Jeffrey Liu

Abstract BACKGROUND There is continuous debate regarding the optimal classification, prognosis, and treatment of the follicular variant of papillary thyroid carcinoma (FVPTC). The objective of this study was to assess the behavior of FVPTC, especially its encapsulated form, and shed more light on its true position in the classification scheme of well differentiated thyroid carcinoma. METHODS All patients with FVPTC, follicular thyroid adenoma (FTA), and follicular thyroid carcinoma (FTC) who were diagnosed between 1980 and 1995 were reviewed and reclassified according to the currently accepted definition of FVPTC. The tumors were separated into encapsulated and nonencapsulated (infiltrative/diffuse) types. Encapsulated tumors were subdivided further into tumors with or without capsular/vascular invasion. These different subtypes of FVPTC were correlated with outcome and with other clinicopathologic parameters. RESULTS After review by 4 pathologists, 78 patients were included in the study. Sixty‐one of 78 patients (78%) had encapsulated tumors (18 invasive, 43 noninvasive), and 17 patients had nonencapsulated tumors (infiltrative/diffuse). The gender distribution, age at presentation, and tumor size did not differ between patients with encapsulated and nonencapsulated FVPTC. Patients who had encapsulated FVPTC had a significantly lower rate of marked intratumor fibrosis (18%), extrathyroid extension (5%), and positive margins (2%) compared with patients who had nonencapsulated tumors (88%, 65%, and 50% respectively; P < .0001). Regional lymph node metastases were present in 14 of 78 patients (18%), and no patients had distant metastases. The lymph node metastatic rate was significantly higher in patients who had nonencapsulated tumors (11 of 17 patients; 65%) compared with patients who had encapsulated neoplasms (3 of 61 patients; 5%; P < .0001). In addition, lymph node metastases were not detected in any noninvasive, encapsulated FVPTCs. With a median follow‐up of 10.8 years, only 1 patient developed a recurrence, which occurred in an encapsulated FVPTC that had numerous invasive foci. None of the patients with noninvasive, encapsulated FVPTCs developed recurrences, including 31 patients who underwent lobectomy alone, with a median follow‐up of 11.1 years. CONCLUSIONS FVPTC appeared to be a heterogeneous disease composed of 2 distinct groups: an infiltrative/diffuse (nonencapsulated) subvariant, which resembles classic papillary carcinoma in its metastatic lymph node pattern and invasive growth, and an encapsulated form, which behaves more like FTA/FTC. Patients who had noninvasive, encapsulated FVPTCs did not develop lymph node metastases or recurrences and could be treated by lobectomy alone. If the current findings are confirmed, then strong consideration should be given to reclassifying encapsulated FVPTC as an entity that is close to the FTA/FTC class of tumors. Cancer 2006. © 2006 American Cancer Society.

To investigate the prevalence and predictors of intraoperative and 90-day postoperative ocular complications associated with cataract surgery performed in the United States Veterans Health Administration (VHA) system.Retrospective cohort study.Forty-five thousand eighty-two veterans who underwent cataract surgery in the VHA.The National Patient Care Database was used to identify all VHA patients who underwent outpatient extracapsular cataract surgery and who underwent only 1 cataract surgery within 90 days of the index surgery between October 1, 2005, and September 30, 2007. Data collected include demographics, preoperative systemic and ocular comorbidities, intraoperative complications, and 90-day postoperative complications. Adjusted odds ratios (ORs) of factors predictive of complications were calculated using logistic regression modeling.Intraoperative and postoperative ocular complications within 90 days of cataract surgery.During the study period, 53786 veterans underwent cataract surgery; 45082 met inclusion criteria. Common preoperative systemic and ocular comorbidities included diabetes mellitus (40.6%), chronic pulmonary disease (21.2%), age-related macular degeneration (14.4%), and diabetes with ophthalmic manifestations (14.0%). The most common ocular complications were posterior capsular tear, anterior vitrectomy, or both during surgery (3.5%) and posterior capsular opacification after surgery (4.2%). Predictors of complications included: black race (OR, 1.38; 95% confidence interval [CI], 1.28-1.50), divorced status (OR, 1.10; 95% CI, 1.03-1.18), never married (OR, 1.26; 95% CI, 1.14-1.38), diabetes with ophthalmic manifestations (OR, 1.33; 95% CI, 1.23-1.43), traumatic cataract (OR, 1.80; 95% CI, 1.40-2.31), previous ocular surgery (OR, 1.29; 95% CI, 1.02-1.63), and older age.In a cohort of United States veterans with a high preoperative disease burden, selected demographic factors and ocular comorbidities were associated with greater risks of cataract surgery complications. Further large-scale studies are warranted to investigate cataract surgery outcomes for non-VHA United States patient populations.

The success of targeted or immune therapies is often hampered by the emergence of resistance and/or clinical benefit in only a subset of patients. We hypothesized that combining targeted therapy with immune modulation would show enhanced antitumor responses. Here, we explored the combination potential of erdafitinib, a fibroblast growth factor receptor (FGFR) inhibitor under clinical development, with PD-1 blockade in an autochthonous FGFR2K660N/p53mut lung cancer mouse model. Erdafitinib monotherapy treatment resulted in substantial tumor control but no significant survival benefit. Although anti-PD-1 alone was ineffective, the erdafitinib and anti-PD-1 combination induced significant tumor regression and improved survival. For both erdafitinib monotherapy and combination treatments, tumor control was accompanied by tumor-intrinsic, FGFR pathway inhibition, increased T-cell infiltration, decreased regulatory T cells, and downregulation of PD-L1 expression on tumor cells. These effects were not observed in a KRASG12C-mutant genetically engineered mouse model, which is insensitive to FGFR inhibition, indicating that the immune changes mediated by erdafitinib may be initiated as a consequence of tumor cell killing. A decreased fraction of tumor-associated macrophages also occurred but only in combination-treated tumors. Treatment with erdafitinib decreased T-cell receptor (TCR) clonality, reflecting a broadening of the TCR repertoire induced by tumor cell death, whereas combination with anti-PD-1 led to increased TCR clonality, suggesting a more focused antitumor T-cell response. Our results showed that the combination of erdafitinib and anti-PD-1 drives expansion of T-cell clones and immunologic changes in the tumor microenvironment to support enhanced antitumor immunity and survival.

The emergence of data from clinical trials of biologics, the approval of new biologics, and our improved understanding of psoriasis pathogenesis have increased the therapeutic possibilities for the treatment of moderate-to-severe psoriasis. Biologics currently approved for the treatment of psoriasis include tumor necrosis factor inhibitors, interleukin (IL)-17 inhibitors, ustekinumab (an IL-12/23 inhibitor), and IL-23 inhibitors. Data from clinical trials and studies of the safety and efficacy of biologics provide essential information for the personalization of patient care. We discuss the benefits and disadvantages of biologics as a first-line treatment choice, update treatment recommendations according to current evidence, and propose psoriasis treatment algorithms. Our discussion includes the following comorbid conditions: psoriatic arthritis, multiple sclerosis, congestive heart failure, inflammatory bowel disease, hepatitis B, nonmelanoma skin cancer, lymphoma, and latent tuberculosis. We make evidence-based treatment recommendations for special populations, including pediatric patients, patients with coronavirus 2019 (COVID-19), and pregnant and breastfeeding patients with psoriasis. Ultimately, individualized recommendations that consider patient preferences, disease severity, comorbid conditions, and additional risk factors should be offered to patients and updated as new trial data emerges.

Objectives/Hypothesis Although the multidisciplinary tumor board (MTB) is accepted as best practice for the management of head and neck squamous cell carcinoma (HNSCC), there is limited evidence showing its impact on survival. Our goal was to investigate the impact of an MTB following the hiring of a fellowship‐trained head and neck surgeon and implementation of an MTB at our institution. We hypothesized that these changes would demonstrate an improvement in survival. Study Design Retrospective chart review. Methods A review of HNSCC treated at our institution between October 2006 and May 2015 was performed. The cohort was divided into pre‐MTB (October 2006–February 2011) and post‐MTB (February 2011–May 2015) cohorts. Patient demographics, cancer stage, and treatment outcomes were reviewed. Univariate, multivariate, and survival analysis were performed. Results The study included 224 patients, 98 in the pre‐MTB cohort and 126 in the post‐MTB cohort. Of total patients, 139 (62%) were black and 91 (40%) were on Medicaid or uninsured. Average follow‐up time was 2.8 years, and most cases were advanced stage (68%). On Kaplan‐Meier evaluation, overall survival and disease‐specific survival were significantly improved in the post‐MTB cohort compared with the pre‐MTB cohort, with a 5‐year disease‐specific survival of 52% vs. 75% ( P = .003). A matched cohort analysis showed that the post‐MTB cohort had significantly lower risk of death (hazard ratio: 0.48). Conclusions Our study demonstrates that treatment of HNSCC by a dedicated multidisciplinary team results in improved survival. Multidisciplinary care should be considered best practice in the care of HNSCC. Level of Evidence 3b Laryngoscope , 130:946–950, 2020

To review the incidence of cerebrospinal fluid leak after vestibular schwannoma removal reported in the literature.MEDLINE and PubMed literature search using the terms "acoustic neuroma" or "vestibular schwannoma," and "cerebrospinal fluid leak" or "cerebrospinal fluid fistula" covering the period from 1985 to the present in the English language literature. A review of bibliographies of these studies was also performed.Criteria for inclusion in this meta-analysis consisted of the availability of extractable data from studies presenting a defined group of patients who had undergone primary vestibular schwannoma removal and for whom the presence and absence of cerebrospinal fluid leakage was reported. Studies reporting combined approaches were excluded. No duplications of patient populations were included. Twenty-five studies met the inclusion criteria.Quality of the studies was determined by the design of each study and the ability to combine the data with the results of other studies. All of the studies were biased by their retrospective, nonrandomized nature.Significance (p < 0.05) was determined using the chi2 test.Cerebrospinal fluid leak occurred in 10.6% of 2,273 retrosigmoid surgeries, 9.5% of 3,118 translabyrinthine surgeries, and 10.6% of 573 middle fossa surgeries. The type of cerebrospinal fluid leak was not associated with surgical approach. Meningitis was significantly associated with cerebrospinal fluid leak (p < 0.05). Age and tumor size were not associated with cerebrospinal fluid leak.

To identify, summarize, and evaluate patient-reported outcome questionnaires for use in head and neck cancer surgery with the view to making recommendations for future research.A systematic review of the English-language literature, with the use of head-and-neck-surgery-specific keywords, was performed in the following databases: Medline, Embase, HAPI, CINAHL, Science/Social Sciences Citation Index, and PsycINFO from 1966 to March 2006. DATA EXTRACTION AND STUDY SELECTION: All English-language instruments identified as patient-reported outcome questionnaires that measure quality of life and/or satisfaction that had undergone development and validation in a head and neck cancer surgery population were included.Twelve patient-reported outcome questionnaires fulfilled our inclusion criteria. Of these, four were developed from expert opinion alone or did not have a published development process and seven questionnaires lacked formal item reduction. Only three questionnaires (EORTC Head and Neck Module, University of Michigan Head and Neck Quality-of-life Questionnaire, and Head and Neck Cancer Inventory) fulfilled guidelines for instrument development and evaluation as outlined by the Medical Outcomes Trust.Rigorous instrument development is important for creating valid, reliable, and responsive disease-specific questionnaires. As a direction for future instrument development, an increased focus on qualitative research to ensure patient input may help to better conceptualize and operationalize the variables most relevant to head and neck cancer surgery patients. In addition, the use of alternative methods of psychometric data analysis, such as Rasch, may improve the value of health measurement in clinical practice for individual patients.

No AccessJournal of UrologyNew Technology and Techniques1 Dec 2017Robotic Ureteroplasty with Buccal Mucosa Graft for the Management of Complex Ureteral Strictures Ziho Lee, Benjamin T. Waldorf, Eric Y. Cho, Jeffrey C. Liu, Michael J. Metro, and Daniel D. Eun Ziho LeeZiho Lee More articles by this author , Benjamin T. WaldorfBenjamin T. Waldorf More articles by this author , Eric Y. ChoEric Y. Cho More articles by this author , Jeffrey C. LiuJeffrey C. Liu More articles by this author , Michael J. MetroMichael J. Metro More articles by this author , and Daniel D. EunDaniel D. Eun More articles by this author View All Author Informationhttps://doi.org/10.1016/j.juro.2017.06.097AboutFull TextPDF ToolsAdd to favoritesDownload CitationsTrack CitationsPermissionsReprints ShareFacebookLinked InTwitterEmail Abstract Purpose: Surgical management of proximal and mid ureteral strictures that are not amenable to primary excision and anastomosis is challenging. Although a buccal mucosa graft is commonly used during substitution urethroplasty, its use in substitution ureteroplasty is limited. We describe our technique of robotic ureteroplasty with a buccal mucosa graft to manage complex ureteral strictures and we report our outcomes. Materials and Methods: We retrospectively reviewed the records of 12 patients who underwent robotic ureteroplasty with a buccal mucosa graft between September 2014 and June 2016. The indication for the procedure was a proximal or mid ureteral stricture not amenable to primary excision and anastomosis. The primary outcomes were clinical success, absent symptoms on ureteral pathology and radiological success, defined as absent ureteral obstruction on retrograde pyelography, renal scan and/or computerized tomography. Results: Four of the 12 patients (33.3%) had a ureteropelvic junction stricture, 4 (33.3%) had a proximal stricture and 4 (33.3%) had a mid ureteral stricture. Eight of the 12 patients (66.7%) had previously undergone failed ureteral reconstruction. Median stricture length was 3 cm (range 2 to 5). Median operative time was 217 minutes (range 136 to 344) and mean estimated blood loss was 100 ml (range 50 to 200). Median length of stay was 1 day (range 1 to 6). At a median followup of 13 months (range 4 to 30) 10 of the 12 cases (83.3%) were clinically and radiologically successful. Conclusions: Robotic ureteroplasty with a buccal mucosa graft is associated with low inherent morbidity. It is an effective way to manage complex proximal and mid ureteral strictures. References 1 : Replacement of the ureter by small intestine: clinical application and results of the ileal ureter in 89 patients. J Urol1979; 121: 728. Link, Google Scholar 2 : The use of bowel for ureteral replacement for complex ureteral reconstruction: long-term results. J Urol2006; 175: 179. Link, Google Scholar 3 : Renal autotransplantation: 27-year experience at 2 institutions. J Urol2015; 194: 1357. Link, Google Scholar 4 : Long-term outcomes and late complications of laparoscopic nephrectomy with renal autotransplantation. J Urol2008; 179: 240. Link, Google Scholar 5 : Robot-assisted surgery for benign ureteral strictures: experience and outcomes from four tertiary care institutions. Eur Urol2017; 71: 945. Google Scholar 6 : Use of indocyanine green during robot-assisted ureteral reconstructions. Eur Urol2015; 67: 291. Google Scholar 7 : Novel use of indocyanine green for intraoperative, real-time localization of ureteral stenosis during robot-assisted ureteroureterostomy. Urology2013; 82: 729. Google Scholar 8 : Near-infrared fluorescence imaging: emerging applications in robotic upper urinary tract surgery. Eur Urol2014; 65: 793. Google Scholar 9 : Buccal mucosal urethroplasty: is it the new gold standard?. BJU Int2004; 93: 1191. Google Scholar 10 : The morbidity of buccal mucosal graft harvest for urethroplasty and the effect of nonclosure of the graft harvest site on postoperative pain. J Urol2004; 172: 580. Link, Google Scholar 11 : The oral mucosa graft: a systematic review. J Urol2007; 178: 387. Link, Google Scholar 12 : Buccal mucosal grafts in the treatment of ureteric lesions. BJU Int1999; 83: 751. Google Scholar 13 : Treatment of long ureteric strictures with buccal mucosal grafts. BJU Int2010; 105: 1452. Google Scholar 14 : Buccal mucosal graft in reconstructive urology: uses beyond urethral stricture. Int J Urol2014; 21: 732. Google Scholar 15 : Robot-assisted ureteral reconstruction using buccal mucosa. Urology2015; 86: 634. Google Scholar 16 : Single surgeon experience with robot-assisted ureteroureterostomy for pathologies at the proximal, middle, and distal ureter in adults. J Endourol2013; 27: 994. Google Scholar 17 : The augmented anastomotic urethroplasty: indications and outcome in 29 patients. J Urol2001; 165: 1496. Link, Google Scholar 18 : The Clavien-Dindo classification of surgical complications: five-year experience. Ann Surg2009; 250: 187. Google Scholar 19 : Use of ileum as ureteral replacement in urological reconstruction. J Urol2009; 181: 177. Link, Google Scholar 20 : Initial series of four-arm robotic completely intracorporeal ileal ureter. J Endourol2016; 30: 395. Google Scholar 21 : Completely intracorporeal robotic renal autotransplantation. J Urol2014; 192: 1516. Link, Google Scholar 22 : Morbidity associated with oral mucosa harvest for urological reconstruction: an overview. J Oral Maxillofac Surg2008; 66: 739. Google Scholar 23 : The natural history of ureteric Bilharzia. Br J Urol1984; 56: 599. Google Scholar 24 : Hydronephrosis and urinary tract bilharziasis. A radiological and necropsy survey. Trans R Soc Trop Med Hyg1968; 62: 231. Google Scholar © 2017 by American Urological Association Education and Research, Inc.FiguresReferencesRelatedDetailsCited bySmith J (2017) This Month in Adult UrologyJournal of Urology, VOL. 198, NO. 6, (1179-1181), Online publication date: 1-Dec-2017. Volume 198Issue 6December 2017Page: 1430-1435 Advertisement Copyright & Permissions© 2017 by American Urological Association Education and Research, Inc.Keywordsrobotic surgical proceduresureterautograftsreconstructive surgical proceduresmouth mucosaMetricsAuthor Information Ziho Lee More articles by this author Benjamin T. Waldorf More articles by this author Eric Y. Cho More articles by this author Jeffrey C. Liu More articles by this author Michael J. Metro More articles by this author Daniel D. Eun More articles by this author Expand All Advertisement PDF downloadLoading ...

Many 3D in vitro models induce breast cancer spheroid formation; however, this alone does not recapitulate the complex in vivo phenotype. To effectively screen therapeutics, it is urgently needed to validate in vitro cancer spheroid models against the gold standard of xenografts. A new oxime-crosslinked hyaluronan (HA) hydrogel is designed, manipulating gelation rate and mechanical properties to grow breast cancer spheroids in 3D. This HA-oxime breast cancer model maintains the gene expression profile most similar to that of tumor xenografts based on a pan-cancer gene expression profile (comprising 730 genes) of three different human breast cancer subtypes compared to Matrigel or conventional 2D culture. Differences in gene expression between breast cancer cultures in HA-oxime versus Matrigel or 2D are confirmed for 12 canonical pathways by gene set variation analysis. Importantly, drug response is dependent on the culture method. Breast cancer cells respond better to the Rac inhibitor (EHT-1864) and the PI3K inhibitor (AZD6482) when cultured in HA-oxime versus Matrigel. This study demonstrates the superiority of an HA-based hydrogel as a platform for in vitro breast cancer culture of both primary, patient-derived cells and cell lines, and provides a hydrogel culture model that closely matches that in vivo.

Evaluation of distant metastasis (DM) is part of every new cancer evaluation. Understanding DM presentation patterns may impact the imaging workup of Head and Neck Squamous Cell Carcinoma (HNSCC). Examine the frequency and location of DM at presentation in HNSCC. We hypothesize that DM are rare, and the lung is the most common site for DM. Secondary evaluation includes identifying patient and tumor factors predictive of DM, and the implications for selection of workup imaging. Data from the National Cancer Data Base (NCDB) from 2010 to 2015 were analyzed. Subsites evaluated included oral cavity, oropharynx, larynx, hypopharynx, and nasopharynx. Sites of distant metastasis were evaluated in available cases and analyzed. Population based database study. 151,730 cases were available for analysis. Nasopharynx had the highest percentage of M1 disease (9.1%) followed by hypopharynx (7.3%). Excluding the nasopharynx (NP), 3.1% of cases were reported as M1. Advanced T-stage, positive N-stage, and N3 status were all predictors of M1 status on univariate and multivariate analysis for all subsites (P < 0.05). Where site of metastasis was available, most (53.1%) DM cases presented with at least lung involvement. In nasopharynx cancers, only 32.8% of DM included the lung. Distant metastasis in HNSCC are rare events. PET/CT offers many advantages, but for routine distant metastasis evaluation in HNSCC, CT scan of the chest may be more cost-effective.

Abstract Many detection methods have been used or reported for the diagnosis and/or surveillance of COVID-19. Among them, reverse transcription polymerase chain reaction (RT-PCR) is the most commonly used because of its high sensitivity, typically claiming detection of about 5 copies of viruses. However, it has been reported that only 47-59% of the positive cases were identified by some RT-PCR methods, probably due to low viral load, timing of sampling, degradation of virus RNA in the sampling process, or possible mutations spanning the primer binding sites. Therefore, alternative and highly sensitive methods are imperative. With the goal of improving sensitivity and accommodating various application settings, we developed a multiplex-PCR-based method comprised of 343 pairs of specific primers, and demonstrated its efficiency to detect SARS-CoV-2 at low copy numbers. The assay produced clean characteristic target peaks of defined sizes, which allowed for direct identification of positives by electrophoresis. We further amplified the entire SARS-CoV-2 genome from 8 to half a million viral copies purified from 13 COVID-19 positive specimens, and detected mutations through next generation sequencing. Finally, we developed a multiplex-PCR-based metagenomic method in parallel, that required modest sequencing depth for uncovering SARS-CoV-2 mutational diversity and potentially novel or emerging isolates.

To the Editor: The dermatology community remains concerned about the risk of COVID-19 in individuals with atopic dermatitis (AD). Using Symphony Health-derived data from the COVID-19 Research Database,1 we aimed to assess the risk of contracting COVID-19 in adults with AD while controlling for demographic factors and comorbidities known or speculated to be COVID-19 risk factors and assess the risk of contracting COVID-19 in adults with AD treated with dupilumab.

Fluorescence recovery after photobleaching was used to study the diffusion of two integral membrane proteins, bacteriorhodopsin and beta2-adrenergic receptor, in lipidic cubic phase (LCP). We found that the diffusion properties within the LCP matrix strongly depend on the protein construct and applied screening conditions. Common precipitants often induce restriction on diffusion of proteins in LCP and thereby impede their chances for crystallization. A high protein mobile fraction and a fast diffusion rate correlate very well with known crystallization conditions. Using this knowledge, one can now pre-screen precipitant conditions with microgram quantities of material to rule out conditions that are not conducive to diffusion, nucleation, and crystal growth. The results of this assay will narrow membrane protein crystallization space by identifying suitable protein constructs, stabilizing compounds and precipitant conditions amenable to in meso crystallization. Crystallization pre-screening will significantly increase the chances of obtaining initial crystal hits, expediting efforts in generating high-resolution structures of challenging membrane protein targets.

microRNAs (miRNAs) are a class of non-coding RNAs that function as endogenous triggers of the RNA interference pathway. Studies have shown that thousands of human protein-coding genes are regulated by miRNAs, indicating that miRNAs are master regulators of many important biological processes, such as cancer development. miRNAs frequently have deregulated expression in many types of human cancers, and play critical roles in tumorigenesis, which functions either as tumor suppressors or as oncogenes. Recent studies have shown that miRNAs are highly related with cancer progression, including initiating, growth, apoptosis, invasion, and metastasis. Furthermore, miRNAs are shown to be responsible for the cancer-related inflammation, anti-cancer drug resistance, and regulation of cancer stem cells. Therefore, miRNAs have generated great interest as a novel strategy in cancer diagnosis and therapy. Here we review the versatile roles of miRNAs in cancers and their potential applications for diagnosis, prognosis, and treatment as biomarkers.

Similar to actors changing costumes during a performance, cancer cells undergo many rapid changes during the process of tumor metastasis, including epithelial–mesenchymal transition (EMT), acquisition of cancer stem cells (CSCs) properties, and mesenchymal–epithelial transition (MET). Such changes allow the tumor to compete with the normal microenvironment to overcome anti-tumorigenic pressures. Then, once tissue homeostasis is lost, the altered microenvironment, like that accompanying inflammation, can itself become a potent tumor promoter. This review will discuss the changes that cancer cells undergo in converting from EMT to CSCs in an inflammation microenvironment, to understand the mechanisms behind invasion and metastasis and provide insights into prevention of metastasis.

Background In recent years, 2 popular implantable cardioverter-defibrillator (ICD) leads have undergone a class I recall by the Food and Drug Administration (FDA): the Sprint Fidelis and the Riata leads. Objective To examine the failure rates of these 2 leads with respect to their date of FDA recall. Methods All patients implanted with a Sprint Fidelis, Riata, or Sprint Quattro lead at our institution were included. Kaplan-Meier failure-free survival curves were constructed with and without censoring at the dates of announcement of the FDA recall for each lead. Results A total of 2270 patients (623 Sprint Fidelis, 627 Riata, and 1020 Sprint Quattro) were included. The failure-free survival of the Sprint Quattro lead was significantly better than that of the Riata lead (P <.0001), which in turn was better than that of the Sprint Fidelis lead (P = .0214). After censoring events at the time of the FDA recall for each lead, the failure-free survival of the Sprint Quattro lead continued to be superior to that of the Riata (P <.0001) and Sprint Fidelis (P = .0124) leads but the difference between the Riata and Sprint Fidelis leads was eliminated (P = .123). Conclusions In this study, a comparative analysis of the failure-free survival of 2 recalled leads demonstrates discrepancies in the timing of the recall despite comparable failure-free survival patterns leading to the recall. The causes of these discrepancies are unclear and raise questions regarding the consistency of postmarketing surveillance and manufacturers' reporting of malfunctions of medical devices. In recent years, 2 popular implantable cardioverter-defibrillator (ICD) leads have undergone a class I recall by the Food and Drug Administration (FDA): the Sprint Fidelis and the Riata leads. To examine the failure rates of these 2 leads with respect to their date of FDA recall. All patients implanted with a Sprint Fidelis, Riata, or Sprint Quattro lead at our institution were included. Kaplan-Meier failure-free survival curves were constructed with and without censoring at the dates of announcement of the FDA recall for each lead. A total of 2270 patients (623 Sprint Fidelis, 627 Riata, and 1020 Sprint Quattro) were included. The failure-free survival of the Sprint Quattro lead was significantly better than that of the Riata lead (P <.0001), which in turn was better than that of the Sprint Fidelis lead (P = .0214). After censoring events at the time of the FDA recall for each lead, the failure-free survival of the Sprint Quattro lead continued to be superior to that of the Riata (P <.0001) and Sprint Fidelis (P = .0124) leads but the difference between the Riata and Sprint Fidelis leads was eliminated (P = .123). In this study, a comparative analysis of the failure-free survival of 2 recalled leads demonstrates discrepancies in the timing of the recall despite comparable failure-free survival patterns leading to the recall. The causes of these discrepancies are unclear and raise questions regarding the consistency of postmarketing surveillance and manufacturers' reporting of malfunctions of medical devices.

International Journal of CancerVolume 140, Issue 3 p. 504-512 Cancer EpidemiologyFree Access The national landscape of human papillomavirus-associated oropharynx squamous cell carcinoma Erik Liederbach, Erik Liederbach Division of Otolaryngology-Head and Neck Surgery, Department of Surgery, NorthShore University HealthSystem, Evanston, ILSearch for more papers by this authorAlexandra Kyrillos, Alexandra Kyrillos Division of Otolaryngology-Head and Neck Surgery, Department of Surgery, NorthShore University HealthSystem, Evanston, ILSearch for more papers by this authorChi-Hsiung Wang, Chi-Hsiung Wang Center for Biomedical Research Informatics, NorthShore University HealthSystem, Evanston, ILSearch for more papers by this authorJeffrey C. Liu, Jeffrey C. Liu Department of Otolaryngology, Temple University School of Medicine, Philadelphia, PASearch for more papers by this authorErich M. Sturgis, Erich M. Sturgis Department of Head and Neck Surgery, University of Texas MD Anderson Cancer Center, Houston, TXSearch for more papers by this authorMihir K. Bhayani, Corresponding Author Mihir K. Bhayani [email protected] Division of Otolaryngology-Head and Neck Surgery, Department of Surgery, NorthShore University HealthSystem, Evanston, IL Pritzker School of Medicine, University of Chicago, Chicago, ILCorrespondence to: Mihir K. Bhayani, MD, Kellogg Cancer Center, NorthShore University HealthSystem, 2650 Ridge Ave, Evanston, IL 60201, USA, Tel.: 847-504-3300, Fax: 847-504-3305, E-mail: [email protected]Search for more papers by this author Erik Liederbach, Erik Liederbach Division of Otolaryngology-Head and Neck Surgery, Department of Surgery, NorthShore University HealthSystem, Evanston, ILSearch for more papers by this authorAlexandra Kyrillos, Alexandra Kyrillos Division of Otolaryngology-Head and Neck Surgery, Department of Surgery, NorthShore University HealthSystem, Evanston, ILSearch for more papers by this authorChi-Hsiung Wang, Chi-Hsiung Wang Center for Biomedical Research Informatics, NorthShore University HealthSystem, Evanston, ILSearch for more papers by this authorJeffrey C. Liu, Jeffrey C. Liu Department of Otolaryngology, Temple University School of Medicine, Philadelphia, PASearch for more papers by this authorErich M. Sturgis, Erich M. Sturgis Department of Head and Neck Surgery, University of Texas MD Anderson Cancer Center, Houston, TXSearch for more papers by this authorMihir K. Bhayani, Corresponding Author Mihir K. Bhayani [email protected] Division of Otolaryngology-Head and Neck Surgery, Department of Surgery, NorthShore University HealthSystem, Evanston, IL Pritzker School of Medicine, University of Chicago, Chicago, ILCorrespondence to: Mihir K. Bhayani, MD, Kellogg Cancer Center, NorthShore University HealthSystem, 2650 Ridge Ave, Evanston, IL 60201, USA, Tel.: 847-504-3300, Fax: 847-504-3305, E-mail: [email protected]Search for more papers by this author First published: 26 September 2016 https://doi.org/10.1002/ijc.30442Citations: 42 Financial Support: None. AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Abstract The head and neck squamous cell carcinoma (HNC) landscape is evolving with human papillomavirus (HPV) being a rising cause of oropharynx carcinoma (OPC). This study seeks to investigate a national database for HPV-associated oropharynx carcinoma (HPV-OPC). Using the National Cancer Data Base, we analyzed 22,693 patients with HPV-OPC and known HPV status. Chi-square tests and logistic regression models were utilized to examine differences between HPV positive and HPV negative OPC. 14,805 (65.2%) patients were HPV positive. Mean age at presentation was 58.4 years with HPV-HNC patients being 2.8 years younger compared to the HPV-negative cohort (58.4 vs. 61.2 years, p < 0.001). 67.6% of white patients were HPV-positive compared to 42.3% of African American patients and 57.1% of Hispanics (p < 0.001). When combining race and socioeconomic status (SES), we found African American patients in high SES groups had HPV-OPC prevalence that was significantly higher than African American patients in low SES groups (56.9% vs. 36.3%, p < 0.001). Geographic distribution of HPV-OPC was also analyzed and found to be most prevalent in Western states and least prevalent in the Southern states (p < 0.001). The distribution of HPV-OPC is variable across the country and among racial and socioeconomic groups. A broad understanding of these differences in HPV-OPC should drive educational programs and improve clinical trials that benefit both prevention and current treatments. Abstract What's new? The incidence of human papillomavirus (HPV)-related cancers of the head and neck is growing in the United States, for reasons that remain unknown. Moreover, according to the present analysis of data on oropharynx carcinoma (OPC) captured in the National Cancer Data Base, HPV prevalence is highest among white OPC patients, compared with African Americans and Hispanics, and is increased among patients of high socioeconomic status. Relative to other regions of the country, southern states carry a lower burden of HPV-related OPC. Causes behind these variations are lacking, necessitating further investigation of predisposing factors to HPV-related OPC. Despite an overall decrease in incidence of head and neck cancer in the United States, there is an increasing presence of human papillomavirus (HPV)-related head and neck squamous cell carcinoma, specifically oropharynx squamous cell carcinoma (OPC).1-3 Fortunately, patients with HPV-OPC overall have been found to be treatment sensitive with overall survival figures 25–33% greater in HPV-OPC compared to HPV-negative OPC.4, 5 However, this survival benefit is not seen in all populations with OPC. Other studies have demonstrated a survival disparity in OPC for African Americans compared to Whites and Hispanics.6-8 In contrast, these studies found non-significant survival difference in non-OPC primary head and neck cancers between African Americans and Whites. Together, these findings and the survival benefit seen in Whites with regards to OPC has been largely attributed to the lower proportion of HPV positivity among African Americans despite a lack of data showing a significant racial difference in oral HPV infection.9, 10 Another consideration in HPV distribution is the geographic variation identified in cervical HPV infection and such differences have been attributable to differences in sexual behavior.11 Geographic variations in HPV prevalence among patients with incident OPC has been identified in Europe but has not been reported within the United States.12 This theory has also been inferred based on single-institution trials with varying prevalence rates.5, 7, 13, 14 Given the paucity of population-based information on HPV-OPC, we sought to investigate a national database to evaluate demographic patterns in patients with OPC in the United States, with a particular focus on HPV prevalence. The information from this study can be used to better target populations where HPV-OPC is endemic and guide further investigation into this unique disease. Methods Data source The National Cancer Data Base (NCDB), a joint project of the American Cancer Society and the Commission on Cancer (CoC), is a nationwide, facility-based oncology data set that currently captures 70% of all newly diagnosed cancers in the United States annually reported from approximately 1,500 hospitals with CoC-accredited cancer programs.15 Data reported from these hospital-based cancer registries include patient demographics, American Joint Committee on Cancer staging, tumor histopathology, and use of surgical treatment, radiation and chemotherapy. Data on HPV status became available in 2010. Data are coded and reported according to nationally established protocols coordinated by the North American Association of Central Cancer Registries.15, 16 All data within the NCDB is compliant with the privacy requirements of the Health Insurance Portability and Accountability Act. Institutional review board approval was not required for this study because no patient, provider, or hospital identifiers were examined, no protected health information was reviewed and the analysis is retrospective. Study population Using the NCDB, adult patients diagnosed between 2010 and 2013 with squamous cell carcinoma of the oropharynx were selected. The study was limited to patients with primary site codes for the tongue base, tonsil and oropharynx (non tonsil or tongue base). A total of 46,087 patients met these criteria. We excluded 25,113 (52.5%) of these patients due to unknown HPV status, and the study population used for analysis was 22,693 patients. Variables studied Variables analyzed in this study can be separated into three categories; facility, patient and tumor characteristics. Facility factors included facility type and location. We analyzed facility type as community, comprehensive community, academic/research and integrated network. These designations are based on the range of services offered, number of new cases seen annually and participation in clinical research and resident training.17 Facility location was based on the reported state of residence and categorized according to the United States Census.18 Patient age was analyzed as a categorical variable. Race was classified into categories similar to the US Census (Non-Hispanic White, African American, Hispanic, Asian/Pacific Islander and other). Insurance status was stratified as follows: uninsured, private, Medicaid, Medicare and other. Community education status was designated by the proportion of zip-code residents without a high school diploma, and income was area-based, with measurements calculated from data based on the patient's zip code. Using the area-based indicators of income and education, a socioeconomic (SES) variable was created to describe patients living in low, middle and high SES areas as previously described.19 Patients living in the lowest quartile income and education areas were classified as low SES, and patients living in the highest quartile income and education areas were classified as high SES. All other patients were classified as middle SES. Tumor stage was categorized according to the AJCC 7th edition guidelines using analytic stage.20 HPV data was recorded from the results of HPV testing performed on pathologic specimens from the primary tumor or a metastatic site, including lymph nodes. Specific testing method for HPV is not available in the NCDB. HPV results from blood tests or serology were not recorded. Patients were dichotomized based on their HPV status into negative or positive.21 Also, patients were categorized based on their tumor location. Tumors originating in the oropharynx, base of tongue, or tonsil were grouped as OPC, and tumors originating in the oral tongue, oral cavity, nasopharynx, hypopharynx, larynx and supraglottis were categorized as non-OPC. Statistical analysis All analyses were performed by SPSS statistical software (SPSS for Windows, version 22: Chicago, IL). All statistical tests were two-sided, and a p-value of ≤0.05 was considered statistically significant. χ2 tests were used to examine trends in the incidence of HPV positive cancer as well as to calculate rates of HPV incidence among facility, patient and tumor factors. Multivariable logistic regression models were created to examine independent factors associated HPV positivity. Patients with unknown income or education level were omitted from the multivariable analysis, as well as patients with unknown grade and analytic stage information, clinical Tis patients, patients with unknown clinical T and N classifications and patients with unknown facility location. An odds ratio >1 signified that a patient was more likely to have an HPV positive cancer. Results The study included 22,693 patients with OPC and HPV status available for analysis. Of these patients, 65.2% were HPV positive and 34.8% were HPV negative. Demographics of OPC patients stratified by HPV status The median age was 59 years old and most patients were male (81.8%) and white (87.9%). Most patients (49.3%) were treated at Academic/Research hospitals, and had private (53.9%) or Medicare (29.4%) insurance. Patients presenting with HPV positive disease were more often below the median age (<59) compared to HPV negative patients (56.7% vs. 46.2%, p < 0.001). A higher proportion of white patients (67.6%) and male patients (67.9%) were HPV positive (Table 1). Moreover, a higher proportion of high SES patients were HPV positive (69.7%, p < 0.001). Table 1. Patient demographics of the OPC cohort stratified by HPV status Characteristic HPV negativea HPV positivea All patients with known HPV status Patients excluded due to unknown HPV status 7,888 (34.8%) 14,805 (65.2%) 22,693 (47.5%) 25,113 (52.5%) Age (mean ± std) 61.2 ± 10.6 58.4 ± 9.5 59.4 ± 10.0 61.5 ± 10.6 Age groups <50 966 (28.1%) 2,466 (71.9%) 3,432 (54.2%) 2,899 (45.8%) 50–69 5,235 (33.0%) 10,611 (67.0%) 15,846 (48.6%) 16,740 (51.4%) ≥70 1,687 (49.4%) 1,728 (50.6%) 3,415 (38.4%) 5,474 (61.6%) Sex Male 5,955 (32.1%) 12,600 (67.9%) 18,555 (48.4%) 19,800 (51.6%) Female 1,933 (46.7%) 2,205 (53.3%) 4,138 (43.8%) 5,313 (56.2%) Facility type Community 679 (37.6%) 1,127 (62.4%) 1,806 (38.6%) 2,871 (61.4%) Comprehensive 2,863 (36.9%) 4,901 (63.1%) 7,764 (41.9%) 10,780 (58.1%) Academic 3,749 (33.5%) 7,443 (66.5%) 11,192 (53.8%) 9,616 (46.2%) Integrated network 480 (31.1%) 1,062 (68.9%) 1,542 (49.3%) 1,586 (50.7%) Other 117 (30.1%) 272 (69.9%) 389 (59.9%) 260 (40.1%) Facility location New England 463 (33.2%) 933 (66.8%) 1,396 (54.5%) 1,164 (45.5%) Mid-Atlantic 1,215 (34.0%) 2,356 (66.0%) 3,571 (54.6%) 2,964 (45.4%) South Atlantic 1,995 (37.2%) 3,368 (62.8%) 5,363 (49.0%) 5,571 (51.0%) East North Central 1,256 (34.6%) 2,374 (65.4%) 3,630 (43.8%) 4,650 (56.2%) East South Central 631 (40.5%) 926 (59.5%) 1,557 (42.6%) 2,095 (57.4%) West North Central 543 (28.1%) 1,388 (71.9%) 1,931 (53.5%) 1,675 (46.5%) West South Central 514 (41.9%) 713 (58.1%) 1,227 (29.2%) 2,979 (70.8%) Mountain 402 (33.3%) 805 (66.7%) 1,207 (55.6%) 965 (44.4%) Pacific 752 (31.0%) 1,670 (69.0%) 2,422 (46.5%) 2,790 (53.5%) Other 117 (30.1%) 272 (69.9%) 389 (59.9%) 260 (40.1%) Race White 6,467 (32.4%) 13,479 (67.6%) 19,946 (48.8%) 20,942 (51.2%) Black 928 (57.7%) 680 (42.3%) 1,608 (38.3%) 2,595 (61.7%) Hispanic 341 (42.9%) 453 (57.1%) 794 (41.7%) 1,111 (58.3%) API 107 (47.1%) 120 (52.9%) 227 (44.0%) 289 (56.0%) Other 45 (38.1%) 73 (61.9%) 118 (40.1%) 176 (59.9%) Insurance Private 3,220 (26.3%) 9,006 (73.7%) 12,226 (55.8%) 9,666 (44.2%) Medicaid 910 (49.8%) 916 (50.2%) 1,826 (39.7%) 2,776 (60.3%) Medicare 2,951 (44.3%) 3,717 (55.7%) 6,668 (42.5%) 9,025 (57.5%) Other 150 (31.8%) 322 (68.2%) 472 (38.9%) 740 (61.1%) No Insurance 507 (43.7%) 654 (56.3%) 1,161 (40.3%) 1,719 (59.7%) Unknown 150 (44.1%) 190 (55.9%) 340 (22.3%) 1,187 (77.7%) Income <$38,000 1,594 (45.3%) 1,925 (54.7%) 3,519 (40.2%) 5,232 (59.8%) $38,000–47,999 1,757 (35.7%) 3,164 (64.3%) 4,921 (44.0%) 6,256 (56.0%) $48,000–62,999 2,111 (34.2%) 4,066 (65.8%) 6,177 (48.5%) 6,549 (51.5%) $63,000+ 2,379 (29.8%) 5,593 (70.2%) 7,972 (53.8%) 6,859 (46.2%) Unknown 47 (45.2%) 57 (54.8%) 104 (32.4%) 217 (67.6%) Education (% without high school degree) ≥21% 1,423 (45.8%) 1,686 (54.2%) 3,109 (39.0%) 4,873 (61.0%) 13.0–20.9% 2,121 (38.1%) 3,453 (61.9%) 5,574 (44.1%) 7,063 (55.9%) 7.0–12.9% 2,509 (32.9%) 5,127 (67.1%) 7,636 (49.5%) 7,790 (50.5%) <7.0% 1,792 (28.5%) 4,491 (71.5%) 6,283 (54.8%) 5,184 (45.2%) Unknown 43 (47.3%) 48 (52.7%) 91 (31.0%) 203 (69.0%) SES Low SES 2,566 (42.0%) 3,545 (58.0%) 6,111 (40.8%) 8,850 (59.2%) Mid SES 1,808 (36.2%) 3,192 (63.8%) 5,000 (45.7%) 5,935 (54.3%) High SES 3,514 (30.3%) 8,068 (69.7%) 11,582 (52.9%) 10,328 (47.1%) API: Asian Pacific Islander; SES: Socioeconomic status. a χ2 comparing HPV negative and HPV positive patients is p < 0.001 for all characteristics. Comparison of pathological features The locations with the highest rates of HPV positivity were the tonsil (71.7%) and tongue base (65.2%, Table 2). Approximately 64% of the cohort was presented with stage IV disease, but a higher proportion of stage IV patients were HPV positive (68.9%, p < 0.001). T4 patients were more likely to be HPV negative (51.5%) in comparison to lower T classifications. Of clinically node positive patients, 69.8% were HPV positive. In contrast, 47.3% of clinically node negative patients were HPV positive (p < 0.001). A higher proportion of patients with distant metastases had HPV negative disease in comparison to patients without metastasis (54.2% vs. 34.2%, p < 0.001). Table 2. Pathological features of the OPC cohort stratified by HPV statusa Characteristic HPV negative HPV positive All patients with known HPV status Patients excluded due to unknown HPV status 7,888 (34.8%) 14,805 (65.2%) 22,693 (47.5%) 25,113 (52.5%) Stage Stage 0 28 (49.1%) 29 (50.9%) 57 (37.0%) 97 (63.0%) Stage 1 732 (57.4%) 544 (42.6%) 1,276 (39.0%) 1,996 (61.0%) Stage 2 797 (45.0%) 976 (55.0%) 1,773 (44.8%) 2,184 (55.2%) Stage 3 1,454 (35.5%) 2,639 (64.5%) 4,093 (47.9%) 4,448 (52.1%) Stage 4 4,566 (31.1%) 10,130 (68.9%) 14,696 (50.0%) 14,707 (50.0%) Unknown 311 (39.0%) 487 (61.0%) 798 (32.2%) 1,681 (67.8%) Clinical T-classification T1 1,655 (29.6%) 3,945 (70.4%) 5,600 (52.3%) 5,099 (47.7%) T2 2,534 (31.4%) 5,530 (68.6%) 8,064 (50.2%) 7,998 (49.8%) T3 1,486 (41.4%) 2,105 (58.6%) 3,591 (45.6%) 4,292 (54.4%) T4 1,391 (48.5%) 1,476 (51.5%) 2,867 (40.4%) 4,229 (59.6%) Unknown 822 (32.0%) 1,749 (68.0%) 2,571 (42.4%) 3,495 (57.6%) Clinical N-classification N0 2,196 (52.7%) 1,974 (47.3%) 4,170 (41.1%) 5,969 (58.9%) N1 1,310 (33.2%) 2,636 (66.8%) 3,946 (48.9%) 4,118 (51.1%) N2 3,648 (28.8%) 9,014 (71.2%) 12,662 (51.6%) 11,888 (48.4%) N3 329 (37.3%) 552 (62.7%) 881 (40.5%) 1,296 (59.5%) Unknown 405 (39.2%) 629 (60.8%) 1,034 (36.0%) 1,842 (64.0%) Distant metastases No 7,526 (34.2%) 14,481 (65.8%) 22,007 (48.4%) 23,429 (51.6%) Yes 293 (54.2%) 248 (45.8%) 541 (33.8%) 1,060 (66.2%) Unknown 69 (47.6%) 76 (52.4%) 145 (18.9%) 624 (81.1%) Tumor grade Grade 1 470 (57.7%) 345 (42.3%) 815 (37.6%) 1,353 (62.4%) Grade 2 3,276 (42.2%) 4,485 (57.8%) 7,761 (47.2%) 8,699 (52.8%) Grade 3 2,411 (28.3%) 6,102 (71.7%) 8,513 (52.9%) 7,590 (47.1%) Grade Unknown 1,731 (30.9%) 3,873 (69.1%) 5,604 (42.9%) 7,471 (57.1%) Primary site location Tongue Base 2,994 (34.8%) 5,598 (65.2%) 8,592 (46.0%) 10,095 (54.0%) Oropharynx, other 1,692 (60.4%) 1,111 (39.6%) 2,803 (36.0%) 4,973 (64.0%) Tonsil 3,202 (28.3%) 8,096 (71.7%) 11,298 (52.9%) 10,045 (47.1%) Lymphatic vascular invasion No 2,570 (34.9%) 4,787 (65.1%) 7,357 (54.2%) 6,215 (45.8%) Yes 613 (30.2%) 1,419 (69.8%) 2,032 (58.5%) 1,439 (41.5%) Unknown 4,705 (35.4%) 8,599 (64.6%) 13,304 (43.2%) 17,459 (56.8%) a χ2 comparing HPV negative and HPV positive patients is p < 0.001 for all characteristics. Prevalence of HPV-OPC The prevalence of HPV-OPC varied across the US census regions (Fig. 1). The regions with highest proportion of patients with HPV-OPC were the West North Central (71.9%) and Pacific (69.0%, p < 0.001) regions. In comparison, regions located in the South had lower rates of HPV-OPC and included the West South Central (58.1%) and East South Central (59.5%) regions (p < 0.001). Figure 1Open in figure viewerPowerPoint Regional variation of HPV positive cancer in OPC, p < 0.001. We stratified HPV status by combining race and SES for OPC patients in Figure 2. A consistent trend was noted that demonstrated higher rates of HPV positive disease in high SES groups. White patients with high SES had the highest rate of HPV positive disease (70.3%, p < 0.001) compared to other racial-socioeconomic groups. Of note, African American patients with low SES had drastically lower rates of HPV positive disease compared to other African American patients with high SES (36.3% vs. 56.9%, p < 0.001). Figure 2Open in figure viewerPowerPoint HPV positive incidence stratified by racial-socioeconomic groups for OPC patients, *indicates χ2 p < 0.001. Multivariable logistic regression A multivariable logistic regression was performed to identify independent predictors of HPV-OPC (Table 3). Patients ≥59 years old were approximately 14% less likely to be HPV positive (OR = 0.86, 95% CI: 0.79–0.94) and female patients were each approximately 42% less likely to be HPV positive (OR = 0.58, 95% CI: 0.53–0.64). In concordance with the regional variation analysis (Fig. 2), patients in the West North Central region were 41% more likely to be HPV positive (OR = 1.41, 95% CI: 1.15–1.73) compared to those in the West South Central region. Additionally, white patients, those with private insurance, and patients living in high SES areas were more likely to be HPV positive. Table 3. Multivariable logistic regression of independent predictors for HPV positive status for OPC patientsa Characteristic Odds ratio (95% CI) p-value Age <59 Ref (1) >=59 0.86 (0.79–0.94) 0.001 Sex Male Ref (1) Female 0.58 (0.53–0.64) <0.001 Facility type Academic Ref (1) Community 0 87 (0.76–1.00) 0.054 Comprehensive 0.85 (0.78–0.92) <0.001 Integrated network 1.10 (0.93–1.28) 0.268 Facility location West South Central Ref (1) New England 1.30 (1.05–1.61) 0.017 Mid-Atlantic 1.32 (1.10–1.60) 0.003 South Atlantic 1.20 (1.01–1.43) 0.040 East North Central 1.26 (1.05–1.51) 0.014 East South Central 1.09 (0.89–1.34) 0.400 West North Central 1.41 (1.15–1.73) 0.001 Mountain 1.13 (0.91–1.42) 0.270 Pacific 1.58 (1.30–1.92) <0.001 Race White Ref (1) Black 0.50 (0.44–0.59) <0.001 Hispanic 0.66 (0.54–0.80) <0.001 API 0.64 (0.44–0.93) 0.020 Other 0.73 (0.44–1.19) 0.205 Insurance Private Ref (1) Medicaid 0.51 (0.44–0.58) <0.001 Medicare 0.63 (0.57–0.69) <0.001 Other Insurance 0.75 (0.58–0.98) 0.032 No Insurance 0.62 (0.52–0.73) <0.001 Unknown Insurance 0.50 (0.37–0.68) <0.001 Income <$38,000 Ref (1) $38,000–47,999 1.23 (1.08–1.40) 0.002 $48,000–62,999 1.08 (0.95–1.24) 0.242 $63,000+ 1.01 (0.87–1.18) 0.897 Education (% without high school degree) >=21% Ref (1) 13.0–20.9% 1.13 (1.00–1.29) 0.060 7.0–12.9% 1.23 (1.07–1.41) 0.005 <7.0% 1.55 (1.31–1.82) <0.001 SESb Low Ref (1) Medium 1.07 (0.96–1.19) 0.251 High 1.18 (1.08–1.30) <0.001 Analytic stage 0 Ref (1) I 0.83 (0.31–2.18) 0.698 II 1.42 (0.54–3.75) 0.477 III 1.52 (0.58–3.99) 0.390 IV 1.86 (0.71–4.86) 0.204 Clinical T-classification T4 Ref (1) T1 2.25 (1.97–2.57) <0.001 T2 1.88 (1.67–2.12) <0.001 T3 1.27 (1.11–1.45) <0.001 Clinical node status Node Negative Ref (1) Node Positive 1.60 (1.41–1.81) <0.001 Grade Grade 1 Ref (1) <0.001 Grade 2 1.47 (1.24–1.75) <0.001 Grade 3 2.37 (1.99–2.82) <0.001 Cancer primary site Oropharynx Ref (1) Tongue Base 2.35 (2.08–2.65) <0.001 Tonsil 3.24 (2.87–3.64) <0.001 a The multivariable model controls all variables listed in table except for SES. b The odds ratio estimate of SES does not adjust for income and education level. Tumor parameters were also associated with HPV positive disease. The analysis demonstrated that T1 (OR = 2.25, 95% CI: 1.97–2.57) and T2 (OR = 1.88, 95% CI: 1.67–2.12) were more likely to be HPV positive in comparison to T4 tumors. Patients that were clinically node positive (OR = 1.60, 95% CI: 1.41–1.81) or presented with grade 3 tumors (OR = 2.37, 95% CI: 1.99–2.82) were more likely to be HPV positive. Tonsil cancers were over three times more likely to be HPV positive (OR = 3.24, 95% CI: 2.87–3.64) compared to oropharynx tumors. Discussion The emergence of HPV as a significant contributor to the development of OPC has generated significant interest into patient populations exposed to the virus and subsequent development of OPC. Evaluation of HPV-OPC at the population level provides insight into distribution of this disease to allow for increased awareness and drive treatment toward these areas and populations. HPV status in head and neck cancers is a new variable within the NCDB, added in 2010, and this study identifies contemporary racial, socioeconomic and geographic differences in HPV-OPC. The tonsil and tongue base were the most common HPV-positive tumor locations (HPV positivity in 71.7% and 65.2% of patients at each subsite, respectively), consistent with other studies.22, 23 In addition, we highlight pathologic features in HPV-positive vs. HPV-negative OPC. OPC was found to have a significantly higher HPV prevalence in OPC in white patients. African American and Hispanic patients were 50% and 34% less likely, respectively, to have HPV positive OPC. Oral sexual contact and open-mouth kissing are significant risk factors for oral HPV infection leading to HPV-OPC,24-26 which may explain the racial differences we found in our analysis as well as in other studies.13, 14 However, Zandberg et al. has demonstrated in a single institution study that HPV-OPC in African Americans significantly increased over a 25-year period by 18% and this finding was confirmed in an earlier analysis, albeit not significant.2, 13 Recent evaluations of National Health and Nutrition Examination Survey (NHANES) have shown that while oral sexual practices are more common in Whites compared to African Americans and Hispanics, the differences between the groups in relation to oral sexual practices and oral HPV16 infection are not significant.10, 27 There is no clear explanation for the different HPV-OPC rates between races. Differences in sexual practices between African American and Whites may be the major driver, but the reasons unclear. Separate unknown factors, such as, genetic susceptibility to HPV and/or racially disparate environmental exposure are other potential possibilities that require further investigation. We examined socioeconomic status (SES) status and HPV-OPC incidence. Our analysis found that high SES groups were 18% more likely to have HPV-OPC, which is consistent with other studies.28-30 Evaluation of income and education levels on an individual basis revealed that patients with higher education level are more likely to have HPV-OPC. Income level did not have a significant effect on HPV-OPC. Dahlstrom et al.29 also noted these findings in her report from a single institution that higher education level, and not income, was predictive of having HPV-OPC. Based on the difference in demographic distribution of HPV-OPC, we hypothesized that SES influenced the racial disparity in HPV-OPC. We divided our racial groups into high and low SES groups and demonstrated an increasing incidence in HPV-OPC in racial groups within higher SES groups. Most striking was the alteration in the rate of HPV-OPC in African American patients who were high SES versus low SES. Socioeconomic differences have been previously seen in sexually transmitted infections (STI) with lower income status, but these studies do not distinguish oral from genital STI.31, 32 Sexual education disparities have been shown as one possible explanation in lower genital-genital transmission of STIs in higher SES groups,33 but only recently has there been data reporting perceptions of oral STIs.34 Future investigation into education on the transmission of oral STI and its association with oral sexual practices among racial and SES groups is needed to better understand this relationship. Variations in HPV prevalence among patients with OPC were also tied to geographic distribution in patients with the HPV-HNC. Southern states had a lower rate of HPV-OPC than the rest of the United States. States within West South Central and East South Central regions had at least 5% less incidence of HPV-OPC than northern regions. In addition, the regional variation remains constant when correcting for racial distribution within a region. While these findings may suggest geographic differences of sexual practices resulting in differential HPV-OPC rates, other causes are possible. Previous reports have identified geographic variation in HPV-related cervical infections between two regions in Mexico, which the authors concluded was a result of difference in sexual practice between the regions.11 Moreover, worldwide trends in OPC are increasing in developed countries, likely a result of changes in sexual behaviors.35 In a study from Greece, HPV subtypes in cervical tissue samples were found to have variability among the regions with high-risk subtypes present in Central Greece compared to Crete, but overall HPV-status was not different between the regions, pointing to a possible immunologic/genetic component to the geographic distribution.36 Therefore, endemic HPV strains may also play a role in explaining the differences in HPV prevalence in patients with OPC between the different regions in the US. This information may also play a role in increasing patient recruitment for HPV-specific treatment trials. Limitations of this analysis are inherent to any retrosp

We report a case of acute macular neuroretinopathy (AMN) following routine annual inactivated influenza vaccination. Projection-resolved optical coherence tomography angiography (PR-OCTA) was used to analyze the retinal capillary flow within the AMN lesion.Our patient reported visual symptoms of her right eye nine days after routine annual influenza vaccination. Multimodal imaging revealed small vessel peripheral vasculitis and AMN in the affected eye. Infectious, immunologic, and hypercoagulable etiologies were investigated and excluded. PR-OCTA B-scans within the AMN lesion demonstrated reduced flow in the deep capillary plexus (DCP) at baseline with relatively improved flow signal in the DCP on follow up, 3 weeks later.We report a new association of AMN following routine inactivated influenza immunization. Recent influenza vaccination should be included in the differential diagnosis for patients presenting with AMN. PR-OCTA demonstrated compromised DCP flow in the AMN lesion which has not been previously described.

Tissue plasminogen activator (tPA) thrombolysis remains the gold standard treatment for ischemic stroke. A time-constrained therapeutic window, with the drug to be given within 4.5 h after stroke onset, and lethal side effects associated with delayed treatment, most notably hemorrhagic transformation (HT), limit the clinical use of tPA. Co-administering tPA with other agents, including drug or non-drug interventions, has been proposed as a practical strategy to address the limitations of tPA. Here, we discuss the pharmacological and non-drug approaches that were examined to mitigate the complications-especially HT-associated with delayed tPA treatment. The pharmacological treatments include those that preserve the blood-brain barrier (e.g., atovarstatin, batimastat, candesartan, cilostazol, fasudil, minocycline, etc.), enhance vascularization and protect the cerebrovasculature (e.g., coumarin derivate IMM-H004 and granulocyte-colony stimulating factor (G-CSF)), and exert their effects through other modes of action (e.g., oxygen transporters, ascorbic acid, etc.). The non-drug approaches include stem cell treatments and gas therapy with multi-pronged biological effects. Co-administering tPA with the abovementioned therapies showed promise in attenuating delayed tPA-induced side effects and stroke-induced neurological and behavioral deficits. Thus, adjunctive treatment approach is an innovative therapeutic modality that can address the limitations of tPA treatment and potentially expand the time window for ischemic stroke therapy.

Abstract Schwannomatosis (SWNTS) is a genetic cancer predisposition syndrome that manifests as multiple and often painful neuronal tumors called schwannomas (SWNs). While germline mutations in SMARCB1 or LZTR1, plus somatic mutations in NF2 and loss of heterozygosity in chromosome 22q have been identified in a subset of patients, little is known about the epigenomic and genomic alterations that drive SWNTS-related SWNs (SWNTS-SWNs) in a majority of the cases. We performed multiplatform genomic analysis and established the molecular signature of SWNTS-SWNs. We show that SWNTS-SWNs harbor distinct genomic features relative to the histologically identical non-syndromic sporadic SWNs (NS-SWNS). We demonstrate the existence of four distinct DNA methylation subgroups of SWNTS-SWNs that are associated with specific transcriptional programs and tumor location. We show several novel recurrent non-22q deletions and structural rearrangements. We detected the SH3PXD2A-HTRA1 gene fusion in SWNTS-SWNs, with predominance in LZTR1 -mutant tumors. In addition, we identified specific genetic, epigenetic, and actionable transcriptional programs associated with painful SWNTS-SWNs including PIGF, VEGF, MEK, and MTOR pathways, which may be harnessed for management of this syndrome.

<h3>Importance</h3> There is epidemiologic evidence that the increasing incidence of thyroid cancer is associated with subclinical disease detection. Evidence for a true increase in thyroid cancer incidence has also been identified. However, a true increase in disease would likely be heralded by an increased incidence of thyroid-referable symptoms in patients presenting with disease. <h3>Objectives</h3> To evaluate whether modes of detection (MODs) used to identify thyroid nodules for surgical removal have changed compared with historic data and to determine if MODs vary by geographic location. <h3>Design, Setting, and Participants</h3> This was a retrospective analysis of pathology and medical records of 1328 patients who underwent thyroid-directed surgery in 16 centers in 4 countries: 4 centers in Canada, 1 in Denmark, 1 in South Africa, and 12 in the US. The participants were the first 100 patients (or the largest number available) at each center who had thyroid surgery in 2019. The MOD of the thyroid finding that required surgery was classified using an updated version of a previously validated tool as endocrine condition, symptomatic thyroid, surveillance, or without thyroid-referable symptoms (asymptomatic). If asymptomatic, the MOD was further classified as clinician screening examination, patient-requested screening, radiologic serendipity, or diagnostic cascade. <h3>Main Outcomes and Measures</h3> The MOD of thyroid nodules that were surgically removed, by geographic variation; and the proportion and size of thyroid cancers discovered in patients without thyroid-referable symptoms compared with symptomatic detection. Data analyses were performed from April 2021 to February 2022. <h3>Results</h3> Of the 1328 patients (mean [SD] age, 52 [15] years; 993 [75%] women; race/ethnicity data were not collected) who underwent thyroid surgery that met inclusion criteria, 34% (448) of the surgeries were for patients with thyroid-related symptoms, 41% (542) for thyroid findings discovered without thyroid-referable symptoms, 14% (184) for endocrine conditions, and 12% (154) for nodules with original MOD unknown (under surveillance). Cancer was detected in 613 (46%) patients; of these, 30% (183 patients) were symptomatic and 51% (310 patients) had no thyroid-referable symptoms. The mean (SD) size of the cancers identified in the symptomatic group was 3.2 (2.1) cm (median [range] cm, 2.6 [0.2-10.5]; 95% CI, 2.91-3.52) and in the asymptomatic group, 2.1 (1.4) cm (median [range] cm, 1.7 [0.05-8.8]; 95% CI, 1.92-2.23). The MOD patterns were significantly different among all participating countries. <h3>Conclusions and Relevance</h3> This retrospective analysis found that most thyroid cancers were discovered in patients who had no thyroid-referable symptoms; on average, these cancers were smaller than symptomatic thyroid cancers. Still, some asymptomatic cancers were large, consistent with historic data. The substantial difference in MOD patterns among the 4 countries suggests extensive variations in practice.

Background— The Food and Drug Administration recently issued a class I recall of the St. Jude Medical Riata implantable cardioverter-defibrillator lead presumably because of increased risk of electric failure and mechanical separation via inside-out abrasion. We sought to examine the incidence and time dependence of inside-out abrasion in asymptomatic patients implanted with the Riata lead. Methods and Results— Asymptomatic patients implanted with the Riata lead at our institution were offered voluntary fluoroscopic screening in 3 views. Electric testing of the Riata lead with provocative isometric muscle contraction was performed at the time of fluoroscopic screening. Of the 245 patients undergoing fluoroscopic screening, 53 (21.6%) patients showed clear evidence of lead separation. Of these externalized leads, 0%, 13%, and 26% had a dwell time of &lt;3 years, 3 to 5 years, and &gt;5 years, respectively ( P =0.037). Externalized leads had a significantly pronounced decrease in R-wave amplitude (−1.7±2.9 mV versus +0.35±2.5 mV; P &lt;0.001), and more patients with externalized leads had ≥25% decrease in R-wave amplitude from baseline (28.0% versus 8.1%; P =0.018). One patient with externalization exhibited new noise on near-field electrogram. Conclusions— The Riata lead exhibits time-dependent high rates of cable externalization exceeding 20% at &gt;5 years of dwell time. Externalized leads are associated with a more pronounced decrease in R-wave amplitude, which may be an early marker of future electric failure. The use of fluoroscopic and electric screening of asymptomatic patients with the Riata lead remains controversial in the management of patients affected by the recent Food and Drug Administration recall.

In head and neck cancer patients prior to treatment, dysphagia noted by patients is more common than aspiration on formal swallow studies. The authors hypothesized that patient-reported dysphagia impacts multiple domains of quality of life (QOL) and predicts disease recurrence and disease-related death.The Swal-QOL, a dysphagia-specific, swallowing-related, QOL measure, and the EuroQOL-5D-3L were administered to 159 patients before treatment with curative intent in this prospective cohort study. Logistic regression analysis evaluated associations among clinical and subjective measures. Multivariable competing risk regression tested the impact of clinical, tumor, and patient-reported measures on survival.Baseline dysphagia, pain, and diminished patient-reported health state were found to be closely associated with weight loss before treatment and advanced T classification. However, only 58% of patients (23 of 40 patients) reporting dysphagia experienced > 5% weight loss. Dysphagia was found to be associated with pain and/or diminished patient-reported health state, independent of weight loss. Female patients were more likely to report pain and dysphagia, whereas male patients reported dysphagia alone. Dysphagia was found to be predictive of disease recurrence and disease-related death, adjusting for T and N classifications, ECOG performance status, smoking status, and weight loss, and accounting for competing risks of death (recurrence-free survival: hazards ratio, 3.8 [95% confidence interval, 1.7-8.4; P = .001] and disease-related death: hazards ratio, 4.2 [95% confidence interval, 1.04-5; P = .004]).Baseline dysphagia affects multiple domains of QOL and general health perceptions in patients with head and neck cancer prior to treatment. A dysphagia measure captures the effort of maintaining nutrition, and identifies patients predisposed to disease recurrence and disease-related death.

Abstract The landscape of human papillomavirus (HPV) infection in racial/ethnic subgroups of head and neck cancer (HNC) patients has not been evaluated carefully. In this study, a meta-analysis examined the prevalence of HPV in HNC patients of African ancestry. Additionally, a pooled analysis of subject-level data was also performed to investigate HPV prevalence and patterns of p16 (CDNK2A) expression amongst different racial groups. Eighteen publications (N = 798 Black HNC patients) were examined in the meta-analysis, and the pooled analysis included 29 datasets comprised of 3129 HNC patients of diverse racial/ethnic background. The meta-analysis revealed that the prevalence of HPV16 was higher among Blacks with oropharyngeal cancer than Blacks with non-oropharyngeal cancer. However, there was great heterogeneity observed among studies (Q test P &amp;lt; 0.0001). In the pooled analysis, after adjusting for each study, year of diagnosis, age, gender and smoking status, the prevalence of HPV16,18 in oropharyngeal cancer patients was highest in Whites (61.1%), followed by 58.0% in Blacks and 25.2% in Asians (P &amp;lt; 0.0001). There was no statistically significant difference in HPV16,18 prevalence in non-oropharyngeal cancer by race (P = 0.682). With regard to the pattern of HPV16,18 status and p16 expression, White patients had the highest proportion of HPV16,18+/p16+ oropharyngeal cancer (52.3%), while Asians and Blacks had significantly lower proportions (23.0 and 22.6%, respectively) [P &amp;lt; 0.0001]. Our findings suggest that the pattern of HPV16,18 status and p16 expression in oropharyngeal cancer appears to differ by race and this may contribute to survival disparities.

Chordomas are rare malignant bone cancers of the skull-base and spine. Patient survival is variable and not reliably predicted using clinical factors or molecular features. This study identifies prognostic epigenetic chordoma subtypes that are detected noninvasively using plasma methylomes.Methylation profiles of 68 chordoma surgical samples were obtained between 1996 and 2018 across three international centers along with matched plasma methylomes where available.Consensus clustering identified two stable tissue clusters with a disease-specific survival difference that was independent of clinical factors in a multivariate Cox analysis (HR = 14.2, 95%CI: 2.1-94.8, P = 0.0063). Immune-related pathways with genes hypomethylated at promoters and increased immune cell abundance were observed in the poor-performing "Immune-infiltrated" subtype. Cell-to-cell interaction plus extracellular matrix pathway hypomethylation and higher tumor purity were observed in the better-performing "Cellular" subtype. The findings were validated in additional DNA methylation and RNA sequencing datasets as well as with immunohistochemical staining. Plasma methylomes distinguished chordomas from other clinical differential diagnoses by applying fifty chordoma-versus-other binomial generalized linear models in random 20% testing sets (mean AUROC = 0.84, 95%CI: 0.52-1.00). Tissue-based and plasma-based methylation signals were highly correlated in both prognostic clusters. Additionally, leave-one-out models accurately classified all tumors into their correct cluster based on plasma methylation data.Here, we show the first identification of prognostic epigenetic chordoma subtypes and first use of plasma methylome-based biomarkers to noninvasively diagnose and subtype chordomas. These results may transform patient management by allowing treatment aggressiveness to be balanced with patient risk according to prognosis.

To the Editor: Recent studies have linked psoriasis with emerging comorbidities, thus requiring up-to-date prevalence of psoriasis to quantify a changing disease burden.1 As a representative database of health status among US adults, the National Health and Nutrition Examination Survey (NHANES) produces reliable estimates of psoriasis prevalence and comorbidities. This study aimed to update psoriasis prevalence rates among US adults in the most recent 2013-2014 NHANES cycle.

Malignant peripheral nerve sheath tumor (MPNST) is a highly aggressive sarcoma, and a lethal neurofibromatosis type 1-related malignancy, with little progress made on treatment strategies. Here, we apply a multiplatform integrated molecular analysis on 108 tumors spanning the spectrum of peripheral nerve sheath tumors to identify candidate drivers of MPNST that can serve as therapeutic targets. Unsupervised analyses of methylome and transcriptome profiles identify two distinct subgroups of MPNSTs with unique targetable oncogenic programs. We establish two subgroups of MPNSTs: SHH pathway activation in MPNST-G1 and WNT/ß-catenin/CCND1 pathway activation in MPNST-G2. Single nuclei RNA sequencing characterizes the complex cellular architecture and demonstrate that malignant cells from MPNST-G1 and MPNST-G2 have neural crest-like and Schwann cell precursor-like cell characteristics, respectively. Further, in pre-clinical models of MPNST we confirm that inhibiting SHH pathway in MPNST-G1 prevent growth and malignant progression, providing the rational for investigating these treatments in clinical trials.

In pituitary lactotrophs the prolactin gene is stimulated by neuropeptides and estrogen and is suppressed by dopamine via D2-type receptors. Stimulatory signals converge on activation of the mitogen-activated protein kinases ERK1/2, but dopamine regulation of this pathway is not well defined. Paradoxically, D2 agonists activate ERK1/2 in many cell types. Here we show that in prolactin-secreting GH4ZR7 cells and primary pituitary cells, dopamine treatment leads to a rapid, pronounced, and specific decrease in activated ERK1/2. The response is blocked by D2-specific antagonists and pertussis toxin. Interestingly, in stable lines expressing specific pertussis toxin-resistant Gα subunits, toxin treatment blocks dopamine suppression of MAPK in Gαi2- but not Gαo-expressing cells, demonstrating that Go-dependent pathways can effect the inhibitory MAPK response. At the nuclear level, the MEK1 inhibitor U0126 mimics the D2-agonist bromocryptine in suppressing levels of endogenous prolactin transcripts. Moreover, a good correlation is seen between the IC50 values for inhibition of MEK1 and suppression of prolactin promoter function (PD184352 > U0126 > U0125). Both dopamine and U0126 enhance the nuclear localization of ERF, a MAPK-sensitive ETS repressor that inhibits prolactin promoter activity. In addition, U0126 suppression is transferred by tandem copies of the Pit-1-binding site, consistent with mapping experiments for dopamine responsiveness. Our data suggest that ERK1/2 suppression is an obligatory step in the dopaminergic control of prolactin gene transcription and that bidirectional control of ERK1/2 function in the pituitary may provide a key mechanism for endocrine gene control. In pituitary lactotrophs the prolactin gene is stimulated by neuropeptides and estrogen and is suppressed by dopamine via D2-type receptors. Stimulatory signals converge on activation of the mitogen-activated protein kinases ERK1/2, but dopamine regulation of this pathway is not well defined. Paradoxically, D2 agonists activate ERK1/2 in many cell types. Here we show that in prolactin-secreting GH4ZR7 cells and primary pituitary cells, dopamine treatment leads to a rapid, pronounced, and specific decrease in activated ERK1/2. The response is blocked by D2-specific antagonists and pertussis toxin. Interestingly, in stable lines expressing specific pertussis toxin-resistant Gα subunits, toxin treatment blocks dopamine suppression of MAPK in Gαi2- but not Gαo-expressing cells, demonstrating that Go-dependent pathways can effect the inhibitory MAPK response. At the nuclear level, the MEK1 inhibitor U0126 mimics the D2-agonist bromocryptine in suppressing levels of endogenous prolactin transcripts. Moreover, a good correlation is seen between the IC50 values for inhibition of MEK1 and suppression of prolactin promoter function (PD184352 > U0126 > U0125). Both dopamine and U0126 enhance the nuclear localization of ERF, a MAPK-sensitive ETS repressor that inhibits prolactin promoter activity. In addition, U0126 suppression is transferred by tandem copies of the Pit-1-binding site, consistent with mapping experiments for dopamine responsiveness. Our data suggest that ERK1/2 suppression is an obligatory step in the dopaminergic control of prolactin gene transcription and that bidirectional control of ERK1/2 function in the pituitary may provide a key mechanism for endocrine gene control. D2-type receptors extracellular signal-regulated kinase mitogen-activated protein kinase mitogen-activated protein kinase kinase thyrotropin-releasing hormone green fluorescence protein prolactin growth hormone Tris-buffered saline dopamine ETS-2 repressor factor beta-adrenergic receptor kinase rous sarcoma virus Dopaminergic activation of G-protein-coupled D2-type receptors (D2R)1 regulates a range of behavioral and locomotor functions in the brain and leads to tonic inhibition of prolactin synthesis and release from the anterior pituitary. Hyperprolactinemia is observed in mice with a targeted disruption of the D2R gene along with the hypertrophic expansion of the pituitary lactotroph population and formation of pituitary adenomas in older animals (1Kelly M.A. Rubinstein M. Asa S.L. Zhang G. Saez C. Bunzow J.R. Allen R.G. Hnasko R. Ben-Jonathan N. Grandy D.K. Low M.J. Neuron. 1997; 19: 103-113Abstract Full Text Full Text PDF PubMed Scopus (367) Google Scholar, 2Saiardi A. Bozzi Y. Baik J.H. Borrelli E. Neuron. 1997; 19: 115-126Abstract Full Text Full Text PDF PubMed Scopus (169) Google Scholar, 3Asa S.L. Kelly M.A. Grandy D.K. Low M.J. Endocrinology. 1999; 140: 5348-5355Crossref PubMed Google Scholar). Inhibition of prolactin synthesis by dopamine occurs at the transcriptional level (4Maurer R.A. Nature. 1981; 294: 94-97Crossref PubMed Scopus (194) Google Scholar) and is dependent on the proximal promoter region of the prolactin gene (5Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar, 6McChesney R. Sealfon S.C. Tsutsumi M. Dong K.W. Roberts J.L. Bancroft C. Mol. Cell. Endocrinol. 1991; 79: R1-R7Crossref PubMed Scopus (24) Google Scholar). This region also confers transactivation by multiple stimulatory pathways, including those involving cAMP/protein kinase A, calcium, phospholipases, protein kinase C, and MAPKs. It is generally held that by antagonizing the elevation of intracellular cAMP or calcium, D2R signaling may inhibit the transactivation functions of factors like Pit-1, ETS-domain proteins, or specific transcription co-activators. Although activation of MAPK cascades are known to have an important role in mediating stimulatory responses of the prolactin gene to growth factors (7Schweppe R.E. Frazer-Abel A.A. Gutierrez-Hartmann A. Bradford A.P. J. Biol. Chem. 1997; 272: 30852-30859Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar, 8Castillo A.I. Tolon R.M. Aranda A. Oncogene. 1998; 16: 1981-1991Crossref PubMed Scopus (43) Google Scholar), thyrotropin-releasing hormone (TRH) (9Wang Y.H. Maurer R.A. Mol Endocrinol. 1999; 13: 1094-1104Crossref PubMed Scopus (53) Google Scholar), and even estrogen (10Watters J.J. Chun T.Y. Kim Y.N. Bertics P.J. Gorski J. Mol Endocrinol. 2000; 14: 1872-1881Crossref PubMed Scopus (108) Google Scholar), the role of MAPK regulation in the dopaminergic suppression of prolactin has not been defined. Indeed, D2R stimulation activates MAPKs in a wide range of cultured cells, including COS (11Faure M. Voyno-Yasenetskaya T.A. Bourne H.R. J. Biol. Chem. 1994; 269: 7851-7854Abstract Full Text PDF PubMed Google Scholar), Balb-c/3T3 (12Ghahremani M.H. Forget C. Albert P.R. Mol. Cell. Biol. 2000; 20: 1497-1506Crossref PubMed Scopus (41) Google Scholar), Chinese hamster ovary (13Oak J.N. Lavine N. van Tol H.H. Mol. Pharmacol. 2001; 60: 92-103Crossref PubMed Scopus (116) Google Scholar), C6 glioma (14Luo Y. Kokkonen G.C. Wang X. Neve K.A. Roth G.S. J. Neurochem. 1998; 71: 980-990Crossref PubMed Scopus (94) Google Scholar), and tissues (e.g. brain slices (15Yan Z. Feng J. Fienberg A.A. Greengard P. Proc. Natl. Acad. Sci. U. S. A. 1999; 96: 11607-11612Crossref PubMed Scopus (189) Google Scholar, 16Calabresi P. Gubellini P. Picconi B. Centonze D. Pisani A. Bonsi P. Greengard P. Hipskind R.A. Borrelli E. Bernardi G. J. Neurosci. 2001; 21: 5110-5120Crossref PubMed Google Scholar) and lung epithelium (17Guerrero C. Lecuona E. Pesce L. Ridge K.M. Sznajder J.I. Am. J. Physiol. Lung Cell Mol. Physiol. 2001; 281: L79-L85Crossref PubMed Google Scholar)). This activation is generally blocked by the ADP-ribosylating agent pertussis toxin (12Ghahremani M.H. Forget C. Albert P.R. Mol. Cell. Biol. 2000; 20: 1497-1506Crossref PubMed Scopus (41) Google Scholar, 13Oak J.N. Lavine N. van Tol H.H. Mol. Pharmacol. 2001; 60: 92-103Crossref PubMed Scopus (116) Google Scholar, 14Luo Y. Kokkonen G.C. Wang X. Neve K.A. Roth G.S. J. Neurochem. 1998; 71: 980-990Crossref PubMed Scopus (94) Google Scholar), indicating a requirement for heterotrimeric Gi/o-type proteins, and in some cases by the C-terminal sequence of βARK kinase (12Ghahremani M.H. Forget C. Albert P.R. Mol. Cell. Biol. 2000; 20: 1497-1506Crossref PubMed Scopus (41) Google Scholar) or Gα subunit of retinal transducin (11Faure M. Voyno-Yasenetskaya T.A. Bourne H.R. J. Biol. Chem. 1994; 269: 7851-7854Abstract Full Text PDF PubMed Google Scholar), consistent with a role for Gβ/γ subunit dimers in stimulatory D2R signaling. Because a stimulatory effect of D2R agonists on MAPKs appears inconsistent with their inhibitory actions on prolactin gene transcription, we examined how D2R activation alters MAPK function in prolactin-secreting cells. We show here that in the pituitary cell line GH4ZR7, dopamine treatment lowers constitutive and hormone-stimulated levels of activated MAPKs, ERK1 and ERK2. The inhibitory response is rapid and dependent on specific heterotrimeric G-proteins and specific MAPK types in that p38 MAPKs are not regulated in a similar manner to ERKs. The effects of MAPKK (MEK1) inhibitors on prolactin transcription parallel those of dopamine and are dependent in part on Pit-1 and ETS-type transcription factors. Finally, dopaminergic inhibition of ERK function is not restricted to transformed pituitary cell lines but is observed also in normal primary pituicytes, suggesting a physiological role for this regulatory mechanism. MEK1 inhibitors PD98059, PD184352, U0126, U0125, and pertussis toxin were purchased fromCalbiochem. Dopamine, bromocryptine, sulpiride, spiperone, and sorbitol were from Sigma. TRH was from Roche Molecular Biochemicals. The luciferase reporter plasmid −422 rPRL-Luc, rGH-Luc, RSV-Luc, 3x1P-Luc, and 3xSp1-Luc constructs were described previously (5Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar, 18Lew A.M. Yao H. Elsholtz H.P. J. Biol. Chem. 1994; 269: 12007-12013Abstract Full Text PDF PubMed Google Scholar). GFP-ERF fusion protein expression vector was prepared by in-frame insertion of the ERF cDNA sequence into pEGFP-C1 (CLONTECH). GH4ZR7 cells were maintained in Ham's F-10 with 12.5% horse serum and 2.5% fetal calf serum. Transfections were done as previously described (18Lew A.M. Yao H. Elsholtz H.P. J. Biol. Chem. 1994; 269: 12007-12013Abstract Full Text PDF PubMed Google Scholar). For primary culture, the pituitaries were isolated from 3-month-old Sprague-Dawley rats, washed with ice-cold phosphate-buffered saline and Dulbecco's modified Eagle's medium, and resuspended in defined medium (Dulbecco's modified Eagle's medium, penicillin/streptomycin, 30 μg/ml putrescine, 1 μm hydrocortisone, 5 μg/ml insulin, 5 μg/ml transferrin, 0.375% bovine serum albumin, and 10 pm T3). The cells were separated mechanically by passing progressively through a Pasteur pipette, 18- and 23-gauge needles. Dispersed cells were plated onto poly-l-lysine-coated culture plates and incubated in defined media for 48 h before treatments. Pertussis toxin-insensitive Gαi/o mutants containing C-terminal Cys to Ser substitutions and cloned into expression vector pcDNA3 (Invitrogen) were kindly provided by Dr. Paul Albert, University of Ottawa) (12Ghahremani M.H. Forget C. Albert P.R. Mol. Cell. Biol. 2000; 20: 1497-1506Crossref PubMed Scopus (41) Google Scholar). GH4ZR7 cells were co-transfected with the mutant Gαi/o subunit constructs and pcDNA3.1/hygromycin vector using electroporation (500 μfarad capacitance, 280 volts) and cultured in Ham's F-10 medium (12.5% horse serum, 2.5% fetal bovine serum) containing 300 μg/ml hygromycin-B for 3–4 weeks. Antibiotic-resistant clones were picked (25 clones/transfection) and tested for expression of recombinant Gαi/o RNA transcripts using 32P-labeled probes that recognized 3′ non-coding sequences specific to the vector. Transcript-positive clones were assessed by Western blot for the presence of corresponding Gαi/o proteins. mRNA from GH4ZR7 cells was prepared using oligo-dT cellulose (Collaborative Biomedical Tech.). Blots were probed with random primer labeled ([32P]dATP) cDNAs for Gαi2, Gαo, PRL, GH, or tubulin as previously described (26Gutkind J.S. J. Biol. Chem. 1998; 273: 1839-1842Abstract Full Text Full Text PDF PubMed Scopus (692) Google Scholar). Cells from 6-cm dishes were harvested in 0.2 ml of radioimmune precipitation assay buffer, extract protein was quantified by BCA protein assay (Pierce, Rockford, IL), samples were resolved on SDS 12% polyacrylamide gels at 100 V, and proteins were transferred to nitrocellulose. Blots were incubated for 2 h in 5% nonfat dry milk in 1× TBS. The blots were then incubated overnight with primary antibody in fresh 5% nonfat dry milk in 1× TBS followed by a 1-h incubation with horseradish peroxidase-conjugated secondary antibody at room temperature. The peroxidase product was developed and exposed to Kodak Blue X-Omat film. ETS mutations of the prolactin promoter were generated by using the PCR method of Kammanet al. (19Kammann M. Laufs J. Schell J. Gronenborn B. Nucleic Acids Res. 1989; 17: 5404Crossref PubMed Scopus (181) Google Scholar). First PCR used a wild-type primer specific for either the 5′-end (ccggctcgagcttttaatttaccca) or 3′-end (ggccaagcttgaccacacttccc) of the prolactin promoter and an ETS core mutagenic primer: −212, gattaattacagcaaaaatcgatgagagaaatgctg; −180, tagtggccagaaagtctagattttgattaattacag; and −160, ttctggccactatgagatcttgaatatgaataagaaat. The 150–200 base pair product was used in a second reaction to amplify a full-length promoter. The PCR product was restriction digested usingXhoI and HindIII and ligated into the luciferase-containing vector. Antibodies to ERK1/2, phospho-ERK1/2, p38, and phospho-p38 (Santa Cruz) were used to measure MAPK phosphorylation by Western analysis. ERK1/2 activity was measured using the p44/42 MAP Kinase Assay kit from Cell Signaling Technology. Immunoprecipitation was done with GH4ZR7 cell extract using immobilized phospho-p44/42 antibody. The precipitate was washed and used in kinase reactions with Elk-1 protein as substrate. The level of ERK activity was determined by Elk-1 phosphorylation in Western blot using anti-phospho-Elk-1 antibody. GH4ZR7 cells were transiently transfected with GFP-ERF expression vector and plated on cover slides coated with poly-l-lysine. After treatment, the cells were washed and fixed in 4% paraformaldehyde. Slides were prepared by coating the cells with 90% glycerol in phosphate-buffered saline and examined by confocal microscope (Fluoview BX50/PC system). GFP-ERF proteins were visualized using an argon ion laser at 488 nm. Regulation of MAPKs in D2R-expressing GH4ZR7 cells was determined by quantifying the activated (i.e. MAPKK-phosphorylated) form of the enzyme and by measuring the ability of immunoprecipitated MAPKs to phosphorylate the substrate ETS protein, Elk1. Initial studies showed that activated ERK1 and ERK2 are readily detected, and at surprisingly comparable levels, in GH4ZR7 cells cultured in serum-containing or serum-free medium for 24 h, even after removal of the weak estrogenic dye, Phenol Red. 2J. Liu, unpublished data. This serum-independent “basal” level of activated ERKs may derive from stimulatory factors released from (or expressed on) pituitary cells, as suggested by a biphasic pattern of phospho-ERK regulation. As shown in Fig. 1, phospho-ERK levels rapidly decline by 4–5-fold following serum withdrawal but recover to 70% control by 6 h post-withdrawal. Control cells (e.g.NIH3T3) treated in a similar manner showed minimal recovery in phospho-ERK levels over the same time course (Fig. 1). Dopamine regulation of phospho-ERK was examined under basal (serum-free) conditions and in the presence of ERK activators such as the hypothalamic peptide thyrotrophin-releasing hormone. In either case, phospho-ERK1/2 were suppressed 2–3-fold by brief exposure of cells to dopamine (Fig. 2, Aand B). This suppression was observed at dopamine concentrations previously shown to inhibit prolactin gene transcription (5Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar, 18Lew A.M. Yao H. Elsholtz H.P. J. Biol. Chem. 1994; 269: 12007-12013Abstract Full Text PDF PubMed Google Scholar), and was blocked completely by D2R-specific antagonists, sulpiride and spiperone (Fig. 2 A and data not shown). In contrast to ERK1/2, the stress-inducible MAPK, p38, was not inhibited by dopamine (Fig. 2 C), demonstrating selectivity in the MAPK response to D2R activation in GH4ZR7 cells. To further examine the cell context for dopaminergic suppression of ERK1/2, we measured the dopamine response in normal rat pituitary cells. Dispersed primary cultures were prepared in serum-free defined medium and treated with D2 agonists under time and dose conditions found effective using GH4ZR7 cells. In three separate experiments of similar design, dopamine or bromocryptine reduced phospho-ERK levels by 15–30% (Fig. 3), demonstrating that D2R-dependent regulation of MAPK in normal pituicytes parallels the response in the GH4ZR7 model. To assess whether suppression of ERKs by dopamine involves specific G-protein subtypes we examined the sensitivity of this response to pertussis toxin. Pretreatment of GH4ZR7 cells with pertussis toxin had no effect on the basal level of phospho-ERK1/2 or on stimulation of ERK1/2 by TRH, which signals predominantly via Gq-coupled receptors, but prevented dopamine-dependent suppression of ERK1/2 (Fig.4 A), indicative of a Gi/o-coupled response. Mutation of the terminal cysteine residue of Gαi/o-subunits renders them insensitive to ADP-ribosylation by pertussis toxin, providing a strategy to identify which Gi/o proteins are critical for coupling to specific signaling pathways. We established stable GH4ZR7 clones that express pertussis toxin-resistant forms of Gαi2 and Gαo and examined whether either Gα subtype was required for D2R-dependent inhibition of ERK1/2. RNA analysis using probes specific for the 3′-end of recombinant Gα transcripts, 3R. Baker, unpublished data. together with immunoblot data in Fig. 4 B (inset) identified several cloned GH4ZR7-PTXr lines that express the mutant Gα subtypes. Following pertussis toxin pretreatment and dopamine addition, Gαi2-PTXr-expressing cells behaved similarly to parental controls where suppression of ERK1/2 function by dopamine was completely blocked. In contrast, pertussis toxin was ineffective in blocking dopamine regulation of phospho-ERK levels in Gαo-PTXr-expressing cells (Fig. 4 B), indicating that this Gα subtype may be critical in coupling D2R activation to MAPK regulation. D2R activation in lactotrophs triggers several signaling events that may reduce prolactin synthesis, including a reduction in cAMP levels, inhibition of calcium channels, and a decrease in phosphatidylinositol turnover. Because dopamine potently suppresses basal ERK1/2 function in GH4ZR7 cells and primary pituitary cells, we investigated the impact of this regulatory mechanism on expression of the endogenous prolactin gene. Fig.5 shows that similar to bromocryptine, MEK1 inhibitors U0126 and U0125 cause a 2–3-fold reduction in prolactin RNA transcripts over a 48-h period. Expression of the prolactin-related growth hormone gene and tubulin control were unchanged in response to the treatments. The aminated phenylthiobutadiene U0126 is a more potent inhibitor of MEK1 than the closely related analog U0125 and also a better inhibitor of the endogenous prolactin gene (Fig. 5, at 48 h). To establish a more quantitative relationship between ERK1/2 suppression and decreases in prolactin gene transcription, we compared the ability of MEK1 inhibitors having a wide range of IC50 values for the suppression of ERK1/2 activation (Fig.6 A) to repress prolactin promoter function. Fig. 6 B shows there is a 100-fold range in the potency of PD184352, U0126, and U0125 to inhibit the prolactin promoter, in good agreement with the range and hierarchy of these compounds to block ERK1/2 activation (i.e. PD184352 > U0126 > U0125). Moreover, the selectivity of MEK1 inhibitors for the prolactin promoter is demonstrated by the dopamine-insensitiveRSV promoter (5Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar), which was unaffected by even the most potent MEK1 inhibitors (i.e. PD184352 and U0126) at concentrations exceeding 100 μm (Fig. 6 B). We have previously shown that ERF, a ubiquitous transcriptional repressor of the ETS-domain family can selectively inhibit the prolactin gene promoter by interacting at composite ETS/Pit-1-binding sites and potentially other Pit-1 sites (21Day R.N. Liu J. Sundmark V. Kawecki M. Berry D. Elsholtz H.P. J. Biol. Chem. 1998; 273: 31909-31915Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). In fibroblasts, ERF is a direct target for MAPK phosphorylation (22Sgouras D.N. Athanasiou M.A. Beal Jr., G.J. Fisher R.J. Blair D.G. Mavrothalassitis G.J. EMBO J. 1995; 14: 4781-4793Crossref PubMed Scopus (146) Google Scholar), and MAPK activation triggers export of the repressor from nuclei (23Le Gallic L. Sgouras D. Beal Jr., G. Mavrothalassitis G. Mol. Cell. Biol. 1999; 19: 4121-4133Crossref PubMed Scopus (90) Google Scholar), providing an attractive mechanism for de-repression of gene transcription. We examined by confocal microscopy whether a reduction in basal ERK1/2 function in dopamine- or U0126-treated GH4ZR7 cells could alter the subcellular location of ERF. In untreated cells, a GFP-ERF fusion protein was largely excluded from nuclei, contrasting with a uniformly distributed GFP control (Fig.7 A). Brief exposure of cells to either dopamine or U0126 caused a redistribution of GFP-ERF to nuclei within 10–30 min (Fig. 7 B). These agents had no effect on the distribution of GFP in control cultures,2indicating that ERF sequences were critical for regulating nuclear translocation. Quantification of localization data (Fig. 7 C) demonstrated that nuclear GFP-ERF was detected in <5% of untreated cells, in contrast to >40% in dopamine-treated cultures. Nearly all cells showed nuclear localization of GFP-ERF following exposure to U0126. The dopamine-responsive promoter region of the prolactin gene includes ras-, TRH-, and MAPK-inducible elements that have been mapped to ETS-binding sites centered at −160 and −212 (24Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar, 25Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar). We mutated the core GGA(A/T) motifs of these ETS sites in a 450-base pair prolactin promoter. A third potential ETS motif positioned at −180, 3′ to the Pit-1-binding site 3P was also mutated (Fig. 8 A). As shown in Fig. 8 B, dopamine and U0126 inhibited activity of the wild-type prolactin promoter by 40 and 62%, respectively. However, a loss in responsiveness to dopamine and the MEK1 inhibitor was not seen following mutation of Ras/TRH-regulated ETS sites of the prolactin promoter. We have shown that a multimerized 1P Pit-1-binding site (coordinates −62 to −38) is sufficient to confer dopamine inhibition to a minimal TATA box promoter, whereas other binding sites (e.g. Sp1) are not regulated by dopamine (5Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar). Interestingly, as shown in Fig. 8 B, U0126 also inhibits activity of a 3x1P-TATA promoter but not a 3xSp1-TATA promoter, further demonstrating that dopamine signaling at the nuclear level in GH4ZR7 cells may involve targeting of the ERK1/2 pathway. Consistent with a role for Pit-1 sites in conferring inhibition by U0126, we found that the growth hormone promoter is also suppressed, albeit with lesser efficiency than the prolactin promoter. However, the inability of U0126 to lower steady state levels of growth hormone mRNA (see Fig. 3) argues that in a chromatin context transcriptional responses to MAPK suppression may depend on cooperative interactions that occur in the prolactin gene but not the growth hormone gene. This study demonstrates that dopamine D2R signaling in normal pituitary cells and prolactin-secreting cell lines leads to a reduction in ERK1/2 function. Dopamine not only antagonizes stimulatory effects of exogenous hormones (e.g. TRH) on ERK1/2, but it also suppresses basal levels of activated ERK1/2 observed in serum-free cultures of GH4ZR7 cells and primary pituitary cells. The biphasic pattern of phospho-ERK1/2 regulation, in which an initial sharp decline in phospho-ERK levels under serum-free conditions is followed by a recovery phase, suggests that secreted or membrane-associated autocrine factors may contribute to the elevated basal levels of activated ERK in pituitary cells. Possible candidates may include one or more members of the fibroblast growth factor family that are expressed in GH4 cells and primary pituicytes as these can be potent activators of ERK1/2 in pituitary cultures (7Schweppe R.E. Frazer-Abel A.A. Gutierrez-Hartmann A. Bradford A.P. J. Biol. Chem. 1997; 272: 30852-30859Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar). 4S. Ezzat, personal communication. Efforts to address this issue using immunoneutralization strategies are currently in progress. Although activation of ERK1/2 by Gi/o-protein-coupled receptors, including D2Rs, is now a well established paradigm in several cell-types and tissues (26Gutkind J.S. J. Biol. Chem. 1998; 273: 1839-1842Abstract Full Text Full Text PDF PubMed Scopus (692) Google Scholar, 27Luttrell L.M. van Biesen T. Hawes B.E. Koch W.J. Krueger K.M. Touhara K. Lefkowitz R.J. Adv. Second Messenger Phosphoprotein Res. 1997; 31: 263-277Crossref PubMed Scopus (97) Google Scholar), the mechanism of rapid inhibition of ERK1/2 by this group of receptors is less well understood. In GH4ZR7 cells, dopamine inhibition of ERK1/2 could involve inhibitory effects on calcium channels or adenylate cyclase (18Lew A.M. Yao H. Elsholtz H.P. J. Biol. Chem. 1994; 269: 12007-12013Abstract Full Text PDF PubMed Google Scholar, 28Albert P.R. Neve K.A. Bunzow J.R. Civelli O. J. Biol. Chem. 1990; 265: 2098-2104Abstract Full Text PDF PubMed Google Scholar, 29Vallar L. Muca C. Magni M. Albert P. Bunzow J. Meldolesi J. Civelli O. J. Biol. Chem. 1990; 265: 10320-10326Abstract Full Text PDF PubMed Google Scholar), as agents that stimulate either calcium influx/PKC or adenylate cyclase/PKA can also stimulate ERK1/2 phosphorylation. Interestingly, two earlier studies using PTX-resistant Gα proteins in GH4 cells (20Senogles S.E. J. Biol. Chem. 1994; 269: 23120-23127Abstract Full Text PDF PubMed Google Scholar) and fibroblasts (12Ghahremani M.H. Forget C. Albert P.R. Mol. Cell. Biol. 2000; 20: 1497-1506Crossref PubMed Scopus (41) Google Scholar) demonstrate a requirement for Gi2 in the D2R-mediated inhibition of cAMP. From our study the ability of PTX-resistant Gαo, but not PTX-resistant Gαi2, to rescue dopamine suppression of ERK1/2 suggests that pathways independent of cAMP inhibition may play a significant role. This finding may be of particular interest in understanding transcriptional inhibition of the prolactin gene, as we have previously demonstrated that a GTPase-deficient Gαomutant inhibits prolactin promoter function without causing a decrease in intracellular cAMP (18Lew A.M. Yao H. Elsholtz H.P. J. Biol. Chem. 1994; 269: 12007-12013Abstract Full Text PDF PubMed Google Scholar). Inhibitory control of ERK1/2 by dopamine may involve the regulation of specific phosphatases, either dual specificity enzymes that directly target MAPKs or phospho-Ser/Thr or phospho-Tyr phosphatases that might act earlier in the signaling cascade. Florio et al. (30Florio T. Pan M.G. Newman B. Hershberger R.E. Civelli O. Stork P.J. J. Biol. Chem. 1992; 267: 24169-24172Abstract Full Text PDF PubMed Google Scholar) reported that dopamine can rapidly stimulate a phospho-Tyr phosphatase activity in GH4ZR7 cell membranes, an effect blocked by the antagonist haloperidol and sensitive to pertussis toxin. Activation of somatostatin receptors was unable to stimulate the PTPase activity (30Florio T. Pan M.G. Newman B. Hershberger R.E. Civelli O. Stork P.J. J. Biol. Chem. 1992; 267: 24169-24172Abstract Full Text PDF PubMed Google Scholar), suggesting functional differences in the signaling pathways evoked by these Gi/o-coupled receptors in GH4ZR7 cells. Among phospho-Ser/Thr phosphatases the ubiquitous PP1 is a possible effector in D2R-mediated ERK1/2 suppression. Inhibition of PP1 can stimulate ERK1/2 signaling in certain prolactin-secreting cell lines (31Manfroid I. Martial J.A. Muller M. Mol. Endocrinol. 2001; 15: 625-637Crossref PubMed Scopus (19) Google Scholar) most likely by preventing dephosphorylation of an upstream component in the kinase cascade. A reversal of PP1 inhibition by dopamine could lead to a reduction in activated ERK1/2. Moreover, a PP1- and actin-binding protein, spinophilin/neurabin II (32Allen P.B. Ouimet C.C. Greengard P. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 9956-9961Crossref PubMed Scopus (394) Google Scholar, 33Satoh A. Nakanishi H. Obaishi H. Wada M. Takahashi K. Satoh K. Hirao K. Nishioka H. Hata Y. Mizoguchi A. Takai Y. J. Biol. Chem. 1998; 273: 3470-3475Abstract Full Text Full Text PDF PubMed Scopus (197) Google Scholar), has recently been identified in yeast two-hybrid screens as a target for the D2R third intracellular loop (34Smith F.D. Oxford G.S. Milgram S.L. J. Biol. Chem. 1999; 274: 19894-19900Abstract Full Text Full Text PDF PubMed Scopus (181) Google Scholar), providing a further link between the D2R and PP1. However, although spinophilin is expressed at low levels in various cell types, including those in which D2Rs activate ERK1/2, its role in dopaminergic inhibition of ERK1/2 in lactotrophs remains to be tested. Promoter activity of the prolactin gene is strongly suppressed by MEK1 inhibitors having unique chemical structures with a ranking for suppression of promoter function that corresponds well to the IC50 values for MEK1 inhibition. Although interpretation of kinase inhibitor data is limited by the specificity of such compounds, it is noteworthy from a recent cross-analysis of multiple kinase inhibitors (35Davies S.P. Reddy H. Caivano M. Cohen P. Biochem. J. 2000; 351: 95-105Crossref PubMed Scopus (3957) Google Scholar) that MEK1 inhibitors (particularly PD184352) demonstrate remarkable target specificity relative to many other kinase inhibitors. In addition, given the prolactin promoter-specific effects of all MEK1 inhibitors tested in our study, it is unlikely that these compounds suppress transcription by a MEK1/ERK-independent mechanism. Hence, together with the RNA blot analysis, these data argue that ERK1/2 activity, whether stimulated by neuroendocrine hormones or maintained at elevated basal levels by autocrine/paracrine pituitary factors, may be required for prolactin gene expression, and thereby provides an effective target for inhibitory control by D2R signaling pathways. The mechanisms involved in transcriptional inhibition by dopamine and MEK1 inhibitors appear to include translocation of the ERF repressor to nuclei and regulation at Pit-1 sites of the prolactin promoter. Although in some fibroblast lines the ERK-sensitive repressor is localized to nuclei following serum withdrawal, requiring the addition of mitogens for nuclear export (23Le Gallic L. Sgouras D. Beal Jr., G. Mavrothalassitis G. Mol. Cell. Biol. 1999; 19: 4121-4133Crossref PubMed Scopus (90) Google Scholar), ERF in GH4ZR7 cells is restricted to the cytoplasm even after prolonged serum withdrawal. A similar distribution is seen in pituitary GHFT-1 cells. 5T. Voss and R. N. Day, personal communication. The ability of dopamine and the MEK inhibitor U0126 to trigger nuclear translocation of ERF, supports the view that D2R-dependent inhibition of ERK1/2 is a requirement for regulation of this transcription repressor. Although our previous data showed that ERF repression can be conferred by the 3P Pit-1/ETS composite site of the prolactin promoter (21Day R.N. Liu J. Sundmark V. Kawecki M. Berry D. Elsholtz H.P. J. Biol. Chem. 1998; 273: 31909-31915Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar), mutations of this site or a second Pit-1/ETS site (4P) were surprisingly unable to diminish the transcriptional response to dopamine or U0126. Other more proximal ETS elements may therefore be required, or alternatively, ERF may inhibit at non-composite Pit-1 sites as suggested by binding analysis of the prolactin 1P element (21Day R.N. Liu J. Sundmark V. Kawecki M. Berry D. Elsholtz H.P. J. Biol. Chem. 1998; 273: 31909-31915Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). Although the 1P element confers dopamine responsiveness (5Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar), it has not previously been considered a target for MAPK regulation based on studies of stimulatory signaling pathways in GH4 cells. Besides serving as a potential site for ERF-dependent repression, the 1P element likely plays a key role in the Pit-1-dependent recruitment of transcriptional coactivators. Dopamine inhibition of ERK1/2 activity may lead to impaired Pit-1/coactivator interactions with a consequent decrease in transactivation. In conclusion, we show that suppression of ERK1/2 activity by dopamine may play a key role in the negative regulation of the prolactin gene. This finding complements studies on the stimulatory control of prolactin, showing that ERK1/2 serves as an integrative node for diverse upstream signals including Gs- (36Le Pechon-Vallee C. Magalon K. Rasolonjanahary R. Enjalbert A. Gerard C. Neuroendocrinology. 2000; 72: 46-560Crossref PubMed Scopus (36) Google Scholar) and Gq-coupled receptors (9Wang Y.H. Maurer R.A. Mol Endocrinol. 1999; 13: 1094-1104Crossref PubMed Scopus (53) Google Scholar), receptor tyrosine kinases that activate ras-dependent (24Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar) or -independent (7Schweppe R.E. Frazer-Abel A.A. Gutierrez-Hartmann A. Bradford A.P. J. Biol. Chem. 1997; 272: 30852-30859Abstract Full Text Full Text PDF PubMed Scopus (38) Google Scholar) pathways, and even steroid hormones (10Watters J.J. Chun T.Y. Kim Y.N. Bertics P.J. Gorski J. Mol Endocrinol. 2000; 14: 1872-1881Crossref PubMed Scopus (108) Google Scholar). Consistent with its inhibitory role in vivo, hypothalamic dopamine may reduce levels of activated ERKs to antagonize this stimulation or suppress basal prolactin gene transcription, which may be maintained in part by local pituitary-derived signals. Finally, although inhibition of ERK1/2 is generally viewed as a restorative mechanism that follows an acute or protracted stimulatory phase, our experiments support a model in which some Gi/o-coupled receptors, or as shown recently some receptor tyrosine kinases (37Miao H. Wei B.R. Peehl D.M., Li, Q. Alexandrou T. Schelling J.R. Rhim J.S. Sedor J.R. Burnett E. Wang B. Nat. Cell Biol. 2001; 3: 527-530Crossref PubMed Scopus (283) Google Scholar), cause a dynamic suppression of ERK1/2 with resultant changes in gene transcription or cell growth. We thank Drs. Richard Day and Ty Voss (University of Virginia) for GFP expression vectors, discussion, and communication of unpublished data, Drs. Paul Albert and Mohammad Ghahremani (University of Ottawa) for mutant Gα expression vectors, Drs. Sylvia Asa and George Fantus (University of Toronto) for providing rat pituitaries and primary culture reagents, and Drs. Peter Backx and Myron Cybulsky (University of Toronto) for use of confocal microscope systems.

Purpose To identify predictors of mortality within 90 days of cataract surgery. Design A retrospective cohort study. Participants A total of 45 082 patients who underwent cataract surgery in the Veterans Health Administration (VHA) between October 1, 2005 and September 30, 2007. Methods The National Patient (US) Care Database (NPCD) was used to identify all patients who underwent outpatient extracapsular cataract surgery performed in the VHA and who had only 1 cataract surgery within 90 days of the index surgery. Data collected includes demographics, number of hospitalizations within 1 year before surgery, postoperative mortality, and systemic comorbidities using the Charlson Comorbidity Index (CCI), which predicts the 1-year mortality for a patient based on a range of co-morbid conditions scored 1, 2, 3 or 6 depending on the risk of dying associated with the condition. Adjusted odds ratios (OR) of factors predictive of 90-day mortality were calculated using logistical regression modeling. Main Outcome Measures Mortality within 90 days of cataract surgery. Results Of the 53 786 patients who underwent cataract surgery during the study period, 45 082 met inclusion criteria. Mean age was 71.8 years; 97.6% were men; 5.0% had complex cataract surgery. The most frequent systemic comorbidities in the CCI were diabetes mellitus (40.6%), chronic pulmonary disease (21.2%), malignant neoplasms (12.5%) and congestive heart failure (CHF; 9.5%). Patients had a median CCI score of 1; 43.7% had a score ≥2. Mortality rate within 90 days after cataract surgery was 7.1 per 1000 patients. Independent predictors of 90-day postoperative mortality were [adjusted OR, (95% confidence interval; CI)]: age 80 or greater [2.54 (1.62,3.98)], CCI ≥2 [2.06 (1.58, 2.70)], ≥1 hospitalizations in the past year [1.85 (1.45, 2.36)], chronic pulmonary disease (CPD) [1.69 (1.34,2.14)], CHF [1.71 (1.29,2.14)], cirrhosis [2.60 (1.31,5.15)], multiple myeloma or leukemia [2.20 (1.07,4.53)], and metastatic solid tumor [4.17 (1.80, 9.66)]. Conclusions The risk of 90-day mortality after cataract surgery is low, even for patients at higher risk for mortality such as the elderly and those with a high preoperative disease burden. Financial Disclosure(s) The author(s) have no proprietary or commercial interest in any materials discussed in this article. To identify predictors of mortality within 90 days of cataract surgery. A retrospective cohort study. A total of 45 082 patients who underwent cataract surgery in the Veterans Health Administration (VHA) between October 1, 2005 and September 30, 2007. The National Patient (US) Care Database (NPCD) was used to identify all patients who underwent outpatient extracapsular cataract surgery performed in the VHA and who had only 1 cataract surgery within 90 days of the index surgery. Data collected includes demographics, number of hospitalizations within 1 year before surgery, postoperative mortality, and systemic comorbidities using the Charlson Comorbidity Index (CCI), which predicts the 1-year mortality for a patient based on a range of co-morbid conditions scored 1, 2, 3 or 6 depending on the risk of dying associated with the condition. Adjusted odds ratios (OR) of factors predictive of 90-day mortality were calculated using logistical regression modeling. Mortality within 90 days of cataract surgery. Of the 53 786 patients who underwent cataract surgery during the study period, 45 082 met inclusion criteria. Mean age was 71.8 years; 97.6% were men; 5.0% had complex cataract surgery. The most frequent systemic comorbidities in the CCI were diabetes mellitus (40.6%), chronic pulmonary disease (21.2%), malignant neoplasms (12.5%) and congestive heart failure (CHF; 9.5%). Patients had a median CCI score of 1; 43.7% had a score ≥2. Mortality rate within 90 days after cataract surgery was 7.1 per 1000 patients. Independent predictors of 90-day postoperative mortality were [adjusted OR, (95% confidence interval; CI)]: age 80 or greater [2.54 (1.62,3.98)], CCI ≥2 [2.06 (1.58, 2.70)], ≥1 hospitalizations in the past year [1.85 (1.45, 2.36)], chronic pulmonary disease (CPD) [1.69 (1.34,2.14)], CHF [1.71 (1.29,2.14)], cirrhosis [2.60 (1.31,5.15)], multiple myeloma or leukemia [2.20 (1.07,4.53)], and metastatic solid tumor [4.17 (1.80, 9.66)]. The risk of 90-day mortality after cataract surgery is low, even for patients at higher risk for mortality such as the elderly and those with a high preoperative disease burden.

This is a retrospective analysis of the impact of moderate dysplasia at the resection margin for early stage cancer of the oral tongue.Patients with T1-2N0 oral tongue cancer treated with surgery alone at Fox Chase Cancer Center (FCCC) from 1990 to 2010 were reviewed. Tumor and margin characteristics were abstracted from the pathology report. Overall survival (OS), disease-free survival (DFS) and local control (LC) were calculated using the Kaplan Meier method. Predictors of LC, OS and DFS were analyzed.126 Patients met the inclusion criteria. Dysplasia was present at the final margin in 36% of the cases (severe: 9%, moderate: 15%, mild: 12%). Median follow-up was 52 months. 3 and 5-year actuarial LC for the entire cohort was 77% and 73%, respectively. Actuarial 5-year LC and DFS were significantly worse for patients with moderate or severe dysplasia at the margin vs. none or mild dysplasia at the margin (49% vs 82%, p=0.005 and 49% vs 80%, p=0.008, respectively); 3-year comparisons were not significant. When analyzed separately, the detrimental local effect of moderate dysplasia at the margin persisted (p=0.02) and the effect of severe dysplasia at the margin was approaching significance (p=0.1). Mild dysplasia at the margin did not significantly impair LC or DFS. Multivariate analysis demonstrated worse LC (HR: 2.99, p=0.006) and DFS (HR: 2.84, p=0.008) associated with severe or moderate dysplasia at the margin.Both severe and moderate dysplasia at the margin appear to be correlated with inferior LC and DFS. Additional therapy may be justified, despite added morbidity.

Although implantable cardioverter defibrillator (ICD) leads are prone to failure and Food and Drug Administration recall, comprehensive longitudinal studies investigating contemporary ICD lead survival rate in the United States are lacking. All patients receiving Medtronic, Boston Scientific, or St. Jude Medical transvenous ICD leads at the hospitals of the University of Pittsburgh Medical Center from 2000 to 2012 were included. Leads were classified as (1) functional lead, patient deceased; (2) functional lead, replaced; (3) failed lead, replaced; or (4) functional lead, active. Kaplan-Meier survival curves were constructed for all lead models separately and in aggregate. We followed 5,288 patients (1,020 Quattro, 623 Fidelis, 627 Riata, 828 Durata, and 2,190 Reliance) over 3.7 ± 3.3 years. Functional leads that were replaced included 30 Quattro (3%), 99 Fidelis (16%), 24 Riata (4%), 24 Durata (3%), and 62 Reliance (3%). Leads replaced because of failure included 11 Quattro (1%), 47 Fidelis (8%), 38 Riata (6%), 18 Durata (2%), and 26 Reliance (1%; p <0.001 for Food and Drug Administration recalled vs nonrecalled leads). Overall survival rate of all leads was 89.3% at 5 years. Survival curves of Riata and Fidelis diverged from nonrecalled leads at approximately 2 years. In conclusion, the overall survival rate of ICD leads is nearly 90% at 5 years. Survival curves of recalled leads diverge from nonrecalled leads after 2 years of implantation. These data have important implications on postmarket release monitoring of ICD leads and physicians' choice of leads.

Objectives: Skin adnexal carcinoma (SAC) is a rare cutaneous malignancy that arises from sebaceous and sweat glands. These carcinomas are believed to behave more aggressively than cutaneous squamous cell carcinomas (SCC) with a propensity for local recurrence. The role of adjuvant radiotherapy in SAC is undefined. Methods: We retrospectively reviewed all cases of head and neck SAC treated with surgery and adjuvant radiation from 2000 to 2012 at a single institution. Results: Nine cases were identified. Median age was 67 (range, 52 to 88) years. The histologies were: adnexal carcinoma (n=1), adnexal carcinoma with sebaceous differentiation (n=1), adnexal carcinoma with squamous differentiation (n=1), skin appendage carcinoma (n=1), sclerosing sweat duct carcinoma (n=1), mucinous carcinoma (n=1), ductal eccrine adenocarcinoma (n=1), porocarcinoma (n=1), and trichilemmal carcinoma (n=1). All tumors were reviewed by a dermatopathologist to confirm the SAC diagnosis. All patients had undergone surgery. Indications for adjuvant radiation included involved lymph nodes (n=4), perineural invasion (n=2), nodal extracapsular extension (n=2), positive margin (n=1), high-grade histology (n=6), multifocal disease (n=2), and/or recurrent disease (n=5). Radiation was delivered to the primary site alone (n=3), to the draining lymphatics alone (n=2), or to both (n=4). One patient received concurrent cisplatin. Median dose to the primary site was 60 Gy and to the neck was 50 Gy. Median follow-up was 4.0 years (range, 0.6 to 11.4 y). Locoregional control was 100%. Five-year progression-free survival was 89%. There was 1 acute grade 3 toxicity and no greater than or equal to grade 2 late toxicities were recorded. Conclusions: Surgery and adjuvant radiation for high-risk SAC offers excellent locoregional control with acceptable toxicity.

Polycomb Repressive Complex 2 (PRC2) is an epigenetic regulator induced in many cancers. It is thought to drive tumorigenesis by repressing division, stemness, and/or developmental regulators. Cancers evade immune detection, and diverse immune regulators are perturbed in different tumors. It is unclear how such cell-specific effects are coordinated. Here, we show a profound and cancer-selective role for PRC2 in repressing multiple cytokine pathways. We find that PRC2 represses hundreds of IFNγ stimulated genes (ISGs), cytokines and cytokine receptors. This target repertoire is significantly broadened in cancer vs non-cancer cells, and is distinct in different cancer types. PRC2 is therefore a higher order regulator of the immune program in cancer cells. Inhibiting PRC2 with either RNAi or EZH2 inhibitors activates cytokine/cytokine receptor promoters marked with bivalent H3K27me3/H3K4me3 chromatin, and augments responsiveness to diverse immune signals. PRC2 inhibition rescues immune gene induction even in the absence of SWI/SNF, a tumor suppressor defective in ~20% of human cancers. This novel PRC2 function in tumor cells could profoundly impact the mechanism of action and efficacy of EZH2 inhibitors in cancer treatment.

Bronchospasm induced in non-asthmatic human subjects can be easily reversed by a deep inspiration (DI) whereas bronchospasm that occurs spontaneously in asthmatic subjects cannot. This physiological effect of a DI has been attributed to the manner in which a DI causes airway smooth muscle (ASM) cells to stretch, but underlying molecular mechanisms–and their failure in asthma–remain obscure. Using cells and tissues from wild type and zyxin-/- mice we report responses to a transient stretch of physiologic magnitude and duration. At the level of the cytoskeleton, zyxin facilitated repair at sites of stress fiber fragmentation. At the level of the isolated ASM cell, zyxin facilitated recovery of contractile force. Finally, at the level of the small airway embedded with a precision cut lung slice, zyxin slowed airway dilation. Thus, at each level zyxin stabilized ASM structure and contractile properties at current muscle length. Furthermore, when we examined tissue samples from humans who died as the result of an asthma attack, we found increased accumulation of zyxin compared with non-asthmatics and asthmatics who died of other causes. Together, these data suggest a biophysical role for zyxin in fatal asthma.

One of the hallmarks of anxiety disorders is impaired cognitive control, affecting working memory (WM). The dorsolateral prefrontal cortex (dlPFC) is critical for WM; however, it is still unclear how dlPFC activity relates to WM impairments in patients. Forty-one healthy volunteers and 32 anxiety (general and/or social anxiety disorder) patients completed the Sternberg WM paradigm during safety and unpredictable shock threat. On each trial, a series of letters was presented, followed by brief retention and response intervals. On low- and high-load trials, subjects retained the series (five and eight letters, respectively) in the original order, while on sort trials, subjects rearranged the series (five letters) in alphabetical order. We sampled the blood oxygenation level-dependent activity during retention using a bilateral anatomical dlPFC mask. Compared to controls, patients showed increased reaction time during high-load trials, greater right dlPFC activity and reduced dlPFC activity during threat. These results suggest that WM performance for patients and controls may rely on distinct patterns of dlPFC activity with patients requiring bilateral dlPFC activity. These results are consistent with reduced efficiency of WM in anxiety patients. This reduced efficiency may be due to an inefficient allocation of dlPFC resources across hemispheres or a decreased overall dlPFC capacity.

To the Editor: Clinical trials and real-world data generally suggest that biologics do not increase susceptibility to COVID-19.1Jones M.E. Kohn A.H. Pourali S.P. et al.The use of biologics during the COVID-19 pandemic.Dermatol Clin. 2021; 39: 545-553https://doi.org/10.1016/j.det.2021.05.010Abstract Full Text Full Text PDF PubMed Scopus (12) Google Scholar However, it remains unknown whether these therapies may confer a protective effect against contracting COVID-19. Therefore, we sought to assess the risk of COVID-19 infection in patients with psoriasis compared with the general population and in patients receiving systemic and topical therapies. This study used the Symphony Health dataset, a large repository of pharmacy data, inpatient and outpatient medical claims, and remittance data (over 300 million patients, 7 million COVID-19 cases, and payer information: Medicaid/Medicare/commercial/cash). Patients with at least 2 recorded International Classification of Diseases-10 diagnosis codes for psoriasis (L40.x) (n = 167,027) and controls without International Classification of Diseases-10 codes for psoriasis (n = 1,002,162) were randomly sampled in a 1:6 ratio between May 1, 2019, and January 1, 2020. Two recorded diagnosis codes for psoriasis were required to increase the positive predictive value, a strategy employed by prior studies.2Icen M. Crowson C.S. McEvoy M.T. Gabriel S.E. Maradit Kremers H. Potential misclassification of patients with psoriasis in electronic databases.J Am Acad Dermatol. 2008; 59: 981-985https://doi.org/10.1016/j.jaad.2008.08.034Abstract Full Text Full Text PDF PubMed Scopus (52) Google Scholar,3Takeshita J. Gelfand J.M. Li P. et al.Psoriasis in the US Medicare population: prevalence, treatment, and factors associated with biologic use.J Invest Dermatol. 2015; 135: 2955-2963https://doi.org/10.1038/jid.2015.296Abstract Full Text Full Text PDF PubMed Scopus (93) Google Scholar Each patient was assigned to 1 of 9 mutually exclusive cohorts based on the last prescription dispense (biologic: Tumor necrosis factor [TNF]-α inhibitor, ustekinumab, interleukin [IL] 17 inhibitor, and IL-23 inhibitor; oral: acitretin, cyclosporine, methotrexate, and apremilast cohorts; topical: none of the above medications). Follow-up began on January 1, 2020, and ended with the first occurrence of any of the following: (1) COVID-19 diagnosis code or (2) November 11, 2020 (the end of the study). Vaccination status was unable to be ascertained from the database because Emergency Use Authorization vaccine approved by the Food and Drug Administration did not occur until December 2020. Demographics were summarized by frequency (percentage) and mean (SD) (Table I). Logistic regression models were constructed with psoriasis status as the independent variable, COVID-19 International Classification of Diseases-10 diagnosis code as the dependent variable, and the following covariates: age, sex, race, congestive heart failure (I50.X), chronic obstructive pulmonary disease (J41/J43/J44), type-2 diabetes mellitus (E11.x/E13.x), and obesity (E66.0-E66.2/E66.8-E66.9/Z68.3-Z68.5).Table ICohort characteristicsDemographicsPsoriasis (n = 167,027)No psoriasis (n = 1,002,162)Total (n = 1,169,189)Male No. (%)77,725 (46.5)444,472 (44.3)522,197 (44.7)Age, mean (SD), y58.1 (13.6)57.7 (16.1)57.7 (15.7)Race No. (%) Caucasian132,036 (79.1)748,490 (74.7)880,526 (75.3) Hispanic15,568 (9.3)90,413 (9.0)105,981 (9.1) African American13,848 (8.3)130,392 (13.0)144,240 (12.3) Asian2894 (1.7)17,171 (1.7)20,065 (1.7) Other2681 (1.6)15,696 (1.6)18,377 (1.6)High-risk factors (ICD-10) for COVID-19, No. (%) Congestive heart failure10,354 (6.2)48,025 (4.8)58,379 (5.0) Type 1 diabetes mellitus37,975 (22.7)158,987 (15.9)196,962 (16.9) Obesity44,557 (26.7)145,347 (14.5)189,904 (16.2) Chronic obstructive pulmonary disease16,514 (9.9)64,145 (6.4)80,659 (6.9)Psoriasis treatment cohorts∗ Topical99,395 (59.5)NANASystemic treatmentsOral systemic cohort, n = 31,468 (18.8)Biologic cohort†, n = 36,164 (21.7)Total systemic treatments received, n = 67,632Oral systemics No. (%) Methotrexate21,478 (68.3)230 (0.6)21,708 (32.1) Apremilast7398 (23.5)99 (0.3)7497 (11.1) Cyclosporine1573 (5.0)7 (0.02)1580 (2.3) Acitretin1072 (3.4)5 (0.01)1077 (1.6)Biologics No. (%) TNF-α inhibitorsAdalimumab09553 (26.4)9553 (14.1)Infliximab03366 (9.3)3366 (5.0)Etanercept04201 (11.6)4201 (6.2)Certolizumab01438 (4.0)1438 (2.1) IL-12/23 inhibitorUstekinumab05085 (14.1)5085 (7.5) IL-17 inhibitorsSecukinumab06266 (17.3)6266 (9.3)Ixekizumab03135 (8.7)3135 (4.6)Brodalumab0142 (0.4)142 (0.2) IL-23 inhibitorsGuselkumab01687 (4.7)1687 (2.5)Risankizumab01021 (2.8)1021 (1.5)Tildrakizumab0312 (0.9)312 (0.5)ICD, International Classification of Diseases; IL, interleukin; NA, not available; TNF, tumor necrosis factor. Open table in a new tab ICD, International Classification of Diseases; IL, interleukin; NA, not available; TNF, tumor necrosis factor. Psoriasis was associated with 18% higher odds of incident COVID-19 (adjusted odd ratio [aOR], 1.18; 95% CI, 1.13-1.23) compared with controls (Supplementary Fig 1, available via Mendeley at https://data.mendeley.com/datasets/68fht87h68/1). In contrast to data from Northeast Italian cohorts, our results appear to align with recent findings from a global registry-based study suggesting that patients receiving no systemic therapy were estimated to have an increased risk of COVID-19 hospitalization compared with patients on biologics.4Piaserico S. Gisondi P. Cazzaniga S. Naldi L. Lack of evidence for an increased risk of severe COVID-19 in psoriasis patients on biologics: a cohort study from Northeast Italy.Am J Clin Dermatol. 2020; 21: 749-751https://doi.org/10.1007/s40257-020-00552-wCrossref PubMed Scopus (19) Google Scholar,5Mahil S.K. Dand N. Mason K.J. et al.Factors associated with adverse COVID-19 outcomes in patients with psoriasis-insights from a global registry-based study.J Allergy Clin Immunol. 2021; 147: 60-71https://doi.org/10.1016/j.jaci.2020.10.007Abstract Full Text Full Text PDF PubMed Scopus (100) Google Scholar In analyses of psoriasis patients (Fig 1), TNF inhibitor (aOR, 0.87; 95% CI, 0.77-1.00), methotrexate (aOR, 0.81; 95% CI, 0.71-0.92), and apremilast (aOR, 0.70; 95% CI, 0.57-0.87) use had decreased odds of incident COVID-19 compared with patients on topical therapy. Odds ratios remained unchanged after excluding patients on concomitant biologic and oral therapy. Among the limitations, first, we cannot differentiate between the impact of psoriasis severity and systemic therapy on the risk of COVID-19, because disease severity was defined based on treatment history. Second, smoking status and other cardiovascular comorbidities were not adjusted in the logistic regression model. Nonetheless, the protective role exerted by TNF-inhibitor and methotrexate is supported by the mechanistic plausibility of proinflammatory cytokine inhibition, particularly of TNF-α, IL-6, and IL-1. Our findings suggest that these drug classes do not increase the risk of acquiring COVID-19 and, thus, are safe options for continuing psoriasis treatment during the COVID-19 pandemic. Dr Wu is or has been an investigator, consultant, or speaker for AbbVie, Almirall, Amgen, Arcutis, Aristea Therapeutics, Boehringer Ingelheim, Bristol-Myers Squibb, Dermavant, Dr Reddy's Laboratories, Eli Lilly, Galderma, Janssen, LEO Pharma, Mindera, Novartis, Regeneron, Sanofi Genzyme, Solius, Sun Pharmaceutical, UCB, Valeant Pharmaceuticals North America LLC, and Zerigo Health. With no relation to the present work, Dr Egeberg has received research funding from Pfizer, Eli Lilly, Novartis, Bristol-Myers Squibb, AbbVie, Janssen Pharmaceuticals, the Danish National Psoriasis Foundation, the Simon Spies Foundation, and the Kgl Hofbundtmager Aage Bang Foundation, and honoraria as a consultant and/or speaker from AbbVie, Almirall, Leo Pharma, Galápagos NV, Sun Pharmaceuticals, Samsung Bioepis Co, Ltd, Pfizer, Eli Lilly and Company, Novartis, Galderma, Dermavant, UCB, Mylan, Bristol-Myers Squibb, and Janssen Pharmaceuticals. Authors Liu, Thatiparthi, and Martin have no conflicts of interest to declare.

Increasing detection of early-stage papillary thyroid neoplasms without improvements in mortality has prompted development of strategies to prevent or mitigate overtreatment.To determine adoption rates of 2 recent strategies developed to limit overtreatment of low-risk thyroid cancers: (1) a new classification, noninvasive follicular thyroid neoplasm with papillarylike nuclear features (NIFTP), and (2) hemithyroidectomy for selected papillary thyroid carcinomas (PTCs) up to 4 cm in size.This is a cross-sectional analysis of 3368 pathology records of 2 cohorts of patients from 18 hospitals in 6 countries during 2 time periods (2015 and 2019). Participating hospitals were included from the US (n = 12), Canada (n = 2), Denmark (n = 1), South Korea (n = 1), South Africa (n = 1), and India (n = 1). The records of the first 100 patients per institution for each year who underwent thyroid-directed surgery (hemithyroidectomy, total thyroidectomy, or completion thyroidectomy) were reviewed.Frequency of diagnosis of NIFTP, PTCs, and thyroidectomies during the study period.Of the 790 papillary thyroid neoplasms captured in the 2019 cohort, 38 (4.8%) were diagnosed as NIFTP. Diagnosis of NIFTP was observed in the US, South Africa, and India. There was minimal difference in the total proportion of PTCs in the 2015 cohort compared with the 2019 cohort (778 [47.1%] vs 752 [44.5%]; difference, 2.6% [95% CI, -16.9% to 22.1%]). The proportion of PTCs eligible for hemithyroidectomy but treated with total thyroidectomy in the 2 cohorts demonstrated a decreasing trend from 2015 to 2019 (341 of 453 [75.3%] vs 253 of 434 [58.3%]; difference, 17.0% [95% CI, -1.2% to 35.2%]).Results of this cohort study showed that the 2 mitigation strategies for preventing overtreatment of early-stage thyroid cancer have had mixed success. The diagnosis of NIFTP has only been applied to a small proportion of thyroid neoplasms compared with expected rates. However, more patients eligible for hemithyroidectomy received it in 2019 compared with 2015, showing some success with this deescalation strategy.

Abstract Panic disorder is characterized by sudden, repeated, and unexpected attacks of intense fear and overwhelming anxiety about when another attack may strike. Patients with panic disorder and healthy individuals with a history of panic attacks show a hypersensitivity to unpredictable threats, suggesting a possible link between panic and sustained anxiety. The purpose of this study was to determine the degree to which induced symptoms of panic relate to fear and anxiety, as well as activity in the neural systems that mediate and regulate these affective states. Psychological and physiological symptoms of panic were assessed during an 8-min 7.5% CO 2 challenge task. Psychological, physiological, and neural symptoms of fear and anxiety were measured during two sessions (one psychophysiology and one functional magnetic resonance imaging where subjects experienced several blocks of no threat (N), predictable shock (P), and unpredictable shock (U; NPU threat task). We used a principle component analysis to characterize panic susceptibility (PS), and found that PS significantly predicted dorsolateral prefrontal cortex (dlPFC) activity to the unpredictable cue during the NPU threat task. When examining the weighted beta coefficients from this analysis, we observed that self-reported fear/anxiety during the CO 2 challenge negatively loaded onto dlPFC activity during the NPU task. Consistent with this observation, dlPFC activity during the unpredictable cue was also negatively correlated with anxiety during the NPU sessions. Together, these results suggest that panic symptoms and anxiety are regulated by the same prefrontal cognitive control system.

Positive margins are known to impact survival in oral cavity squamous cell carcinoma (OCSCC). We aimed to determine the impact of positive margins on survival and whether radiation improves survival following positive margins.Data was obtained from the National Cancer Database and included patients with cT1T2N0 OCSCC. Survival outcomes were assessed via log-rank test. Cox-regression analysis was performed to determine if positive margins or radiation, when applicable, correlated with survival after accounting for covariates.Positive margin patients had worse overall survival compared to negative margin control (HR = 1.76, p < 0.001) and reduced survival by 13%. On multivariate analysis, positive margins correlated with survival (HR = 1.60, p < 0.001). Radiation did not improve survival in positive margin patients (HR = 0.99, p = 0.55).Patients with positive margins have an 11-15% worse overall survival. Radiation does not appear to impact survival in patients with a positive margin.

Abstract Background Survival disparities between Black and White head and neck cancer patients are well documented, with access to care and socioeconomic status as major contributors. We set out to assess the role of self-reported race in head and neck cancer by evaluating treatment outcomes of patients enrolled in clinical trials, where access to care and socioeconomic status confounders are minimized. Methods Clinical trial data from the Radiation Therapy Oncology Group studies were obtained. Studies were included if they were therapeutic trials that employed survival as an endpoint. Studies that did not report survival as an endpoint were excluded; 7 Radiation Therapy Oncology Group Studies were included for study. For each Black patient enrolled in a clinical trial, a study arm–matched White patient was used as a control. Results A total of 468 Black participants were identified and matched with 468 White study arm–specific controls. White participants had better outcomes than Black participants in 60% of matched pairs (P &amp;lt; .001). Black participants were consistently more likely to have worse outcomes. When outcomes were measured by progression-free survival or disease-free survival, the failure rate was statistically significantly higher in Black participants (hazard ratio [HR] = 1.50, P &amp;lt; .001). Failure was largely due to locoregional failure, and Black participants were at higher risk (subdistribution HR =1.51, P = .002). The development of distant metastasis within the paired cohorts was not statistically significantly different. Conclusion In this study of clinical trial participants using self-reported race, Black participants consistently had worse outcomes in comparison to study arm–specific White controls. Further study is needed to confirm these findings and to explore causes underlying this disparity.

Abstract Objective Medical literature identifies stark racial disparities in head and neck cancer (HNC) in the United States, primarily between non‐Hispanic white (NHW) and non‐Hispanic black (NHB) populations. The etiology of this disparity is often attributed to inequitable access to health care and socioeconomic status (SES). However, other contributors have been reported. We performed a systematic review to better understand the multifactorial landscape driving racial disparities in HNC. Data Sources A systematic review was conducted in Covidence following Preferred Reporting Items for Systematic Reviews and Meta‐analyses Guidelines. A search of PubMed, SCOPUS, and CINAHL for literature published through November 2022 evaluating racial disparities in HNC identified 2309 publications. Review Methods Full texts were screened by 2 authors independently, and inconsistencies were resolved by consensus. Three hundred forty publications were ultimately selected and categorized into themes including disparities in access/SES, treatment, lifestyle, and biology. Racial groups examined included NHB and NHW patients but also included Hispanic, Native American, and Asian/Pacific Islander patients to a lesser extent. Results Of the 340 articles, 192 focused on themes of access/SES, including access to high‐quality hospitals, insurance coverage, and transportation contributing to disparate HNC outcomes. Additional themes discussed in 148 articles included incongruities in surgical recommendations, tobacco/alcohol use, human papillomavirus‐associated malignancies, and race‐informed silencing of tumor suppressor genes. Conclusion Differential access to care plays a significant role in racial disparities in HNC, disproportionately affecting NHB populations. However, there are other significant themes driving racial disparities. Future studies should focus on providing equitable access to care while also addressing these additional sources of disparities in HNC.

Abstract Head and Neck Squamous Cell Carcinoma (HNSCC) impose a significant health burden, necessitating innovative therapeutic strategies to enhance treatment efficacy. Current standard treatments, including surgery, radiation therapy, and chemotherapy, often exhibit limited effectiveness and cause substantial side effects. This underscores the critical need for novel therapies that selectively target cancer cells, sparing normal tissue. Survival from HNSCC is poor, and importantly, a racial disparity between African Americans (AfAm) and European Americans (EuAm) has been known for some time. Ancestry Informative Markers (AIMs) are associated with altered mRNA expression of Polβ where higher expression of Polβ was observed among AfAm patients in comparison to EuAm patients. Our research focuses on DNA polymerase beta (Polβ) and its role in replication stress and response to chemotherapy and DNA damage response modifiers. Elevated expression of Polβ is linked to increased DNA damage and genomic instability, contributing to treatment resistance. In this regard, our investigations reveal a regulatory role for base excision repair (BER) proteins, including Polβ, in the cellular response to inhibitors of poly(ADP-ribose) glycohydrolase (PARG), an enzyme involved in poly(ADP-ribose) (PAR) degradation. Inhibition of PARG triggers a robust intra-S phase response, activating ATR and CHK1 signaling. Exploiting the synthetic lethality between PARG inhibition and ATR/CHK1 inhibition, we have demonstrated the ability to overcome Polβ overexpression mediated treatment resistance in HNSCC cells. Specifically, our in vitro studies demonstrate that the response to a combination of an ATR inhibitor and PARG inhibitor is impacted by Polβ expression in HNSCC cells, with synergistic effects surpassing the efficacy of the individual inhibitors. Similarly, the combination of a CHK1 inhibitor and PARG inhibitor proves effective in cells with elevated Polβ expression, offering a potential dual therapeutic strategy. These combinations exhibit promising potential for HNSCC treatment when Polβ expression is elevated. In conclusion, our findings propose a novel therapeutic paradigm for HNSCC, employing combination therapy with ATR or CHK1 inhibitors and PARG inhibitors. This approach offers a targeted strategy, presenting a promising avenue for the development of more effective and less toxic treatment modalities in the management of HNSCC and may help overcome resistance from elevated expression of Polβ. Citation Format: Md Maruf Khan, Anusha Angajala, Denise Y. Gibbs, Jeffrey C. Liu, Camille Ragin, Robert W. Sobol. DNA polymerase beta expression in head &amp; neck cancer modulates the poly-ADP-ribose-mediated replication checkpoint [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 7129.

The role of radiotherapy (RT) in the management of Merkel cell carcinoma (MCC) is controversial. The authors of this report evaluated the rates and patterns of failure in a selected group of patients who underwent RT for MCC of the head and neck (HN).The records of 145 consecutive patients with MCC of the HN who presented to the authors' institution between 1988 and 2009 were reviewed. Only patients who received RT at the institution were included. The cumulative incidence of locoregional failure (LRF), distant metastatic failure (DMF), disease progression (DP) and disease-specific death (DSD) were estimated with death as a competing risk.Forty-eight patients were identified. The median follow-up was 51 months (range, 6-220 months) for living patients. LRF developed in 5 patients (10%), and those patients had a median time to recurrence of 3 months. Two of the 5 LRFs were local and developed at the edge of the treatment field; the remaining 3 LRFs were in lymph nodes and occurred outside the treatment field. DMF developed in 12 patients (25%). The estimated 5-year cumulative incidences of LRF, DP, and DSD were 10%, 30%, and 21%, respectively. Acute toxicities included 5 episodes (10%) of grade 3 dermatitis and 1 episode (2%) of grade 3 mucositis.The authors report a site-specific series of patients with HN MCC who received RT. In this group of patients with adverse features, RT was well tolerated, and LRF was low. The propensity for MCC to recur at the edge of the treatment field suggests that generous margins are appropriate when RT is administered.

J Oral Pathol Med (2012) 41 : 424–431 Background: Adenoid cystic carcinoma (ACC) of salivary gland is characterized by advanced local invasion and distant metastasis. Intratumoral hypoxia was reported to be associated with epithelial–mesenchymal transition (EMT) regulators. The purpose of this study was to evaluate the relationship between hypoxia‐inducible factor (HIF)‐2α, TWIST2, and SIP1 expression and the invasion and metastasis in ACC of salivary gland. Method: In vitro we first detected the expression of HIF‐2α, TWIST2, and SIP1 in two ACC cell lines by Western blot and real‐time RT‐PCR. Then, in vivo , a retrospective investigation of 121 patients with ACC from Department of Oral and Maxillofacial Surgery, West China Hospital of Stomatology, Sichuan University between 1996 and 2005 was carried out using immunohistochemistry to analyze the association between the expression of these three factors and clinical–pathological factors of patients. Results: The protein and mRNA levels of HIF‐2α, TWIST2, and SIP1 in the high‐metastasis cell line (ACC‐M) were much higher than those of the low‐metastasis cell line (ACC‐2). The positive expression of HIF‐2α, TWIST2, and SIP1 (71.07%, 42.98%, and 38.02%, respectively) was associated with the perineural invasion, the local recurrence, and distant metastasis of patients with ACC ( P &lt; 0.05). The patients with the positive coexpression of the three factors had a lower survival rate than those with the negative expression ( P &lt; 0.05). Conclusion: It is proposed that the elevated expression of HIF‐2α, TWIST2, and SIP1 can contribute to invasion and metastasis of ACC, and there might be some correlation between the hypoxia microenvironment and EMT in ACC.

BACKGROUND African Americans with head and neck squamous cell carcinoma (HNSCC) have a lower survival rate than whites. This study investigated the functional importance of ancestry‐informative single‐nucleotide polymorphisms (SNPs) in HNSCC and also examined the effect of functionally important genetic elements on racial disparities in HNSCC survival. METHODS Ancestry‐informative SNPs, RNA sequencing, methylation, and copy number variation data for 316 oral cavity and laryngeal cancer patients were analyzed across 178 DNA repair genes. The results of expression quantitative trait locus (eQTL) analyses were also replicated with a Gene Expression Omnibus (GEO) data set. The effects of eQTLs on overall survival (OS) and disease‐free survival (DFS) were evaluated. RESULTS Five ancestry‐related SNPs were identified as cis‐eQTLs in the DNA polymerase β ( POLB ) gene (false discovery rate [FDR] &lt; 0.01). The homozygous/heterozygous genotypes containing the African allele showed higher POLB expression than the homozygous white allele genotype ( P &lt; .001). A replication study using a GEO data set validated all 5 eQTLs and also showed a statistically significant difference in POLB expression based on genetic ancestry ( P = .002). An association was observed between these eQTLs and OS ( P &lt; .037; FDR &lt; 0.0363) as well as DFS ( P = .018 to .0629; FDR &lt; 0.079) for oral cavity and laryngeal cancer patients treated with platinum‐based chemotherapy and/or radiotherapy. Genotypes containing the African allele were associated with poor OS/DFS in comparison with homozygous genotypes harboring the white allele. CONCLUSIONS Analyses show that ancestry‐related alleles could act as eQTLs in HNSCC and support the association of ancestry‐related genetic factors with survival disparities in patients diagnosed with oral cavity and laryngeal cancer. Cancer 2017;123:849–60. © 2016 American Cancer Society .

SCCRO (squamous cell carcinoma-related oncogene; also known as DCUN1D1) is a highly conserved gene that functions as an E3 in neddylation. Although inactivation of SCCRO in yeast results in lethality, SCCRO−/− mice are viable. The exclusive presence of highly conserved paralogues in higher organisms led us to assess whether compensation by SCCRO paralogues rescues lethality in SCCRO−/− mice. Using murine and Drosophila models, we assessed the in vivo activities of SCCRO and its paralogues in cullin neddylation. We found that SCCRO family members have overlapping and antagonistic activity that regulates neddylation and cell proliferation activities in vivo. In flies, both dSCCRO and dSCCRO3 promote neddylation and cell proliferation, whereas dSCCRO4 negatively regulates these processes. Analysis of somatic clones showed that the effects that these paralogues have on proliferation serve to promote cell competition, leading to apoptosis in clones with a net decrease in neddylation activity. We found that dSCCRO and, to a lesser extent, dSCCRO3 rescue the neddylation and proliferation defects promoted by expression of SCCRO4. dSCCRO and dSCCRO3 functioned cooperatively, with their coexpression resulting in an increase in both the neddylated cullin fraction and proliferation activity. In contrast, human SCCRO and SCCRO4 promote, and human SCCRO3 inhibits, neddylation and proliferation when expressed in flies. Our findings provide the first insights into the mechanisms through which SCCRO family members cooperatively regulate neddylation and cell proliferation. SCCRO (squamous cell carcinoma-related oncogene; also known as DCUN1D1) is a highly conserved gene that functions as an E3 in neddylation. Although inactivation of SCCRO in yeast results in lethality, SCCRO−/− mice are viable. The exclusive presence of highly conserved paralogues in higher organisms led us to assess whether compensation by SCCRO paralogues rescues lethality in SCCRO−/− mice. Using murine and Drosophila models, we assessed the in vivo activities of SCCRO and its paralogues in cullin neddylation. We found that SCCRO family members have overlapping and antagonistic activity that regulates neddylation and cell proliferation activities in vivo. In flies, both dSCCRO and dSCCRO3 promote neddylation and cell proliferation, whereas dSCCRO4 negatively regulates these processes. Analysis of somatic clones showed that the effects that these paralogues have on proliferation serve to promote cell competition, leading to apoptosis in clones with a net decrease in neddylation activity. We found that dSCCRO and, to a lesser extent, dSCCRO3 rescue the neddylation and proliferation defects promoted by expression of SCCRO4. dSCCRO and dSCCRO3 functioned cooperatively, with their coexpression resulting in an increase in both the neddylated cullin fraction and proliferation activity. In contrast, human SCCRO and SCCRO4 promote, and human SCCRO3 inhibits, neddylation and proliferation when expressed in flies. Our findings provide the first insights into the mechanisms through which SCCRO family members cooperatively regulate neddylation and cell proliferation.

To highlight common pitfalls observed in scientific research derived from national cancer registries, predominantly the Survival, Epidemiology, and End Results Program and the National Cancer Database.Literature review and expert opinion.This state-of-the-art review consolidates the literature with editorial experiences describing how and why statistically flawed studies are usually rejected for publication, highlighting common errors in submitted articles employing national cancer registries.Pitfalls were identified in 2 major areas-design and data analysis. Design pitfalls included unbalanced cohorts, uncontrolled covariates, and flawed oncologic variables. Analytical pitfalls included incorrect application of univariate analyses, inclusion of inaccurate data, and inclusion of stage IVc disease in curative survival analysis. Additional limitations of database studies were identified, including absence of patient-related outcomes, hypothesis-generating vs practice-changing implications, and inability to differentiate between overall survival and disease-specific survival.Methodological strategies are suggested to ensure careful analytical design and appropriate interpretation. Although national cancer registries provide a wealth of data, researchers must remain vigilant when designing studies and analyzing these data sets. Inherent design flaws raise considerable problems with interpretation; however, when analyzed judiciously, registries can lead to a better understanding of cancer outcomes.

Imaging in the emergent setting carries high stakes. With increased demand for dedicated on-site service, emergency radiologists face increasingly large image volumes that require rapid turnaround times. However, novel artificial intelligence (AI) algorithms may assist trauma and emergency radiologists with efficient and accurate medical image analysis, providing an opportunity to augment human decision making, including outcome prediction and treatment planning. While traditional radiology practice involves visual assessment of medical images for detection and characterization of pathologies, AI algorithms can automatically identify subtle disease states and provide quantitative characterization of disease severity based on morphologic image details, such as geometry and fluid flow. Taken together, the benefits provided by implementing AI in radiology have the potential to improve workflow efficiency, engender faster turnaround results for complex cases, and reduce heavy workloads. Although analysis of AI applications within abdominopelvic imaging has primarily focused on oncologic detection, localization, and treatment response, several promising algorithms have been developed for use in the emergency setting. This article aims to establish a general understanding of the AI algorithms used in emergent image-based tasks and to discuss the challenges associated with the implementation of AI into the clinical workflow.

INTRODUCTION: Gliomas are the most common malignant brain tumour. Despite standard-of-care therapy, these tumours inevitably recur. Recurrent tumours are often treatment-resistant and associated with a poor prognosis, and there is an urgent need for novel treatments. METHODS: The epigenome-wide methylome, transcriptome, and proteome was analyzed in a total of 271 samples from 176 patients with gliomas, including 166 primary (pre-treatment) and 105 recurrent (post-treatment) tumours. Included is a unique cohort of 81 patients with paired tumour samples collected at both pre- and post- treatment. RESULTS: Epigenomics accounted for the majority of observed variance between samples and was driven by IDH status. Paired analyses identified epigenetic stability in IDH wildtype tumours at recurrence, compared to a loss of methylation at recurrence in IDH mutant tumours. Loss of methylation in IDH mutant gliomas at recurrence was driven by astrocytomas undergoing malignant transformation. Integrated, multi-platform analyses of paired samples undergoing malignant transformation identified novel genetic markers and pathways of transformation. Finally, a novel subgroup of IDH wildtype GBM with improved survival and a distinct proteomics signature was discovered. Multi-platform analyses characterized this novel subgroup as exhibiting hypermethylation, increased DNA mismatch repair and cell cycle regulation, and an altered tumour microenvironment. CONCLUSIONS: In conclusion, this study identifies targetable molecular factors that promote malignant transformation in IDH mutant gliomas and classifies a novel subgroup of IDH wildtype GBM with improved prognosis.

INTRODUCTION: Aside from surgery, radiotherapy (RT) remains the only treatment for meningiomas. However, patient selection for adjuvant RT remains controversial. METHODS: We utilized publicly available molecular datasets of meningiomas and generated de novo DNA-methylation and RNA-sequencing data. Meningiomas were classified into different molecular and methylation groups based on the methodologies of their original publications (Nassiri et al. [2021], Bayley et al. [2022], Choudhury et al. [2022], Sahm et al.[2017]) and progression-free survival (PFS) following surgery with and without adjuvant RT were analyzed. RESULTS: A total of 2029 meningiomas from 11 different institutions with adjuvant RT data were included. Adjuvant RT was associated with improved PFS in WHO grade 1 meningiomas following subtotal resection (STR), WHO grade 2 meningiomas following gross total resection (GTR) or STR, and immunogenic (COCA1) and NF2-wildtype (COCA2) meningiomas following STR. Multivariable analysis using Cox proportional hazards regression models showed that having a meningioma belonging to a hypermetabolic (COCA3) (HR 2.49, 95% CI 1.71-3.62), or proliferative (COCA4) (HR 3.77, 95% CI 2.78-5.10) group were associated with worse PFS when controlling for age, gender, extent of resection, and receipt of adjuvant RT. Meningiomas belonging to DKFZ MC-intermediate, MC-malignant, MenGC, and UCSF hypermitotic groups were also associated with worse outcomes. These relationships held true even in subgroup analysis with only WHO grade 2 meningiomas and following propensity score matching for the same clinical covariates above. Nearly all molecular and methylation classifications predicted 5-year PFS following surgery and adjuvant RT (area under the curve [AUC] 0.61-0.72) better than WHO grade (AUC 0.51). CONCLUSIONS: Molecular classification improves outcome prediction for meningiomas following surgery and adjuvant radiotherapy, supporting the rationale for molecularly informed treatment decisions and clinical trial stratification.

Objective: To review the management of cerebrospinal fluid leak after vestibular schwannoma removal reported in the literature and to present a novel approach to management of recalcitrant cases. Data Sources: MEDLINE and PubMed literature search using the terms “cerebrospinal fluid leak” or “cerebrospinal fluid fistula” and “acoustic neuroma” or “vestibular schwannoma” covering the period from 1985 to present in English. A review of bibliographies of these studies was also performed. Study Selection: Criteria for inclusion in this meta-analysis consisted of the availability of extractable data from studies presenting a defined group of patients who had undergone primary vestibular schwannoma removal and for whom the presence and absence of cerebrospinal fluid leakage was reported. Studies reporting combined approaches were excluded. No duplications of patient populations were included. Twenty-five studies met the inclusion criteria. Data Extraction: Quality of the studies was determined by the design of each study and the ability to combine the data with the results of other studies. All of the studies were biased by their retrospective, nonrandomized nature. Data Synthesis: Significance (p < 0.05) was determined using the χ2 test. Conclusions: Incisional cerebrospinal fluid leakage responded well to local management and lumbar drainage. Rhinorrhea often necessitated surgical intervention. No specific reoperation techniques correlated exclusively with better reoperation outcomes. The transaural/transnasal approach presents an alternative for surgical management of cerebrospinal fluid rhinorrhea.

AimsGiven design similarities and a common manufacturer, there have been suspicions regarding the Durata™ defibrillator (ICD) lead, in the aftermath of the Riata™ class I recall. We therefore examined the failure-free survival rates of the Durata™ compared with the Riata™ and Sprint Quattro™ ICD leads.

Head & NeckVolume 35, Issue 11 p. 1567-1572 Original Article Outcome of resection of infratemporal fossa tumors Babak Givi MD, Corresponding Author Babak Givi MD Department of Otolaryngology, Head and Neck Surgery, New York University, New York, NYDepartment of Otolaryngology, Head and Neck Surgery, New York University, 423 E 23rd St. New York, NY 10010. E-mail: [email protected]Search for more papers by this authorJeffrey Liu MD, Jeffrey Liu MD Department of Otolaryngology, Head and Neck Surgery, Temple University, Philadelphia, PennsylvaniaSearch for more papers by this authorMark Bilsky MD, Mark Bilsky MD Neurosurgical Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorBabak Mehrara MD, Babak Mehrara MD Plastic and Reconstructive Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorJoseph Disa MD, Joseph Disa MD Plastic and Reconstructive Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorAndrea Pusic MD, Andrea Pusic MD Plastic and Reconstructive Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorPeter Cordeiro MD, Peter Cordeiro MD Plastic and Reconstructive Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorJatin P. Shah MD, Jatin P. Shah MD Head and Neck Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorDennis H. Kraus MD, Dennis H. Kraus MD Head and Neck Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this author Babak Givi MD, Corresponding Author Babak Givi MD Department of Otolaryngology, Head and Neck Surgery, New York University, New York, NYDepartment of Otolaryngology, Head and Neck Surgery, New York University, 423 E 23rd St. New York, NY 10010. E-mail: [email protected]Search for more papers by this authorJeffrey Liu MD, Jeffrey Liu MD Department of Otolaryngology, Head and Neck Surgery, Temple University, Philadelphia, PennsylvaniaSearch for more papers by this authorMark Bilsky MD, Mark Bilsky MD Neurosurgical Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorBabak Mehrara MD, Babak Mehrara MD Plastic and Reconstructive Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorJoseph Disa MD, Joseph Disa MD Plastic and Reconstructive Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorAndrea Pusic MD, Andrea Pusic MD Plastic and Reconstructive Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorPeter Cordeiro MD, Peter Cordeiro MD Plastic and Reconstructive Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorJatin P. Shah MD, Jatin P. Shah MD Head and Neck Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this authorDennis H. Kraus MD, Dennis H. Kraus MD Head and Neck Service, Department of Surgery, Memorial Sloan–Kettering Cancer Center, New York, New YorkSearch for more papers by this author First published: 16 January 2013 https://doi.org/10.1002/hed.23186Citations: 17 This work was presented at the 20th North American Skull Base Society Annual Meeting, October 14–18, 2009, New Orleans, Louisiana. Read the full textAboutPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onEmailFacebookTwitterLinkedInRedditWechat Abstract Background A variety of tumors arise in or extend to the infratemporal fossa. We investigated the outcome of surgical management of these tumors. Methods We conducted a retrospective review of a craniofacial approach to resection of infratemporal fossa tumors from 1992 to 2008 in a cancer center. Results Forty-three patients underwent resection of a infratemporal fossa tumors (68% men). Median age was 46 years (range, 1–81 years). The most common pathology was sarcoma (13; 30%). Twenty-two tumors (51%) were recurrent. Twenty patients (46%) underwent resection of tumors from the infratemporal fossa, 5 (12%) required resection of the anterior skull base, and 18 (42%) required orbital exenteration, additionally. Thirty-one patients (72%) required reconstruction with free tissue transfer. Twenty-seven patients (62.8%) required further treatment with radiation and/or chemotherapy. Complications occurred in 9 patients (21%). Six patients (14%) underwent salvage operations. Median follow-up was 24 months. Median overall survival and 3-year survival were 40 months and 59.6%. Conclusion Tumors involving the infratemporal fossa can be resected with acceptable morbidity and long-term survival. © 2013 Wiley Periodicals, Inc. Head Neck, 35: 1567–1572, 2013 REFERENCES 1Shah JP, Kraus DH, Bilsky MH, Gutin PH, Harrison LH, Strong EW. Craniofacial resection for malignant tumors involving the anterior skull base. Arch Otolaryngol Head Neck Surg 1997; 123: 1312–1317. 10.1001/archotol.1997.01900120062010 CASPubMedWeb of Science®Google Scholar 2Bilsky MH, Kraus DH, Strong EW, Harrison LB, Gutin PH, Shah JP. Extended anterior craniofacial resection for intracranial extension of malignant tumors. Am J Surg 1997; 174: 565–568. 10.1016/S0002-9610(97)00172-4 CASPubMedWeb of Science®Google Scholar 3Bigelow DC, Smith PG, Leonetti JP, Backer RL, Grubb RL, Kotapka MJ. Treatment of malignant neoplasms of the lateral cranial base with the combined frontotemporal-anterolateral approach: five-year follow-up. Otolaryngol Head Neck Surg 1999; 120: 17–24. 10.1016/S0194-5998(99)70364-5 CASPubMedWeb of Science®Google Scholar 4Bentz BG, Bilsky MH, Shah JP, Kraus D. Anterior skull base surgery for malignant tumors: a multivariate analysis of 27 years of experience. Head Neck 2003; 25: 515–520. 10.1002/hed.10250 PubMedWeb of Science®Google Scholar 5Ganly I, Patel SG, Singh B, et al. Craniofacial resection for malignant paranasal sinus tumors: report of an International Collaborative Study. Head Neck 2005; 27: 575–584. 10.1002/hed.20165 CASPubMedWeb of Science®Google Scholar 6Patel SG, Singh B, Polluri A, et al. Craniofacial surgery for malignant skull base tumors: report of an international collaborative study. Cancer 2003; 98: 1179–1187. 10.1002/cncr.11630 PubMedWeb of Science®Google Scholar 7Dias FL, Sá GM, Kligerman J, Nogueira J, Galvão ML, Lima RA. Prognostic factors and outcome in craniofacial surgery for malignant cutaneous tumors involving the anterior skull base. Arch Otolaryngol Head Neck Surg 1997; 123: 738–742. 10.1001/archotol.1997.01900070082013 CASPubMedWeb of Science®Google Scholar 8Sekhar LN, Janecka IP, Jones NF. Subtemporal-infratemporal and basal subfrontal approach to extensive cranial base tumours. Acta Neurochir (Wien) 1988; 92: 83–92. 10.1007/BF01401977 CASPubMedWeb of Science®Google Scholar 9Smith PG, Grubb RL, Kletzker GR, Leonetti JP. Combined pterional-anterolateral approaches to cranial base tumors. Otolaryngol Head Neck Surg 1990; 103: 357–363. 10.1177/019459989010300304 CASPubMedWeb of Science®Google Scholar 10Seifert V, Dietz H. Combined orbito-frontal, sub- and infratemporal fossa approach to skull base neoplasms. Surgical technique and clinical application. Acta Neurochir (Wien) 1992; 114: 139–144. 10.1007/BF01400603 CASPubMedWeb of Science®Google Scholar 11Iannetti G, Belli E, Cicconetti A, Delfini R, Ciappetta P. Infratemporal fossa surgery for malignant diseases. Acta Neurochir (Wien) 1996; 138: 658–671; discussion 671. 10.1007/BF01411469 CASPubMedWeb of Science®Google Scholar 12Irish JC, Gullane PJ, Gentili F, et al. Tumors of the skull base: outcome and survival analysis of 77 cases. Head Neck 1994; 16: 3–10. 10.1002/hed.2880160103 CASPubMedWeb of Science®Google Scholar 13Bilsky MH, Bentz B, Vitax T, Shah J, Kraus D. Craniofacial resection for cranial base malignancies involving the infratemporal fossa. Neurosurgery 2005; 57(4 Suppl): 339–347; discussion 339–347. 10.1227/01.NEU.0000176648.06547.15 PubMedWeb of Science®Google Scholar 14Hentschel SJ, Vora Y, Suki D, Hanna EY, DeMonte F. Malignant tumors of the anterolateral skull base. Neurosurgery 2010; 66: 102–112; discussion 112. 10.1227/01.NEU.0000362033.38035.25 PubMedWeb of Science®Google Scholar 15Krespi YP. Lateral skull base surgery for cancer. Laryngoscope 1989; 99: 514–524. 10.1288/00005537-198905000-00010 CASPubMedWeb of Science®Google Scholar 16Manolidis S, Pappas D Jr, Von Doersten P, Jackson CG, Glasscock ME III. Temporal bone and lateral skull base malignancy: experience and results with 81 patients. Am J Otol 1998; 19(6 Suppl): S1–15. CASPubMedWeb of Science®Google Scholar 17Sen C, Triana A, Hiltzik D, et al. Malignant tumors involving the lateral skull base. Clin Neurosurg 2001; 48: 373–386. CASPubMedGoogle Scholar 18Dos Santos LR, Cernea CR, Brandao LG, et al. Results and prognostic factors in skull base surgery. Am J Surg 1994; 168: 481–484. 10.1016/S0002-9610(05)80106-0 CASPubMedWeb of Science®Google Scholar 19Brisman MH, Sen C, Catalano P. Results of surgery for head and neck tumors that involve the carotid artery at the skull base. J Neurosurg 1997; 86: 787–792. 10.3171/jns.1997.86.5.0787 CASPubMedWeb of Science®Google Scholar 20Kraus DH, Gonen M, Mener D, Brown AE, Bilsky MH, Shah JP. A standardized regimen of antibiotics prevents infectious complications in skull base surgery. Laryngoscope 2005; 115: 1347–1357. 10.1097/01.mlg.0000172201.61487.69 CASPubMedWeb of Science®Google Scholar 21Ganly I, Patel SG, Singh B, et al. Complications of craniofacial resection for malignant tumors of the skull base: report of an International Collaborative Study. Head Neck 2005; 27: 445–451. 10.1002/hed.20166 CASPubMedWeb of Science®Google Scholar Citing Literature Volume35, Issue11November 2013Pages 1567-1572 ReferencesRelatedInformation

Laryngeal cancer disproportionately affects more African-Americans than European-Americans. Here, we analyze the genome-wide somatic point mutations from the tumors of 13 African-Americans and 57 European-Americans from TCGA to differentiate between environmental and ancestrally-inherited factors. The mean number of mutations was different between African-Americans (151.31) and European-Americans (277.63). Other differences in the overall mutational landscape between African-American and European-American were also found. The frequency of C > A, and C > G were significantly different between the two populations (p-value < 0.05). Context nucleotide signatures for some mutation types significantly differ between these two populations. Thus, the context nucleotide signatures along with other factors could be related to the observed mutational landscape differences between two races. Finally, we show that mutated genes associated with these mutational differences differ between the two populations. Thus, at the molecular level, race appears to be a factor in the progression of laryngeal cancer with ancestral genomic signatures best explaining these differences.

Video applications and analytics are routinely projected as a stressing and significant service of the Nationwide Public Safety Broadband Network. As part of a NIST PSCR funded effort, the New Jersey Office of Homeland Security and Preparedness and MIT Lincoln Laboratory have been developing a computer vision dataset of operational and representative public safety scenarios. The scale and scope of this dataset necessitates a hierarchical organization approach for efficient compute and storage. We overview architectural considerations using the Lincoln Laboratory Supercomputing Cluster as a test architecture. We then describe how we intelligently organized the dataset across LLSC and evaluated it with large scale imagery inference across terabytes of data.

Very elderly patients have not been well-represented in the randomized trials that established the benefits of cardiac resynchronization therapy (CRT) in heart failure (HF) patients. We therefore compared clinical outcomes in CRT-defibrillator (CRT-D) recipients ≥80 and <80 years old.We compared mortality and time to first appropriate shock in 258 consecutive CRT-D patients ≥80 years old with New York Heart Association II-IV HF, left ventricular ejection fraction ≤35%, QRS duration ≥120 ms, and no prior sustained ventricular tachyarrhythmias to 1058 patients <80 years old implanted with CRT-D during the same timeframe. Comorbidities and medical therapy differed significantly between the groups. During 52 ± 36 months, 123 (48%) patients ≥80 and 474 (45%) patients <80 died; mortality was significantly higher among patients ≥80 [corrected hazard ratio (HR) 1.39, 95% confidence interval (CI) 1.12-1.72; P = 0.003]. Among 258 patients ≥80 with device follow-up, only 20 (8%) received an appropriate shock compared with 172 (17%) shocks in 1053 patients <80 years old. Time to first appropriate shock was significantly shorter in patients <80 (corrected HR 0.51, 95% CI 0.30-0.87, P = 0.013). Older patients experienced 14 inappropriate shocks, and while life-threatening device complications were rare, complications related to the high-power components of the CRT-D system were not infrequent (n = 11).Mortality among CRT-D recipients ≥80 years old is higher than in younger patients but is not excessive. The risk of appropriate device shocks in older patients is relatively low and significantly less than in younger patients. These observations suggest that CRT-pacemakers should be given due consideration in elderly HF patients.

This invited article reviews the grant process to include the following objectives: (1) to provide an understanding of otolaryngology funding mechanisms in the context of career progression; (2) to outline key components of a well‐written grant; (3) to highlight vital members of a successful research team, with emphasis on the mentor‐mentee relationship; and (4) to clarify grant scoring with emphasis on common pitfalls to avoid. Current otolaryngology funding mechanisms and up‐to‐date resources are provided. The review is aimed to assist otolaryngology residents, faculty new to the grant process, as well as experienced researchers striving to improve their grant review scores.

Medical Journal of AustraliaVolume 214, Issue 8 p. 365-370 ResearchFree Access High prevalence of Crohn disease and ulcerative colitis among older people in Sydney Aviv Pudipeddi, Corresponding Author Aviv Pudipeddi avivpudipeddi@gmail.com Concord Repatriation General Hospital, Sydney, NSW Correspondence avivpudipeddi@gmail.comSearch for more papers by this authorJeffrey Liu, Jeffrey Liu Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorViraj Kariyawasam, Viraj Kariyawasam Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorThomas J Borody, Thomas J Borody Centre for Digestive Diseases, Sydney, NSWSearch for more papers by this authorJames L Cowlishaw, James L Cowlishaw Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorCharles McDonald, Charles McDonald Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorPeter Katelaris, Peter Katelaris University of Sydney, Sydney, NSWSearch for more papers by this authorGrace Chapman, Grace Chapman Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorCrispin Corte, Crispin Corte AW Morrow Gastroenterology and Liver Centre, Royal Prince Albert Hospital, Sydney, NSWSearch for more papers by this authorDaniel A Lemberg, Daniel A Lemberg Sydney Children's Hospital, Sydney, NSWSearch for more papers by this authorCheng H Lee, Cheng H Lee Children's Hospital at Westmead, Sydney, NSWSearch for more papers by this authorAnil Keshava, Anil Keshava Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorJohn Napoli, John Napoli Ryde Hospital, Sydney, NSWSearch for more papers by this authorRobert Clancy, Robert Clancy Centre for Digestive Diseases, Sydney, NSWSearch for more papers by this authorWebber Chan, Webber Chan Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorSudarshan Paramsothy, Sudarshan Paramsothy Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorRupert Leong, Rupert Leong orcid.org/0000-0001-5944-3488 Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this author Aviv Pudipeddi, Corresponding Author Aviv Pudipeddi avivpudipeddi@gmail.com Concord Repatriation General Hospital, Sydney, NSW Correspondence avivpudipeddi@gmail.comSearch for more papers by this authorJeffrey Liu, Jeffrey Liu Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorViraj Kariyawasam, Viraj Kariyawasam Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorThomas J Borody, Thomas J Borody Centre for Digestive Diseases, Sydney, NSWSearch for more papers by this authorJames L Cowlishaw, James L Cowlishaw Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorCharles McDonald, Charles McDonald Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorPeter Katelaris, Peter Katelaris University of Sydney, Sydney, NSWSearch for more papers by this authorGrace Chapman, Grace Chapman Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorCrispin Corte, Crispin Corte AW Morrow Gastroenterology and Liver Centre, Royal Prince Albert Hospital, Sydney, NSWSearch for more papers by this authorDaniel A Lemberg, Daniel A Lemberg Sydney Children's Hospital, Sydney, NSWSearch for more papers by this authorCheng H Lee, Cheng H Lee Children's Hospital at Westmead, Sydney, NSWSearch for more papers by this authorAnil Keshava, Anil Keshava Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorJohn Napoli, John Napoli Ryde Hospital, Sydney, NSWSearch for more papers by this authorRobert Clancy, Robert Clancy Centre for Digestive Diseases, Sydney, NSWSearch for more papers by this authorWebber Chan, Webber Chan Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorSudarshan Paramsothy, Sudarshan Paramsothy Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this authorRupert Leong, Rupert Leong orcid.org/0000-0001-5944-3488 Concord Repatriation General Hospital, Sydney, NSWSearch for more papers by this author First published: 27 January 2021 https://doi.org/10.5694/mja2.50910Citations: 2AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat Abstract Objectives To determine the age-standardised prevalence of inflammatory bowel disease (IBD) in a metropolitan area of Sydney, with a focus on its prevalence among older people. Design, setting Population-based epidemiological study of people with IBD in the City of Canada Bay, a local government area in the inner west of Sydney, during 1 March 2016 – 10 November 2016. Participants Patients diagnosed with confirmed IBD according to the Copenhagen or revised Porto criteria. Main outcome measures Crude prevalence of IBD, including Crohn disease and ulcerative colitis; age-standardised prevalence of IBD, based on the World Health Organization standard population; prevalence rates among people aged 65 years or more. Results The median age of 364 people with IBD was 47 years (IQR, 34–62 years); 185 were women (50.8%). The crude IBD prevalence rate was 414 cases (95% CI, 371–456 cases) per 100 000 population; the age-standardised rate was 348 cases (95% CI, 312–385 cases) per 100 000 population. The age-standardised rate for Crohn disease was 166 cases (95% CI, 141–192 cases) per 100 000 population; for ulcerative colitis, 148 cases (95% CI, 124–171 cases) per 100 000 population. The IBD prevalence rate in people aged 65 years or more was 612 cases (95% CI, 564‒660 cases) per 100 000, and for those aged 85 years or more, 891 cases (95% CI, 833–949 cases) per 100 000; for people under 65, the rate was 380 cases (95% CI, 342–418 cases) per 100 000. Conclusions We found that the prevalence of confirmed IBD in a metropolitan sample was highest among older people. Challenges for managing older patients with IBD include higher rates of comorbid conditions, polypharmacy, and cognitive decline, and the immunosuppressive nature of standard therapies for IBD. The known: The prevalence of inflammatory bowel disease (IBD) is increasing worldwide. However, recent age-standardised prevalence data for Australia are not available. The new: The age-standardised IBD prevalence rate of 348 cases per 100 000 population we found is the highest ever reported in Australia. Its prevalence was higher in older people: 612 per 100 000 people aged 65 years or more and 891 per 100 000 people aged 85 years or more. The implications: Given the higher prevalence of IBD among older people in metropolitan Sydney, and their higher risk of infections, doctors should consider replacing systemic immunosuppressive therapies with alternatives when possible. The worldwide burden of inflammatory bowel disease (IBD), which includes Crohn disease and ulcerative colitis, has increased markedly over the past sixty years,1 partly because IBD is incurable but rarely fatal.2 Its prevalence is greatest (but stable) in western Europe and North America,1 but its incidence has risen over the past two decades in more recently industrialised countries in Asia, South America, and Africa.3, 4 The burden associated with IBD in Australia is high; it was estimated to have incurred more than $2.7 billion in costs in 2012.5, 6 Earlier epidemiological studies in Victoria (2010–11)5 and Tasmania (2013–14)7 included mixed urban and rural populations; in a multi-nation Asia–Pacific study, epidemiological variations were associated with population density and proximity to metropolitan areas.8 Young people with IBD may move to cities for education and employment, reducing the apparent prevalence of IBD in rural areas. It was recently reported that IBD prevalence rates in Lothian (Scotland) were very high among people aged 60–79 years (1178 per 100 000) or 80 years or more (1042 per 100 000), and they are projected to rise further by 2028.9 The use of immunosuppressive therapies to treat IBD in these age groups is problematic, as opportunistic infections, sepsis, comorbid conditions, and malignancy are more frequent in older patients. We therefore examined age-specific prevalence rates of IBD in a defined metropolitan area of Australia, focusing on its prevalence in older people. Methods Population characteristics We assessed the prevalence of IBD in the City of Canada Bay, a local government area in the inner west of Sydney, with a population of 88 015 at the time of data collection (Box 1).10 Concord Hospital, a centrally located public hospital with an established IBD clinic, provides free health care for patients with IBD. Box 1. The City of Canada Bay local government area Source: City of Canada Bay Council.10 Reproduced with kind permission of the copyright holder, .id (https://home.id.com.au). Data collection We analysed clinical data for people with IBD living in the City of Canada Bay (postcodes 2046, 2047, 2137, 2138) during 1 March 2016 – 10 November 2016, including those reviewed by gastroenterologists outside the study area. We identified people treated at Concord Hospital according to International Classification of Diseases, 10th revision (ICD-10) coding. We also obtained information on patients from gastroenterologists and colorectal surgeons at Concord Hospital, private gastroenterology and colorectal surgery practices, the Sydney IBD database (ambulatory IBD patients identified in medical records from Concord Hospital and City of Canada Bay community gastroenterologists), and the paediatric IBD database of the Westmead Children's Hospital. Two authors (AP, JL) collected patient data in standardised forms. Given the heterogeneity of the data sources, various search methods were employed to identify patients, including searches for keywords (eg, Crohn, colitis, IBD), pharmaceutical prescriptions, and ICD-10 codes. Demographic data (patient's initials, sex, age, postcode) were collected to check for duplication and for analyses of point prevalence. "Older person" was defined as someone aged 65 years or more. Clinical data (IBD subtype, age at diagnosis) were obtained from patient medical records. The most recently updated IBD phenotype details (according to the Montreal classification11) were also collected. Inflammatory bowel disease: diagnostic criteria We included only patients with confirmed IBD according to the internationally recognised Copenhagen12, 13 (Supporting Information, table 1) and revised Porto criteria14 for clinical, endoscopic, radiological and histological findings. Each included IBD case was independently verified by two of the authors (AP, JL). Data analysis Crude IBD prevalence rates were calculated by dividing the number of confirmed cases by the City of Canada Bay resident population; rates were separately calculated for Crohn disease, ulcerative colitis, and IBD unclassified (IBDU). Rates, with 95% confidence intervals (CIs), were expressed per 100 000 population. Direct age standardisation was based on the World Health Organization standard population,15 permitting comparisons with overseas data; 95% CIs were calculated with the Keyfitz formula.16 Statistical analysis was performed in the Statistical Package for the Social Sciences (SPSS) Statistics 23. Ethics approval Our study was approved by the Sydney Local Health District Human Research Ethics Committee (reference, HREC/16/CRGH/21). Results Demographic characteristics and phenotypes We identified 364 prevalent cases of IBD; the median age of patients was 47 years (interquartile range [IQR], 34–62 years; range, 7–100 years), and 185 patients were women (50.8%). The median duration of IBD was 8 years for Crohn disease (IQR, 4–17 years), 10 years for ulcerative colitis (IQR, 4–18 years) and 11 years for IBDU (IQR, 4–14.5 years) (Box 2). Box 2. Demographic characteristics of residents of the City of Canada Bay with inflammatory bowel disease Inflammatory bowel disease type All Crohn disease Ulcerative colitis Unspecified 364 164 160 40 Sex (male) 179 (49%) 82 (50%) 83 (52%) 14 (35%) Age (years), median (IQR) 47.0 (34.0–62.0) 45.5 (31.0–56.3) 46.5 (36.0–63.0) 56.5 (43.3–76.0) Disease duration (years), median (IQR) 9.0 (4.0–17.0) 8.0 (4.0–17.0) 10.0 (4.0–18.0) 11.0 (4.0–13.5) IQR = interquartile range. Complete phenotypic details were available for 163 of 164 cases of Crohn disease (99.4%) and 159 of 160 cases of ulcerative colitis (99.4%). Most patients with Crohn disease were diagnosed when aged 17–40 years and had disease affecting both the ileum and colon (68 of 164 patients, 41%). Disease was usually inflammatory but non-stricturing and non-penetrating (98 patients, 60%); 37 patients (23%) were classified as having peri-anal disease. The most frequent disease extent for ulcerative colitis was left-sided colitis (63 of 160 patients, 39%) (Box 3). Box 3. Inflammatory bowel disease phenotypes of patients in the City of Canada Bay, according to the Montreal classification11 Phenotype characteristics Crohn disease 164 Age at diagnosis (years) < 16 17 (10%) 17–40 95 (58%) > 40 51 (31%) Missing data 1 Disease extent L1 (ileal) 43 (26%) L2 (colonic) 53 (32%) L3 (ileo-colonic) 68 (41%) L4 (isolated upper gastrointestinal involvement) 0 Disease behaviour B1 (non-stricturing and non-penetrating) 98 (60%) B2 (stricturing) 34 (21%) B3 (penetrating) 31 (19%) P (perianal involvement) 37 (23%) Missing data 1 Ulcerative colitis Disease extent 160 E1 (proctitis) 56 (35%) E2 (left-sided colitis) 63 (39%) E3 (pancolitis) 40 (25%) Missing data 1 Prevalence rates The crude IBD prevalence rate was 414 cases (95% CI, 371–456 cases) per 100 000 population; the age-standardised rate was 348 cases (95% CI, 312–385 cases) per 100 000 population. The age-standardised prevalence of Crohn disease was slightly higher than that of ulcerative colitis (Box 4). Box 4. Prevalence of inflammatory bowel disease and its subtypes in the City of Canada Bay Subtype Number of cases Crude point prevalence rate, per 100 000 (95% CI) Age-standardised prevalence rate, per 100 000 (95% CI) All types 364 414 (371–456) 348 (312–385) Crohn disease 164 (45%) 186 (158–215) 166 (141–192) Ulcerative colitis 160 (44%) 182 (154–210) 148 (124–171) Unspecified 40 (11%) 45 (31–60) 34 (23–46) CI = confidence interval. Age-specific prevalence rates IBD prevalence increased with age (Box 5). The prevalence of Crohn disease peaked in the 50–54-year age group, that of ulcerative colitis in the 35–39-year and the 85 years or more age groups (Box 6). The age distribution was similar for both sexes (Box 7). Box 5. Age-specific prevalence of inflammatory bowel disease in the City of Canada Bay Age group (years) Number of cases Prevalence rate, per 100 000 (95% CI) 0–64 285 380 (342‒418) 0–4 0 0 5–9 1 21 (12–30) 10–14 7 174 (146–202) 15–19 7 175 (149–204) 20–24 18 287 (253–320) 25–29 29 354 (318–391) 30–34 31 365 (327–402) 35–39 42 606 (558–654) 40–44 31 484 (441–527) 45–49 34 586 (539–633) 50–54 36 663 (612–713) 55–59 26 522 (477–566) 60–64 23 538 (492–583) ≥ 65 79 612 (564‒660) 65–69 20 507 (463–551) 70–74 15 512 (468–556) 75–79 13 572 (526–619) 80–84 13 743 (689–796) ≥ 85 18 891 (833–949) CI = confidence interval. Box 6. Age-specific prevalence of inflammatory bowel disease in the City of Canada Bay, by type and age Box 7. Age-specific prevalence of inflammatory bowel disease in the City of Canada Bay, by sex Age at diagnosis Age at diagnosis was available for 362 of 364 patients (99.5%). Median age at diagnosis was 32 years (IQR, 23–48 years). For Crohn disease, the median age of diagnosis was 27 years (IQR, 20–41.5 years) for men, 31.5 years (IQR, 25–47 years) for women. For ulcerative colitis, the median age at diagnosis was 31 years (IQR, 24–53 years) for men, 32 years (IQR, 23–46 years) for women (Box 8). Box 8. Age at diagnosis for people in the City of Canada Bay with Crohn disease or ulcerative colitis, by sex Data sources Of the 364 cases, 175 (48%) were identified in a single data source, including 139 patients of a private gastroenterologist (Supporting Information, table 2). Discussion We have reported the first population-based IBD prevalence study in New South Wales, and the first IBD prevalence study in Australia restricted to a metropolitan area. Our population-based methodology allows direct comparison with other national and international studies (Supporting Information, table 3). We found the highest age-standardised rates of IBD (348 cases per 100 000 population), Crohn disease (166 per 100 000 population) and ulcerative colitis (148 per 100 000 population) reported by any study in Australia or New Zealand.5, 7, 17 The prevalence rate of Crohn disease was higher than that of ulcerative colitis, as also found by earlier Australian, New Zealand and Canadian studies,5, 7, 17-19 but not by older studies from Scandinavia and North America.20-22 These differences are consistent with observations over the past fifty years that the incidence of ulcerative colitis had increased but then plateaued, while that of Crohn disease has continued to increase.23 Our prevalence rates are slightly higher than reported by earlier Australian studies for mixed urban and rural populations.5, 7 The difference is probably attributable to a time-cohort effect (cumulative increase in number of IBD cases over time), but our higher rate may be related to the urban nature of our sample. A systematic review and meta-analysis found that the risks of Crohn disease (incidence rate ratio [IRR], 1.42; 95% CI, 1.26–1.60) and ulcerative colitis (IRR, 1.17; 95% CI, 1.03–1.32) were higher for urban than rural residents.22 Factors that may contribute to greater risk include higher rates of smoking (for Crohn disease), better hygiene and sanitation, antibiotic use, and air pollution in urban areas, as well as migration of young people from rural to metropolitan regions for education and employment. Further exploration of risk factors associated with urban living that may contribute to the pathogenesis of IBD is required.24 Our major finding was that the age-specific prevalence of IBD increased with age. The prevalence rate among people aged 65 years or more was 612 (95% CI, 564‒660 cases) per 100 000 population, and 380 (95% CI, 342–418 cases) per 100 000 people under 65 years of age; 79 patients with IBD (22%) were 65 years or more old, compared with 12 916 of 88 015 people (14.7%) in the City of Canada Bay population. We also found that the prevalence of IBD among people aged 85 years or more was 891 per 100 000 people. Both rates are higher than the 483 cases per 100 000 people age 65 years or more reported by an earlier Australian study, which found that IBD prevalence increased from the age of 15–24 years, and was highest among those aged 25–54 years and people aged 65 years or more.5 Our differing finding is probably attributable to a cumulative increase in the number of IBD cases over time. A Canadian study found that the prevalence of ulcerative colitis was highest among people aged 40–49 years, but was similar for older age groups.19 Findings from other studies have been heterogeneous; some North American studies reported, like us, a steady increase in IBD prevalence with age, particularly of ulcerative colitis.18, 22 As ulcerative colitis is more common among non-smokers, these patients may have lower mortality, as they are healthier than the age-matched general population, as previously reported.25 The rising prevalence of IBD with age is important for management strategies, including the use of immunosuppressive medications that exacerbate the risks of infections and malignancies in older people.26 Accurate prevalence rates allow health care administrators to efficiently plan for investigating IBD and managing patients. Our findings highlight the importance of safer therapies, appropriate cancer screening, and taking comorbid conditions into account when managing older people with IBD.27 Systemic immunosuppressive therapies should be de-escalated when possible, and newer biological agents less likely to lead to sepsis, such as ustekinumab and vedolizumab, should be considered.26 The demographic features of the City of Canada Bay are similar to those of Greater Sydney, NSW, and Australia (Supporting Information, table 4), except for higher proportions than the Australian population of people with Chinese (17% v 5.2%) or Italian ancestry (15% v 4.3%). Extrapolating the IBD prevalence rate in Canada Bay would suggest that 16 797 people in Greater Sydney, 26 046 in NSW, and 81 485 in Australia live with IBD. By way of comparison, it was estimated in 2013 that the number of people in Australia living with IBD in 2016 would lie in the range 72 805–89 502.6 Strengths and limitations We fully characterised all included patients to confirm diagnoses according to the Copenhagen and revised Porto criteria. Duplication of cases was avoided by uniquely identifying each case. Phenotypic details were available for all but two patients, perhaps explaining the larger proportion of IBDU patients than in other studies. In contrast, detailed information on disease location in another Australian study was available for only 350 of 579 patients with prevalent Crohn disease (60%).5 Limitations include the fact that we undertook a retrospective review of medical records, and we may have missed patients who sought gastroenterology care outside the City of Canada Bay. Mild cases of IBD may be managed by family physicians, but they do not usually manage IBD without involving a specialist gastroenterologist.28 We used different search methods to reduce selection bias, including searches of paper medical records and for keywords in electronic medical records. Further, we selected an area with a small population compared with some other studies. However, the smaller population facilitated full case ascertainment in a metropolitan area, an approach not previously undertaken in Australia. The ethnic background, socio-economic status, and urban nature of our population may affect the generalisability of our findings to Australia as a whole. Finally, undiagnosed IBD is possible, as the median time from symptom onset to diagnosis is 4 months for ulcerative colitis and 9 months for Crohn disease.29 Conclusion In the first IBD prevalence study in New South Wales, the most populous state in Australia, we found that its prevalence was high in the City of Canada Bay, particularly among people aged 65 years or more. The high age-specific IBD prevalence in the middle-aged and older people has important implications for treatment decisions. Competing interests Viraj Kariyawasam undertakes consultancy work for Janssen-Cilag and has received grants from Takeda, Ferring, Abbvie, and Shire. Thomas Borody has a pecuniary interest in the Centre for Digestive Diseases and sits on advisory boards for Redhill, Crestovo, and Finch Therapeutics. Crispin Corte has received unrestricted research grants from Shire and Ferring, and has received speakers' honoraria from Abbvie, Ferring, Janssen, Takeda, and Shire. Rupert Leong has served on advisory boards for AbbVie, Aspen, Celgene, Ferring, Janssen, and Takeda, and has received unrestricted research support from the National Health and Medical Research Council, Shire, and Janssen, and speakers' honoraria from Emerge Health. Supporting Information Filename Description mja250910-sup-0001-supinfo.pdfPDF document, 888.7 KB Supplementary Material Supplementary information and results Please note: The publisher is not responsible for the content or functionality of any supporting information supplied by the authors. Any queries (other than missing content) should be directed to the corresponding author for the article. References 1Ng SC, Shi HY, Hamidi N, et al. Worldwide incidence and prevalence of inflammatory bowel disease in the 21st century: a systematic review of population-based studies. Lancet 2018; 390: 2769– 2778. CrossrefPubMedWeb of Science®Google Scholar 2Coward S, Clement F, Benchimol EI, et al. Past and future burden of inflammatory bowel disease based on modeling of population-based data. Gastroenterology 2019; 156: 1345– 1353. CrossrefPubMedWeb of Science®Google Scholar 3Ng SC, Tang W, Ching JY, et al. Asia-Pacific Crohn's and Colitis Epidemiologic Study (ACCESS) Study Group. Incidence and phenotype of inflammatory bowel disease based on results from the Asia-Pacific Crohn's and colitis epidemiological study. Gastroenterology 2013; 145: 158– 165. CrossrefPubMedWeb of Science®Google Scholar 4Ray K. IBD: the changing epidemiology of IBD. Nat Rev Gastroenterol Hepatol 2017; 14: 690. Web of Science®Google Scholar 5Studd C, Cameron G, Beswick L, et al. Never underestimate inflammatory bowel disease: high prevalence rates and confirmation of high incidence rates in Australia. J Gastroenterol Hepatol 2016; 31: 81– 86. Wiley Online LibraryPubMedWeb of Science®Google Scholar 6 PricewaterhouseCoopers Australia; Crohn's and Colitis Australia. Improving inflammatory bowel disease care across Australia. Mar 2013. https://www.crohnsandcolitis.com.au/site/wp-content/uploads/PwC-report-2013.pdf (viewed June 2019). Google Scholar 7Bhatia R, Yeoh SW, Vaz K, et al. Inflammatory bowel disease incidence, prevalence and 12-month initial disease course in Tasmania, Australia. Intern Med J 2019; 49: 622– 630. Wiley Online LibraryPubMedWeb of Science®Google Scholar 8Ng SC, Kaplan GG, Tang W, et al. Population density and risk of inflammatory bowel disease: a prospective population-based study in 13 countries or regions in Asia-Pacific. Am J Gastroenterol 2019; 114: 107– 115. CrossrefPubMedWeb of Science®Google Scholar 9Jones GR, Lyons M, Plevris N, et al. IBD prevalence in Lothian, Scotland, derived by capture-recapture methodology. Gut 2019; 68: 1953– 1960. CrossrefPubMedWeb of Science®Google Scholar 10 City of Canada Bay Council. Welcome to the City of Canada Bay: community profile. Updated Oct 2016. http://profile.id.com.au/canada-bay/about (viewed Nov 2016). Google Scholar 11Silverberg MS, Satsangi J, Ahmad T, et al. Toward an integrated clinical, molecular and serological classification of inflammatory bowel disease: report of a Working Party of the 2005 Montreal World Congress of Gastroenterology. Can J Gastroenterol 2005; 19 (Suppl A): 5A– 36A. CrossrefPubMedWeb of Science®Google Scholar 12Munkholm P. Crohn's disease: occurrence, course and prognosis. An epidemiologic cohort-study. Dan Med Bull 1997; 44: 287– 302. CASPubMedWeb of Science®Google Scholar 13Langholz E. Ulcerative colitis. An epidemiological study based on a regional inception cohort, with special reference to disease course and prognosis. Dan Med Bull 1999; 46: 400– 415. CASPubMedWeb of Science®Google Scholar 14Levine A, Koletzko S, Turner D, et al. European Society of Pediatric Gastroenterology, Hepatology, and Nutrition. ESPGHAN revised Porto criteria for the diagnosis of inflammatory bowel disease in children and adolescents. J Pediatr Gastroenterol Nutr 2014; 58: 795– 806. CrossrefCASPubMedWeb of Science®Google Scholar 15Ahmad OB, Boschi-Pinot C, Lopez AD, et al. Age standardization of rates: a new WHO standard (GPE Discussion paper series: No. 31). Geneva: World Health Organization, 2001. http://who.int/healthinfo/paper31.pdf (viewed Sept 2019). Google Scholar 16Keyfitz N. Sampling variance of standardized mortality rates. Hum Biol 1966; 38: 309– 317. CASPubMedWeb of Science®Google Scholar 17Gearry RB, Richardson A, Frampton C, et al. High incidence of Crohn's disease in Canterbury, New Zealand: results of an epidemiologic study. Inflamm Bowel Dis 2006; 12: 936– 943. Wiley Online LibraryPubMedWeb of Science®Google Scholar 18Bernstein CN, Wajda A, Svenson LW, et al. The epidemiology of inflammatory bowel disease in Canada: a population-based study. Am J Gastroenterol 2006; 101: 1559– 1568. CrossrefPubMedWeb of Science®Google Scholar 19Bitton A, Vutcovici M, Patenaude V, et al. Epidemiology of inflammatory bowel disease in Quebec: recent trends. Inflamm Bowel Dis 2014; 20: 1770– 1776. CrossrefPubMedWeb of Science®Google Scholar 20Jacobsen BA, Fallingborg J, Rasmussen HH, et al. Increase in incidence and prevalence of inflammatory bowel disease in northern Denmark: a population-based study, 1978–2002. Eur J Gastroenterol Hepatol 2006; 18: 601– 606. CrossrefPubMedWeb of Science®Google Scholar 21Loftus CG, Loftus EV, Harmsen WS, et al. Update on the incidence and prevalence of Crohn's disease and ulcerative colitis in Olmsted County, Minnesota, 1940–2000. Inflamm Bowel Dis 2007; 13: 254– 261. Wiley Online LibraryPubMedWeb of Science®Google Scholar 22Kappelman MD, Rifas-Shiman SL, Kleinman K, et al. The prevalence and geographic distribution of Crohn's disease and ulcerative colitis in the United States. Clin Gastroenterol Hepatol 2007; 5: 1424– 1429. CrossrefPubMedWeb of Science®Google Scholar 23Ng SC, Bernstein CN, Vatn MH, et al; Epidemiology and Natural History Task Force of the International Organization of Inflammatory Bowel Disease (IOIBD). Geographical variability and environmental risk factors in inflammatory bowel disease. Gut 2013; 62: 630– 649. CrossrefPubMedWeb of Science®Google Scholar 24Soon IS, Molodecky NA, Rabi DM, et al. The relationship between urban environment and the inflammatory bowel diseases: a systematic review and meta-analysis. BMC Gastroenterol 2012; 12: 51. CrossrefPubMedWeb of Science®Google Scholar 25Selinger CP, Andrews J, Dent OF, et al. Cause-specific mortality and 30-year relative survival of Crohn's disease and ulcerative colitis. Inflamm Bowel Dis 2013; 19: 1880– 1888. PubMedWeb of Science®Google Scholar 26Pudipeddi A, Kariyawasam V, Haifer C, et al. Safety of drugs used for the treatment of Crohn's disease. Expert Opin Drug Saf 2019; 18: 357– 367. CrossrefCASPubMedWeb of Science®Google Scholar 27Kariyawasam VC, Kim S, Mourad FH, et al. Comorbidities rather than age are associated with the use of immunomodulators in elderly-onset inflammatory bowel disease. Inflamm Bowel Dis 2018; 25: 1390– 1398. CrossrefWeb of Science®Google Scholar 28Tan M, Holloway RH, Lange K, et al. General practitioners' knowledge of and attitudes to inflammatory bowel disease. Intern Med J 2012; 42: 801– 807. Wiley Online LibraryCASPubMedWeb of Science®Google Scholar 29Vavricka SR, Spigaglia SM, Rogler G, et al. Systematic evaluation of risk factors for diagnostic delay in inflammatory bowel disease. Inflamm Bowel Dis 2012; 18: 496– 505. Wiley Online LibraryPubMedWeb of Science®Google Scholar Citing Literature Volume214, Issue8May 2021Pages 365-370 ReferencesRelatedInformation

Due to the public health risk associated with SARS-CoV-2 (COVID-19) infection, universal use of face masks has been recommended to protect against viral spread. Adverse facial reactions from the utilization of masks in the general public are poorly characterized in literature.We aimed to provide a systematic review of studies reporting adverse facial reactions associated with use of face masks during the COVID-19 pandemic.PubMed and Cochrane databases were searched using the following search terms: "masks" AND "skin reactions, facial dermatosis, rash, acne, atopic dermatitis, rosacea, OR seborrheic dermatitis."A total of 954 cases of dermatological adverse effects were reported. Over 17 different adverse facial reactions were found, including the top 10 in order: itch (370, 38.8%), indentation/ear pain (102, 10.7%), discomfort (90, 9.4%), erythema (72, 7.5%), dryness (62, 6.5%), rash (60, 6.3%), scarring (42, 4.4%), desquamation (22, 2.3%), pain (19, 2.0%), burning (19, 2.0%), and wheals (7, 0.7%). Face masks can increase acne (n=44), rosacea (n=14), and seborrheic dermatitis (n=9).Publication bias of articles, with limited studies available regarding this topic.Wearing face masks to protect from COVID-19 can increase adverse facial dermatoses and exacerbate underlying dermatology conditions; however, several preventative measures may be taken.

Transcription of the prolactin gene is dynamically controlled by positive and negative hormone signals that target the regulatory promoter region. Based on the inducibility of prolactin gene expression by inhibitors of histone deacetylases (HDACs), we examined the role of histone acetylation at the genomic prolactin promoter as a late step in transcriptional regulation. Chromatin immunoprecipitation analysis of GH4 cells revealed elevated levels of acetylated histones in the promoter and enhancer regions of the gene, compared with downstream intron sequences. 17beta-Estradiol stimulated histone H4 acetylation in the promoter region by 2- to 3-fold within 30 min. Dopamine inhibited histone H4 acetylation by 2-fold in 30 min, an effect mimicked by the MAPK kinase (MEK1) inhibitor U0126. In contrast, the synthetic glucocorticoid dexamethasone, which inhibits prolactin transcription, failed to alter histone acetylation over the same time frame. Association of transcription activator Pit-1 with the prolactin promoter was unchanged by hormone treatment. However, in response to dopamine, histone deacetylase HDAC2 and corepressor mSin3A were rapidly recruited to the prolactin promoter, and association was sustained above basal levels over a 1-h period. Consistent with this corepressor function, depletion of endogenous mSin3A by small interfering RNA was sufficient to enhance prolactin gene expression by 70%, comparable to the induction by the HDAC inhibitor, trichostatin A. These studies demonstrate that dopamine D2 receptor activation and inhibition of MAPK (ERK1/2) signaling lead to rapid deacetylation of histones at the genomic prolactin promoter. Recruitment of specific HDAC/ corepressor complexes may be an important mechanism for repression of target gene transcription by Gi/o-coupled receptors.

Objectives (1) To present data from the American Academy of Otolaryngology—Head and Neck Surgery (AAO‐HNS) Section for Residents and Fellows‐in‐Training (SRF) annual survey from 2002 to 2011. (2) To compare and analyze trends in resident demographics, residency experiences, and post‐training career choices. Study Design Review of cross‐sectional survey data. Setting Residents and Fellows registered as Members‐in‐Training through AAO‐HNS. Methods A review of data from surveys distributed between 2002 and 2011 was conducted. Respondent demographic data including age, postgraduate year, gender, and geographic distribution were analyzed. Responses about training experiences, fellowship selection, debt burden, and post‐training practice choice were studied in order to elicit trends. Results Respondents have consistently rated otolaryngology, anesthesia, and trauma/critical care as the most important intern rotations for otolaryngology residents. Each year, approximately 70% of respondents have reported interest in pursuing a fellowship. Pediatric otolaryngology fellowship is now the most popular fellowship among respondents. There has been a recent increase in the percentage of respondents who are interested in pursuing a career in academics. Location, family, and lifestyle have consistently been the most important factors in determining choice of practice. Respondents have reported increasing levels of educational debt. Conclusion The AAO‐HNS SRF survey collects important data regarding resident/fellow training. Several factors limit the generalizability of these results. Despite its limitations, these unique data provide valuable information for continual evaluation and improvement of physician training in the specialty.

ABSTRACT Background Most studies on human papillomavirus (HPV)‐associated oropharyngeal squamous cell carcinoma (SCC) have been performed on white Americans. Our study examined the incidence of HPV in an African American oropharyngeal SCC cohort and its survival. Methods African American patients with oropharyngeal SCC in a combined tumor registry were identified. HPV16 testing was performed by polymerase chain reaction (PCR) from DNA extracted from tumor blocks. The p16 staining was performed using standard immunohistochemistry. Results Forty‐four patients were identified for analysis. Seventy‐three percent of the tumors were HPV‐positive. Only 39% of the patients who were HPV‐positive were also p16‐positive. Survival between all 3 tumor types, patients who tested HPV‐positive/p16, HPV‐positive/p16‐positive, and HPV‐negative/p16‐negative was significantly different ( p = .03). HPV/p16 status was significant on univariate and multivariate analysis. Conclusion HPV oropharyngeal SCC is strongly present in this African American cohort. Two thirds of the patients who were HPV‐positive were p16‐negative. Greater study is needed to explain the high p16 negativity among this HPV‐positive oropharyngeal SCC African American cohort. © 2015 Wiley Periodicals, Inc. Head Neck 38 : E867–E872, 2016

The global burden of cerebrovascular disease, especially cerebral infarction has been increasing at an alarming rate with the atherosclerosis in carotid arteries as the primary risk factor. Despite the active involvement of minimally oxidized LDL (oxLDL) in atherosclerosis, limited information is available regarding the role of oxLDL in the pathogenesis of cerebrovascular diseases. The present study utilized the carotid bifurcation tissues and isolated carotid SMCs challenged with oxLDL from clinically relevant minimally invasive minimally-oxLDL-induced carotid atheroma microswine model to examine the levels of pro-atherogenic and pro-inflammatory mediators and cellular processes following immunostaining approaches. The immunopositivity of IL18, PDGFRA, IL17, LOX1, TLR4, MYF5, IL1B, and PDPN were increased in the carotid artery bifurcation tissues with a concomitant decrease in DAMPs, HMGB1 and S100B in oxLDL (600μg)-treated group compared to non-intervention control. Moreover, the cultured SMCs displayed increased level of IL18, LOX1, TLR4, MYF5, NLRP3, and PDPN upon challenging with oxLDL (100 mg/ml) compared to non-treatment control. In addition, the SMCs treated with oxLDL were resistant to the peroxidation of lipids as evident from lipid peroxidation staining. Also, the oxLDL displayed compromised mitochondrial membrane potential based on mitochondrial pore transition assay and increased hypertrophy due to decreased level of microtubules. Overall, oxLDL alters the expression status of pathological mediators and multiple biological processes in carotid SMCs aggravating carotid atherosclerosis. The understanding regarding the molecular mechanisms underlying oxLDL-driven pathological events would open novel translational avenues in the management of carotid atherosclerosis.

Abstract Primary osteosarcoma of the thyroid is an extremely rare tumor, with only 27 well‐documented cases reported in the literature, including only one in the cytology literature. We describe here an additional case with fine‐needle aspiration biopsy findings. A 60‐year‐old woman presented with a 1‐month history of progressive midline neck swelling. CT and ultrasound demonstrated a large thyroid mass with tracheal compression. Fine‐needle aspiration biopsies were performed and showed pleomorphic spindle and epithelioid neoplastic cells, multinucleated giant cells, and scant metachromatic extracellular matrix material. Cell block sections contained minute tissue fragments with neoplastic spindle cells. Immunohistochemical stains showed the tumor cells to be positive for vimentin and negative for cytokeratins, TTF‐1, calcitonin, synatophysin, chromogranin, and S‐100 protein, suggesting a sarcoma; however, the differential diagnosis also included anaplastic thyroid carcinoma and medullary thyroid carcinoma. Tissue biopsy revealed a high‐grade spindle cell neoplasm with osteoid production, consistent with osteosarcoma of the thyroid. The patient developed a large pulmonary embolus and superior vena cava syndrome and no further surgical intervention was performed. She died 5 weeks after the initial diagnosis. Upon retrospective review, the cytologic features resemble osteosarcoma in other areas. Although cytologic features on fine‐needle aspiration biopsy may suggest a diagnosis of this rare entity, definitive diagnosis should be deferred to histologic examination. Diagn. Cytopathol. 2008; 36: 589–594. © 2008 Wiley‐Liss, Inc.

Abstract Background Minimally invasive video‐assisted thyroidectomy (MIVAT) advantages include a smaller incision, less extensive surgical dissection, improved visualization secondary to rigid fiberoptics, and decreased postoperative pain. The aims of our study were to report our experience using expanded indications of MIVAT. Methods A retrospective chart review of a single surgeon's initial experience was carried out at a tertiary academic cancer center. Results In all, 53 patients were identified, of whom 40 underwent total thyroidectomy and 13 underwent hemithyroidectomy. Thyroid volume, nodule size, incision length, and surgical time were all examined. Most common pathology was well‐differentiated papillary thyroid cancer (69.8%): 42% of patients had evidence of thyroiditis found on pathology; 17% of patients had temporary vocal cord paralysis, with only 1 case of vocal cord paralysis persisting &gt;6 months (1.9%). Six patients (11%) experienced temporary hypocalcemia, requiring postoperative calcium supplementation; no patients experienced permanent hypocalcemia. Conclusions The use of MIVAT with expanded indications shows complication rates comparable to those of traditional open thyroidectomy. © 2010 Wiley Periodicals, Inc. Head Neck, 2011

To the Editor: Emerging evidence supports the association of psoriasis with several autoimmune diseases, including Graves' disease and Hashimoto thyroiditis.1 However, the association between psoriasis and thyroid disease remains inconclusive in the US population.2 This study sought to determine whether psoriasis is associated with an increased risk of thyroid disease in adults using the 2009-2014 National Health and Nutrition Examination Survey, a nationally representative database of health information of the general population in the United States.

Regulation of prolactin gene transcription requires cooperative interactions between the pituitary-specific POU domain protein Pit-1 and members of the ETS transcription factor family. We demonstrate here that the ETS-2 repressor factor (ERF) is expressed in pituitary tumor cells and that overexpression of recombinant ERF inhibits prolactin promoter activity, but not the closely related growth hormone promoter. In non-pituitary cell lines, coexpression of ERF disrupts the cooperative interactions between Pit-1 and ETS-1 and blocks the induction of Pit-1-dependent prolactin promoter activity by cAMP. The potential role of ERF in the inhibitory response of the prolactin promoter to dopamine was examined using pituitary tumor cells stably expressing dopamine D2 receptors. The inhibitory responses of the prolactin promoter to ERF and dopamine are additive, suggesting that ERF has a complementary role in this hormonal response. A single Pit-1 DNA-binding element from the prolactin promoter is sufficient to reconstitute the inhibitory response to ERF. DNA binding analysis using either a composite Pit-1/ETS protein-binding site or a Pit-1 element with no known affinity for ETS proteins revealed that ERF interferes with Pit-1 binding. Together, these results demonstrate that ERF is a specific inhibitor of basal and hormone-regulated transcription of the prolactin gene and suggest a new level of complexity for the interaction of ETS factors with Pit-1 target genes. Regulation of prolactin gene transcription requires cooperative interactions between the pituitary-specific POU domain protein Pit-1 and members of the ETS transcription factor family. We demonstrate here that the ETS-2 repressor factor (ERF) is expressed in pituitary tumor cells and that overexpression of recombinant ERF inhibits prolactin promoter activity, but not the closely related growth hormone promoter. In non-pituitary cell lines, coexpression of ERF disrupts the cooperative interactions between Pit-1 and ETS-1 and blocks the induction of Pit-1-dependent prolactin promoter activity by cAMP. The potential role of ERF in the inhibitory response of the prolactin promoter to dopamine was examined using pituitary tumor cells stably expressing dopamine D2 receptors. The inhibitory responses of the prolactin promoter to ERF and dopamine are additive, suggesting that ERF has a complementary role in this hormonal response. A single Pit-1 DNA-binding element from the prolactin promoter is sufficient to reconstitute the inhibitory response to ERF. DNA binding analysis using either a composite Pit-1/ETS protein-binding site or a Pit-1 element with no known affinity for ETS proteins revealed that ERF interferes with Pit-1 binding. Together, these results demonstrate that ERF is a specific inhibitor of basal and hormone-regulated transcription of the prolactin gene and suggest a new level of complexity for the interaction of ETS factors with Pit-1 target genes. prolactin rat prolactin Ras/mitogen-activated protein kinase growth hormone rat growth hormone ETS-2 repressor factor electrophoretic mobility shift assay ETS protein-binding site MAPK kinase-1 8-(4-chlorophenylthio)adenosine 3′,5′-triphosphate. The transcription of the prolactin (PRL)1 gene in the lactotroph cells of the anterior pituitary is under predominantly inhibitory control mediated by dopamine released by hypothalamic neurons. Extensive analysis of tissue-specific and hormone-responsive DNA elements in the rat PRL gene promoter, however, has not lead to the identification of specific inhibitory sites. Instead, this analysis has revealed a series of apparently redundant DNA-binding sites for the pituitary-specific transcription factor Pit-1 (GHF-1) that are both necessary and sufficient for multihormonal regulation of transcriptional activity, including the inhibitory response to dopamine (1Iverson R.A. Day K.H. d’Emden M . Day R.N Maurer R.A. Mol. Endocrinol. 1990; 4: 1564-1571Crossref PubMed Scopus (103) Google Scholar, 2Yan G.Z. Pan W.T. Bancroft C. Mol. Endocrinol. 1991; 5: 535-541Crossref PubMed Scopus (68) Google Scholar, 3Peers B. Monget P. Nalda M.A. Voz M.L. Berwaer M. Belayew A. Martial J.A. J. Biol. Chem. 1991; 266: 18127-18134Abstract Full Text PDF PubMed Google Scholar, 4Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar, 5Keech C.A. Jackson S.M. Siddiqui S.K. Ocran K.W. Gutierrez-Hartmann A. Mol. Endocrinol. 1992; 6: 2059-2070PubMed Google Scholar, 6Lew A.M. Elsholtz H.P. J. Biol. Chem. 1995; 270: 7156-7160Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). Although Pit-1 has been implicated as the mediator of hormonal responses conferred by the PRL gene promoter, the transcriptional regulatory mechanisms involving Pit-1 remain obscure. Previous studies demonstrated that Pit-1 is phos- phorylated in response to several different signaling pathways (7Howard P.W. Maurer R.A. J. Biol. Chem. 1994; 269: 28662-28669Abstract Full Text PDF PubMed Google Scholar, 8Kapiloff M.S. Farkash Y. Wegner M. Rosenfeld M.G. Science. 1991; 253: 786-789Crossref PubMed Scopus (173) Google Scholar, 9Caelles C. Hennemann H. Karin M. Mol. Cell. Biol. 1995; 15: 6694-6701Crossref PubMed Scopus (59) Google Scholar); however, mutagenesis of the three phosphoacceptor sites within the Pit-1 POU domain showed that this modification is not a key step in hormonal regulation of the PRL gene (10Okimura Y. Howard P.W. Maurer R.A. Mol. Endocrinol. 1994; 8: 1559-1565PubMed Google Scholar, 11Fischberg D.J. Chen X.-h. Bancroft C. Mol. Endocrinol. 1994; 8: 1566-1573PubMed Google Scholar). These data predict that Pit-1 is not the sole mediator of hormonal responses conferred by the PRL gene promoter and that other factors recruited to the Pit-1 DNA elements may function in the capacity of positive or negative regulators of PRL gene transcription. In this regard, some of the Pit-1 elements in the PRL promoter also serve as binding sites for other transcription factors. For example, members of the ETS transcription factor family interact with two Pit-1-binding sites within the PRL promoter (12Bradford A.P. Conrad K.E. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1995; 15: 2849-2857Crossref PubMed Scopus (109) Google Scholar, 13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 14Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 15Bradford A.P. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1997; 17: 1065-1074Crossref PubMed Scopus (99) Google Scholar). The ETS family of proteins mediate transcriptional responses to growth factors and activators of the Ras/mitogen-activated protein kinase (MAPK) pathway, and these composite PRL gene Pit-1/ETS protein DNA elements confer responses to several different hormones acting through diverse signal transduction pathways (12Bradford A.P. Conrad K.E. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1995; 15: 2849-2857Crossref PubMed Scopus (109) Google Scholar, 13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 14Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 15Bradford A.P. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1997; 17: 1065-1074Crossref PubMed Scopus (99) Google Scholar). One possible molecular mechanism for multihormonal control of PRL promoter activity is the convergence of different signal transduction pathways on the MAPK pathway, which in turn modulates the cooperative interactions between ETS factors and Pit-1 (13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 14Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). The cooperative interactions between Pit-1 and ETS family members appear particularly important in establishing pituitary lactotroph-specific PRL gene expression (15Bradford A.P. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1997; 17: 1065-1074Crossref PubMed Scopus (99) Google Scholar) and could account for the differential basal and hormonally induced transcriptional responses of the Pit-1-dependent PRL and growth hormone (GH) genes. The above model predicts that factors interfering with the interactions between Pit-1 and ETS proteins could selectively inhibit PRL gene transcription. Recently, a novel member of the ETS family was identified that acts as a transcriptional repressor. The ETS-2 repressor factor (ERF) is a 548-amino acid phosphoprotein with an N-terminal DNA-binding domain homologous to that of other ETS family members and a unique C-terminal repressor domain (16Sgouras D.N. Athanasiou M.A. Beal Jr., G.J. Fisher R.J. Blair D.G. Mavrothalassitis G.J. EMBO J. 1995; 14: 4781-4793Crossref PubMed Scopus (143) Google Scholar, 17Liu D. Pavlopoulos E. Modi W. Moschonas N. Mavrothalassitis G. Oncogene. 1997; 14: 1445-1451Crossref PubMed Scopus (18) Google Scholar). The DNA-binding domain of ERF recognizes ETS-binding sites, and the repressor activity of ERF can abrogate transactivation by ETS proteins. Given the importance of the interaction of Pit-1 and ETS proteins to PRL gene transcription, we hypothesized that ERF could act to inhibit PRL promoter activity by antagonizing this interaction. Here we show that the ERF gene transcript is expressed in GH pituitary tumor cells. Using an expression vector encoding the ERF protein, we demonstrate profound and specific suppression of PRL reporter gene expression in both lactotroph cell lines and non-pituitary cells coexpressing the Pit-1 and ETS-1 proteins. Moreover, expression of ERF effectively blocked the induction of PRL gene transcription by the protein kinase A pathway and acted in an additive manner with dopamine to suppress PRL promoter activity. We demonstrate that tandem copies of a single PRL promoter Pit-1 DNA element are sufficient to confer the inhibitory response to ERF and that protein extracts from cells expressing ERF inhibit Pit-1 binding to Pit-1 DNA elements. Together, these results support the view that ERF can act as a potent inhibitor of PRL gene activity. All cell lines used in these studies were maintained as monolayers in Ham’s F-12/Dulbecco’s modified Eagle’s medium supplemented with 10% new born calf serum. The cell culture medium was changed prior to transfection as indicated for the individual experiments. For transfection, cells were harvested by treatment with 0.05% trypsin and 0.53 mm EDTA and washed by centrifugation. The LZR1 cells were transfected using calcium phosphate precipitation as described (4Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar). All other cell lines were transfected by electroporation with the BTX ECM 600 electroporation system using conditions optimized for each cell type. The cells were resuspended Ca2+/Mg2+-free Dulbecco’s phosphate-buffered saline, and 0.4-ml aliquots of the cell suspension (containing ∼1 × 106 cells) were transferred into 0.2-cm gap electroporation cuvettes containing the indicated luciferase reporter gene and varying concentrations of the indicated expression vector DNAs. The total amount of DNA was kept constant using empty vector DNA. Luciferase reporter plasmids containing rat PRL promoter sequences spanning coordinates −422 to +34 or −306 to +34 relative to the transcription start site (rPRL-Luc) and the rat GH promoter (−235 to +8) have been described previously (14Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar,18Day R.N. Koike S. Sakai M. Muramatsu M. Maurer R.A. Mol. Endocrinol. 1990; 4: 1964-1971Crossref PubMed Scopus (192) Google Scholar, 19Nelson C. Albert V.R. Elsholtz H.P. Lu L.I. Rosenfeld M.G. Science. 1988; 239: 1400-1405Crossref PubMed Scopus (416) Google Scholar). The luciferase reporter gene containing four tandem copies of the rPRL 3P Pit-1 element linked to the rPRL minimal promoter (coordinates −36 to +34) was described previously (13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). The expression vector encoding the ERF protein used in these studies was prepared by in-frame insertion of the ERF cDNA sequence from the pSG5-ERF plasmid (16Sgouras D.N. Athanasiou M.A. Beal Jr., G.J. Fisher R.J. Blair D.G. Mavrothalassitis G.J. EMBO J. 1995; 14: 4781-4793Crossref PubMed Scopus (143) Google Scholar) into the pcDNA3.1-HisA expression vector (Invitrogen, San Diego, CA). The expression vectors encoding Pit-1 (18Day R.N. Koike S. Sakai M. Muramatsu M. Maurer R.A. Mol. Endocrinol. 1990; 4: 1964-1971Crossref PubMed Scopus (192) Google Scholar) and c-ETS-1 (20Mavrothalassitis G. Fisher R.J. Smyth F. Watson D.K. Papas T.S. Oncogene. 1994; 9: 425-435PubMed Google Scholar) have been described. Total cellular RNA was isolated from GH4ZR7 cells by the guanidinium thiocyanate/phenol/chloroform method (21Chomczynski P. Sacchi N. Anal. Biochem. 1987; 162: 156-159Crossref PubMed Scopus (62909) Google Scholar), and poly(A)+ RNA was isolated. The yield and purity of RNA samples were assessed by the ratio of absorbance at 260 and 280 nm. mRNA was fractionated by denaturing agarose gel electrophoresis and transferred to nylon membrane. The membranes were sequentially hybridized with 1 × 106 cpm/ml32P-labeled complementary DNA probes to human ERF and glyceraldehyde-3-phosphate dehydrogenase at 45 °C for 16 h. The blots were rinsed in 2× SSC and washed in succession with 2× SSC and 0.1% SDS, 0.5× SSC and 0.1% SDS, and 0.1× SSC and 0.1% SDS at 60 °C and exposed to Kodak XAR-5 film at −70 °C. Transiently transfected HeLa cells were lysed at 4 °C in detergent buffer as described previously (22Day R.N. Mol. Endocrinol. 1998; 12: 1410-1419Crossref PubMed Scopus (116) Google Scholar). Samples were fractionated by SDS-polyacrylamide gel electrophoresis on 10% gels. The proteins were transferred to nitrocellulose for 1 h by electroblotting at 100 V and then detected by Ponceau S staining. The membranes were blocked with 5% nonfat dried milk in TBS-T buffer (20 mm Tris-HCl (pH 7.6), 137 mm NaCl, and 0.1% Tween 20) and incubated with the Anti-Xpress antibody directed against the enterokinase recognition sequence (1:10,000 final dilution; Invitrogen) for 1 h at room temperature. Following washes in TBS-T buffer, the membranes were incubated with a 1:50,000 final dilution of horseradish peroxidase-conjugated anti-rabbit Ig (Pierce). The membranes were washed in TBS-T buffer and incubated in ECL reagents (NEN Life Science Products) for 1 min. The membranes were then exposed to Kodak XAR-5 film for 5–15 min. EMSAs were performed on whole cell extracts prepared from transiently transfected HeLa cells as described previously (23Day R.N. Day K.H. Mol. Endocrinol. 1994; 8: 12-20PubMed Google Scholar). Duplex oligonucleotides corresponding to the PRL 3P and PAL 1P Pit-1-binding sites and the GATA gene EBS were as follows: PRL 3P, 5′-GGCTTCCTGAATATGAATAAGA; PAL 1P, 5′- CCTGATTACATGAATATTCATGAAGGTG; and GATA EBS, 5′-CTTCGAGGAAGGGCACAGTGCCTTCCTTTAAC. The indicated duplex oligonucleotides were end-labeled using [γ-32P]ATP and T4 polynucleotide kinase. Whole cell extracts from transfected HeLa cells were added alone or in the indicated combinations to 15-μl reaction mixtures assembled on ice. For immunoclearing experiments, 1 μl of anti-Pit-1 polyclonal antibody was added to the reaction mixtures and incubated for 1 h at 4 °C. The reaction mixtures were transferred to tubes containing ∼50,000 cpm of the end-labeled probe. For competition studies, unlabeled duplex oligonucleotides were added in excess as indicated. The mixtures were then incubated for 20 min at room temperature and loaded on prerun 6% polyacrylamide gels prepared in running buffer containing 25 mm Tris-HCl (pH 8.3), 192 mmglycine, and 1 mm EDTA. The gels were run at 150 V, dried, and autoradiographed using Kodak XAR-5 film. RNA blot analysis was performed to determine if ERF is expressed in pituitary lactotroph cells. Using RNA from the dopamine-responsive GH4ZR7 cell line probed with the human ERF cDNA, we detected a single transcript ∼2.6 kilobases in length (Fig. 1). This result is in agreement with that reported by Sgouras et al. (16Sgouras D.N. Athanasiou M.A. Beal Jr., G.J. Fisher R.J. Blair D.G. Mavrothalassitis G.J. EMBO J. 1995; 14: 4781-4793Crossref PubMed Scopus (143) Google Scholar) for other tissues and cell lines. The recent cloning of the ERF gene and 5′-regulatory sequences revealed a number of potential promoter elements that could function in hormonal regulation of ERF expression (24de Castro C.M. Rabe S.M. Langdon S.D. Fleenor D.E. Slentz-Kesler K. Ahmed M.N. Qumsiyeh M.B. Kaufman R.E. Genomics. 1997; 42: 227-235Crossref PubMed Scopus (9) Google Scholar). The GH4ZR7 cells were treated with several different hormones and agents known to alter gene expression in GH pituitary cell lines to determine if ERF is transcriptionally regulated. Treatment of GH4ZR7 cells with dopamine for 5 or 24 h or exposure to forskolin, dexamethasone, or retinoic acid had no affect on steady-state levels of ERF mRNA (Fig. 1). These results indicate that expression of the ERF gene in pituitary cells does not appear to be controlled at the level of transcription. Because cooperative interactions between Pit-1 and ETS-1 are key to the regulation of PRL gene transcription (12Bradford A.P. Conrad K.E. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1995; 15: 2849-2857Crossref PubMed Scopus (109) Google Scholar, 13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 14Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar, 15Bradford A.P. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1997; 17: 1065-1074Crossref PubMed Scopus (99) Google Scholar), we determined the effect of ERF expression on PRL promoter activity. The Pit-1-dependent GH promoter was used for comparison. Cotransfection of GH pituitary cells with an expression vector encoding ERF and the luciferase reporter gene linked to the rat PRL promoter (rPRL-Luc) demonstrated that ERF inhibits the basal activity of the PRL promoter in a dose-dependent manner (Fig. 2 A). In contrast, expression of ERF had no significant impact on the rat GH promoter-luciferase reporter gene (rGH-Luc) (Fig. 2 B), suggesting selectivity in the inhibitory actions of ERF at these Pit-1-dependent promoters. In this regard, it should be noted that in cells expressing ERF, we also achieved expression of other proteins from several different genetic vectors using the cytomegalovirus, early SV40, or Rous sarcoma virus promoters. This indicates that ERF is not a potent inhibitor of transcription from these promoters. Cotransfection studies to reconstitute the activation of the PRL promoter in non-pituitary cells were used to determine the effect of ERF expression on the functional interactions between Pit-1 and ETS-1. COS-1 kidney cells were cotransfected with the rPRL-Luc reporter gene and expression vectors encoding Pit-1, ETS-1, and ERF. Expression of Pit-1 induced PRL promoter activity 5-fold, and coexpression of Pit-1 with ETS-1 resulted in ∼30-fold induction (Fig. 3). Cotransfection of the Pit-1 and ETS-1 plasmids with increasing amounts of the ERF expression vector resulted in the dose-dependent inhibition of the Pit-1- and ETS-1-mediated induction of PRL promoter activity. Together, these results show that expression of the ERF protein inhibits rPRL (but not rGH) basal promoter activity in pituitary cells and suggest that the inhibitory activity results from interference with the ability of Pit-1 and ETS-1 to cooperatively induce the PRL promoter. Previous studies demonstrated that functional interactions between Pit-1 and ETS-1 are required for some hormonal responses conferred by the PRL promoter (12Bradford A.P. Conrad K.E. Wasylyk C. Wasylyk B. Gutierrez-Hartmann A. Mol. Cell. Biol. 1995; 15: 2849-2857Crossref PubMed Scopus (109) Google Scholar, 13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 14Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). The protein kinase A signaling pathway activates the MAPK signaling cascade through B-Raf, resulting in activation of ETS family transcription factors (25Vossler M.R. Yao H. York R.D. Pan M.G. Rim C.S. Stork P.J. Cell. 1997; 89: 73-82Abstract Full Text Full Text PDF PubMed Scopus (941) Google Scholar). In pituitary cells, this signaling cascade could induce the cooperative interaction of an ETS protein with Pit-1, resulting in protein kinase A-dependent activation of PRL transcription (13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). We examined the effect of ERF expression on protein kinase A induction of PRL promoter activity and evaluated the role of p42 MAPK in this response using the specific inhibitor of MAPK kinase-1 (MEK), the drug PD098059 (26Alessi D.R. Cuenda A. Cohen P. Dudley D.T. Saltiel A.R. J. Biol. Chem. 1995; 270: 27489-27494Abstract Full Text Full Text PDF PubMed Scopus (3242) Google Scholar). Rat-1 fibroblast cells maintained in the absence of serum were cotransfected with the rPRL-Luc reporter gene and the indicated protein expression vectors. The transfected cells received no further addition or were treated with the permeable analog of cAMP, CPT-cAMP. Addition of CPT-cAMP had no effect on basal rPRL promoter activity in these non-pituitary cells (Fig. 4). In contrast, coexpression of Pit-1 induced reporter gene activity 5-fold, and treatment with CPT-cAMP increased this activity an additional 2-fold. This response to CPT-cAMP was completely blocked by addition of the MEK inhibitor PD098059. Under these serum-free conditions, coexpression of the ETS-1 and Pit-1 proteins did not result in cooperative induction of rPRL promoter activity (compare with Fig. 3). However, CPT-cAMP treatment of the cells coexpressing Pit-1 and ETS-1 resulted in 8-fold induction of PRL promoter activity, and this response was also inhibited by treatment with PD098059. Similarly, coexpression of ERF resulted in inhibition of the CPT-cAMP response mediated by the coexpressed Pit-1 and ETS-1 proteins, and the response to ERF was additive with the inhibitory response to addition of the MEK inhibitor (Fig. 4). Together, these results support the convergence of the protein kinase A and MAPK signaling pathways in activation of PRL promoter activity and demonstrate that ERF can inhibit this response. Dopamine binding to lactotroph D2 receptors results in tonic inhibition of PRL promoter function (4Elsholtz H.P. Lew A.M. Albert P.R. Sundmark V.C. J. Biol. Chem. 1991; 266: 22919-22925Abstract Full Text PDF PubMed Google Scholar, 27McChesney R. Sealfon S.C. Tsutsumi M. Dong K.W. Roberts J.L. Bancroft C. Mol. Cell. Endocrinol. 1991; 79: R1-R7Crossref PubMed Scopus (24) Google Scholar). We examined the ability of ERF to modulate dopaminergic inhibition of rPRL promoter activity in the dopamine D2 receptor-expressing GH4ZR7 cell line. Typical dose-response curves for both dopamine and the ERF expression plasmid are shown in Fig. 5 A. Dopamine treatment of GH4ZR7 cells transfected with the rPRL-Luc reporter gene caused a 1.7-fold decrease in reporter activity. Similarly, in GH4ZR7 cell cultures transfected with the ERF plasmid, basal promoter activity was reduced 2.6-fold, and the inhibitory response to ERF was enhanced significantly by addition of dopamine (Fig. 5 A). The inhibitory response of the PRL promoter to D2 receptor activation is restricted to pituitary cells and several other neuroendocrine cell types. In a number of non-pituitary cell lines stably expressing dopamine D2 receptors, dopamine stimulates PRL promoter activity (6Lew A.M. Elsholtz H.P. J. Biol. Chem. 1995; 270: 7156-7160Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar, 28Lew A.M. Yao H. Elsholtz H.P. J. Biol. Chem. 1994; 269: 12007-12013Abstract Full Text PDF PubMed Google Scholar). This response may result from increased Ca2+ levels or phosphatidylinositol 4,5-bisphosphate hydrolysis (28Lew A.M. Yao H. Elsholtz H.P. J. Biol. Chem. 1994; 269: 12007-12013Abstract Full Text PDF PubMed Google Scholar, 29Vallar L. Muca C. Magni M. Albert P. Bunzow J. Meldolesi J. Civelli O. J. Biol. Chem. 1990; 265: 10320-10326Abstract Full Text PDF PubMed Google Scholar), and similar to other stimulatory hormonal responses of the PRL promoter, Pit-1 markedly enhances the dopamine induction in these cell types. A mouse Ltk− cell line stably expressing dopamine D2 receptors (LZR1) was used to determine the effect of ERF expression on the stimulatory responses to dopamine conferred by the rPRL promoter. The results shown in Fig. 5 B demonstrate that expression of Pit-1 in LZR1 cells induced the rPRL-Luc reporter gene 4-fold over basal levels and that expression of ERF suppressed both basal and Pit-1-activated transcription. Treatment of LZR1 cells with dopamine induced basal rPRL-Luc activity <2-fold, but stimulated the promoter by 3.7-fold in the presence of Pit-1 (Fig. 5 B, right panel). Interestingly, expression of ERF failed to suppress the stimulatory response to dopamine, either in the presence or absence of Pit-1 (Fig. 5 B). These results indicate that certain transcriptional responses conferred by PRL promoter elements in the context of non-pituitary cells are not inhibited by the ETS repressor, ERF. The results comparing the rGH and rPRL promoters (Fig. 2) indicated that ERF displayed specificity in inhibition of these Pit-1-dependent promoters. The PRL 3P Pit-1 DNA element, a composite Pit-1/ETS site located between positions −165 and −150 base pairs, is sufficient to confer hormonal responsiveness in non-pituitary cells expressing Pit-1 (13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar). We examined the ability of ERF to inhibit transcriptional responses conferred by tandem copies of the PRL 3P DNA element. HeLa cells were transfected with a luciferase reporter gene coupled to four tandem copies of the PRL 3P site and the minimal PRL promoter (4×3P-Luc). Expression of Pit-1 resulted in a 6-fold induction of the reporter gene, and coexpression of the ERF protein inhibited this response by 60% (Fig. 6). Furthermore, coexpression of Pit-1 and ETS-1 together resulted in a cooperative 25-fold induction of the PRL 3P site reporter gene construct, and this response was reduced 90% by expression of ERF. These results demonstrate that this Pit-1 DNA element is sufficient to confer the inhibitory response to ERF. To begin to dissect the mechanisms for ERF-dependent inhibition of PRL promoter activity, extracts were prepared from HeLa cells expressing epitope-tagged Pit-1 and ERF proteins for use in EMSA. Western blot analysis confirmed that similar amounts of the recombinant proteins were made and indicated that the tagged ERF protein migrated as a doublet (Fig. 7). The ERF protein is a substrate for MAPK, and this pattern of migration could indicate that the protein is partially phosphorylated in HeLa cells (16Sgouras D.N. Athanasiou M.A. Beal Jr., G.J. Fisher R.J. Blair D.G. Mavrothalassitis G.J. EMBO J. 1995; 14: 4781-4793Crossref PubMed Scopus (143) Google Scholar). EMSA was then used to assess the binding of proteins from these transfected cell extracts to the PRL 3P site. An endogenous HeLa cell protein bound to the PRL 3P element, forming a single shifted complex (Fig. 8 A, lane 1, solid arrow), and extracts from HeLa cells expressing Pit-1 resulted in the formation of two additional shifted complexes (lane 2, open arrows). This result is consistent with previous reports of Pit-1 binding to DNA elements as both a monomer and dimer (13Howard P.W. Maurer R.A. J. Biol. Chem. 1995; 270: 20930-20936Abstract Full Text Full Text PDF PubMed Scopus (65) Google Scholar, 30Holloway J.M. Szeto D.P. Scully K.M. Glass C.K. Rosenfeld M.G. Genes Dev. 1995; 9: 1992-2006Crossref PubMed Scopus (87) Google Scholar, 31Jacobson E.M. Peng L. Leon-del-Rio A. Rosenfeld M.G. Aggarwal A.K. Genes Dev. 1997; 11: 198-212Crossref PubMed Scopus (176) Google Scholar). Both of these complexes were cleared from the reaction by addition of an antibody specific to Pit-1 (Fig. 8 A, lane 3), and all three protein complexes were diminished by competition with increasing amounts of the unlabeled PRL 3P site oligonucleotide. In contrast, only the complex formed by endogenous HeLa cell protein was competed for by the EBS from theGATA gene (32Seth A. Robinson L. Thompson D.M. Watson D.K. Papas T.S. Oncogene. 1993; 8: 1783-1790PubMed Google Scholar), suggesting that this complex contains an ETS family member (Fig. 8 A).Figure 8The ERF protein interferes with protein binding to the composite PRL 3P DNA element. Whole cell extracts were prepared from HeLa cells transfected with empty vector or with the expression vector encoding either Pit-1 or ERF. EMSA was used to assess binding of proteins to the duplex 32P-labeled PRL 3P Pit-1 site probe. The reactions were fractionated by nondenaturing gel electrophoresis, and the probe was detected by autoradiography.A, a single shifted complex was detected for proteins from the control HeLa cell extract (lane 1, solid arrow). Two additional DNA-protein complexes were formed by extracts from cells expressing Pit-1 (lane 2, open arrowheads), and these complexes were cleared by pretreatment with an antibody directed against Pit-1 (lane 3). Competition with excess unlabeled PRL 3P oligonucleotide (lanes 4–6) or excess unlabeled GATA gene EBS oligonucleotide (lanes 7–9) from 3- to 30-fold (indicated by the wedge) demonstrated the specificity of these DNA-protein complexes. B, to examine potential interactions of ERF with the PRL 3P DNA element, extract from control HeLa cells was mixed with increasing amounts of extract from HeLa cells expressing ERF (left panel). Then, to determine if the ERF protein influenced Pit-1 binding to the PRL 3P site, a constant amount of extract from HeLa cells expressing Pit-1 (3 μg) was mixed with increasing amounts of ERF cell extract (3 or 9 μg); the total amount of HeLa cell protein was kept constant with the control extract (right panel).View Large Image Figure ViewerDownload Hi-res image Download (PPT) To investigate potential interactions of ERF with the PRL 3P site, EMSA reactions were prepared using increasing amounts of protein extract from HeLa cells expressing ERF. Total protein was kept constant using extract prepared from control HeLa cells transfected with vector alone. The results shown in Fig. 8 B demonstrate that no additional shifted complexes were detected with extracts containing ERF. There was, however, diminished binding of the endogenous HeLa cell protein to the PRL 3P site with increasing amounts of ERF-containing cell extract (Fig. 8 B, left panel). Moreover, when Pit-1 cell extract was held constant and increasing amounts of ERF cell extract were added, both of the shifted complexes resulting from Pit-1 binding (open arrows) and the HeLa cell protein (solid arrow) were diminished (Fig. 8 B, right panel). One interpretation of these results is that ERF protein binding to the EBS of the composite Pit-1/EBS site displaces both Pit-1 and ETS proteins. An alternative view would be that protein/protein interactions between ERF and complexes including Pit-1 and ETS proteins interfere with binding to the Pit-1 element. To differentiate these potential mechanisms, we examined the effect of ERF on protein binding to a synthetic palindromic Pit-1 DNA-binding element (PAL 1P site) (33Elsholtz H.P. Albert V.R. Treacy M.N. Rosenfeld M.G. Genes Dev. 1990; 4: 43-51Crossref PubMed Scopus (62) Google Scholar), an element with no known affinity for ETS proteins. Extract from HeLa cells expressing Pit-1 resulted in three complexes (Fig. 9 A, open arrows) that were cleared by addition of anti-Pit-1 antibody (lane 2). Competition with unlabeled PAL 1P site demonstrated the specificity of the complexes containing Pit-1 and showed a shifted complex forming with HeLa cell protein to be nonspecific (Fig. 9 A, solid arrow). As was observed for the PRL 3P site (Fig. 8 B), no additional complexes were detected with ERF cell extracts (Fig. 9 B, lane 1). When a constant amount of Pit-1 cell extract was titrated with increasing amounts of ERF cell extract, only the Pit-1 complexes were reduced (open arrows); the nonspecific complex was not affected by increasing amounts of ERF cell extract (Fig. 9 B). Taken together, these results suggest that ERF inhibits Pit-1-dependent transcriptional activity through interference with binding to specific promoter elements. The predominant physiological control of PRL gene expression in anterior pituitary lactotrophs is inhibitory, and the molecular mechanisms that contribute to the suppression of transcription are not well understood. It has become increasingly clear that specific endocrine regulation of PRL gene transcription requires the cooperative interactions between Pit-1 and other transcription factors, including members of the ETS family of proteins. More important, the closely related GH gene is expressed in distinct pituitary cell types and has a different pattern of endocrine regulation. Whereas the GH promoter contains both Pit-1 DNA elements and potential ETS protein-binding sites, this promoter does not support the cooperative interactions between Pit-1 and ETS factors (14Bradford A.P. Conrad K.E. Tran P.H. Ostrowski M.C. Gutierrez-Hartmann A. J. Biol. Chem. 1996; 271: 24639-24648Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Thus, it appears that the Pit-1/ETS protein interactions provide a mechanism for differential regulation of the PRL and GH gene promoters in anterior pituitary cells. This interaction could also serve as a potential target for inhibitory factors that selectively suppress PRL gene transcription, and the results shown here indicate that the ETS family repressor protein ERF can function in this capacity. The studies presented here demonstrate that mRNAs homologous to the transcript encoding ERF are present in GH pituitary tumor cells, indicating that these lactotroph cells have the capacity to synthesize the ETS repressor protein. Consistent with the results reported by Sgouras et al. (16Sgouras D.N. Athanasiou M.A. Beal Jr., G.J. Fisher R.J. Blair D.G. Mavrothalassitis G.J. EMBO J. 1995; 14: 4781-4793Crossref PubMed Scopus (143) Google Scholar), we found no evidence for hormonal regulation of the ERF transcript levels. However, these authors demonstrated post-transcriptional regulation of ERF repressor activity through phosphorylation by MAPK, and our Western blot analysis of the ERF protein expressed in HeLa cells indicated that the protein is modified (see Fig. 7). The differential regulation of gene expression by MAPK pathway modulation of ETS transcription factor activities appears to be of both physiological and developmental importance. For example, in Drosophila, a critical stage in eye development occurs when activation of the MAPK pathway simultaneously inhibits the ETS repressor protein Yan and stimulates the ETS activator Pointed (34Brunner D. Dücker K. Oellers N. Hafen E. Scholz H. Klämbt C. Nature. 1994; 370: 386-389Crossref PubMed Scopus (313) Google Scholar). A similar mechanism involving coordinate activation of ETS proteins and reduction of ERF repressor activity by MAPK phosphorylation could mediate transcriptional responses to hormones (16Sgouras D.N. Athanasiou M.A. Beal Jr., G.J. Fisher R.J. Blair D.G. Mavrothalassitis G.J. EMBO J. 1995; 14: 4781-4793Crossref PubMed Scopus (143) Google Scholar, 17Liu D. Pavlopoulos E. Modi W. Moschonas N. Mavrothalassitis G. Oncogene. 1997; 14: 1445-1451Crossref PubMed Scopus (18) Google Scholar). Given the central role of Pit-1 and ETS proteins in the hormonal regulation of PRL gene transcription, we undertook studies to determine if the ERF protein could influence PRL promoter activity. Our results demonstrate ERF to be a potent inhibitor of the PRL promoter, but not the closely related GH promoter, in pituitary tumor cells. Moreover, expression of the ERF protein in non-pituitary cells blocked the activation of the PRL promoter by the coexpressed Pit-1 protein as well as by the combined expression of Pit-1 and ETS-1. Furthermore, we found that ERF inhibits the cAMP induction of Pit-1/ETS-1-dependent PRL promoter activity in these non-pituitary cells. A convergence of the protein kinase A signaling pathway and the MAPK pathway resulting in the activation of ETS proteins, such as Elk-1, was demonstrated (25Vossler M.R. Yao H. York R.D. Pan M.G. Rim C.S. Stork P.J. Cell. 1997; 89: 73-82Abstract Full Text Full Text PDF PubMed Scopus (941) Google Scholar), and we show here that the Pit-1-dependent cAMP response is blocked by the MEK inhibitor PD098059. Together, these results support the view that induction of PRL gene transcription by the protein kinase A signaling pathway is mediated by activation of the MAPK pathway and ETS proteins and that the ETS repressor ERF can inhibit this response. These results implicated ERF as a potential mediator of inhibitory responses conferred by the PRL promoter. Because PRL transcription in pituitary lactotrophs is under the inhibitory control of dopamine D2 receptor-coupled signaling, we used the dopamine-responsive GH4ZR7 pituitary cell line to determine if ERF participated in this inhibitory pathway. Our results indicate that dopamine inhibition and ERF inhibition of PRL promoter activity are additive. Our previous study demonstrated that isolated Pit-1 DNA elements, including the PRL 1P site, which has no known affinity for ETS proteins, are sufficient to confer dopamine inhibition (6Lew A.M. Elsholtz H.P. J. Biol. Chem. 1995; 270: 7156-7160Abstract Full Text Full Text PDF PubMed Scopus (25) Google Scholar). Moreover, site-directed mutagenesis of the EBSs that are part of the composite Pit-1 elements does not prevent dopamine inhibition. 2J. Liu and H. P. Elsholtz, unpublished data. These results suggest that ERF and dopamine may function by complementary mechanisms to reduce transcription at the PRL promoter. In D2receptor-expressing mouse L cells, dopamine treatment stimulated PRL promoter activity. We observed here that ERF failed to block dopaminergic stimulation, indicating that not all PRL promoter responses are sensitive to ERF inhibition. It is important to note that not all cis-active sites in the rPRL promoter are part of composite Pit-1 elements. For example, an ETS site located in the promoter region between −101 and −76 confers responsiveness to insulin, insulin-like growth factor 1, and fibroblast growth factor (35Ouyang L. Jacob K.K. Stanley F.M. J. Biol. Chem. 1996; 271: 10425-10428Abstract Full Text Full Text PDF PubMed Scopus (44) Google Scholar, 36Schweppe R.E. Frazer-Abel A.A. Gutierrez-Hartmann A. Bradford A.P. J. Biol. Chem. 1997; 272: 30852-30859Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 37Castillo A.I. Tolon R.M. Aranda A. Oncogene. 1998; 16: 1981-1991Crossref PubMed Scopus (42) Google Scholar). This site is also required for responsiveness to the phosphatidylinositol 3-kinase signaling pathway and may specify interactions with ETS family proteins that differ from those directed to the composite Pit-1 DNA elements (36Schweppe R.E. Frazer-Abel A.A. Gutierrez-Hartmann A. Bradford A.P. J. Biol. Chem. 1997; 272: 30852-30859Abstract Full Text Full Text PDF PubMed Scopus (36) Google Scholar, 37Castillo A.I. Tolon R.M. Aranda A. Oncogene. 1998; 16: 1981-1991Crossref PubMed Scopus (42) Google Scholar). Together, these results indicate that ERF is unlikely to directly mediate transcriptional effects of dopamine on the PRL promoter. Our present data, however, do not exclude a mechanism whereby dopamine D2 receptor signaling could induce post-translational modifications of ERF that enhance repressor activity that may be independent of binding to DNA elements. We found that tandem copies of the PRL 3P Pit-1 site were sufficient to confer the inhibitory response to ERF (Fig. 6), suggesting that ERF could interact with this composite element. Using EMSA and extracts from HeLa cells expressing Pit-1, we demonstrated binding of an endogenous HeLa cell protein to the PRL 3P site as well as specific shifted complexes formed by Pit-1. Competition studies demonstrated that HeLa cell protein binding to the PRL 3P site also had affinity for the GATA EBS oligonucleotide. More important, although competition with the homologous PRL 3P site reduced both the Pit-1-specific and HeLa protein complexes, competition with the EBS oligonucleotide did not influence Pit-1 binding (Fig. 8). This indicated that in this in vitro system, binding of Pit-1 to the PRL 3P site is independent of the HeLa cell protein binding. Using extracts from HeLa cells expressing ERF, we were unable to detect the formation of any additional shifted complexes. There was, however, diminished binding of both the endogenous HeLa cell protein and Pit-1 to the PRL 3P site in the presence of these extracts. This result could be an indication that ERF binding to the EBS of the composite PRL 3P element is capable of displacing both Pit-1 and ETS proteins, suggesting that competition for DNA binding at this composite Pit-1 element is a potential mechanism of ERF inhibitory action. This interpretation, however, is not supported by our EMSA results using the PAL 1P site, an element with no known affinity for ETS proteins. EMSA studies using extracts from HeLa cells expressing Pit-1 identified both Pit-1-specific complexes and a nonspecific complex formed by HeLa cell protein. Using ERF-containing cell extracts, we again found no evidence for the binding of ERF to this DNA element. However, titration of a constant amount of Pit-1 cell extract with increasing amounts of ERF cell extract resulted in diminished Pit-1 binding. In contrast, the binding of the nonspecific protein complex was not influenced by increasing amounts of ERF cell extract (Fig. 9), demonstrating selective effects of ERF on DNA/protein interactions. It is possible that low affinity binding of ERF to these Pit-1 DNA elements could account for the inhibitory actions of ERF and that the EMSA conditions used here did not allow detection of these interactions. However, this would predict inhibition of all Pit-1-dependent promoters, including the rGH promoter, a result not obtained in the present studies (Fig. 2). An alternative view is that inhibitory activity results from the formation of protein complexes with Pit-1 not requiring the ERF protein to form specific contacts with DNA. Promoter element specificity could arise if the pairing of Pit-1 and coactivator protein partners directs these ERF protein interactions. The potential role of ERF in the pituitary lactotroph has not been defined, nor has its ability to regulate the endogenous PRL gene been determined. One approach to address this issue would be to examine endogenous PRL gene transcription in a stable pituitary cell line in which ERF is expressed under the control of an inducible promoter. Taken together, our results suggest that ERF inhibits Pit-1-dependent transcriptional activity through interference with binding to specific promoter elements. In addition, our results with ERF extend the view that ubiquitous ETS family proteins, through unique partnerships with cell-specific transcription factors, can serve to integrate and coordinate both stimulatory and inhibitory transcriptional responses, leading to the control of tissue-specific gene expression. We thank Dr. George Mavrothalassitis for supplying the cDNAs encoding ERF and ETS-1 and Drs. Paul Howard and Rich Maurer for supplying the 3P-Luc vectors.

Learning to apply the ever-expanding volume of clinical literature to patient care is critical for the next generation of physicians. This evidence-based medicine (EBM) offers much to improve patient care and outcomes, but should enhance rather than restrict the practice of medicine. Although the barriers to the adoption and teaching of EBM lie on many fronts, including institutional and staff limitations, many examples of structured didactics--from journal club to professor rounds--have been reported with good success. Published reviews and online evidence-based guidelines offer excellent synthesis of complex topics as a catalyst for understanding the clinical literature. Beyond academics, this article, in its discussion of what EBM is and how to practice it, presents information of value to practicing clinicians.

Glaucoma is a group of diseases that lead to the loss of retinal ganglion cells and damage to the optic nerve with associated visual function loss. The primary risk factor is elevated intraocular pressure and therapy is directed toward lowering the pressure through medical and surgical interventions. The Trabectome™ is a novel device used to remove a portion of the trabecular meshwork and inner layer of Schlemm’s canal within the anterior chamber to allow for increased aqueous outflow. It is similar to trabeculotomy, with the primary difference being the permanent ablation and removal of trabecular meshwork tissue rather than a simple incision through this tissue. It offers a safer and more efficient procedure than the current gold standard, filtering surgery, while still providing reduction of intraocular pressure without reports of vision-threatening complications. Therefore, it can be offered earlier in patient management, as well as in conjunction with cataract extraction. Trabeculotomy was previously only reserved for treatment of congenital glaucoma, but the Trabectome has demonstrated its effectiveness in adults with open-angle glaucoma.

Riata family of implantable cardioverter defibrillator leads have demonstrated in situ conductor externalization, prompting a class I recall and the Food and Drug Administration recommendation for fluoroscopic screening. The natural history of externalized Riata leads, however, remains unclear. In this study, we examined the rate of electrical failure in Riata leads with externalized cables. We reviewed medical and implantable cardioverter defibrillator records of all 329 patients with Riata leads who underwent fluoroscopic screening from December 2011 to March 2012 at the University of Pittsburgh Medical Center hospitals. Externalization was present in 76 patients (23%); of whom, 24 (32%) had the Riata lead replaced shortly after screening. The remaining 52 patients were followed for 7.9 ± 2.9 months, during which 5 patients were lost to follow-up and 2 patients exhibited electrical lead failure resulting in lead replacement, an electrical failure rate of 6.4% per year in externalized leads. In conclusion, prospective follow-up data on externalized Riata leads suggest an electrical failure rate in excess of 6% per year. This high failure rate warrants consideration of prophylactic replacement of externalized Riata leads. Further studies examining the natural history of Riata leads are warranted.

The effects of diclazuril on the bursa of Fabricius (BF) structure and secretory IgA (SIgA) expression in chickens infected with Eimeria tenella were examined. The morphology of the BF was observed by hematoxylin and eosin staining, while ultrastructural changes were monitored by transmission electron microscopy. E. tenella infection caused the BF cell volumes to decrease, irregularly arranged, as well as, enlargement of the intercellular space. Diclazuril treatment alleviated the physical signs of damages associated with E. tenella infection. The SIgA expression in BF was analyzed by immunohistochemistry technique. The SIgA expression increased significantly by 350.4% (P<0.01) after E. tenella infection compared to the normal control group. With the treatment of diclazuril, the SIgA was relatively fewer in the cortex, and the expression level was significantly decreased by 46.7% (P<0.01) compared with the infected and untreated group. In conclusion, E. tenella infection in chickens induced obvious harmful changes in BF morphological structure and stimulated the expression of SIgA in the BF. Diclazuril treatment effectively alleviated the morphological changes. This result demonstrates a method to develop an immunological strategy in coccidiosis control. Key words: Eimeria tenella, diclazuril, bursa of Fabricius (BF), secretory immunoglobulin A (SIgA), ultrastructure, chicken

Abstract Background Rapid recurrence, defined as gross tumor recurrence after primary operation but prior to initiating postoperative radiation therapy (PORT), is underappreciated in head and neck cancer (HNC). Methods CT simulation images in patients with HNC managed surgically with adjuvant therapy at a single center between 2010 and 2017 were retrospectively reviewed. Results A total of 194 patients with HNC were included. Rapid recurrence occurred in 39 patients (20%) with a median time from operation to CT simulation of 37 days. On multivariable analysis (MVA), extranodal extension (ENE) was the only predictor of rapid recurrence ( P = .03). While rapid recurrence, ENE, and perineural invasion were all associated with poor overall survival (OS) on MVA, rapid recurrence was the strongest predictor (hazard ratio [HR] 5.47). Conclusion Rapid recurrence occurs at an underappreciated rate and is associated with poor survival outcomes. Patients with ENE are at highest risk and may benefit from diagnostic imaging evaluations immediately prior to PORT.

There is hesitation to offer pediatric patients rhinoplasty due to concerns about postoperative effect on midface growth. A cross-sectional survey of members of the American Academy of Facial Plastic and Reconstructive Surgery was conducted regarding practice information and attitudes towards pediatric septorhinoplasty. The goal of the study is to describe the current attitudes on pediatric septorhinoplasty.Cross-sectional survey.Community members of the American Academy of Facial Plastic and Reconstructive Surgery society.A 19-question survey was distributed to surgeons surveying background information and current attitudes towards pediatric septorhinoplasty practices. Fisher's exact tests were implemented using Monte Carlo methods.There were 94 total respondents. A majority believed septorhinoplasty is safe in patients <16 years of age (n = 68, 72.34 %) with most choosing either 16 years (n = 30, 31.91 %) or 14 years (n = 29, 30.85 %) as the minimum age to consider the procedure. A majority of respondents would not perform any nasal procedures in patients ≤12 years (n = 40, 43.48 %).Trends in pediatric rhinoplasty practices have evolved overtime. Despite prior beliefs and studies cautioning against performing septorhinoplasty in pediatric patients (<16 years of age), a majority of practicing facial plastic surgeons believe that pediatric septorhinoplasty can be performed in patients >14 years old.IV.

Extended reality (XR) devices, including augmented, virtual, and mixed reality, provide a deeply immersive experience. However, practical limitations like weight, heat, and comfort put extreme constraints on the performance, power consumption, and image quality of such systems. In this paper, we study how these constraints form the tradeoff between Fixed Foveated Rendering (FFR), Gaze-Tracked Foveated Rendering (TFR), and conventional, non-foveated rendering. While existing papers have often studied these methods, we provide the first comprehensive study of their relative feasibility in practical systems with limited battery life and computational budget. We show that TFR with the added cost of the gaze-tracker can often be more expensive than FFR. Thus, we co-design a gaze-tracked foveated renderer considering its benefits in computation, power efficiency, and tradeoffs in image quality. We describe principled approximations for eye tracking which provide up to a 9x speedup in runtime performance with approximately a 20x improvement in energy efficiency when run on a mobile GPU. In isolation, these approximations appear to significantly degrade the gaze quality, but appropriate compensation in the visual pipeline can mitigate the loss. Overall, we show that with a highly optimized gaze-tracker, TFR is feasible compared to FFR, resulting in up to 1.25x faster frame times while also reducing total energy consumption by over 40%.

This paper examines treatment needs of the children of women served in the Center for Substance Abuse Treatment's Residential Women and Children and Pregnant and Postpartum Women (RWC/PPW) program. It integrates statistical information from CSAT's cross-site evaluation of the program and clinical insights obtained from one RWC treatment site, the Arkansas CARES project. The cross-site data provide broad-based information about the extent to which clients' children experience various risk factors, while the project data provide concrete information about major administrative and clinical challenges to the provision of needed child services in a parent-focused residential treatment setting. Data from both perspectives suggest that many children admitted into residential treatment with their mothers need an array of long-term supportive services, requiring a new focus and a commitment of resources from substance abuse treatment providers.

The head and neck region poses a challenging arena for oncologic surgery. Diseases and their treatment can affect a myriad of functions, including sight, hearing, taste, smell, breathing, speaking, swallowing, facial expression, and appearance. This review discusses several areas where refinements in surgical techniques have led to improved patient outcomes. This includes surgical incisions, neck lymphadenectomy, transoral laser microsurgery, minimally invasive thyroid surgery, and the use of vascularized free flaps for oromandibular reconstruction.

We study a Bayesian congestion game which models routing in environments where the route costs are affected by a random network state. Each player is subscribed to one of two Traveler Information Systems (TIS), which estimate the state with different levels of accuracy. The TISs induce two traveler populations with heterogeneous access to information about the state. Each traveler population then routes its demand on a network of two parallel routes based on its private beliefs of the state and of the other population. For simplicity, we assume that one TIS provides a more accurate estimate than the other in all states. We characterize the equilibria of the game under two information structures. The first information structure is specified by objective beliefs, i.e., those consistent with a common prior distribution on the network state and type profiles, whereas the second is specified by subjective beliefs that do not admit a common prior. Our equilibrium results permit an analysis of social costs with respect to changes in the relative size of two populations. We show that the equilibrium social cost is minimized either for a unique ratio of population sizes, or for a continuous range of population sizes, and that information access heterogeneity is always socially beneficial. However, this ratio (or range) of population sizes differ between the subjective and objective cases. Finally, we study examples of information structures in which travelers in the population with access to more accurate information about the state are worse off than the other travelers.

<h2>Abstract</h2><h3>Background</h3> Preoperative laboratory tests (PLTs) are not associated with complications among healthy patients in various ambulatory procedures. This association has not been studied in ambulatory endocrine surgery. <h3>Methods</h3> The 2015–2018 NSQIP datasets were queried for elective outpatient thyroid and parathyroid procedures in ASA class 1 and 2 patients. Outcomes were compared between those with and without PLTs. Multivariate regression examined factors predictive of receiving PLTs. Testing costs were calculated. <h3>Results</h3> 58.7% of the cohort received PLTs. There were no differences in outcomes between those who were and those who were not tested. Non-white ethnicity, dyspnea, and non-general anesthesia were strongly predictive of receiving PLTs. Over $2.6 million is spent annually on PLTs in this population. <h3>Conclusions</h3> Over half of healthy patients undergoing elective thyroid and parathyroid surgery receive PLTs. Complication rates did not differ between those with and without PLTs. Preoperative testing should be used more judiciously in these patients, which may lead to cost savings.

Management of hypopharynx cancer is often extrapolated from larynx cancer. This report analyses treatment patterns and survival limited to hypopharynx cancer using the National Cancer Database (NCDB).There are 9314 patients diagnosed with hypopharynx cancer between 2004 and 2016. The association between treatment modality and survival was analyzed using Kaplan-Meier survival curves and multivariable Cox regression.Five-year overall survival ranged from 45% for stage I to 21% for stage IVB. Treatment modality did not influence survival in stage I/II. For stage III/IV, chemoradiation and surgery + adjuvant therapy were equivalent. Surgery yielded improved survival for T4 disease. Human papillomavirus (HPV)-positive tumors were present in 21% and were associated with improved hazard ratio of death (0.60, p = <0.0001).Survival is superior for T4 hypopharynx cancer managed with surgery, while treatment modality does not impact outcomes for other T-stages. HPV-positive tumors are associated with improved survival regardless of treatment.

Cutaneous sarcomas represent a rare group of tumors presenting in the head and neck. In this article, we discuss specific sarcoma tumor types and their presentation, pathogenesis, histologic findings, and management recommendations. Tumors to be reviewed include dermatofibrosarcoma protuberans, atypical fibroxanthoma, pleomorphic dermal sarcoma, cutaneous leiomyosarcoma, and angiosarcoma.

Federated Learning (FL) is a widely adopted distributed learning paradigm for to its privacy-preserving and collaborative nature. In FL, each client trains and sends a local model to the central cloud for aggregation. However, FL systems using neural network (NN) models are expensive to deploy on constrained edge devices regarding computation and communication. In this demo, we present FedHD, a FL system using Hyperdimensional Computing (HDC). In contrast to NN, HDC is a brain-inspired and lightweight computing paradigm using high-dimensional vectors and associative memory. Our measurements indicate that FedHD is 3.2×, 3.2×, 5× better on performance, energy and communication efficiency respectively compared to NN-based FL systems whilst maintaining similar accuracy to the state of the art. Our code is available on GitHub1.

Objectives Mandibular dose constraints are designed to limit high dose to small volumes to avoid osteoradionecrosis (ORN). Based upon a published experience, intermediate-dose constraints were introduced but have not been independently validated. We hypothesize that these constraints lower ORN rate without compromising other organs at risk (OAR). Methods Oropharyngeal cancer patients treated with standard fractionation adjuvant/definitive VMAT from 01/2014–08/2020 were included. In 09/2017, mandibular dose constraint was changed from historical constraint (HC) of D 0.1 cc < 70 Gy to modified constraints (MC) of V 44 Gy < 42%, V 58 Gy < 25%, D 0.5 cc < 70 Gy. OAR dosimetric changes and ORN development were evaluated. Regression modelling predicted long-term ORN cases in MC group. Results There were 174 patients, 71 in MC group. Seven cases of ORN in HC group at a median follow up (FU) of 39 months and 1 case of ORN in MC group at a median FU of 11 months were observed. More patients in the MC group met V 44 Gy (87% vs 62%, p < 0.01) and V 58 Gy constraints (92% vs 73%, p < 0.01). Mean doses to OARs did not rise. Mandible V 44 Gy and V 58 Gy were significantly associated with ORN (p < 0.01 and p = 0.03, respectively) across all patients. In the HC group, V 44 Gy was independently associated with ORN (p = 0.01). To account for shorter FU in MC group, logistic regression of ORN based on V 44 Gy in HC patients was performed. This predicts 3.2 ORN cases in the MC group (95% CI: 0.00–6.4). Conclusion Achieving V 44 Gy and V 58 Gy was successful in 87% of cases without sacrificing target coverage or OARs and resulted in non-significant ORN decrease.

Dysphagia-related symptoms in patients with head and neck cancer are common before treatment. We hypothesized greater self-reported baseline dysphagia would predict gastrostomy placement during primary radiation.Swallowing-specific/general surveys (SwalQOL/EuroQOL) collected prospectively before definitive radiation were analyzed for associations with gastrostomy placement. Prophylactic gastrostomy was recommended at the discretion of a multidisciplinary team blinded to the surveys.Of 84 patients in the cohort, 42 patients (50%) received feeding tubes. Eleven patients (13%) who underwent prophylactic feeding tube placement reported the greatest pretreatment dysphagia, whereas those who avoided gastrostomies reported the least. Prophylactic gastrostomy was more strongly associated with patient-reported measures than other clinical criteria. Controlling for stage IV, T3 to T4 classification, smoking, chemotherapy, and pretreatment weight loss, baseline dysphagia remained an independent predictor of feeding tube placement (odds ratio [OR] = 0.12; 95% confidence interval [CI] = 0.05-0.55; p = .01). Patients without gastrostomies during treatment avoided persistent gastrostomy dependence.Baseline dysphagia-related symptoms before radiation are independent predictors of gastrostomy placement. © 2015 Wiley Periodicals, Inc. Head Neck 38: E1318-E1324, 2016.

Head and neck cancer typically refers to epithelial malignancies of the upper aerodigestive tract and may include neoplasms of the thyroid, salivary glands, and soft tissue, bone sarcomas, and skin cancers. Two-thirds of patients present with advanced disease involving regional lymph nodes at the time of diagnosis. A thorough history and detailed examination are integral to oncologic staging and treatment planning. This article begins with an overview of the head and neck examination (with special attention to detailed findings with clinical implications), followed by a discussion of the major head and neck subsites, and clinical pearls surrounding the examination.

Introduction The last few years have seen significant increase in the number of available clinical trials in head and neck cancer. It has been difficult to stay abreast of these efforts because multiple cooperative groups and institutions are engaged in their recruitment. This review presents the state of the art of available clinical trials organized around major research themes. Data Sources Published literature, published cooperative group monographs, expert review. Review Methods Initial themes in head and neck cancer clinical trial development were first identified along with examples. Opinions from an international panel of multidisciplinary experts were then solicited. Results/Discussion Current major themes of head and neck clinical trials centered on 5 major themes: (1) recognition of human papillomavirus oropharynx cancer and optimal treatment strategies, (2) defining the role of transoral surgery in head and neck cancer treatment, (3) improving postoperative adjuvant treatment, (4) investigation of rare malignancies, and (5) the importance of biomarker‐driven, innovative, and targeted therapy investigation. Conclusions A number of exciting clinical trials are currently in development or accrual with the potential for tremendous impact and improvement of the treatment of head and neck cancer. Implications for Practice Awareness by practicing otolaryngologists and trainees of these current themes will be essential for study accrual, success, and improvement in the care of head and neck cancer.

Hyperthermia has been shown promising in the treatment of head and neck squamous cell carcinoma (HNSCC); however, the mechanism underlying hyperthermia reducing tumor metastasis is poorly elucidated. TWIST2, an important transcription factor of epithelial-mesenchymal transition (EMT), plays a critical role in the tumor progression and metastasis. The role of TWIST2 in tongue squamous cell carcinoma (TSCC) and its association with hyperthermia still have not been reported.The correlations between TWIST2 expression and the clinical-pathologic characteristics of 89 patients with TSCC were evaluated by immunohistochemical staining. TSCC cell lines transfected with siRNA against TWIST2 were heated for 40 min at 42.5°C, and the migration capability of cells was examined by migration assay. Xenograft tumors in nude mice were treated by hyperthermia, and TWIST2 expression was measured.Our data showed that TWIST2 expression was associated with the metastasis of human TSCC. In Tca8113 and Cal-27 cells, TWIST2-siRNA treatment can reduce cell migration ability and has no effect on the cell proliferation and apoptosis. Hyperthermia can decrease the level of TWIST2 in TSCC and inhibit the migration of cells.This demonstrated that hyperthermia might decrease the migration of Tca8113 and Cal-27 cells by reducing TWIST2 expression. Altogether, these findings suggest an as yet undescribed link between TWIST2 and hyperthermia in TSCC.

Laboratory and clinical studies have shown that vacuum-assisted closure (VAC) therapy increases wound blood flow and granulation tissue formation and decreases accumulation of fluid and bacteria. Many publications outline the use of VAC dressings in the treatment of sternal, sacral, upper and lower extremity, perineal, and abdominal wounds, but few describe its use in the head and neck region. No report to date has addressed the use of VAC therapy in helping to preserve facial nerve integrity.We present a case of a 64-year-old woman who underwent tissue debridement for necrotizing fasciitis of the left face, neck, and upper chest. She subsequently had exposed facial nerve that was covered with a VAC dressing and demonstrated complete granulation by postoperative day 7 with preservation of function.This case highlights the effectiveness of VAC in eliminating infectious material and promoting granulation tissue formation. This is the first time that VAC therapy has been shown to maintain neural function when placed directly on functioning cranial nerves.

Background Multi-gene prognostic signatures derived from primary tumor biopsies can guide clinicians in designing an appropriate course of treatment. Identifying genes and pathways most essential to a signature performance may facilitate clinical application, provide insights into cancer progression, and uncover potentially new therapeutic targets. We previously developed a 17-gene prognostic signature (HTICS) for HER2+:ERα- breast cancer patients, using genes that are differentially expressed in tumor initiating cells (TICs) versus non-TICs from MMTV-Her2/neu mammary tumors. Here we probed the pathways and genes that underlie the prognostic power of HTICS. Methods We used Leave-One Out, Data Combination Test, Gene Set Enrichment Analysis (GSEA), Correlation and Substitution analyses together with Receiver Operating Characteristic (ROC) and Kaplan-Meier survival analysis to identify critical biological pathways within HTICS. Publically available cohorts with gene expression and clinical outcome were used to assess prognosis. NanoString technology was used to detect gene expression in formalin-fixed paraffin embedded (FFPE) tissues. Results We show that three major biological pathways: cell proliferation, immune response, and cell migration, drive the prognostic power of HTICS, which is further tuned by Homeostatic and Glycan metabolic signalling. A 6-gene minimal Core that retained a significant prognostic power, albeit less than HTICS, also comprised the proliferation/immune/migration pathways. Finally, we developed NanoString probes that could detect expression of HTICS genes and their substitutions in FFPE samples. Conclusion Our results demonstrate that the prognostic power of a signature is driven by the biological processes it monitors, identify cell proliferation, immune response and cell migration as critical pathways for HER2+:ERα- cancer progression, and defines substitutes and Core genes that should facilitate clinical application of HTICS.

This article studies the value of information in route choice decisions when a fraction of players have access to high accuracy information about traffic incidents relative to others. To model such environments, we introduce a Bayesian congestion game, in which players have private information about incidents, and each player chooses her route on a network of parallel links. The links are prone to incidents that occur with an ex-ante known probability. The demand is comprised of two player populations: one with access to high accuracy incident information and another with low accuracy information, i.e. the populations differ only by their access to information. The common knowledge includes: (i) the demand and route cost functions, (ii) the fraction of highly-informed players, (iii) the incident probability, and (iv) the marginal type distributions induced by the information structure of the game. We present a full characterization of the Bayesian Wardrop Equilibrium of this game under the assumption that low information players receive no additional information beyond common knowledge. We also compute the cost to individual players and the social cost as a function of the fraction of highly-informed players when they receive perfectly accurate information. Our first result suggests that below a certain threshold of highly-informed players, both populations experience a reduction in individual cost, with the highly-informed players receiving a greater reduction. However, above this threshold, both populations realize the same equilibrium cost. Secondly, there exists another (lower or equal) threshold above which a further increase in the fraction of highly-informed players does not reduce the expected social costs. Thus, once a sufficiently large number of players are highly informed, wider distribution of more accurate information is ineffective at best, and otherwise socially harmful.

Objective To report T1‐2N0 tongue cancer recurrences initially treated with surgery alone. Methods Between 1990 and 2010, 27 patients at tertiary hospital referral center institution were treated with curative intent for locoregional recurrence after initial glossectomy with or without neck dissection for T1‐2N0 tongue cancer. None had received adjuvant postoperative radiation as a component of the original treatment. Results Median time to locoregional recurrence was 12 months (range 5–39 months) and 78% of failures occurred in the first 2 years. Most treatment failures were local (63%). Salvage strategy was risk‐adapted by individual patient. The 5‐year disease specific survival (DSS) was 61%. Patients with local recurrences alone fared significantly better than those with regional recurrences (5‐yr DSS: 86% vs . 22%, P = 0.0018). Local recurrences were usually treated by surgery alone, while regional recurrences were more commonly treated with combined modality treatment ( P = 0.005). Conclusions Recurrence of early stage oral tongue cancer can be successfully salvaged in a majority of cases. Patients developing regional recurrence have significantly worse prognosis than those with local failures.

Multidisciplinary care (MDC) yields proven benefits for patients with cancer, although it may be underused in the complex management of head and neck squamous cell carcinoma (HNSCC).To characterize the patterns of MDC in the treatment of HNSCC among elderly patients in the US.This nationwide, population-based, retrospective cohort study used Surveillance, Epidemiology, and End Results (SEER)-Medicare linked data from January 1, 1991, to December 31, 2011, to identify patients 66 years or older diagnosed with head and neck cancer and determine the dates of diagnosis, oncology consultations, treatment initiation, and speech therapy evaluation in addition to MDC completion. Multidisciplinary care was defined in a stage-dependent manner: localized disease necessitated consultations with radiation and surgical oncologists, and advanced-stage disease also included a medical oncology consultation, all before definitive treatment. Data were analyzed between December 2016 and September 2020.Rates of MDC across all subsites of head and neck cancer as measured by the presence of an evaluation for each oncologist on the MDC team and its effect on treatment initiation.This cohort study assessed 28 293 patients with HNSCC (mean [SD] age, 75.1 [6.6] years; 67% male; 87% White) from the SEER-Medicare linked database. The HNSCC subsites included larynx (40%), oral cavity (30%), oropharynx (21%), hypopharynx (7%), and nasopharynx (2%). Overall, the practice of MDC significantly increased over time, from 24% in 1991 to 52% in 2011 (P < .001). For patients with localized (stage 0-II) tumors, 60% received care in the multidisciplinary setting, whereas 28% of those with advanced-stage disease did. A total of 18 181 patients (64%) were treated with initial definitive nonsurgical therapy across all stages. Regardless of stage and subsite, few patients (2%) underwent evaluation by a speech-language pathologist before definitive therapy. Multidisciplinary care prolonged the time to initiation of definitive treatment by 11 days for localized disease and 10 days for advanced disease.This cohort study found that most elderly patients with localized HNSCC received MDC, whereas few patients with advanced-stage disease received such care, although a significant proportion received adjuvant therapy. Multidisciplinary care may prolong time to initiation of definitive treatment with an uncertain impact. Consultation with a speech-language pathologist before definitive therapy was rare.

Abstract Pleomorphic adenoma (PA) is the most common benign salivary gland tumor. Fine‐needle aspiration (FNA) of PA exhibits variable combinations of bland ductal epithelial cells, myoepithelial cells, and characteristic magenta fibrillary stroma on Diff–Quik/Romanowsky stain. However, a cellular PA with scant chondromyxoid stroma can be a diagnostic challenge on FNA. Around 70% of PAs have a translocation involving PLAG1 or HMGA2 . The presence of either PLAG1 or HMGA2 fusion gene can be used to diagnose PA since they have not been reported in other salivary gland tumors except for carcinoma ex PA. In this case report, we describe a case of cellular PA initially diagnosed on FNA as a “low grade salivary gland neoplasm, favor PA.” RNA next‐generation sequencing performed on the cell block showed a BOC‐PLAG1 fusion gene. The presence of PLAG1 fusion gene in conjunction with cytomorphology supported a diagnosis of PA. The mass was surgically removed and proved to be a cellular PA with scattered foci of chondromyxoid and collagenous stroma. To our knowledge, this is the first reported PA bearing BOC‐PLAG1 . RNA next‐generation sequencing performed on cytology specimens can be helpful in achieving a more specific diagnosis of salivary gland tumors.

To determine potential effects of humidification on the volume of airway secretions in mechanically ventilated patients.Water vapor delivery from devices providing non-heated-wire humidification, heated-wire humidification, and heat and moisture exchanger (HME) were quantified on the bench. Then, patients requiring 24-hour mechanical ventilation were exposed sequentially to each of these humidification devices, and secretions were removed and measured by suctioning every hour during the last 4 hours of the 24-hour study period.In vitro water vapor delivery was greater using non-heated-wire humidification, compared to heated-wire humidification and HME. In vivo, a total of 9 patients were studied. Secretion volume following humidification by non-heated-wire humidification was significantly greater than for heated-wire humidification and HME (P=.004).The volume of secretions appeared to be linked to humidification, as greater water vapor delivery measured in vitro was associated with greater secretion volume in vivo.

We report the pathology and outcome of secondary skull base tumors in patients previously treated with external beam radiation for retinoblastoma (Rb). Rb patients are at increased risk of second head and neck primary malignancies due to early radiation exposure during treatment and loss of RB1 protein in genetic carriers. An institutional database was reviewed for patients with retinoblastoma who had previously received radiation therapy and subsequently developed skull base tumors. Seventeen patients met the selection criteria. The median age of Rb diagnosis was 12 months. Thirteen cases underwent enucleation in addition to radiation therapy as part of initial Rb treatment. A median of 19 years elapsed between the diagnosis of Rb and diagnosis of skull base malignancy. The most common tumors were osteogenic sarcoma (39%) and leiomyosarcoma (22%). Eleven (71%) patients received postoperative chemotherapy, and 7 (41%) received postoperative radiotherapy. Three (24%) patients underwent salvage surgery for recurrent disease. Five-year survival was 68%, and 10-year survival was 51% by Kaplan-Meier analysis. Secondary malignancy in Rb patients is a well-defined event. The use of surgery with appropriate adjuvant therapy was associated with a 51% 10-year survival in this study population.

Abstract Allergic disorders have now become a major worldwide public health issue, but the effective treatment options remain limited. We report a novel approach to block allergic reactivity by targeting the surface-bound IgE of the allergic effector cells via low-affinity anti-human IgE Abs with dissociation constants in the 10−6 to 10−8 M range. We demonstrated that these low-affinity anti-IgE mAbs bind to the cell surface–bound IgE without triggering anaphylactic degranulation even at high concentration, albeit they would weakly upregulate CD203c expression on basophils. This is in contrast to the high-affinity anti-IgE mAbs that trigger anaphylactic degranulation at low concentration. Instead, the low-affinity anti-IgE mAbs profoundly block human peanut- and cat-allergic IgE-mediated basophil CD63 induction indicative of anaphylactic degranulation; suppress peanut-, cat-, and dansyl-specific IgE-mediated passive cutaneous anaphylaxis; and attenuate dansyl IgE-mediated systemic anaphylaxis in human FcεRIα transgenic mouse model. Mechanistic studies reveal that the ability of allergic reaction blockade by the low-affinity anti-IgE mAbs was correlated with their capacity to downregulate the surface IgE and FcεRI level on human basophils and the human FcεRIα transgenic mouse bone marrow–derived mast cells via driving internalization of the IgE/FcεRI complex. Our studies demonstrate that targeting surface-bound IgE with low-affinity anti-IgE Abs is capable of suppressing allergic reactivity while displaying an excellent safety profile, indicating that use of low-affinity anti-IgE mAbs holds promise as a novel therapeutic approach for IgE-mediated allergic diseases.