lipid metabolism were determined by Northern blot analysis (Fig. 4). Among the major apolipoproteins, only the expression of apoA-I, apoA-II, apoE, and apoB was increased in FXR- and FPXR-null mice after CA feeding; expression of other apolipoproteins was either not altered (apoC-I, apoC-II) or up-regulated by the CA diet regardless of genotype (apoA-V; data not shown). The levels of ABCA1 and CD36 mRNA were also increased in the livers of FXR- and FPXR-null mice fed the CA diet, whereas those of SRB1 and sterol regulatory element-binding protein-1c were lower in FXR- and FPXR-nulls. In addition, feeding of CA resulted in a dramatic reduction of plasma LCAT activity in FXR- and FPXR-nulls (5.8 ± 2.1 and 3.7 ± 1.4 nmol cholesterol esterification/ml/h, respectively) compared with WTs and PXR-nulls, respectively (21.2 ± 0.9 and 19.4 ± 3.2 nmol CE/ml/h, n = 4, p < 0.05). There was a dose-dependent and positive correlation between the concentration of bile acids and the inhibition of LCAT activity in the plasma of the animals, suggesting a specific inhibition of LCAT activity by bile acids (data not shown). Hepatic Expression of the Genes Associated with Bile Acid Metabolism and Transport—To understand the molecular mechanisms responsible for defective biliary secretion in FPXR-null mice, the hepatic expression of the major genes involved in bile acid production, metabolism, and transport was determined (Fig. 5). With the control diet, expression levels of the rate-limiting enzyme for bile acid synthesis, CYP7A1, were decreased in PXR-nulls, elevated in FXR-nulls, and markedly reduced in FPXR-nulls. With the CA diet, CYP7A1 mRNA levels were strongly repressed in WTs and PXR-nulls, weakly in FXR-nulls, but not altered in FPXR-nulls. Basal levels of CYP3A11 mRNA were induced in PXR-, FXR-, and FPXR-nulls but were only further elevated in FXR-nulls fed the CA diet. Basal mRNA levels of the nuclear hormone receptor CAR and its classical target gene, CYP2B, were markedly increased in FXR-nulls and to a lesser degree in FPXR-nulls. The CA diet further induced CAR and CYP2B mRNA levels in FXR-nulls, followed by in FPXR- and PXR-nulls. Basal mRNA levels of the bile salt export pump, BSEP, were higher in PXR-nulls, lower in FXR-nulls, and unchanged in FPXR-nulls fed the control diet. Feeding the CA diet led to an induction of BSEP in WTs and PXR-nulls but a further suppression in FXR- and FPXR-nulls. The expression pattern of MDR1a followed that of CYP3A11, whereas the levels of MRP2 and MRP3 mRNA were slightly induced in FPXR-nulls on the CA diet (1.6- and 2-fold, respectively). On the control diet, the mRNA levels of the biliary phospholipid transporter MDR2, the biliary cholesterol half-transporter ABCG8, and the biliary cholesterol half-transporter ABCG5 appeared to be not altered in FXR- or FPXR-nulls on control diet, but all were induced to a similar degree by the CA diet. With the CA diet, the levels of ABCG1 were suppressed in WTs and PXR-nulls but were up-regulated in FXR- and FPXR-nulls. Levels of other nuclear hormone receptors (retinoid X receptor α, LXRα, HNF4α, and PPARα) were not altered in these four strains regardless of the diet (data not shown). Hepatic Protein Levels of CYP3A and CYP2B—Because hepatic mRNA levels of CYP3A11 and CYP2B in FXR- and FPXR-null mice were increased following a 1% CA diet, their protein levels were determined by Western blot analysis (Fig. 6). Similar to their mRNA levels, basal protein levels of CYP3A were increased in PXR-, FXR-, and FPXR-null mice, with the highest elevation in the latter animals. However, feeding the 1% CA diet only resulted in increased CYP3A protein levels in WTs, PXR-, and FXR-nulls but not in FPXR-nulls, indicating that activation of PXR is mainly responsible for induction of CYP3A in FXR-null mice. Basal levels of CYP2B protein in FPXR-null mice were slightly increased compared with WTs (1.5-fold), which was further increased by feeding with the CA diet (1.8-fold). Compared with CYP3A, the degree of CYP2B induction was much lower. Protection of CA Toxicity in FXR- and FPXR Null Mice by Pretreatment with PB or TCPOBOP—Because CAR and CYP2B were induced in FXR- and FPXR-null mice, it was hypothesized that activation of both CAR and CYP2B might reduce the overt hepatic toxicity by bile acids. To test this possibility, two CAR activators, PB (100 mg/kg, intraperitoneal, with saline as control) or TCPOBOP (3 mg/kg, intraperitoneal, with corn oil as control), were administered 2 days before the CA diet feeding was initiated, and the treatment was continued for an additional 4 days with coadministration of the CA diet. Cotreatment of PB or TCPOBOP with CA significantly lowered the serum bile acids and total and direct bilirubin levels in FXR- and FPXR-null mice compared with treatment with CA alone, strongly indicating that activation of CAR reduced the overt bile acid toxicity (Fig. 7, A–C). Hepatic Expression of the Genes for Bile Acid and Bilirubin Metabolism and Transport following PB or TCPOBOP Treatment—To determine the mechanism by which PB or TCPOBOP treatment effectively prevented the elevation of serum bile acid and bilirubin levels in CA-fed FXR- or FPXR-null mice, mRNA levels of the major genes involved in bile acid and/or bilirubin metabolism and transport were determined (Fig. 8). Treatment with the CAR activators induced the levels of CYP2B, CYP3A11, UGT1a, GSTα, MRP2, MRP3, and organic anion transporting polypeptide 2, leading to increased metabolism and excretion of bile acids and bilirubin. Surprisingly, the mRNA levels of ALAS1, the rate-limiting enzyme for bilirubin synthesis, were induced by the CAR activators as well. Because the net levels of serum bilirubin were decreased following treatment with the CAR activators, the possibility exists that the degree for induction of bilirubin synthesis was lower than that for its metabolism and excretion. Furthermore, PB and TCPOBOP affected the CAR mRNA levels differently; PB induced CAR mRNA in WT and PXR-null mice but not in FXR- and FPXR-null mice; in contrast, TCPOBOP did not affect CAR mRNA levels in WT mice, and it prevented the induction of CAR mRNA by CA in PXR-, FXR-, and FPXR-null mice. PB and TCPOBOP also differentially affected MDR1a; PB induced but TCPOBOP repressed MDR1a mRNA levels. PB and TCPOBOP tended to reduce the CA toxicity not only by inducing metabolism enzymes and export transporters but also by inhibiting the main bile acid uptake transporter, Na+/taurocholate cotransporting polypeptide. The mRNA levels of BSEP were not affected by the pretreatment with CAR activators (data not shown). In summary, pretreatment with the CAR activators reduced bile acid uptake but enhanced their metabolism and excretion, particularly in FXR- and FPXR-null mice fed with a CA diet, thus resulting in a lower bile acid or bilirubin content in the circulation. Following the discovery that FXR was a key nuclear receptor for regulating bile acid levels (5Parks D.J. Blanchard S.G. Bledsoe R.K. Chandra G. Consler T.G. Kliewer S.A. Stimmel J.B. Willson T.M. Zavacki A.M. Moore D.D. Lehmann J.M. Science. 1999; 284: 1365-1368Crossref PubMed Scopus (1843) Google Scholar, 6Makishima M. Okamoto A.Y. Repa J.J. Tu H. Learned R.M. Luk A. Hull M.V. Lustig K.D. Mangelsdorf D.J. Shan B. Science. 1999; 284: 1362-1365Crossref PubMed Scopus (2164) Google Scholar, 7Wang H. Chen J. Hollister K. Sowers L.C. Forman B.M. Mol. Cell. 1999; 3: 543-553Abstract Full Text Full Text PDF PubMed Scopus (1298) Google Scholar), PXR was identified as another bile acid sensor with relative specificity toward LCA and its metabolites (14Xie W. Radominska-Pandya A. Shi Y. Simon C.M. Nelson M.C. Ong E.S. Waxman D.J. Evans R.M. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3375-3380Crossref PubMed Scopus (683) Google Scholar, 15Staudinger J.L. Goodwin B. Jones S.A. Hawkins-Brown D. MacKenzie K.I. LaTour A. Liu Y. Klaassen C.D. Brown K.K. Reinhard J. Willson T.M. Koller B.H. Kliewer S.A. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 3369-3374Crossref PubMed Scopus (1139) Google Scholar). To test the combined role of FXR and PXR in vivo in regulating bile acid synthesis, metabolism, and transport, as well as for maintaining cholesterol and lipid homeostasis, FPXR double null mice were generated by cross-breeding FXR-null with PXR-null mice. An exacerbated

Mammalian cells harbor three highly homologous and widely expressed members of the ras family (H-ras, N-ras, and K-ras), but it remains unclear whether they play specific or overlapping cellular roles. To gain insight into such functional roles, here we generated and analyzed H-ras null mutant mice, which were then also bred with N-ras knockout animals to ascertain the viability and properties of potential double null mutations in both loci. Mating among heterozygous H-ras(+/-) mice produced H-ras(-/-) offspring with a normal Mendelian pattern of inheritance, indicating that the loss of H-ras did not interfere with embryonic and fetal viability in the uterus. Homozygous mutant H-ras(-/-) mice reached sexual maturity at the same age as their littermates, and both males and females were fertile. Characterization of lymphocyte subsets in the spleen and thymus showed no significant differences between wild-type and H-ras(-/-) mice. Analysis of neuronal markers in the brains of knockout and wild-type H-ras mice showed that disruption of this locus did not impair or alter neuronal development. Breeding between our H-ras mutant animals and previously available N-ras null mutants gave rise to viable double knockout (H-ras(-/-)/N-ras(-/-)) offspring expressing only K-ras genes which grew normally, were fertile, and did not show any obvious phenotype. Interestingly, however, lower-than-expected numbers of adult, double knockout animals were consistently obtained in Mendelian crosses between heterozygous N-ras/H-ras mice. Our results indicate that, as for N-ras, H-ras gene function is dispensable for normal mouse development, growth, fertility, and neuronal development. Additionally, of the three ras genes, K-ras appears to be not only essential but also sufficient for normal mouse development.

We have used gene targeting to create a mouse model of glycogen storage disease type II, a disease in which distinct clinical phenotypes present at different ages. As in the severe human infantile disease (Pompe Syndrome), mice homozygous for disruption of the acid α-glucosidase gene (6neo/6neo) lack enzyme activity and begin to accumulate glycogen in cardiac and skeletal muscle lysosomes by 3 weeks of age, with a progressive increase thereafter. By 3.5 weeks of age, these mice have markedly reduced mobility and strength. They grow normally, however, reach adulthood, remain fertile, and, as in the human adult disease, older mice accumulate glycogen in the diaphragm. By 8–9 months of age animals develop obvious muscle wasting and a weak, waddling gait. This model, therefore, recapitulates critical features of both the infantile and the adult forms of the disease at a pace suitable for the evaluation of enzyme or gene replacement. In contrast, in a second model, mutant mice with deletion of exon 6 (Δ6/Δ6), like the recently published acid α-glucosidase knockout with disruption of exon 13 (Bijvoet, A. G., van de Kamp, E. H., Kroos, M., Ding, J. H., Yang, B. Z., Visser, P., Bakker, C. E., Verbeet, M. P., Oostra, B. A., Reuser, A. J. J., and van der Ploeg, A. T. (1998) Hum. Mol. Genet. 7, 53–62), have unimpaired strength and mobility (up to 6.5 months of age) despite indistinguishable biochemical and pathological changes. The genetic background of the mouse strains appears to contribute to the differences among the three models. We have used gene targeting to create a mouse model of glycogen storage disease type II, a disease in which distinct clinical phenotypes present at different ages. As in the severe human infantile disease (Pompe Syndrome), mice homozygous for disruption of the acid α-glucosidase gene (6neo/6neo) lack enzyme activity and begin to accumulate glycogen in cardiac and skeletal muscle lysosomes by 3 weeks of age, with a progressive increase thereafter. By 3.5 weeks of age, these mice have markedly reduced mobility and strength. They grow normally, however, reach adulthood, remain fertile, and, as in the human adult disease, older mice accumulate glycogen in the diaphragm. By 8–9 months of age animals develop obvious muscle wasting and a weak, waddling gait. This model, therefore, recapitulates critical features of both the infantile and the adult forms of the disease at a pace suitable for the evaluation of enzyme or gene replacement. In contrast, in a second model, mutant mice with deletion of exon 6 (Δ6/Δ6), like the recently published acid α-glucosidase knockout with disruption of exon 13 (Bijvoet, A. G., van de Kamp, E. H., Kroos, M., Ding, J. H., Yang, B. Z., Visser, P., Bakker, C. E., Verbeet, M. P., Oostra, B. A., Reuser, A. J. J., and van der Ploeg, A. T. (1998) Hum. Mol. Genet. 7, 53–62), have unimpaired strength and mobility (up to 6.5 months of age) despite indistinguishable biochemical and pathological changes. The genetic background of the mouse strains appears to contribute to the differences among the three models. In glycogen storage disease type II (GSDII), 1GSDII, glycogen storage disease type II; GAA, acid α-glucosidase; ES, embryonic stem; PAS, periodic acid-Schiff; RT, reverse transcriptase; PCR, polymerase chain reaction; bp, base pair(s); kb, kilobase pair(s). an autosomal recessive disorder, the failure of acid α-glucosidase (GAA, acid maltase, EC 3.2.1.20) to hydrolyze lysosomal glycogen leads to the abnormal accumulation of large lysosomes filled with glycogen in some tissues (2Hirschhorn R. Scriver C.R. Beaudet A.L. Sly W.S. Valle D. The Metabolic and Molecular Basis of Inherited Disease. McGraw-Hill, New York1995: 2443-2464Google Scholar). The most severe form, Pompe Syndrome, is a rapidly progressive disease in which heart failure is fatal in infancy. In milder forms, there is progressive skeletal muscle weakness, and death may result from pulmonary failure secondary to diaphragmatic weakness as late as the seventh decade. There is currently no effective therapy, but several candidate therapies, based on the discovery that acid α-glucosidase, like many other lysosomal enzymes, is secreted and can be taken up through cell surface mannose-6-phosphate receptors on other cells (3van der Ploeg A.T. Loonen M.C. Bolhuis P.A. Busch H.M. Reuser A.J. Galjaard H. Pediatr. Res. 1988; 24: 90-94Crossref PubMed Scopus (37) Google Scholar, 4van der Ploeg A.T. Kroos M.A. Willemsen R. Brons N.H. Reuser A.J. J Clin. Invest. 1991; 87: 513-518Crossref PubMed Scopus (69) Google Scholar, 5Neufeld E.F. Annu. Rev. Biochem. 1991; 60: 257-280Crossref PubMed Scopus (484) Google Scholar), are already under development (6van der Ploeg A.T. Bolhuis P.A. Wolterman R.A. Visser J.W. Loonen M.C. Busch H.F. Reuser A.J. J Neurol. 1988; 235: 392-396Crossref PubMed Scopus (38) Google Scholar, 7van Hove J.L. Yang H.W. Wu J.Y. Brady R.O. Chen Y.T. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 65-70Crossref PubMed Scopus (105) Google Scholar, 8Zaretsky J.Z. Candotti F. Boerkoel C. Adams E.M. Yewdell J.W. Blaese R.M. Plotz P.H. Hum. Gene Ther. 1997; 8: 1555-1563Crossref PubMed Scopus (33) Google Scholar, 9Kessler P.D. Podsakoff G.M. Chen X. McQuiston S.A. Colosi P.C. Matelis L.A. Kurtzman G.J. Byrne B.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 14082-14087Crossref PubMed Scopus (534) Google Scholar, 10Bijvoet A.G. Kroos M.A. Pieper F.R. de Boer H.A. Reuser A.J. van der Ploeg A.T. Verbeet M.P. Biochim. Biophys. Acta. 1996; 1308: 93-96Crossref PubMed Scopus (28) Google Scholar, 11Pauly D.F. Johns D.C. Matelis L.A. Lawrence J.H. Byrne B.J. Kessler P.D. Gene Therapy. 1998; 5: 473-480Crossref PubMed Scopus (47) Google Scholar, 12Kikuchi T. Yang H.W. Pennybacker M. Ichihara N. Mizutani M. van Hove J.L. Chen Y.T. J. Clin. Invest. 1998; 101: 827-833Crossref PubMed Scopus (146) Google Scholar). These studies stimulated efforts to create a mouse model suitable for testing enzyme replacement and gene therapies. Bijvoet et al. (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar) recently reported the generation of knockout mice which develop generalized glycogen storage and cardiomegaly but remain phenotypically normal. We describe here the generation of two models: 1) knockout mice in which the GAA gene is disrupted by a neo insertion in exon 6 (6neo/6neo) and 2) mutant mice in which exon 6 of the GAA gene and the neo gene are removed by Cre/lox-mediated recombination (Δ6/Δ6) (13Sauer B. Henderson N. Proc. Natl. Acad. Sci. U. S. A. 1988; 85: 5166-5170Crossref PubMed Scopus (894) Google Scholar). In both models, animals develop biochemical and pathological changes similar to those in humans, but only 6neo/6neo mice show early signs of reduced mobility and muscle strength. By 8–9 months of age 6neo/6neo mice develop a weak, waddling gait, and progressive muscle wasting. GAA genomic clones were isolated from a 129/Sv mouse genomic library. A plasmid containing both the neomycin-resistance (neo) gene and the herpes virus thymidine kinase gene in the pBluescript vector (a gift of Dr. R. Proia) served as the backbone of the targeting vector (14Yamanaka S. Johnson M.D. Grinberg A. Westphal H. Crawley J.N. Taniike M. Suzuki K. Proia R.L. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9975-9979Crossref PubMed Scopus (163) Google Scholar). The organization of the targeting construct is shown in Fig. 1 A. A genomic fragment extending from an XbaI site in intron 2 to a BamHI site in exon 6 was inserted into theXhoI site between the thymidine kinase and neogenes. In addition, a termination codon and a new EcoRV site were introduced within exon 6 upstream from the neo gene. Next, a genomic fragment containing the remainder of exon 6 and exons 7 through 13 was cloned into the SalI site downstream of theneo gene. Two loxP sites were inserted into introns 5 and 6. The resulting vector has ∼2.7 kb of homology upstream and ∼4.3 kb of homology downstream of the neogene. The linearized vector was electroporated into 129/Sv RW4 ES cells (Genome Systems Inc.), and the resulting neo-positive (G418-resistant), thymidine kinase-negative (ganciclovir-resistant) clones were screened by Southern analysis. Chimeric mice were generated by blastocyst injection of heterozygous ES cells into 3.5-day C57BL/6 embryos. Six independent cell lines containing the disrupted GAA allele were used to make chimeras that were bred to C57BL/6 females to generate heterozygous mice (F1). Four mutant lines were then established through germ line transmission; heterozygous F1 mice derived from two independent cell lines, 2-55 and 2-86, were intercrossed to obtain mice homozygous for the disrupted allele (F2 and F3). Alternatively, F1/2-55 and F1/2-86 heterozygous mice were bred to EIIa-cre transgenic mice (FVB/N) for Cre-mediated deletion (Δ6/Δ6) of the neo gene and exon 6 of the GAA gene in vivo. GAA activity in the homogenates of skeletal muscle, liver, heart, and tail was measured as conversion of the substrate 4-methylumbelliferyl-α-d-glucoside to the fluorescent product umbelliferone as described previously (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar, 15Hermans M.M. Kroos M.A. van Beeumen J. Oostra B.A. Reuser A.J. J Biol. Chem. 1991; 266: 13507-13512Abstract Full Text PDF PubMed Google Scholar). Tissues were dissected and homogenized in lysis buffer (300 mm NaCl, 50 mm Tris, 2 mm EDTA, 0.5% Triton X-100) with proteinase inhibitors (4 mm Pefabloc SC, 10 μg/ml aprotinin, 10 μg/ml leupeptin). Samples (50 μg protein) were electrophoresed on 10% SDS-polyacrylamide gel electrophoresis gels and electrotransferred to nitrocellulose membranes. The blots were blocked with bovine serum albumin and incubated with rabbit antiserum to human placental GAA or rabbit antiserum to human urine GAA (kindly provided by Dr. F. Martiniuk and Dr. A. J. J. Reuser). Immunodetection was performed with goat anti-rabbit IgG conjugated to horseradish peroxidase in combination with chemiluminescence (ECL, Amersham Life Science Inc.). RNA was isolated from skeletal muscle and liver using a Total RNA Kit (Qiagen). First strand cDNA synthesis was primed from 2 μg of total RNA with 50 ng of random hexamers according to the manufacturer's instructions (Boehringer Mannheim). Two μl of the cDNA sample were used as a template for PCR amplification with primers flanking the neo gene: cctttctacctggcactggaggac (exon 5 sense) and ggacaatggcggtcgaggagta (exon 7 antisense) or tcaccctctggaaccgggacacacca (exon 4 sense) and ccggccatcctggtgcagctcccgca (exon 8 antisense). The second set of primers was used to detect any possible transcripts in which theneo gene may be spliced out. PCR reactions were carried out for 35 cycles that consisted of 50-s denaturation at 95 °C, 50-s annealing at 55 °C, and 2-min extension at 72 °C using PCR SuperMix (Life Technologies, Inc.). Genomic DNA isolated from ES cells or mouse tails was digested with EcoRV, electrophoresed on 1% agarose gels, and transferred to Nytran membranes. The hybridization probe was generated by PCR, and labeled by the random hexamer method after gel purification. For electron microscopy, tissues were fixed in phosphate-buffered saline containing 4% formaldehyde and 2% glutaraldehyde followed by post-fixation in 1% osmium in 0.1m cacodylate buffer. The tissues were rinsed in an aqueous solution containing 4.5% sucrose, dehydrated in a series of graded alcohol solutions, rinsed in 100% propylene oxide, and embedded in epoxy resin. Thin sections (60 to 70 nm) were double-stained with uranyl acetate and lead citrate. The stained sections were stabilized by carbon evaporation and photographed with a Hitachi H7000 electron microscope operated at 75 kV. For light microscopy, sections from tissues were fixed in 10% formalin, processed, embedded in paraffin, and stained with hematoxylin-eosin or periodic acid-Schiff (PAS) by standard methods. All procedures were conducted in accordance with the National Institutes of Health Guide for the Care and Use of Laboratory Animals. Locomotor activity in an open field was measured in a Digiscan apparatus (model RXYZCM, Omnitech Electronics). Total distance, horizontal activity, and vertical activity were measured by the total number of photocell beam breaks in 10- or 15-min intervals over 1 h, and data averaged over these periods were used for analysis. Three to six independent testing sessions were conducted for each group over a period of 1–2 weeks. Male mice were tested at ages 3.5–6, 8–9, and 10.5–22 weeks. Fourteen 6neo/+, 11 6neo/6neo, 8 Δ6/+, and 9 Δ6/Δ6 mice were used for the test. The origin of the mice which were phenotypically tested is indicated in TableI. Statistical analyses were performed using the one-way analysis of variance test (Sigmastat program). The ability to hang upside down from a wire screen placed 60 cm above a large housing cage was measured as latency to fall into the cage.Table IOrigin of the mice used for behavioral testingCell lineMouse line2–552–862–55/cre2–86/cre6neo/+1 /7/1aF1 mice/F2 mice/F3 mice (n).1 /4/06neo/6neo2 /1bF2 mice/F3 mice (n).3 /5Δ6/+0 /5/03 /0/0Δ6/Δ63 /60 /0a F1 mice/F2 mice/F3 mice (n).b F2 mice/F3 mice (n). Open table in a new tab The murine GAA gene was disrupted by insertion of neointo exon 6, with the expectation that the disruption would completely block gene expression (6neo/6neo). In addition,loxP sites were placed in the introns flanking the disrupted exon 6 so that exon 6 could be precisely removed (Δ6) by mating to Cre-producing mice. In humans, a similar splicing mutation around exon 6 is associated with a relatively mild phenotype (16Adams E.M. Becker J.A. Griffith L. Segal A. Plotz P.H. Raben N. Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (29) Google Scholar). By homologous recombination in ES cells, we created a mutant GAA allele in which a neo cassette disrupts the gene within exon 6 (Fig. 1 A). A termination codon and a new EcoRV site were introduced into exon 6 upstream from theneo gene. Translational termination at the stop codon in exon 6 would result in the synthesis of a truncated protein of ∼36 kDa. The frequency of recombination was 1 in 4 G418/ganciclovir-resistant clones. Recombinant clones were used to produce chimeric mice that transmitted the mutation through the germ line. Heterozygous mice (F1) derived from two independent cell lines (2-55 and 2-86) carrying the targeted allele were used for further breeding. Genotyping of the mice generated by intercrossing of heterozygotes (Fig. 1 B) revealed the expected Mendelian ratio, indicating no effect on embryonic development. Reverse transcription-PCR with two sets of primers flanking theneo gene detected wild-type products in the wild-type (+/+) and heterozygous (+/−) but not in 6neo/6neo (−/−) mice (Fig. 1 C), indicating that normal mRNA is not made in homozygotes. However, mRNA amplification with primers in exon 12 (sense) and exon 14 (antisense) downstream from the neo gene detected a low level of transcripts in 6neo/6neo mice (not shown). Similarly, RT-PCR with primers in exon 5 (sense) and theneo gene (antisense) detected a very low abundance message in the 6neo/6neo; reamplification of the PCR product with nested primers followed by sequencing established that the termination codon introduced into exon 6 upstream from the neo gene remained intact (not shown). In homozygous mice, no GAA protein was detected by Western analysis (Fig. 1 D) using antibodies against either human urine or human placental GAA. The absence of functional protein in 6neo/6neo mice was confirmed by enzyme assay in the lysates of multiple tissues (TableII). The residual levels of enzyme activity (at the standard pH 4.3) in the muscle, heart, and tail samples of 6neo/6neo mice did not exceed the background level found in a fibroblast cell line from an infantile patient (0.64 nmol of 4-methylumbelliferyl-α-d-glucoside/h/mg of protein; cell line 4912) in which mRNA is not expressed (17Martiniuk F. Mehler M. Pellicer A. Tzall S. La Badie G. Hobart C. Ellenbogen A. Hirschhorn R. Proc. Natl. Acad. Sci. U. S. A. 1986; 83: 9641-9644Crossref PubMed Scopus (91) Google Scholar). At low pH 3.6 (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar) the enzyme activity was below the detection limits (0.7–1.0 ng of 4-methylumbelliferone/10-μl reaction).Table IIGAA activity (nmol of 4-methylumbelliferyl-α-d-glucoside/h/mg of protein) in tissues and tail samplesTissueGenotype+/+6neo/+6neo/6neoHeart10.6 ± 0.694.7 ± 0.50.11 ± 0.01Muscle17.2 ± 1.410.4 ± 1.20.11 ± 0.03Brain57.0 ± 4.516.4 ± 2.40.62 ± 0.04Tail65.8 ± 8.126.3 ± 3.10.54 ± 0.05GAA activity was measured under standard conditions, pH 4.3 (15Hermans M.M. Kroos M.A. van Beeumen J. Oostra B.A. Reuser A.J. J Biol. Chem. 1991; 266: 13507-13512Abstract Full Text PDF PubMed Google Scholar). Open table in a new tab GAA activity was measured under standard conditions, pH 4.3 (15Hermans M.M. Kroos M.A. van Beeumen J. Oostra B.A. Reuser A.J. J Biol. Chem. 1991; 266: 13507-13512Abstract Full Text PDF PubMed Google Scholar). Abnormal lysosomal glycogen storage was found in the heart and skeletal muscle of 6neo/6neo mice. Electron microscopy showed the progressive accumulation of membrane-limited organelles between the bundles of myofibrils at the earliest point examined - age 3 weeks (Fig. 2 a and d). Immunoelectron microscopy with an antibody specific for the LAMP-1 protein confirmed that the organelles were lysosomes (not shown). Over time, the lysosomes increased in size and number (Fig. 2, b, c, e, andf). Furthermore, the density of the accumulated glycogen particles within the lysosomes increased (Fig. 2, h andi). The accumulation was clearly more marked in the heart than in the skeletal muscle (Fig. 2, d–f anda–c). Importantly, in the 6neo/6neo mice, there is a significant reduction in the number of myofibrils, loss of lateral myofibrillar registration, and signs of sacromere degradation, especially the deformation at the Z lines. Some lysosomes appear broken, suggesting that the leakage of lysosomal proteases may have contributed to the damage of the muscle structure. Light microscopy (at 8 weeks) showed PAS-positive, diastase-sensitive material in vacuoles in the heart and skeletal muscle (Fig. 3, b and d). In animals examined at 14 weeks, the diaphragm showed PAS-positive vacuoles by light microscopy (Fig. 3 f). Although the mutant mice appeared normal, when placed in an open field environment 6neo/6neo mice consistently performed significantly worse than heterozygous littermates by several measures of locomotion (Fig. 4). Reduced activity was registered as early as 3.5 weeks of age and was particularly striking for vertical motion (Fig. 4, bottom panel). Similarly, in the wire-hang task, which measures muscular function and grip strength, 6neo/+ mice outperformed 6neo/6neo littermates. At 15–16 weeks of age, 6neo/6neo mice were almost never able to hold on to the inverted screen for more than 2 min (once in 12 tests), whereas in 8 of 12 tests 6neo/+ littermates were able to remain hanging for more than 2 min, and 4 of 12 heterozygous littermates were still holding on at 5 min when the test was stopped. Older mice (8–9 months of age) show obvious signs of muscle weakness with a weak, waddling gait and muscle wasting (Fig. 5). Offspring from independent mutant mouse lines were phenotypically indistinguishable.Figure 5Clinical signs of muscle weakness. This 8-month-old female 6neo/6neo mouse has wasted lower back muscle and displays its hind limbs in a splayed posture.View Large Image Figure ViewerDownload (PPT) In the second model, the disrupted exon 6 of the GAA gene and the neo gene were totally excised from early embryos by breeding 6neo/+ mice (F1/2-55 and F1/2-86; 129/C57BL/6 background) to transgenic homozygous EIIa-cre (18Lakso M. Pichel J.G. Gorman J.R. Sauer B. Okamoto Y. Lee E. Alt F.W. Westphal H. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 5860-5865Crossref PubMed Scopus (909) Google Scholar) mice (FVB/N background) in which the adenovirus promoter confines the expression of Cre to an early stage of pre-implantation development. F1 heterozygous (mouse lines 2-55/cre and 2-86/cre) for exon 6-deleted allele were subsequently intercrossed to obtain F2 and F3 homozygous mice (Δ6/Δ6). Cre-mediated deletion was detected by PCR with primers in exon 5 and exon 7 (Fig. 6). As expected, the genomic sequence in homozygous mice contained the 5′ part of intron 5, then a singleloxP site in place of exon 6, followed by the 3′ part of intron 7 and exon 7 of the gene (not shown). RT-PCR with two sets of primers (in exons 5/7 and exons 4/8) showed that the mutant mRNA is produced (Fig. 7 A), and that in this mRNA exon 5 is spliced to exon 7, resulting in a precise in-frame deletion of exon 6 (not shown).Figure 7Expression of the exon 6-deleted allele. A, RT-PCR analysis of muscle cDNA from Δ6/Δ6 mice. Primers in exons 4 and 8 detect a 354-bp amplification product; primers in exons 5 and 7 detect a 150-bp product. The sizes of the products correspond to those expected for mRNA with exon 6 deleted. Each PCR was done in duplicate. The RT-PCR negative control (NC) was carried out by omitting RNA from reverse-transcription reaction in which both sets of primers were used. M, DNA marker.B , Western analysis (shown for liver). The blot was probed with rabbit IgG to human placental GAA. Lane 1, 6neo/+; lane 2, 6neo/6neo; lane 3, Δ6/Δ6.View Large Image Figure ViewerDownload (PPT) The Δ6/Δ6 mice were similar to the 6neo/6neo animals with respect to the level of enzyme activity measured in tail skin, muscle, and liver (not shown), absence of protein (Fig. 7 B), and accumulation of lysosomal glycogen in skeletal muscle, heart, and diaphragm (Fig. 8). Strikingly, however, unlike the 6neo/6neomice, their performance in the open field was similar to that of heterozygous Δ6/+ littermates derived from two mouse lines (Fig. 9, Table I). Interestingly, in all measures of activity, the Δ6/+ mice outperformed the 6neo/+ animals, indicating a genetic difference between the two mouse strains. So far (up to 6.5 months of age) the Δ6/Δ6 mice have not developed any clinical symptoms.Figure 9Locomotor activity of mice with exon 6 deletion (heterozygotes, Δ6/+; homozygotes, Δ6/Δ6), and exon 6 disruption (heterozygotes, 6neo/+; homozygotes, 6neo/6neo). Top panel, mean (±S.E.) horizontal activity per min in the open field (measured by the number of photocell beam breaks). Middle panel, mean (±S.E.) total distance (cm) per min in the open field. Bottom panel, mean (±S.E.) vertical activity per min in the open field (measured by the number of photocell beam breaks). Each bar represents the performance of 8–14 animals, and ∼200 intervals (10 min each) were averaged for each bar.View Large Image Figure ViewerDownload (PPT) We have used an efficient method for generating two allelic mutations at the murine GAA locus. The approach required the production of only one targeted mouse line with an exon 6 disrupted allele, which served as a progenitor of the second line with exon 6 deleted allele. Since the targeted locus contains two loxP sites flanking exon 6, the removal of the exon was performed simply by mating to transgenic mice carrying Cre recombinase. The two models were designed to replicate a range of clinical phenotypes: 6neo/6neo mice for a severe phenotype, and Δ6/Δ6 mice for a milder disease. A milder phenotype was predicted in the Δ6/Δ6 mice since a similar, though not identical defect in a patient, splicing out exon 6 and the inclusion of 7 new amino acids encoded by 21 nucleotides from IVS6, resulted in 5–7% of residual enzyme activity and a juvenile form of the illness (16Adams E.M. Becker J.A. Griffith L. Segal A. Plotz P.H. Raben N. Hum Mutat. 1997; 10: 128-134Crossref PubMed Scopus (29) Google Scholar). Both mouse models, however, resulted in apparently complete “knockout,” as shown by the virtual absence of enzyme activity and the absence of GAA protein. In humans, the severity and the age of onset of GSDII appear to depend largely on the level of residual activity of the enzyme. Lack of enzyme activity or extremely low levels (≤1–2%) are associated with a fatal infantile cardiomyopathy, whereas levels of 10–20% are associated with an adult onset indolent skeletal myopathy (19Reuser A.J. Kroos M.A. Hermans M.M. Bijvoet A.G. Verbeet M.P. van Diggelen O.P. Kleijer W.J. van der Ploeg A.T. Muscle Nerve. 1995; 3: S61-S69Crossref PubMed Scopus (135) Google Scholar, 20Kroos M.A. Van der Kraan M. van Diggelen O.P. Kleijer W.J. Reuser A.J. Van den Boogaard M.J. Ausems M.G. Ploos van Amstel H.K. Poenaru L. Nicolino M. Wevers R. J Med. Genet. 1995; 32: 836-837Crossref PubMed Scopus (83) Google Scholar, 21Raben N. Nichols R.C. Boerkoel C. Plotz P. Muscle Nerve. 1995; 3: S70-S74Crossref PubMed Scopus (44) Google Scholar). Unlike humans, recently described knockout mice (9 months old) (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar) and the Δ6/Δ6 mutants (6.5 months old) described here do not show clinical signs despite a severe enzyme deficiency. In contrast, 6neo/6neomice develop a progressive muscle weakness detectable as early as 3.5 weeks of age. The pathologic findings in 6neo/6neo mice indicate accumulation of lysosomal glycogen in the skeletal muscle and diaphragm, as in the adult human disease, and an even greater accumulation in heart, a hallmark of infantile disease. Tests of cardiac function will allow determination of the effects of the glycogen accumulation in the heart. In quantitative tests of mobility and strength, 6neo/6neomice moved less, especially in the vertical direction, and could not hold on to a wire screen nearly as long as 6neo/+ littermates. By 8–9 months, clinical signs of muscle weakness and muscle wasting are obvious. Longer observation will be necessary to determine if this reduced strength affects lifespan and if glycogen accumulation in the diaphragm reduces lung function. Thus, the 6neo/6neo model has features of both the adult and the infantile forms of the human disease, but the effects are attenuated. This difference in severity and in pace between mice and humans is not surprising since the factors which promote lysosomal glycogen storage are largely obscure. In humans, for example, the deposition of glycogen is very different from tissue to tissue within the same patient and from patient to patient or even sibling to sibling although they may bear the same mutation(s). Of related interest in that regard are the observations that although both the 6neo/6neo and Δ6/Δ6 mice have negligible enzyme activity and accumulate glycogen in skeletal and heart muscles, the 6neo/6neo are weak in open field and wire hang testing, but the Δ6/Δ6 are not. The phenotypic difference between the two models described here cannot be explained by the presence of a neo gene in the targeted locus of the 6neo/6neomice: in both the phenotypically affected 6neo/6neo model and a recently published phenotypically normal model with insertion of aneo gene in exon 13, a hybrid GAA-neo mRNA was detected by RT-PCR. Furthermore, we have studied the expression of the neo gene in a mouse strain with disruption of the HexA gene which is known to perform normally in the open field (14Yamanaka S. Johnson M.D. Grinberg A. Westphal H. Crawley J.N. Taniike M. Suzuki K. Proia R.L. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 9975-9979Crossref PubMed Scopus (163) Google Scholar). In this strain, abundant neo transcripts were detected in both liver and muscle by RT-PCR and sequencing (not shown), thus further indicating no effect of neo phosphotransferase on mobility and muscle strength. It is possible that the accumulation of glycogen is different in the muscles crucial for the activities tested; or that accumulation of glycogen in other sites such as the nervous system differs in the two models; or that weakness is related not only to the amount of accumulated glycogen. Indeed, the structural changes in myofibrillar structure may relate to other factors besides simple glycogen accumulation which are involved in lysosomal integrity. In support of the last possibility, it should be noted that the two strains are of different genetic background since the creation of the Δ6/Δ6 required mating to a strain bearing the Cre recombinase (FVB/N) while the 6neo/6neo mice were bred onto a C57BL/6 background. There is abundant similar evidence illustrating the importance of genetic background and modifying genes on phenotypic variation in knockout mice (22Erickson R.P. Bioessays. 1996; 18: 993-998Crossref PubMed Scopus (67) Google Scholar, 23Wilson J.M. J. Clin. Invest. 1996; 97: 1138-1141Crossref PubMed Google Scholar). As shown in Fig. 9, the background activity of the Cre strain control mice is substantially greater than that of the controls for the 6neo/6neo mice, suggesting that other genes influence behavior in the tests, and only in the less active strain is the additional insult of glycogen accumulation reflected in poorer performance. Such strain differences may account for the apparent absence of weakness in the recently published model (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar), which, like the Δ6/Δ6 model described here, was created on the 129/FVB background. It should be noted that the level of residual activity in the exon 13 model was somewhat higher (2.6% in muscle and 3.8% in heart) than the levels in the 6neo/6neoand the Δ6/Δ6 mice when measured at the same low pH 3.6. At that low pH, neither of the knockout strains described here had detectable activity in tail skin, muscle, or heart. It is possible that a residual low level of enzyme activity contributes to rescue of the phenotype of the exon 13 published knockout (1Bijvoet A.G. van de Kamp E.H. Kroos M. Ding J.H. Yang B.Z. Visser P. Bakker C.E. Verbeet M.P. Oostra B.A. Reuser A.J.J. van der Ploeg A.T. Hum Mol Genet. 1998; 7: 53-62Crossref PubMed Scopus (115) Google Scholar). Longer observation of the Δ6/Δ6 mice (oldest animals are 6.5 months of age) may clarify this point. Although all of the models created so far could be used for testing proposed gene therapy or enzyme replacement since the pathological and biochemical changes closely resemble those in humans, the nondestructive and easily testable phenotypic abnormalities of the 6neo/6neo model suggest that it would be the preferable choice.

The peroxisome proliferator-activated receptor alpha (PPAR alpha) is the mediator of the biological effects of peroxisome proliferators through control of gene transcription. To determine if the toxic effects of di(2-ethylhexyl)phthalate (DEHP) are mediated by PPAR alpha, we examined its effect in PPAR alpha-null mice. Male Sv/129 mice, PPAR alpha-null (-/-) or wild-type (+/+) were fed ad libitum either a control diet or one containing 12,000 ppm DEHP for up to 24 wk. Significant body weight loss and high mortality was observed in (+/+) mice fed DEHP. By 16 wk, all DEHP-fed (+/+) mice had died of cystic renal tubular disease. In contrast, the (-/-) mice fed DEHP had no changes in body weight until later in the study nor increased mortality. Histologically, (+/+) mice fed DEHP had typical toxic lesions in liver, kidney, and testis while (-/-) mice fed DEHP had no toxic liver lesions but did show evidence of toxicity in kidney and testis after 4-8 wk of feeding, which progressed into moderate lesions by 24 wk. Analysis of hepatic and renal mRNAs showed a typical pleiotropic response in gene expression in the DEHP-fed (+/+) mice that was absent in the DEHP-fed (-/-) mice. These results provide evidence that PPAR alpha mediates the subacute-chronic toxicity of DEHP in liver, kidney, and testis. However, because (-/-) mice did develop toxic lesions in kidney and testis, DEHP can also act through PPAR alpha-independent pathways in mediating renal and testicular toxicity.

Patients with multiple endocrine neoplasia type 1 (MEN1) develop multiple endocrine tumors, primarily affecting the parathyroid, pituitary, and endocrine pancreas, due to the inactivation of the MEN1 gene. A conditional mouse model was developed to evaluate the loss of the mouse homolog, Men1, in the pancreatic beta cell. Men1 in these mice contains exons 3 to 8 flanked by loxP sites, such that, when the mice are crossed to transgenic mice expressing cre from the rat insulin promoter (RIP-cre), exons 3 to 8 are deleted in beta cells. By 60 weeks of age, >80% of mice homozygous for the floxed Men1 gene and expressing RIP-cre develop multiple pancreatic islet adenomas. The formation of adenomas results in elevated serum insulin levels and decreased blood glucose levels. The delay in tumor appearance, even with early loss of both copies of Men1, implies that additional somatic events are required for adenoma formation in beta cells. Comparative genomic hybridization of beta cell tumor DNA from these mice reveals duplication of chromosome 11, potentially revealing regions of interest with respect to tumorigenesis.

To elucidate the function of PPARgamma in leptin-deficient mouse (ob/ob) liver, a PPARgamma liver-null mouse on an ob/ob background, ob/ob-PPARgamma(fl/fl)AlbCre(+), was produced using a floxed PPARgamma allele, PPARgamma(fl/fl), and Cre recombinase under control of the albumin promoter (AlbCre). The liver of ob/ob-PPARgamma(fl/fl)AlbCre(+) mice had a deletion of exon 2 and a corresponding loss of full-length PPARgamma mRNA and protein. The PPARgamma-deficient liver in ob/ob mice was smaller and had a dramatically decreased triglyceride (TG) content compared with equivalent mice lacking the AlbCre transgene (ob/ob-PPARgamma(fl/fl)AlbCre(-)). Messenger RNA levels of the hepatic lipogenic genes, fatty acid synthase, acetyl-CoA carboxylase, and stearoyl-CoA desaturase-1, were reduced in ob/ob-PPARgamma(fl/fl)AlbCre(+) mice, and the levels of serum TG and FFA in ob/ob-PPARgamma(fl/fl)AlbCre(+) mice were significantly higher than in the control ob/ob-PPARgamma(fl/fl)AlbCre(-) mice. Rosiglitazone treatment exacerbated the fatty liver in ob/ob-PPARgamma(fl/fl)AlbCre(-) mice compared with livers from nonobese Cre(-) mice; there was no effect of rosiglitazone in ob/ob-PPARgamma(fl/fl)AlbCre(+) mice. The deficiency of hepatic PPARgamma further aggravated the severity of diabetes in ob/ob mice due to decreased insulin sensitivity in muscle and fat. These data indicate that hepatic PPARgamma plays a critical role in the regulation of TG content and in the homeostasis of blood glucose and insulin resistance in steatotic diabetic mice.

Chemokines are attractants and regulators of cell activation. Several CXC family chemokine members induce angiogenesis and promote tumor growth. In contrast, the only CC chemokine, reported to play a direct role in angiogenesis is monocyte-chemotactic protein-1. Here we report that another CC chemokine, eotaxin (also known as CCL11), also induced chemotaxis of human microvascular endothelial cells. CCL11-induced chemotactic responses were comparable with those induced by monocyte-chemotactic protein-1 (CCL2), but lower than those induced by stroma-derived factor-1alpha (CXCL12) and IL-8 (CXCL8). The chemotactic activity was consistent with the expression of CCR3, the receptor for CCL11, on human microvascular endothelial cells and was inhibited by mAbs to either human CCL11 or human CCR3. CCL11 also induced the formation of blood vessels in vivo as assessed by the chick chorioallantoic membrane and Matrigel plug assays. The angiogenic response induced by CCL11 was about one-half of that induced by basic fibroblast factor, and it was accompanied by an inflammatory infiltrate, which consisted predominantly of eosinophils. Because the rat aortic sprouting assay, which is not infiltrated by eosinophils, yielded a positive response to CCL11, this angiogenic response appears to be direct and is not mediated by eosinophil products. This suggests that CCL11 may contribute to angiogenesis in conditions characterized by increased CCL11 production and eosinophil infiltration such as Hodgkin's lymphoma, nasal polyposis, endometriosis, and allergic diathesis.

Abstract Approximately 2 wk after birth, mice having a TGF-beta 1 null mutation (TGF-beta 1(-/-)) exhibit a progressive wasting syndrome and death. Associated with this phenotype is a multifocal infiltration of lymphocytes and macrophages into target organs, especially the heart, lungs, and salivary glands. To explore the consequences of TGF-beta 1 deficiency on the immune system, lymphocyte phenotype and function were analyzed. Initially, lymphoid organ architecture seemed to be normal and, as symptoms developed, the thymus decreased in size, whereas lymph nodes were enlarged. Phenotypically, the TGF-beta 1(-/-) lymphoid cells seemed to be more differentiated in the thymus and activated in the lymph nodes, but remarkably unaffected in the spleen. Moreover, TGF-beta 1(-/-) spleen and lymph nodes displayed enhanced numbers of proliferating cells, as measured by proliferating cell nuclear Ag and/or cyclin-dependent kinase levels. Consistent with this hyperproliferative response, constitutive levels of IL-2 mRNA were elevated in the thymus and both IL-2 and IL-2R mRNA were increased in the lymph nodes. In contrast with the activation profile of TGF-beta 1(-/-) lymphoid cells in vivo, mitogen challenge of these cells in vitro revealed suppressed proliferation that was associated with a defect in inducible IL-2 mRNA expression and IL-2 secretion. Moreover, the addition of rIL-2 restored the deficient mitogen-induced proliferation. The mechanism leading to T cell anergy remains unclear; however, these data confirm the essential role for TGF-beta 1 in maintaining normal immune function.

West Nile virus (WNV) is a re-emerging pathogen that can cause fatal encephalitis. In mice, susceptibility to WNV has been reported to result from a single point mutation in oas1b, which encodes 2'-5' oligoadenylate synthetase 1b, a member of the type I interferon-regulated OAS gene family involved in viral RNA degradation. In man, the human ortholog of oas1b appears to be OAS1. The 'A' allele at SNP rs10774671 of OAS1 has previously been shown to alter splicing of OAS1 and to be associated with reduced OAS activity in PBMCs. Here we show that the frequency of this hypofunctional allele is increased in both symptomatic and asymptomatic WNV seroconverters (Caucasians from five US centers; total n = 501; OR = 1.6 [95% CI 1.2-2.0], P = 0.0002 in a recessive genetic model). We then directly tested the effect of this SNP on viral replication in a novel ex vivo model of WNV infection in primary human lymphoid tissue. Virus accumulation varied markedly among donors, and was highest for individuals homozygous for the 'A' allele (P<0.0001). Together, these data identify OAS1 SNP rs10774671 as a host genetic risk factor for initial infection with WNV in humans.

Glycogen storage disease type 1a (GSD–1a) is caused by a deficiency in microsomal glucose–6–phosphatase (G6Pase), the key enzyme in glucose homeostasis. A G6Pase knockout mouse which mimics the pathophysiology of human GSD–1 a patients was created to understand the pathogenesis of this disorder, to delineate the mechanisms of G6Pase catalysis, and to develop future therapeutic approaches. By examining G6Pase in the liver and kidney, the primary gluconeogenic tissues, we demonstrate that glucose–6–P transport and hydrolysis are performed by separate proteins which are tightly coupled. We propose a modified translocase catalytic unit model for G6Pase catalysis

Experimental autoimmune encephalomyelitis (EAE) is a T cell-mediated demyelinating disease of the central nervous system (CNS). Indoleamine 2,3-dioxygenase (IDO) is an enzyme that catabolizes tryptophan, which can result in the death of T lymphocytes. This effect of IDO is inhibited by 1-methyl-tryptophan (1-MT). We used a murine model of EAE to demonstrate: (1) opposing patterns of spinal cord IDO and interferon-gamma (INF-gamma) mRNA expression through the preclinical, acute and remission I phases of EAE; (2) a change in the kynurenine-to-tryptophan (K/T) ratio during these same phases; and (3) 1-MT-induced exacerbation of clinical and histologic disease parameters during EAE. These results suggest that IDO may contribute to the regulation of T cell activity associated with the different phases of this animal model of multiple sclerosis (MS).

Abstract Lipid-lowering fibrate drugs function as agonists for the nuclear receptor peroxisome proliferator-activated receptor α (PPARα). Sustained activation of PPARα leads to the development of liver tumors in rats and mice. However, humans appear to be resistant to the induction of peroxisome proliferation and the development of liver cancer by fibrate drugs. The molecular basis of this species difference is not known. To examine the mechanism determining species differences in peroxisome proliferator response between mice and humans, a PPARα-humanized mouse line was generated in which the human PPARα was expressed in liver under control of the tetracycline responsive regulatory system. The PPARα-humanized and wild-type mice responded to treatment with the potent PPARα ligand Wy-14643 as revealed by induction of genes encoding peroxisomal and mitochondrial fatty acid metabolizing enzymes and resultant decrease of serum triglycerides. However, surprisingly, only the wild-type mice and not the PPARα-humanized mice exhibited hepatocellular proliferation as revealed by elevation of cell cycle control genes, increased incorporation of 5-bromo-2′-deoxyuridine into hepatocyte nuclei, and hepatomegaly. These studies establish that following ligand activation, the PPARα-mediated pathways controlling lipid metabolism are independent from those controlling the cell proliferation pathways. These findings also suggest that structural differences between human and mouse PPARα are responsible for the differential susceptibility to the development of hepatocarcinomas observed after treatment with fibrates. The PPARα-humanized mice should serve as models for use in drug development and human risk assessment and to determine the mechanism of hepatocarcinogenesis of peroxisome proliferators.

New prophylactic and therapeutic strategies to combat human infections with highly pathogenic avian influenza (HPAI) H5N1 viruses are needed. We generated neutralizing anti-H5N1 human monoclonal antibodies (mAbs) and tested their efficacy for prophylaxis and therapy in a murine model of infection.Using Epstein-Barr virus we immortalized memory B cells from Vietnamese adults who had recovered from infections with HPAI H5N1 viruses. Supernatants from B cell lines were screened in a virus neutralization assay. B cell lines secreting neutralizing antibodies were cloned and the mAbs purified. The cross-reactivity of these antibodies for different strains of H5N1 was tested in vitro by neutralization assays, and their prophylactic and therapeutic efficacy in vivo was tested in mice. In vitro, mAbs FLA3.14 and FLD20.19 neutralized both Clade I and Clade II H5N1 viruses, whilst FLA5.10 and FLD21.140 neutralized Clade I viruses only. In vivo, FLA3.14 and FLA5.10 conferred protection from lethality in mice challenged with A/Vietnam/1203/04 (H5N1) in a dose-dependent manner. mAb prophylaxis provided a statistically significant reduction in pulmonary virus titer, reduced associated inflammation in the lungs, and restricted extrapulmonary dissemination of the virus. Therapeutic doses of FLA3.14, FLA5.10, FLD20.19, and FLD21.140 provided robust protection from lethality at least up to 72 h postinfection with A/Vietnam/1203/04 (H5N1). mAbs FLA3.14, FLD21.140 and FLD20.19, but not FLA5.10, were also therapeutically active in vivo against the Clade II virus A/Indonesia/5/2005 (H5N1).These studies provide proof of concept that fully human mAbs with neutralizing activity can be rapidly generated from the peripheral blood of convalescent patients and that these mAbs are effective for the prevention and treatment of H5N1 infection in a mouse model. A panel of neutralizing, cross-reactive mAbs might be useful for prophylaxis or adjunctive treatment of human cases of H5N1 influenza.

T/EBP/NKX2.1, a member of the NKX family of homeodomain-containing transcription factors, regulates the expression of a number of genes in lung and thyroid. Here we describe the isolation and characterization of a novel target gene, termed claudin-18, that is down-regulated in the lungs of T/ebp/Nkx2.1-null mouse embryos. The gene product exhibits an amino acid sequence similar to those of the claudin multigene family of proteins that constitute tight junction strands in epithelial cells. The gene was localized by fluorescence in situ hybridization to mouse chromosome 9 at region 9E3-F1 and to human chromosome 3 at region 3q21-23. The claudin-18 gene has two promoters, each with its own unique exon 1 that is spliced to common exons 2 through 5. Alternative usage of these promoters leads to production of lung and stomach-specific transcripts. The downstream lung-specific promoter contains two T/EBP/NKX2.1 binding sites responsible for trans activation of the gene by T/EBP/NKX2.1 in lung cells. Only claudin-18 was down-regulated in T/ebp/Nkx2.1-null embryo lungs among 11 claudin transcripts examined. Furthermore, the claudin-18 transcript has an alternative 12-bp insertion derived from the 5' end of intron 4, which produces a C-terminally truncated isoform in lung and stomach. Immunohistochemistry demonstrated complete membrane localization of claudin-18 with small focal dots in the lung and stomach epithelial cells. Immunogold electron microscopy analysis revealed that claudin-18 is concentrated at the cell-cell borders of epithelial cells. These unique features suggest a potentially important role for claudin-18 in the structure and function of tight junctions in lung and stomach.

Ethylene dibromide and 1,2-dibromo-3-chloropropane (DBCP) were administered to Osborne-Mendel rats and (C57BL × C3H)F1 mice via chronic oral intubation 5 times per week at experimentally predetermined maximally tolerated doses and at half those doses. As early as 10 weeks after initiation of treatment, both compounds induced a high incidence of squamous cell carcinomas of the stomach in both species. In addition, DBCP induced mammary adenocarcinomas in the female rats. Possible environmental hazards of these compounds are discussed.

Peroxisome proliferators, such as lipid-lowering fibrate drugs, are agonists for the peroxisome proliferator-activated receptor α (PPARα). Sustained activation of PPARα leads to the development of liver tumors in rodents. Paradoxically, humans appear to be resistant to the induction of peroxisome proliferation and development of liver tumors by peroxisome proliferators. To examine the species differences in response to peroxisome proliferators, a PPARα humanized mouse (hPPARα) was generated, in which the human PPARα was expressed in liver under control of the Tet-OFF system. To evaluate the susceptibility of hPPARα mice to peroxisome proliferator-induced hepatocarcinogenesis, a long-term feeding study of Wy-14,643 was carried out. hPPARα and wild-type (mPPARα) mice were fed either a control diet or one containing 0.1% Wy-14,643 for 44 and 38 weeks, respectively. Gene expression analysis for peroxisomal and mitochondrial fatty acid metabolizing enzymes revealed that both hPPARα and mPPARα were functional. However, the incidence of liver tumors including hepatocellular carcinoma was 71% in Wy-14,643-treated mPPARα mice, and 5% in Wy-14,643-treated hPPARα mice. Upregulation of cell cycle regulated genes such as cd1 and Cdks were observed in non-tumorous liver tissue of Wy-14,643-treated mPPARα mice, whereas p53 gene expression was increased only in the livers of Wy-14,643-treated hPPARα mice. These findings suggest that structural differences between human and mouse PPARα are responsible for the differential susceptibility to the peroxisome proliferator-induced hepatocarcinogenesis. This mouse model will be useful for human cancer risk assessment of PPARα ligands.

Mitotic arrest-deficient protein 1 (MAD1) is a component of the mitotic spindle assembly checkpoint. We have created a knockout mouse model to examine the physiologic consequence of reduced MAD1 function. Mad1(+/-) mice were successfully generated, but repeated paired mating of Mad1(+/-) with Mad1(+/-) mice failed to produce a single Mad1(-/-) animal, suggesting that the latter genotype is embryonic lethal. In aging studies conducted for >18 months, Mad1(+/-) mice compared with control wild-type (wt) littermates showed a 2-fold higher incidence of constitutive tumors. Moreover, 42% of Mad1(+/-) (P < 0.03), but 0% of wt, mice developed neoplasia after treatment with vincristine, a microtubule depolymerization agent. Mad1(+/-) mouse embryonic fibroblasts (MEF) were found to be more prone than wt cells to become aneuploid; Mad1(+/-), but not wt, MEFs produced fibrosarcomas when explanted into nude mice. Our results indicate an essential MAD1 function in mouse development and correlate Mad1 haploinsufficiency with increased constitutive tumors.

Variability in the incidence rates of some common naturally occurring tumors for 72 inbred F344 rat and 54 (C57BL/6N × C3H/HeN)F1 (B6C3F1) mouse control groups used in carcinogenesis bioassays was evaluated. Significant heterogeneity of control rates was observed in at least two of six laboratories for lymphomas-leukemias, liver tumors, and pituitary tumors in the male rat and for pituitary tumors and endometrial stromal polyps in the female rat. Significant interlaboratory heterogeneity was observed for several tumor types in the F344 rat. In contrast, control incidence rates for tumors of the lung and liver and lymphomas-leukemias in B6C3F1 mice were relatively homogeneous within four of five laboratories. Significant interlaboratory heterogeneity was observed, however, for these mouse tumors. The causes of significant heterogeneity in naturally occurring tumor incidence rates within and among laboratories are unknown. Although the most appropriate and important comparison of an experimental group is with its matched control, there may be instances in which the historical control rates provide relevant data needed to clearly interpret carcinogenesis bioassay results. With the use of data from bioassays of 4-chloro-m-phenylenediamine and nitrilotriacetic acid, two examples are presented to demonstrate the usefulness of the historical control data.

Hepatic enzyme induction is generally an adaptive response associated with increases in liver weight, induction of gene expression, and morphological changes in hepatocytes. The additive growth and functional demands that initiated the response to hepatic enzyme induction cover a wide range of stimuli including pregnancy and lactation, hormonal fluctuations, dietary constituents, infections associated with acute-phase proteins, as well as responses to exposure to xenobiotics. Common xenobiotic enzyme inducers trigger pathways involving the constitutive androstane receptor (CAR), the peroxisome proliferator-activated receptor (PPAR), the aryl hydrocarbon receptor (AhR), and the pregnane-X-receptor (PXR). Liver enlargement in response to hepatic enzyme induction is typically associated with hepatocellular hypertrophy and often, transient hepatocyte hyperplasia. The hypertrophy may show a lobular distribution, with the pattern of lobular zonation and severity reflecting species, strain, and sex differences in addition to effects from specific xenobiotics. Toxicity and hepatocarcinogenicity may occur when liver responses exceed adaptive changes or induced enzymes generate toxic metabolites. These undesirable consequences are influenced by the type and dose of xenobiotic and show considerable species differences in susceptibility and severity that need to be understood for assessing the potential effects on human health from similar exposures to specific xenobiotics.

The cytochrome P450 (P450) CYP2E1 enzyme metabolizes and activates a wide array of toxicological substrates, including alcohols, the widely used analgesic acetaminophen, acetone, benzene, halothane, and carcinogens such as azoxymethane and dimethylhydrazine. Most studies on the biochemical and pharmacological actions of CYP2E1 are derived from studies with rodents, rabbits, and cultured hepatocytes; therefore, extrapolation of the results to humans can be difficult. Creating “humanized” mice by introducing the human <i>CYP2E1</i> gene into Cyp2e1-null mice can circumvent this disadvantage. A transgenic mouse line expressing the human <i>CYP2E1</i> gene was established. Western blot and high-performance liquid chromatography/mass spectrometry analyses revealed human CYP2E1 protein expression and enzymatic activity in the liver of <i>CYP2E1</i>-humanized mice. Treatment of mice with the CYP2E1 inducer acetone demonstrated that human CYP2E1 was inducible in this transgenic model. The response to the CYP2E1 substrate acetaminophen was explored in the <i>CYP2E1</i>-humanized mice. Hepatotoxicity, resulting from the CYP2E1-mediated activation of acetaminophen, was demonstrated in the livers of <i>CYP2E1</i>-humanized mice by elevated serum alanine aminotransferase levels, increased hepatocyte necrosis, and decreased P450 levels. These data establish that in this humanized mouse model, human CYP2E1 is functional and can metabolize and activate different CYP2E1 substrates such as chlorzoxazone, <i>p</i>-nitrophenol, acetaminophen, and acetone. <i>CYP2E1</i>-humanized mice will be of great value for delineating the role of human CYP2E1 in ethanol-induced oxidative stress and alcoholic liver damage. They will also function as an important in vivo tool for predicting drug metabolism and disposition and drug-drug interactions of chemicals that are substrates for human CYP2E1.

Th cells can be subdivided into IFN-gamma-secreting Th1, IL-4/IL-5-secreting Th2, and IL-17-secreting Th17 cells. We have evaluated the capacity of fully differentiated Th1, Th2, and Th17 cells derived from a mouse bearing a transgenic TCR specific for the gastric parietal cell antigen, H(+)K(+)-ATPase, to induce autoimmune gastritis after transfer to immunodeficient recipients. We have also determined the susceptibility of the disease induced by each of the effector T cell types to suppression by polyclonal regulatory T cells (Treg) in vivo. Each type of effector cell induced autoimmune gastritis with distinct histological patterns. Th17 cells induced the most destructive disease with cellular infiltrates composed primarily of eosinophils accompanied by high levels of serum IgE. Polyclonal Treg could suppress the capacity of Th1 cells, could moderately suppress Th2 cells, but could suppress Th17-induced disease only at early time points. The major effect of the Treg was to inhibit the expansion of the effector T cells. However, effector cells isolated from protected animals were not anergic and were fully competent to proliferate and produce effector cytokines ex vivo. The strong inhibitory effect of polyclonal Treg on the capacity of some types of differentiated effector cells to induce disease provides an experimental basis for the clinical use of polyclonal Treg in the treatment of autoimmune disease in humans.

Multiple endocrine neoplasia type 1 (MEN1), among all syndromes, causes tumors in the highest number of tissue types. Most of the tumors are hormone producing (e.g., parathyroid, enteropancreatic endocrine, anterior pituitary) but some are not (e.g., angiofibroma). MEN1 tumors are multiple for organ type, for regions of a discontinuous organ, and for subregions of a continuous organ. Cancer contributes to late mortality; there is no effective prevention or cure for MEN1 cancers. Morbidities are more frequent from benign than malignant tumor, and both are indicators for screening. Onset age is usually earlier in a tumor type of MEN1 than of nonhereditary cases. Broad trends contrast with those in nonneoplastic excess of hormones (e.g., persistent hyperinsulinemic hypoglycemia of infancy). Most germline or somatic mutations in the MEN1 gene predict truncation or absence of encoded menin. Similarly, 11q13 loss of heterozygosity in tumors predicts inactivation of the other MEN1 copy. MEN1 somatic mutation is prevalent in nonhereditary, MEN1-like tumor types. Compiled germline and somatic mutations show almost no genotype/phenotype relation. Normal menin is 67 kDa, widespread, and mainly nuclear. It may partner with junD, NF-kB, PEM, SMAD3, RPA2, FANCD2, NM23beta, nonmuscle myosin heavy chain II-A, GFAP, and/or vimentin. These partners have not clarified menin's pathways in normal or tumor tissues. Animal models have opened approaches to menin pathways. Local overexpression of menin in Drosophila reveals its interaction with the jun-kinase pathway. The Men1+/- mouse has robust MEN1; its most important difference from human MEN1 is marked hyperplasia of pancreatic islets, a tumor precursor stage.

A primate lymphotropic lentivirus was isolated on the human T-cell line HuT 78 after cocultivation of a lymph node from a pig-tailed macaque (Macaca nemestrina) that had died with malignant lymphoma. This isolate, originally designated M. nemestrina immunodeficiency virus (MnIV) and now classified as simian immunodeficiency virus (SIV/Mne), was inoculated intravenously into three juvenile rhesus monkeys (Macaca mulatta), three juvenile pig-tailed macaques (M. nemestrina), and two juvenile baboons (Papio cynocephalus). All six macaques became viremic by 3 weeks after inoculation, whereas neither of the baboons developed viremia. One pig-tailed macaque died at 15 weeks with suppurative peritonitis secondary to ulcerative, necrotizing colitis. Immunologic abnormalities included a marked decrease in CD4+ peripheral blood lymphocytes. Although five macaques mounted an antibody response to SIV/Mne, the animal that died at 15 weeks remained antibody negative. Three other macaques (two rhesus and one pig-tailed) died 66 to 87 weeks after inoculation after exhibiting progressive weight loss, anemia, and diarrhea. Histopathologic findings at necropsy included various manifestations of immune deficiency, nephropathy, subacute encephalitis, pancreatitis, adenocarcinoma, and lymphoid atrophy. SIV/Mne could be readily isolated from the spleens and lymph nodes of all necropsied macaques, and from the cerebrospinal fluid, brains, bone marrow, livers, and pancreas of some of the animals. SIV antigens were localized by avidin-biotin immunohistochemistry to pancreatic islet cells and to bone marrow endothelial cells. The data suggest that African baboons may be resistant to infection by SIV/Mne, whereas Asian macaques are susceptible to infection with this pathogenic primate lentivirus.

The nephropathologic effects of cis-diammine-dichloroplatinum (II) are described. Male F344 rats, 6 weeks of age, were injected ip with cis-diammine-dichloroplatinum (II)(NSC-119875) at doses from 0.5–12 mg/kg. The LD50 was 7.7 mg/kg. After one injection, many rats lost weight by 24 hr and died from 2–7 days later, depending on the dose, whereas rats receiving lower doses recovered and gained weight by 7–10 days. Increased blood urea nitrogen (BUN) concentrations and renal weights reached a peak on Day 5 and returned to control values by Day 15. Histologically, acute degenerative and necrotizing lesions involved tubules in the outer stripe of the renal medulla and regeneration was noted by 5 days. Death of rats after one or five daily injections was attributed to the necrotizing enteritis, thymic atrophy, lymphocytic and bone marrow depletion, and renal lesions. Weekly injections resulted in uremia and development of markedly cystic kidneys. The results indicate that the F344 rat is a sensitive strain for the study of platinum nephrotoxicity.

ABSTRACT Respiratory syncytial virus (RSV) readily infects and reinfects during infancy and throughout life, despite maternal antibodies and immunity from prior infection and without the need for significant antigenic change. RSV has two neutralization antigens, the F and G virion glycoproteins. G is expressed in both membrane-bound (mG) and secreted (sG) forms. We investigated whether sG might act as a decoy for neutralizing antibodies by comparing the in vitro neutralization of wild-type (wt) RSV versus recombinant mG RSV expressing only mG. wt RSV indeed was less susceptible than mG RSV to monovalent G-specific and polyvalent RSV-specific antibodies, whereas susceptibility to F-specific antibodies was equivalent. This difference disappeared when the virus preparations were purified to remove sG. Thus, sG appears to function as a neutralization decoy. We evaluated this effect in vivo in mice by comparing the effects of passively transferred antibodies on the pulmonary replication of wt RSV versus mG RSV. Again, wt RSV was less sensitive than mG RSV to G-specific and RSV-specific antibodies; however, a similar difference was also observed with F-specific antibodies. This confirmed that sG helps wt RSV evade the antibody-dependent restriction of replication but indicated that in mice, it is not acting primarily as a decoy for G-specific antibodies, perhaps because sG is produced in insufficient quantities in this poorly permissive animal. Rather, we found that the greater sensitivity of mG versus wt RSV to the antiviral effect of passively transferred RSV antibodies required the presence of inflammatory cells in the lung and was Fcγ receptor dependent. Thus, sG helps RSV escape the antibody-dependent restriction of replication via effects as an antigen decoy and as a modulator of leukocytes bearing Fcγ receptors.

Severe acute respiratory syndrome coronavirus (SARS-CoV) infection often caused severe end stage lung disease and organizing phase diffuse alveolar damage, especially in the elderly. The virus-host interactions that governed development of these acute end stage lung diseases and death are unknown. To address this question, we evaluated the role of innate immune signaling in protection from human (Urbani) and a recombinant mouse adapted SARS-CoV, designated rMA15. In contrast to most models of viral pathogenesis, infection of type I, type II or type III interferon knockout mice (129 background) with either Urbani or MA15 viruses resulted in clinical disease outcomes, including transient weight loss, denuding bronchiolitis and alveolar inflammation and recovery, identical to that seen in infection of wildtype mice. This suggests that type I, II and III interferon signaling play minor roles in regulating SARS pathogenesis in mouse models. In contrast, infection of STAT1-/- mice resulted in severe disease, high virus titer, extensive pulmonary lesions and 100% mortality by day 9 and 30 post-infection with rMA15 or Urbani viruses, respectively. Non-lethal in BALB/c mice, Urbani SARS-CoV infection in STAT1-/- mice caused disseminated infection involving the liver, spleen and other tissues after day 9. These findings demonstrated that SARS-CoV pathogenesis is regulated by a STAT1 dependent but type I, II and III interferon receptor independent, mechanism. In contrast to a well documented role in innate immunity, we propose that STAT1 also protects mice via its role as an antagonist of unrestrained cell proliferation.

Utilizing the direct and indirect fluorescent antibody procedure, the antigenic relationship of the feline infectious peritonitis virus (FIPV) to 7 other human and animal coronaviruses was studied. FIPV was found to be closely related to transmissible gastroenteritis virus (TGEV) of swine. Transmissible gastroenteritis virus and FIPV were in turn antigenically related to human coronavirus 229E (HCV-229E) and canine coronavirus (CCV). An interesting finding in the study was that the 8 coronaviruses selected for this study fell into one of two antigenically distinct groups. Viruses in each group were antigenically related to each other to varying degrees, but were antigenically unrelated to coronaviruses of the second group. The first antigenically related group was comprised of mouse hepatitis virus, type 3 (MHV-3), hemeagglutinating encephalomyelitis virus 67N (HEV-67N) of swine, calf diarrhea coronavirus (CDCV), and human coronavirus OC43 (HCV-OC43). The second antigenically related group was comprised of FIPV, TGEV, HCV-229E and CCV.

Neoplastic and nonneoplastic lesions in 975 male and 970 female Osborne-Mendel rats used as controls in carcinogenesis tests were tabulated and evaluated. Three types of controls were considered—untreated controls (245 males, 245 females), controls administered corn oil in feed (530 males, 525 females), and controls administered corn oil by gavage (200 males, 200 females). Few neoplasms were seen in rats less than 18 months of age; the incidence of tumors markedly increased between 18 and 24 months of age. The incidence of some of the more common neoplasms, in which the combined incidence was greater than 1%, varied among the control groups, and in most cases the differences in incidences were not statistically significant. Hemangiosarcomas at all sites and C-cell adenomas of the thyroid in female rats were marginally significantly lower in controls given corn oil by gavage than in the other two groups. The occurrence of adenocarcinomas of the mammary gland was significantly higher in male controls given corn oil by gavage than in the other two groups. In untreated controls, the incidences of adrenal cortical adenomas in males and females and of pheochromocytomas in males were significantly higher than in both groups given corn oil. In rats administered corn oil in the feed, the incidences of pituitary adenomas in males and females, follicular cell adenomas of the thyroid in males, and endometrial stromal polyps in females were significantly higher than the incidences in the other two groups. The possible reasons for these differences are discussed. However, the types of tumors seen in the three control groups were morphologically comparable. The tumors observed included two types that had not previously been well characterized in Osborne-Mendel rats—malignant fibrous histiocytomas and lipomatous tumors of the kidney. Incidences of the more common nonneoplastic lesions are reported.

The use of induced and spontaneous mutant mice and genetically engineered mice (and combinations thereof) to study cancers and other aging phenotypes to advance improved functional human life spans will involve studies of aging mice. Genetic background contributes to pathology phenotypes and to causes of death as well as to longevity. Increased recognition of expected phenotypes, experimental variables that influence phenotypes and research outcomes, and experimental design options and rationales can maximize the utility of genetically engineered mice (GEM) models to translational research on aging. This review aims to provide resources to enhance the design and practice of chronic and longevity studies involving GEM. C57BL6, 129, and FVB/N strains are emphasized because of their widespread use in the generation of knockout, transgenic, and conditional mutant GEM. Resources are included also for pathology of other inbred strain families, including A, AKR, BALB/c, C3H, C57L, C58, CBA, DBA, GR, NOD.scid, SAMP, and SJL/J, and non-inbred mice, including 4WC, AB6F1, Ames dwarf, B6, 129, B6C3F1, BALB/c,129, Het3, nude, SENCAR, and several Swiss stocks. Experimental strategies for long-term cross-sectional and longitudinal studies to assess causes of or contributors to death, disease burden, spectrum of pathology phenotypes, longevity, and functional healthy life spans (health spans) are compared and discussed.

Immunity to a sand fly salivary protein protects against visceral leishmaniasis (VL) in hamsters. This protection was associated with the development of cellular immunity in the form of a delayed-type hypersensitivity response and the presence of IFN-gamma at the site of sand fly bites. To date, there are no data available regarding the cellular immune response to sand fly saliva in dogs, the main reservoirs of VL in Latin America, and its role in protection from this fatal disease. Two of 35 salivary proteins from the vector sand fly Lutzomyia longipalpis, identified using a novel approach termed reverse antigen screening, elicited strong cellular immunity in dogs. Immunization with either molecule induced high IgG(2) antibody levels and significant IFN-gamma production following in vitro stimulation of PBMC with salivary gland homogenate (SGH). Upon challenge with uninfected or infected flies, immunized dogs developed a cellular response at the bite site characterized by lymphocytic infiltration and IFN-gamma and IL-12 expression. Additionally, SGH-stimulated lymphocytes from immunized dogs efficiently killed Leishmania infantum chagasi within autologous macrophages. Certain sand fly salivary proteins are potent immunogens obligatorily co-deposited with Leishmania parasites during transmission. Their inclusion in an anti-Leishmania vaccine would exploit anti-saliva immunity following an infective sand fly bite and set the stage for a protective anti-Leishmania immune response.

Scurfy mice have a deletion in the forkhead domain of the forkhead transcription factor p3 (Foxp3), fail to develop thymic-derived, naturally occurring Foxp3+ regulatory T cells (nTreg), and develop a fatal lymphoproliferative syndrome with multi-organ inflammation. Transfer of thymic-derived Foxp3+ nTreg into neonatal Scurfy mice prevents the development of disease. Stimulation of conventional CD4+Foxp3(-) via the TCR in the presence of TGF-beta and IL-2 induces the expression of Foxp3 and an anergic/suppressive phenotype. To determine whether the TGF-beta-induced Treg (iTreg) were capable of suppressing disease in the Scurfy mouse, we reconstituted newborn Scurfy mice with polyclonal iTreg. Scurfy mice treated with iTreg do not show any signs of disease and have drastically reduced cell numbers in peripheral lymph nodes and spleen in comparison to untreated Scurfy controls. The iTreg retained their expression of Foxp3 in vivo for 21 days, migrated into the skin, and prevented the development of inflammation in skin, liver and lung. Thus, TGF-beta-differentiated Foxp3+ Treg appear to possess all of the functional properties of thymic-derived nTreg and represent a potent population for the cellular immunotherapy of autoimmune and inflammatory diseases.

The mouse macrophage-like cell line RAW264.7, the most commonly used mouse macrophage cell line in medical research, was originally reported to be free of replication-competent murine leukemia virus (MuLV) despite its origin in a tumor induced by Abelson MuLV containing Moloney MuLV as helper virus. As currently available, however, we find that it produces significant levels of ecotropic MuLV with the biologic features of the Moloney isolate and also MuLV of the polytropic or MCF class. Newborn mice developed lymphoma following inoculation with the MuLV mixture expressed by these cells. These findings should be considered in interpretation of increasingly widespread use of these cells for propagation of other viruses, studies of biological responses to virus infection and use in RNA interference and cell signalling studies.

The American Medical Association and the American Veterinary Medical Association have recently approved resolutions supporting 'One Medicine' or 'One Health' that bridge the two professions. The concept is far from novel. Rudolf Virchow, the Father of Modern Pathology, and Sir William Osler, the Father of Modern Medicine, were outspoken advocates of the concept. The concept in its modern iteration was re-articulated in the 1984 edition of Calvin Schwabe's 'Veterinary Medicine and Human Health.' The veterinary and medical pathology professions are steeped in a rich history of 'One Medicine,' but they have paradoxically parted ways, leaving the discipline of pathology poorly positioned to contribute to contemporary science. The time has come for not only scientists but also all pathologists to recognize the value in comparative pathology, the consequences of ignoring the opportunity and, most importantly, the necessity of preparing future generations to meet the challenge inherent in the renewed momentum for 'One Medicine.' The impending glut of new genetically engineered mice creates an urgent need for prepared investigators and pathologists.

Inorganic arsenic is a ubiquitous environmental contaminant that has long been considered a human carcinogen. Recent studies raise further concern about the metalloid as a major, naturally occurring carcinogen in the environment. However, during this same period it has proven difficult to provide experimental evidence of the carcinogenicity of inorganic arsenic in laboratory animals and, until recently, there was considered to be a lack of clear evidence for carcinogenicity of any arsenical in animals. More recent work with arsenical methylation metabolites and early life exposures to inorganic arsenic has now provided evidence of carcinogenicity in rodents. Given that tens of millions of people worldwide are exposed to potentially unhealthy levels of environmental arsenic, in vivo rodent models of arsenic carcinogenesis are a clear necessity for resolving critical issues, such as mechanisms of action, target tissue specificity, and sensitive subpopulations, and in developing strategies to reduce cancers in exposed human populations. This work reviews the available rodent studies considered relevant to carcinogenic assessment of arsenicals, taking advantage of the most recent review by the International Agency for Research on Cancer (IARC) that has not yet appeared as a full monograph but has been summarized (IARC, 2009 , IARC Special Report: Policy, Vol. 10. Lyon: IARC Press, 453–454). Many valid studies show that arsenic can interact with other carcinogens/agents to enhance oncogenesis, and help elucidate mechanisms, and these too are summarized in this review. Finally, this body of rodent work is discussed in light of its impact on mechanisms and in the context of the persistent argument that arsenic is not carcinogenic in animals.

In a previously developed mouse model, arsenic exposure in utero induces tumors at multiple sites in the offspring as adults, often duplicating human targets. However, human environmental inorganic arsenic exposure occurs during the entire life span, not just part of gestation. Thus, “whole-life” inorganic arsenic carcinogenesis in mice was studied. CD1 mice were exposed to 0, 6, 12, or 24 ppm arsenic in the drinking water 2 weeks prior to breeding, during pregnancy, lactation, and after weaning through adulthood. Tumors were assessed in offspring until 2 years of age. Arsenic induced dose-related increases in lung adenocarcinoma (both sexes), hepatocellular carcinoma (both sexes), gallbladder tumors (males), and uterine carcinomas. Arsenic induced dose-related increases in ovarian tumors (including carcinomas) starting with the lowest dose. Adrenal tumors increased at all doses (both sexes). Arsenic-induced lung and liver cancers were highly enriched for cancer stem cells, consistent with prior work with skin cancers stimulated by prenatal arsenic. Reproductive tract tumors overexpressed cyclooxygenase-2 and estrogen receptor-α. Arsenic target sites were remarkably similar to prior transplacental studies, although tumors from whole-life exposure were generally more aggressive and frequent. This may indicate that arsenic-induced events in utero dictate target site in some tissues, whereas other exposure periods of arsenic enhance incidence or progression, though other factors could be at play, like cumulative dose. Whole-life arsenic exposure induced tumors at dramatically lower external doses than in utero arsenic only while more realistically duplicating human exposure.

Melanoma represents a significant malignancy in humans and dogs. Different from genetically engineered models, sporadic canine melanocytic neoplasms share several characteristics with human disease that could make dogs a more relevant preclinical model. Canine melanomas rarely arise in sun-exposed sites. Most occur in the oral cavity, with a subset having intra-epithelial malignant melanocytes mimicking the in situ component of human mucosal melanoma. The spectrum of canine melanocytic neoplasia includes benign lesions with some analogy to nevi, as well as invasive primary melanoma, and widespread metastasis. Growing evidence of distinct subtypes in humans, differing in somatic and predisposing germ-line genetic alterations, cell of origin, epidemiology, relationship to ultraviolet radiation and progression from benign to malignant tumors, may also exist in dogs. Canine and human mucosal melanomas appear to harbor BRAF, NRAS, and c-kit mutations uncommonly, compared with human cutaneous melanomas, although both species share AKT and MAPK signaling activation. We conclude that there is significant overlap in the clinical and histopathological features of canine and human mucosal melanomas. This represents opportunity to explore canine oral cavity melanoma as a preclinical model.

The most common risk factor for developing hepatocellular carcinoma (HCC) is chronic infection with hepatitis B virus (HBV). To better understand the evolutionary forces driving HCC, we performed a near-saturating transposon mutagenesis screen in a mouse HBV model of HCC. This screen identified 21 candidate early stage drivers and a very large number (2,860) of candidate later stage drivers that were enriched for genes that are mutated, deregulated or functioning in signaling pathways important for human HCC, with a striking 1,199 genes being linked to cellular metabolic processes. Our study provides a comprehensive overview of the genetic landscape of HCC.

Male Fischer rats were given 10 weekly subcutaneous injections of azoxymethane (AOM) at 2 dose levels, 14.8 and 7.4 m g/kg. Rats were killed at 26 and 34 weeks, respectively. The number and distribution of intestinal tumors were dose related. Tumors in rats receiving the higher dose were limited mainly to the duodenum and descending colon; few duodenal tumors occurred in the rats given the lower dose. In the latter group, tumors were more generally distributed in the colon. Histologically there were 3 types of colon tumors: polypoid lesions, adenocarcinomas, and mucinous adenocarcinomas. Carcinomas of both the small and large intestines metastasized to regional lymph nodes and the peritoneal cavity. The pathology of the induced tumors was similar to that of man. Comparison of our results with epidemiologic data and the ratio of ascending to descending colon tumors in man in high- and low-incidence colon cancer areas revealed a striking similarity to the dose response in this study. Other lesions in rats given AOM included squamous cell carcinoma of the ear canal, hepatic nodular hyperplasia and megalocytosis, and gastric ulcers.

Naked mole-rats (NMRs; Heterocephalus glaber) are highly adapted, eusocial rodents renowned for their extreme longevity and resistance to cancer. Because cancer has not been formally described in this species, NMRs have been increasingly utilized as an animal model in aging and cancer research. We previously reported the occurrence of several age-related diseases, including putative pre-neoplastic lesions, in zoo-housed NMR colonies. Here, we report for the first time 2 cases of cancer in zoo-housed NMRs. In Case No. 1, we observed a subcutaneous mass in the axillary region of a 22-year-old male NMR, with histologic, immunohistochemical (pancytokeratin positive, rare p63 immunolabeling, and smooth muscle actin negative), and ultrastructural characteristics of an adenocarcinoma possibly of mammary or salivary origin. In Case No. 2, we observed a densely cellular, poorly demarcated gastric mass of polygonal cells arranged in nests with positive immunolabeling for synaptophysin and chromogranin indicative of a neuroendocrine carcinoma in an approximately 20-year-old male NMR. We also include a brief discussion of other proliferative growths and pre-cancerous lesions diagnosed in 1 zoo colony. Although these case reports do not alter the longstanding observation of cancer resistance, they do raise questions about the scope of cancer resistance and the interpretation of biomedical studies in this model. These reports also highlight the benefit of long-term disease investigations in zoo-housed populations to better understand naturally occurring disease processes in species used as models in biomedical research.

Expression of antigens in cells and tissues can be readily studied immunohistochemically with the use of antibodies. A panel of antibodies to cell-specific markers can be used to diagnose lesions, including tumors, in the hematopoietic and lymphoid systems. This review discusses the use of readily available antibodies and procedures to identify antigens expressed in normal tissues and in proliferative and inflammatory lesions in formalin-fixed, paraffin-embedded (FFPE) murine specimens.

Recent studies suggest that gastrointestinal tract microbiota modulate cancer development in distant non-intestinal tissues. Here we tested mechanistic hypotheses using a targeted pathogenic gut microbial infection animal model with a predilection to breast cancer. FVB-Tg(C3-1-TAg)cJeg/JegJ female mice were infected by gastric gavage with Helicobacter hepaticus at three-months-of-age putting them at increased risk for mammary tumor development. Tumorigenesis was multifocal and characterized by extensive infiltrates of myeloperoxidase-positive neutrophils otherwise implicated in cancer progression in humans and animal models. To test whether neutrophils were important in etiopathogenesis in this bacteria-triggered model system, we next systemically depleted mice of neutrophils using thrice weekly intraperitoneal injections with anti-Ly-6G antibody. We found that antibody depletion entirely inhibited tumor development in this H. hepaticus-infected model. These data demonstrate that host neutrophil-associated immune responses to intestinal tract microbes significantly impact cancer progression in distal tissues such as mammary glands, and identify gut microbes as novel targets for extra-intestinal cancer therapy.

The INHAND (International Harmonization of Nomenclature and Diagnostic Criteria for Lesions in Rats and Mice) project is a joint initiative of the Societies of Toxicologic Pathology from Europe (ESTP), Great Britain (BSTP), Japan (JSTP), and North America (STP) to develop an internationally accepted nomenclature and diagnostic criteria for nonproliferative and proliferative lesions in laboratory animals.The purpose of this publication is to provide a standardized nomenclature and diagnostic criteria for classifying lesions in the digestive system including the salivary glands and the exocrine pancreas of laboratory rats and mice.Most lesions are illustrated by color photomicrographs.The standardized nomenclature, the diagnostic criteria, and the photomicrographs are also available electronically on the Internet (http://www.goreni.org/).Sources of material included histopathology databases from government, academia, and industrial laboratories throughout the world.Content includes spontaneous and age related lesions as well as lesions induced by exposure to test items.Relevant infectious and parasitic lesions are included as well.A widely accepted and utilized international harmonization of nomenclature and diagnostic criteria for the digestive system will decrease misunderstandings among regulatory and scientific research organizations in different countries and provide a common language to increase and enrich international exchanges of information among toxicologists and pathologists.(

Zika virus (ZIKV) infection during human pregnancy may cause diverse and serious congenital defects in the developing fetus. Previous efforts to generate animal models of human ZIKV infection and clinical symptoms often involved manipulating mice to impair their Type I interferon (IFN) signaling, thereby allowing enhanced infection and vertical transmission of virus to the embryo. Here, we show that even pregnant mice competent to generate Type I IFN responses that can limit ZIKV infection nonetheless develop profound placental pathology and high frequency of fetal demise. We consistently found that maternal ZIKV exposure led to placental pathology and that ZIKV RNA levels measured in maternal, placental or embryonic tissues were not predictive of the pathological effects seen in the embryos. Placental pathology included trophoblast hyperplasia in the labyrinth, trophoblast giant cell necrosis in the junctional zone, and loss of embryonic vessels. Our findings suggest that, in this context of limited infection, placental pathology rather than embryonic/fetal viral infection may be a stronger contributor to adverse pregnancy outcomes in mice. Our finding demonstrates that in immunocompetent mice, direct viral infection of the embryo is not essential for fetal demise. Our immunologically unmanipulated pregnancy mouse model provides a consistent and easily measurable congenital abnormality readout to assess fetal outcome, and may serve as an additional model to test prophylactic and therapeutic interventions to protect the fetus during pregnancy, and for studying the mechanisms of ZIKV congenital immunopathogenesis.

The INHAND Project (International Harmonization of Nomenclature and Diagnostic Criteria for Lesions in Rats and Mice) is a joint initiative of the Societies of Toxicologic Pathology from Europe (ESTP), Great Britain (BSTP), Japan (JSTP), and North America (STP) to develop an internationally accepted nomenclature for proliferative and nonproliferative changes in rats and mice. The purpose of this publication is to provide a standardized nomenclature for classifying changes observed in the hematolymphoid organs, including the bone marrow, thymus, spleen, lymph nodes, mucosa-associated lymphoid tissues, and other lymphoid tissues (serosa-associated lymphoid clusters and tertiary lymphoid structures) with color photomicrographs illustrating examples of the lesions. Sources of material included histopathology databases from government, academia, and industrial laboratories throughout the world. Content includes spontaneous lesions as well as lesions induced by exposure to test materials. The nomenclature for these organs is divided into 3 terminologies: descriptive, conventional, and enhanced. Three terms are listed for each diagnosis. The rationale for this approach and guidance for its application to toxicologic pathology are described in detail below.

We have demonstrated previously the oncolytic effects of a systemically delivered, replicating vaccinia virus. To enhance the tumor specificity of this vector, we have developed a combined thymidine kinase-deleted (TK-) and vaccinia growth factor-deleted (VGF-) vaccinia virus and investigated its properties in vitro and in vivo. The gene for enhanced green fluorescent protein (EGFP) was inserted into the TK locus of a VGF- vaccinia virus by homologous recombination creating a double-deleted mutant vaccinia virus (vvDD-GFP). Infection of resting and dividing NIH3T3 cells with vvDD-GFP yielded reduced viral recovery compared with wild-type (WT), TK-, or VGF- viruses from resting cultures but equivalent virus recovery from dividing cultures. Eight days after nude mice were injected i.p. with 10(7) plaque-forming units (pfu) of WT, TK-, VGF-, or vvDD-GFP vaccinia virus, tissues and tumor were harvested for viral titer determination. No virus was recovered from the brains of mice injected with vvDD-GFP compared with the other viruses, which ranged from 130 to 28,000 pfu/mg protein; however, equivalent amounts were recovered from tumor. There was no toxicity from vvDD-GFP because nude mice receiving 10(8) pfu of IP vvDD-GFP lived >100 days, whereas mice receiving WT, VGF-, or TK- virus had median survivals of only 6, 17, and 29 days, respectively. Similar results were seen when 10(9) pfu of vvDD-GFP were given. Nude mice bearing s.c. murine colon adenocarcinoma (MC38) had significant tumor regression after treatment with 10(9) pfu of systemic (i.p.) vvDD-GFP compared with control (mean tumor size, 180.71 +/- 35.26 mm(3) versus 2796.79 +/- 573.20 mm(3) 12 days after injection of virus). Our data demonstrate that a TK- and VGF- mutant vaccinia virus is significantly attenuated in resting cells in vitro and demonstrates tumor-specific replication in vivo. It is a promising vector for use in tumor-directed gene therapy, given its enhanced safety profile, tumor selectivity, and the oncolytic effects after systemic delivery.

Th2 lymphocytes have been postulated to play a major role in the immunopathology induced by Schistosoma mansoni infection. Nevertheless, infected IL-4 knockout (KO) and wild-type (wt) mice develop egg granulomas comparable in size. To further investigate the function of the Th2 response in egg pathology we studied IL-4Ralpha-deficient mice, which are nonresponsive to both IL-4 and IL-13. In striking contrast to IL-4 KO animals, infected IL-4Ralpha KO mice developed only minimal hepatic granulomas and fibrosis despite the presence of CD3+ T cells in the residual egg lesions. Moreover, liver lymphokine mRNA levels in these animals and IL-4 KO mice were equivalent. In addition, infected IL-4Ralpha-deficient, IL-4-deficient, and wt animals developed similar egg Ag-specific IgG Ab titers, arguing that CD4-dependent Th activity is intact in KO mice. As expected, IFN-gamma secretion was strongly up-regulated in mesenteric lymph node cultures from both groups of deficient animals, a change reflected in increased serum IgG2a and IgG2b Ab levels. Surprisingly, Th2 cytokine production in infected IL-4Ralpha KO mice was not abolished but was only reduced and resembled that previously documented in IL-4 KO animals. This residual Th2 response is likely to explain the ability of IL-4 KO mice to generate egg granulomas, which cannot be formed in IL-4Ralpha-deficient animals because of their lack of responsiveness to the same cytokine ligands. Taken together, these findings argue that tissue pathology in schistosomiasis requires, in addition to egg-specific CD4+ lymphocytes, a previously unrecognized IL-4Ralpha+ non-T cell effector population.

Abstract There is considerable debate whether peroxisome proliferator–activated receptor β/δ (PPARβ/δ) ligands potentiate or suppress colon carcinogenesis. Whereas administration of a PPARβ ligand causes increased small intestinal tumorigenesis in Apcmin/+ mice, PPARβ-null (Pparb−/−) mice exhibit increased colon polyp multiplicity in colon cancer bioassays, suggesting that ligand activation of this receptor will inhibit colon carcinogenesis. This hypothesis was examined by treating wild-type (Pparb+/+) and Pparb−/− with azoxymethane, coupled with a highly specific PPARβ ligand, GW0742. Ligand activation of PPARβ in Pparb+/+ mice caused an increase in the expression of mRNA encoding adipocyte differentiation–related protein, fatty acid–binding protein, and cathepsin E. These findings are indicative of colonocyte differentiation, which was confirmed by immunohistochemical analysis. No PPARβ-dependent differences in replicative DNA synthesis or expression of phosphatase and tensin homologue, phosphoinositide-dependent kinase, integrin-linked kinase, or phospho-Akt were detected in ligand-treated mouse colonic epithelial cells although increased apoptosis was found in GW0742-treated Pparb+/+ mice. Consistent with increased colonocyte differentiation and apoptosis, inhibition of colon polyp multiplicity was also found in ligand-treated Pparb+/+ mice, and all of these effects were not found in Pparb−/− mice. In contrast to previous reports suggesting that activation of PPARβ potentiates intestinal tumorigenesis, here we show that ligand activation of PPARβ attenuates chemically induced colon carcinogenesis and that PPARβ-dependent induction of cathepsin E could explain the reported disparity in the literature about the effect of ligand activation of PPARβ in the intestine. (Cancer Res 2006; 66(8): 4394-401)

Fifty male and 49 female B6;129 mice (wild-type, + / + ) were maintained until 2 years of age to study their age-related pathology. By 104—105 weeks, 14/50 (28%) of the males and 30/49 (61%) of the females were still alive. The most common contributing cause of morbidity or mortality was lymphoma. Lymphoma was observed in 21/50 (42%) of the males and 33/49 (67%) of the females with the most common sites being mesenteric lymph nodes, gut associated lymphoid tissue (Peyer's patches), and spleen. The lymphoma most often appeared to arise in the mesenteric node. Immunohistochemistry revealed CD45R expression as well as infiltration by many CD3+ T cells. IgH gene rearrangements were found in typical mesenteric node lymphomas indicating B-cell origin. They bore similarities to the human T-cell rich, B-cell lymphomas. Other tumors included hepatocellular adenoma or carcinoma (male 12%, females 10%), lung alveolar Type II cell adenoma or carcinoma (male 32%, female 20%), thyroid follicular adenoma or carcinoma (male 2%, female 8%), ovarian tumors (17%), and endometrial tumors (6%). Nonneoplastic lesions included amyloidlike material in the nasal septum (male and female 100%), otitis media (male 84%, female 79%), epididymal epithelial karyomegaly (88%), melanosis (high incidences in various tissues including brain, parathyroid, and spleen), membranoproliferative glomerulonephritis (male 52%, female 71%), hyalinosis with extracellular crystals in several tissues (respiratory tract, gall bladder, stomach), islet cell hyperplasia (male 45%, female 29%) and esophageal dilation (male 10%, female 6%). The B6;129 mouse is a mouse with aging lesions similar to those in other mouse strains but with a characteristic common lymphoma.

A compendium of carcinogenesi s bioassay results organized by target organ is presented for 738 chemicals that are carcinogeni c in chronic-exposure, long-term bioassays in at least 1 species. This compendium is based primarily on experiments in rats or mice; results in hamsters, monkeys, and dogs are also reported. The compendium can be used to identify chemicals that induce tumors at particular sites and to determine whether target sites are the same for chemicals positive in more than 1 species. The source of information is the Carcinogenic Potency Database (CPDB), which includes results of 6073 experiments on 1458 chemicals (positive or negative for carcinogenicity) that have been reported in Technical Reports of the National Cancer Institute/National Toxicology Program or in papers in the general published literature. The published CPDB includes detailed analyses of each test and citations. The CPDB is publicly available in several formats (http://potency.berkeley.edu). Chemical carcinogens are reported for 35 different target organs in rats or mice. Target organs in humans are also summarized for 82 agents that have been evaluated as human carcinogens at a particular target site by the International Agency for Research on Cancer (IARC). Comparisons are provided of target organs for mutagens versus nonmutagens and rats versus mice.

Plasma cell neoplasms in humans comprise plasma cell myeloma, otherwise known as multiple myeloma, Ig deposition and heavy chain diseases, and plasmacytoma (PCT). A subset of PCT, designated extramedullary PCT, is distinguished from multiple myeloma and solitary PCT of bone by its distribution among various tissue sites but not the bone marrow. Extramedullary (extraosseus) PCT are rare spontaneous neoplasms of mice but are readily induced in a susceptible strain, BALB/c, by treatment with pristane. The tumors develop in peritoneal granulomas and are characterized by Myc-activating T(12;15) chromosomal translocations and, most frequently, by secretion of IgA. A uniting feature of human and mouse plasma cell neoplasms is the critical role played by IL-6, a B cell growth, differentiation, and survival factor. To directly test the contribution of IL-6 to PCT development, we generated BALB/c mice carrying a widely expressed IL-6 transgene. All mice exhibited lymphoproliferation and plasmacytosis. By 18 months of age, over half developed readily transplantable PCT in lymph nodes, Peyer's patches, and sometimes spleen. These neoplasms also had T(12;15) translocations, but remarkably, none expressed IgA. Unexpectedly, approximately 30% of the mice developed follicular and diffuse large cell B cell lymphomas that often coexisted with PCT. These findings provide a unique model of extramedullary PCT for studies on pathogenesis and treatment and suggest a previously unappreciated role for IL-6 in the genesis of germinal center-derived lymphomas.

Despite myriads of biological activities ascribed to uteroglobin (UG), a steroid-inducible secreted protein, its physiological functions are unknown. Mice in which the uteroglobin gene was disrupted had severe renal disease that was associated with massive glomerular deposition of predominantly multimeric fibronectin (Fn). The molecular mechanism that normally prevents Fn deposition appears to involve high-affinity binding of UG with Fn to form Fn-UG heteromers that counteract Fn self-aggregation, which is required for abnormal tissue deposition. Thus, UG is essential for maintaining normal renal function in mice, which raises the possibility that an analogous pathogenic mechanism may underlie genetic Fn-deposit human glomerular disease.

Considerable controversy exists in determining the role of peroxisome proliferator-activated receptor-α (PPARα) in obesity. Two purebred congenic strains of PPARα-null mice were developed to study the role of this receptor in modulating lipid transport and storage. Weight gain and average body weight in wild-type and PPARα-null mice on either an Sv/129 or a C57BL/6N background were not markedly different between genotypes from 3 to 9 months of age. However, gonadal adipose stores were significantly greater in both strains of male and female PPARα-null mice. Hepatic accumulation of lipids was greater in both strains and sexes of PPARα-null mice compared with wild-type controls. Administration of the peroxisome proliferator WY-14643 caused hepatomegaly, alterations in mRNAs encoding proteins that regulate lipid metabolism, and reduced serum triglycerides in a PPARα-dependent mechanism. Constitutive differences in serum cholesterol and triglycerides in PPARα-null mice were found between genetic backgrounds. Results from this work establish that PPARα is a critical modulator of lipid homeostasis in two congenic mouse lines. This study demonstrates that disruption of the murine gene encoding PPARα results in significant alterations in constitutive serum, hepatic, and adipose tissue lipid metabolism. However, an overt, obese phenotype in either of the two congenic strains was not observed. In contrast to earlier published work, this study establishes that PPARα is not associated with obesity in mice. Considerable controversy exists in determining the role of peroxisome proliferator-activated receptor-α (PPARα) in obesity. Two purebred congenic strains of PPARα-null mice were developed to study the role of this receptor in modulating lipid transport and storage. Weight gain and average body weight in wild-type and PPARα-null mice on either an Sv/129 or a C57BL/6N background were not markedly different between genotypes from 3 to 9 months of age. However, gonadal adipose stores were significantly greater in both strains of male and female PPARα-null mice. Hepatic accumulation of lipids was greater in both strains and sexes of PPARα-null mice compared with wild-type controls. Administration of the peroxisome proliferator WY-14643 caused hepatomegaly, alterations in mRNAs encoding proteins that regulate lipid metabolism, and reduced serum triglycerides in a PPARα-dependent mechanism. Constitutive differences in serum cholesterol and triglycerides in PPARα-null mice were found between genetic backgrounds. Results from this work establish that PPARα is a critical modulator of lipid homeostasis in two congenic mouse lines. This study demonstrates that disruption of the murine gene encoding PPARα results in significant alterations in constitutive serum, hepatic, and adipose tissue lipid metabolism. However, an overt, obese phenotype in either of the two congenic strains was not observed. In contrast to earlier published work, this study establishes that PPARα is not associated with obesity in mice. peroxisome proliferator-activated receptor Peroxisome proliferators are a diverse class of compounds that include commercially used plasticizers (e.g. phthalates), industrial solvents (e.g. trichloroethylene), herbicides (e.g. lactofen), hypolipidemic drugs (e.g.fibrates), naturally occurring chemicals (e.g. phenyl acetate), and hormones (e.g. dehydroepiandrosterone sulfate) (1Desvergne B. Wahli W. Endocr. Rev. 1999; 20: 649-688Crossref PubMed Scopus (2727) Google Scholar, 2Gonzalez F.J. Peters J.M. Cattley R.C. J. Natl. Cancer Inst. 1998; 90: 1702-1709Crossref PubMed Scopus (264) Google Scholar). Administration of peroxisome proliferators to rodents results in numerous hepatic alterations, including an increase in the number and size of peroxisomes; hepatomegaly; increased expression of genes encoding peroxisomal, mitochondrial, and microsomal fatty acid-metabolizing enzymes; and subsequent modulation of lipid homeostasis characterized by increased oxidation of fatty acids, decreased serum lipids, and reduced adipose stores (1Desvergne B. Wahli W. Endocr. Rev. 1999; 20: 649-688Crossref PubMed Scopus (2727) Google Scholar). All of these effects are mediated by PPARα1 since PPARα-null mice are refractory to these changes when administered the prototypical peroxisome proliferator WY-14643 (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar, 4Peters J.M. Hennuyer N. Staels B. Fruchart J.C. Fievet C. Gonzalez F.J. Auwerx J. J. Biol. Chem. 1997; 272: 27307-27312Abstract Full Text Full Text PDF PubMed Scopus (399) Google Scholar, 5Aoyama A. Peters J.M. Iritani N. Nasu-Nakajima T. Furihata K. Hashimoto T. Gonzalez F.J. J. Biol. Chem. 1998; 273: 5678-5684Abstract Full Text Full Text PDF PubMed Scopus (750) Google Scholar). In addition to modulation of lipid metabolism induced by peroxisome proliferators, a central role for PPARα in lipid homeostasis during periods of fasting and in response to dietary fatty acids has also been established (6Leone T.C. Weinheimer C.J. Kelly D.P. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7473-7478Crossref PubMed Scopus (819) Google Scholar, 7Kersten S. Seydoux J. Peters J.M. Gonzalez F.J. Desvergne B. Wahli W. J. Clin. Invest. 1999; 103: 1489-1498Crossref PubMed Scopus (1360) Google Scholar, 8Kroetz D.L. Yook P. Costet P. Bianchi P. Pineau T. J. Biol. Chem. 1998; 273: 31581-31589Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 9Ren B. Thelen A.P. Peters J.M. Gonzalez F.J. Jump D.B. J. Biol. Chem. 1997; 272: 26827-26832Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar). Thus, it is clear that PPARα regulates lipid homeostasis in response to treatment with peroxisome proliferators, dietary fatty acids, and possibly endogenous fatty acids released during fasting. The PPARα-null mouse was generated to identify PPARα-dependent regulation induced by a variety of stimuli. Most of the early reports for this mouse line used mice with a mixed genetic background (C57BL/6N × Sv/129) (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar, 4Peters J.M. Hennuyer N. Staels B. Fruchart J.C. Fievet C. Gonzalez F.J. Auwerx J. J. Biol. Chem. 1997; 272: 27307-27312Abstract Full Text Full Text PDF PubMed Scopus (399) Google Scholar, 9Ren B. Thelen A.P. Peters J.M. Gonzalez F.J. Jump D.B. J. Biol. Chem. 1997; 272: 26827-26832Abstract Full Text Full Text PDF PubMed Scopus (230) Google Scholar, 10Peters J.M. Zhou Y.C. Ram P.A. Lee S.S. Gonzalez F.J. Waxman D.J. Mol. Pharmacol. 1996; 50: 67-74PubMed Google Scholar, 11Peters J.M. Taubeneck M.W. Keen C.L. Gonzalez F.J. Teratology. 1997; 56: 311-316Crossref PubMed Google Scholar, 12Motojima K. Peters J.M. Gonzalez F.J. Biochem. Biophys. Res. Commun. 1997; 230: 155-158Crossref PubMed Scopus (32) Google Scholar). After the initial production (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar), the PPARα-null mouse was subsequently backcrossed at the National Institutes of Health to obtain a pure Sv/129 line. The Sv/129 line of PPARα-null mice has been used extensively by many research groups to demonstrate that alterations induced by PPARα activation require PPARα (5Aoyama A. Peters J.M. Iritani N. Nasu-Nakajima T. Furihata K. Hashimoto T. Gonzalez F.J. J. Biol. Chem. 1998; 273: 5678-5684Abstract Full Text Full Text PDF PubMed Scopus (750) Google Scholar, 6Leone T.C. Weinheimer C.J. Kelly D.P. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 7473-7478Crossref PubMed Scopus (819) Google Scholar, 13Anderson S.P. Cattley R.C. Corton J.C. Mol. Carcinog. 1999; 26: 226-238Crossref PubMed Scopus (35) Google Scholar, 14Barclay T.B. Peters J.M. Sewer M.B. Ferrari L. Gonzalez F.J. Morgan E.T. J. Pharmacol. Exp. Ther. 1999; 290: 1250-1257PubMed Google Scholar, 15Belury M.A. Moya-Camarena S.Y. Sun H. Snyder E. Davis J.W. Cunningham M.L. Vanden Heuvel J.P. Toxicol. Appl. Pharmacol. 1998; 151: 254-261Crossref PubMed Scopus (33) Google Scholar, 16Brandt J.M. Djouadi F. Kelly D.P. J. Biol. Chem. 1998; 273: 23786-23792Abstract Full Text Full Text PDF PubMed Scopus (405) Google Scholar, 17Corton J.C. Fan L.Q. Brown S. Anderson S.P. Bocos C. Cattley R.C. Mode A. Gustafsson J.A. Mol. Pharmacol. 1998; 54: 463-473Crossref PubMed Scopus (98) Google Scholar, 18Delerive P. De Bosscher K. Besnard S. Vanden Berghe W. Peters J.M. Gonzalez F.J. Fruchart J.C. Tedgui A. Haegeman G. Staels B. J. Biol. Chem. 1999; 274: 32048-32054Abstract Full Text Full Text PDF PubMed Scopus (979) Google Scholar, 19Devchand P.R. Keller H. Peters J.M. Vazquez M. Gonzalez F.J. Wahli W. Nature. 1996; 384: 39-43Crossref PubMed Scopus (1205) Google Scholar, 20Djouadi F. Weinheimer C.J. Saffitz J.E. Pitchford C. Bastin J. Gonzalez F.J. Kelly D.P. J. Clin. Invest. 1998; 102: 1083-1091Crossref PubMed Scopus (354) Google Scholar, 21Djouadi F. Brandt J.M. Weinheimer C.J. Leone T.C. Gonzalez F.J. Kelly D.P. Prostaglandins Leukotrienes Essent. Fatty Acids. 1999; 60: 339-343Abstract Full Text PDF PubMed Scopus (110) Google Scholar, 22Fan L.Q. Cattley R.C. Corton J.C. J. Endocrinol. 1998; 158: 237-246Crossref PubMed Scopus (51) Google Scholar, 23Guidotti L.G. Eggers C.M. Raney A.K. Chi S.Y. Peters J.M. Gonzalez F.J. McLachlan A. J. Virol. 1999; 73: 10377-10386Crossref PubMed Google Scholar, 24Hunt M.C. Lindquist P.J. Peters J.M. Gonzalez F.J. Diczfalusy U. Alexson S.E. J. Lipid Res. 2000; 41: 814-823Abstract Full Text Full Text PDF PubMed Google Scholar, 25Kockx M. Gervois P.P. Poulain P. Derudas B. Peters J.M. Gonzalez F.J. Princen H.M. Kooistra T. Staels B. Blood. 1999; 93: 2991-2998Crossref PubMed Google Scholar, 26Nakajima T. Kamijo Y. Usuda N. Liang Y. Fukushima Y. Kametani K. Gonzalez F.J. Aoyama T. Carcinogenesis. 2000; 21: 677-682Crossref PubMed Scopus (48) Google Scholar, 27Peters J.M. Cattley R.C. Gonzalez F.J. Carcinogenesis. 1997; 18: 2029-2033Crossref PubMed Scopus (426) Google Scholar, 28Peters J.M. Aoyama T. Cattley R.C. Nobumitsu U. Hashimoto T. Gonzalez F.J. Carcinogenesis. 1998; 19: 1989-1994Crossref PubMed Google Scholar, 29Poynter M.E. Daynes R.A. J. Biol. Chem. 1998; 273: 32833-32841Abstract Full Text Full Text PDF PubMed Scopus (491) Google Scholar, 30Turunen M. Peters J.M. Gonzalez F.J. Schedin S. Dallner G. J. Mol. Biol. 2000; 297: 607-614Crossref PubMed Scopus (38) Google Scholar, 31Ward J.M. Peters J.M. Perella C.M. Gonzalez F.J. Toxicol. Pathol. 1998; 26: 240-246Crossref PubMed Scopus (229) Google Scholar, 32Vanden Heuvel J.P. Holden P. Tugwood J. Ingle C. Yen W. Galjart N. Greenlee W.F. Toxicol. Appl. Pharmacol. 1998; 152: 107-118Crossref PubMed Scopus (14) Google Scholar, 33Hunt M.C. Yang Y.Z. Eggertsen G. Carneheim C.M. Gafvels M. Einarsson C. Alexson S.E. J. Biol. Chem. 2000; 275: 28947-28953Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar, 34Hashimoto T. Cook W.S. Qi C. Yeldandi A.V. Reddy J.K. Rao M.S. J. Biol. Chem. 2000; 275: 28918-28928Abstract Full Text Full Text PDF PubMed Scopus (354) Google Scholar, 35Kersten S. Mandard S. Tan N.S. Escher P. Metzger D. Chambon P. Gonzalez F.J. Desvergne B. Wahli W. J. Biol. Chem. 2000; 275: 28488-28493Abstract Full Text Full Text PDF PubMed Scopus (459) Google Scholar, 36Hanley K. Komuves L.G. Ng D.C. Schoonjans K. He S.S. Lau P. Bikle D.D. Williams M.L. Elias P.M. Auwerx J. Feingold K.R. J. Biol. Chem. 2000; 275: 11484-11491Abstract Full Text Full Text PDF PubMed Scopus (98) Google Scholar, 37Watanabe K. Fujii H. Takahashi T. Kodama M. Aizawa Y. Ohta Y. Ono T. Hasegawa G. Naito M. Nakajima T. Kamijo Y. Gonzalez F.J. Aoyama T. J. Biol. Chem. 2000; 275: 22293-22299Abstract Full Text Full Text PDF PubMed Scopus (266) Google Scholar, 38Patel D.D. Knight B.L. Wiggins D. Humphreys S.M. Gibbons G.F. J. Lipid Res. 2001; 42: 328-337Abstract Full Text Full Text PDF PubMed Google Scholar). There are a number of recent studies (8Kroetz D.L. Yook P. Costet P. Bianchi P. Pineau T. J. Biol. Chem. 1998; 273: 31581-31589Abstract Full Text Full Text PDF PubMed Scopus (189) Google Scholar, 39Gueraud F. Alary J. Costet P. Debrauwer L. Dolo L. Pineau T. Paris A. J. Lipid Res. 1999; 40: 152-159Abstract Full Text Full Text PDF PubMed Google Scholar, 40Edgar A.D. Tomkiewicz C. Costet P. Legendre C. Aggerbeck M. Bouguet J. Staels B. Guyomard C. Pineau T. Barouki R. Toxicol. Lett. 1998; 98: 13-23Crossref PubMed Scopus (69) Google Scholar, 41Le May C.L. Pineau T. Bigot K. Kohl C. Girard J. Pegorier J.P. FEBS Lett. 2000; 475 (. P.): 163-166JCrossref PubMed Scopus (74) Google Scholar, 42Costet P. Legendre C. More J. Edgar A. Galtier P. Pineau T. J. Biol. Chem. 1998; 273: 29577-29585Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar, 43Casas F. Pineau T. Rochard P. Rodier A. Daury L. Dauca M. Cabello G. Wrutniak-Cabello C. FEBS Lett. 2000; 482: 71-74Crossref PubMed Scopus (16) Google Scholar, 44Poirier H. Niot I. Monnot M.C. Braissant O. Meunier-Durmort C. Costet P. Pineau T. Wahli W. Willson T.M. Besnard P. Biochem. J. 2001; 355: 481-488Crossref PubMed Scopus (125) Google Scholar, 45Louet J.F. Chatelain F. Decaux J.F. Park E.A. Kohl C. Pineau T. Girard J. Pegorier J.P. Biochem. J. 2001; 354: 189-197Crossref PubMed Scopus (138) Google Scholar, 46Fourcade S. Savary S. Albet S. Gauthe D. Gondcaille C. Pineau T. Bellenger J. Bentejac M. Holzinger A. Berger J. Bugaut M. Eur. J. Biochem. 2001; 268: 3490-3500Crossref PubMed Scopus (58) Google Scholar) that used PPARα-null mice on a C57BL/6 background that were generated from several rounds of backcrossing with an unidentified substrain of the C57BL/6 mouse line to the original mixed genetic background PPARα-null mice in an independent laboratory (42Costet P. Legendre C. More J. Edgar A. Galtier P. Pineau T. J. Biol. Chem. 1998; 273: 29577-29585Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar). However, due to the strategy used to generate PPARα-null mice (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar), backcrossing to the C57BL/6N background requires backcrossing mice at least 10 generations to obtain a fully congenic mouse line (47Papaioannou V. Johnson R. Joyner A.L. Gene Targeting: A Practical Approach. Oxford University Press, New York1993: 106-146Google Scholar). The construction of the PPARα-null mouse used recombinant DNA and cells from two strains of mice, Sv/129 Jae and C57BL/6N (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar). For the PPARα-null mouse line, the Sv/129 mouse was the source of the genomic DNA library used to construct a targeting vector and the embryonic stem cells used for transfection of a targeting vector, whereas the C57BL/6N mouse (NIH substrain) was the source of donor blastocysts used for microinjecting the heterozygous embryonic stem cells. Thus, the F1 offspring from mating the chimeric mice generated by this approach were not congenic, but contained the genetic background of both Sv/129 and C57BL/6N mice. Although many published phenotypes for the PPARα-null mouse have been reported that have significant influence on lipid metabolism, many of these reports focused on mice that were either of mixed genetic background or congenic Sv/129 mice. In this work, the phenotypic characterization of lipid metabolism in wild-type or PPARα-null mice on either a pure Sv/129 or C57BL/6N genetic background was performed in both male and female mice to determine if the phenotype is consistent between congenic mouse lines. Male chimeric mice for the targeted PPARα allele (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar) were bred with Sv/129 Jae females since this line is the same genotype as the embryonic stem cells used to generate the chimeric mice. The heterozygous F1agoutioffspring from this breeding were subsequently crossed using brother-sister matings to obtain F2 purebred wild-type or PPARα-null mice. The homozygous F2 wild-type or PPARα-null mice were used to generate F3 homozygotes, which were then randomly assigned to breeding cages to establish a larger colony of mice to perform experiments. The Sv/129 mice used for this work were from the F6 generation of mice from this colony. The male chimeras described above were mated with purebred C57BL/6N females to obtain F1offspring. The heterozygous F1agouti offspring from this breeding were then backcrossed with purebred C57BL/6N mice (either heterozygous male × wild-type female or heterozygous female × wild-type male). The heterozygous F2offspring with black coat color were then removed and backcrossed with either male or female wild-type mice, and this process was continued until the F10 generation of mice was obtained. Heterozygous F10 mice were then crossed to produce homozygous wild-type or PPARα-null mice, and the homozygous F11 mice were randomly distributed to make a breeding colony of mice to obtain F12 mice for phenotypic analysis. 4-Chloro-6-(2,3-xylidino)-2-pyrimidinylthioacetic acid (WY-14643) was purchased commercially (ChemSyn Science Laboratories, Lenexa, KS). Pelleted mouse chow containing either 0.0 (control) or 0.1% WY-14643 (Bioserv, Frenchtown, NJ) was prepared and provided to mice ad libitum. 6–8-week-old male or female PPARα+/+ or PPARα−/− mice on either a C57BL/6N (F12generation) or an Sv/129 (F6 generation) background were housed four to five animals per cage in a temperature- and light-controlled environment (T = 25 °C, 12-h light/12-h dark cycle). Mice were weighed every month for 9 months. Cohorts of mice were killed at the age of 12–14 weeks or 9 months by overexposure to carbon dioxide. Blood was collected by cardiac puncture for isolation of serum. Serum analysis of lipids and lipoproteins was performed as described below. Liver and gonadal fat pads were removed, weighed, snap-frozen, and stored at −80 °C until further analysis. An additional section of liver was fixed in phosphate-buffered formaldehyde for analysis of liver lipid accumulation as previously described (48Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1409) Google Scholar). 10–12-week-old male or female PPARα+/+ or PPARα−/− mice on either a pure C57BL/6N (F12 generation) or an Sv/129 (F6 generation) background were housed three to five animals per cage as described above. Mice from both strains were fed either a control diet or one containing 0.1% WY-14643 for 7 days. Mice were killed by overexposure to carbon dioxide, and livers were removed, weighed, and snap-frozen until further use. Serum was obtained from whole blood collected from individual mice and used fresh for analysis of serum lipids and lipoproteins. Gonadal adipose was removed, and the weight was recorded for each mouse. Serum lipids (cholesterol and triglycerides) and high density lipoprotein cholesterol were measured as previously described (48Sinal C.J. Tohkin M. Miyata M. Ward J.M. Lambert G. Gonzalez F.J. Cell. 2000; 102: 731-744Abstract Full Text Full Text PDF PubMed Scopus (1409) Google Scholar). Total RNA was prepared from liver using the Trizol method (Life Technologies, Inc.) and quantified using standard spectrophotometric methods. 10 cDNA probes were used for sequential Northern blot analysis as previously described (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar, 4Peters J.M. Hennuyer N. Staels B. Fruchart J.C. Fievet C. Gonzalez F.J. Auwerx J. J. Biol. Chem. 1997; 272: 27307-27312Abstract Full Text Full Text PDF PubMed Scopus (399) Google Scholar, 5Aoyama A. Peters J.M. Iritani N. Nasu-Nakajima T. Furihata K. Hashimoto T. Gonzalez F.J. J. Biol. Chem. 1998; 273: 5678-5684Abstract Full Text Full Text PDF PubMed Scopus (750) Google Scholar), including peroxisomal acyl-CoA oxidase, peroxisomal bifunctional enzyme, peroxisomal 3-ketoacyl-CoA thiolase, cytochrome P450 4A1, mitochondrial very long chain acyl-CoA dehydrogenase, mitochondrial long chain acyl-CoA dehydrogenase, mitochondrial medium chain acyl-CoA dehydrogenase, PPARγ, apoC-III, and β-actin as a loading control. Monthly body weight measurements revealed small differences in average body weight between wild-type and PPARα-null mice on either the Sv/129 or C57BL/6N background (Fig.1). Body weight was significantly higher in male PPARα-null mice on an Sv/129 background compared with the respective wild-type controls at 3–4 months of age (Fig. 1). Although average body weight tended to be higher in male and female PPARα-null mice on both genetic backgrounds, these differences were not statistically different (Fig. 1). Liver weights were similar between PPARα-null and wild-type mice of both sexes compared with the respective controls (Tables I and II). Although liver weights were not significantly different between genotypes, hepatic accumulation of lipids was considerably higher in the livers of male PPARα-null mice of both strains after 6 months (Fig. 2). Similar results were observed with female mice (data not shown). PPARα-null mice had significantly larger gonadal adipose stores than the respective wild-type controls, and this effect was slightly more pronounced in female PPARα-null mice compared with male mice (Tables I and II). Although internal adipose stores were significantly greater in PPARα-null mice than in controls, the overall sizes of 7–8-month-old male and female wild-type and PPARα-null mice were not markedly different on either an Sv/129 or a C57BL/6N background (Fig.3).Table IBody, liver, and gonadal adipose weights in male or female wild-type (+/+) or PPARα-null (−/−) mice on either an Sv/129 or a C57BL/6N genetic backgroundGenotypeSexTreatment groupnBWLiverAdiposegggC57BL/6N+/+MControl1024 ± 11.1 ± 0.10.43 ± 0.04(4.5 ± 0.1%)(1.8 ± 0.1%)+/+MWY621 ± 11-aSignificantly different from wild-type controls (p < 0.05).2.1 ± 0.11-aSignificantly different from wild-type controls (p < 0.05).0.17 ± 0.011-aSignificantly different from wild-type controls (p < 0.05).(9.9 ± 0.5%)1-aSignificantly different from wild-type controls (p < 0.05).(0.8 ± 0.1%)1-aSignificantly different from wild-type controls (p < 0.05).−/−MControl1025 ± 11.1 ± 0.10.67 ± 0.031-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).(4.4 ± 0.1%)(2.7 ± 0.1%)1-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).−/−MWY525 ± 11.2 ± 0.10.72 ± 0.051-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).(4.5 ± 0.2%)(2.8 ± 0.2%)1-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).+/+FControl920 ± 10.99 ± 0.10.24 ± 0.03(4.9 ± 0.2%)(1.2 ± 0.1%)+/+FWY617 ± 11-aSignificantly different from wild-type controls (p < 0.05).1.8 ± 0.11-aSignificantly different from wild-type controls (p < 0.05).0.07 ± 0.021-aSignificantly different from wild-type controls (p < 0.05).(10.4 ± 0.4%)1-aSignificantly different from wild-type controls (p < 0.05).(0.4 ± 0.1%)1-aSignificantly different from wild-type controls (p < 0.05).−/−FControl1022 ± 11.1 ± 0.10.67 ± 0.031-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).(5.1 ± 0.2%)(3.1 ± 0.2%)1-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).−/−FWY521 ± 11.1 ± 0.10.58 ± 0.101-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).(5.1 ± 0.1%)(2.8 ± 0.4%)1-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).Sv/129+/+MControl1026 ± 11.1 ± 0.10.50 ± 0.03(4.3 ± 0.1%)(1.9 ± 0.1%)+/+MWY1022 ± 11-aSignificantly different from wild-type controls (p < 0.05).1.9 ± 0.11-aSignificantly different from wild-type controls (p < 0.05).0.14 ± 0.031-aSignificantly different from wild-type controls (p < 0.05).(8.7 ± 0.3%)1-aSignificantly different from wild-type controls (p < 0.05).(0.7 ± 0.1%)1-aSignificantly different from wild-type controls (p < 0.05).−/−MControl1027 ± 11.2 ± 0.10.65 ± 0.041-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).(4.2 ± 0.1%)(2.4 ± 0.1%)1-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).−/−MWY1028 ± 11.2 ± 0.10.60 ± 0.051-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).(4.3 ± 0.2%)(2.2 ± 0.1%)1-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).+/+FControl522 ± 11.2 ± 0.10.32 ± 0.02(5.2 ± 0.2%)(1.5 ± 0.1%)+/+FWY520 ± 12.0 ± 0.11-aSignificantly different from wild-type controls (p < 0.05).0.09 ± 0.041-aSignificantly different from wild-type controls (p < 0.05).(10.8 ± 0.6%)1-aSignificantly different from wild-type controls (p < 0.05).(0.5 ± 0.2%)1-aSignificantly different from wild-type controls (p < 0.05).−/−FControl523 ± 10.9 ± 0.10.41 ± 0.031-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).(3.9 ± 0.3%)(1.8 ± 0.1%)1-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).−/−FWY522 ± 10.7 ± 0.10.43 ± 0.061-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).(3.3 ± 0.1%)(1.9 ± 0.2%)1-bSignificantly different from control and WY-14643-treated wild-type controls (p < 0.05).Treatment group indicates a control or WY-14643 (WY) diet.n, number of mice examined; BW, body weight. Liver and gonadal adipose weights are expressed as grams and relative to body weight ((grams of adipose/g of body weight) × 100).1-a Significantly different from wild-type controls (p < 0.05).1-b Significantly different from control and WY-14643-treated wild-type controls (p < 0.05). Open table in a new tab Table IIBody, liver, and adipose weights and serum lipids in 9-month-old male or female C57BL/6N or Sv/129 wild-type (+/+) or PPARα-null (−/−) miceGenotypeSexnBWLiverAdiposeTGTCHDLgggmg/dlmg/dlmg/dlC57BL/6N+/+M1330 ± 11.4 ± 0.11.0 ± 0.183 ± 878 ± 269 ± 2(3.7 ± 0.1%)(2.7 ± 0.2%)+/+F1325 ± 10.9 ± 0.10.5 ± 0.168 ± 1071 ± 362 ± 3(3.9 ± 0.1%)(1.6 ± 0.2%)−/−M1129 ± 21.3 ± 0.11.5 ± 0.22-aSignificantly different from wild-type male (p < 0.05).110 ± 132-aSignificantly different from wild-type male (p < 0.05).84 ± 269 ± 4(3.5 ± 0.1%)(3.9 ± 0.3%)2-aSignificantly different from wild-type male (p < 0.05).−/−F1428 ± 21.2 ± 0.11.4 ± 0.22-bSignificantly different from wild-type female (p < 0.05).85 ± 102-bSignificantly different from wild-type female (p < 0.05).69 ± 259 ± 3(3.6 ± 0.2%)(4.3 ± 0.5%)2-bSignificantly different from wild-type female (p < 0.05).Sv/129+/+M1132 ± 11.1 ± 0.10.8 ± 0.1111 ± 9124 ± 4107 ± 7(3.8 ± 0.1%)(2.5 ± 0.3%)+/+F1226 ± 10.9 ± 0.10.5 ± 0.199 ± 8106 ± 593 ± 3(3.6 ± 0.2%)(1.9 ± 0.4%)−/−M1332 ± 11.0 ± 0.11.2 ± 0.22-aSignificantly different from wild-type male (p < 0.05).94 ± 10142 ± 52-aSignificantly different from wild-type male (p < 0.05).118 ± 4(3.3 ± 0.1%)(3.5 ± 0.3%)2-aSignificantly different from wild-type male (p < 0.05).−/−F1328 ± 10.8 ± 0.10.9 ± 0.22-bSignificantly different from wild-type female (p < 0.05).95 ± 11122 ± 82-bSignificantly different from wild-type female (p < 0.05).108 ± 32-bSignificantly different from wild-type female (p < 0.05).(2.9 ± 0.1%)(3.4 ± 0.1%)2-bSignificantly different from wild-type female (p < 0.05).n, number of mice examined; BW, body weight; TG, serum triglycerides; TC, serum total cholesterol; HDL, high density lipoprotein cholesterol. Liver and gonadal adipose weights are expressed as grams and relative to body weight ((grams of adipose/g of body weight) × 100).2-a Significantly different from wild-type male (p < 0.05).2-b Significantly different from wild-type female (p < 0.05). Open table in a new tab Figure 2Hepatic accumulation of lipids in male PPAR α-null mice. Shown are representative hematoxylin- and eosin-stained sections of livers (magnification × 300) from wild-type (+/+) and PPARα-null (−/−) mice on either an Sv/129 or a C57BL/6N genetic background.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Figure 3PPAR α-null mice are not overtly obese. Shown are representative 7–8-month-old male and female wild-type (+/+) or PPARα-null (−/−) mice on either an Sv/129 or a C57BL/6N genetic background. Bar = 1 inch.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Treatment group indicates a control or WY-14643 (WY) diet.n, number of mice examined; BW, body weight. Liver and gonadal adipose weights are expressed as grams and relative to body weight ((grams of adipose/g of body weight) × 100). n, number of mice examined; BW, body weight; TG, serum triglycerides; TC, serum total cholesterol; HDL, high density lipoprotein cholesterol. Liver and gonadal adipose weights are expressed as grams and relative to body weight ((grams of adipose/g of body weight) × 100). Serum concentrations of cholesterol and high density lipoprotein cholesterol were significantly higher in 9-month-old purebred Sv/129 PPARα-null mice than in wild-type controls (TableII). This effect was observed in both male and female mice, with no apparent difference in the magnitude of these effects (Table II). Serum levels of triglycerides were similar in Sv/129 PPARα-null and wild-type mice (Table II). Serum concentrations of cholesterol and high density lipoprotein cholesterol were similar in 9-month-old purebred C57BL/6N PPARα-null mice and wild-type controls (Table II). This was observed in both male and female mice (Table II). In contrast to Sv/129 mice, serum levels of triglycerides were significantly higher in both male and female PPARα-null mice compared with the respective wild-type controls (Table II). Constitutive hepatic levels of mRNAs encoding mitochondrial fatty acid-metabolizing enzymes (very long chain and long chain acyl-CoA dehydrogenases) were significantly lower in both C57BL/6N and Sv/129 PPARα-null mice of both sexes compared with wild-type controls (Fig.4), consistent with previous results (5Aoyama A. Peters J.M. Iritani N. Nasu-Nakajima T. Furihata K. Hashimoto T. Gonzalez F.J. J. Biol. Chem. 1998; 273: 5678-5684Abstract Full Text Full Text PDF PubMed Scopus (750) Google Scholar). Constitutive hepatic levels of apoC-III were not different between genotypes or sexes in either the C57BL/6N or Sv/129 mouse strain (Fig.4). Similarly, constitutive hepatic levels of mRNA encoding PPARγ were not different between either genotype in both strains and sexes of mice (Fig. 4). Liver weight was significantly higher in male and female wild-type mice fed WY-14643 compared with controls in both C57BL/6N and Sv/129 mice, and this effect was not different between strains (Table I). In contrast, liver weight was not different between male and female null mice compared with controls, and again there was no difference in this effect between C57BL/6N and Sv/129 mice (Table I). Consistent with previous studies, gonadal adipose stores were significantly lower in male and female wild-type mice fed WY-14643 for 1 week compared with controls, and this effect was not found in either strain of PPARα-null mice fed WY-14643 (TableI). Administration of WY-14643 to mice caused a significant decrease in serum triglycerides in both strains of purebred wild-type mice compared with untreated controls (Table II). Hepatic levels of mRNAs encoding acyl-CoA oxidase; bifunctional enzyme; 3-ketoacyl-CoA thiolase; cytochrome P450 4A1; and very long chain, long chain, and medium chain acyl-CoA dehydrogenases were higher in wild-type mice fed WY-14643 than in controls, and these effects were not different between wild-type C57BL/6N and Sv/129 mice of both sexes (Fig. 4). The PPARα-null mice were refractory to increased levels of these mRNAs, and there was no difference in this effect between strains (Fig. 4). Hepatic mRNA for apoC-III was reduced in wild-type mice fed WY-14643 compared with controls (Fig. 4), and this effect was absent in both strains and sexes of the PPARα-null mice. The original phenotypic assessment of PPARα-null mice on a mixed genetic background (C57BL/6N × Sv/129) provided strong in vivo evidence that PPARα mediates the pleiotropic response to peroxisome proliferators, including hepatomegaly, peroxisome proliferation, and induction of genes encoding peroxisomal and microsomal lipid-metabolizing enzymes (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar). Although constitutive expression of peroxisomal and microsomal lipid-metabolizing enzymes was not influenced by targeted disruption of the PPARα gene, hepatic accumulation of lipids was described in PPARα-null mice, suggesting that constitutive lipid homeostasis is altered in the absence of a functional PPARα (3Lee S.S. Pineau T. Drago J. Lee E.J. Owens J.W. Kroetz D.L. Fernandez-Salguero P.M. Westphal H. Gonzalez F.J. Mol. Cell. Biol. 1995; 15: 3012-3022Crossref PubMed Scopus (1498) Google Scholar). Evidence that constitutive gene expression is altered in PPARα-null mice on an Sv/129 background was provided by the report that mRNAs encoding mitochondrial fatty acid-metabolizing enzymes are reduced compared with wild-type mice, whereas constitutive expression of mRNAs encoding peroxisomal and microsomal fatty acid-metabolizing enzymes is unaffected (5Aoyama A. Peters J.M. Iritani N. Nasu-Nakajima T. Furihata K. Hashimoto T. Gonzalez F.J. J. Biol. Chem. 1998; 273: 5678-5684Abstract Full Text Full Text PDF PubMed Scopus (750) Google Scholar). This study also confirmed that many of the observations made in mixed background PPARα-null mice are consistently found in purebred Sv/129 mice, including an absence of peroxisome proliferator-induced hepatomegaly and induction of mRNAs encoding peroxisomal and microsomal lipid-metabolizing enzymes (5Aoyama A. Peters J.M. Iritani N. Nasu-Nakajima T. Furihata K. Hashimoto T. Gonzalez F.J. J. Biol. Chem. 1998; 273: 5678-5684Abstract Full Text Full Text PDF PubMed Scopus (750) Google Scholar). This suggests that hepatic lipid accumulation found in PPARα-null mice may be the result of reduced mitochondrial fatty acid oxidation. Results from the present study confirm and extend this characterization by demonstrating that male and female C57BL/6N PPARα-null mice are refractory to the pleiotropic response induced by peroxisome proliferators and that constitutive hepatic lipid accumulation occurs as previously described. Furthermore, this work demonstrates that this response is similar between male and female PPARα-null mice on either a pure Sv/129 or C57BL/6N genetic background. Serum lipids in mixed background PPARα-null mice were also reported to be altered compared with wild-type controls. PPARα-null mice on a mixed genetic background exhibit significantly higher serum levels of cholesterol, in particular high density lipoprotein cholesterol, compared with wild-type controls (4Peters J.M. Hennuyer N. Staels B. Fruchart J.C. Fievet C. Gonzalez F.J. Auwerx J. J. Biol. Chem. 1997; 272: 27307-27312Abstract Full Text Full Text PDF PubMed Scopus (399) Google Scholar). Similar results were found in this study in both male and female PPARα-null mice on a pure Sv/129 genetic background, consistent with the observations made in mixed background mice. In contrast, higher levels of serum cholesterol were not found, whereas serum levels of triglycerides were significantly higher than controls in both male and female PPARα-null mice on a C57BL/6N background. These results suggest that the genetic background of the PPARα-null mouse can significantly influence serum lipid biochemistry, likely through interactions with other genes. The mechanisms underlying this difference are unclear. Nevertheless, purebred Sv/129 and C57BL/6N PPARα-null mice provide unique tools for studies investigating the role of altered serum cholesterol and triglycerides in the etiology of atherosclerosis. The C57BL/6 mouse strain is better suited for evaluating the mechanisms contributing to atherosclerosis since atherosclerotic plaques can be induced by feeding a high fat diet (49Rubin E.M. Krauss R.M. Spangler E.A. Verstuyft J.G. Clift S.M. Nature. 1991; 353: 265-267Crossref PubMed Scopus (860) Google Scholar, 50Shimano H. Ohsuga J. Shimada M. Namba Y. Gotoda T. Harada K. Katsuki M. Yazaki Y. Yamada N. J. Clin. Invest. 1995; 95: 469-476Crossref PubMed Scopus (128) Google Scholar). Thus, the PPARα-null mouse line on a C57BL/6N genetic background may be well suited for this purpose since constitutively higher levels of lipids are a known risk factor for this disease (51Assmann G. Cullen P. Jossa F. Lewis B. Mancini M. Arterioscler. Thromb. Vasc. Biol. 1999; 19: 1819-1824Crossref PubMed Scopus (109) Google Scholar). As PPARα-null mice exhibit significant lipid accumulation that may be due in part to impaired mitochondrial oxidation of fatty acids, it is not surprising that adipose stores are significantly greater in this mouse line as well. Although it is clear from these results that purebred PPARα-null mice on a pure Sv/129 or C57BL/6N genetic background have larger stores of adipose and accumulate lipids in the liver, differences in body weight are not of sufficient magnitude to be indicative of an obese phenotype. In the original mixed background PPARα-null mouse line, it was noted that adipose stores were significantly greater than controls with little difference in overall body weight (52Gonzalez F.J. Adv. Exp. Med. Biol. 1997; 422: 109-125Crossref PubMed Scopus (52) Google Scholar). Similar reports of PPARα-null mice on an Sv/129 background are consistent with this observation in that large differences in body weight were not found even in male mice that are >1-year-old (26Nakajima T. Kamijo Y. Usuda N. Liang Y. Fukushima Y. Kametani K. Gonzalez F.J. Aoyama T. Carcinogenesis. 2000; 21: 677-682Crossref PubMed Scopus (48) Google Scholar, 27Peters J.M. Cattley R.C. Gonzalez F.J. Carcinogenesis. 1997; 18: 2029-2033Crossref PubMed Scopus (426) Google Scholar). Conflicting reports suggest that this phenotype may be influenced by other factors, including diet and genetics. Costet et al. (42Costet P. Legendre C. More J. Edgar A. Galtier P. Pineau T. J. Biol. Chem. 1998; 273: 29577-29585Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar) provided evidence suggesting that the PPARα-null mouse may be a useful model to study obesity and that this phenotype is more prevalent in female mice than in male mice. In contrast to results presented in the present study, these investigators reported that body weight of PPARα-null mice is significantly greater than controls in both sexes after 7 months of age. Consistent with previous work (4Peters J.M. Hennuyer N. Staels B. Fruchart J.C. Fievet C. Gonzalez F.J. Auwerx J. J. Biol. Chem. 1997; 272: 27307-27312Abstract Full Text Full Text PDF PubMed Scopus (399) Google Scholar) and the present study, alterations in serum lipids, adipose stores, and hepatic lipid accumulation were also detected in PPARα-null mice compared with controls (42Costet P. Legendre C. More J. Edgar A. Galtier P. Pineau T. J. Biol. Chem. 1998; 273: 29577-29585Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar). The difference in body weight between male and female PPARα-null mice was attributed in part to differences in hepatic PPARγ expression and differences in hepatic lipid accumulation (42Costet P. Legendre C. More J. Edgar A. Galtier P. Pineau T. J. Biol. Chem. 1998; 273: 29577-29585Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar); however, these changes were not detected in the present study. It is critical to emphasize that the genetic background of the PPARα-null mice used for the analysis performed by Costet et al. (42Costet P. Legendre C. More J. Edgar A. Galtier P. Pineau T. J. Biol. Chem. 1998; 273: 29577-29585Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar) is unclear, as the substrain of the C57BL/6 mouse used for backcrossing was not identified, and the extent of backcrossing described (<10 generations) theoretically would not result in a congenic line of mice. Thus, the congenic control C57BL/6 mice of unknown substrain used for controls are likely inappropriate and may have resulted in incorrect comparisons. Indeed, significant differences in the functional properties of another xenobiotic receptor (aryl hydrocarbon receptor) are known to exist between C57BL/6N and C57BL/6J mouse lines (53Poland A. Palen D. Glover E. Mol. Pharmacol. 1994; 46: 915-921PubMed Google Scholar, 54Poland A. Glover E. Mol. Pharmacol. 1990; 38: 306-312PubMed Google Scholar), demonstrating the importance of backcrossing mice with the identical line used for blastocyst transfer in this case. Differences in control mouse chow may also have contributed to the difference in body weight observed in PPARα-null mice between the present study and that of Costet et al. (42Costet P. Legendre C. More J. Edgar A. Galtier P. Pineau T. J. Biol. Chem. 1998; 273: 29577-29585Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar), although the percentage of fat was similar (4.5%), suggesting that the genetic background is more likely a confounding variable in this work. That dietary fatty acids may influence the phenotype of PPARα-null mice is also suggested by another report showing that purebred Sv/129 PPARα-null mice have larger adipose stores than controls (29Poynter M.E. Daynes R.A. J. Biol. Chem. 1998; 273: 32833-32841Abstract Full Text Full Text PDF PubMed Scopus (491) Google Scholar). In contrast to data presented in this study and that of Costet et al. (42Costet P. Legendre C. More J. Edgar A. Galtier P. Pineau T. J. Biol. Chem. 1998; 273: 29577-29585Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar), these investigators reported that gonadal adipose stores and average body weight were greater in male PPARα-null mice compared with female PPARα-null mice (29Poynter M.E. Daynes R.A. J. Biol. Chem. 1998; 273: 32833-32841Abstract Full Text Full Text PDF PubMed Scopus (491) Google Scholar). Although increased adipose stores and body weight in PPARα-null mice are consistent with this work, the fact that male PPARα-null mice on an Sv/129 background were reported to have larger adipose stores than female mice (29Poynter M.E. Daynes R.A. J. Biol. Chem. 1998; 273: 32833-32841Abstract Full Text Full Text PDF PubMed Scopus (491) Google Scholar) illustrates how significant variation can occur between laboratories using an identical mouse line. The most likely explanation for this difference is the source of fat used for the control diet, which can significantly influence lipid metabolism in these mice (7Kersten S. Seydoux J. Peters J.M. Gonzalez F.J. Desvergne B. Wahli W. J. Clin. Invest. 1999; 103: 1489-1498Crossref PubMed Scopus (1360) Google Scholar). Given the conflicting accounts of phenotypes for the PPARα-null mouse lines with respect to obesity, it is critical that investigators indicate the source of fat used for control and experimental diets in the future and the strain of congenic mouse used for analysis. This study provides details of the backcrossing performed at the National Institutes of Health with the original line of mice, which to date has been the sole source for distribution of PPARα-null mice to independent investigators.

Inorganic arsenic is a known human carcinogen causing tumors of the skin, urinary bladder, lung, liver, kidney, and possibly other organs. However, the animal models for inorganic arsenic carcinogenesis have been limited and development has been problematic. Gestation is often a period of high sensitivity to carcinogenesis so we investigated inorganic arsenite as a transplacental carcinogen in mice. Pregnant C3H mice were exposed to sodium arsenite (0, 42.5, and 85 ppm as arsenic) in the drinking water for a brief period during gestation (from gestation day 8 to 18), with no further arsenic exposure or other treatments. The offsprings were monitored up to 90 weeks. Transplacental inorganic arsenic exposure produced a dose-dependent induction of tumors in the liver, adrenal, lung, and ovary in the offsprings after they had reached adulthood. This included hepatocellular carcinoma (HCC), a tumor associated with arsenic exposure in humans. These tumors occurred when mice became adults in the absence of any other treatments and well after arsenic exposure had ended. Genomic analysis of liver tumors and tumor-surrounding tissues revealed several patterns of aberrant gene expression associated with transplacental arsenic carcinogenesis. This animal model demonstrated that inorganic arsenic could act as a "complete" transplacental carcinogen in mice. In addition, other important animal models for inorganic arsenic as a skin tumor co-promoter or as a co-carcinogen are discussed. The development of these animal models should advance our understanding of the mechanisms of inorganic arsenic carcinogenesis.

To identify possible immune mechanisms in human onchocerciasis, we compared a group of 12 individuals who had no clinical or parasitological evidence of infection, despite ongoing exposure to the parasite, with a group of 16 individuals from the same area who had active Onchocerca volvulus infection. Despite having less parasite-specific serum antibody, the infection-free (“putatively immune”) individuals showed greater lymphocyte responsiveness, especially interleukin-2 (lL-2) production, to O. volvulus antigen (OVA) than did the infected subjects; lymphocyte responses (including IL-2 production) to mitogens and nonparasite antigen in both study groups were equivalent and normal. Our findings define differences in parasite-specific T cell subpopulations between infected and putatively immune subjects that could be a central element in developing or maintaining protective immunity to O. volvulus infection.

Helicobacter infections cause chronic gastroenteritis in humans and several animal species. We recently discovered a new Helicobacter (H. hepaticus) that is the etiological agent of a unique chronic active hepatitis in mice. Natural infection appeared to be acquired early in life in enzootically infected colonies. Liver lesions arose as focal necrosis and focal nonsuppurative inflammation by 1 to 4 months of age in susceptible mouse strains. By 6 to 8 months, extensive liver involvement included hepatocytomegaly, bile ductular (oval cell) hyperplasia, and cholangitis. There was an age-related increase in proliferating cell nuclear antigen hepatocyte nuclear labeling index. The bacteria were usually found within bile canaliculi as determined by ultrastructural evaluation of liver lesions, the Steiner modification of the Warthin-Starry stain and immunohistochemistry with a rabbit antibody to Helicobacter pylori. Naturally infected mice showed an age-related increase in serum IgG antibodies to Helicobacter hepaticus proteins. The disease was experimentally reproduced by intraperitoneal injection of liver suspensions from affected livers or bacteria cultivated in vitro. The earliest lesions of the experimental disease appeared 4 weeks after injection. The course of spontaneous and experimental infection was slow and insidious and resulted in high titers of antibodies to bacterial proteins. This chronic bacterial infection represents a new model of chronic liver disease.

Peroxisome proliferator-activated receptor gamma (PPARgamma), a member of the nuclear receptor superfamily, plays a role in adipocyte differentiation, type II diabetes, macrophage response to inflammation and is suggested to influence carcinogen-induced colon cancer. Studies done in vitro and in vivo also revealed that PPARgamma ligands might promote differentiation and/or regression of mammary tumors. To directly evaluate the role of PPARgamma in mammary carcinogenesis, PPARgamma wild-type (+/+) or heterozygous (+/-) mice were administered 1 mg 7,12-dimethylbenz[a]anthracene (DMBA) by gavage once a week for 6 weeks and followed for a total of 25 weeks. Compared with congenic PPARgamma(+/+) littermate controls, PPARgamma(+/-) mice had early evidence for increased susceptibility to DMBA-mediated carcinogenesis based on a 1.6-fold increase in the percentage of mice with skin papillomas, as well as a 1.7-fold increase in the numbers of skin papillomas per mouse (P < 0.05). Similarly, PPARgamma(+/-) mice also had a 1.5-fold decreased survival rate (P = 0.059), and a 1.7-fold increased incidence of total tumors per mouse (P < 0.01). Moreover, PPARgamma(+/-) mice had an almost 3-fold increase in mammary adenocarcinomas (P < 0.05), an over 3-fold increase in ovarian granulosa cell carcinomas (P < 0.05), an over 3-fold increase in malignant tumors (P < 0.02) and a 4.6-fold increase in metastatic incidence. These results are the first to demonstrate an increased susceptibility in vivo of PPARgamma haploinsufficiency to DMBA-mediated carcinogenesis and suggest that PPARgamma may act as a tumor modifier of skin, ovarian and breast cancers. The data also support evidence suggesting a beneficial role for PPARgamma-specific ligands in the chemoprevention of mammary, ovarian and skin carcinogenesis.

Prolonged administration of peroxisome proliferators to rodents typically leads to hepatocarcinogenesis. Peroxisome proliferator-activated receptor-alpha (PPARalpha) is required to mediate alterations in PPARalpha target gene expression, repress apoptosis, enhance replicative DNA synthesis, oxidative stress to DNA and hepatocarcinogenesis induced by the relatively specific PPARalpha agonist, Wy-14,643. Interestingly, administration of the less specific PPARalpha agonist, bezafibrate, leads to a modest induction of PPARalpha target genes in the absence of PPARalpha expression. In these studies, the role of PPARalpha in modulating hepatocarcinogenesis induced by long-term feeding of 0.5% bezafibrate was examined in wild-type (+/+) and PPARalpha-null (-/-) mice. The average liver weight was significantly higher in (+/+) and (-/-) mice fed bezafibrate than controls, but this effect was considerably less in (-/-) mice as compared with similarly treated (+/+) mice. Increased levels of mRNA encoding cell cycle regulatory proteins and DNA repair enzymes were found in (+/+) mice fed bezafibrate, and this effect was not found in (-/-) mice. In mice fed bezafibrate for 1 year, preneoplastic foci, adenomas and a hepatocellular carcinoma were found in (+/+) mice, while only a single microscopic adenoma was found in one (-/-) mouse. This effect was observed in both Sv/129 and C57BL/6N strains of mice, although only preneoplastic foci were observed in the latter strain. Interestingly, hepatic cholestasis was observed in 100% of the bezafibrate-fed (-/-) mice, and this was accompanied by significantly elevated hepatic expression of mRNA encoding bile salt export pump and lower expression of mRNA encoding cytochrome P450 7A1, consistent with enhanced activation of the bile acid receptor, farnesoid X receptor. Results from these studies demonstrate that the PPARalpha is required to mediate hepatocarcinogenesis induced by bezafibrate, and that PPARalpha protects against potential cholestasis.

The C57BL/6, 129, and B6,129 mouse strains or stocks have been commonly used to generate targeted mutant mice. The pathology of these mice is not well characterized. In studies of these aging mice, we found high incidences of hyalinosis (eosinophilic cytoplasmic change) in the glandular stomach, respiratory tract, bile duct, and gall bladder of B6,129 CYP1A2-null and wild-type mice as well as in both sexes of the background 129S4/SvJae strain. The gastric lesions of the glandular stomach were found in 95.7% of female CYP1A2-null mice as well as in 45.7% of female 129S4/SvJae animals. The eosinophilic protein isolated from characteristic hyaline gastric lesions was identified as Ym2, a member of the chitinase family. Immunohistochemistry, using rabbit polyclonal antibodies to oligopeptides derived from the Ym1 sequence, detected focal to diffuse reactivity within both normal and abnormal nasal olfactory and respiratory epithelium, pulmonary alveolar macrophages, bone marrow myeloid cells, and the squamous epithelium of the forestomach and epithelium of the glandular stomach. Alveolar macrophages in acidophilic pneumonia, a major cause of death of aging 129 mice, and in mice with the me mutation also were highly immunoreactive. The possible cause of this protein excess in gastric and other lesions and its possible functions are discussed.

Abstract Erythrophagocytosis and inflammation from activated macrophages occur in distinct clinical scenarios. The presence of CD8+ T cells and interferon-γ (IFN-γ) production is required to induce disease in mouse models of hemophagocytic lymphohistiocytosis. We investigated the roles of a different class of proinflammatory cytokines, interleukin-4 (IL-4) and IL-13, in the induction of inflammatory tissue macrophage accumulation and/or hemophagocytosis. We found that large amounts of IL-4, but not IL-13, delivered via an implanted mini-pump or IL-4/anti–IL-4 complexes, lead to substantial YM1+ tissue macrophage accumulation, erythrophagocytosis within the liver, spleen, and bone marrow, decreased hemoglobin and platelet levels, and acute weight loss. This effect is not dependent on the presence of antibody or T cells, as treatment of Rag2−/− mice leads to similar disease, and IFN-γ neutralization during IL-4 treatment had no effect. IL-4 treatment results in suppression of IL-12, elevation of serum IFN-γ, IL-10, and the murine IL-8 homolog KC, but not IL-6, IL-1β, or tumor necrosis factor-α. Finally, mice transgenic for IL-4 production developed tissue macrophage accumulation, disruption of splenic architecture, bone marrow hypocellularity, and extramedullary hematopoiesis. These data describe a novel pathophysiologic pathway for erythrophagocytosis in the context of tissue macrophage accumulation and inflammation involving elevations in IL-4 and alternative macrophage activation.

In determining the carcinogenicity of a chemical tested in a National Cancer Institute (NCI) bioassay, the following criteria are considered: (1) the adequacy of the bioassay data, (2) the presence of significantly increased incidences of tumors, (3) the adequacy of the number of animals at risk of developing tumors, (4) the adequacy of the dose of chemical administered, (5) the etiology and pathogenesis of the lesions, and (6) other factors that may influence an evaluation, such as o shortened latency period for tumor formation in dosed animals or the stability of the chemical. A decision tree for evaluating these factors is presented. A summary of the results of 200 NCI carcinogen bioassays is also reported. These procedures are presented in the hope that they may serve as discussion points for future developments In the field.

Antigens of human (HIV) or simian immunodeficiency viruses (SIV) were identified with polyclonal or monoclonal antibodies and avidin-biotin complex (ABC) immunohistochemistry in fixed surgical pathology and autopsy specimens of humans or monkeys with the acquired immunodeficiency syndrome. With B-5 fixative, viral antigens were readily detected in lymph nodes of 8 of 13 patients with follicular hyperplasia, but in only 1 of 12 patients with follicular atrophy. Antigen was detected in follicular dendritic reticular cells and rare blastlike cells, extracellularly, and in postcapillary venules, medullary lymphocytes, sinus histiocytes, and macrophages in some lymph nodes. In the brain at autopsy, antigen could be found in gliomesenchymal-cell nodules, astrocytes, vascular endothelial cells, multinucleated cells, and astrocytes and macrophages associated with demyelination. In contrast, 4 rhesus monkeys with experimental SIV infection had abundant antigen in sinus histiocytes, macrophages, and multinucleated giant cells of lymph nodes and spleen and in thymic epithelial cells. Brain lesions of monkeys resembled those of humans, with antigen found in macrophages and multinucleated giant cells. Antibodies to HIV also were immunoreactive in formalin-fixed tissue sections of monkeys containing SIV antigens. The ABC technique provided a fast and efficient method for localizing HIV and SIV antigens in fixed surgical and autopsy specimens. These findings are consistent with those found with in situ hybridization, ultrastructural studies, frozen sections of lymph nodes, and permanent sections of brain.

Lymphopenia and restricted T cell repertoires in humans are often associated with severe eosinophilic disease and a T cell Th2 bias. To examine the pathogenesis of this phenomenon, C57BL/6 Rag2-/- mice received limited (3 x 10(4)) or large (2 x 10(6)) numbers of CD4 T cells. Three to 5 months after transfer, mice that had received 3 x 10(4) T cells, but not those that received 2 x 10(6), developed fulminant macrophage pneumonia with eosinophilia, Ym1 deposition, and methacholine-induced airway hyperresponsiveness, as well as eosinophilic gastritis; esophagitis and other organ damage occurred in some cases. Donor cells were enriched for IL-4, IL-5, and IL-13 producers. When 3 x 10(4) cells were transferred into CD3epsilon-/- hosts, the mice developed strikingly elevated serum IgE. Prior transfer of 3 x 10(5) CD25+ CD4 T cells into Rag2-/- recipients prevented disease upon subsequent transfer of CD25- CD4 T cells, whereas 3 x 10(4) regulatory T cells (Tregs) did not, despite the fact that there were equal total numbers of Tregs in the host at the time of transfer of CD25- CD4 T cells. Limited repertoire complexity of Tregs may lead to a failure to control induction of immunopathologic responses, and limitation in repertoire complexity of conventional cells may be responsible for the Th2 phenotype.