Isei Tanida

Autophagy is a membrane-trafficking mechanism that delivers cytoplasmic constituents into the lysosome/vacuole for bulk protein degradation. This mechanism is involved in the preservation of nutrients under starvation condition as well as the normal turnover of cytoplasmic component. Aberrant autophagy has been reported in several neurodegenerative disorders, hepatitis, and myopathies. Here, we generated conditional knockout mice of Atg7, an essential gene for autophagy in yeast. Atg7 was essential for ATG conjugation systems and autophagosome formation, amino acid supply in neonates, and starvation-induced bulk degradation of proteins and organelles in mice. Furthermore, Atg7 deficiency led to multiple cellular abnormalities, such as appearance of concentric membranous structure and deformed mitochondria, and accumulation of ubiquitin-positive aggregates. Our results indicate the important role of autophagy in starvation response and the quality control of proteins and organelles in quiescent cells.

SummaryMicrotubule-associated protein 1A/1B-light chain 3 (LC3) is a soluble protein with a molecular mass of ∼17 kDa that is distributed ubiquitously in mammalian tissues and cultured cells. During autophagy, autophagosomes engulf cytoplasmic components, including cytosolic proteins and organelles. Concomitantly, a cytosolic form of LC3 (LC3-I) is conjugated to phosphatidylethanolamine to form LC3-phosphatidylethanolamine conjugate (LC3-II), which is recruited to autophagosomal membranes. Autophagosomes fuse with lysosomes to form autolysosomes, and intra-autophagosomal components are degraded by lysosomal hydrolases. At the same time, LC3-II in autolysosomal lumen is degraded. Thus, lysosomal turnover of the autophagosomal marker LC3-II reflects starvation-induced autophagic activity, and detecting LC3 by immunoblotting or immunofluorescence has become a reliable method for monitoring autophagy and autophagy-related processes, including autophagic cell death. Here we describe basic protocols to assay for endogenous LC3-II by immunoblotting, immunoprecipitation, and immunofluorescence.

Autophagy is the bulk degradation of proteins and organelles, a process essential for cellular maintenance, cell viability, differentiation and development in mammals. Autophagy has significant associations with neurodegenerative diseases, cardiomyopathies, cancer, programmed cell death, and bacterial and viral infections. During autophagy, a cup-shaped structure, the preautophagosome, engulfs cytosolic components, including organelles, and closes, forming an autophagosome, which subsequently fuses with a lysosome, leading to the proteolytic degradation of internal components of the autophagosome by lysosomal lytic enzymes. During the formation of mammalian autophagosomes, two ubiquitylation-like modifications are required, Atg12-conjugation and LC3-modification. LC3 is an autophagosomal ortholog of yeast Atg8. A lipidated form of LC3, LC3-II, has been shown to be an autophagosomal marker in mammals, and has been used to study autophagy in neurodegenerative and neuromuscular diseases, tumorigenesis, and bacterial and viral infections. The other Atg8 homologues, GABARAP and GATE-16, are also modified by the same mechanism. In non-starved rats, the tissue distribution of LC3-II differs from those of the lipidated forms of GABARAP and GATE-16, GABARAP-II and GATE-16-II, suggesting that there is a functional divergence among these three modified proteins. Delipidation of LC3-II and GABARAP-II is mediated by hAtg4B. We review the molecular mechanism of LC3-modification, the crosstalk between LC3-modification and mammalian Atg12-conjugation, and the cycle of LC3-lipidation and delipidation mediated by hAtg4B, as well as recent findings concerning the other two Atg8 homologues, GABARAP and GATE-16. We also highlight recent findings regarding the pathobiology of LC3-modification, including its role in microbial infection, cancer and neuromuscular diseases.

During starvation-induced autophagy in mammals, autophagosomes form and fuse with lysosomes, leading to the degradation of the intra-autophagosomal contents by lysosomal proteases. During the formation of autophagosomes, LC3 is lipidated, and this LC3-phospholipid conjugate (LC3-II) is localized on autophagosomes and autolysosomes. While intra-autophagosomal LC3-II may be degraded by lysosomal hydrolases, recent studies have regarded LC3-II accumulation as marker of autophagy. The effect of lysosomal turnover of endogenous LC3-II in this process, however, has not been considered. We therefore investigated the lysosomal turnover of endogenous LC3-II during starvation-induced autophagy using E64d and pepstatin A, which inhibit lysosomal proteases, including cathepsins B, D, and L. We found that endogenous LC3-II significantly accumulated in the presence of E64d and pepstatin A under starvation conditions, increasing about 3.5 fold in HEK293 cells and about 6.7 fold in HeLa cells compared with that in their absence, whereas the amount of LC3-II in their absence is cell-line dependent. Morphological analyses indicated that endogenous LC3-positive puncta and autolysosomes increased in HeLa cells under starvation conditions in the presence of these inhibitors. These results indicate that endogenous LC3-II is considerably degraded by lysosomal hydrolases after formation of autolysosomes, and suggest that lysosomal turnover, not a transient amount, of this protein reflects starvation-induced autophagic activity.

Expanded polyglutamine 72 repeat (polyQ72) aggregates induce endoplasmic reticulum (ER) stress-mediated cell death with caspase-12 activation and vesicular formation (autophagy). We examined this relationship and the molecular mechanism of autophagy formation. Rapamycin, a stimulator of autophagy, inhibited the polyQ72-induced cell death with caspase-12 activation. PolyQ72, but not polyQ11, stimulated Atg5-Atg12-Atg16 complex-dependent microtubule-associated protein 1 (MAP1) light chain 3 (LC3) conversion from LC3-I to -II, which plays a key role in autophagy. The eucaryotic translation initiation factor 2 α (eIF2α) A/A mutation, a knock-in to replace a phosphorylatable Ser51 with Ala51, and dominant-negative PERK inhibited polyQ72-induced LC3 conversion. PolyQ72 as well as ER stress stimulators upregulated Atg12 mRNA and proteins via eIF2α phosphorylation. Furthermore, Atg5 deficiency as well as the eIF2α A/A mutation increased the number of cells showing polyQ72 aggregates and polyQ72-induced caspase-12 activation. Thus, autophagy formation is a cellular defense mechanism against polyQ72-induced ER-stress-mediated cell death by degrading polyQ72 aggregates, with PERK/eIF2α phosphorylation being involved in polyQ72-induced LC3 conversion.

The small GTP binding protein Rab7 has a role in the late endocytic pathway and lysosome biogenesis. The role of mammalian Rab7 in autophagy is, however, unknown. We have addressed this by inhibiting Rab7 function with RNA interference and overexpression of dominant negative Rab7. We show here that Rab7 was needed for the formation of preferably perinuclear, large aggregates, where the autophagosome marker LC3 colocalised with Rab7 and late endosomal and lysosomal markers. By electron microscopy we showed that these large aggregates corresponded to autophagic vacuoles surrounding late endosomal or lysosomal vesicles. Our experiments with quantitative electron microscopy showed that Rab7 was not needed for the initial maturation of early autophagosomes to late autophagic vacuoles, but that it participated in the final maturation of late autophagic vacuoles. Finally, we showed that the recruitment of Rab7 to autophagic vacuoles was retarded in cells deficient in the lysosomal membrane proteins Lamp1 and Lamp2, which we have recently shown to accumulate late autophagic vacuoles during starvation. In conclusion, our results showed a role for Rab7 in the final maturation of late autophagic vacuoles.

Autophagy (macroautophagy), or the degradation of large numbers of cytoplasmic components, is induced by extracellular and intracellular signals, including oxidative stress, ceramide, and endoplasmic reticulum stress. This dynamic process involves membrane formation and fusion, including autophagosome formation, autophagosome-lysosome fusion, and the degradation of intra-autophagosomal contents by lysosomal hydrolases. Autophagy is associated with tumorigenesis, neurodegenerative diseases, cardiomyopathy, Crohn's disease, fatty liver, type II diabetes, defense against intracellular pathogens, antigen presentation, and longevity. Among the proteins and multimolecular complexes that contribute to autophagosome formation are the PI(3)-binding proteins, the PI3-phosphatases, the Rab proteins, the Atg1/ULK1 protein-kinase complex, the Atg9•Atg2-Atg18 complex, the Vps34-Atg6/beclin1 class III PI3-kinase complex, and the Atg12 and Atg8/LC3 conjugation systems. Two ubiquitin-like modifications, the Atg12 and LC3 conjugations, are essential for membrane elongation and autophagosome formation. Recent findings have revealed that processes of selective autophagy, including pexophagy, mitophagy, ERphagy (reticulophagy), and the p62-dependent degradation of ubiquitin-positive aggregates, are physiologically important in various disease states, whereas "classical" autophagy is considered nonselective degradation. Processes of selective autophagy require specific Atg proteins in addition to the "core" Atg complexes. Finally, methods to monitor autophagic activity in mammalian cells are described.

Caffeine is one of the most frequently ingested neuroactive compounds. All known mechanisms of apoptosis induced by caffeine act through cell cycle modulation or p53 induction. It is currently unknown whether caffeine-induced apoptosis is associated with other cell death mechanisms, such as autophagy. Herein we show that caffeine increases both the levels of microtubule-associated protein 1 light chain 3-II and the number of autophagosomes, through the use of western blotting, electron microscopy and immunocytochemistry techniques. Phosphorylated p70 ribosomal protein S6 kinase (Thr389), S6 ribosomal protein (Ser235/236), 4E-BP1 (Thr37/46) and Akt (Ser473) were significantly decreased by caffeine. In contrast, ERK1/2 (Thr202/204) was increased by caffeine, suggesting an inhibition of the Akt/mTOR/p70S6K pathway and activation of the ERK1/2 pathway. Although insulin treatment phosphorylated Akt (Ser473) and led to autophagy suppression, the effect of insulin treatment was completely abolished by caffeine addition. Caffeine-induced autophagy was not completely blocked by inhibition of ERK1/2 by U0126. Caffeine induced reduction of mitochondrial membrane potentials and apoptosis in a dose-dependent manner, which was further attenuated by the inhibition of autophagy with 3-methyladenine or Atg7 siRNA knockdown. Furthermore, there was a reduced number of early apoptotic cells (annexin V positive, propidium iodide negative) among autophagy-deficient mouse embryonic fibroblasts treated with caffeine than their wild-type counterparts. These results support previous studies on the use of caffeine in the treatment of human tumors and indicate a potential new target in the regulation of apoptosis.

In the yeast Saccharomyces cerevisiae, the Apg12p-Apg5p conjugating system is essential for autophagy. Apg7p is required for the conjugation reaction, because Apg12p is unable to form a conjugate with Apg5p in the apg7/cvt2 mutant. Apg7p shows a significant similarity to a ubiquitin-activating enzyme, Uba1p. In this article, we investigated the function of Apg7p as an Apg12p-activating enzyme. Hemagglutinin-tagged Apg12p was coimmunoprecipitated with c-myc-tagged Apg7p. A two-hybrid experiment confirmed the interaction. The coimmunoprecipitation was sensitive to a thiol-reducing reagent. Furthermore, a thioester conjugate of Apg7p was detected in a lysate of cells overexpressing both Apg7p and Apg12p. These results indicated that Apg12p interacts with Apg7p via a thioester bond. Mutational analyses of Apg7p suggested that Cys507 of Apg7p is an active site cysteine and that both the ATP-binding domain and the cysteine residue are essential for the conjugation of Apg7p with Apg12p to form the Apg12p-Apg5p conjugate. Cells expressing mutant Apg7ps, Apg7pG333A, or Apg7pC507A showed defects in autophagy and cytoplasm-to-vacuole targeting of aminopeptidase I. These results indicated that Apg7p functions as a novel protein-activating enzyme necessary for Apg12p-Apg5p conjugation.

In cathepsin D-deficient (CD-/-) and cathepsins B and L double-deficient (CB-/-CL-/-) mice, abnormal vacuolar structures accumulate in neurons of the brains. Many of these structures resemble autophagosomes in which part of the cytoplasm is retained but their precise nature and biogenesis remain unknown. We show here how autophagy contributes to the accumulation of these vacuolar structures in neurons deficient in cathepsin D or both cathepsins B and L by demonstrating an increased conversion of the molecular form of MAP1-LC3 for autophagosome formation from the cytosolic form (LC3-I) to the membrane-bound form (LC3-II). In both CD-/- and CB-/-CL-/- mouse brains, the membrane-bound LC3-II form predominated whereas MAP1-LC3 signals accumulated in granular structures located in neuronal perikarya and axons of these mutant brains and were localized to the membranes of autophagosomes, evidenced by immunofluorescence microscopy and freeze-fracture-replica immunoelectron microscopy. Moreover, as in CD-/- neurons, autofluorescence and subunit c of mitochondrial ATP synthase accumulated in CB-/-CL-/- neurons. This suggests that not only CD-/- but also CB-/-CL-/- mice could be useful animal models for neuronal ceroid-lipofuscinosis/Batten disease. These data strongly argue for a major involvement of autophagy in the pathogenesis of Batten disease/lysosomal storage disorders.

Article8 April 2004free access A novel protein-conjugating system for Ufm1, a ubiquitin-fold modifier Masaaki Komatsu Masaaki Komatsu Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Tomoki Chiba Tomoki Chiba Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Kanako Tatsumi Kanako Tatsumi Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Shun-ichiro Iemura Shun-ichiro Iemura National Institutes of Advanced Industrial Science and Technology, Biological Information Research Center (JBIRC), Kohtoh-ku, Tokyo, Japan Search for more papers by this author Isei Tanida Isei Tanida Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Noriko Okazaki Noriko Okazaki Kazusa DNA Research Institute, Kazusa-Kamatari, Kisarazu, Chiba, Japan Search for more papers by this author Takashi Ueno Takashi Ueno Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Eiki Kominami Eiki Kominami Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Tohru Natsume Tohru Natsume National Institutes of Advanced Industrial Science and Technology, Biological Information Research Center (JBIRC), Kohtoh-ku, Tokyo, Japan Search for more papers by this author Keiji Tanaka Corresponding Author Keiji Tanaka Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Masaaki Komatsu Masaaki Komatsu Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Tomoki Chiba Tomoki Chiba Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Kanako Tatsumi Kanako Tatsumi Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Shun-ichiro Iemura Shun-ichiro Iemura National Institutes of Advanced Industrial Science and Technology, Biological Information Research Center (JBIRC), Kohtoh-ku, Tokyo, Japan Search for more papers by this author Isei Tanida Isei Tanida Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Noriko Okazaki Noriko Okazaki Kazusa DNA Research Institute, Kazusa-Kamatari, Kisarazu, Chiba, Japan Search for more papers by this author Takashi Ueno Takashi Ueno Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Eiki Kominami Eiki Kominami Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Tohru Natsume Tohru Natsume National Institutes of Advanced Industrial Science and Technology, Biological Information Research Center (JBIRC), Kohtoh-ku, Tokyo, Japan Search for more papers by this author Keiji Tanaka Corresponding Author Keiji Tanaka Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan Search for more papers by this author Author Information Masaaki Komatsu1, Tomoki Chiba1, Kanako Tatsumi1, Shun-ichiro Iemura2, Isei Tanida3, Noriko Okazaki4, Takashi Ueno3, Eiki Kominami3, Tohru Natsume2 and Keiji Tanaka 1 1Department of Molecular Oncology, Tokyo Metropolitan Institute of Medical Science, Bunkyo-ku, Tokyo, Japan 2National Institutes of Advanced Industrial Science and Technology, Biological Information Research Center (JBIRC), Kohtoh-ku, Tokyo, Japan 3Department of Biochemistry, Juntendo University School of Medicine, Bunkyo-ku, Tokyo, Japan 4Kazusa DNA Research Institute, Kazusa-Kamatari, Kisarazu, Chiba, Japan *Corresponding author. Department of Molecular Oncology, The Tokyo Metropolitan Institute of Medical Science, 3-18-22 Honkomagome, Bunkyo-ku, Tokyo 113-8613, Japan. Tel.: +81 3 3823 2237; Fax: +81 3 3823 2237; E-mail: [email protected] The EMBO Journal (2004)23:1977-1986https://doi.org/10.1038/sj.emboj.7600205 PDFDownload PDF of article text and main figures. ToolsAdd to favoritesDownload CitationsTrack CitationsPermissions ShareFacebookTwitterLinked InMendeleyWechatReddit Figures & Info Several studies have addressed the importance of various ubiquitin-like (UBL) post-translational modifiers. These UBLs are covalently linked to most, if not all, target protein(s) through an enzymatic cascade analogous to ubiquitylation, consisting of E1 (activating), E2 (conjugating), and E3 (ligating) enzymes. In this report, we describe the identification of a novel ubiquitin-fold modifier 1 (Ufm1) with a molecular mass of 9.1 kDa, displaying apparently similar tertiary structure, although lacking obvious sequence identity, to ubiquitin. Ufm1 is first cleaved at the C-terminus to expose its conserved Gly residue. This Gly residue is essential for its subsequent conjugating reactions. The C-terminally processed Ufm1 is activated by a novel E1-like enzyme, Uba5, by forming a high-energy thioester bond. Activated Ufm1 is then transferred to its cognate E2-like enzyme, Ufc1, in a similar thioester linkage. Ufm1 forms several complexes in HEK293 cells and mouse tissues, revealing that it conjugates to the target proteins. Ufm1, Uba5, and Ufc1 are all conserved in metazoa and plants but not in yeast, suggesting its potential roles in various multicellular organisms. Introduction Protein modification plays a pivotal role in the regulation and expansion of genetic information. In the past two decades, a new type of post-translational protein-modifying system has been identified whose uniqueness is that protein(s) is used as a ligand, that is, modification of protein, by protein, and for protein. A typical system is the ubiquitylation, a modification system in which a single or multiple ubiquitin molecules are attached to a protein, which serves as a signaling player that controls a variety of cellular functions (Hershko and Ciechanover, 1998; Pickart, 2001). Protein ubiquitylation is catalyzed by an elaborate system highly regulated in the cells, which is catalyzed by a sequential reaction of multiple enzymes consisting of activating (E1), conjugating (E2), and ligating (E3) enzymes. E1, which initiates the reaction, forms a high-energy thiolester bond with ubiquitin via adenylation in an ATP-dependent manner. The E1-activated ubiquitin is then transferred to E2 in a thioester linkage. In some cases, E2 can directly transfer the ubiquitin to substrate proteins in an isopeptide linkage; however, E2s mostly requires the participation of E3 to achieve substrate-specific ubiquitylation reaction in the cells. E3s are defined as enzymes required for recognition of specific substrates for ubiquitylation, other than E1 and E2 (Varshavsky, 1997; Bonifacino and Weissman, 1998; Glickman and Ciechanover, 2002). A set of novel molecules called ubiquitin-like proteins (UBLs) that have structural similarities to ubiquitin has been recently identified (Jentsch and Pyrowolakis, 2000). They are divided into two subclasses: type-1 UBLs, which ligate to target proteins in a manner similar, but not identical, to the ubiquitylation pathway, such as SUMO, NEDD8, and UCRP/ISG15, and type-2 UBLs (also called UDPs, ubiquitin-domain proteins), which contain ubiquitin-like structure embedded in a variety of different classes of large proteins with apparently distinct functions, such as Rad23, Elongin B, Scythe, Parkin, and HOIL-1 (Tanaka et al, 1998; Jentsch and Pyrowolakis, 2000; Yeh et al, 2000; Schwartz and Hochstrasser, 2003). In this report, we describe a unique human UBL-type modifier named ubiquitin-fold modifier 1 (Ufm1) that is synthesized in a precursor form consisting of 85 amino-acid residues. We also identified the human activating (Uba5) and conjugating (Ufc1) enzymes for Ufm1. Prior to activation by Uba5, the extra two amino acids at the C-terminal region of the human proUfm1 protein are removed to expose Gly whose residue is necessary for conjugation to target molecule(s). Lastly, we show that the mature Ufm1 is conjugated to yet unidentified endogenous proteins, forming ∼28, 38, 47, and 70 kDa complexes in human HEK293 cells and various mouse tissues. Results Identification of a novel protein-activating enzyme, Uba5 Our initial plan was to identify the molecule(s) that interacts with human Atg8p homolog GATE16, a type-1 UBL modifier required for autophagy (Klionsky and Emr, 2000; Ohsumi, 2001), using a yeast two-hybrid screening. Please note that the nomenclature of the autophagy-related genes was recently unified as ATG (Klionsky et al, 2003). Among several positive clones, we identified fragments of FLJ23251 (Figure 1A), which encodes a 404-amino-acid protein highly conserved in various multicellular organisms, such as Homo sapiens, Caenorhabditis elegans, Drosophila melanogaster, and Arabidopsis thaliana, but absent in yeasts (Saccharomyces cerevisiae and Schizosaccharomyces pombe) (Figure 1B). The sequence of FLJ23251 in the region containing residues 72–229 is highly homologous to the corresponding regions in Uba1 (i.e., E1 for ubiquitin) and other E1-like proteins for UBLs including the ATP-binding motif (GXGXXG) (Figure 1A and B). We named this protein Uba5, because it is a member of the E1-like enzyme family. Uba5 also has a metal-binding motif conserved in other E1-like enzymes such as Uba2, Uba3, Uba4, and Atg7. Most of E1-like enzymes have an active site Cys residue within the conserved 10–20 amino-acid residues downstream from the metal-binding motif. In the case of Uba5, the Cys250 seems to be the most possible active site Cys residue (Figure 1B). If an active site Cys residue within an E1 and E1-like enzymes is changed to Ser, an O-ester bond instead of a thioester bond is formed with its respective modifier protein and the intermediates become stable even under reducing conditions. Therefore, we mutated Cys250 within Uba5 to Ser and expressed it as a Flag-fused Uba5C250S (Flag-Uba5C250S) or Flag-Uba5 as control in HEK293 cells. As shown in Figure 1C, both Flag-Uba5 and Flag-Uba5C250S were expressed as ∼50 kDa proteins in HEK293 cells. When Flag-Uba5C250S was expressed, an additional band with a higher molecular mass of ∼60 kDa was clearly observed, indicating that Flag-Uba5C250S forms an intermediate complex with an endogenous protein. These results suggest that Uba5 is indeed a novel protein-activating enzyme for a presumptive modifier (see below). Figure 1.Uba5, a novel E1-like enzyme. (A) Schematic representation of Uba1 and Uba5 in H. sapiens. Uba1 is divided into several domains, including I, Ib, II, III, and IV boxes, which are conserved in other E1-like enzymes, and other regions without obvious similarity, described previously (Komatsu et al, 2001). Note that Uba5 is of a relatively small size and includes the box I and two other parts. The box I region of Uba1 (amino acids 459–611) has 48.4% similarity and 22.3% identity to amino acids 72–229 of Uba5, which includes the conserved ATP-binding motif (GXGXXG). The sequence of Uba5 is available from GenBanK™ under the accession number AK026904. hs, H. sapiens; ce, C. elegans; dm, D. melanogaster; at, A. thaliana. (B) Sequence alignment of hsUba5 and its homologs of other species (dm, NM_132494; ce, NM_058847; at, NM_100414). The amino-acid sequence of hsUba5 is compared by the ClustalW program. Asterisks, identical amino acids; single and double dots, weakly and strongly similar amino acids, respectively, determined by the criteria of ClustalW program. Open box indicates an ATP-binding motif. The putative active site Cys residue is boxed in black. The metal-binding motif is underlined. (C) Identification of the intermediate linked to Uba5 in HEK293 cells. Both Uba5 and Uba5C250S, in which the predicted active site Cys positioned at 250 was changed to Ser by site-directed mutagenesis, were tagged with Flag peptide at N-terminus, resulting in Flag-Uba5 and Flag-Uba5C250S, respectively. Each Flag-Uba5 and Flag-Uba5C250S was expressed in HEK293 cells. The cell lysates were subjected to SDS–PAGE and analyzed by immunoblotting with anti-Flag antibody. Download figure Download PowerPoint Identification of a novel ubiquitin-fold molecule, Ufm1 Because Uba5 was identified as GATE-16-binding protein, we initially assumed that Uba5 is another GATE-16-activating enzyme, in addition to Atg7. To test this possibility, we examined whether Uba5C250S (the presumptive active site Cys at position 250 was replaced by Ser) forms an intermediate complex with GATE-16 or not. Unexpectedly, we could not identify a stable complex between Uba5C250S and GATE-16 (data not shown). Therefore, we attempted to identify a protein(s) that physically associates with Uba5 in the cells. To do this, Flag-Uba5 was expressed in HEK293 cells, then immunoprecipitated by anti-Flag antibody. The immunoprecipitates were eluted with a Flag peptide, then digested with Lys-C endopeptides (Achromobacter protease I) and the cleaved fragments were directly analyzed using a highly sensitive ‘direct nano-flow LC–MS/MS’ system as described in Materials and methods. Following database search, a total of 28 peptides were assigned to MS/MS spectra obtained from four nano-LC–MS/MS analyses for the Flag-Uba5-associated complexes. These peptide data identified three proteins as Uba5-associated components: GATE-16, and hypothetical proteins BM-002 and CGI-126 (excluding the bait protein Uba5 and the background proteins, such as HSP70 and keratins). One of these identified proteins, BM-002, is an 85-amino-acid protein with a predicted molecular mass of ∼9.1 kDa. This protein is conserved in multicellular organisms, but not in yeasts, like Uba5 (Figure 2A). The human BM-002 has high identity over the species in the central region but has elongated sequences at both N- and C-terminal regions in some species. Although the protein shows no clear overall sequence identity to ubiquitin or other modifiers (Figure 2B), the tertiary structure of BM-002 displays a striking resemblance to human ubiquitin (Figure 2C). The human structure of BM-002 was constructed by a computer-assisted modeling, based on the structure of its C. elegans homolog that has been analyzed previously, as a protein possessing ‘ubiquitin-like fold’ with secondary structure elements ordered β–β–α–β–β–α (α-helix and β-sheet) along the sequence (Cort et al, 2002). Thus, we named human BM-002 as Ufm1. Figure 2.Ufm1, a novel ubiquitin-fold molecule. (A) Sequence alignment of hsUfm1 and its homologs. The sequence of hsUfm1 is available from GenBanK™ under the accession number BC005193 (dm, a coding region of dmUfm1 was found from D. melanogaster genomic sequence; ce, NM_066304; at, NM_106420). The homology analysis was performed as described in Figure 1B. The C-terminal conserved Gly residue is boxed in black. (B) Sequence alignment of hsUbiquitin with hsUfm1. The homology analysis was performed as described in Figure 1B. The C-terminal conserved Gly residue is boxed in black. (C) Structural ribbon of hsUbiquitin and predicted structural ribbon of hsUfm1. α-Helices and β-strands are shown in green and yellow, respectively. The homology model of hsUfm1 was created from the C. elegans Ufm1 structure (Cort et al, 2002) by using MOE program (2003.02; Chemical Computing Group Inc., Montreal, Quebec, Canada). (D) Schematic representation of mammalian expression plasmids for Ufm1 and the derivative mutants. Flag epitope tags at the N-terminus, HA epitope tags at the C-terminus, and putative cleavage site Gly83 residue (vertical dotted lines) are indicated. To construct Ufm1G83A, a single point mutation was introduced into Ufm1, which led to an amino-acid substitution from Gly to Ala at position 83. To construct Ufm1ΔC2, the two C-terminal residues were deleted by PCR. Ufm1ΔC2G83A was also produced by site-directed mutagenesis of Ufm1ΔC2. The ΔC2 mutants were tagged with the Flag epitopes at N-terminus. (E) ProUfm1 processing. HEK293 cells were transfected with Flag-Ufm1-HA, Flag-Ufm1G83A-HA, Flag-Ufm1ΔC2, or Flag-Ufm1ΔC2G83A. The cell lysates were subjected to SDS–PAGE and analyzed by immunoblots with anti-Flag and anti-HA antibodies. ProUfm1 and mature Ufm1 are indicated on the left. The numbers at the top from I to IV are similar to those in (D). Download figure Download PowerPoint Ubiquitin is synthesized in a precursor form that must be processed by de-ubiquitylating enzymes (DUBs) to generate a Gly–Gly sequence at the C-terminus. Similarly, Ufm1 has a single Gly residue conserved across species at the C-terminal region, although the length and sequences of amino acids extending from this Gly residue vary among species. To test whether the C-terminus of Ufm1 is post-translationally cleaved, we constructed an expression vector for Ufm1 tagged at both the N- and C-ends, that is, a Flag epitope at the N-terminus and an HA epitope at the C-terminus (Flag-Ufm1-HA) (Figure 2D). After transfection of Flag-Ufm1-HA into HEK293 cells, the cell lysate was subjected to SDS–PAGE, and Flag-Ufm1-HA was detected by immunoblotting. A 10-kDa protein corresponding to Ufm1 was recognized with anti-Flag antibody, while no appreciable protein was observed with anti-HA antibody (Figure 2E, lanes 2 and 7). The mobility on SDS–PAGE was similar to that of Flag-Ufm1ΔC2 (equivalent to mature Ufm11–83 protein) lacking the C-terminal Ser84 and Cys85 of proUfm1 (Figure 2E, lane 4). These results suggested that the C-terminus of Ufm1 is post-translationally cleaved in the cells, producing mature Ufm1 with the C-terminal Gly83 residue. It is known that the replacement of C-terminal Gly residue of Ub and other UBLs with an Ala residue inhibits the C-terminal processing (Kabeya et al, 2000; Tanida et al, 2003). To examine whether Gly83 of Ufm1 is essential for the cleavage, Gly83 of Flag-Ufm1-HA was mutated to Ala, and expressed in HEK293 cells (Figure 2D, Flag-Ufm1G83A-HA). The mobility of most Flag-Ufm1G83A-HA on SDS–PAGE was apparently slower than that of Flag-Ufm1-HA (Figure 2E, lane 3). This mutant was recognized by immunoblotting with anti-HA antibody as well as anti-Flag antibody, suggesting that mutation Gly83 to Ala confers resistance to its C-terminal cleavage. Uba5 is an Ufm1-activating enzyme We next investigated whether Uba5 forms an intermediate complex with Ufm1. We expressed Flag-Uba5 or Flag-Uba5C250S with Myc-tagged Ufm1 (Myc-Ufm1) in HEK293 cells. Myc-tagged Ufm1ΔC3 lacking the C-terminal Gly83 of mature Ufm1 (Myc-Ufm1ΔC3; i.e., deletion form of three residues from precursor Ufm11–85 protein) was used as control. Each cell lysate was prepared and analyzed by immunoblotting with anti-Flag antibody. Flag-Uba5C250S formed an intermediate with an endogenous protein as shown in Figure 1 (Figure 3A, lane 7). When Flag-Uba5C250S was coexpressed with Myc-Ufm1, the intermediate shifted to higher molecular weight (Figure 3A, lane 8). The higher band was not detected when Myc-Ufm1ΔC3 was coexpressed (Figure 3A, lane 9). To verify that the intermediate is indeed the Uba5–Ufm1 complex, Flag-Uba5C250S was immunoprecipitated and blotted with anti-Flag and anti-Myc antibody. Consistent with the above data, a higher sized intermediate was observed when Flag-Uba5C250S was coexpressed with Myc-Ufm1 (Figure 3B, top panel, lane 5), but not alone or with Myc-Ufm1ΔC3 (Figure 3B, top panel, lanes 4 and 6). The intermediate was also recognized by anti-Myc antibody (Figure 3B, lower panel, lane 5), indicating the existence of the Flag-Uba5C250S–Myc-Ufm1 complex. Note that the small-sized intermediate is presumably a complex with an endogenous Ufm1, as mentioned. These results indicate that Uba5 forms an intermediate with Ufm1 and the Gly83 residue of Ufm1 is essential for the formation of the intermediate with Uba5 in vivo. Figure 3.Demonstration that Uba5 is an Ufm1-activating enzyme. (A) Immunoblotting analysis. Each Myc-tagged Ufm1 (Myc-Ufm1) and Myc-Ufm1ΔC3 was expressed alone (lanes 2 and 3, respectively), and coexpressed with Flag-Uba5 (lanes 5 and 6, respectively) or Flag-Uba5C250S (lanes 8 and 9, respectively). Each Flag-Uba5 and Flag-Uba5C250S was also expressed alone (lanes 4 and 7, respectively). The cell lysates were subjected to SDS–PAGE and analyzed by immunoblotting with anti-Flag antibody. The bands corresponding to Flag-Uba5, Flag-Uba5C250S, and Flag-Uba5C250S intermediates are indicated on the right. (B) Immunoblotting analysis after immunoprecipitation. Each Myc-Ufm1 and Myc-Ufm1ΔC3 was expressed alone (lanes 2 and 3, respectively), and coexpressed with Flag-Uba5C250S (lanes 5 and 6, respectively). Flag-Uba5C250S was also expressed alone (lane 4). The cell lysates were immunoprecipitated with anti-Flag antibody. The resulting immunoprecipitates were subjected to SDS–PAGE and analyzed by immunoblotting with anti-Flag and anti-Myc antibodies. The bands corresponding to Flag-Uba5C250S, Flag-Uba5C250S–endogenous Ufm1, and Flag-Uba5C250S–Myc-Ufm1 intermediates are indicated. (C) In vitro activating assay of Ufm1 by Uba5. Purified recombinant GST-Ufm1ΔC2 (2 μg) (lanes 1–7) was incubated for 30 min at 25°C with some of the following: 2 μg of purified recombinant GST-Uba5 (lanes 2–5, 7, and 8), GST-Uba5C250A (lane 6), and 5 mM ATP (lanes 1 and 3–8). Lane 8 was conducted similar to lane 7, except that GST-Ufm1ΔC3 was used instead of GST-Ufm1ΔC2. Reactions were then incubated with SDS loading buffer lacking reducing agent (lanes 1–3 and 5–8) or containing 100 mM DTT (lane 4). The presence or absence of various components is indicated above the lanes. The bands corresponding to free GST-Uba5, GST-Uba5C250A, GST-Ufm1ΔC2 (mature Ufm1), GST-Ufm1ΔC3, and GST-Uba5–GST-Ufm1ΔC2 thioester product are indicated on the right. Download figure Download PowerPoint We subsequently tested whether Uba5 can activate Ufm1 in vitro. The thioester formation assay was performed using recombinant proteins expressed in Escherichia coli. Recombinant GST-tagged Uba5 and mature Ufm1 (Ufm1ΔC2) with exposed C-terminal Gly83 residue were purified, mixed and incubated in the presence of ATP and then subjected to SDS–PAGE at either reducing or nonreducing conditions. GST-Ufm1ΔC3 was used as control. An ∼100 kDa band corresponding to the GST-Ufm1ΔC2–GST-Uba5 intermediate complex was clearly observed when the mixture was applied at nonreducing conditions (Figure 3C, lane 3). This intermediate was not observed when ATP or GST-Uba5 was excluded from the mixture (Figure 3C, lanes 1 and 2), or when the mixture was loaded in the presence of a reducing agent dithiothreitol (DTT) (Figure 3C, lane 4). Furthermore, GST-tagged Uba5C250A mutant, a presumptive active site Cys mutant, could not form the intermediate even at nonreducing conditions (Figure 3C, lane 6). GST-tagged Ufm1ΔC3 was also incapable of forming the intermediate in this reaction (Figure 3C, lane 8). Taken together, we concluded that Uba5 is an Ufm1-activating enzyme and has the active site in Cys250. Identification of a novel protein-conjugating enzyme, Ufc1 The LC–MS/MS analysis revealed CGI-126 protein as another Uba5 interacting protein. CGI-126 is a protein of 167-amino-acid residues with a predicted molecular mass of 19.4 kDa. This protein is also conserved in multicellular organisms, like Uba5 and Ufm1 (Figure 4A). The C-terminal half of human CGI-126 has a high identity across species as shown in Figure 4A. CGI-126 has a highly conserved region, for example, residues 113–126, with limited similarity to the region of Ubc's that encodes an active site Cys residue capable of forming a thioester bond (Figure 4A). We assumed that this protein may be an E2-like conjugating enzyme for Ufm1 and thus named it Ufm1-conjugating enzyme 1 (Ufc1). If Ufc1 is an authentic E2 enzyme for Ufm1, it is expected to form an intermediate complex with Ufm1 via a thioester linkage. To test this possibility in the same way as Uba5, we mutated the predicted active site Cys residue within Ufc1 (Figure 4A, Cys116) to Ser. We expressed Flag-Ufc1 or Flag-Ufc1C116S (a presumptive active site Cys at position 116 was replaced by Ser) in combination with Myc-Ufm1 or Myc-Ufm1ΔC3 in HEK293 cells. Flag-Ufc1C116S formed a stable intermediate band when coexpressed with Myc-Ufm1 (Figure 4B, lane 8), but not alone or with Myc-Ufm1ΔC3 (Figure 4B, lanes 7 and 9). To ascertain that this is the Flag-Ufc1C116S–Myc-Ufm1 intermediate, Flag-Ufc1C116S was immunoprecipitated and blotted with anti-Myc antibody (Figure 4C). Indeed, Myc-Ufm1, but not Myc-Ufm1ΔC3, formed a complex with Flag-Ufc1C116S (Figure 4C, lanes 5 and 6, top and bottom panels). Note that Flag-Ufc1C116S intermediate with a faster electrophoretic mobility than the Flag-Ufc1C116S–Myc-Ufm1 complex is presumably the intermediate with the endogenous Ufm1 (Figure 4C, lanes 4–6, upper panel). These results indicate that Ufc1 forms an intermediate with Ufm1 in vivo. Figure 4.Ufc1, a novel E2-like enzyme. (A) Sequence alignment of hsUfc1 and its homologs. The sequence of Ufc1 is available from GenBanK™ under the accession number BC005187 (dm, NM_137230; ce, NM_066654; at, BT001180). The homology analysis was performed as described in Figure 1B. The putative active site Cys residue is boxed in black. (B) Immunoblotting analysis. Each Myc-tagged Ufm1 (Myc-Ufm1) and Myc-Ufm1ΔC3 was expressed alone (lanes 2 and 3, respectively), and coexpressed with Flag-Ufc1 (lanes 5 and 6, respectively) or Flag-Ufc1C116S (lanes 8 and 9, respectively). Each Flag-Ufc1 and Flag-Ufc1C116S was also expressed alone (lanes 4 and 7, respectively). The cell lysates were subjected to SDS–PAGE and analyzed by immunoblotting with anti-Flag antibody. The bands corresponding to Flag-Ufc1, Flag-Ufc1C116S, and Flag-Ufc1C116S intermediates are indicated on the right. (C) Immunoblotting analysis after immunoprecipitation. Each Myc-Ufm1 and Myc-Ufm1ΔC3 was expressed alone (lanes 2 and 3, respectively), and coexpressed with Flag-Ufc1C116S (lanes 5 and 6, respectively). Flag-Ufc1C116S was also expressed alone (lane 4). The cell lysates were immunoprecipitated with anti-Flag antibody. The resulting immunoprecipitates were subjected to SDS–PAGE and analyzed by immunoblots with anti-Flag and anti-Myc antibodies. The bands corresponding to Flag-Ufc1C116S, Flag-Ufc1C116S–endogenous Ufm1, and Flag-Ufc1C116S–Myc-Ufm1 intermediates are indicated. (D) In vitro thioester bond formation assay of Ufm1 by Ufc1. Purified recombinant GST-Ufm1ΔC2 (2 μg) (lanes 1–8) was incubated for 30 min at 25°C with the following: purified recombinant GST-Uba5 (0.2 μg) (lanes 2–9), GST-Ufc1 (2 μg) (lanes 3–6, 8, and 9), GST-Ufc1C116S (2 μg) (lane 7), and 5 mM ATP (lanes 1, 2, and 4–9). Lane 9 was conducted similar to lane 8, except that GST-Ufm1ΔC3 was used instead of GST-Ufm1ΔC2. Reactions were then incubated with SDS loading buffer lacking reducing agent (lanes 1–4 and 6–9) or containing 100 mM DTT (lane 5). The presence or absence of various components is indicated above the lanes. The bands corresponding to free GST-Ufm1ΔC2 (mature Ufm1), GST-Ufm1ΔC3, GST-Uba5, GST-Ufc1, GST-Ufc1C116S, and GST-Ufc1–GST-Ufm1ΔC2 thioester product are indicated on the right. Download figure Download PowerPoint To confirm that Ufc1 is indeed an E2-like enzyme that conjugates with Ufm1 via a thioester linkage, we conducted an in vitro Ufm1 conjugation assay. Recombinant GST-Uba5, GST-Ufc1, and GST-Ufm1ΔC2 were mixed and incubated in the presence of ATP. GST-Ufc1C116A mutant and GST-Ufm1ΔC3 were used as negative controls. Under nonreducing conditions, an ∼70 kDa band corresponding to GST-Ufm1ΔC2–GST-Ufc1 intermediate was observed (Figure 4D, lane 4). This product was not formed at reducing conditions, or when any of the components was omitted from the reaction (Figure 4D, lanes 1–3 and 5). GST-tagged Ufc1C116A mutant could not form the intermediate, suggesting that Cys116 is indeed the active site (Figure 4D, lane 7). GST-Ufm1ΔC3 was again unable to form the intermediate complex in this reaction (Figure 4D, lane 9). Taken together, we concluded that Ufc1 functions as an Ufm1-conjugating enzyme and has the active site in Cys116. Conjugation of Ufm1 to cellular protein(s) We next examined whether Ufm1 conjugates to the target protein(s) in cells. To this end, we expressed Flag- and 6xHis-tagged Ufm1 constructs in HEK293 cells, and purified them under denaturing conditions by Ni2+ beads. The resulting precipitates were then analyzed by immunoblotting with anti-Flag antibody. When FlagHis-Ufm1-HA (proUfm1) or FlagHis-Ufm1ΔC2 (mature form) was expressed, several proteins with sizes of about 28, 38, and 47 kDa were detected, in addition to the 10 kDa corresponding to free FlagHis-Ufm1ΔC2 (Figure 5A, lanes 2 and 4). These bands were not detected by FlagHis-Ufm1G83A-HA and FlagHis-Ufm1ΔC3, suggesting that both C-terminal cleavage and C-terminal Gly residue are required for the conjugation reaction (Figure 5A, lanes 3 and 6). Moreover, these protein bands were resistant to reducing agents, such as DTT and β-mercaptoethanol. These results indicate that Ufm1 is covalently attached to some target proteins, probably through an isopeptide bond between the C-terminal Gly83 of Ufm1 and a Lys residue in the cellular proteins. It is of note that FlagHis-Ufm1G83A mutant with exp

In yeast, Atg4/Apg4 is a unique cysteine protease responsible for the cleavage of the carboxyl terminus of Atg8/Apg8/Aut7, a reaction essential for its lipidation during the formation of autophagosomes. However, it is still unclear whether four human Atg4 homologues cleave the carboxyl termini of the three human Atg8 homologues, microtubule-associated protein light chain 3 (LC3), GABARAP, and GATE-16. Using a cell-free system, we found that HsAtg4B, one of the human Atg4 homologues, cleaves the carboxyl termini of these three Atg8 homologues. In contrast, the mutant HsAtg4BC74A, in which a predicted active site Cys74 was changed to Ala, lacked proteolytic activity, indicating that Cys74 is essential for the cleavage activity of cysteine protease. Using phospholipase D, we showed that the modified forms of endogenous LC3 and GABARAP are lipidated and therefore were designated LC3-PL and GABARAP-PL. When purified glutathione S-transferase-tagged HsAtg4B was incubated in vitro with a membrane fraction enriched with endogenous LC3-PL and GABARAP-PL, the mobility of LC3-PL and GABARAP-PL was changed to those of the unmodified proteins. These mobility shifts were not seen when Cys74 of HsAtg4B was changed to Ala. Overexpression of wild-type HsAtg4B decreased the amount of LC3-PL and GABARAP-PL and increased the amount of unmodified endogenous LC3 and GABARAP in HeLa cells. Expression of CFP-tagged HsAtg4B (CFP-HsAtg4B) and YFP-tagged LC3 in HeLa cells under starvation conditions resulted in a significant decrease in the punctate pattern of distribution of YFP-tagged LC3 and an increase in its cytoplasmic distribution. RNA interference of HsAtg4B increased the amount of LC3-PL in HEK293 cells. Taken together, these results suggest that HsAtg4B negatively regulates the localization of LC3 to a membrane compartment by delipidation. In yeast, Atg4/Apg4 is a unique cysteine protease responsible for the cleavage of the carboxyl terminus of Atg8/Apg8/Aut7, a reaction essential for its lipidation during the formation of autophagosomes. However, it is still unclear whether four human Atg4 homologues cleave the carboxyl termini of the three human Atg8 homologues, microtubule-associated protein light chain 3 (LC3), GABARAP, and GATE-16. Using a cell-free system, we found that HsAtg4B, one of the human Atg4 homologues, cleaves the carboxyl termini of these three Atg8 homologues. In contrast, the mutant HsAtg4BC74A, in which a predicted active site Cys74 was changed to Ala, lacked proteolytic activity, indicating that Cys74 is essential for the cleavage activity of cysteine protease. Using phospholipase D, we showed that the modified forms of endogenous LC3 and GABARAP are lipidated and therefore were designated LC3-PL and GABARAP-PL. When purified glutathione S-transferase-tagged HsAtg4B was incubated in vitro with a membrane fraction enriched with endogenous LC3-PL and GABARAP-PL, the mobility of LC3-PL and GABARAP-PL was changed to those of the unmodified proteins. These mobility shifts were not seen when Cys74 of HsAtg4B was changed to Ala. Overexpression of wild-type HsAtg4B decreased the amount of LC3-PL and GABARAP-PL and increased the amount of unmodified endogenous LC3 and GABARAP in HeLa cells. Expression of CFP-tagged HsAtg4B (CFP-HsAtg4B) and YFP-tagged LC3 in HeLa cells under starvation conditions resulted in a significant decrease in the punctate pattern of distribution of YFP-tagged LC3 and an increase in its cytoplasmic distribution. RNA interference of HsAtg4B increased the amount of LC3-PL in HEK293 cells. Taken together, these results suggest that HsAtg4B negatively regulates the localization of LC3 to a membrane compartment by delipidation. Autophagy is the bulk degradation of proteins and organelles, essential for cellular maintenance and cell viability. In yeast, the Atg/Apg/Aut/Cvt (cytoplasm-to-vacuole targeting) proteins involved in autophagy have been identified and characterized (1Ohsumi Y. Nat. Rev. Mol. Cell. Biol. 2001; 2: 211-216Crossref PubMed Scopus (1035) Google Scholar, 2Huang W.P. Klionsky D.J. Cell Struct. Funct. 2002; 27: 409-420Crossref PubMed Scopus (159) Google Scholar). Recently, the nomenclature for yeast autophagy-related genes was unified to ATG from APG, AUT, or CVT (3Klionsky D.J. Cregg J.M. Dunn Jr., W.A. Emr S.D. Sakai Y. Sandoval I.V. Sibirny A. Subramani S. Thumm M. Veenhuis M. Ohsumi Y. Dev. Cell. 2003; 5: 539-545Abstract Full Text Full Text PDF PubMed Scopus (1005) Google Scholar). The Atg4/Apg4/Aut2 protein has been shown to be a unique cysteine protease essential for autophagy and Cvt (cytoplasm-to-vacuole) transport in yeast (4Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1489) Google Scholar, 5Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-276Crossref PubMed Scopus (731) Google Scholar). Atg4 cleaves Atg8/Apg8/Aut7 near its carboxyl terminus to expose a carboxyl-terminal Gly. This proteolytic reaction is indispensable for the ensuing conjugation of Atg8 with phosphatidylethanolamine (PE), 1The abbreviations used are: PE, phosphatidylethanolamine; CFP, cyan fluorescent protein (a variant of green fluorescent protein); DMEM, Dulbecco's modified Eagle's medium; dsRNA, double stranded RNA; GABARAP, GABAA receptor-associated protein; GABARAP-Myc, thioredoxin-His6-GABARAP-Myc fusion protein; GATE-16, Golgi-associated ATPase enhancer of 16 kDa; GABARAP-Myc, thioredoxin-His6-GABARAP-Myc fusion protein; GABARAP-PL, GABARAP-phospholipid conjugate (GABARAP-II); GST, glutathione S-transferase; LC3, microtubule-associated protein light chain 3; LC3-Myc, thioredoxin-His6-LC3-Myc fusion protein; LC3-PL, LC3-phospholipid conjugate (LC3-II); PL, phospholipid; RNAi, RNA interference; TM, LC3-PL- and GABARAP-PL-enriched pellet; TRX, thioredoxin; YFP, yellow fluorescent protein (a variant of green fluorescent protein); YFP-LC3, YFP-tagged LC3; E1, ubiquitin-activating enzyme; E2, ubiquitin carrier protein; CMV, cytomegalovirus; FCS, fetal calf serum; ds-HsAtg4B, dsRNA of HsATG4B for RNA interference.1The abbreviations used are: PE, phosphatidylethanolamine; CFP, cyan fluorescent protein (a variant of green fluorescent protein); DMEM, Dulbecco's modified Eagle's medium; dsRNA, double stranded RNA; GABARAP, GABAA receptor-associated protein; GABARAP-Myc, thioredoxin-His6-GABARAP-Myc fusion protein; GATE-16, Golgi-associated ATPase enhancer of 16 kDa; GABARAP-Myc, thioredoxin-His6-GABARAP-Myc fusion protein; GABARAP-PL, GABARAP-phospholipid conjugate (GABARAP-II); GST, glutathione S-transferase; LC3, microtubule-associated protein light chain 3; LC3-Myc, thioredoxin-His6-LC3-Myc fusion protein; LC3-PL, LC3-phospholipid conjugate (LC3-II); PL, phospholipid; RNAi, RNA interference; TM, LC3-PL- and GABARAP-PL-enriched pellet; TRX, thioredoxin; YFP, yellow fluorescent protein (a variant of green fluorescent protein); YFP-LC3, YFP-tagged LC3; E1, ubiquitin-activating enzyme; E2, ubiquitin carrier protein; CMV, cytomegalovirus; FCS, fetal calf serum; ds-HsAtg4B, dsRNA of HsATG4B for RNA interference. which is mediated by Atg7/Apg7/Cvt2, an E1-like enzyme, and Atg3/Apg3/Aut1, an E2-like enzyme (4Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1489) Google Scholar, 6Kim J. Dalton V.M. Eggerton K.P. Scott S.V. Klionsky D.J. Mol. Biol. Cell. 1999; 10: 1337-1351Crossref PubMed Scopus (177) Google Scholar, 7Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (234) Google Scholar, 8Tanida I. Mizushima N. Kiyooka M. Ohsumi M. Ueno T. Ohsumi Y. Kominami E. Mol. Biol. Cell. 1999; 10: 1367-1379Crossref PubMed Scopus (324) Google Scholar, 9Yuan W. Stromhaug P.E. Dunn Jr., W.A. Mol. Biol. Cell. 1999; 10: 1353-1366Crossref PubMed Scopus (117) Google Scholar). Atg8 conjugated to phosphatidylethanolamine (Atg8-PE) is localized to autophagosomes under starvation conditions and to Cvt vesicles under nutrient-rich conditions, and the atg4 mutant shows defects in autophagy and the Cvt pathway (5Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-276Crossref PubMed Scopus (731) Google Scholar, 10Kirisako T. Baba M. Ishihara N. Miyazawa K. Ohsumi M. Yoshimori T. Noda T. Ohsumi Y. J. Cell Biol. 1999; 147: 435-446Crossref PubMed Scopus (712) Google Scholar). Interestingly, expression of a mutant form of Atg8 that has a carboxyl-terminal Gly (Atg8-G) in an atg4 mutant results in significantly more accumulation of the lipidated form of Atg8 than is found in a wild-type strain (5Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-276Crossref PubMed Scopus (731) Google Scholar). Taken together, these findings suggest that Atg4 may be important for the delipidation of Atg8-PE as well as for the cleavage of the carboxyl-terminal region of Atg8. It has not been shown, however, whether Atg4 directly delipidates Atg8-PE to Atg8 or indirectly activates an as yet unidentified delipidating enzyme. Autophagy has been observed in many mammalian tissues, and it has been shown to be essential for differentiation and development as well as for cellular maintenance (11Reggiori F. Klionsky D.J. Eukaryot. Cell. 2002; 1: 11-21Crossref PubMed Scopus (467) Google Scholar, 12Kadowaki M. Kanazawa T. J. Nutr. 2003; 133: 2052S-2056SCrossref PubMed Google Scholar, 13Yoshimori T. Biochem. Biophys. Res. Commun. 2004; 313: 453-458Crossref PubMed Scopus (460) Google Scholar). Autophagy has significant associations with neurodegenerative diseases, cardiomyopathies, cancer, programmed cell death, and bacterial and viral infections (14Raught B. Gingras A.C. Sonenberg N. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 7037-7044Crossref PubMed Scopus (499) Google Scholar, 15Saftig P. Tanaka Y. Lullmann-Rauch R. von Figura K. Trends Mol. Med. 2001; 7: 37-39Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 16Thummel C.S. BioEssays. 2001; 23: 677-682Crossref PubMed Scopus (67) Google Scholar, 17Larsen K.E. Sulzer D. Histol. Histopathol. 2002; 17: 897-908PubMed Google Scholar, 18Lockshin R.A. Zakeri Z. Curr. Opin. Cell Biol. 2002; 14: 727-733Crossref PubMed Scopus (206) Google Scholar, 19Tolkovsky A.M. Xue L. Fletcher G.C. Borutaite V. Biochimie (Paris). 2002; 84: 233-240Crossref PubMed Scopus (189) Google Scholar, 20Ogier-Denis E. Codogno P. Biochim. Biophys. Acta. 2003; 1603: 113-128PubMed Google Scholar). In mammalian cells, the Atg8-like modification system seems to be conserved (21Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5395) Google Scholar, 22Mizushima N. Yamamoto A. Hatano M. Kobayashi Y. Kabeya Y. Suzuki K. Tokuhisa T. Ohsumi Y. Yoshimori T. J. Cell Biol. 2001; 152: 657-668Crossref PubMed Scopus (1153) Google Scholar, 23Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar, 24Tanida I. Tanida-Miyake E. Komatsu M. Ueno T. Kominami E. J. Biol. Chem. 2002; 277: 13739-13744Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar), with LC3, GABARAP, and GATE-16 being three Atg8 homologues (recently, it has been reported that Apg8L/Atg8L is a fourth homologue, but Atg8L has not yet been characterized as a modifier) (21Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5395) Google Scholar, 25Mann S.S. Hammarback J.A. J. Biol. Chem. 1994; 269: 11492-11497Abstract Full Text PDF PubMed Google Scholar, 26Mann S.S. Hammarback J.A. J. Neurosci. Res. 1996; 43: 535-544Crossref PubMed Scopus (48) Google Scholar, 27Wang H. Bedford F.K. Brandon N.J. Moss S.J. Olsen R.W. Nature. 1999; 397: 69-72Crossref PubMed Scopus (485) Google Scholar, 28Sagiv Y. Legesse-Miller A. Porat A. Elazar Z. EMBO J. 2000; 19: 1494-1504Crossref PubMed Scopus (206) Google Scholar, 29Hemelaar J. Lelyveld V.S. Kessler B.M. Ploegh H.L. J. Biol. Chem. 2003; 278: 51841-51850Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). The carboxyl-terminal regions of these homologues are cleaved soon after translation in the cytosol (30Scherz-Shouval R. Sagiv Y. Shorer H. Elazar Z. J. Biol. Chem. 2003; 278: 14053-14058Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 31Tanida I. Komatsu M. Ueno T. Kominami E. Biochem. Biophys. Res. Commun. 2003; 300: 637-644Crossref PubMed Scopus (84) Google Scholar). Human Atg7 and Atg3 can form E1- and E2-substrate intermediates with each of these three Atg8 homologues (23Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar, 24Tanida I. Tanida-Miyake E. Komatsu M. Ueno T. Kominami E. J. Biol. Chem. 2002; 277: 13739-13744Abstract Full Text Full Text PDF PubMed Scopus (219) Google Scholar), and transient expression of human Atg7 and Atg3 along with LC3, GABARAP, and GATE-16 has been shown to result in the expression of modified forms of the latter three proteins, which have been designated as LC3-II, GABARAP-II, and GATE-16-II, respectively (21Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5395) Google Scholar, 31Tanida I. Komatsu M. Ueno T. Kominami E. Biochem. Biophys. Res. Commun. 2003; 300: 637-644Crossref PubMed Scopus (84) Google Scholar). LC3-II has been shown to localize to autophagosomes (21Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5395) Google Scholar). At least four human Atg4 homologues, HsAtg4A/HsApg4A/autophagin-2, HsAtg4B/HsApg4B/autophagin-1, HsAutl1/autophagin-3, and autophagin-4, have been reported (30Scherz-Shouval R. Sagiv Y. Shorer H. Elazar Z. J. Biol. Chem. 2003; 278: 14053-14058Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 32Marino G. Uria J.A. Puente X.S. Quesada V. Bordallo J. Lopez-Otin C. J. Biol. Chem. 2003; 278: 3671-3678Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). Since the carboxyl-terminal regions of LC3, GABARAP, and GATE-16 are cleaved soon after translation, it is possible that one or more of these Atg4 homologues is the cysteine protease that cleaves these proteins. HsAtg4A has recently been shown to cleave the carboxyl terminus of GATE-16 (30Scherz-Shouval R. Sagiv Y. Shorer H. Elazar Z. J. Biol. Chem. 2003; 278: 14053-14058Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar), and autophagin-3/HsAutl1 has been shown to have N-ethylmaleimide-sensitive proteolytic activities for a synthetic substrate, 7-(methoxycoumarin-4-yl)-acetyl-Thr-Phe-Gly-Met-N-3-(2,4-dinitrophenyl)-l-α,β-diaminopropionyl-NH2 (32Marino G. Uria J.A. Puente X.S. Quesada V. Bordallo J. Lopez-Otin C. J. Biol. Chem. 2003; 278: 3671-3678Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). The overexpression of HsAtg4B or HsAutl1 has been found to suppress the Atg– and Cvt– phenotypes of the atg4 mutant (32Marino G. Uria J.A. Puente X.S. Quesada V. Bordallo J. Lopez-Otin C. J. Biol. Chem. 2003; 278: 3671-3678Abstract Full Text Full Text PDF PubMed Scopus (185) Google Scholar). Moreover, one of the two Drosophila Atg4 homologues has been shown to play an essential role in the Notch-signaling pathway (33Thumm M. Kadowaki T. Mol. Genet. Genomics. 2001; 266: 657-663Crossref PubMed Scopus (40) Google Scholar), suggesting that the four human Atg4 homologues may have divergent functions. Although HsAtg4A and HsAutl1 have been independently characterized as cysteine proteases, HsAtg4B has not yet been biochemically characterized, nor have its effects on LC3, GABARAP, and GATE-16 been determined, whereas HsAtg4B has specific interactions with the carboxyl termini of LC3, GABARAP, GATE-16, and Atg8L (29Hemelaar J. Lelyveld V.S. Kessler B.M. Ploegh H.L. J. Biol. Chem. 2003; 278: 51841-51850Abstract Full Text Full Text PDF PubMed Scopus (204) Google Scholar). It is not known if LC3-II and GABARAP-II are lipidated forms of their respective proteins in mammals; nor has it been shown whether Atg4 and human Atg4 homologues directly delipidate Atg8-PE, LC3-II, and GABARAP-II in yeast and mammals. We have therefore investigated whether HsAtg4B can cleave the carboxyl termini of LC3, GABARAP, and GATE-16 in a cell-free system. We also investigated whether LC3-II and GABARAP-II are phospholipase D-sensitive forms (i.e. lipidated forms of LC3 and GABARAP, respectively) and whether HsAtg4B has delipidating activity in vitro. We also determined whether overexpression of HsAtg4B affects endogenous LC3 modification and the localization of YFP-tagged LC3 (YFP-LC3) in HeLa cells and whether RNA interference of HsAtg4B affects LC3 modification. Strains, Media, and Materials—Escherichia coli strain JM109, the host for plasmids and protein expression, was grown in LB medium in the presence of antibiotics as required. The plasmid pGEM-T was purchased from Promega (Madison, WI); pCMV-Tag2B was from Stratagene (La Jolla, CA); pEGFP-C1, pECFP-C1, and pEYFP-C1 were from BD Biosciences Clontech (Palo Alto, CA); and pGEX-4T-1 was from Amersham Biosciences. Plasmid Construction and Site-directed Mutagenesis—Based on the DNA sequence of HsATG4A and HsAUTL1 (GenBank™ accession numbers AB066214 and AJ320169, respectively), the open reading frame of each was amplified by high fidelity PCR with human brain Marathon-ready cDNA as template. The cDNA was synthesized from RNA extracted from a normal, whole brain of a 50-year-old Caucasian male. The primers were designed to introduce a BglII site 5′ to the start codon and a SalI site 3′ to the termination codon. Each resulting DNA fragment was cloned in pGEM-T, and the resulting plasmids were designated as pGEM-HsATG4A and pGEM-HsAUTL1, respectively. Similarly, based on the DNA sequence of HsATG4B/HsAPG4B (GenBank™ accession number AB066215), its open reading frame was amplified by high fidelity PCR with human brain Marathon-ready cDNA as template, with the primers designed to introduce a BamHI site 5′ to the start codon and a SalI site 3′ to the termination codon. The resulting DNA fragment was cloned in pGEM-T, and the resultant plasmid was designated as pGEM-HsAtg4B. To express CFP-HsAtg4A, CFP-HsAutl1, and CFP-HsAtg4B under the control of the CMV promoter in mammalian cells, the cloned DNA fragments of pGEM-HsATG4A, pGEM-HsAUTL1, and pGEM-HsATG4B were introduced into the mammalian expression vector, pECFP-C1 (BD Biosciences Clontech) and designated as pCFP-HsATG4A, pCFP-HsAUTL1, and pCFP-HsATG4B, respectively. To express FLAG-tagged proteins, the cloned DNA fragments of pGEM-HsATG4A, pGEM-HsAUTL1, and pGEM-HsATG4B were introduced into the vector, pCMV-Tag2B (Stratagene), and designated as pTag2B-HsATG4A, pTag2B-HsAUTL1, and pTag2B-HsATG4B, respectively. To express GST-tagged proteins in E. coli, the cloned DNA fragments of pGEM-HsATG4A, pGEM-HsAUTL1, and pGEM-HsATG4B were introduced into the vector, pGEX-4T-1 (Amersham Biosciences) and designated as pGEX-HsATG4A, pGEX-HsAUTL1, and pGEX-HsATG4B, respectively. The human Atg8 homologues LC3, GABARAP, and GATE-16 were fused with thioredoxin-His6 at the amino terminus and with the Myc epitope at the carboxyl terminus by introducing six His repeats into the amino-terminal region of each Atg8 homologue by high fidelity PCR and subsequently introducing the Myc epitope directly 3′ to each sequence. Each resultant DNA fragment was cloned in the vector pThioHisA (Invitrogen), and each construct was used to transform E. coli (Fig. 1B). To express YFP-LC3, a BglII-SalI fragment of pGEM-LC3 was introduced into the BglII-SalI site of the vector pEYFP-C1 (BD Biosciences Clontech), and the resulting construct was designated as pYFP-LC3. The Cys residue at amino acid 74 of HsAtg4B was replaced by Ala using the Gene-Editor in vitro site-directed mutagenesis system (Promega) and the oligonucleotide, 5′-CCCACCTCGGACACAGGCTGGGGCGGCCATGCTGCGGTGTGGACAGATGATCTTTGCCC-3′ (HsA-TG4BCA oligonucleotide), according to the manufacturer's directions. Cell Culture and Transfection—HEK293 and HeLa cells obtained from the ATCC (Manassas, VA), were grown in DMEM containing 10% fetal calf serum (FCS). Cells were transfected with the indicated constructs using LipofectAMINE 2000 transfection reagent (Invitrogen) according to the manufacturer's instructions. After 48 h, the cells were harvested for further analyses. Antibodies—Rabbits were immunized with GST-HsAtg4A, GST-HsAtg4B, and GST-HsAutl1 to obtain antisera against HsAtg4A, HsAtg4B, and HsAutl1, respectively. Each antibody was affinity-purified by chromatography on each thioredoxin (TRX)-linked antigen-Sepharose and designated as anti-HsAtg4A, anti-HsAtg4B, and anti-HsAutl1 antibodies, respectively. Anti-LC3 and anti-GABARAP antibodies were prepared as described previously. Anti-LC3 antibody shows little cross-reactivity with GABARAP and GATE-16. Anti-GABARAP antibody shows little cross-reactivity with LC3 and GATE-16. Anti-Myc antibody was purchased from Cell Signaling Technology, Inc. (Beverly, MA), and anti-TRX antibody was from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA). Purification of Recombinant Proteins—The purification of GST fusion proteins from E. coli was performed according to the manufacturer's protocol (Amersham Biosciences). The purification of LC3-Myc, GABARAP-Myc, and GATE-16-Myc, each with a His6 tag, was performed using TALON purification kits according to the manufacturer's protocol (BD Biosciences Clontech). Assay for Cleavage of the Carboxyl Terminus of LC3-Myc, GABARAP-Myc, and GATE-16-Myc by Human Atg4 Homologues—FLAG-tagged HsAtg4A/autophagin-2 (FLAG-HsAtg4A), FLAG-tagged HsAtg4B/autophagin-1 (FLAG-HsAtg4B), and FLAG-tagged HsAutl1/autophagin-3 (FLAG-HsAutl1) were expressed in HEK293 cells using pTag2B-HsAtg4A, pTag2B-HsAtg4B, and pTag2B-HsAutl1, respectively. Cells were lysed in phosphate-buffered saline-dithiothreitol buffer (20 mm sodium phosphate, pH 7.2, 150 mm NaCl, 1 mm dithiothreitol) containing a Complete™ proteinase inhibitor mixture tablet (Roche Applied Science), and supernatant was prepared from each lysate as described previously (34Nemoto T. Tanida I. Tanida-Miyake E. Minematsu-Ikeguchi N. Yokota M. Ohsumi M. Ueno T. Kominami E. J. Biol. Chem. 2003; 278: 39517-39526Abstract Full Text Full Text PDF PubMed Scopus (74) Google Scholar). Supernatant (0.4 μg) of each lysate was added to 3.6 μg purified LC3-Myc, GABARAP-Myc, or GATE-16-Myc in phosphate-buffered saline-dithiothreitol buffer containing a Complete™ proteinase inhibitor mixture tablet, and the mixture was incubated at 37 °C for the indicated times (0, 30, and 60 min). To stop the reaction, Laemmli's sample buffer was added to the mixture, and the mixture was boiled for 5 min. Proteins were separated by 12.5% SDS-PAGE and analyzed by immunoblotting with anti-Myc and anti-TRX antibodies. Preparation of a Pelletable Fraction Enriched with Modified Forms of LC3 (LC3-II) and GABARAP (GABARAP-II) as Substrates of the Delipidation Assay—Endogenous LC3 and GABARAP in HeLa cells were present as modified forms, even under nutrient-rich conditions. 2I. Tanida, T. Ueno, and E. Kominami, unpublished results. HeLa cells were cultured in DMEM containing 10% FCS in the presence of E64d (10 μg/ml) and pepstatin A (10 μg/ml) to enrich for LC3-II and GABARAP-II. The cells were lysed in phosphate-buffered saline by sonication, and total pellets were prepared by ultracentrifugation at 100,000 × g for 1 h. The LC3-II- and GABARAP-II-enriched pellet fraction (TM fraction) was employed as substrates for treatment with phospholipase D and GST-HsAtg4B. Assay for Delipidation of LC3-II and GABARAP-II by Phospholipase D—Phospholipase D (from Streptomyces chromofuscus) was purchased from Sigma. LC3-II was solubilized from 45 μg of the TM fraction in TX solution (2% Triton X-100, 20 mm sodium phosphate, pH 7.5, 150 mm NaCl), 10 units of phospholipase D were added, and the mixture was incubated at 37 °C for the indicated times. To stop the reaction, Laemmli's sample buffer was added to the mixture, and the mixture was boiled for 5 min. Total proteins were separated by 12.5% SDS-PAGE, and LC3 was assayed by immunoblotting with an anti-LC3 antibody. Delipidation of LC3-II (membrane-bound form) was recognized as a change in mobility. To assay delipidation of GABARAP-II, the latter was solubilized from 90 μg of the TM fraction in NP solution (0.5% Nonidet P-40, 20 mm sodium phosphate, pH 7.5, 150 mm NaCl), and the sample was treated with phospholipase D as described above. GABARAP was assayed by immunoblotting with an anti-GABARAP antibody. Delipidation of GABARAP-II was recognized as a change in mobility. Assay for Delipidation of LC3-II and GABARAP-II by Purified GST-HsAtg4B—To assay delipidation of LC3-II and GABARAP-II by GST-HsAtg4B, 0.45 μg of GST-HsAtg4B was added in place of phospholipase Dto45 μg of the TM fraction, and the assay was performed as described above. Fluorescent Microscopy—HeLa cells expressing CFP-HsAtg4B and YFP-LC3 were fixed according to the manufacturer's protocol (BD Biosciences Clontech), and cyan and yellow fluorescences in HeLa cells were observed with a Zeiss Axioplan2 fluorescence microscope with filters XF114-2 and XF104-2. RNA Interference Analysis of HsAtg4B—Double-stranded RNAs of HsAtg4B were produced by a BLOCK-it™ Complete Dicer RNAi kit with a DNA template containing the region from start codon to 500 base of HsAtg4B cDNA as a template according to the manufacturer's protocol (Invitrogen). For RNA interference of HsAtg4B, 2 μg of dsRNA of HsAtg4B/60-mm culture dish was transfected into HEK293 cells using LipofectAMINE 2000 transfection reagent (Invitrogen) according to the manufacturer's instructions. After 24 h, the cells were harvested for further analyses. For plasmid-based RNA interference of HsATG4B, two oligonucleotides, siT4 (5′-GATCCGAAGCTTGCTGTCTTCGATTTCAAGAGAATCGAAGACAGCAAGCTTCTTTTTTGGAAA-3′) and siB4 (5′-AGCTTTTCCAAAAAAGAAGCTTGCTGTCTTCGATTCTCTTGAAATCGAAGACAGCAAGCTTCG-3′), were synthesized. After annealing these oligonucleotides, the resultant fragment was introduced into a BamHI-HindIII site of pSilencer H1–3.0 (Ambion, Austin, TX), and the resulting construct was designated as pSi-HsATG4B. For RNA interference of HsA-tg4B, 6 μg of pSi-HsATG4B per 60-mm culture dish was transfected into HEK293 cells using LipofectAMINE 2000 transfection reagent (Invitrogen). After 24 h, the cells were harvested for further analyses. Other Techniques—Quantification of the images was performed using Aqua Lite (Hamamatsu Photonics, Tokyo, Japan) and NIH Image (Dr. W. Raeband, National Institutes of Health) programs on Endeavor (EPSON direct, Tokyo, Japan) and Macintosh G4 (Apple Computer, New York) computers, respectively. The Cys74 Residue in HsAtg4B Is an Authentic Active Site Cysteine Essential for the Ability of This Protein to Cleave the Carboxyl Termini of the Three Atg8 Homologues—Although the carboxyl termini of LC3, GABARAP, and GATE-16 are cleaved to expose a Gly soon after translation (21Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5395) Google Scholar, 30Scherz-Shouval R. Sagiv Y. Shorer H. Elazar Z. J. Biol. Chem. 2003; 278: 14053-14058Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar, 31Tanida I. Komatsu M. Ueno T. Kominami E. Biochem. Biophys. Res. Commun. 2003; 300: 637-644Crossref PubMed Scopus (84) Google Scholar), it is not known whether HsAtg4B is responsible for this activity. However, the region containing a predicted active site Cys within HsAtg4B shows a significant homology with that within yeast Atg4 (Fig. 1A). Therefore, we focused on HsAtg4B and determined its proteolytic activity on the carboxyl termini of LC3, GABARAP, and GATE-16. FLAG-HsAtg4B was expressed in HEK293 cells, the cells were lysed, and the lysate was fractionated by ultracentrifugation, with the resulting supernatant used as enzyme mixture. HsAtg4B in the supernatant was recognized by immunoblotting with an anti-FLAG-antibody (Fig. 1B, pTag2B-HsATG4B wt, +). The substrates, LC3-Myc, GABARAP-Myc, and GATE-16-Myc with TRX-His6 at the amino terminus and with the Myc epitope at the carboxyl terminus were expressed in E. coli and affinity-purified by a nickel-chelating resin. We incubated FLAG-HsAtg4B with each Myc-linked Atg8 homologue and determined the carboxyl-terminal cleavage activity by immunoblotting using an anti-Myc antibody (Fig. 1C, WB: anti-Myc, HsAtg4B versus vector control). FLAG-HsAtg4B cleaved the carboxyl terminus of Myc conjugate LC3, GABARAP, and GATE-16 in a time-dependent manner. Using an anti-TRX antibody, we were able to confirm that the amino-terminal TRX tag within each substrate remains unchanged (Fig. 1C, anti-TRX), indicating that the carboxyl-terminal Myc tag itself was cleaved by HsAtg4B. Essentially the same results were obtained when purified GST-HsAtg4B, instead of the supernatant expressing FLAG-HsAtg4B, was incubated with Myc-linked Atg8 homologues (data not shown). The cleavage is sensitive to N-ethylmaleimide, but not to phenylmethylsulfonyl fluoride or pepstatin A (data not shown). These results show that the HsAtg4B protease cleaves the carboxyl termini of all

Both anabolism and catabolism of the amino acids released by starvation-induced autophagy are essential for cell survival, but their actual metabolic contributions in adult animals are poorly understood. Herein, we report that, in mice, liver autophagy makes a significant contribution to the maintenance of blood glucose by converting amino acids to glucose via gluconeogenesis. Under a synchronous fasting-initiation regimen, autophagy was induced concomitantly with a fall in plasma insulin in the presence of stable glucagon levels, resulting in a robust amino acid release. In liver-specific autophagy (Atg7)-deficient mice, no amino acid release occurred and blood glucose levels continued to decrease in contrast to those of wild-type mice. Administration of serine (30 mg/animal) exerted a comparable effect, raising the blood glucose levels in both control wild-type and mutant mice under starvation. Thus, the absence of the amino acids that were released by autophagic proteolysis is a major reason for a decrease in blood glucose. Autophagic amino acid release in control wild-type livers was significantly suppressed by the prior administration of glucose, which elicited a prompt increase in plasma insulin levels. This indicates that insulin plays a dominant role over glucagon in controlling liver autophagy. These results are the first to show that liver-specific autophagy plays a role in blood glucose regulation.

Autophagy is a process that involves the bulk degradation of cytoplasmic components by the lysosomal/vacuolar system. In the yeast, Saccharomyces cerevisiae, an autophagosome is formed in the cytosol. The outer membrane of the autophagosome is fused with the vacuole, releasing the inner membrane structure, an autophagic body, into the vacuole. The autophagic body is subsequently degraded by vacuolar hydrolases. Taking advantage of yeast genetics,apg(autophagy-defective) mutants were isolated that are defective in terms of formation of autophagic bodies under nutrient starvation conditions. One of the APG gene products, Apg12p, is covalently attached to Apg5p via the C-terminal Gly of Apg12p as in the case of ubiquitylation, and this conjugation is essential for autophagy. Apg7p is a novel E1 enzyme essential for the Apg12p-conjugation system. In mammalian cells, the human Apg12p homolog (hApg12p) also conjugates with the human Apg5p homolog. In this study, the unique characteristics of hApg7p are shown. A two-hybrid experiment indicated that hApg12p interacts with hApg7p. Site-directed mutagenesis revealed that Cys572 of hApg7p is an authentic active site cysteine residue essential for the formation of the hApg7p·hApg12p intermediate. Overexpression of hApg7p enhances the formation of the hApg5p·hApg12p conjugate, indicating that hApg7p is an E1-like enzyme essential for the hApg12p conjugation system. Cross-linking experiments and glycerol-gradient centrifugation analysis showed that the mammalian Apg7p homolog forms a homodimer as in yeast Apg7p. Each of three human Apg8p counterparts, i.e. the Golgi-associated ATPase enhancer of 16 kDa, GABAAreceptor-associated protein, and microtubule-associated protein light chain 3, coimmunoprecipitates with hApg7p and conjugates with mutant hApg7pC572S to form a stable intermediate via an ester bond. These results indicate that hApg7p is an authentic protein-activating enzyme for hApg12p and the three Apg8p homologs. Autophagy is a process that involves the bulk degradation of cytoplasmic components by the lysosomal/vacuolar system. In the yeast, Saccharomyces cerevisiae, an autophagosome is formed in the cytosol. The outer membrane of the autophagosome is fused with the vacuole, releasing the inner membrane structure, an autophagic body, into the vacuole. The autophagic body is subsequently degraded by vacuolar hydrolases. Taking advantage of yeast genetics,apg(autophagy-defective) mutants were isolated that are defective in terms of formation of autophagic bodies under nutrient starvation conditions. One of the APG gene products, Apg12p, is covalently attached to Apg5p via the C-terminal Gly of Apg12p as in the case of ubiquitylation, and this conjugation is essential for autophagy. Apg7p is a novel E1 enzyme essential for the Apg12p-conjugation system. In mammalian cells, the human Apg12p homolog (hApg12p) also conjugates with the human Apg5p homolog. In this study, the unique characteristics of hApg7p are shown. A two-hybrid experiment indicated that hApg12p interacts with hApg7p. Site-directed mutagenesis revealed that Cys572 of hApg7p is an authentic active site cysteine residue essential for the formation of the hApg7p·hApg12p intermediate. Overexpression of hApg7p enhances the formation of the hApg5p·hApg12p conjugate, indicating that hApg7p is an E1-like enzyme essential for the hApg12p conjugation system. Cross-linking experiments and glycerol-gradient centrifugation analysis showed that the mammalian Apg7p homolog forms a homodimer as in yeast Apg7p. Each of three human Apg8p counterparts, i.e. the Golgi-associated ATPase enhancer of 16 kDa, GABAAreceptor-associated protein, and microtubule-associated protein light chain 3, coimmunoprecipitates with hApg7p and conjugates with mutant hApg7pC572S to form a stable intermediate via an ester bond. These results indicate that hApg7p is an authentic protein-activating enzyme for hApg12p and the three Apg8p homologs. yeast autophagy mutant and wild-type genes expression products from the APG gene cytoplasm-to-vacuole targeting γ-aminobutyric acid receptor-associated protein GAL4 activation domain GAL4 DNA binding domain Golgi-associated ATPase enhancer of 16 kDa green fluorescent protein human murine microtubule-associated protein light chain 3 N-ethylmaleimide-sensitive fusion protein soluble NSF attachment protein receptor polyacrylamide gel electrophoresis expressed sequence tag human embryonic kidney cells ubiquitin-activating enzyme ubiquitin-conjugating enzyme. Tes, 2-{[2-hydroxy-1,1-bis(hydroxymethyl)ethyl]amino}ethanesulfonic acid endoplasmic reticulum Post-translational modifications regulate the functions and localization of target proteins, resulting in many significant intracellular events. One unique modification is the covalent attachment of modifier proteins, ubiquitin, ubiquitin-related proteins (SUMO-1/Smt3p and NEDD-8/RUB1), and Apg12p (for reviews, see Refs.1Varshavsky A. Genes Cells. 1997; 2: 13-28Crossref PubMed Scopus (271) Google Scholar, 2Bonifacino J.S. Weissman A.M. Annu. Rev. Cell Dev. Biol. 1998; 14: 19-57Crossref PubMed Scopus (536) Google Scholar, 3Ciechanover A. EMBO J. 1998; 17: 7151-7160Crossref PubMed Scopus (1196) Google Scholar, 4Hershko A. Ciechanover A. Annu. Rev. Biochem. 1998; 67: 425-479Crossref PubMed Scopus (6902) Google Scholar, 5Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-32Crossref PubMed Scopus (391) Google Scholar, 6Kim J. Klionsky D.J. Annu. Rev. Biochem. 2000; 69: 303-342Crossref PubMed Scopus (320) Google Scholar). The enzymatic processes of these modifications have been intensively studied in ubiquitylation. Ubiquitin forms conjugates with a target protein via a three step mechanism. First, ubiquitin is activated at its C-terminal Gly by the ubiquitin-activating enzyme (UBA1, E1 enzyme) to form a conjugate with the active site Cys in the E1 enzyme via a thiol ester bond. Next, ubiquitin is transferred from the E1 enzyme to one of several ubiquitin-conjugating enzymes (UBCs, E2 enzymes). In the last step, ubiquitin is attached to a Lys within the target protein via an isopeptide bond. This step is often catalyzed by a member of the ubiquitin-protein ligase family, an E3 enzyme. The reaction mechanism is basically common for each modifier protein. Autophagy is a process of bulk degradation of cytoplasmic components by the lysosomal/vacuolar system (5Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-32Crossref PubMed Scopus (391) Google Scholar, 7Seglen P.O. Bohley P. Experientia. 1992; 48: 158-172Crossref PubMed Scopus (369) Google Scholar, 8Dunn W.A.J. Trends in Cell Biol. 1994; 4: 139-143Abstract Full Text PDF PubMed Scopus (444) Google Scholar). In the initial step of macroautophagy, a cup-shaped membrane sac surrounds cytosolic components to form an autophagosome (9Baba M. Takeshige K. Baba N. Ohsumi Y. J. Cell Biol. 1994; 124: 903-913Crossref PubMed Scopus (403) Google Scholar). The outer membrane of the autophagosome fuses with a lysosome/vacuole (10Baba M. Ohsumi M. Ohsumi Y. Cell Struct. Funct. 1995; 20: 465-471Crossref PubMed Scopus (128) Google Scholar). Taking advantage of yeast genetics,apg 1 andaut mutants were isolated as autophagy-defective mutants in the yeast, Saccharomyces cerevisiae (12Tsukada M. Ohsumi Y. FEBS Lett. 1993; 333: 169-174Crossref PubMed Scopus (1409) Google Scholar, 13Thumm M. Egner R. Koch B. Schlumpberger M. Straub M. Veenhuis M. Wolf D.H. FEBS Lett. 1994; 349: 275-280Crossref PubMed Scopus (481) Google Scholar). Surprisingly, most of the apg mutants overlap genetically withcvt mutants, which have a defect in the cytoplasm-to-vacuole targeting of aminopeptidase I, indicating that these genes function in a unique transport system under vegetative growth conditions in addition to starvation conditions (14Harding T.M. Hefner-Gravink A. Thumm M. Klionsky D.J. J. Biol. Chem. 1996; 271: 17621-17624Abstract Full Text Full Text PDF PubMed Scopus (218) Google Scholar, 15Baba M. Osumi M. Scott S.V. Klionsky D.J. Ohsumi Y. J. Cell Biol. 1997; 139: 1687-1695Crossref PubMed Scopus (279) Google Scholar, 16Scott S.V. Hefner-Gravink A. Morano K.A. Noda T. Ohsumi Y. Klionsky D.J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 12304-12308Crossref PubMed Scopus (214) Google Scholar). A novel modifier protein, Apg12p, was discovered as an APG gene product (11Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1284) Google Scholar). Apg12p shows little homology to ubiquitin, but it is covalently attached to Apg5p via the C-terminal Gly of Apg12p as in the case of ubiquitylation. In this conjugation reaction, Apg7p and Apg10p function as E1- and E2-like enzymes for Apg12p, respectively (11Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1284) Google Scholar, 17McGrath J.P. Jentsch S. Varshavsky A. EMBO J. 1991; 10: 227-236Crossref PubMed Scopus (189) Google Scholar, 18Tanida I. Mizushima N. Kiyooka M. Ohsumi M. Ueno T. Ohsumi Y. Kominami E. Mol. Biol. Cell. 1999; 10: 1367-1379Crossref PubMed Scopus (325) Google Scholar, 19Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (235) Google Scholar). After the formation of the Apg12p· Apg5p conjugate, Apg16p attaches to Apg5p forming an Apg12p·Apg5p·Apg16p complex for autophagy (20Mizushima N. Noda T. Ohsumi Y. EMBO J. 1999; 15: 3888-3896Crossref Scopus (340) Google Scholar). Unlike other modifier-conjugation systems, the unique character of the Apg12p-conjugation system is that it plays indispensable roles in the formation of membrane structures, including autophagosomes and Cvt-vesicles. Apg7p, an authentic E1-like enzyme essential for Apg12p, plays an indispensable role in the initial step of the conjugation system, whereas the enzyme shows slight homology to other E1 enzymes (18Tanida I. Mizushima N. Kiyooka M. Ohsumi M. Ueno T. Ohsumi Y. Kominami E. Mol. Biol. Cell. 1999; 10: 1367-1379Crossref PubMed Scopus (325) Google Scholar). Apg7p interacts with Apg8p/Aut7p and Aut1p/Apg3p in addition to Apg12p (21Uetz P. Giot L. Cagney G. Mansfield T.A. Judson R.S. Knight J.R. Lockshon D. Narayan V. Srinivasan M. Pochart P. Qureshi-Emili A. Li Y. Godwin B. Conover D. Kalbfleisch T. Vijayadamodar G. Yang M. Johnston M. Fields S. Rothberg J.M. Nature. 2000; 403: 623-627Crossref PubMed Scopus (3915) Google Scholar, 22Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-275Crossref PubMed Scopus (736) Google Scholar). 2M. Komatsu, I. Tanida, T. Ueno, M. Ohsumi, Y. Ohsumi, and E. Kominami, submitted manuscript. The dimerization of Apg7p via the C-terminal region is essential for these interactions, suggesting that Apg7p forms multimeric complexes with these proteins.2 Apg8p/Aut7p is localized on autophagosomes and Cvt-vesicles (23Kirisako T. Baba M. Ishihara N. Miyazawa K. Ohsumi M. Yoshimori T. Noda T. Ohsumi Y. J. Cell Biol. 1999; 147: 435-446Crossref PubMed Scopus (713) Google Scholar). The AUT1/APG3 gene is a multicopy suppressor of the apg8/aut7 mutant (24Lang T. Schaeffeler E. Bernreuther D. Bredschneider M. Wolf D.H. Thumm M. EMBO J. 1998; 17: 3597-3607Crossref PubMed Scopus (230) Google Scholar). Apg8p/Aut7p also interacts with two ER-to-Golgi v-SNAREs (Bet1p and Sec22p) and vacuolar t- and v-SNAREs (Vam3p and Nyv1p, Ref. 25Legesse-Miller A. Sagiv Y. Gluzman R. Elazar Z. J. Biol. Chem. 2000; 275: 32966-32973Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). Furthermore, more recent findings suggest that Apg8p/Aut7p, Aut1p/Apg3p, and Apg7p comprise a second protein-conjugation system indispensable for autophagy and Cvt pathways (22Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-275Crossref PubMed Scopus (736) Google Scholar, 26Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1516) Google Scholar). The second modifier is Apg8p/Aut7p, and Apg7p and Aut1p/Apg3p are corresponding E1- and E2-like enzymes. These results suggest that Apg7p, because it is involved in two distinct conjugation systems, is a key enzyme for membrane formation and the targeting of autophagosomes and Cvt vesicles. In mammalian cells, several homologs of yeast APG gene products have been reported. hApg12p conjugates with hApg5p (first identified as an apoptosis-specific protein), suggesting that the Apg12p conjugation system exists even in human cells (27Hammond E.M. Brunet C.L. Johnson G.D. Parkhill J. Milner A.E. Brady G. Gregory C.D. Grand R.J. FEBS Lett. 1998; 425: 391-395Crossref PubMed Scopus (79) Google Scholar, 28Mizushima N. Sugita H. Yoshimori T. Ohsumi Y. J. Biol. Chem. 1998; 273: 33889-33892Abstract Full Text Full Text PDF PubMed Scopus (412) Google Scholar). There are three candidates for mammalian Apg8p/Aut7p homologs, GATE-16 (Golgi-associated ATPase enhancer of 16 kDa), GABARAP (GABA receptor-associated protein), and MAP-LC3 (microtubule-associated protein light chain 3) (25Legesse-Miller A. Sagiv Y. Gluzman R. Elazar Z. J. Biol. Chem. 2000; 275: 32966-32973Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar, 29Mann S.S. Hammarback J.A. J. Biol. Chem. 1994; 269: 11492-11497Abstract Full Text PDF PubMed Google Scholar, 30Mann S.S. Hammarback J.A. J. Neurosci. Res. 1996; 43: 535-544Crossref PubMed Scopus (48) Google Scholar, 31Wang H. Bedford F.K. Brandon N.J. Moss S.J. Olsen R.W. Nature. 1999; 397: 69-72Crossref PubMed Scopus (490) Google Scholar, 32Paz Y. Elazar Z. Fass D. J. Biol. Chem. 2000; 275: 25445-25450Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar, 33Sagiv Y. Legesse-Miller A. Porat A. Elazar Z. EMBO J. 2000; 19: 1494-1504Crossref PubMed Scopus (207) Google Scholar). GATE-16 was first identified as a ganglioside expression factor, but was recently characterized as a soluble transport factor. GATE-16 interacts with NSF and the Golgi v-SNARE GOS-28 (33Sagiv Y. Legesse-Miller A. Porat A. Elazar Z. EMBO J. 2000; 19: 1494-1504Crossref PubMed Scopus (207) Google Scholar). The mRNA of GATE-16 is expressed ubiquitously but at significantly higher levels in brain tissue. The interaction of yeast Apg8p/Aut7p with two ER-to-Golgi v-SNAREs was proven as a functional GATE-16 homolog (25Legesse-Miller A. Sagiv Y. Gluzman R. Elazar Z. J. Biol. Chem. 2000; 275: 32966-32973Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). GABARAP interacts with GABAA receptors, cytoskeleton, and gephyrin, suggesting functional importance in brain or neuronal cells (31Wang H. Bedford F.K. Brandon N.J. Moss S.J. Olsen R.W. Nature. 1999; 397: 69-72Crossref PubMed Scopus (490) Google Scholar, 34Kneussel M. Haverkamp S. Fuhrmann J.C. Wang H. Wassle H. Olsen R.W. Betz H. Proc. Natl. Acad. Sci. 2000; 97: 8594-9599Crossref PubMed Scopus (154) Google Scholar). MAP-LC3 copolymerizes with tubulin and is a component of the MAP-1 complex, which is composed of light chains 1, 2, and 3 and heavy chains (29Mann S.S. Hammarback J.A. J. Biol. Chem. 1994; 269: 11492-11497Abstract Full Text PDF PubMed Google Scholar,30Mann S.S. Hammarback J.A. J. Neurosci. Res. 1996; 43: 535-544Crossref PubMed Scopus (48) Google Scholar). Rat MAP-LC3 is localized on autophagosomal membranes, suggesting that rat MAP-LC3 is also a functional Apg8p/Aut7p homolog (35Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5463) Google Scholar). These results suggest that mammalian Apg8p/Aut7p homologs have divergent functions in mammalian cells, especially in neuronal cells. For Apg7p, there are several clones in the EST database, and the sequence of hApg7p has been determined to be homologous to Pichia pastoris GSA7, which is essential for microautophagy (36Yuan W. Stromhaug P.E. Dunn W.A.J. Mol. Biol. Cell. 1999; 10: 1353-1366Crossref PubMed Scopus (117) Google Scholar). However, as yet, there is no biochemical evidence that hApg7p is an E1-like enzyme for hApg12p. There is a further question; which of MAP-LC3, GATE-16, and GABARAP is an authentic substrate for hApg7p? In this report, we show that hApg7p conjugates with hApg12p and all three Apg8p/Aut7p homologs as hApg7p substrate intermediates in mammalian cells. Male Wistar rats (250–300 g) were maintained in an environmentally controlled room (lights on from 7:00 AM to 20:00 PM) for at least 2 weeks before experiments. All rats were fed a standard pellet laboratory diet and tap water ad labitum during this period. Escherichia coli strain DH5α cells, the host for plasmids and protein expression, were grown in Luria Broth medium in the presence of antibiotics as required (37Ausubel F. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Short Protocols in Molecular Biology, Third Edition. John Wiley & Sons, Inc., NY1995Google Scholar). Standard genetic and molecular biological techniques were performed as described (37Ausubel F. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Short Protocols in Molecular Biology, Third Edition. John Wiley & Sons, Inc., NY1995Google Scholar, 38Kaiser C. Michaelis S. Mitchell A. Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1994Google Scholar). The yeast strain for two hybrid experiments was cultured in SD medium (0.67% yeast nitrogen base without amino acids, 2% glucose, and appropriate amino acids) as described previously (38Kaiser C. Michaelis S. Mitchell A. Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY1994Google Scholar). Protein was determined by BCA protein assay following the manufacturer's protocol (Pierce, Rockford, IL). The polymerase chain reaction was performed with a programmed temperature control system PC-701 (ASTEC, Fukuoka, Japan). The DNA sequence was determined with an ABI 373A DNA sequencer (PE Biosystems, Foster City, CA). DNA plasmid was transfected into mammalian cells with FuGene-6 transfection reagent according to the manufacturer's protocol (Roche Diagnostics, Mannheim, Germany). Restriction enzymes were purchased from TOYOBO (Osaka, Japan) and New England BioLabs (Beverly, MA). Oligonucleotides were synthesized by the ESPEC oligo-service (Ibaraki, Japan). pGAD-C1 vector, pGBD-C1 vector, and PJ69–4A strain were kind gifts from P. James (39James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar). pcDNA3 was purchased from Invitrogen (Carlsbad, CA), pGEM-T was from PROMEGA (Madison, WI), pEGFP-C1 and pEGFP-N1 were fromCLONTECH, and pBluescriptII (SK+) was from Stratagene (La Jolla, CA). Based on the DNA sequence of the human APG7/GSA7 homolog (GenbankTM/EBI accession number AF094516), we cloned an open-reading frame of the human GSA7/APG7 cDNA by polymerase chain reaction with high fidelity (36Yuan W. Stromhaug P.E. Dunn W.A.J. Mol. Biol. Cell. 1999; 10: 1353-1366Crossref PubMed Scopus (117) Google Scholar, 40Barnes W.M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2216-2220Crossref PubMed Scopus (980) Google Scholar), introduced the amplified DNA fragment into the SalI-NotI site of pBluescriptII (SK+), and designated the resultant plasmid for pSKhAPG7 plasmid. To construct an expression plasmid as hApg7p, aKpnI-NotI fragment (∼2.5 kilobase pairs) of the pSKhAPG7 plasmid was introduced into the pEGFP-N1 vector (CLONTECH) and designated pCMV-hAPG7. To obtain a DNA fragment containing an open-reading frame of the humanAPG12 homolog, GATE-16, and GABARAP, polymerase chain reaction was performed with specific primers for their open-reading frames with high fidelity using a human brain cDNA library as a template, and the amplified fragment was introduced into pGEM-T vector (pGEM-hAPG12, pGEM-hGATE-16, and pGEM-hGABARAP). The isolated DNA fragments were introduced into pEGFP-C1 to express GFP fusion proteins (pGFP·hApg12p, pGFP·hGATE-16, and pGFP·hGABARAP). Cys572 within hApg7p was replaced by Ser, mutagenized by the Gene-Editor in vitro site-directed mutagenesis system (PROMEGA) with an oligonucleotide (hAPG7CS; 5′-CGGACCTTGGACCAGCAGAGCACTGTGAGTCGTCCAGG-3′) according to the manufacturer's protocol. The expression plasmid for mutant Apg7pC572S was constructed as in the case of pCMV-hAPG7 and was designated pCMV-hAPG7C572S. A polyclonal antibody against a synthetic polypeptide (VVAPGDSTRDRTL) corresponding to residues 550–571 of hApg7p was raised in Japanese white rabbits (anti-hApg7p). The antibody was affinity-purified by chromatography on immobilized hApg7p-peptide-Sepharose. For the preparation of antibody against murine Apg12p homolog (mApg12p), rabbits were immunized with a maltose-binding protein·mApg12p fusion protein. The antibody to mApg12p was purified by affinity chromatography on maltose-binding protein·mApg12p-immobilized-Sepharose. The polyclonal anti-GFP antibody was purchased from CLONTECH. The advanced BLAST search program from the National Center for Biotechnology Information was used to search for homologs in the human and mouse EST database. Based on the DNA sequence of EST clones, we performed rapid amplification of the 5′-cDNA ends in Marathon-Ready cDNA (CLONTECH) by polymerase chain reaction with high fidelity (40Barnes W.M. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 2216-2220Crossref PubMed Scopus (980) Google Scholar). The amplified DNA fragment was introduced into pGEM-T vector, and the DNA sequence was determined. The DNA sequences of all five independent clones were identical, and the predicted amino acids of the clones show significant homology to rat and murine MAP-LC3. To express GFP·hMAP-LC3 in HEK293 cells, the cloned DNA fragment was introduced into pEGFP-C1 vector (pGFP·hMAP-LC3). HEK293 cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. For transfection, 2 × 105 cells were seeded on 60-mm dishes. After incubation for 24 h at 37 °C, the cells were transfected with a mixture of 2.5 μg of plasmid DNA and 12 μl of FuGene-6. For cotransfection, 1 μg of each plasmid was used. The transfectant was harvested after incubation for an additional 48 h. 1 × 106 cells were washed with 1 ml of phosphate-buffered saline, and resuspended in 200 μl of phosphate-buffered saline containing Complete protease inhibitor mixture (Roche Diagnostics). The cell suspension was lysed by sonication for 10 s at 4 °C. Proteins in the lysate were separated by reducing or nonreducing SDS-PAGE and transferred to a polyvinylidene difluoride membrane (Millipore, Bedford, MA). Immunoblot analysis was performed with anti-hApg7p and -GFP antibodies (CLONTECH), and the blots were developed by an enhanced chemiluminescence system (Amersham Pharmacia Biotech). Livers were isolated from Wistar male rats, passed through a stainless steel mesh, and suspended in 5 volumes of 5 mm Tes-NaOH, pH 7.5, 0.3 msucrose. The homogenate was centrifuged at 100,000 × gfor 1 h, and the supernatant was used as the cytosol fraction. Cytosol (0.4 ml) was loaded onto an 11.5-ml linear glycerol gradient (10–40%) in 20 mm Tes-NaOH, pH 7.5, 0.15 mNaCl and centrifuged at 151,000 × g for 15 h (Beckman SW-41 rotor). Fractions of 0.7 ml were collected from the bottom of the tubes. Rat Apg7p was immunoprecipitated from each fraction with anti-hApg7p and subjected to immunoblotting analysis, because hApg7p cross-reacts with rat Apg7p. Authentic thyroglobulin (670 kDa, 19 S), catalase (220 kDa, 11.2 S), aldolase (158 kDa, 7.4 S), and bovine serum albumin (67 kDa, 4.3 S) were used as internal S-value standards. Two-hybrid analysis was performed as described by Jameset al. (39James P. Halladay J. Craig E.A. Genetics. 1996; 144: 1425-1436Crossref PubMed Google Scholar). In yeast, S. cerevisiae, Apg7p is a protein-activating enzyme for Apg12p (18Tanida I. Mizushima N. Kiyooka M. Ohsumi M. Ueno T. Ohsumi Y. Kominami E. Mol. Biol. Cell. 1999; 10: 1367-1379Crossref PubMed Scopus (325) Google Scholar). If hApg7p is a protein-activating enzyme essential for the hApg12p·hApg5p conjugation system, hApg12p will interact with hApg7p. We first examined the interaction between hApg7p and hApg12p by a two-hybrid experiment (Fig. 1). We constructed yeast expression plasmids of GAL4BD-fused hApg7p (GAL4BD·hApg7p) and GAL4AD-fused hApg12p (GAL4AD·hApg12p) and expressed both fusion proteins in a yeast tester strain (trp1–901 leu2–3, 112 LYS2::GAL1-HIS3). The tester strain expressing both GAL4AD·hApg12p and GAL4BD·hApg7p grew well on selection plate (SD-Trp-Leu-His plate), whereas strains expressing GAL4AD and GAL4BD, GAL4AD·hApg12p and GAL4BD, or GAL4AD and GAL4BD·hApg7p did not (Fig. 1). These results indicate that hApg12p interacts with hApg7p. To investigate whether hApg7p forms an enzyme-hApg12p intermediate, we employed site-directed mutagenesis of a predicted active site cysteine residue within hApg7p. Based on a homology search between yeast and human Apg7p, we predicted that the active site cysteine residue within hApg7p must be Cys572 (Fig.2 A). If an active site cysteine residue within an E1-enzyme is changed to serine, anO-ester bond will be formed instead of a thiol ester bond. Therefore, we changed Cys572 within hApg7p to Ser by site-directed mutagenesis and expressed both the mutant hApg7pC572S and GFP-fused hApg12p (GFP·hApg12p) in HEK293 cells (Fig. 2 B). Cell lysates expressing both proteins were prepared and analyzed by SDS-PAGE. hApg7p was recognized by immunoblot with anti-hApg7p antibody. Wild-type hApg7p and mutant hApg7pC572S were both expressed well in HEK293 cells (Fig.2 B, wild and C572S, hApg7p of ∼80 kDa). When both hApg7pC572S and GFP·hApg12p were expressed in HEK293 cells, a higher molecular mass band consistent with a stable GFP·hApg12p·hApg7pC572S intermediate (∼140 kDa) appeared in addition to the band of ∼80 kDa for free hApg7p (Fig. 2 B, C572S). This higher molecular mass band was also recognized by immunoblotting with anti-GFP antibody in the presence or absence of reducing reagent (data not shown). These results indicate that hApg12p is an authentic substrate for hApg7p. If hApg7p is an E1-like enzyme in the hApg12p-conjugation system, it is possible that the overexpression of hApg7p will influence the conjugation of hApg12p with hApg5p. To investigate this possibility, we expressed both hApg7p and GFP·hApg12p in HEK293 cells, metabolically labeled the cells with 35S-labeled Met and Cys and prepared a cell lysate. hApg12p was immunoprecipitated with anti-mApg12p antibody, and the precipitates were analyzed by SDS-PAGE and autoradiography. When GFP·hApg12p alone was expressed, GFP·hAPG12p itself was immunoprecipitated with anti-mApg12p antibody (Fig.2 C, vector). In cells expressing both GFP·hApg12p and hApg7p, a high molecular weight peptide corresponding to the hApg5p·GFP·hApg12p conjugate was immunoprecipitated in addition to GFP·hApg12p with anti-mApg12p antibody (Fig.2 C, pCMV-hAPG7). The formation of the hApg5p·GFP·hApg12p conjugate was further confirmed by a second immunoprecipitation using anti-hApg5p antibody (data not shown). The overexpression of mutant hApg7pC572S did not enhance the conjugation (data not shown). These results indicate that hApg7p is an authentic protein-activating enzyme essential for the human Apg12p-conjugation system. Komatsu et al. 2 have found that yeast Apg7p forms a homodimer via the C-terminal region. Considering the functional homology between yeast and human Apg7p, it is likely that hApg7p will also form a homodimer. To investigate this possibility, we conducted a cross-linking experiment. A HEK293 cell lysate expressing hApg7p was prepared and treated with a noncleavable cross-linker, disuccinimidyl suberate. After cross-linking, the lysate was analyzed by SDS-PAGE, and hApg7p was detected by immunoblotting with anti-hApg7p antibody. Before treatment with the cross-linking reagent, hApg7p was detected in the cell lysate as a band corresponding to ∼80 kDa (Fig.3 A, pCMV-hAPG7,DSS−). After cross-linking, the amount of this 80-kDa band was decreased, and a broad band at ∼160 kDa appeared (Fig.3 A, pCMV-hAPG7, DSS+). We next analyzed endogenous Apg7p in rat liver cytosol by glycerol density gradient ultracentrifugation using the cross-reactivity of the anti-hApg7p antibody with rat Apg7p. The cytosolic fraction of a rat liver homogenate was prepared and subjected to a 10–40% glycerol density gradient centrifugation. Rat Apg7p was immunoprecipitated with anti-hApg7p antibody. The resulting precipitates were analyzed by SDS-PAGE, and rat Apg7p was identified by immunoblotting with anti-hApg7p antibody. Rat Apg7p was collected in fractions 11–14 and sedimented mainly with a sedimentation coefficient of ∼7.4 S (Fig.3 B, fraction 13). A two-hybrid experiment also indicated that hApg7p interacts with itself (data not shown). Therefore we conclude that mammalian Apg7p forms a homodimer similar to yeast Apg7p. Recent findings have indicated that yeast Apg7p also functions as an activating enzyme for Apg8p and is essential for Apg8p targeting to autophagosomal membranes (22Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-275Crossref PubMed Scopus (736) Google Scholar, 26Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1516) Google Scholar).2A BLAST search suggested that there are at least three Apg8p homologs, GATE-16 (human), GABARAP (human, mouse, and rat), and MAP-LC3 (rat) in mammalian cells. A BLAST search of the human EST database suggested that there are human MAP-LC3 homologs (GenbankTM/EBI accession numbers AI365977, AA476809, and AI382200). hMAP-LC3 was isolated from a human brain cDNA library by rapid amplification of the 5′-cDNA ends according to the information obtained from the BLAST search. The amino acid sequence of hMAP-LC3 shows 95.9% identity with its rat counterpart. The C-terminal regions of the three hApg8p proteins show significant homology to yeast Apg8p. Considering the significant homology between human and yeast Apg8p, these proteins may also be substrates for Apg7p. To investigate whether these Apg8p homologs interact with hApg7p as substrates, we first performed a coimmunoprecipitation experiment. hMAP-LC3, hGATE-16, and hGABARAP were expressed as GFP fusion proteins together with hApg7p in COS7 cells. Cell lysates expressing both hApg7p and a GFP fusion protein were prepared. The GFP fusion proteins were immunoprecipitated using anti-GFP antibody. The precipitates were analyzed by SDS-PAGE, and hApg7p was recognized by immunoblotting using anti-hApg7p antibody. hApg7p coimmunoprecipitated with GFPhGATE-16, GFPhGABARAP, and GFPhMAP-LC3 but not with GFP alone (Fig.4 A). The results indicate that hGATE-16, hGABARAP, and hMAP-LC3 interact with hApg7p. We next examined the formation of stable conjugates of mutant hApg7pC572S with hGATE-16, hGABARAP, and hMAP-LC3 via anO-ester bond. hApg7pC572S was coexpressed with GFPhGATE-16, GFPhGABARAP, or GFPhMAP-LC3 in COS7 cells, and the cell lysates were analyzed by SDS-PAGE under reducing conditions. The GFP·hApg8p homologs were recognized by immunoblotting with anti-GFP antibody. A high molecular weight band corresponding to a stable hApg7pC572S substrate intermediate was detected in cell lysates expressing both hApg7pC572S and a GFP·Apg8p homolog, but not in cells expressing both wild-type hApg7p and GFP·Apg8p homologs, indicating that a stable conjugate is formed between hApg7pC572S and the Apg8p homologs (Fig.4 B). These results indicate that all three hApg8p proteins, hGATE-16, hGABARAP, and hMAP-LC3, are authentic substrates for hApg7p. In this study, we showed that the human Apg7p homolog is an authentic E1-like enzyme for the hApg12p conjugation system and that hGATE-16, hGABARAP, and hMAP-LC3 are substrates for hApg7p. GATE-16 as a soluble transport factor interacts with NSF and GOS-28, is localized in the Golgi, and is expressed in the largest amount in brain (33Sagiv Y. Legesse-Miller A. Porat A. Elazar Z. EMBO J. 2000; 19: 1494-1504Crossref PubMed Scopus (207) Google Scholar). GABARAP is GABAA receptor-associated protein that colocalizes with the GABAA receptor in cultured cortical neurons and interacts with gephyrin (31Wang H. Bedford F.K. Brandon N.J. Moss S.J. Olsen R.W. Nature. 1999; 397: 69-72Crossref PubMed Scopus (490) Google Scholar, 32Paz Y. Elazar Z. Fass D. J. Biol. Chem. 2000; 275: 25445-25450Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar, 34Kneussel M. Haverkamp S. Fuhrmann J.C. Wang H. Wassle H. Olsen R.W. Betz H. Proc. Natl. Acad. Sci. 2000; 97: 8594-9599Crossref PubMed Scopus (154) Google Scholar). MAP-LC3 is localized on autophagosomal membranes (35Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5463) Google Scholar). Considering the divergent functions and intracellular localizations of the three Apg8p homologs, it is surprising that all three human Apg8p homologs are substrates for hApg7p. Because yeast Apg7p plays an indispensable role in autophagy and the Cvt transport of aminopeptidase I, mammalian Apg7p must also be essential for autophagy and other forms of membrane transport, common phenomena involving the formation of cup-shaped and/or elongated membrane structures. Because MAP-LC3 is localized on autophagosomal membranes in rat liver as in yeast Apg8p (35Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5463) Google Scholar), at least two substrates, MAP-LC3 and hApg12p, play major roles in autophagy in mammalian cells. At present, there has been no report of a mammalian Cvt-like pathway. Considering the strong expression of GATE-16 and GABARAP in brain and neuronal cells, a Cvt-like pathway and/or other membrane transport pathways in which GATE-16 and GABARAP function as protein modifiers may also exist in these tissues. It is difficult to explain how hApg7p distinguishes the four substrates and regulates the multiple interactions among the substrates. There must be some regulatory factors associated with the hApg7p homodimer to form multimeric complexes. Further candidates related to hApg7p will be sought by a two-hybrid experiment using a human brain cDNA library and coimmunoprecipitation of rat Apg7p with anti-hApg7p antibody in several rat tissues. At present, the target proteins of GATE-16, GABARAP, and MAP-LC3 remain unknown. There is no report that these proteins conjugate with other proteins. We have recognized no targeting protein with which MAP-LC3 forms a conjugate. Kabeya et al. (35Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5463) Google Scholar) reported that MAP-LC3 is processed to several forms in cultured mammalian cells, so there may exist some unknown mechanism. Further biochemical analysis of hApg8p is necessary. It has become more and more evident that the Apg machinery plays an important role in at least brain and cardiac and skeletal muscles. Clinical and biochemical analyses of a group of severe inheritable neurodegenerative disorders, neuronal ceroid-lipofuscinosis, have suggested that lysosomal degradation via autophagy occurs actively during neuronal development (for a review see Ref. 41Peltonen L. Savukoski M. Vesa J. Curr. Opin. Genet. Dev. 2000; 10: 299-305Crossref PubMed Scopus (22) Google Scholar). Furthermore, clinical, genetic and biochemical analyses of X-linked vacuolar cardiomyopathy, myopathy in humans and LAMP-2-deficient mice have indicated that autophagic processes play an indispensable role in normal mammalian bodies (42Nishino I. Fu J. Tanji K. Yamada T. Shimojo S. Koori T. Mora M. Riggs J.E. Oh S.J. Koga Y. Sue C.M. Yamamoto A. Murakami N. Shanske S. Byrne E. Bonilla E. Nonaka I. DiMauro S. Hirano M. Nature. 2000; 406: 906-910Crossref PubMed Scopus (731) Google Scholar, 43Tanaka Y. Guhde G. Suter A. Eskelinen E.-L. Hartmann D. Lullmann-Rauch R. Janssen P.M.L. Blanz J. von Figura K. Saftig P. Nature. 2000; 406: 902-906Crossref PubMed Scopus (731) Google Scholar). In addition, autophagy is activated by apoptotic signaling in sympathetic neurons (44Xue L. Fletcher G.C. Tolkovsky A.M. Mol. Cell. Neurosci. 1999; 14: 180-199Crossref PubMed Scopus (390) Google Scholar). In view of the ubiquitous distribution of hApg12p and human Apg8p homologs, GATE-16, GABARAP, and MAP-LC3, and the multiple reactivity of hApg7p with these different substrates, it is possible that mammalian Apg7p plays an essential role in various stages of development and apoptosis in addition to autophagy. We are now investigating the possible tissue-specific functions of hApg7p using APG7 gene-knockout mice. These studies will contribute to the understanding of the physiological functions of mammalian Apg7p. We thank Y. Ohsumi, T. Yoshimori, T. Noda, N. Mizushima, Y. Ichimura, K. Kirisako (National Institute for Basic Biology), D. J. Klionsky (University of California, Davis), and M. Komatsu (Juntendo University) for important discussions and information; P. James (University of Wisconsin) for providing strains and plasmids; and K. Ishidoh, J. Ezaki, and D. Muno (Juntendo University) for helpful discussions.

Autophagy is a process of bulk degradation of cytoplasmic components by the lysosome/vacuole and has a significant relationship to several neurodegenerative disorders and myopathies in mammals. One of APG gene products essential for autophagy in yeast, Apg3p, is a protein-conjugating enzyme for Apg8p lipidation (Ichimura, Y., Kirisako, T., Takao, T., Satomi, Y., Shimonishi, Y., Ishihara, N., Mizushima, N., Tanida, I., Kominami, E., Ohsumi, M., Noda, T., and Ohsumi, Y. (2000) Nature 408, 488–492). In this study, the cloning of a human Apg3p homologue (hApg3p) as an E2 enzyme essential for human Apg8p homologues (i.e. GATE-16, GABARAP, and MAP-LC3) is shown, and its unique characteristics are described. The predicted amino acid sequence of the isolated clone shows 34.1% identity and 48.1% similarity to yeast Apg3p. Site-directed mutagenesis revealed that Cys264 of hApg3p is an authentic active-site cysteine residue essential for the formation of hApg3p·hApg8p homologue intermediates. Overexpression of hApg7p enhances the formation of a stable E2-substrate complex between hApg3pC264S and each of the hApg8p homologues, and MAP-LC3 is preferred as the substrate over the other two Apg8p homologues. These results indicate that hApg3p is an E2-like enzyme essential for three human Apg8p homologues. Co-immunoprecipitation of hApg7p with hApg3p indicates that hApg3p forms an E1·E2 complex with hApg7p as in the case of yeast Apg3p and Apg7p. Furthermore, hApg3p coimmunoprecipitates with hApg12p, and the overexpression of hApg3p facilitates the formation of the GFPhApg12p·hApg5p conjugate, suggesting that hApg3p cross-talks with the hApg12p conjugation system. Autophagy is a process of bulk degradation of cytoplasmic components by the lysosome/vacuole and has a significant relationship to several neurodegenerative disorders and myopathies in mammals. One of APG gene products essential for autophagy in yeast, Apg3p, is a protein-conjugating enzyme for Apg8p lipidation (Ichimura, Y., Kirisako, T., Takao, T., Satomi, Y., Shimonishi, Y., Ishihara, N., Mizushima, N., Tanida, I., Kominami, E., Ohsumi, M., Noda, T., and Ohsumi, Y. (2000) Nature 408, 488–492). In this study, the cloning of a human Apg3p homologue (hApg3p) as an E2 enzyme essential for human Apg8p homologues (i.e. GATE-16, GABARAP, and MAP-LC3) is shown, and its unique characteristics are described. The predicted amino acid sequence of the isolated clone shows 34.1% identity and 48.1% similarity to yeast Apg3p. Site-directed mutagenesis revealed that Cys264 of hApg3p is an authentic active-site cysteine residue essential for the formation of hApg3p·hApg8p homologue intermediates. Overexpression of hApg7p enhances the formation of a stable E2-substrate complex between hApg3pC264S and each of the hApg8p homologues, and MAP-LC3 is preferred as the substrate over the other two Apg8p homologues. These results indicate that hApg3p is an E2-like enzyme essential for three human Apg8p homologues. Co-immunoprecipitation of hApg7p with hApg3p indicates that hApg3p forms an E1·E2 complex with hApg7p as in the case of yeast Apg3p and Apg7p. Furthermore, hApg3p coimmunoprecipitates with hApg12p, and the overexpression of hApg3p facilitates the formation of the GFPhApg12p·hApg5p conjugate, suggesting that hApg3p cross-talks with the hApg12p conjugation system. Autophagy is a process of bulk degradation of cytoplasmic components by the lysosomal/vacuolar system (1.Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-32Crossref PubMed Scopus (391) Google Scholar, 2.Ohsumi Y. Trends Cell Biol. 1999; 9: 162Abstract Full Text Full Text PDF PubMed Scopus (2) Google Scholar, 3.Klionsky D.J. Emr S.D. Science. 2000; 290: 1717-1721Crossref PubMed Scopus (3014) Google Scholar). In the initial step of macroautophagy, a cup-shaped membrane sac surrounds cytosolic components to form an autophagosome (4.Baba M. Takeshige K. Baba N. Ohsumi Y. J. Cell Biol. 1994; 124: 903-913Crossref PubMed Scopus (404) Google Scholar, 5.Baba M. Ohsumi M. Ohsumi Y. Cell Struct. Funct. 1995; 20: 465-471Crossref PubMed Scopus (128) Google Scholar), and the outer membrane of the autophagosome fuses with a lysosome/vacuole. The APG andAUT genes (autophagy orautophagy), which play indispensable roles in autophagy, have been identified and characterized in yeast, Saccharomyces cerevisiae (6.Tsukada M. Ohsumi Y. FEBS Lett. 1993; 333: 169-174Crossref PubMed Scopus (1427) Google Scholar, 7.Thumm M. Egner R. Koch B. Schlumpberger M. Straub M. Veenhuis M. Wolf D.H. FEBS Lett. 1994; 349: 275-280Crossref PubMed Scopus (483) Google Scholar). The analyses of the gene products revealed two modifier-conjugation systems (the modifiers are Apg12p and Apg8p/Aut7p) that are essential for autophagy and the Cvt 1The abbreviations used are: Cvtcytoplasm-to-vacuole targetingE1protein-activating enzymeE2protein-conjugating enzymeMAP-LC3microtubule-associated protein light chain 3FLAGhApg3pFLAG-tagged human Apg3p/Aut1p homologueFLAGhMAP-LC3FLAG-tagged human MAP-LC3ESTexpressed sequence tagGABAAγ-aminobutyric acid, type AGABARAPGABAA receptor-associated proteinGATE-16Golgi-associated ATPase enhancer of 16 kDaGFPgreen fluorescent proteinGFPhApg3pGFP-tagged hApg3pGFPhApg12pGFP-tagged hApg12pmApg12pmurine Apg12p homologueSNAREsoluble NSF attachment protein receptorsRACErapid amplification of cDNA endspathway, and these modifiers have been shown to be processed by an enzymatic system similar to ubiquitylation (8–12, for review see Refs. 1.Klionsky D.J. Ohsumi Y. Annu. Rev. Cell Dev. Biol. 1999; 15: 1-32Crossref PubMed Scopus (391) Google Scholar, 3.Klionsky D.J. Emr S.D. Science. 2000; 290: 1717-1721Crossref PubMed Scopus (3014) Google Scholar, 13.Ohsumi Y. Philos. Trans. R. Soc. Lond-Biol. Sci. 1999; 354: 1580-1581Crossref Scopus (55) Google Scholar, and14.Ohsumi Y. Nat. Rev. Mol. Cell Biol. 2001; 2: 211-216Crossref PubMed Scopus (1052) Google Scholar). cytoplasm-to-vacuole targeting protein-activating enzyme protein-conjugating enzyme microtubule-associated protein light chain 3 FLAG-tagged human Apg3p/Aut1p homologue FLAG-tagged human MAP-LC3 expressed sequence tag γ-aminobutyric acid, type A GABAA receptor-associated protein Golgi-associated ATPase enhancer of 16 kDa green fluorescent protein GFP-tagged hApg3p GFP-tagged hApg12p murine Apg12p homologue soluble NSF attachment protein receptors rapid amplification of cDNA ends In the yeast S. cerevisiae, Apg8p/Aut7p is unique among ubiquitin and other modifiers (9.Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1542) Google Scholar). Unlike the other modifiers, the target of Apg8p is a lipid, not a protein. Apg8p is activated by an E1 enzyme, Apg7p, and transferred to an E2 enzyme, Apg3p/Aut1p (9.Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1542) Google Scholar, 10.Tanida I. Mizushima N. Kiyooka M. Ohsumi M. Ueno T. Ohsumi Y. Kominami E. Mol. Biol. Cell. 1999; 10: 1367-1379Crossref PubMed Scopus (327) Google Scholar,15.Schlumpberger M. Schaeffeler E. Straub M. Bredschneider M. Wolf D.H. Thumm M. J. Bacteriol. 1997; 179: 1068-1076Crossref PubMed Scopus (81) Google Scholar). In the last step, Apg8p is conjugated to phosphatidylethanolamine on a preautophagosomal membrane sac (9.Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1542) Google Scholar). After the formation of the autophagosome, luminal Apg8p is released into the luminal space and degraded in the vacuole (12.Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-276Crossref PubMed Scopus (742) Google Scholar, 16.Kirisako T. Baba M. Ishihara N. Miyazawa K. Ohsumi M. Yoshimori T. Noda T. Ohsumi Y. J. Cell Biol. 1999; 147: 435-446Crossref PubMed Scopus (719) Google Scholar). At the same time, Apg8p on the cytosolic surface of the autophagosome is detached into the cytosol by Apg4p, a cysteine protease that is also essential for the activation of Apg8p (9.Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1542) Google Scholar). Apg8p/Aut7p also interacts with two ER-to-Golgi vacuole SNAREs (Bet1p and Sec22p) and vacuolar target SNARE and vacuole SNARE (Vam3p and Nyv1p) (17.Legesse-Miller A. Sagiv Y. Glozman R. Elazar Z. J. Biol. Chem. 2000; 275: 32966-32973Abstract Full Text Full Text PDF PubMed Scopus (57) Google Scholar). For the reaction, the carboxyl-terminal Gly in Apg8p is essential as in ubiquitin and other modifiers. Furthermore, in addition to the Apg8p-lipidation system, the Apg12p-conjugation system is also essential for the Cvt pathway and autophagy (8.Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1297) Google Scholar). Apg12p is activated by the common E1 enzyme, Apg7p, transferred to a second E2 enzyme, Apg10p, and finally conjugates with Apg5p (8.Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1297) Google Scholar, 10.Tanida I. Mizushima N. Kiyooka M. Ohsumi M. Ueno T. Ohsumi Y. Kominami E. Mol. Biol. Cell. 1999; 10: 1367-1379Crossref PubMed Scopus (327) Google Scholar, 11.Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (235) Google Scholar). The carboxyl-terminal Gly of Apg12p is also essential for conjugation. After the formation of the Apg12p·Apg5p conjugate, Apg16p attaches to Apg5p, forming an Apg12p·Apg5p·Apg16p complex for autophagy (18.Mizushima N. Noda T. Ohsumi Y. EMBO J. 1999; 15: 3888-3896Crossref Scopus (342) Google Scholar). Apg5p and the Apg12p·Apg5p conjugate localize to the membrane fraction but not the autophagosome, suggesting that they play a role in an initial step in the formation of autophagosomes and Cvt vesicles (8.Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1297) Google Scholar). Unlike other modifier-conjugation systems, two conjugation systems play indispensable roles in the formation of membrane structures including autophagosomes and Cvt vesicles. Apg7p is a unique E1 enzyme for two substrates in two independent modification systems of autophagy and the Cvt-pathway and exists as a homodimer (19.Komatsu M. Tanida I. Ueno T. Ohsumi M. Ohsumi Y. Kominami E. J. Biol. Chem. 2001; 276: 9846-9854Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar). More interestingly, Apg3p/Aut1p forms an E1·E2 enzyme complex with Apg7p, and Apg3p also interacts with Apg12p, which is a substrate for Apg7p and Apg10p but not Apg3p (19.Komatsu M. Tanida I. Ueno T. Ohsumi M. Ohsumi Y. Kominami E. J. Biol. Chem. 2001; 276: 9846-9854Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 20.Uetz P. Giot L. Cagney G. Mansfield T.A. Judson R.S. Knight J.R. Lockshon D. Narayan V. Srinivasan M. Pochart P. Qureshi-Emili A. Li Y. Godwin B. Conover D. Kalbfleisch T. Vijayadamodar G. Yang M. Johnston M. Fields S. Rothberg J.M. Nature. 2000; 403: 601-603Crossref PubMed Scopus (391) Google Scholar). These results suggest that the E1·E2 complex is a key to the cooperative regulation of two modification systems. In mammalian cells, two modification systems seem to be conserved. A human Apg12p homologue (hApg12p) conjugates with the human Apg5p homologue (hApg5p), which was first identified as an apoptosis-specific protein (21.Hammond E.M. Brunet C.L. Johnson G.D. Parkhill J. Milner A.E. Brady G. Gregory C.D. Grand R.J. FEBS Lett. 1998; 425: 391-395Crossref PubMed Scopus (79) Google Scholar, 22.Mizushima N. Sugita H. Yoshimori T. Ohsumi Y. J. Biol. Chem. 1998; 273: 33889-33892Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar). Recently, experiments using embryonic stem cells that knocked out the mouse APG5 gene demonstrated that a murine Apg5p homologue is essential for autophagy (23.Mizushima N. Yamamoto A. Hatano M. Kobayashi Y. Kabeya Y. Suzuki K. Tokuhisa T. Ohsumi Y. Yoshimori T. J. Cell Biol. 2001; 152: 657-668Crossref PubMed Scopus (1164) Google Scholar). With regard to mammalian Apg8p modification, there are three mammalian Apg8p/Aut7p homologue candidates, the Golgi-associated ATPase enhancer of 16 kDa (GATE-16), GABAA receptor-associated protein (GABARAP), and microtubule-associated protein light chain 3 (MAP-LC3) (16.Kirisako T. Baba M. Ishihara N. Miyazawa K. Ohsumi M. Yoshimori T. Noda T. Ohsumi Y. J. Cell Biol. 1999; 147: 435-446Crossref PubMed Scopus (719) Google Scholar, 24.Wang H. Bedford F.K. Brandon N.J. Moss S.J. Olsen R.W. Nature. 1999; 397: 69-72Crossref PubMed Scopus (491) Google Scholar, 25.Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5510) Google Scholar, 26.Sagiv Y. Legesse-Miller A. Porat A. Elazar Z. EMBO J. 2000; 19: 1494-1504Crossref PubMed Scopus (209) Google Scholar, 27.Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar). GATE-16 interacts with N-ethylmaleimide-sensitive fusion protein and the 28-kDa Golgi SNARE protein (26.Sagiv Y. Legesse-Miller A. Porat A. Elazar Z. EMBO J. 2000; 19: 1494-1504Crossref PubMed Scopus (209) Google Scholar). The mRNA for GATE-16 is expressed ubiquitously but at significantly higher levels in brain tissue. GABARAP interacts with GABAAreceptors, the cytoskeleton, and gephyrin, suggesting its functional importance in brain or neuronal cells (24.Wang H. Bedford F.K. Brandon N.J. Moss S.J. Olsen R.W. Nature. 1999; 397: 69-72Crossref PubMed Scopus (491) Google Scholar, 28.Kneussel M. Haverkamp S. Fuhrmann J.C. Wang H. Wassle H. Olsen R.W. Betz H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8594-8599Crossref PubMed Scopus (154) Google Scholar, 29.Wang H. Olsen R.W. J. Neurochem. 2000; 75: 644-655Crossref PubMed Scopus (132) Google Scholar). MAP-LC3 co-polymerizes with tubulin and is a component of the MAP-1 complex, which is composed of light chains 1, 2, and 3 and heavy chains (30.Mann S.S. Hammarback J.A. J. Biol. Chem. 1994; 269: 11492-11497Abstract Full Text PDF PubMed Google Scholar,31.Mann S.S. Hammarback J.A. J. Neurosci. Res. 1996; 43: 535-544Crossref PubMed Scopus (48) Google Scholar). Rat MAP-LC3 is localized on autophagosomal membranes, suggesting that rat MAP-LC3 is also a functional Apg8p homologue (25.Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5510) Google Scholar). These results suggest that mammalian Apg8p homologues have divergent functions in mammalian cells, especially in neuronal cells. Recently, we showed that the human Apg7p homologue (hApg7p) is an E1 enzyme essential for multiple substrates such as hApg12p, GATE-16, GABARAP, and MAP-LC3 and forms a homodimer (27.Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar). Considering the functional divergence of GATE-16, GABARAP, and MAP-LC3, it is assumed that a regulatory system for the conjugation system exists in mammalian cells. To reveal the three mammalian Apg8p homologue-modification systems, we are interested in the human Apg3p homologue (hApg3p). In this paper, we report the isolation and characterization of hApg3p as an E2 enzyme for mammalian Apg8p homologues. Furthermore, we showed a functional relationship between hApg3p- and the hApg12p-conjugation system. Escherichia coli strain DH5α cells, the host for plasmids and protein expression, were grown in Luria Broth medium in the presence of antibiotics as required (32.Ausubel F. Brent R. Kingston R.E. Moore D.D. Seidman J.G. Smith J.A. Struhl K. Short Protocols in Molecular Biology. 3rd Ed. John Wiley & Sons, Inc., New York1995Google Scholar). pGEM-T was purchased from Promega (Madison, WI), pCMV-Tag2B was from Stratagene, pEGFP-C1 and pIRES were from CLONTECH, and pGEX4T-1 was from Amersham Biosciences. A membrane blotted poly(A) RNA derived from human tissues for Northern analysis was purchased from CLONTECH, and Northern analysis was performed according to the manufacturer's protocol using the cDNA of the open reading frame of hAPG3 as a probe. Based on the DNA sequence of two EST clones (GenBankTM accession numbers AI830763 and AI857615), two oligonucleotides were synthesized (hAPG3-GSP1, 5′-AAGTTCTCCCCCTCCTTCTG-3′, and hAPG3-GSP2, 5′-TGCCGTTGCTCATCATAGCC-3′). Using these primers, 5′-RACE was performed by high fidelity PCR with human brain MarathonTM-ready cDNA (normal whole brain from a 50-year-old Caucasian male) as a template according to the manufacturer's protocol (CLONTECH). Based on the obtained DNA sequence of the human APG3 homologue, we amplified an open reading frame of the human APG3 cDNA by PCR with high fidelity introducing a BglII site before the start codon, and a SalI site after the termination codon cloned the fragment into pGEM-T and designated the resultant plasmid as pGEMhAPG3. To express GFPhApg3p under the control of the cytomegalovirus promoter, a BglII-SalI fragment of the pGEMhAPG3 plasmid was introduced into a pEGFP-C1 vector (CLONTECH) and designated pEGFPhAPG3. To express FLAGhApg3p in COS7 cells, a BglII-SalI fragment of the pGEMhAPG3 plasmid was introduced into theBamHI-SalI site of pCMV-Tag2B vector (Stratagene) and designated pTag2BhAPG3. Mammalian expression vectors for each of the enhanced GFP modifier fusion proteins (EGFPhApg12p, EGFPhMAP-LC3, EGFPhGATE-16, and EGFPhGABARAP) have been described previously (27.Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar). To express both hApg7p and enhanced GFP modifier fusion proteins, we inserted the internal ribosome entry site sequence between the DNA sequences of each of the enhanced GFP modifiers and hApg7p using the pIRES vector. Cys264 within hApg3p was replaced by Ser, mutagenized by the Gene-Editor in vitro site-directed mutagenesis system (Promega) with an oligonucleotide (hAPG3CS, 5′-ATGTGTTCAGTTCACCCAAGCAGGCATGCTGA-3′) according to the manufacturer's protocol. The expression plasmid for mutant hApg3pC264S was constructed as in the case of pEGFP-hAPG3 and designated pEGFPhAPG3CS. A polyclonal antibody against a synthetic polypeptide corresponding to residues 550–571 of hApg7p has been described previously (27.Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar). For the preparation of antiserum against hApg3p, rabbits were immunized with a glutathioneS-transferase-hApg3p fusion protein. The resultant antiserum against hApg3p recognized a recombinant green fluorescent protein (GFP)-hApg3p fusion protein in COS7 cells. The polyclonal and monoclonal anti-GFP antibodies were purchased from CLONTECH. The monoclonal anti-FLAG antibody (M2) was purchased from Sigma. Co-immunoprecipitation of interacting proteins has been described previously (27.Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar). COS7 and HEK293 cells were maintained in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. For transfection, 2 × 105 cells were seeded on 60-mm dishes. After incubation for 24 h at 37 °C, the cells were transfected with a mixture of 1 μg of plasmid DNA and 15 μl of FuGENE 6 (Roche Diagnostics). For co-transfection, 1 μg of each plasmid was used. The transfectant was harvested after incubation for an additional 48 h. The subcellular fractionation of HEK293 cells has been described by Kabeya et al. (25.Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5510) Google Scholar). To investigate factors in the modification system for mammalian hApg8p homologues, we isolated a cDNA to hApg3p. A BLAST search of the EST data base with the amino acid sequence of yeast Apg3p indicated candidate hApg3p homologues (GenBankTM accession numbers AI830763 and AI857615). Based on the DNA sequences of two EST clones, a cDNA to hApg3p was amplified by 5′-RACE with a human brain cDNA library as a template. The DNA sequence of each of the four isolated clones contains a single open reading frame and a 5′ sequence identical to that of another EST clone (GenBank accession number AW408464). The predicted amino acid sequence of the isolated clone (calculated molecular mass of 35.8 kDa) shows 34.1% identity and 48.1% similarity to yeast Apg3p, and the region corresponding to the predicted active-site cysteine residue is significantly conserved between the isolated clones and yeast Apg3p (Fig. 1A). Therefore, we conclude that the clone is a cDNA to hApg3p. To investigate the expression of the human APG3 mRNA in human tissues, we performed Northern blot analysis using a multiple tissue-specific mRNA blot and a DNA fragment encoding the open reading frame of hApg3p. The human APG3 mRNA is expressed ubiquitously in all human tissues examined with especially high levels of expression in heart, skeletal muscle, kidney, liver, and placenta (Fig. 1B). If the isolated clone encodes an authentic E2 enzyme essential for hApg8p homologues, its gene product, hApg3p, will form E2·hApg8p intermediates. To investigate this possibility, we employed site-directed mutagenesis of the predicted active-site cysteine residue within hApg3p (Fig. 1A, Cys264). Wild type hApg3p forms an enzyme/substrate intermediate via a thiol ester bond. Because of the rapid turnover of the Apg3p reaction, it is difficult to recognize such an intermediate in sufficient quantity. If the active-site cysteine residue of Apg3p is replaced by serine, a stable O-ester bond instead of a thiol ester bond will be formed between the enzyme and substrate(s), and the formation of a high molecular mass Apg8p·Apg3p intermediate will be clearly detected in immunoblots as demonstrated previously with hApg7p (27.Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar). We changed Cys264 within hApg3p to serine by site-directed mutagenesis and expressed both the mutant GFPhApg3pC264S and each GFPhApg8ps (GFPhGATE-16, GFPhGABARAP, and GFPhMAP-LC3) in COS7 cells (Fig. 2). Wild type GFPhApg3p, mutant GFPhApg3pC264S, and GFP-hApg8ps were well expressed in COS7 cells; however, contrary to our expectations, no high molecular mass band corresponding to the predicted intermediate was recognized (Fig. 2, Short Exposure and Long Exposure, lanes 2, 4, and 6). We reasoned that because of the sparse content of endogenous Apg7p, the overexpressed Apg8p homologues could not be activated efficiently and could not be subsequently transferred to hApg3p. When hApg7p was expressed together with mutant GFPhApg3pC264S and GFPhApg8ps, higher molecular mass bands consistent with stable GFPhApg8p·GFPhApg3pC264S intermediates (∼105 kDa) were recognized by immunoblot with anti-GFP antibody (Fig. 2, Long Exposure, lanes 8, 10, and 12). hMAP-LC3 preferentially forms an intermediate with hApg3pC264S in COS7 cells (Fig. 2, Short Exposure, lane 12). The interactions of hApg3p with hApg8ps were also confirmed by co-immunoprecipitation (data not shown). These results indicate that hApg3p is an authentic E2 enzyme essential for hGATE-16, hGABARAP, and hMAP-LC3, and that the activation of the hApg8p homologue by hApg7p is essential for a further reaction mediated by hApg3p. To investigate the intracellular localization of hApg3p, we performed subcellular fractionation. HEK293 cells expressing GFPhApg3p and FLAGhMAP-LC3 were lysed and fractionated by ultracentrifugation at 100,000 × g for 1 h. Total proteins in the supernatant and pellet were analyzed by SDS-PAGE, and GFPhApg3p was recognized by immunoblot with anti-GFP antibody (Fig. 3, WB: anti-GFP). GFPhApg3p fractionated mainly in the supernatant, and the FLAGhMAP-LC3·GFPhApg3pC264S intermediate also fractionated in the supernatant (Fig. 3, WB: anti-GFP, LC3-GFPhApg3p). The results suggest that hApg3p is present in the cytosol, and that the reaction of hMAP-LC3 mediated by hApg3p occurs predominantly in the cytosol. In yeast, Apg3p forms an E1·E2 complex with Apg7p, which is one of its unique characteristics compared with other protein-conjugation systems. To investigate whether hApg3p interacts with hApg7p as in the case of yeast, co-immunoprecipitation was performed. We expressed FLAGhApg3p and hApg7p in COS7 cells (Fig. 4, Expression, lanes 1–3), and FLAGhApg3p in the lysate of the transfectant was immunoprecipitated well with anti-hApg3p antibody (Fig. 4, IP: anti-hApg3, WB: anti-FLAG, lanes 1 and 3). When both FLAGhApg3p and hApg7p were expressed in the cells, hApg7p co-immunoprecipitated with FLAGhApg3p by the anti-hApg3p antibody (Fig. 4, IP: anti-hApg3, WB: anti-hApg7, lane 3). When hApg7p alone was expressed in the cells, hApg7p was not immunoprecipitated by the anti-hApg3p antibody (Fig. 4, IP: anti-hApg3, WB: anti-hApg7, lane 2). The co-immunoprecipitation of hApg7p with hApg3p was confirmed using another hApg3p fusion protein (Fig. 4, GFPhApg3p,lanes 4–6). When GFPhApg3p was expressed in COS7 cells, GFPhApg3p in the lysate immunoprecipitated with anti-hApg3p antibody, whereas GFP itself did not immunoprecipitate with this antibody (Fig. 4, Expression, IP: anti-hApg3, WB: anti-GFP, lanes 4–6). Only when both GFPhApg3p and hApg7p were co-expressed in COS7 cells did hApg7p co-immunoprecipitate with GFPhApg3p using the anti-hApg3p antibody (Fig. 4, IP: anti-hApg3, WB: anti-hApg7, lane 6). Finally, we confirmed the interaction using an anti-hApg7p antibody. When hApg7p was expressed in COS7 cells, the hApg7p immunoprecipitated well with anti-hApg7p antibody (Fig. 4, IP: hApg7, WB: anti-hApg7, lanes 2, 3, 5, and 6). When FLAG-hApg3p or GFP-hApg3p was co-expressed with hApg7p in COS7 cells, they co-immunoprecipitated with hApg7p using the anti-hApg7p antibody (Fig. 4, IP: anti-hApg7, WB: anti-FLAG, WB: anti-GFP, lanes 3and 6). Considering these results, we conclude that hApg3p forms an E1·E2 complex with hApg7p as is the case in yeast. Another characteristic feature of Apg3p is that it also interacts with a second modifier protein, Apg12p, which is a substrate for Apg7p but not for Apg3p in yeast (19.Komatsu M. Tanida I. Ueno T. Ohsumi M. Ohsumi Y. Kominami E. J. Biol. Chem. 2001; 276: 9846-9854Abstract Full Text Full Text PDF PubMed Scopus (81) Google Scholar, 20.Uetz P. Giot L. Cagney G. Mansfield T.A. Judson R.S. Knight J.R. Lockshon D. Narayan V. Srinivasan M. Pochart P. Qureshi-Emili A. Li Y. Godwin B. Conover D. Kalbfleisch T. Vijayadamodar G. Yang M. Johnston M. Fields S. Rothberg J.M. Nature. 2000; 403: 601-603Crossref PubMed Scopus (391) Google Scholar). We then investigated the interaction of hApg3p with hApg12p in mammalian cells by co-immunoprecipitation. We expressed GFPhApg12p and FLAGhApg3p in COS7 cells (Fig. 5, Expression, WB: anti-FLAG, anti-GFP, lanes 1–3). When FLAGhApg3p was expressed in the cells, FLAGhApg3p in the cell lysate immunoprecipitated well with the anti-hApg3p antibody (Fig. 5,IP: anti-hApg3, WB: anti-FLAG, lanes 1 and3). When FLAGhApg3p and GFPhApg12p were expressed together in the cells, GFPhApg12p co-immunoprecipitated with FLAGhApg3p (Fig. 5,IP: anti-hApg3, WB: anti-GFP, lane 3). These results indicate that hApg3p interacts with hApg12p. Recent analyses using murineAPG5 gene-deficient embryonic stem cells revealed that the Apg12p·Apg5p conjugate cooperates sequentially with MAP-LC3 in the formation of a preautophagosomal membrane sac (23.Mizushima N. Yamamoto A. Hatano M. Kobayashi Y. Kabeya Y. Suzuki K. Tokuhisa T. Ohsumi Y. Yoshimori T. J. Cell Biol. 2001; 152: 657-668Crossref PubMed Scopus (1164) Google Scholar). As described in the previous section, hApg3p interacts with both hApg7p and hApg12p (Figs.4 and 5). Considering these interactions, it is interesting to see whether the hApg7p·hApg3p complex and/or the hApg3p·hApg12p complex play some roles in the two conjugation reactions. As reported previously (27.Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar), when both hApg7p and GFPhApg12p were expressed in COS7 cells, the formation of the GFPhApg12p-hApg5p conjugate was recognized (Fig. 6,GFPhApg12p-Apg5p, lane 5). We next examined the effects of the overexpression of hApg3p, hApg12p, and hApg7p in conjugate formation. When GFPhApg3p was expressed together with hApg7p and GFPhApg12p, the amount of the hApg12p·hApg5p conjugate increased significantly (Fig. 6, GFPhApg12p-Apg5p conjugate,lane 7). The carboxyl-terminal Gly in hApg12p is reported to be essential for the formation of the conjugate (22.Mizushima N. Sugita H. Yoshimori T. Ohsumi Y. J. Biol. Chem. 1998; 273: 33889-33892Abstract Full Text Full Text PDF PubMed Scopus (416) Google Scholar). We constructed a mutant hApg12pΔG with a deletion of the carboxyl-terminal Gly. When mutant GFPhApg12pΔG was expressed in cells instead of GFPhApg12p, no conjugate was formed even in the presence of both hApg7p and hApg3p (Fig. 6, lanes 6 and 8). The enhanced conjugate formation is dependent on hApg7p, because when hApg7p was not expressed, the conjugate was not recognized even in the presence of overexpressed hApg3p and hApg12p (Fig. 6, lane 9). These results indicate that the overexpression of hApg3p in addition to hApg12p and hApg7p further facilitates the formation of the hApg12p·hApg5p conjugate. In this study, we show that the human Apg3p homologue is an authentic E2 enzyme for the hApg8p-conjugation system(s), and that human GATE-16, GABARAP, and MAP-LC3, the three hApg8p homologues, are substrates for hApg3p (Table I). We show that hApg3pC264S in which the active-site cysteine is changed to serine can bind to GATE-16, GABARAP, and MAP-LC3 to form stable enzyme-substrate intermediates. The overexpression of hApg7p facilitates this reaction. Overexpressed hApg7p may be required for the efficient activation of overexpressed hApg8p homologues, which is necessary for the accumulation of substantial quantities of hApg3p·hApg8p intermediate via an O-ester bond. Alternatively, overexpressed hApg7p may enhance the formation of the E1·E2 complex with hApg3p, which may facilitate the sequential E2 reaction after the activation of hApg8p homologues by hApg7p. Furthermore, the overexpressed hApg3p facilitates the formation of hApg12p·hApg5p, whereas hApg3p is not an E2 enzyme for hApg12p (Table I).Table ISummary of two conjugation systems in yeast and humanApg12p-conjugation systemModifierE1E2Target YeastApg12pApg7pApg10pApg5p HumanhApg12phApg7pN.I.hApg5pApg8p-lipidation systemModifierE1E2Target YeastApg8pApg7pApg3pPE HumanMAP-LC3hApg7phApg3pN.I.GABARAPGATE-16N.I., not identified. PE, phosphatidylethanolamine. Open table in a new tab N.I., not identified. PE, phosphatidylethanolamine. There are two unique characteristics of hApg3p. 1) It forms an E1-E2 complex with hApg7p. 2) It interacts with hApg12p. More importantly, we showed for the first time that the overexpression of hApg3p together with hApg7p and hApg12p enhances the formation of the hApg12p-hApg5p conjugate. The overexpression of hApg12p and hApg3p in the presence of endogenous hApg7p did not cause an enhancement of conjugate formation. Thus, the enhancement appears to be attributed to the formation of the hApg7p-hApg3p (E1-E2) complex rather than the hApg12p-hApg3p complex. These results strongly suggest that the formation of a complex between hApg7p and hApg3p, two indispensable members of the hApg8p-conjugation system, also plays an important role in the hApg12p-conjugation system. Mizushima et al. (23.Mizushima N. Yamamoto A. Hatano M. Kobayashi Y. Kabeya Y. Suzuki K. Tokuhisa T. Ohsumi Y. Yoshimori T. J. Cell Biol. 2001; 152: 657-668Crossref PubMed Scopus (1164) Google Scholar) reported that the formation of the mApg12p·mApg5p conjugate precedes the lipidation and subsequent targeting of MAP-LC3 to autophagosomal precursors. Our data on the facilitation of the hApg12p-conjugation reaction by hApg3p indicate that there is intimate cross-talk between hApg12p-conjugation and the hApg8p-modification systems in the formation of autophagosomes. To our knowledge, this is the first observation of a cooperative relationship between the two different conjugation systems. In Fig. 7, we present a hypothetical scheme based on our experimental results. Although the precise mechanism by which the hApg7p·hApg3p complex facilitates hApg12p·hApg5p conjugation is still unknown, it is reasonable to assume that it may be possible by the activation of some step(s) in the hApg12p-conjugation pathway. For example, hApg7p complexed with hApg3p may be more active as an E1 enzyme than uncomplexed hApg7p. It is also possible that the presumptive hApg10p may be directly or indirectly involved in this mechanism. So far, authentic hApg10p has not been identified (Table I). We are now attempting to isolate and characterize an hApg10p homologue. In summary, hApg3p, which interacts with hApg12p on the one hand, forms an E1-E2 complex with hApg7p on the other and functions as a facilitating factor in the hApg12p-conjugation system in addition to an authentic E2 enzyme for hApg8p homologues. An enhanced level of the hApg12p-hApg5p conjugate in turn promotes the recruitment of the lipidated form of MAP-LC3 onto autophagosomal membranes. In the end, the activation of hApg12p-conjugation by the hApg7p-hApg3p complex promotes hApg8p-conjugation reaction. Thus, the two autophagic conjugation systems, which comprise the one activation enzyme (E1, hApg7p) in common, two distinct E2 enzymes (hApg3p and hApg10p) and four different modifiers (hApg12p and three hApg8p homologues) interact and cooperate with each other. GATE-16, which interacts with NSF and 28 kDa Golgi SNARE protein, is localized in the Golgi and is expressed in the largest amounts in brain (26.Sagiv Y. Legesse-Miller A. Porat A. Elazar Z. EMBO J. 2000; 19: 1494-1504Crossref PubMed Scopus (209) Google Scholar). GABARAP is a GABAA-receptor-associated protein that co-localizes with the GABAA receptor in cultured cortical neurons and interacts with gephyrin (24.Wang H. Bedford F.K. Brandon N.J. Moss S.J. Olsen R.W. Nature. 1999; 397: 69-72Crossref PubMed Scopus (491) Google Scholar, 28.Kneussel M. Haverkamp S. Fuhrmann J.C. Wang H. Wassle H. Olsen R.W. Betz H. Proc. Natl. Acad. Sci. U. S. A. 2000; 97: 8594-8599Crossref PubMed Scopus (154) Google Scholar). MAP-LC3 is localized on autophagosomal membranes (25.Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5510) Google Scholar). Considering the divergent functions and intracellular localizations of the three Apg8p homologues, it is surprising that all three hApg8p homologues, MAP-LC3, GATE-16, and GABARAP, are substrates for hApg3p. The affinity of hApg3p for these substrates differs from that of hApg7p. hApg3p preferentially conjugates with MAP-LC3 in COS7 cells, whereas hApg7p conjugates almost equally with each of the hApg8p homologues. What are the implications of the difference in substrate specificity between the E1 and E2 enzymes? The higher affinity of hApg3p for MAP-LC3 is coincident with the autophagosomal localization of MAP-LC3 considering the function of hApg3p in autophagy (25.Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5510) Google Scholar). With regard to GATE-16 and GABARAP, it is possible that there is another Apg3p homologue specific for GATE-16 and/or GABARAP. But no further candidate was obtained from further BLAST search on the EST data base and 5′-RACE, and genomic Southern analysis of the murine genome suggests that there are no further Apg3p homologues. 2M. Komatsu, I. Tanida, T. Ueno, and E. Kominami, unpublished results. Another possibility is that there is a cofactor or E3-like complex that determines the specificity for substrates. In COS7 cells, MAP-LC3 is expressed, whereas little GABARAP or GATE-16 is expressed. 3I. Tanida and E. Kominami, unpublished results. The expression of each of the hApg8p homologues in mammalian tissues and cultured cell lines is diverse, whereas hApg7p and hApg3p are expressed ubiquitously. 4I. Tanida, T. Ueno, and E. Kominami, unpublished results. In some cases of ubiquitylation, an E3 complex specifies the target protein. It is probable that there is a regulatory factor(s) that facilitates the conjugation of hApg3p with MAP-LC3 in COS7 cells. We are now investigating whether there is a regulatory factor or not by co-immunoprecipitation using anti-hApg3p antibody. Considering the divergent functions and intracellular localizations of the three Apg8p homologues, MAP-LC3, GABARAP, and GATE-16, it is necessary to determine the final target of each hApg8p homologue and to investigate the regulatory system. Recent findings suggest that the Apg machinery plays an important role at least in brain and in cardiac and skeletal muscles. Clinical and biochemical analyses of a group of severe inheritable neurodegenerative disorders and X-linked vacuolar cardiomyopathy, myopathy in humans, and lysosome-associated membrane glycoprotein-deficient mice have also suggested that lysosomal degradation via autophagy occurs actively during neuronal development and in normal mammalian bodies (33.Gardiner R.M. J. Inherit. Metab. Dis. 1993; 16: 787-790Crossref PubMed Scopus (6) Google Scholar, 34.Bennett M.J. Hofmann S.L. J. Inherit. Metab. Dis. 1999; 22: 535-544Crossref PubMed Scopus (50) Google Scholar, 35.Tanaka Y. Guhde G. Suter A. Eskelinen E.L. Hartmann D. Lullmann-Rauch R. Janssen P.M. Blanz J. von Figura K. Saftig P. Nature. 2000; 406: 902-906Crossref PubMed Scopus (734) Google Scholar, 36.Saftig P. von Figura K. Tanaka Y. Lullmann-Rauch R. Mol. Med. Today. 2001; 7: 37-39Scopus (90) Google Scholar). We will investigate these problem using murine APG3 and APG7 homologue knock-out mice. We thank Drs. Y. Ohsumi, T. Yoshimori, T. Noda, Y. Ichimura, K. Kirisako (National Institute for Basic Biology, Okazaki, Japan), N. Mizushima (PRESTO, Kawaguchi, Japan), and D. J. Klionsky (University of California, Davis, CA) for significant discussion and information, and Drs. K. Ishidoh, J. Ezaki, and D. Muno (Juntendo University, Tokyo, Japan) for helpful discussion. We also thank Margaret Dooley-Ohto for editing language of the manuscript. AB079384

Human light chain 3/MAP1LC3B, an autophagosomal ortholog of yeast Atg8, is conjugated to phospholipid (PL) via ubiquitylation-like reactions mediated by human Atg7 and Atg3.Since human Atg4B was found to cleave the carboxyl terminus of MAP1LC3B in vitro, we hypothesized that this exposes its carboxyl-terminal Gly 120 .It was recently reported, however, that when Myc-MAP1LC3B-His is expressed in HEK293 cells, its carboxyl terminus is not cleaved.(Tanida, I.,

Peroxisomes are degraded by autophagic machinery termed "pexophagy" in yeast; however, whether this is essential for peroxisome degradation in mammals remains unknown. Here we have shown that <i>Atg7</i>, an essential gene for autophagy, plays a pivotal role in the degradation of excess peroxisomes in mammals. Following induction of peroxisomes by a 2-week treatment with phthalate esters in control and <i>Atg7</i>-deficient livers, peroxisomal degradation was monitored within 1 week after discontinuation of phthalate esters. Although most of the excess peroxisomes in the control liver were selectively degraded within 1 week, this rapid removal was exclusively impaired in the mutant liver. Furthermore, morphological analysis revealed that surplus peroxisomes, but not mutant hepatocytes, were surrounded by autophagosomes in the control. Our results indicated that the autophagic machinery is essential for the selective clearance of excess peroxisomes in mammals. This is the first direct evidence for the contribution of autophagic machinery in peroxisomal degradation in mammals.

Microbiology and ImmunologyVolume 55, Issue 1 p. 1-11 REVIEWFree Access Autophagy basics Isei Tanida, Isei Tanida Department of Biochemistry and Cell Biology, National Institute of Infectious Diseases, Toyama, Shinjyuku, Tokyo 162-8640, JapanSearch for more papers by this author Isei Tanida, Isei Tanida Department of Biochemistry and Cell Biology, National Institute of Infectious Diseases, Toyama, Shinjyuku, Tokyo 162-8640, JapanSearch for more papers by this author First published: 27 September 2010 https://doi.org/10.1111/j.1348-0421.2010.00271.xCitations: 167 Correspondence Isei Tanida, Department of Biochemistry and Cell Biology, National Institute of Infectious Diseases, 1-23-1, Toyama, Shinjyuku, Tokyo 162-8640, Japan.Tel: +81 3 5285 1111 (ext. 2126), fax: +81 3 5285 1157; email: tanida@nih.go.jp AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinked InRedditWechat ABSTRACT Autophagy (macroautophagy) is a dynamic process for degradation of cytosolic components. Autophagy has intracellular anti-viral and anti-bacterial functions, and plays a role in the initiation of innate and adaptive immune system responses to viral and bacterial infections. Some viruses encode virulence factors for blocking autophagy, whereas others utilize some autophagy components for their intracellular growth or cellular budding. The "core" autophagy-related (Atg) complexes in mammals are ULK1 protein kinase, Atg9-WIPI-1 and Vps34-beclin1 class III PI3-kinase complexes, and the Atg12 and LC3 conjugation systems. In addition, PI(3)-binding proteins, PI3-phosphatases, and Rab proteins contribute to autophagy. The autophagy process consists of continuous dynamic membrane formation and fusion. In this review, the relationships between these Atg complexes and each process are described. Finally, the critical points for monitoring autophagy, including the use of GFP-LC3 and GFP-Atg5, are discussed. List of Abbreviations: ATG autophagy-related genes Atg autophagy-related gene products ATP adenosine triphosphate beclin1 autophagy-related bcl2-interacting Atg6 homolog DFCP1 d ouble F YVE domain-containing p rotein 1 ER endoplasmic reticulum GABARAP GABAA-receptor associated protein GATE-16 Golgi-associated ATPase enhancer of 16 kDa GFP-LC3 LC3 fused to green fluorescent protein LC3 wild-type human microtubule-associated protein 1 light chain 3 LC3-I soluble unlipidated form of LC3 LC3-II LC3-phospholipid conjugate mRFP monomeric red fluorescent protein MTMR myotubularin-related protein PE phosphatidylethanolamine PI3-kinase phosphoinositide 3-kinase PI(3)P phosphatidylinositol 3-phosphate V-ATPase vacuolar-type H+-ATPase WIPI WD-repeat protein interacting phosphoinositides The term "autophagy" is derived from the Latin words for "self" and "eating." Macroautophagy (here referred to simply as "autophagy") is essential for tissue and cell homeostasis, and defects in autophagy are associated with many diseases, including neurodegenerative diseases, cardiomyopathy, tumorigenesis, diabetes, fatty liver, and Crohn's disease (1-3). Autophagy is a bulk degradation system that accompanies the dynamic processes of omegasome formation, initiation and elongation of the isolation membrane, autophagosome formation, autophagosome-lysosome fusion, and degradation of intra-autophagosomal contents by lysosomal hydrolases (Fig. 1) (4-6). Autophagy has an intracellular anti-viral function, the targeting of viral components or virions to degrade them via the lysosomes during viral infection; it also plays a role in the initiation of innate and adaptive immune system responses to viral infections (7-12). Some viruses encode virulence factors that interact with the host autophagy machinery and block autophagy. In contrast, other viruses utilize some autophagy components to facilitate their intracellular growth or cellular budding. Figure 1Open in figure viewerPowerPoint Schematic model of Atg complexes during autophagy. The ULK1-Atg13-FIP200-Atg101 complex is activated via the mTor kinase signaling pathway to induce autophagy (Initiation). Following the induction of autophagy, an omegasome is formed from the ER by association with DFCP1. Two PI(3)P-phosphatases, Jumpy and MTMR3, are negative regulators of this process. Next is the formation of an isolation membrane, which elongates to engulf cytoplasmic components, including mitochondria and endoplasmic reticulum (Elongation). Association with the Atg5-Atg12-Atg16L complex forms the isolation membrane. LC3-II localizes to the elongated isolation membrane at the latter step of autophagosome formation, while the Atg5-Atg12-Atg16L complex dissociates from it. Finally, the isolation membrane is enclosed to form an autophagosome (Maturation). After autophagosome formation, the lysosome fuses with the autophagosome (Autophagosome-lysosome fusion) to form an autolysosome. Intra-autophagosomal contents are degraded by lysosomal hydrolases (Degradation). After formation of the autolysosome, the lysosomal hydrolases degrade the intra-autophagosomal contents, including LC3-II. All of these events occur within 10–15 min. After degradation, the protolysosome is elongated from the autolysosome. Taking advantage of yeast genetics, autophagy-defective (atg/apg/aut) mutants of Saccharomyces cerevisiae were isolated in 1993 (the nomenclature of autophagy related genes has been unified to ATG) (13, 14). The ATG (A uT ophaG y-related) genes were later isolated and characterized (Table 1) (5, 13, 15). Most ATG genes contribute to autophagosome formation, many being well conserved from yeast to mammals. Although the molecular mechanisms and cellular functions of mammalian autophagy were being elucidated within a decade, our molecular understanding of autophagy is still far from complete. In this review, we describe the molecular mechanism of action of mammalian Atg proteins and their cellular functions in autophagy. Table 1. Atg genes essential for "core" autophagy in mammals Mammals Yeasts Comments References ULK1 protein kinase complex ULK1 ATG1 Protein kinase, target of mTor kinase (16) ATG13/APG13 ATG13 Phosphorylated protein, target of mTor kinase (33) FIP200 ATG17 Essential for both stability and phosphorylation of ULK1 (31) ATG101 Important for stability and basal phosphorylation of Atg13 and ULK1, conserved from S. pombe to mammals (34, 35) Atg9-WIPI1 complex ATG9A, B ATG9 Membrane-protein (18, 42) WIPI-1,2,3,4 ATG18 PI(3)P binding protein (30, 45) Vps34-beclin1 class III PI3-kinase complex PIK3C3/VPS34 VPS34 PI3 kinase that interacts with Rab5 and Rab7 (101) PIK3R4/VPS15 VPS15 Core activator of the Vps34 PI3 kinase complex (101) BECN1 ATG6 Beclin1, one of the core subunits, bcl2-interacting protein (17, 102) ATG14 ATG14 Enhancer of autophagosome formation (27, 102) UVRAG VPS38 Enhancer of autophagosome-lysosome fusion and endocytic traffic (26) Rubicon Negative regulator of autophagosome-lysosome fusion and endocytic traffic (28, 29) AMBRA1 WD40 domain containing a positive regulator of autophagy (40) Atg12 conjugation ATG12 ATG12 Modifier conjugates with Atg5 (21, 22) ATG5 ATG5 Target of Atg12 localizing to isolated membranes (21, 22) ATG16L1,L2 ATG16 Atg16L determines the site of LC3 conjugation (54, 56) ATG7 ATG7 E1-like enzyme for Atg12 and LC3/Atg8 conjugation (21, 48, 51) ATG10 ATG10 E2-like enzyme for Atg12 conjugation (49, 53) LC3/Atg8 conjugation MAP1LC3B/LC3B ATG8 Modifier conjugating with PE and localizing to autophagosomes, LC3-A and LC3-C are isoforms (23) GABARAP ATG8 Modifier, GABAA-receptor associating protein (103) GATE-16 ATG8 Modifier, Golgi-associated ATPase enhancer of 16 kDa (104) GABARAPL1 ATG8 Modifier, myotube-differentiation-specific (57) ATG7 ATG7 E1-like enzyme for Atg12 and Atg8/LC3 conjugation (48, 51) ATG3 ATG3 E2-like enzyme for Atg12 and Atg8/LC3 conjugation (24, 58) ATG4A-D (autophagins 1–4) ATG4 Cytosolic cysteine protease for processing and recycling of Atg8/LC3 (24, 98) PI(3)P-related proteins ALFY/WDFY3 FYVE-domain-containing protein associated with protein granules and autophagic membranes (70) DFCP1/ZFYVE1 Double FYVE-domain containing protein1, omegasome-localization for autophagosome-initiation (105) FYCO1 Rab7 effector binding to LC3 and PI(3)P and mediating microtubule plus end directed vesicle transport (74) MTMR14 Jumpy, PI3P phosphatase, negative regulator of autophagosome-initiation (66) MTMR3 PI3P phosphatase, negative regulator of autophagosome-initiation (67) "CORE" AUTOPHAGY-RELATED COMPLEXES IN MAMMALS In mammals, the "core" Atg proteins are divided into five subgroups: the ULK1 protein kinase complex (16), Vps34-beclin1 class III PI3-kinase complex (17), Atg9-WIPI-1 complex (18-20), Atg12 conjugation system (21, 22), and LC3 conjugation system (23, 24). Autophagy is impaired without any of these "core" Atg gene products, indicating that a sequential reaction of many protein complexes, including kinases, phosphatases, lipids, and ATP-dependent conjugation, are indispensable for the whole process of autophagy. Upstream of the autophagy machinery, class I PI3-kinase and mTor kinase contribute to the induction of autophagy (25). The Vps34-beclin1 class III PI3-kinase complex is divided into at least three types, the Atg14-Vps34-Vps15-beclin1, UVRAG-Vps34-Vps15-beclin1, and Rubicon-UVRAG-Vps34-Vps15-beclin1 complexes (26-29). Each complex contributes to a different function during autophagy. The Atg9-WIPI-1 complex is composed of an Atg9 membrane-protein and WIPI-1 (18, 30). Two ubiquitylation-like reactions, the Atg12 and LC3 conjugation systems, are essential for the initiation and formation of autophagosomes (Fig. 1, Initiation, elongation, and maturation). ULK1 PROTEIN KINASE COMPLEX The ULK1 protein kinase complex is composed of ULK1 (a protein kinase), Atg13, FIP200, and Atg101 (Fig. 1, Initiation) (16, 31-35). The mTOR kinase directly phosphorylates Atg13 to negatively regulate autophagy (33). Atg101 is important for the stability and basal phosphorylation of Atg13 and ULK1 (34, 35). FIP200 is important for the stability and phosphorylation of ULK1 (31). Considering that Atg13 is responsible for recruitment of Atg14 to the pre-autophagosomal structure in yeasts (36), it is possible that the ULK1-Atg13-FIP200-Atg101 complex interacts with the Atg14-Vps34 class III PI3-kinase complex in mammals. VPS34-BECLIN1 CLASS III PI3-KINASE COMPLEX The Vps34-beclin1 complex is a core complex of class III PI3-kinase (37). In mammals, at least three types of class III PI3-kinase complex contribute to autophagy (26-29, 38, 39). The Atg14-Vps34-Vps15-beclin1 complex is essential for autophagosome formation (Fig. 1, Initiation and elongation), and the UVRAG-Vps34-Vps15-beclin1 complex functions positively in autophagosome maturation and endocytic traffic (Fig. 1, Autophagosome-lysosome fusion) (27, 39). In contrast, the Rubicon-UVRAG-Vps34-Vps15-beclin1 complex negatively regulates autophagosome-maturation and endocytic traffic (Fig. 1, Autophagosome-lysosome fusion) (28). Ambra1, a protein containing a WD40 domain that activates beclin1-regulated autophagy, regulates autophagy and has a crucial role in embryogenesis (40). In sensory neurons, Vps34-independent autophagy has been reported as a non-canonical autophagy pathway (41). ATG9-WIPI-1 COMPLEX Based on the findings in yeast, the Atg9-WIPI-1 complex is considered to be composed of Atg9, hypothetical Atg2 and WIPI-1 (PI[3]P-binding protein) in mammals. Atg9 is the only integral membrane protein in yeasts (42, 43); its mammalian homologs are Atg9/mAtg9/Atg9L1 (ubiquitous expression) and Atg9L2 (expressed specifically in the placenta and pituitary gland) (18). Under nutrient-rich conditions Atg9 is localized to the trans-Golgi network and partial endosomes, whereas under starvation conditions it is localized to autophagosomes in a process dependent on ULK1 (18). WIPI-1 is also localized to the autophagosome during autophagy (Fig. 1, Elongation) (20, 44). Atg18, a yeast homolog of WIPI-1, constitutively interacts with yeast Atg2 in yeasts, and yeast Atg9 interacts with the Atg2-Atg18 complex during autophagy (45). According to the findings obtained with the yeast Atg9-model, mammalian Atg9 may interact with the Atg2-WIPI-1 complex during autophagy. Atg27 is required for autophagy-dependent cycling of Atg9 in yeasts (46). No mammalian homologs of Atg2 and Atg27 have yet been identified. ATG12 CONJUGATION SYSTEM: THE FIRST UBIQUITYLATION-LIKE REACTION The Atg12 conjugation system, the first ubiquitylation-like reaction, is essential for formation and elongation of the isolation membrane (Fig. 1, Initiation and elongation, Atg12-Atg5-Atg16 complex) (47). Although the amino acid sequences of Atg12 and ubiquitin are dissimilar, Atg12 does possess a ubiquitin fold (21). In the Atg12 conjugation system, Atg12 is activated by Atg7, an E1-like enzyme; transferred to Atg10, an E2-like enzyme, and conjugated to Atg5 to form Atg12-Atg5 conjugates (Fig. 2, Wild-type Atg12 and Atg5) (21, 22, 48-50). As in ubiquitin, the carboxyl terminal Gly of Atg12 is essential for the formation of thioester bonds with the active site Cys residues of Atg7 and Atg10, and is also essential for the formation of amide bonds with the Lys130 residues in Atg5 (21, 48, 49, 51-53). Therefore, Atg12 is a modifier that has a structural ubiquitin fold. Atg16 interacts with Atg5, forming a multimeric complex (54-56). In many tissues and cell lines, most endogenous Atg5 and Atg12 are present as the Atg12-Atg5 conjugate, and little increase in the amount of Atg12-Atg5 conjugate is observed during autophagy. Figure 2Open in figure viewerPowerPoint Atg12 conjugation, LC3 conjugation, and mutant Atg proteins that affect these conjugation reactions. Atg12 is activated by Atg7, an E1-like enzyme, and Atg10, an E2-like enzyme, and conjugated to Atg5 to form the Atg12-Atg5 conjugate (Wild-type Atg12 and Atg5). Atg16 interacts with the Atg12-Atg5 conjugate. The Atg12-Atg5-Atg16 complex is indispensable for the LC3 lipidation (dashed arrow). Atg5K130R mutant, in which Lys130 is changed to Arg, is unable to conjugate to Atg12. Atg12ΔG lacking the carboxy-terminal Gly is also unable to conjugate to Atg5. Therefore, Atg5K130R and Atg12ΔG are employed as negative controls of Atg5 and Atg12, respectively. As a second conjugation reaction, LC3 is synthesized as proLC3 (Wild-type LC3). proLC3 is cleaved by Atg4B, a cysteine protease, to expose Gly at the carboxy terminus. The cleaved form of LC3 is LC3-II (cytosolic form). LC3-I is activated by Atg7, the same E1-like enzyme, and Atg3, a second E2-like enzyme, to conjugate to PE. The LC3-PE conjugate is LC3-II, a membrane-bound form. Because a mutant LC3ΔG lacking the essential Gly produces defects in cleavage and conjugation, this mutant is used as a negative control of LC3. Atg4BC74A is used as a dominant negative mutant to inhibit autophagy, as it dominantly inhibits the initial cleavage and recycling steps in LC3 conjugation. LC3 LIPIDATION: SECOND UBIQUITYLATION-LIKE REACTION The second ubiquitin-like conjugation system, the LC3 conjugation system, is unique in that its target is a phospholipid, PE (23, 24). Therefore, the LC3 conjugation system has been called LC3-lipidation. To date, at least four mammalian Atg8 homologs have been identified: LC3/MAP1-LC3/LC3B (microtubule-associated protein 1 light chain 3), GABARAP, GATE-16, and Atg8L (4, 57). LC3 is the best characterized of these proteins, and LC3-II is regarded as a promising autophagosome marker (Fig. 1, Maturation, LC3-II) (23). LC3 is synthesized as proLC3, which is cleaved by Atg4B to form LC3-I, with the carboxyl terminal Gly exposed (Fig. 2, Wild-type LC3) (23). LC3-I is activated by Atg7, transferred to Atg3, and finally conjugated to PE (51, 58). The carboxy-terminal Gly of LC3 is also essential for the formation of a thioester bond with the active site Cys residues of Atg7 and Atg3, and for the formation of an amide bond with PE (59, 60). With regard to GABARAP, GATE-16, and mAtg8L, the reactions mediated by Atg7 and Atg3 are similar to those of LC3. Both these Atg8 homologs and yeast Atg8 also have a ubiquitin fold, as is the case with Atg12, however their amino acid sequences are dissimilar from those of Atg12 and ubiquitin. Therefore, these Atg8 homologs are second modifiers activated by Atg7 and Atg10. Because LC3-I is localized in the cytosol and LC3-II to autophagosomes (Fig. 1, Elongation and maturation) (23), LC3-II is a promising autophagosomal marker in mammals. LC3-II on the cytoplasmic surface of autophagosomes is delipidated by Atg4B to recycle LC3-I for further autophagosome formation (Fig. 1, Autophagosome-Lysosome fusion). In contrast to what occurs with Atg12-Atg5 conjugate, the amount of endogenous LC3-II changes during autophagy. RELATIONSHIP BETWEEN ATG12 CONJUGATION AND LC3 LIPIDATION Atg12 conjugation is closely related to LC3 lipidation. Atg5 deficiency results in a defect in LC3 lipidation (47, 61). The yeast Atg12-Atg5 conjugate functions in vitro as an E3-like enzyme for Atg8 lipidation (62). Mammalian Atg16L determines the site of autophagosome formation (63). Therefore, the Atg12-Atg5-Atg16 complex may function as an E3-ligase complex to facilitate LC3 lipidation complex (Fig. 2, dashed arrow). Lack of Atg3 in mammals leads to a decrease in the Atg12-Atg5 conjugate as well as impairing LC3 lipidation (64), and is associated with defective autophagosome formation, including defects in elongation and complete closure of the isolation membranes, resulting in malformed autophagosomes. In cells lacking Atg3, Atg16L and Atg5 are localized to elongated isolation membranes/incomplete autophagosomes, suggesting that elongation of the isolation membrane can occur in the absence of LC3 lipidation (64). Thus, in addition to its potential E3-like function, the Atg12-Atg5-Atg16 complex may function in the elongation of isolation membranes. INITIAL STEP OF AUTOPHAGY (LC3-II INCREASING STEP): OMEGASOME AND AUTOPHAGOSOME FORMATION Autophagy is divided into six steps; omegasome formation, initiation of isolation membranes, elongation of the isolation membrane, autophagosome formation, autophagosome-lysosome fusion, and degradation (Fig. 1). The ULK1-protein kinase complex activates autophagic signaling via the mTor-signaling pathway when autophagy is induced (Fig. 1, Initiation) (33, 32). The omegasome, which is shaped like the Greek letter omega (Ω), is first formed from the ER. A PI(3)P-binding protein, DFCP1, is localized to PI(3)P on the omegasome under starvation conditions (Fig. 1, Initiation, DFCP1), but localizes to the ER and Golgi under nutrient-rich conditions. The Atg14-Vps34-beclin1 PI3-kinase complex positively regulates DFCP1-positive omegasome formation (Fig. 1, Initiation, omegasome) (65). After omegasome formation, the isolation membrane (also called the pre-autophagosome or phagophore) is formed inside the ring of the omegasome (Fig. 1, Initiation, isolation membrane), and the Atg12-Atg5-Atg16 complex is localized to the isolation membrane (Fig. 1, Elongation, Atg12-Atg5-Atg16 complex) (47, 54, 55). The protein Atg9, WIPI-1, the ULK1 protein kinase complex, and the Atg14-Vps34-beclin1 PI3-kinase complex are also localized to the isolation membrane (Fig. 1, Elongation). DFCP1 itself, however, is probably not required for autophagosome formation. Two PI(3)P-phosphatases (Jumpy [also known as MTMR14] and MTMR3) negatively regulate formation of the omegasome and the isolation membrane (Fig. 1, Elongation) (66, 67). The Atg12-Atg5-Atg16 complex-localized isolation membrane elongates to engulf cytoplasmic components. In the later stages of isolation membrane elongation, the Atg12-Atg5-Atg16 complex progressively dissociates from the isolation membrane, whereas LC3-II is gradually localized to both sides of this membrane (Fig. 1, Elongation) (47). Finally, the isolation membrane closes to form the autophagosome (Fig. 1, Maturation). While LC3-II is localized to autophagosomes, most of the Atg12-Atg5-Atg16 complex dissociates from the autophagosome (47). During this process, LC3-II is increased. Rab32 and Rab33B also contribute to elongation of the isolation membrane (68, 69). Alfy, a PI(3)P-binding FYVE domain-containing protein, has been found to localize with autophagosomes and protein granules (70). Functional multivesicular bodies are required for Alfy-mediated clearance of protein aggregates via autophagy (71). SUBSEQUENT STEP OF AUTOPHAGY (LC3-II DECREASING STEP): AUTOPHAGOSOME-LYSOSOME FUSION AND DEGRADATION Soon after autophagosome formation, its outer membrane fuses with the lysosome to form the autolysosome, a process requiring Rab7 (Fig. 1, Autophagosome-lysosome fusion) (72, 73). Following autolysosome formation, Atg4B delipidates LC3-II on the cytosolic surface to recycle LC3-I (Fig. 1, Autophagosome-lysosome fusion, Atg4B). The FYVE and coiled-coil domain-containing protein FYCO1 functions as a Rab7 effector, binding to LC3 and PI3P and mediating microtubule plus end-directed vesicle transport (74). The fusion of autophagosomes and lysosomes is positively regulated by the UVRAG-Vps34-beclin1 PI3-kinase complex and negatively regulated by the Rubicon-UVRAG-Vps34-beclin1 PI3-kinase complex (Fig. 1, Autophagosome-lysosome fusion) (26-29, 38). Following autolysosome formation, the lysosomal hydrolases, including cathepsins, lysosomal glycolytic enzymes, and lipases, degrade the intra-autophagosomal contents. In this step cathepsins degrade LC3-II on the intra-autophagosomal surface (Fig. 1, Degradation) (75, 76). In yeasts, Atg15, a vacuolar lipase, and Atg22, a vacuolar membrane protein, are indispensable for the specific degradation of autophagic bodies (77-79). No mammalian homologs of yeast Atg15 and Atg22 have yet been identified. During conversion by Atg4B of LC3-II to LC3-I on the cytoplasmic face of the autophagosome and degradation by lysosomal hydrolases of LC3-II on the luminal face of autophagosome, LC3-II decreases. After digestion of intra-autophagosomal contents, a lysosomal-associated membrane protein 1 -positive and LC3-negative tubular structure, the protolysosome, is elongated from the autolysosome (Fig. 1, Protolysosome) (80). The protolysosome finally forms a vesicle, and matures into the lysosome by accumulating of lysosomal hydrolases. ESTIMATION OF AUTOPHAGY: YIN AND YANG It is necessary to estimate autophagic activity accurately and quantitatively when studying autophagy in infection and immune responses. LC3-II and LC3-positive puncta are recognized as promising autophagosome and autolysosome markers (but not "autophagy" markers). However, autophagosomes and autolysosomes are transient structures during autophagy. Therefore, the amount of LC3-II (or number of LC3-positive puncta) alone does not always reflect autophagic activity. Production of LC3-II is increased when autophagy is activated (Fig. 1, Maturation), in addition lysosomal degradation of LC3-II and delipidation of LC3-II by Atg4B are simultaneously activated (Fig. 1, Autophagosome-lysosome fusion). Many methods for monitoring autophagy, including GFP-LC3, tf-LC3, and LC3-II turnover assay, have been proposed, these have both advantages and disadvantages. Recently, critical issues and guidelines for monitoring autophagy have been described (81-83). LC3 FUSED TO GREEN FLUORESCENT PROTEIN AND ITS NEGATIVE CONTROL FOR ESTIMATION OF AUTOPHAGY LC3 fused to green fluorescent protein is useful for in vivo imaging of autophagosome formation (84, 85). However, caution must be exercised due to the limitations of GFP-LC3 (86, 87). GFP-LC3 tends to form puncta in cells independent of autophagy, and GFP fluorescence in lysosomes may occur even after degradation of the LC3 moiety. Therefore, this method tends to overestimate the number of autophagosomes. These problems may be avoided by using a mutant, GFP-LC3ΔG which lacks the essential carboxy-terminal Gly of LC3, as a negative control (Fig. 2, LC3ΔG). GFP-LC3 transgenic mice, however, can be used to study autophagy in many tissues outside the brain (84, 88). ATG5, ATG12, AND NEGATIVE CONTROLS FOR STUDYING THEIR FUNCTIONS IN AUTOPHAGY Endogenous Atg5 and Atg12 are mainly present as the Atg12-Atg5 conjugate, this conjugate being essential for autophagy. Therefore, when Atg5 and Atg12 are analyzed using an expression plasmid(s), negative controls should be used. The Lys130 within human Atg5 is essential for Atg12 conjugation (Fig. 2, Wild-type Atg12 and Atg5). An Atg5K130R mutant, in which essential Lys130 has been changed to Arg, has a defect in conjugate formation resulting in a defect of autophagosome formation (Fig. 2, Atg5K130R) (47). Therefore, mutant Atg5K130R is suitable as a negative control for Atg5. The carboxy-terminal Gly within Atg12 is also essential for formation of the Atg12-Atg5 conjugate. A mutant Atg12ΔG lacking the carboxy-terminal Gly within Atg12 has defects in E1-like and E2-like reactions with Atg7 and Atg3, respectively (Fig. 2, Atg12ΔG) (58, 51). Therefore, mutant Atg12ΔG is also suitable as a negative control for Atg5. It is necessary to use these negative controls to clarify whether the functional interaction between Atg5 (or Atg12) and a target protein is related to the conjugate, that is, to autophagy. TANDEM FLUORESCENT PROTEIN-LC3-COLOR CHANGE ASSAY The mRFP-GFP-tandem fluorescent protein-LC3-color change assay is based on a difference between GFP and mRFP in pH stability (89, 90). Autophagosomes have a pH similar to that of the cytosol, while autolysosomes have an acidic pH. At an acidic pH, the fluorescence of mRFP is stable, while that of GFP decreases. Therefore, the merged color of mRFP-GFP-LC3 in autophagosomes is yellow, while that in autolysosomes is red (89). This assay is suitable for real-time (and short-term) monitoring of autophagy, but care should be taken when using it in long-term monitoring of this process. Fluorescence derived from GFP in the lysosomes has been observed even after degradation of LC3 (87). LC3-PHOSPHOLIPID CONJUGATE TURNOVER ASSAY The amount of LC3- II increases during autophagosome formation, an initial step in autophagy, while LC3-II decreases during autophagosome-lysosome fusion and degradation of intra-autophagosomal contents by lysosomal hydrolases. Therefore, it is difficult to judge whether a transient assessment of LC3-II by immunoblotting represents activation or impairment of autophagy. To resolve this issue, the LC3-II turnover assay, a measure of autophagic flux in which LC3-II is assayed by immunoblotting with anti-LC3 antibody in the presence and absence of lysosomal inhibitors, is employed (76). A mixture of E64d (a membrane-permeable inhibitor of cathepsins B, H, and L) and pepstatin A (a membrane-permeable inhibitor of cathepsins D and E) is used to inhibit lysosomal function (91). Treatment of cells with this inhibitor cocktail results in significant accumulation of autolysosomes (and LC3-II dots) because there is little degradation of their contents. Thus, the accumulation of LC3-II reflects the activity of the process of delivering LC3-II into lysosomes, that is, autophagic flux. Fluorescent microscopic assays of LC3-positive puncta in the presence and absence of the lysosomal inhibitor cocktail may also be useful. Methods for immunoblotting and immunostaining of endogenous LC3 have been described (76). Bafilomycin A1 (an inhibitor of V-ATPase) is also used to inhibit autophagy and to estimate the autophagic flux of LC3-II. As V-ATPase contributes to the acidification of other organelles, including the Golgi and endosomes, bafilomycin A1 may show multiple off-target effects (92, 93). INCREASE OF UBIQUITYLATED PROTEINS AND A PROTEIN ESSENTIAL FOR SELECTIVE AUTOPHAGY, P62/SQSTM1, IN IMPAIRMENT OF AUTOPHAGY p62 has ubiquitin-binding and LC3-binding domains, and binds to ubiquitylated protein aggregates to degrade them selectively via autophagy (94-96). When autophagy is impaired, p62 increases in cells and tissues (94, 97). At the same time, ubiquitin-positive aggregates accumulate. Ubiquitin-positive and p62-positive aggregates are observed in brains in some neurodegenerative diseases and in other autophagy-defective tissues. Therefore, accumulation of p62 and ubiquitin-positive proteins suggests the possibility of impairment of autophagy. A DOMINANT NEGATIVE ATG4B MUTANT FOR INHIBITION OF AUTOPHAGY Atg4B is a cysteine protease which is essential for conversion of proLC3 to LC3-I and for delipidation of LC3-II (Figs 1 and 2) (98). A mutant Atg4BC74A, in which the active site Cys74 is changed to Ala, produces defects in conversion and delipidation (Fig. 2, Atg4BC74A) (99, 100). Because overexpression of the mutant Atg4BC74A results in inhibition of LC3 lipidation, that is, in autophagy, the mutant is employed as a dominant negative mutant. CONCLUDING REMARKS Autophagy is a bulk process of degradation of cytoplasmic components, including organelles. The pathophysiological functions of autophagy are becoming clear; however, our understanding of autophagy machinery, and methods for monitoring autophagy, are somewhat less than

In yeast, phosphatidylethanolamine is a target of the Atg8 modifier in ubiquitylation-like reactions essential for autophagy. Three human Atg8 (hAtg8) homologs, LC3, GABARAP, and GATE-16, have been characterized as modifiers in reactions mediated by hAtg7 (an E1-like enzyme) and hAtg3 (an E2-like enzyme) as in yeast Atg8 lipidation, but their final targets have not been identified. The results of a recent study in which COS7 cells were incubated with [14C]ethanolamine for 48 h suggested that phosphatidylethanolamine is a target of LC3. However, these results were not conclusive because of the long incubation time. To identify the phospholipid targets of Atg8 homologs, we reconstituted conjugation systems for mammalian Atg8 homologs in vitro using purified recombinant Atg proteins and liposomes. Each purified mutant Atg8 homolog with an exposed C-terminal Gly formed an E1-substrate intermediate with hAtg7 via a thioester bond in an ATP-dependent manner and formed an E2-substrate intermediate with hAtg3 via a thioester bond dependent on ATP and hAtg7. A conjugated form of each Atg8 homolog was observed in the presence of hAtg7, hAtg3, ATP, and liposomes. In addition to phosphatidylethanolamine, in vitro conjugation experiments using synthetic phospholipid liposomes showed that phosphatidylserine is also a target of LC3, GABARAP, and GATE-16. In contrast, thin layer chromatography of phospholipids released on hAtg4B-digestion from endogenous LC3-phospholipid conjugate revealed that phosphatidylethanolamine, but not phosphatidylserine, is the predominant target phospholipid of LC3 in vivo. The discrepancy between in vitro and in vivo reactions suggested that there may be selective factor(s) involved in the endogenous LC3 conjugation system.

Ca(2+)-sensitive mutants of the yeast Saccharomyces cerevisiae showing a Pet- phenotype (cls7-cls11) have lesions in a system for maintaining intracellular Ca2+ homeostasis (Ohya, Y., Ohsumi, Y., and Anraku, Y. (1986) J. Gen. Microbiol. 132, 979-988). Genetic and biochemical studies have demonstrated that these Pet- cls mutants are related to defects in vacuolar membrane H(+)-ATPase. CLS7 and CLS8 were found to be identical with the structural genes encoding subunit c (VMA3) and subunit a (VMA1), respectively, of the enzyme. In addition, these five mutants all had vma defects; no vacuolar membrane ATPase activity was detected in the cls cells, and the cls mutants showed a loss of ability to acidify the vacuole in vivo. Measurements of the cytosolic free Ca2+ concentration [( Ca2+]i) in individual cells showed that the average [Ca2+]i in wild-type cells was 150 +/- 80 nM, whereas that in five Pet- cls cells was 900 +/- 100 nM. These data are consistent with the observation that vacuolar membrane vesicles prepared from the Pet- cls cells have lost ATP-dependent Ca2+ uptake activities. The cls defects of vacuolar membrane H(+)-ATPase resulted in pleiotropic effects on several cellular activities, including Ca2+ homeostasis, glycerol metabolism, and phospholipid metabolism. The mutants showed an inositol-dependent phenotype, possibly due to alteration in regulation of phospholipid biosynthesis; the phosphatidylserine decarboxylase activities of the mutants were 15-50% of that of the wild-type cells and were not repressed by the addition of inositol. In contrast to the majority of previously isolated pet mutants (Tzagoloff, A., and Dieckmann, C. L. (1990) Microbiol. Rev. 54, 211-225), the Pet- cls mutants showed no detectable mitochondrial defects. Taking all these findings into account, we suggest that at least six genes, VMA1 (CLS8, subunit a), VMA2 (subunit b), VMA3 (CLS7, subunit c), VMA11 (CLS9), VMA12 (CLS10), and VMA13 (CLS11), are required for expression of the vacuolar membrane H(+)-ATPase activity.

Microtubule-associated protein 1 light chain 3 (LC3) is a unique modifier protein. LC3-I, the cytosolic form, is modified to LC3-II, the membrane-bound form, by a mechanism similar to ubiquitylation by E1- and E2-like enzymes, Apg7p and Apg3p, respectively. In the present study, we found that LC3-I is processed to LC3-II during the differentiation and recovery from puromycin aminonucleoside-induced nephrosis of podocytes. LC3 is especially expressed in the podocytes of rat kidney as the membrane-bound form LC3-II. Biochemical analysis using a conditionally immortalized mouse podocyte clone (MPC) revealed that LC3-I is processed to LC3-II during the differentiation of cells into mature podocytes and accumulates in the membrane-rich fraction of the cell lysate. LC3-II-localized vesicles, which differ from lysosomes and endosomes, in differentiated MPC cells are morphologically similar to autophagic vacuoles during starvation-induced autophagy. During starvation-induced autophagy, autophagosomes fuses with lysosome and LC3-II on autophagosomes is finally degraded by lysosomal proteases. However, in differentiated MPC cells, little LC3-II on the vesicles is degraded by lysosomal proteases, suggesting that little LC3-II-localized vesicles in differentiated MPC cells fuse with lysosome. Furthermore, the LC3-II level in differentiated MPC cells increases with recovery from damage caused by experimental puromycin aminonucleoside-induced nephrosis. These results suggest that LC3-II-localized vesicles play an important role in the physiological function of podocytes.

Hepatitis C virus (HCV) is a positive-strand RNA virus, and classified within the Flaviridae family. Atg7-knockdown decreases the amount of HCV replicon RNA, when HCV JFH1 RNA and HCV subgenomic replicon are transfected into Huh7.5 cells. However, when infectious naive HCV particles are directly infected into Huh7.5.1 cells, it is still unclear whether Atg7-knockdown decreases the production of intracellular HCV-related proteins, HCV mRNA and infectious HCV particles. When Atg7 protein in HCV-infected Huh7.5.1 cells was knocked down by RNA-interference, the levels of intracellular HCV core, NS3, NS5A proteins, HCV mRNA and secreted albumin remained unchanged compared with those in the control HCV-infected cells. However, the level of infectious HCV particles released in the medium was decreased by the Atg7-knockdown. Similar results were obtained when Beclin 1 was knocked down by RNA-interference. The colocalization of endogenous LC3-puncta with HCV core, HS5A proteins and lipid droplets was also investigated. However, little endogenous LC3-puncta colocalized with HCV core, NS5A proteins or lipid droplets. These results suggested that autophagy contributed to the effective production of HCV particles, but little to the intracellular production of HCV-related proteins, HCV mRNA and the secretory pathway, in a naive HCV particles-infection system.

Ubiquitously expressed micro- and millicalpain, which both require the calpain small 1 (CAPNS1) regulatory subunit for function, play important roles in numerous biological and pathological phenomena. We have previously shown that the product of GAS2, a gene specifically induced at growth arrest, is an inhibitor of millicalpain and that its overexpression sensitizes cells to apoptosis in a p53-dependent manner (Benetti, R., G. Del Sal, M. Monte, G. Paroni, C. Brancolini, and C. Schneider. 2001. EMBO J. 20:2702–2714). More recently, we have shown that calpain is also involved in nuclear factor κB activation and its relative prosurvival function in response to ceramide, in which calpain deficiency strengthens the proapoptotic effect of ceramide (Demarchi, F., C. Bertoli, P.A. Greer, and C. Schneider. 2005. Cell Death Differ. 12:512–522). Here, we further explore the involvement of calpain in the apoptotic switch and find that in calpain-deficient cells, autophagy is impaired with a resulting dramatic increase in apoptotic cell death. Immunostaining of the endogenous autophagosome marker LC3 and electron microscopy experiments demonstrate that autophagy is impaired in CAPNS1-deficient cells. Accordingly, the enhancement of lysosomal activity and long-lived protein degradation, which normally occur upon starvation, is also reduced. In CAPNS1-depleted cells, ectopic LC3 accumulates in early endosome-like vesicles that may represent a salvage pathway for protein degradation when autophagy is defective.

Two major proteolysis systems, the ubiquitin-proteasome system, and the autophagy-lysosome system, contribute to degradation of various types of protein and/or protein aggregates. In general, the autophagy-lysosome system is involved in bulk intracellular degradation of proteins and organelles, while the ubiquitin-proteasome system is selective. During autophagy, a cytosolic form of LC3 (LC3-I) is conjugated to phosphatidylethanolamine to form LC3-phosphatidylethanolamine conjugate (LC3-II), which is recruited to autophagosomal membranes, and LC3-II is degraded by lysosomal hydrolases after the fusion of autophagosomes with lysosomes. Therefore, lysosomal turnover of LC3-II reflects starvation-induced autophagic activity, and detection of LC3 by immunoblotting or immunofluorescence has become a reliable method for monitoring autophagy. When autophagy is impaired, the level of p62/SQSTM1, a ubiquitin- and LC3-binding protein, is increased in addition to the accumulation of ubiquitinated proteins. Here, we describe basic protocols to analyze endogenous LC3-II, p62, and autophagy-related proteins by immunoblotting, immunofluorescence, and electron microscopy.

Autophagy, one of protein degradation system, contributes to maintain cellular homeostasis and cell defense. Recently, some evidences indicated that autophagy and lipid metabolism are interrelated. Here, we demonstrate that hepatic steatosis impairs autophagic proteolysis. Though accumulation of autophagosome is observed in hepatocytes from ob/ob mice, expression of p62 was augmented in liver from ob/ob mice more than control mice. Moreover, degradation of the long-lived protein leucine was significantly suppressed in hepatocytes isolated from ob/ob mice. More than 80% of autophagosomes were stained by LysoTracker Red (LTR) in hepatocytes from control mice; however, rate of LTR-stained autophagosomes in hepatocytes were suppressed in ob/ob mice. On the other hand, clearance of autolysosomes loaded with LTR was blunted in hepatocytes from ob/ob mice. Although fusion of isolated autophagosome and lysosome was not disturbed, proteinase activity of cathepsin B and L in autolysosomes and cathepsin B and L expression of liver were suppressed in ob/ob mice. These results indicate that lipid accumulation blunts autophagic proteolysis via impairment of autophagosomal acidification and cathepsin expression.

Conditional knockout mice for Atg9a, specifically in brain tissue, were generated to understand the roles of ATG9A in the neural tissue cells. The mice were born normally, but half of them died within one wk, and none lived beyond 4 wk of age. SQSTM1/p62 and NBR1, receptor proteins for selective autophagy, together with ubiquitin, accumulated in Atg9a-deficient neurosoma at postnatal d 15 (P15), indicating an inhibition of autophagy, whereas these proteins were significantly decreased at P28, as evidenced by immunohistochemistry, electron microscopy and western blot. Conversely, degenerative changes such as spongiosis of nerve fiber tracts proceeded in axons and their terminals that were occupied with aberrant membrane structures and amorphous materials at P28, although no clear-cut degenerative change was detected in neuronal cell bodies. Different from autophagy, diffusion tensor magnetic resonance imaging and histological observations revealed Atg9a-deficiency-induced dysgenesis of the corpus callosum and anterior commissure. As for the neurite extensions of primary cultured neurons, the neurite outgrowth after 3 d culturing was significantly impaired in primary neurons from atg9a-KO mouse brains, but not in those from atg7-KO and atg16l1-KO brains. Moreover, this tendency was also confirmed in Atg9a-knockdown neurons under an atg7-KO background, indicating the role of ATG9A in the regulation of neurite outgrowth that is independent of autophagy. These results suggest that Atg9a deficiency causes progressive degeneration in the axons and their terminals, but not in neuronal cell bodies, where the degradations of SQSTM1/p62 and NBR1 were insufficiently suppressed. Moreover, the deletion of Atg9a impaired nerve fiber tract formation.

Autophagy has been reported to play a pivotal role on the replication of various RNA viruses. In this study, we investigated the role of autophagy on hepatitis C virus (HCV) RNA replication and demonstrated anti-HCV effects of an autophagic proteolysis inhibitor, chloroquine. Induction of autophagy was evaluated following the transfection of HCV replicon to Huh-7 cells. Next, we investigated the replication of HCV subgenomic replicon in response to treatment with lysosomal protease inhibitors or pharmacological autophagy inhibitor. The effect on HCV replication was analyzed after transfection with siRNA of ATG5, ATG7 and light-chain (LC)-3 to replicon cells. The antiviral effect of chloroquine and/or interferon-α (IFNα) was evaluated. The transfection of HCV replicon increased the number of autophagosomes to about twofold over untransfected cells. Pharmacological inhibition of autophagic proteolysis significantly suppressed expression level of HCV replicon. Silencing of autophagy-related genes by siRNA transfection significantly blunted the replication of HCV replicon. Treatment of replicon cells with chloroquine suppressed the replication of the HCV replicon in a dose-dependent manner. Furthermore, combination treatment of chloroquine to IFNα enhanced the antiviral effect of IFNα and prevented re-propagation of HCV replicon. Protein kinase R was activated in cells treated with IFNα but not with chloroquine. Incubation with chloroquine decreased degradation of long-lived protein leucine. The results of this study suggest that the replication of HCV replicon utilizes machinery involving cellular autophagic proteolysis. The therapy targeted to autophagic proteolysis by using chloroquine may provide a new therapeutic option against chronic hepatitis C.

Tandem fluorescent protein-tagged LC3s that were comprised of a protein tag that emits green fluorescence (e.g., EGFP or mWasabi) fused with another tag that emits red fluorescence (e.g. mCherry or TagRFP) were used for monitoring the maturation step of mammalian autophagosomes. A critical point for this tandem fluorescent-tagged LC3 was the sensitivity of green fluorescence at an acidic pH. EGFP and mWasabi continue to emit a weak, but significant, fluorescence at a pH of approximately 6. To overcome this issue, we focused on super-ecliptic pHluorin, which is a more pH-sensitive GFP variation. The green fluorescence of EGFP and mWasabi in the cells was still observed at weakly acidic levels (pH 6.0-6.5). In contrast, the fluorescence of pHluorin was more significantly quenched at pH 6.5, and was almost completely abolished at pH 5.5-6.0, indicating that pHluorin is more suitable for use in a tandem fluorescent protein-tag for monitoring autophagy. A pHluorin-mKate2 tandem fluorescence protein showed pH-sensitive green fluorescence and pH-resistant far-red fluorescence. We therefore generated expression plasmids for pHluorin-mKate2-tagged human LC3 (PK-hLC3), which could be used as a modifier for LC3-lipidation. The green and far-red fluorescent puncta of PK-hLC3 were increased under starvation conditions. Puncta that were green-negative, but far-red positive, were increased when autolysosomes accumulated, but few puncta of the mutant PK-hLC3ΔG that lacked the carboxyl terminal Gly essential for autophagy were observed in the cells under the same conditions. These results indicated that the PK-hLC3 were more appropriate for the pH-sensitive monitoring of the maturation step of autophagosomes.

Microtubule-associated protein (MAP) light chain 3 (LC3) is a human homologue of yeast Apg8/Aut7/Cvt5 (Atg8), which is essential for autophagy. MAP-LC3 is cleaved by a cysteine protease to produce LC3-I, which is located in cytosolic fraction. LC3-I, in turn, is converted to LC3-II through the actions of E1- and E2-like enzymes. LC3-II is covalently attached to phosphatidylethanolamine on its C terminus, and it binds tightly to autophagosome membranes. We determined the solution structure of LC3-I and found that it is divided into N- and C-terminal subdomains. Additional analysis using a photochemically induced dynamic nuclear polarization technique also showed that the N-terminal subdomain of LC3-I makes contact with the surface of the C-terminal subdomain and that LC3-I adopts a single compact conformation in solution. Moreover, the addition of dodecylphosphocholine into the LC3-I solution induced chemical shift perturbations primarily in the C-terminal subdomain, which implies that the two subdomains have different sensitivities to dodecylphosphocholine micelles. On the other hand, deletion of the N-terminal subdomain abolished binding of tubulin and microtubules. Thus, we showed that two subdomains of the LC3-I structure have distinct functions, suggesting that MAP-LC3 can act as an adaptor protein between microtubules and autophagosomes.

GATE-16, GABARAP, and LC3 are three mammalian counterparts of yeast Apg8p/Aut7p. Here, we show that GATE-16 and GABARAP are authentic modifiers, as is the case of LC3 modification. The C-terminal Phe117 of proGATE-16 and the C-terminal Leu117 of proGABARAP are post-translationally cleaved to expose an essential Gly116 within GATE-16 and GABARAP, with the products designated GATE-16-I and GABARAP-I, respectively. The Gly116 within GATE-16 and GABARAP are essential for further formation of the intermediates between them and Apg7pC572S and Apg3pC264S. When Apg7p and Apg3p are expressed, GATE-16-I and GABARAP-I are modified to a secondary ubiquitin-like modified form, GATE-16-II and GABARAP-II, respectively. GATE-16-I and GABARAP-I, but not LC3-I, localize to membrane compartments before their modification. These results indicate that GATE-16 and GABARAP are authentic modifiers, but that they have different biochemical characteristics from those of LC3.

Apg7p/Cvt2p, a protein-activating enzyme, is essential for both the Apg12p-Apg5p conjugation system and the Apg8p membrane targeting in autophagy and cytoplasm-to-vacuole targeting in the yeast <i>Saccharomyces cerevisiae</i>. Similar to the ubiquitin-conjugating system, both Apg12p and Apg8p are activated by Apg7p, an E1-like enzyme. Apg12p is then transferred to Apg10p, an E2-like enzyme, and conjugated with Apg5p, whereas Apg8p is transferred to Apg3p, another E2-like enzyme, followed by conjugation with phosphatidylethanolamine. Evidence is presented here that Apg7p forms a homodimer with two active-site cysteine residues via the C-terminal region. The dimerization of Apg7p is independent of the other Apg proteins and facilitated by overexpressed Apg12p. The C-terminal 123 amino acids of Apg7p (residues 508 to 630 out of 630 amino acids) are sufficient for its dimerization, where there is neither an ATP binding domain nor an active-site cysteine essential for its E1 activity. The deletion of its carboxyl 40 amino acids (residues 591–630 out of 630 amino acids) results in several defects of not only Apg7p dimerization but also interactions with two substrates, Apg12p and Apg8p and Apg12p-Apg5p conjugation, whereas the mutant Apg7p contains both an ATP binding domain and an active-site cysteine. Furthermore, the carboxyl 40 amino acids of Apg7p are also essential for the interaction of Apg7p with Apg3p to form the E1-E2 complex for Apg8p. These results suggest that Apg7p forms a homodimer via the C-terminal region and that the C-terminal region is essential for both the activity of the E1 enzyme for Apg12p and Apg8p as well as the formation of an E1-E2 complex for Apg8p.

1Pten (phosphatase and tensin homolog deleted on chromosome ten), a tumor suppressor, is a phosphatase with a variety of substrate specificities. Its function as a negative regulator of the class I phosphatidyl-inositol 3-kinase/Akt pathway antagonizes insulin-dependent cell signaling. The targeted deletion of Pten in mouse liver leads to insulin hypersensitivity and the upregulation of the phosphatidyl-inositol 3-kinase/Akt signaling pathway. In this study, we investigated the effects of Pten deficiency on autophagy, a major cellular degradative system responsible for the turnover of cell constituents. The autophagic degradation of [14C]-leucine-labeled proteins of hepatocytes isolated from Pten-deficient livers was strongly inhibited, compared with that of control hepatocytes. However, no significant difference was found in the levels of the Atg12-Atg5 conjugate and LC3-II, the lipidated form of LC3, an intrinsic autophagosomal membrane marker, between control and Pten-deficient livers. Electron microsopic analyses showed that numerous autophagic vacuoles (autophagosomes plus autolysosomes) were present in the livers of control mice that had been starved for 48 hours, whereas they were markedly reduced in Pten-deficient livers under the same conditions. In vivo administration of leupeptin to control livers caused the inhibition of autophagic proteolysis, resulting in the accumulation of autolysosomes. These autolysosomes could be separated as a denser autolysosomal fraction from other cell membranes by Percoll density gradient centrifugation. In leupeptin-administered mutant livers, however, the accumulation of denser autolysosomes was reduced substantially. Collectively, we conclude that enhanced insulin signaling in Pten deficiency suppresses autophagy at the formation and maturation steps of autophagosomes, without inhibiting ATG conjugation reactions.

Autophagy is an evolutionarily conserved pathway in which the cytoplasm and organelles are engulfed within double-membrane vesicles, termed autophagosomes, for the turnover and recycling of these cellular constituents. The yeast Atg8 and its human orthologs, such as LC3 and GABARAP, have a unique feature as they conjugate covalently to phospholipids, differing from ubiquitin and other ubiquitin-like modifiers that attach only to protein substrates. The lipidated Atg8 and LC3 localize to autophagosomal membranes and play indispensable roles for maturation of autophagosomes. Upon completion of autophagosome formation, some populations of lipidated Atg8 and LC3 are delipidated for recycling. Atg4b, a specific protease for LC3 and GABARAP, catalyzes the processing reaction of LC3 and GABARAP precursors to mature forms and de-conjugating reaction of the modifiers from phospholipids. Atg4b is a unique enzyme whose primary structure differs from that of any other proteases that function as processing and/or de-conjugating enzymes of ubiquitin and ubiquitin-like modifiers. However, the tertiary structures of the substrates considerably resemble that of ubiquitin except for the N-terminal additional domain. Here we determined the crystal structure of human Atg4b by X-ray crystallography at 2.0 Å resolution, and show that Atg4b is a cysteine protease whose active catalytic triad site consists of Cys74, His280 and Asp278. The structure is comprised of a left lobe and a small right lobe, designated the “protease domain” and the “auxiliary domain”, respectively. Whereas the protease domain structure of Atg4b matches that of papain superfamily cysteine proteinases, the auxiliary domain contains a unique structure with yet-unknown function. We propose that the R229 and W142 residues in Atg4b are specifically essential for recognition of substrates and catalysis of both precursor processing and de-conjugation of phospholipids.

The subunit composition of GABA A receptors is known to be associated with distinct physiological and pharmacological properties. Previous studies that used phospholipase C-related inactive protein type 1 knock-out (PRIP-1 KO) mice revealed that PRIP-1 is involved in the assembly and/or the trafficking of γ2 subunit-containing GABA A receptors. There are two PRIP genes in mammals; thus the roles of PRIP-1 might be compensated partly by those of PRIP-2 in PRIP-1 KO mice. Here we used PRIP-1 and PRIP-2 double knock-out (PRIP-DKO) mice and examined the roles for PRIP in regulating the trafficking of GABA A receptors. Consistent with previous results, sensitivity to diazepam was reduced in electrophysiological and behavioral analyses of PRIP-DKO mice, suggesting an alteration of γ2 subunit-containing GABA A receptors. The surface numbers of diazepam binding sites (α/γ2 subunits) assessed by [ 3 H]flumazenil binding were reduced in the PRIP-DKO mice as compared with those of wild-type mice, whereas the cell surface GABA binding sites (α/β subunits, assessed by [ 3 H]muscimol binding) were increased in PRIP-DKO mice. The association between GABA A receptors and GABA A receptor-associated protein (GABARAP) was reduced significantly in PRIP-DKO neurons. Disruption of the direct interaction between PRIP and GABA A receptor β subunits via the use of a peptide corresponding to the PRIP-1 binding site reduced the cell surface expression of γ2 subunit-containing GABA A receptors in cultured cell lines and neurons. These results suggest that PRIP is implicated in the trafficking of γ2 subunit-containing GABA A receptors to the cell surface, probably by acting as a bridging molecule between GABARAP and the receptors.

AbstractA cytosolic form of LC3 is conjugated to phosphatidylethanolamine by Atg7, an E1-like enzyme, and Atg3, an E2-like enzyme, during autophagy. To monitor intracellular autophagosomes and autolysosomes, GFP-LC3 is a useful tool. However, GFP-LC3 can aggregate without being conjugated to phosphatidylethanolamine, especially when GFP-LC3 is transiently expressed (Kuma A, Matsui M, Mizushima N. Autophagy 2007; 3:323–8). Therefore, as a negative control, we investigated a mutant human LC3ΔG protein in which the C-terminal Gly120 essential for LC3-lipidation is deleted, and generated a set of expression plasmids for wild-type human LC3 and mutant LC3ΔG fused to either CFP, GFP, YFP, or HcRed at the N terminus. We found that the mutant LC3ΔG protein does not react with human Atg7 and Atg3, indicating that LC3-lipidation does not occur, and few puncta containing mutant LC3ΔG form under starvation conditions. As observed with wild-type HcRed-LC3, mutant HcRed-LC3ΔG also co-localizes with polyQ150-aggregates suggesting that the colocalization of HcRed-LC3 to polyQ150-aggregates is independent of LC3-lipidation. These mutant LC3ΔG proteins will be useful negative controls in recognizing non-specific fluorescent protein-LC3 aggregates.

Abstract The presentation of self-peptides in the context of MHC molecules by thymic epithelial cells (TECs) is essential for T cell repertoire selection in the thymus. However, the underlying mechanisms of this process have not been fully elucidated. To address whether autophagy, a catabolic process involving the degradation of a cell’s components through the lysosomal machinery, intersects the MHC class II-restricted Ag presentation pathway in TECs, we investigated the colocalization of LC3, a peculiar autophagy marker molecule, with MHC class II compartments in in vitro-established TEC lines by immunofluorescence microscopy and Western blotting analyses. We found that in both cortical and medullary TEC lines, LC3 was colocalized with the H2-DM-positive lysosomal compartments, in which MHC class II plus class II-associated invariant chain peptides complexes are formed. Furthermore, our analysis of thymic cryosections from 1-day-old mice revealed that LC3 colocalizes with the H2-DM-positive compartments in TECs. These results strongly suggest that the cytoplasmic self-Ags gain access to the H2-DM-positive compartments via the autophagic process in the thymus.

Streptococcus pneumoniae is the most common causative agent of community-acquired pneumonia and can penetrate epithelial barriers to enter the bloodstream and brain. We investigated intracellular fates of S. pneumoniae and found that the pathogen is entrapped by selective autophagy in pneumolysin- and ubiquitin-p62-LC3 cargo-dependent manners. Importantly, following induction of autophagy, Rab41 was relocated from the Golgi apparatus to S. pneumoniae-containing autophagic vesicles (PcAV), which were only formed in the presence of Rab41-positive intact Golgi apparatuses. Moreover, subsequent localization and regulation of K48- and K63-linked polyubiquitin chains in and on PcAV were clearly distinguishable from each other. Finally, we found that E3 ligase Nedd4-1 was recruited to PcAV and played a pivotal role in K63-linked polyubiquitin chain (K63Ub) generation on PcAV, promotion of PcAV formation, and elimination of intracellular S. pneumoniae. These findings suggest that Nedd4-1-mediated K63Ub deposition on PcAV acts as a scaffold for PcAV biogenesis and efficient elimination of host cell-invaded pneumococci.

<i>Saccharomyces cerevisiae VMA</i> genes, encoding essential components for the expression of vacuolar membrane H⁺-ATPase activity, are involved in intracellular ionic homeostasis and vacuolar biogenesis. We report here that the immunosuppressants FK506 and cyclosporin A cause general growth inhibition of the <i>vma3</i> mutant. Upon addition of the drugs, the mutant grew neither in the presence of more than 5 mM Ca²⁺nor above pH 6.0. The action of the immunosuppressants is dependent on their binding proteins and ascribable to inhibition of calcineurin activity; a mutation of a calcineurin subunit (<i>cnb1</i>) shows synthetic lethal interaction with the <i>vma</i> mutation. The addition of FK506 decreases the cytosolic free concentration of Ca²⁺in the <i>vma3</i> mutant cells. Consequently, FK506 induces an 8.9-fold elevation of a nonexchangeable Ca²⁺pool. These results suggest that calcineurin controls calcium homeostasis by repression of Ca²⁺flux into a cellular compartment(s) and that the vacuolar H⁺-ATPase is essential for cell growth cooperating with calcineurin to regulate the cytosolic free concentration of Ca²⁺.

Abstract: The specific accumulation of the hydrophobic protein, subunit c of ATP synthase, in lysosomes from the cells of patients with the late infantile form of neuronal ceroid lipofuscinosis (LINCL) is caused by lysosomal proteolytic dysfunction. The defective gene in LINCL ( CLN2 gene) has been identified recently. To elucidate the mechanism of lysosomal storage of subunit c, antibodies against the human CLN2 gene product (Cln2p) were prepared. Immunoblot analysis indicated that Cln2p is a 46‐kDa protein in normal control skin fibroblasts and carrier heterozygote cells, whereas it was absent in cells from four patients with LINCL. RT‐PCR analysis indicated the presence of mRNA for CLN2 in cells from the four different patients tested, suggesting a low efficiency of translation of mRNA or the production of the unstable translation products in these patient cells. Pulse‐chase analysis showed that Cln2p was synthesized as a 67‐kDa precursor and processed to a 46‐kDa mature protein ( t 1/2 = 1 h). Subcellular fractionation analysis indicated that Cln2p is localized with cathepsin B in the high‐density lysosomal fractions. Confocal immunomicroscopic analysis also revealed that Cln2p is colocalized with a lysosomal soluble marker, cathepsin D. The immunodepletion of Cln2p from normal fibroblast extracts caused a loss in the degradative capacity of subunit c, but not the β subunit of ATP synthase, suggesting that the absence of Cln2p provokes the lysosomal accumulation of subunit c.

Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes/vacuoles. The formation of autophagosomes involves a dynamic rearrangement of the membrane for which two ubiquitin-like modifications (the conjugation of Apg12p and the modification of a soluble form of MAP-LC3 to a membrane-bound form) are essential. In yeast, Apg10p is an E2-like enzyme essential for Apg12p conjugation. The isolated mouse APG10 gene product interacts with mammalian Apg12p dependent on mammalian Apg7p (E1-like enzyme), and facilitates Apg12p conjugation. The interaction of Apg10p with Apg12p is dependent on the carboxyl-terminal glycine of Apg12p. Mutational analysis of the predicted active site cysteine (Cys161) within mouse Apg10p shows that mutant Apg10pC161S, which can form a stable intermediate with Apg12p, inhibits Apg12p conjugation even in the presence of Apg7p, while overexpression of Apg7p facilitates formation of an Apg12p-Apg5p conjugate. Furthermore, the coexpression of Apg10p with Apg7p facilitates the modification of a soluble form of MAP-LC3 to a membrane-bound form, a second modification essential for autophagy. Mouse Apg10p interacts with MAP-LC3 in HEK293 cells, while no mutant Apg10pC161S forms any intermediate with MAP-LC3. Direct interaction between Apg10p and MAP-LC3 is also demonstrated by yeast two-hybrid analysis. The inability of mutant Apg10pC161S to form any intermediate with MAP-LC3 has ruled out the possibility that MAP-LC3 interacts with Apg10p as a substrate. Autophagy is a process for the bulk degradation of cytosolic compartments by lysosomes/vacuoles. The formation of autophagosomes involves a dynamic rearrangement of the membrane for which two ubiquitin-like modifications (the conjugation of Apg12p and the modification of a soluble form of MAP-LC3 to a membrane-bound form) are essential. In yeast, Apg10p is an E2-like enzyme essential for Apg12p conjugation. The isolated mouse APG10 gene product interacts with mammalian Apg12p dependent on mammalian Apg7p (E1-like enzyme), and facilitates Apg12p conjugation. The interaction of Apg10p with Apg12p is dependent on the carboxyl-terminal glycine of Apg12p. Mutational analysis of the predicted active site cysteine (Cys161) within mouse Apg10p shows that mutant Apg10pC161S, which can form a stable intermediate with Apg12p, inhibits Apg12p conjugation even in the presence of Apg7p, while overexpression of Apg7p facilitates formation of an Apg12p-Apg5p conjugate. Furthermore, the coexpression of Apg10p with Apg7p facilitates the modification of a soluble form of MAP-LC3 to a membrane-bound form, a second modification essential for autophagy. Mouse Apg10p interacts with MAP-LC3 in HEK293 cells, while no mutant Apg10pC161S forms any intermediate with MAP-LC3. Direct interaction between Apg10p and MAP-LC3 is also demonstrated by yeast two-hybrid analysis. The inability of mutant Apg10pC161S to form any intermediate with MAP-LC3 has ruled out the possibility that MAP-LC3 interacts with Apg10p as a substrate. Ubiquitylation and ubiquitylation-like protein conjugation mechanisms are essential to many cell-biological activities. Ubiquitin forms conjugates with target proteins via a three-step mechanism (1Pickeart C.M. Mol. Cell. 2001; 8: 499-504Abstract Full Text Full Text PDF PubMed Scopus (338) Google Scholar, 2Bonifacino J.S. Weissman A.M. Annu. Rev. Cell Dev. Biol. 1998; 14: 19-57Crossref PubMed Scopus (536) Google Scholar, 3Varshavsky A. Trends Biochem. Sci. 1997; 22: 383-387Abstract Full Text PDF PubMed Scopus (515) Google Scholar). First, ubiquitin is activated at its carboxyl-terminal glycine by the ubiquitin-activating (E1) 1The abbreviations used are: E1, protein-activating enzyme; E2, protein-conjugating enzyme; EST, expressed sequence tagged; FLAGhApg12p, FLAG-tagged hApg12p; FLAGmApg10p, FLAG-tagged mouse Apg10p homologue; FLAGMAP-LC3, FLAG-tagged MAP-LC3; GABARAP, GABAA receptor-associated protein; GAD, GAL4 activating domain; GATE-16, Golgi-associated ATPase enhancer of 16 kDa; GBD, GAL4 DNA-binding domain; GFP, green fluorescent protein; GFPhApg12p, GFP-tagged hApg12p; MAP-LC3, microtubule-associated protein light chain 3; mychApg5p, Myc-tagged hApg5p; YFP, yellow fluorescent protein; YFPmApg10p, YFP-tagged mApg10p; WB, Western blot; IP, immunoprecipitate. enzyme to form a conjugate through the active cysteine in the E1 enzyme via a thiol ester bond. Next, ubiquitin is transferred from the E1 enzyme to one of several ubiquitin-conjugating (E2) enzymes. In the last step, ubiquitin attaches to a lysine within a target protein via an isopeptide bond. This step is often catalyzed by a member of the ubiquitin protein ligase (E3 enzyme) family. With regard to other modifiers, Nedd8, SUMOs, Apg12p, and Apg8ps (Apg8p in yeast, and, MAP-LC3, GABARAP, and GATE-16 in mammals), each is modified by specific E1 and E2 enzymes, and conjugated with its target (4Yeh E.T. Gong L. Kamitani T. Gene (Amst.). 2000; 248: 1-14Crossref PubMed Scopus (418) Google Scholar, 5Melchior F. Annu. Rev. Cell Dev. Biol. 2000; 16: 591-626Crossref PubMed Scopus (653) Google Scholar, 6Ohsumi Y. Nat. Rev. Mol. Cell. Biol. 2001; 2: 211-216Crossref PubMed Scopus (1044) Google Scholar, 7Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1286) Google Scholar, 8Mizushima N. Sugita H. Yoshimori T. Ohsumi Y. J. Biol. Chem. 1998; 273: 33889-33892Abstract Full Text Full Text PDF PubMed Scopus (414) Google Scholar, 9Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1519) Google Scholar, 10Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar). Of these modifiers, Apg12p and MAP-LC3 (Apg8p in yeast) cooperatively play an essential role in the dynamic membrane formation of the autophagosome during autophagy. Autophagy is a process for the bulk degradation of cytoplasmic components by lysosomes/vacuoles (6Ohsumi Y. Nat. Rev. Mol. Cell. Biol. 2001; 2: 211-216Crossref PubMed Scopus (1044) Google Scholar, 11Kim J. Klionsky D.J. Annu. Rev. Biochem. 2000; 69: 303-342Crossref PubMed Scopus (320) Google Scholar, 12Klionsky D.J. Emr S.D. Science. 2000; 290: 1717-1721Crossref PubMed Scopus (2988) Google Scholar), and has a significant relationship with type II programmed cell death, several neurodegenerative disorders, and cardiomyopathies in addition to normal cell growth and differentiation (for reviews, see Refs. 6Ohsumi Y. Nat. Rev. Mol. Cell. Biol. 2001; 2: 211-216Crossref PubMed Scopus (1044) Google Scholar and 11Kim J. Klionsky D.J. Annu. Rev. Biochem. 2000; 69: 303-342Crossref PubMed Scopus (320) Google Scholar). In the initial step of macroautophagy, a cup-shaped membrane sac surrounds cytosolic components to form an autophagosome. The outer membrane of the autophagosome fuses with the lysosome/vacuole. Thereafter, intralumenal components are degraded by lysosomal lytic enzymes. The process of autophagy is essentially the same in yeast, plant, and animal cells, and the genes, which encode components of the autophagic system in several organisms, seem to be highly conserved. In mammalian cells, autophagic vacuoles are found in hepatocytes under conditions of starvation (13Ohshita T. Kominami E. Ii K. Katsunuma N. J. Biochem. 1986; 100: 623-632Crossref PubMed Scopus (31) Google Scholar) and cell differentiation (14Takano-Ohmuro H. Mukaida M. Kominami E. Morioka K. Eur. J. Cell Biol. 2000; 79: 759-764Crossref PubMed Scopus (77) Google Scholar, 15Hornung J.P. Koppel H. Clarke P.G. J. Comp. Neurol. 1989; 283: 425-437Crossref PubMed Scopus (72) Google Scholar, 16Heynen M.J. Tricot G. Verwilghen R.L. Cell Tissue Res. 1985; 239: 235-239Crossref PubMed Scopus (58) Google Scholar), as well as in several neuromuscular diseases (17Nixon R.A. Cataldo A.M. Mathews P.M. Neurochem. Res. 2000; 25: 1161-1172Crossref PubMed Scopus (280) Google Scholar, 18Anglade P. Vyas S. Javoy-Agid F. Herrero M.T. Michel P.P. Marquez J. Mouatt-Prigent A. Ruberg M. Hirsch E.C. Agid Y. Histol. Histopathol. 1997; 12: 25-31PubMed Google Scholar, 19Nishino I. Fu J. Tanji K. Yamada T. Shimojo S. Koori T. Mora M. Riggs J.E. Oh S.J. Koga Y. Sue C.M. Yamamoto A. Murakami N. Shanske S. Byrne E. Bonilla E. Nonaka I. DiMauro S. Hirano M. Nature. 2000; 406: 906-910Crossref PubMed Scopus (731) Google Scholar). In the formation of autophagosomes, two ubiquitin-like modifications, Apg12p conjugation and Apg8p/Aut7p processing, are essential (6Ohsumi Y. Nat. Rev. Mol. Cell. Biol. 2001; 2: 211-216Crossref PubMed Scopus (1044) Google Scholar, 9Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1519) Google Scholar, 20Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5468) Google Scholar). In yeast, Apg12p is covalently attached to Apg5p via its carboxyl-terminal glycine as in the case of ubiquitylation (7Mizushima N. Noda T. Yoshimori T. Tanaka Y. Ishii T. George M.D. Klionsky D.J. Ohsumi M. Ohsumi Y. Nature. 1998; 395: 395-398Crossref PubMed Scopus (1286) Google Scholar). In this conjugate reaction, Apg7p and Apg10p function as E1- and E2-like enzymes for Apg12p, respectively (21Tanida I. Mizushima N. Kiyooka M. Ohsumi M. Ueno T. Ohsumi Y. Kominami E. Mol. Cell. Biol. 1999; 10: 1367-1379Crossref Scopus (326) Google Scholar, 22Komatsu M. Tanida I. Ueno T. Ohsumi M. Ohsumi Y. Kominami E. J. Biol. Chem. 2001; 276: 9846-9854Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar, 23Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (235) Google Scholar, 24Suzuki K. Kirisako T. Kamada Y. Mizushima N. Noda T. Ohsumi Y. EMBO J. 2001; 20: 5971-5981Crossref PubMed Scopus (800) Google Scholar). After the formation of the Apg12p-Apg5p conjugate, Apg16p attaches to Apg5p to form an Apg12p-Apg5p-Apg16p complex for autophagy (23Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (235) Google Scholar, 26Kuma A. Mizushima N. Ishihara N. Ohsumi Y. J. Biol. Chem. 2002; 277: 18619-19625Abstract Full Text Full Text PDF PubMed Scopus (347) Google Scholar). The Apg12p-Apg5p conjugate is essential for the autophagosomal precursor to form. Thereafter, an Apg8p/Aut7p modification, a unique lipidation, plays an indispensable role in the formation of the autophagosome (9Ichimura Y. Kirisako T. Takao T. Satomi Y. Shimonishi Y. Ishihara N. Mizushima N. Tanida I. Kominami E. Ohsumi M. Noda T. Ohsumi Y. Nature. 2000; 408: 488-492Crossref PubMed Scopus (1519) Google Scholar, 27Kirisako T. Ichimura Y. Okada H. Kabeya Y. Mizushima N. Yoshimori T. Ohsumi M. Takao T. Noda T. Ohsumi Y. J. Cell Biol. 2000; 151: 263-276Crossref PubMed Scopus (737) Google Scholar, 28Kirisako T. Baba M. Ishihara N. Miyazawa K. Ohsumi M. Yoshimori T. Noda T. Ohsumi Y. J. Cell Biol. 1999; 147: 435-446Crossref PubMed Scopus (714) Google Scholar). In this Apg8p lipidation, the same E1-like enzyme, Apg7p, and a second E2-like enzyme, Apg3p, mediate the reaction. In mammals, these two modifications seem to be conserved; the Apg12p-Apg5p conjugate associates with an autophagosomal precursor in embryonic stem cells (29Mizushima N. Yamamoto A. Hatano M. Kobayashi Y. Kabeya Y. Suzuki K. Tokuhisa T. Ohsumi Y. Yoshimori T. J. Cell Biol. 2001; 152: 657-668Crossref PubMed Scopus (1161) Google Scholar). After the dissociation of the conjugate according to extension of the precursor, modified, or lipidated form of MAP-LC3 (a mammalian Apg8p/ Aut7p homologue) is localized to a cup-shaped preautophago-some and autophagosome (10Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar, 20Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5468) Google Scholar). As the apparent mobility of the soluble form of MAP-LC3 is smaller than that of the membrane-bound form in SDS-PAGE, we have designated the soluble and membrane bound form as MAP-LC3-I and MAP-LC3-II, respectively, for simplicity (20Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5468) Google Scholar). We have characterized mammalian Apg7p as an E1-like enzyme essential to both mammalian Apg12p and three Apg8 homologues (MAP-LC3, GABARAP, and GATE-16), and mammalian Apg3p as an E2-like enzyme essential to three Apg8p homologues (10Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar, 30Tanida I. Tanida-Miyake E Nishitani T. Komatsu M. Yamazaki H. Ueno T. Kominami E. Biochem. Biophys. Res. Commun. 2002; 292: 256-262Crossref PubMed Scopus (27) Google Scholar, 31Tanida I. Tanida-Miyake E. Komatsu M. Ueno T. Kominami E. J. Biol. Chem. 2002; 277: 13739-13744Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar). However, there has been little progress in the biochemical characterization of mammalian Apg10p with regard to interacting proteins and cooperative function between Apg12p conjugation and MAP-LC3 modification. Mutational analysis showed that a mutant, Apg10pC161S, in which the active site cysteine was changed to serine, inhibits the conjugation of Apg12p even in the presence of Apg7p. Furthermore, we found that Apg10p facilitates the modification of MAP-LC3 (a second modification pathway), suggesting that the Apg12p conjugation mediated by Apg10p cooperates in the modification of a soluble form of MAP-LC3 to a membrane-bound form. Cloning of Mouse APG10 cDNA—Two oligonucleotides (mAPG10GSP1, 5′-GGCGATGGCTGGGAATGG-3′; mAPG10-GSP2, 5′-AGGCTGCTCCAGGGACCGTG-3′) were synthesized based on the DNA sequence of two EST clones (GenBank™ accession numbers, AI152249 and AI594591). Using these primers, the 5′-rapid amplification of cDNA ends was performed by high fidelity PCR using mouse brain Marathon-ready cDNA as a template according to the manufacturer's protocol (Clontech, Palo Alto, CA). Plasmid Construction and Site-directed Mutagenesis—Based on the obtained DNA sequence of the mouse APG10 homologue (GenBank™ accession number, AB079383), we amplified an open-reading frame of the mouse APG10 cDNA by PCR with high fidelity introducing a BglII site before the start codon, and a SalI site after the termination codon, cloned the fragment into pGEM-T, and designated the resultant plasmid the pGEMmAPG10 plasmid. To express YFPmApg10p under the control of the CMV promoter, a BglII-SalI fragment of the pGEMmAPG10 plasmid was introduced into a pEYFP-C1 vector (Clontech, Palo Alto, CA), and designated pYFP-mAPG10. To express FLAGmApg10p in HEK293 cells, a BglII-SalI fragment of the pGEMmApg10 plasmid was introduced into the BamHI-SalI site of a pCMVTag2B vector (Stratagene), and designated pCMV-tag2B-mApg10. Mammalian expression vectors for each of the EGFP modifier fusion proteins and FLAG-tagged proteins have been described previously (10Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar, 30Tanida I. Tanida-Miyake E Nishitani T. Komatsu M. Yamazaki H. Ueno T. Kominami E. Biochem. Biophys. Res. Commun. 2002; 292: 256-262Crossref PubMed Scopus (27) Google Scholar, 31Tanida I. Tanida-Miyake E. Komatsu M. Ueno T. Kominami E. J. Biol. Chem. 2002; 277: 13739-13744Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar). To express Myc-tagged hApg5p, the BamHI-SalI fragment of the pGEMhAPG5 plasmid was introduced into the BamHI-SalI site of a pCMVTag3B vector (Stratagene), and designated pCMV-tag3B-hApg5. Cys161 within Apg10p was replaced by Ser and mutagenized using the Gene-Editor in vitro site-directed mutagenesis system (Promega) with an oligonucleotide (mAPG10CS; 5′-CAACCATTTTTTGTTCTACATCCCAGCAAGACAAATGAATTCATGACTGC-3′) according to the manufacturer's directions. Antibodies—A polyclonal antibody against a synthetic polypeptide corresponding to residues 550–571 of hApg7p has been described previously (10Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar). For the preparation of anti-serum against mouse Apg10p, rabbits were immunized with a glutathione S-transferase-Apg10p fusion protein. The antibody to mouse Apg10p was purified by affinity chromatography on glutathione S-transferase-Apg10p fusion protein-immobilized Sepharose. Then, the obtained antibody was passed through a column of glutathione S-transferase-immobilized Sepharose. The resultant antibody (anti-mApg10p antibody) recognized a recombinant YFPmApg10p in HEK293 cells. The monoclonal anti-green fluorescent protein (GFP) antibody was purchased from Clontech. The monoclonal anti-FLAG antibody (M2) was purchased from Sigma-Aldrich. The co-immunoprecipitation of interacting proteins has been described previously (10Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar, 30Tanida I. Tanida-Miyake E Nishitani T. Komatsu M. Yamazaki H. Ueno T. Kominami E. Biochem. Biophys. Res. Commun. 2002; 292: 256-262Crossref PubMed Scopus (27) Google Scholar, 31Tanida I. Tanida-Miyake E. Komatsu M. Ueno T. Kominami E. J. Biol. Chem. 2002; 277: 13739-13744Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar). Cell Culture and Transfection—HEK293 cells were obtained from Health Science Research Resources Bank (Osaka, Japan). Cells were grown in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. HEK293 cells (5 × 105 cells) were transfected with the indicated constructs using LipofectAMINE 2000 transfection reagent according to the manufacturer's instructions (Invitrogen, Carlsbad, CA). After 48 h, cells were harvested for further analyses. Western Blotting and Immunoprecipitation—Cells were lysed with TNE buffer (10 mm Tris-HCl, pH 7.8, 1% Nonidet P-40, 150 mm NaCl, and1mm EDTA) containing a Complete™ proteinase inhibitor mixture tablet (Roche Applied Science). Cell lysates were separated by SDS-PAGE and transferred onto polyvinylidene difluoride membranes (Millipore, Bedford, MA). The membranes were blocked with 5% nonfat dried milk and primed with the indicated antibodies. The membranes were washed and then incubated with HRP-conjugated anti-mouse IgG or anti-rabbit IgG antibodies. Immunoreactivity was detected on x-ray film using Super Signal ULTRA chemiluminescent Substrate (Pierce). For immunoprecipitation, cell lysates were pre-absorbed with protein A-agarose at 4 °C for 1 h. The pre-absorbed lysates were incubated with the indicated antibodies at 4 °C for 18 h. After incubation, unbound proteins were removed and the protein A-agarose was washed five times with TNE buffer. The immunoprecipitated proteins were eluted by boiling with Laemmli's sample buffer. Animals—Male Wistar rats (250–300 g) were maintained in an environmentally controlled room (lights on 7:00 to 20:00) for at least 2 weeks before the experiments. All rats were fed a standard pelleted laboratory diet and tap water ad libitum during this period. Preparation of Cell Lysates from Rat Tissues—Apg10p in lysates of rat brain, liver, kidney, heart, skeletal muscle, and spleen was immunoprecipitated with anti-mApg10p antibody, and recognized by immunoblotting using the antibody. Two-hybrid Analyses—Two-hybrid analysis was performed as described previously (22Komatsu M. Tanida I. Ueno T. Ohsumi M. Ohsumi Y. Kominami E. J. Biol. Chem. 2001; 276: 9846-9854Abstract Full Text Full Text PDF PubMed Scopus (80) Google Scholar). Isolation and Identification of Mouse APG10 cDNA and Its Gene Product—To investigate the E2-like enzyme essential for the mammalian Apg12p conjugation system, we first isolated a cDNA to a mouse APG10 homologue. A BLAST search of the EST data base with the amino acid sequence of yeast Apg10p indicated a candidate mouse Apg10p homologue (GenBank™ accession numbers, AI152249 and AI594591). Based on the DNA sequences of two EST clones, a cDNA to mouse Apg10p was isolated by 5′-RACE using a mouse brain cDNA library as a template (GenBank™ accession number, AB079383). The predicted amino acid sequence of the isolated clone (calculated molecular mass, 24.3 kDa) shows 10.0% identity and 22.5% similarity to yeast Apg10p, and the region including the predicted active-site cysteine residue (Cys161) is significantly conserved between the isolated clones and yeast Apg10p (47.7% similarity) (Fig. 1). Apg10p Interacts with Apg12p via the Carboxyl-terminal Glycine within Apg12p Dependent on Apg7p—Yeast Apg10p interacts with yeast Apg12p, its substrate, depending on yeast Apg7p, an E1-like enzyme for yeast Apg12p (23Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (235) Google Scholar). If the isolated clone encodes an authentic E2-like enzyme essential to mammalian Apg12p, its gene product will interact with mammalian Apg12p. We then investigated whether its gene product (Apg10p) interacts with human Apg12p by immunoprecipitation. We expressed YFPmApg10p (pYFP-mApg10) and FLAGhApg12p (pCMV-tag2B-hApg12) in the presence of human Apg7p in HEK293 cells. When FLAGhApg12p in the lysate of the transfectant was immunoprecipitated with anti-FLAG antibody, YFPmApg10p coprecipitated with FLAGhApg12p (Fig. 2A, lane 2, IP, anti-FLAG, WB, anti-FLAG and mApg10p). Apg12p also coprecipitated with Apg10p when the anti-mApg10p antibody was used (Fig. 2A, lane 2, IP, anti-mApg10p; WB, anti-FLAG). In the absence of Apg7p, little interaction occurred (Fig. 2A, lane 1). These results indicate that Apg10p interacts with Apg12p dependent on Apg7p. When mutant FLAGhApg12pΔG, which lacks the carboxyl-terminal glycine of wild-type FLAGhApg12p was expressed in HEK293 cells, little interaction of YFPmApg10p with FLAGhApg12pΔG was recognized even in the presence of Apg7p (Fig. 2A, lane 5 versus lane 4). These results indicate that the interaction of Apg10p with Apg12p in the presence of Apg7p is dependent on the carboxyl-terminal glycine of Apg12p that is essential for the conjugation reaction (Fig. 2A, lane 5). Yeast Apg10p also interacts with yeast Apg7p, an E1-like enzyme (23Shintani T. Mizushima N. Ogawa Y. Matsuura A. Noda T. Ohsumi Y. EMBO J. 1999; 18: 5234-5241Crossref PubMed Scopus (235) Google Scholar). Considering that Apg10p interacts with Apg12p dependent on Apg7p (Fig. 2A), it is likely that mammalian Apg10p would also interact with Apg7p. We next studied whether mammalian Apg10p interacts with Apg7p in HEK293 cells. YFPmApg10p was expressed together with human Apg7p, and immunoprecipitated with anti-mApg10p antibody. When both YFPmApg10p and Apg7p were expressed, Apg7p coprecipitated with YFPmApg10p using the anti-mApg10p antibody (Fig. 2B, lane 1). When Apg7p alone was expressed, little Apg7p was immunoprecipitated with this antibody (Fig. 2B, lane 2). These results indicate that Apg10p interacts with Apg7p and Apg12p in mammals, as is the case in yeast. Mutant Apg10pC161S Forms a Stable Intermediate with Apg12p Dependent on Apg7p—As previously reported (31Tanida I. Tanida-Miyake E. Komatsu M. Ueno T. Kominami E. J. Biol. Chem. 2002; 277: 13739-13744Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar, 32Sullivan M.L. Vierstra R.D. J. Biol. Chem. 1993; 268: 8777-8780Abstract Full Text PDF PubMed Google Scholar, 33Mo Y.Y. Yu Y. Shen Z. Beck W.T. J. Biol. Chem. 2002; 277: 2958-2964Abstract Full Text Full Text PDF PubMed Scopus (89) Google Scholar), when an active site cysteine within E2 (or E2-like) enzyme is changed to serine, a stable intermediate between substrate and enzyme is formed in the presence of the respective E1 (or E1-like) enzyme. Therefore, if the isolated mouse Apg10p is an authentic E2-like enzyme essential for Apg12p conjugation in cooperation with Apg7p, a mutant Apg10p (Apg10pC161S), in which the predicted active site cysteine positioned at 161 has been changed to serine by site directed mutagenesis, will form a stable intermediate with Apg12p in the presence of Apg7p. Then, we expressed both a mutant YFPmApg10pC161S and FLAGhApg12p in the absence or presence of Apg7p in HEK293 cells (Fig. 3A, lanes 1 and 2). Apg7p, YPFmApg12pC161S, and FLAGhApg12p were expressed well in the cells (Fig. 3A, Apg7p, YFPmApg10pCS, and FLAGApg12p). When Apg7p was overexpressed, a stable intermediate was recognized by immunoblotting using anti-mApg10p and anti-FLAG antibodies (Fig. 3A, YFPmApg10pCS-FLAGhApg12p). When FLAGhApg12pΔG, which lacks the carboxyl-terminal glycine, was expressed instead of wild-type FLAGhApg12p together with Apg7p and YFPmApg10pC161S, no intermediate was recognized (Fig. 3A, lane 3). These results indicate that the cysteine positioned at 161 is an authentic active-site cysteine for the E2-like reaction of hApg12p via the carboxyl-terminal glycine within hApg12p. Mouse Apg10p Facilitates Apg12p-Apg5p Conjugate Formation—Considering the above results, the mammalian Apg10p would facilitate Apg12p-Apg5p conjugation. When FLAGhApg12p and mychApg5p were expressed in HEK293 cells, a small amount of the FLAGhApg12p-mychApg5p conjugate was recognized (Fig. 3B, lane 5). In the presence of human Apg7p, FLAGhApg12p conjugates to mychApg5p significantly as described previously (Fig. 3B, lane 3, Apg12p-Apg5p) (10Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar, 30Tanida I. Tanida-Miyake E Nishitani T. Komatsu M. Yamazaki H. Ueno T. Kominami E. Biochem. Biophys. Res. Commun. 2002; 292: 256-262Crossref PubMed Scopus (27) Google Scholar). When FLAGmApg10p was expressed in addition to human Apg7p, the formation of the FLAGhApg12p-mychApg5p conjugate was facilitated significantly (Fig. 3B, lane 1). Without overexpressed Apg7p, a significant reduction in the amount of conjugate occurred even in the presence of Apg10p (Fig. 3B, lane 2 versus lane 5). A mutant Apg12p (FLAGhApg12pΔG) hardly conjugated to mychApg5p even in the presence of Apg7p and Apg10p, because the carboxyl-terminal glycine of Apg12p is essential for the conjugation (Fig. 3B, lane 4, ΔG). These results indicate that Apg10p facilitates Apg12p-Apg5p conjugation dependent on human Apg7p. An Active-site Cysteine Mutant, Apg10pC161S, Inhibits the Effect of Overexpression of Apg7p on Apg12p Conjugation— Considering the reaction of the E2-like enzyme, it is probable that a mutant Apg10pC161S inhibits the Apg12p conjugation even in the presence of endogenous Apg10p in mammalian cells. To investigate whether Apg10pC161S inhibits the formation of the Apg12p-Apg5p conjugate, YFPmApg10pC161S was expressed together with FLAGhApg12p and mychApg5p, in the presence or absence of Apg7p. When YFPmApg10p was expressed with FLAGhApg12p and mychApg5p, FLAGhApg12pmychApg5p conjugate was formed (Fig. 4, lane 1, WB, anti-Myc, FLAGhApg12-mychApg5). When YFPmApg10pC161S was expressed instead of wild-type YFPmApg10p together with FLAGhApg12p, and mychApg5p, little conjugate was recognized (Fig. 4, lane 2). The overexpression of human Apg7p stimulated the Apg12p conjugation reaction, as shown above (10Tanida I. Tanida-Miyake E. Ueno T. Kominami E. J. Biol. Chem. 2001; 276: 1701-1706Abstract Full Text Full Text PDF PubMed Scopus (275) Google Scholar). However, when mutant Apg10pC161S was expressed instead of wild-type Apg10p, the formation of the Apg12p-Apg5p conjugate was almost completely inhibited even in the presence of Apg7p. Essentially the same result was obtained, when FLAGmApg10pC161S was expressed instead of wild-type FLAGmApg10p together with GFPhApg12p, mychApg5p, and Apg7p (Fig. 4B, lane 5 versus lane 6, WB, anti-Myc, GFPhApg12p-mychApg5p). These results indicate that the overexpression of mutant Apg10pC161S inhibits the formation of the Apg12p-Apg5p conjugate even in the presence of Apg7p. Overexpression of Mouse Apg10 Facilitates the Modification of a Soluble Form of MAP-LC3 to a Membrane-bound Form—A cytosolic MAP-LC3 (a soluble form of MAP-LC3, MAP-LC3-I) is modified to a membrane-bound form (MAP-LC3-II) to form autophagosomes after the Apg12p-Apg5p conjugate associates with autophagosomal precursors (20Kabeya Y. Mizushima N. Ueno T. Yamamoto A. Kirisako T. Noda T. Kominami E. Ohsumi Y. Yoshimori T. EMBO J. 2000; 19: 5720-5728Crossref PubMed Scopus (5468) Google Scholar). The modification of the soluble form of MAP-LC3 to the membrane-bound form following the Apg12p-Apg5p conjugation is essential for mammalian autophagy (29Mizushima N. Yamamoto A. Hatano M. Kobayashi Y. Kabeya Y. Suzuki K. Tokuhisa T. Ohsumi Y. Yoshimori T. J. Cell Biol. 2001; 152: 657-668Crossref PubMed Scopus (1161) Google Scholar). Recently, we showed that Apg3p, an E2-like enzyme essential for the modification of MAP-LC3, facilitates the conjugation of Apg12p-Apg5p, suggesting functional crosstalk between Apg12p conjugation and MAP-LC3 modification (31Tanida I. Tanida-Miyake E. Komatsu M. Ueno T. Kominami E. J. Biol. Chem. 2002; 277: 13739-13744Abstract Full Text Full Text PDF PubMed Scopus (220) Google Scholar). Therefore, it is possible that Apg10p influences the modification of MAP-LC3 in reverse. We then investigated whether the overexpression of mammalian Apg

Murine Atg8L/Apg8L has significant homology with the other known mammalian Atg8 homologs, LC3, GABARAP and GATE‐16. However, it is unclear whether murine Atg8L modification is mediated by human Atg4B, Atg7 and Atg3. Expression of Atg8L in HEK293 cells led to cleavage of its C‐terminus. In vitro , the C‐terminus of Atg8L was cleaved by human Atg4B, but not human Atg4A or Atg4C. Atg8L‐I formed an E1‐substrate intermediate with Atg7 C572S , and an E2‐substrate intermediate with Atg3 C264S . A modified form of Atg8L was detected in the pelletable fraction in the presence of lysosomal protease inhibitors under nutrient‐rich conditions. Cyan fluorescent protein (CFP)–Atg8L colocalized with yellow fluorescent protein (YFP)–LC3 in HeLa cells in the presence of the inhibitors. However, little accumulation of the modified form of Atg8L was observed under conditions of starvation. These results indicate that Atg8L is the fourth modifier of mammalian Atg8 conjugation.

ATG7 is an autophagy-related E1-like enzyme that is essential for two ubiquitination-like reactions, ATG12-conjugation and LC3-lipidation. The existence of functional sequences at the amino-terminal region of human ATG7 remains uncertain. Mutational analyses of ATG7 revealed that both mutant ATG7ΔFAP lacking the FAP motif and ATG7FAPtoDDD, in which the Phe15-Ala16-Pro17 sequence was changed to Asp-Asp-Asp, could not complement defects in endogenous ATG12-conjugation and LC3-lipidation when expressed in Atg7-deficient mouse embryonic fibroblasts (MEFs). However, wild-type ATG7 complemented the defects in these cells. Overexpression of GFP-ATG10 and GFP-ATG12 rescued a defect in ATG12-conjugation in Atg7-deficient MEFs expressing mutant ATG7ΔFAP and ATG7FAPtoDDD, whereas overexpression of all ATG proteins related to ATG12-conjugation and LC3-lipidation could not rescue a defect in LC3-lipidation in Atg7-deficient MEFs expressing these ATG7 mutants. Both ATG7ΔFAP and ATG7FAPtoDDD mutants showed severe defects in the formation of an E2-substrate intermediate of ATG3 with LC3 in LC3-lipidation, but were able to form an E1-substrate intermediate of ATG7 with LC3 and the E1- and E2-substrate intermediates in ATG12-conjugation with reduced efficiency. These ATG7 mutants could also form the ATG12-ATG3 conjugate. Co-immunoprecipitation experiments revealed that the FAP motif of ATG7 is essential for the interaction of ATG7 with ATG3, but not for ATG7-homodimerization. These results indicated that the FAP motif of ATG7 is indispensable for formation of the ATG3-LC3 E2-substrate intermediate through the interaction of ATG7 with ATG3.

Multipurpose cohort studies have demonstrated that coffee consumption reduces the risk of hepatocellular carcinoma (HCC). Given that one of the main causes of HCC is hepatitis C virus (HCV) infection, we examined the effect of caffeic acid, a major organic acid derived from coffee, on the propagation of HCV using an in vitro naïve HCV particle-infection and production system within human hepatoma-derived Huh-7.5.1-8 cells. When cells were treated with 1% coffee extract or 0.1% caffeic acid for 1-h post HCV infection, the amount of HCV particles released into the medium at 3 and 4 days post-infection considerably decreased. In addition, HCV-infected cells cultured with 0.001% caffeic acid for 4 days, also released less HCV particles into the medium. Caffeic acid treatment inhibited the initial stage of HCV infection (i.e., between virion entry and the translation of the RNA genome) in both HCV genotypes 1b and 2a. These results suggest that the treatment of cells with caffeic acid may inhibit HCV propagation.

<h2>Abstract</h2> Caffeic acid (CA), a coffee-related natural compound, has various beneficial biological effects, including antiviral effects. Our former studies demonstrated that the CA dose-dependently inhibited the <i>in vitro</i> infection with <i>Dabie bandavirus</i>, which was previously named as severe fever with thrombocytopenia syndrome virus (SFTSV), mainly at the step of virus attachment. Therefore, we studied the structural basis of CA for conferring anti-SFTSV activity to clarify the mechanism of action of CA against SFTSV. In this study, the anti-SFTSV activity of nine CA analogs were examined. The treatment of SFTSV with the 3,4-dihydroxyhydrocinnamic acid (DHCA) as well as CA inhibited the SFTSV infection in a dose-dependent manner, whereas other CA analogs did not. Both CA and DHCA only possessed the <i>o</i>-dihydroxybenzene backbone. When SFTSV was treated with catechol (<i>o</i>-dihydroxybenzene), SFTSV infection was also dose-dependently inhibited. Additionally, four compounds having the <i>o</i>-dihydroxybenzene backbone; CA phenethyl ester, methyl CA, 3,4-dihydroxyphenylacetic acid, and 3,4-dihydroxybenzoic acid, dose-dependently inhibited the viral infection, although these compounds were more toxic or less effective than CA. In conclusion, the <i>o</i>-dihydroxybenzene backbone in CA and its analogs was a critical structure for the anti-SFTSV activity. Based on these findings, modifications of the <i>o</i>-dihydroxybenzene backbone with various other residues might improve the antiviral effect and cytotoxicity for SFTSV.

We compared the membrane proteins of autolysosomes isolated from leupeptin-administered rat liver with those of lysosomes. In addition to many polypeptides common to the two membranes, the autolysosomal membranes were found to be more enriched in endoplasmic reticulum lumenal proteins (protein-disulfide isomerase, calreticulin, ER60, BiP) and endosome/Golgi markers (cation-independent mannose 6-phosphate receptor, transferrin receptor, Golgi 58-kDa protein) than lysosomal membranes. The autolysosomal membrane proteins include three polypeptides (44, 35, and 32 kDa) whose amino-terminal sequences have not yet been reported. Combining immunoblotting and reverse transcriptase-polymerase chain reaction analyses, we identified the 44-kDa peptide as the intact subunit of betaine homocysteine methyltransferase and the 35- and 32-kDa peptides as two proteolytic fragments. Pronase digestion of autolysosomes revealed that the 44-kDa and 32-kDa peptides are present in the lumen, whereas the 35-kDa peptide is not. In primary hepatocyte cultures, the starvation-induced accumulation of the 32-kDa peptide occurs in the presence of E64d, showing that the 32-kDa peptide is formed from the sequestered 44-kDa peptide during autophagy. The accumulation is induced by rapamycin but completely inhibited by wortmannin, 3-methyladenine, and bafilomycin. Thus, detection of the 32-kDa peptide by immunoblotting can be used as a streamlined assay for monitoring autophagy. We compared the membrane proteins of autolysosomes isolated from leupeptin-administered rat liver with those of lysosomes. In addition to many polypeptides common to the two membranes, the autolysosomal membranes were found to be more enriched in endoplasmic reticulum lumenal proteins (protein-disulfide isomerase, calreticulin, ER60, BiP) and endosome/Golgi markers (cation-independent mannose 6-phosphate receptor, transferrin receptor, Golgi 58-kDa protein) than lysosomal membranes. The autolysosomal membrane proteins include three polypeptides (44, 35, and 32 kDa) whose amino-terminal sequences have not yet been reported. Combining immunoblotting and reverse transcriptase-polymerase chain reaction analyses, we identified the 44-kDa peptide as the intact subunit of betaine homocysteine methyltransferase and the 35- and 32-kDa peptides as two proteolytic fragments. Pronase digestion of autolysosomes revealed that the 44-kDa and 32-kDa peptides are present in the lumen, whereas the 35-kDa peptide is not. In primary hepatocyte cultures, the starvation-induced accumulation of the 32-kDa peptide occurs in the presence of E64d, showing that the 32-kDa peptide is formed from the sequestered 44-kDa peptide during autophagy. The accumulation is induced by rapamycin but completely inhibited by wortmannin, 3-methyladenine, and bafilomycin. Thus, detection of the 32-kDa peptide by immunoblotting can be used as a streamlined assay for monitoring autophagy. Autophagy is a universal process by which cellular proteins are degraded via a lysosomal/vacuolar system. Depending on the extracellular nutrient conditions, the rate of autophagic protein degradation fluctuates between 1–1.5% and 4–5% of total cell proteins per hour (1Schworer C.M. Schiffer K.A. Mortimore G.E. J. Biol. Chem. 1981; 256: 7652-7658Abstract Full Text PDF PubMed Google Scholar, 2Seglen P.O. Gordon P.B. Poli A. Biochim. Biophys. Acta. 1980; 630: 103-118Crossref PubMed Scopus (135) Google Scholar). There are two pathways of autophagy, microautophagy and macroautophagy (for reviews, see Refs. 3Seglen P.O. Bohley P.B. Experientia (Basel). 1992; 48: 158-172Crossref PubMed Scopus (370) Google Scholar and 4Dunn W.A. Trends Cell Biol. 1994; 4: 139-143Abstract Full Text PDF PubMed Scopus (444) Google Scholar). In microautophagy, relatively small portions of the cytoplasm are directly enclosed by invaginating lysosomal membranes for subsequent sequestration and degradation. Degradation of bulky cell constituents by the lysosome/vacuole system occurs via macroautophagy. In the initial step of macroautophagy, various cytosolic proteins, as well as cytoplasmic organelles such as mitochondria, endoplasmic reticulum (ER), 1The abbreviations used are: ER, endoplasmic reticulum; FCS, fetal calf serum; PAGE, polyacrylamide gel electrophoresis; CI-M6PR, cation-independent mannose 6-phosphate receptor; E64c, (+)-(2S,3S)-3-[(S)-methyl-1-(3-methylbutylcarbamoyl)-butylcarbamoyl]-2-oxiranecarboxylic acid; E64d, ethyl-(+)-(2S,3S)-3-[(S)-methyl-1-(3-methyl-butylcarbamoyl)-butylcarbamoyl]-2-oxiranecarboxylate; Caps, 3-cyclo- hexylaminopropanesulfonic acid; Tes, N-tris(hydroxymethyl)-2aminoethanesulfonic acid; PVDF, polyvinylidene fluoride; BiP, immunoglobulin heavy chain binding protein; BHMT, betaine homocysteine methyltransferase; α-p44–10R, antibody raised against the NH2terminal 10 amino acid residues (APIAGKKAKR) of the intact subunit of BHMT; α-p35–10R, antibody raised against the NH2-terminal 10 amino acid residues (YVAEKISGQK) of the 35-kDa fragment of BHMT; α-p35–5R, antibody raised against the NH2-terminal 5 amino acid residues (YVAEK) of the 35-kDa fragment of BHMT; α-p32–10R, antibody raised against the NH2-terminal 10 amino acid residues (KISGQKVNEA) of the 32-kDa fragment of BHMT; α-p32–5R, antibody raised against the NH2-terminal 5 amino acid residues (KISGQ) of the 32-kDa fragment of BHMT; KRB, Krebs-Ringer bicarbonate; RACE, rapid amplification of cDNA ends; RT, reverse transcriptase; PCR, polymerase chain reaction. and peroxisomes, are sequestered in the lumen of double-membraned autophagosomes. Autophagosomes then fuse with endosomes or lysosomes to become mature, single-membraned autolysosomes. Acidification of the lumen and acquisition of lysosomal hydrolytic enzymes enable this specialized membrane system to degrade sequestered cytoplasmic components. The origin of the autophagosomal membrane is a subject of controversy. Extensive morphological analyses by Dunn (5Dunn W.A. J. Cell Biol. 1990; 110: 1923-1933Crossref PubMed Scopus (515) Google Scholar) indicated that the autophagosomal membrane derives from the rough ER. However, the post-Golgi membrane, as well as a unique de novo synthesized membrane, the phagophore, have also been proposed as sources (6Yamamoto A. Masaki R. Tashiro Y. J. Histochem. Cytochem. 1990; 38: 573-580Crossref PubMed Scopus (82) Google Scholar, 7Seglen P.O. Glaumann H. Ballard F.J. Lysosomes: Their Role in Protein Breakdown. Academic Press Inc., London1987: 371-414Google Scholar). In recent morphological studies on yeast autophagy (8Baba M. Takeshige K. Baba N. Ohsumi Y. J. Cell Biol. 1994; 124: 903-913Crossref PubMed Scopus (404) Google Scholar, 9Liou W. Geuze H.J. Slot J.W. Histochem. Cell Biol. 1996; 106: 41-58Crossref PubMed Scopus (439) Google Scholar), autophagosomal membranes were found to have features distinct from those of other pre-existing cell membranes. This appears to support the notion that the membrane may have a unique origin. Understanding the molecular organization of the autophagosomal membrane is important for understanding the mechanism of autophagy at the membrane level, since various key molecules involved in or necessary for the formation and fusion of autophagosomes are likely to exist on the autophagosomal membrane. In order to characterize the autophagosomal membrane, it is necessary to isolate autophagosomes. However, autophagosomal maturation proceeds so quickly that it is very difficult to isolate autophagosomes of sufficient purity and in quantities suitable for biochemical analyses. Therefore, we decided to take an indirect approach. Autolysosomes isolated from leupeptin-administered rat liver have some advantages. First, they can be easily purified by Percoll-gradient centrifugation and obtained in quantity (10Furuno K. Ishikawa T. Kato K. J. Biochem. (Tokyo). 1982; 91: 1485-1494Crossref PubMed Scopus (61) Google Scholar, 11Furuno K. Ishikawa T. Kato K. J. Biochem. (Tokyo). 1982; 91: 1943-1950Crossref PubMed Scopus (27) Google Scholar). Second, effective inhibition of lysosomal proteolysis by leupeptin keeps many of the sequestered cytoplasmic proteins apparently active or undegraded (12Kominami E. Hashida S. Khairallah E.A. Katunuma N. J. Biol. Chem. 1983; 258: 6093-6100Abstract Full Text PDF PubMed Google Scholar,13Ueno T. Muno D. Kominami E. J. Biol. Chem. 1991; 266: 18995-18999Abstract Full Text PDF PubMed Google Scholar). As a result, it is expected that some membrane components characteristic of autophagosomes may also be preserved on autolysosomal membranes. In a previous study (13Ueno T. Muno D. Kominami E. J. Biol. Chem. 1991; 266: 18995-18999Abstract Full Text PDF PubMed Google Scholar), we found that isolated autolysosomal membranes possess two ER membrane proteins, cytochrome P450 and NADPH-cytochrome P450 reductase. These results are consistent with those of Dunn (5Dunn W.A. J. Cell Biol. 1990; 110: 1923-1933Crossref PubMed Scopus (515) Google Scholar) in showing that autophagosomes originate from the ER. It is interesting to clarify other components in isolated autolysosomal membranes, especially in relation to autophagosomes. In this study, we systematically analyzed membrane proteins in isolated autolysosomes by two dimensional gel electrophoresis and compared the results with those of lysosomes isolated from dextran-loaded rat liver. Male Wistar rats (250–300 g) were maintained in an environmentally controlled room (lights on 6:00 to 20:00) for at least 2 weeks before experiments. All rats were fed a standard pelleted laboratory diet and tap water ad libitum during this period. For all experiments, the rats were starved for 12–18 h before use. Hepatocytes were isolated from 18 h-starved male Wistar rats by a collagenase perfusion procedure (14Tanaka K. Sato M. Tomita Y. Ichihara A. J. Biochem. (Tokyo). 1978; 84: 937-946Crossref PubMed Scopus (351) Google Scholar). The hepatocytes were seeded at a density of 105 cells/0.2 ml/cm2 and cultured in Williams E medium supplemented with 10% fetal calf serum (Williams E/10% FCS). Protein was determined by the BCA protein assay following the manufacturer's protocol (Pierce). Sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was carried out according to the method of Laemmli (15Laemmli U.K. Nature. 1970; 227: 680-685Crossref PubMed Scopus (207537) Google Scholar). Immunoblot analyses were performed according to the method of Towbin et al. (16Towbin H. Staehelin T. Gordon J. Proc. Natl. Acad. Sci. U. S. A. 1982; 76: 4350-4354Crossref Scopus (44939) Google Scholar) except that 2,4-dichloro-1-naphthol (17Kobayashi R. Tashima Y. Anal. Biochem. 1989; 183: 9-12Crossref PubMed Scopus (39) Google Scholar) or an ECL Western blot detection kit (Amersham Pharmacia Biotech) was used as the substrate for the horseradish peroxidase conjugate of the second antibodies. β-Hexosamidase activity was measured as described by Lusis et al. (18Lusis A.J. Tomono S. Paigen K. J. Biol. Chem. 1976; 251: 7753-7760Abstract Full Text PDF PubMed Google Scholar) using 4-methyl-umbelliferyl-β-d-glucosaminide as the substrate. Antibodies against synthetic pentapeptides and decapeptides corresponding to the amino-terminal sequences of three unidentified polypeptides in autolysosomal membranes were produced in rabbits as described by Liu et al. (19Liu F.-T. Zinnecker M. Hamaoka T. Katz D.H. Biochemistry. 1979; 18: 690-697Crossref PubMed Scopus (331) Google Scholar). Antibodies were affinity-purified on immobilized peptide-Sepharose columns. Antibody against a synthetic peptide corresponding to a sequence in rab 7 (residues 175–191) was produced in rabbits as described by Chavrieret al. (20Chavrier P. Parton R.G. Hauri H.P. Simons K. Zerial M. Cell. 1990; 62: 317-329Abstract Full Text PDF PubMed Scopus (891) Google Scholar). Antibody to cation-independent mannose 6-phosphate receptor (CI-M6PR) was produced in rabbits as described (21Muno D. Ishidoh K. Ueno T. Kominami E. Arch. Biophys. Biochem. 1993; 306: 103-110Crossref PubMed Scopus (50) Google Scholar). Commercially available antibodies were purchased from the following sources: antibodies against rab 5A, trimeric GTP-binding protein subunits Gsα, Gi-2α, and Gi-3α from Santa Cruz Biochemicals; antibody to Golgi 58-kDa protein from Sigma. A monoclonal antibody against transferrin receptor was produced as described by White et al. (22White S. Miller K. Hopkins C. Trowbridge I.S. Biochim. Biophys. Acta. 1992; 1136: 28-34Crossref PubMed Scopus (59) Google Scholar) and kindly donated by Dr. Ian Trowbridge. Percoll was obtained from Amersham Pharmacia Biotech (Uppsala, Sweden). Pronase E (Streptomyces griseus protease, type XXV) and dextran (M r = 70,000) were obtained from Sigma. [α-32P]GTP was obtained from NEN Life Science Products. Leupeptin and pepstatin were purchased from Peptide Institute Inc. (Osaka, Japan). E64c and E64d were donated by Dr. Kazuhiro Hanada (Taisho Pharmaceutical Co., Saitama, Japan). Rapamycin and wortmannin were obtained from Wako Pure Chemical Industries, Ltd. (Osaka, Japan). Autolysosomes (referred to as autophagic vacuoles in our previous study) and dextran-loaded lysosomes (hereafter designated lysosomes) were prepared from rats according the procedure of Uenoet al. (13Ueno T. Muno D. Kominami E. J. Biol. Chem. 1991; 266: 18995-18999Abstract Full Text PDF PubMed Google Scholar). Autolysosomal and lysosomal membranes were isolated by centrifugation on a discontinuous sucrose gradient (13Ueno T. Muno D. Kominami E. J. Biol. Chem. 1991; 266: 18995-18999Abstract Full Text PDF PubMed Google Scholar), except that the final carbonate treatment of the membranes to remove peripheral membrane proteins was omitted. As for autolysosomes, the vast majority of proteins were recovered in the pellets after discontinuous sucrose gradient centrifugation. This sediment fraction consisted of sequestered protein aggregates denatured in the acidic milieu of the autolysosomal lumen (23Furuno K. Miyamoto K. Ishikawa T. Kato K. J. Biochem. (Tokyo). 1984; 95: 671-678Crossref PubMed Scopus (12) Google Scholar) and was used for the experiments shown in Fig. 5. Protein separation by two-dimensional gel electrophoresis was performed according to the method of O'Farrellet al. (24O'Farrell P.Z. Goodman H.M. O'Farrell P.H. Cell. 1977; 12: 1133-1141Abstract Full Text PDF PubMed Scopus (2583) Google Scholar) with slight modifications. For isoelectric focusing, the gels were polymerized in Pyrex tubes (inner diameter, 3 mm; height, 12 cm) to give a gel height of 9.5 cm. Gels containing 4% acrylamide, 0.22%N,N′-methylene-bis-(acrylamide), 9.2m urea, 2.5% Nonidet P-40, 1.5% octyl glucoside, 1.2% Ampholine (pH 5–8), 0.4% Ampholine (pH 3.5–9.5), and 0.4% Ampholine (pH 4–6) were prepared for analyses at acidic pH (pH 4–7). The electrode solutions used were 20 mm NaOH (cathode) and 0.2m phosphoric acid (anode). Gels containing 4% acrylamide, 0.22% N,N′-methylene-bis(acrylamide), 9.2m urea, 2% Nonidet P-40, 0.5%n-dodecyl-β-d-maltoside, 1.6% Ampholine (pH 7–9), and 0.4% Ampholine (pH 3.5–9.5) were prepared for analyses at alkaline pH (pH 6–8). The electrode solutions used were 0.1m NaOH (cathode) and 10 mm phosphoric acid (anode). All samples applied to a gel contained the same amount of protein. SDS-PAGE in the second dimension was performed using 5–15% linear gradient gels. After SDS-PAGE, the gels were fixed in 50% methanol containing 10% acetic acid, and subsequently silver-stained. For amino-terminal amino acid sequence analysis, the proteins separated by two- dimensional gel electrophoresis were electrophoretically transferred onto PVDF membranes (Immobilon PSQ, Millipore Corp.) using 10 mm Caps (pH 11) containing 20% methanol as the electrode buffer. The membrane was stained with Coomassie Brilliant Blue, destained with 10% acetic acid containing 50% methanol (destaining solution), and air-dried. Pieces containing individual spots were cut out and soaked in destaining solution, washed several times with 10% acetic acid, and air-dried. The amino-terminal amino acid sequences of proteins fixed on Immobilon PSQ membranes were determined with a protein sequencer (Hewlet Packard, model G1005A). GTP blotting assays were carried out according to the method of Huber et al. (25Huber L.A. Pimplikar S. Parton R.G. Vitra H. Zerial M. Simons K. J. Cell Biol. 1993; 123: 35-45Crossref PubMed Scopus (384) Google Scholar). Autolysosomal and lysosomal membrane proteins resolved by isoelectric focusing and subsequent SDS-PAGE in the second dimension (15% gels), as described in the previous section, were electrophoretically transferred onto nitrocellulose membranes (Advantec Toyo, Tokyo, Japan). The nitrocellulose membrane sheets were incubated with [α-32P]GTP (10 μCi) in the presence of 4 μm ATP at room temperature for 2 h, washed with 50 mm NaH2PO4 (pH 7.5) containing 10 μm MgCl2, 0.2% Tween 20, 4 μmATP, and 2 mm dithioerythritol, and then air-dried. The incorporation of radioactive GTP was detected by autoradiography. Identical sheets were used for immunoblots to identify rab GTP-binding proteins after washing the sheets with 1% acetic acid to remove membrane-bound GTP. Freshly isolated autolysosomes were incubated at 0 °C in medium (1 ml) containing 5 mm Tes (pH 7.5), 0.3 m sucrose, and Pronase E (0.2–0.8 mg/ml) in the presence or absence of 0.2% Triton X-100. The reaction was stopped by adding an equal volume of 10% trichloroacetic acid. The pellets were collected by centrifugation at 5,000 ×g for 5 min, neutralized with a minimal volume of 0.5m Na2CO3, and vigorously shaken on a microtube shaker for 5 min. The samples were then solubilized with SDS-PAGE sample buffer, boiled in a water bath for 3 min, and electrophoresed in 10% SDS-polyacrylamide gels. Total RNA extracted from rat liver was subjected to guanidium thiocyanate/CsCl ultracentrifugation (26Chirgwin J.M. Przybyla A.E. MacDonald R.J. Rurrer W.J. Biochemistry. 1979; 18: 5294-5299Crossref PubMed Scopus (16652) Google Scholar). Poly(A) RNA was isolated from total RNA on oligo(dT)-cellulose according to the manufacturer's protocol. Degenerated primers deduced from the amino acid sequences at the protein level were synthesized: CCNATHGCNGGNAARAARGC designated as p44–1, AAYGCNGGNGARGTNGTNATTHGG as p44–2, GCNACYTCNGCRTCNCCYTCRTC as p32–1R, and GCNGCYTCRTTNACYTTYTGNCC as p32–2R. RT-PCR using the primer set p44-1 and p32-1R from rat liver poly(A)+ RNA was accomplished at an annealing temperature of 55 °C by an RT-PCR kit (Toyobo, Tokyo, Japan). An aliquot of sample was further subjected to nested PCR with the primer set p44–2 and p32–2R at an annealing temperature of 57 °C. After subcloning into pCRII vector (Invitrogen), some of the insert-positive clones were sequenced in an Applied System 373A sequencer by the dye-primer method. The amino acid sequence deduced from the nucleotide sequence was compared with the amino acid sequence determined at the protein level, and two clones were identified as the cDNA for p44. To isolate the 5′-region further upstream of the cDNA, we carried out the RACE reaction using nucleotide sequence primers including CCAGCTTGTCCTCACTTGCATAGA designated as Up-1 and CTGCATGACGTTGGATCCAGCTCTG as Up-2 for 5′-RACE at an annealing temperature of 57 °C with rat liver poly(A)+ RNA with a MarathonTM cDNA amplification kit (CLONTECH). After subcloning into pCRII vector, the nucleotide sequences were determined by the dye-primer method in an Applied 373A DNA sequencer. In order to identify as many polypeptides present in greater quantity in autolysosomal membranes than in lysosomal membranes as possible, we performed preparative two-dimensional gel electrophoretic analyses at different pH ranges to allow us to identify major membrane polypeptides directly by amino acid sequence determination. It should also be noted that the carbonate treatment of the membranes carried out in the previous study (13Ueno T. Muno D. Kominami E. J. Biol. Chem. 1991; 266: 18995-18999Abstract Full Text PDF PubMed Google Scholar) was omitted so as not to overlook peripheral membrane proteins. Fig. 1 shows silver-stained protein spots separated at pH 4–7 (Fig. 1, A and B) and pH 6–8 (Fig. 1, C and D). Basically, autolysosomal membranes and lysosomal membranes closely resemble one another, indicating that autolysosomes from leupeptin-treated liver have reached a substantial level of maturation. However, some spots appear to be more enriched, or present only in autolysosomal membranes (Fig. 1,A and C). The spots (a–u) shown byarrows (Fig. 1, A and C) were reproducibly found among different preparations, and because almost all of these spots could be stained by Coomassie Brilliant Blue after electrophoretic transfer to PVDF membranes, we attempted to identify the polypeptides by protein sequence analysis. The amino-terminal sequences of these polypeptides are summarized in Table I. Unambiguous sequences were not obtained for 9 of the 21 polypeptides analyzed, possibly due to blocked amino termini (spots d, p, and t) or insufficient amounts of amino acids detected (spots g, h, i, j, l, and n). Several major polypeptides separated by isoelectric focusing in the acidic pH range (Fig. 1A) were identified as ER lumenal proteins, including protein-disulfide isomerase, calreticulin, ER60 protease, and BiP. In contrast, no polypeptides were identified as being of post-Golgi membrane origin. There are five polypeptides (spots m, o, q, r, and u) whose amino-terminal sequences have not yet been reported. No further analysis was made of spot m, because the quantity obtained was too small; information on the sequence beyond residue 10 is not yet available. The remaining four components were identified as betaine homocysteine methyltransferase and its partially degraded fragments, as described below.Table IAmino-terminal sequences of autolysosomal membrane proteinsSpotSequenceIdentityaDDAIYFKEQFCalreticulinbDALEEEDNVLProtein-disulfide isomerasecEEEDKKEDVGBiP (GRP78)dUndeterminedUnknowneSDVLELTDENER-60 proteasefXDVLELTDENER-60 proteasegUndeterminedUnknownhUndeterminedUnknowniUndeterminedUnknownjUndeterminedUnknownkYPSSMDWRKKCathepsin HlUndeterminedUnknownmSARANGQYAEUnidentifiednUndeterminedUnknownoKISGQKVNEAUnidentifiedpUndeterminedUnknownqYVAEKISGQKUnidentifiedrKISGQKVNEAUnidentifiedsXHSLPDLPYDSuperoxide dismutasetUndeterminedUnknownuAPIAGKKAKRUnidentified Open table in a new tab As clearly seen in the previous section, there are no major Golgi/endosome components in amounts sufficient for identification by amino acid sequence determination. The immunoblots shown in Fig. 2A show that autolysosomal but not lysosomal membranes possess three Golgi/endosome markers, transferrin receptor, CI-M6PR, and Golgi 58-kDa protein. As transferrin receptor and CI-M6PR are early and late endosome markers, respectively, we took notice of the rab GTP-binding proteins, because it has been found that distinctive rab GTP-binding proteins characterize distinct compartments of intracellular membranes (27Novick P. Brennwald P. Cell. 1993; 75: 597-601Abstract Full Text PDF PubMed Scopus (316) Google Scholar). The GTP blots indicate that both autolysosomal and lysosomal membranes have almost identical sets of rab GTP-binding proteins, except that rab 5A, identified by immunoblot, is more abundant in lysosomal membranes than in autolysosomal membranes (Fig. 2B). Although no incorporation of [32P]GTP into rab7 is seen in the GTP blots, it is detected by immunoblot in both autolysosomal and lysosomal membranes (Fig. 2C). The roles of trimeric GTP-binding proteins in ER-Golgi transport, homotype membrane fusion of lysosomes, and in the maintenance of Golgi structures have been reported recently (28Schwanninger R. Plutner R. Bokoch G.M. Balch W.E. J. Cell Biol. 1992; 119: 1077-1096Crossref PubMed Scopus (81) Google Scholar, 29Ward D.M. Leslie J.D. Kaplan J. J. Cell Biol. 1997; 139: 665-673Crossref PubMed Scopus (41) Google Scholar, 30Jamora C. Takizawa P.A. Zaarour R.F. Denesvre C. Faulkner D.J. Malhotra V. Cell. 1997; 91: 617-626Abstract Full Text Full Text PDF PubMed Scopus (104) Google Scholar). It has also been reported that trimeric GTP-binding protein subunits are associated with Golgi membranes and the trans-Golgi network (31Beron W. Colombo M.I. Mayorga L.S. Stahl P. Arch. Biochem. Biophys. 1995; 317: 337-342Crossref PubMed Scopus (39) Google Scholar, 32Maier O. Ehmsen E. Westermann P. Biochem. Biophys. Res. Commun. 1995; 208: 135-143Crossref PubMed Scopus (29) Google Scholar). We confirmed by immunoblotting that the trimeric GTP-binding protein subunits, Gsα and Giα, are associated with isolated autolysosomal and lysosomal membranes (Fig. 2D). Both Gi-2α and Gi-3α appear to be evenly distributed in the two membranes, whereas Gsα seems more abundant in autolysosomal membranes. As mentioned in the previous section, there are four major polypeptides (spots o, q,r, and u in Fig. 1) in autolysosomal membranes whose amino-terminal sequences have not yet been reported. Based on the apparent molecular sizes determined by mobility in SDS-PAGE, we designate spot u as p44 and spot q as p35. Spot o and spot r have identical sequences despite their apparently different pI values. We therefore designate the two components as p32 without further discrimination. We first attempted to determine as many amino acid residues as possible toward the carboxyl terminus by protein sequencing; the data are summarized in TableII. It appears obvious that p32 must be processed from p35, because, except for the first four amino acid residues, Y, V, A, and E, the two polypeptides have identical sequences. Immunoblot analyses using antibodies raised against synthetic decapeptides corresponding to 10 amino-terminal residues further support the possibility that both p35 and p32 derive from a common precursor form, p44. As Fig. 3shows, the antibody to p32 (α-p32–10R) recognized all three polypeptides and the p35 antibody (α-p35–10R) reacted with both p35 and p44 (Fig. 3, A and B).Table IIProtein sequence determination of three unidentified polypeptides associated with autolysosomal membranesSpotNameAmino-terminal amino acid sequenceop32KISGQKVNEAAXDIARQVADIARQVADEGDqp35YVAEKISGQKVNEAAXDrp32KISGQKVNEAAXDIARQVADIARQVADEGDup44APIAGKKAKRGILERLNAGEVVIGDGGFVFALEKRGYVKAGPWTPEAAVEaOnly the amino-terminal 10 residues could be determined for spot u separated by two-dimensional gel electrophoresis. The following 30 residues were determined for p44 immunoprecipitated using an anti-p44-peptide antibody (α-p44–10R).a Only the amino-terminal 10 residues could be determined for spot u separated by two-dimensional gel electrophoresis. The following 30 residues were determined for p44 immunoprecipitated using an anti-p44-peptide antibody (α-p44–10R). Open table in a new tab In order to confirm the above possibility further, we carried out RT-PCR using degenerated primer sets deduced from the amino acid sequences of p44 and p32 as described under “Experimental Procedures.” Fragments of about 250 base pairs were amplified and sequenced after subcloning into pCRII vector. The nucleotide sequences were 258 base pairs in length, and the deduced amino acid sequences contained the amino acid sequences of both p44 and p32 (Fig. 4A). To isolate a region on the 5′-upstream side of the cDNA for the precursor protein, 5′-RACE was carried out using the specific primers, Up-1 and Up-2. One clone isolated from the 5′-RACE reaction when subcloned into pCRII vector encodes the 5′-end of the precursor protein (Fig. 4B). The nucleotide sequence of this cDNA, which includes a region that overlaps with the first RT-PCR product, was subjected to a nucleotide sequence homology search using the computer package, BLAST. It was found that the nucleotide sequence of the cDNA for human betaine homocysteine methyltransferase (BHMT) (33Garrow T.A. J. Biol. Chem. 1996; 271: 22831-22838Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar) shows 86% identity at the nucleotide sequence level and 93% identity at the deduced amino acid sequence level to that of the cDNA clone isolated in our study. Thus, p35 and p32 have been identified as the proteolytic products of p44, i.e. rat BHMT. (Recently, the full-length cDNA for rat BHMT was registered in GenBank with accession number U96133.) BHMT is a major cytosolic protein accounting for nearly 1.6% of the total cytosolic protein in the liver (33Garrow T.A. J. Biol. Chem. 1996; 271: 22831-22838Abstract Full Text Full Text PDF PubMed Scopus (193) Google Scholar). We therefore reasoned that BHMT is originally sequestered as a cytoplasmic component, the substrate of autophagy, into autophagosomes, and subsequently degraded to p35 and p32 by some steps during the maturation process from autophagosomes to autolysosomes. To examine this possibility further, we attempted to determine if autolysosomal BHMT and the two fragments truly exist in the lumen. Since antibodies raised against synthetic peptides corresponding to the 10 amino-terminal residues of p35 and p32 (α-p35–10R and α-p32–10R) also recognized p44, we first tried to prepare peptide antibodies that do not react with p44 but more specifically recognize p35 or p32 to avoid complications to the experimental data. As the results of immunoblotting show (Fig. 5A, lane 2), antibody raised against the five amino-terminal residues of p35 (α-p35–5R) was found to react only with p35. Likewise, antibody raised against the five amino-terminal residues of p32 (α-p32–5R) recognized p32 but not p35 or p44 (Fig. 5A,lane 3). Using these newly prepared antibodies together with an anti-p44 antibody (α-p44–10R), we next analyzed the distribution of p44, p35, and p32 in autolysosomal subfractions. As shown in Fig. 5B, both p44 and p32 exist in autolysosomal membranes and t

Neutrophils play a key role in the control of Burkholderia pseudomallei, the pathogen that causes melioidosis. Here, we show that survival of intracellular B. pseudomallei was significantly increased in the presence of 3-methyladenine or lysosomal cathepsin inhibitors. The LC3-flux was increased in B. pseudomallei-infected neutrophils. Concordant with this result, confocal microscopy analyses using anti-LC3 antibodies revealed that B. pseudomallei-containing phagosomes partially overlapped with LC3-positive signal at 3 and 6 h postinfection. Electron microscopic analyses of B. pseudomallei-infected neutrophils at 3 h revealed B. pseudomallei-containing phagosomes that occasionally fused with phagophores or autophagosomes. Following infection with a B. pseudomallei mutant lacking the Burkholderia secretion apparatus Bsa Type III secretion system, neither this characteristic structure nor bacterial escape into the cytosol were observed. These findings indicate that human neutrophils are able to recruit autophagic machinery adjacent to B. pseudomallei-containing phagosomes in a Type III secretion system-dependent manner.

It is well known that occludin (OCLN) is involved in hepatitis C virus (HCV) entry into hepatocytes, but there has been no conclusive evidence that OCLN is essential for HCV infection. In this study, we first established an OCLN-knockout cell line derived from human hepatic Huh7.5.1-8 cells using the clustered regularly interspaced short palindromic repeat (CRISPR)/CRISPR-associated protein 9 system, in which two independent targeting plasmids expressing single-guide RNAs were used. One established cell clone, named OKH-4, had the OCLN gene truncated in the N-terminal region, and a complete defect of the OCLN protein was shown using immunoblot analysis. Infection of OKH-4 cells with various genotypes of HCV was abolished, and exogenous expression of the OCLN protein in OKH-4 cells completely reversed permissiveness to HCV infection. In addition, using a co-culture system of HCV-infected Huh7.5.1-8 cells with OKH-4 cells, we showed that OCLN is also critical for cell-to-cell HCV transmission. Thus, we concluded that OCLN is essential for HCV infection of human hepatic cells. Further experiments using HCV genomic RNA-transfected OKH-4 cells or HCV subgenomic replicon-harboring OKH-4 cells suggested that OCLN is mainly involved in the entry step of the HCV life cycle. It was also demonstrated that the second extracellular loop of OCLN, especially the two cysteine residues, is critical for HCV infection of hepatic cells. OKH-4 cells may be a useful tool for understanding not only the entire mechanism of HCV entry, but also the biological functions of OCLN.

Renal proximal tubular epithelial cells are significantly damaged during acute kidney injury. Renal proximal tubular cell-specific autophagy-deficient mice show increased sensitivity against renal injury, while showing few pathological defects under normal fed conditions. Considering that autophagy protects the proximal tubular cells from acute renal injury, it is reasonable to assume that autophagy contributes to the maintenance of renal tubular cells under normal fed conditions. To clarify this possibility, we generated a knock out mouse model which lacks Atg7, a key autophagosome forming enzyme, in renal proximal tubular cells (Atg7flox/flox;KAP-Cre+). Analysis of renal tissue from two months old Atg7flox/flox;KAP-Cre+ mouse revealed an accumulation of LC3, binding protein p62/sequestosome 1 (a selective substrate for autophagy), and more interestingly, Kim-1, a biomarker for early kidney injury, in the renal proximal tubular cells under normal fed conditions. TUNEL (TdT-mediated dUTP Nick End Labeling)-positive cells were also detected in the autophagy-deficient renal tubular cells. Analysis of renal tissue from Atg7flox/flox;KAP-Cre+ mice at different age points showed that tubular cells positive for p62 and Kim-1 continually increase in number in an age-dependent manner. Ultrastructural analysis of tubular cells from Atg7flox/flox;KAP-Cre+ revealed the presence of intracellular inclusions and abnormal structures. These results indicated that autophagy-deficiency in the renal proximal epithelial tubular cells leads to an increase in injured cells in the kidney even under normal fed conditions.

Post-fixation with osmium tetroxide staining and the embedding of Epon are robust and essential treatments that are used to preserve and visualize intracellular membranous structures during electron microscopic analyses. These treatments, however, can significantly diminish the fluorescent intensity of most fluorescent proteins in cells, which creates an obstacle for the in-resin correlative light-electron microscopy (CLEM) of Epon-embedded cells. In this study, we used a far-red fluorescent protein that retains fluorescence after osmium staining and Epon embedding to perform an in-resin CLEM of Epon-embedded samples. The fluorescence of this protein was detected in 100 nm thin sections of the cells in Epon-embedded samples after fixation with 2.5% glutaraldehyde and post-fixation with 1% osmium tetroxide. We performed in-resin CLEM of the mitochondria in Epon-embedded cells using a mitochondria-localized fluorescent protein. Using this protein, we achieved in-resin CLEM of the Golgi apparatus and the endoplasmic reticulum in thin sections of the cells in Epon-embedded samples. To our knowledge, this is the first reported use of a far-red fluorescent protein retains its fluorescence after osmium staining and Epon-embedding, and it represents the first achievement of in-resin CLEM of both the Golgi apparatus and the endoplasmic reticulum in Epon-embedded samples.

Abstract In innate immunity, multiple autophagic processes eliminate intracellular pathogens, but it remains unclear whether noncanonical autophagy and xenophagy are coordinated, and whether they occur concomitantly or sequentially. Here, we show that Streptococcus pneumoniae , a causative of invasive pneumococcal disease, can trigger FIP200-, PI3P-, and ROS-independent pneumococcus-containing LC3-associated phagosome (LAPosome)-like vacuoles (PcLVs) in an early stage of infection, and that PcLVs are indispensable for subsequent formation of bactericidal pneumococcus-containing autophagic vacuoles (PcAVs). Specifically, we identified LC3- and NDP52-delocalized PcLV, which are intermediates between PcLV and PcAV. Atg14L, Beclin1, and FIP200 were responsible for delocalizing LC3 and NDP52 from PcLVs. Thus, multiple noncanonical and canonical autophagic processes are deployed sequentially against intracellular S. pneumoniae . The Atg16L1 WD domain, p62, NDP52, and poly-Ub contributed to PcLV formation. These findings reveal a previously unidentified hierarchical autophagy mechanism during bactericidal xenophagy against intracellular bacterial pathogens, and should improve our ability to control life-threating pneumococcal diseases.

Abstract In-resin CLEM of Epon embedded samples can greatly simplify the correlation of fluorescent images with electron micrographs. The usefulness of this technique is limited at present by the low number of fluorescent proteins that resist CLEM processing. Additionally, no study has reported the possibility of two-color in-resin CLEM of Epon embedded cells. In this study, we screened for monomeric green and red fluorescent proteins that resist CLEM processing. We identified mWasabi, CoGFP variant 0, and mCherry2; two green and one red fluorescent proteins as alternatives for in-resin CLEM. We expressed mitochondria-localized mCherry2 and histone H2B tagged with CoGFP variant 0 in cells. Green and red fluorescence was detected in 100 nm-thin sections of the Epon-embedded cells. In the same thin sections, we correlated the fluorescent signals to mitochondria and the nucleus using a scanning electron microscope. Similar results were obtained when endoplasmic reticulum-localized mCherry2 and histone H2B tagged with CoGFP variant 0 were expressed in the cells. Two-color in-resin CLEM of two cytoplasmic organelles, mitochondria and endoplasmic reticulum, was also achieved using mitochondria-localized mCherry2 and endoplasmic reticulum-localized mWasabi. In summary, we report three new fluorescent protein-alternatives suitable for in-resin CLEM of Epon-embedded samples, and achieved Epon-based two-color in-resin CLEM.

Autophagy plays an essential role in preserving cellular homeostasis in pancreatic beta cells. However, the extent of autophagic flux in pancreatic islets induced in various physiological settings remains unclear. In this study, we generate transgenic mice expressing pHluorin-LC3-mCherry reporter for monitoring systemic autophagic flux by measuring the pHluorin/mCherry ratio, validating them in the starvation and insulin-deficient model. Our findings reveal that autophagic flux in pancreatic islets enhances after starvation, and suppression of the flux after short-term refeeding needs more prolonged re-starvation in islets than in the other insulin-targeted organs. Furthermore, heterogeneity of autophagic flux in pancreatic beta cells manifests under insulin resistance, and intracellular calcium influx by glucose stimulation increases more in high- than low-autophagic flux beta cells, with differential gene expression, including lipoprotein lipase. Our pHluorin-LC3-mCherry mice enable us to reveal biological insight into heterogeneity in autophagic flux in pancreatic beta cells.

In-resin CLEM (Correlative Light and Electron Microscopy) of Epon-embedded cells involves correlating fluorescence microscopy with electron microscopy in the same Epon-embedded ultrathin section. This method offers the advantage of high positional accuracy compared to standard CLEM. However, it requires the expression of recombinant proteins. In order to detect the localization of endogenous target(s) and their localized ultrastructures of Epon-embedded samples using in-resin CLEM, we investigated whether immunological and affinity-labeling using fluorescent dyes applied to in-resin CLEM of Epon-embedded cells. The orange fluorescent (λem ∼550 nm) and far-red (λem ∼650 nm) fluorescent dyes examined maintained a sufficient level of fluorescent intensity after staining with osmium tetroxide and subsequent dehydration treatment with ethanol. Immunological in-resin CLEM of mitochondria and the Golgi apparatus was achieved using anti-TOM20, anti-GM130 antibodies, and fluorescent dyes. Two-color in-resin CLEM revealed that wheat germ agglutinin-puncta showed the ultrastructures of multivesicular body-like structures. Finally, taking the advantage of high positional accuracy, volume in-resin CLEM of mitochondria in the semi-thin section (2 μm thick) of Epon-embedded cells was performed by focused ion beam scanning electron microscopy. These results suggested that the application of immunological reaction and affinity-labeling with fluorescent dyes to in-resin CLEM of Epon-embedded cells is suitable for analyzing the localization of endogenous targets and their ultrastructures by scanning and transmission electron microscopy.

Saccharromyces cerevisiae CLS2 gene product (Cls2p) that is localized on the endoplasmic reticulum is important for the regulation of intracellular Ca2+ in a compartment distinct from the vacuole. Using a vma3 mutation that impairs the Ca2+ sequestering activity into the vacuole, we have shown that the cls2 mutation results in 3.4-fold increase in the Ca2+ pool that is not exchangeable with extracellular Ca2+. Accumulation of Ca2+ within the cls2 cells is synergistically elevated by the addition of immunosuppressant, FK506. Moreover, in the vma3 background, toxicity caused by the cls2 mutation is greatly enhanced by FK506. Given that FK506 inhibits the calcineurin activity, Cls2p likely functions in releasing Ca2+ flux from the endoplasmic reticulum, somehow cooperating with calcineurin.

We screened a series of new epoxysuccinyl peptides for the development of a lysosomal cathepsin L-specific inhibitor. Among the compounds tested, (2S,3S)-oxirane-2,3-dicarboxylic acid 2-[((S)-1-benzylcarbamoyl-2-phenyl-ethyl)-amide] 3-{[2-(4-hydroxy-phenyl)-ethyl]-amide} (compound CAA0225) was the most potent inhibitor of cathepsin L. CAA0225 inhibited rat liver cathepsin L with IC50 values of 1.9 nM, but not rat liver cathepsin B (IC50, >1000-5000 nM). To assess the contribution of cathepsin L to lysosomal proteolysis, we evaluated autophagy, which is the process of lysosomal self-degradation of cell constituents. In HeLa and Huh-7 cells cultured under nutrient-deprived conditions CAA0225 significantly inhibited degradation of long-lived proteins; however, the magnitude of inhibition was comparable to that in the presence of CA-074-OMe, which is a cathepsin B-specific inhibitor. Thus the contributions of cathepsin L and cathepsin B to autophagic protein degradation of cytoplasmic proteins are nearly equal. During autophagy, microtubule-associated protein IA/IB light chain 3-II (LC3-II) and gamma-aminobutyric acid (A) receptor-associated protein (GABARAP)-II, which are specific markers of autophagosomal membranes that engulf cytoplasmic components, also undergo degradation upon fusion of autophagosomes with lysosomes. CAA0225 effectively inhibited degradation of LC3-II and GABARAP, whereas CA-074-OMe had only a marginal effect on their levels. Therefore we conclude that cathepsin L does not play a general role in the degradation of proteins in the lumen of autophagosomes, but rather is involved specifically in the degradation of autophagosomal membrane markers.

ABSTRACT We previously reported that phospholipase C-related catalytically inactive protein (PRIP)-knockout mice exhibited hyperinsulinemia. Here, we investigated the role of PRIP in insulin granule exocytosis using Prip-knockdown mouse insulinoma (MIN6) cells. Insulin release from Prip-knockdown MIN6 cells was higher than that from control cells, and Prip knockdown facilitated movement of GFP-phogrin-labeled insulin secretory vesicles. Double-immunofluorescent staining and density step-gradient analyses showed that the KIF5B motor protein co-localized with insulin vesicles in Prip-knockdown MIN6 cells. Knockdown of GABAA-receptor-associated protein (GABARAP), a microtubule-associated PRIP-binding partner, by Gabarap silencing in MIN6 cells reduced the co-localization of insulin vesicles with KIF5B and the movement of vesicles, resulting in decreased insulin secretion. However, the co-localization of KIF5B with microtubules was not altered in Prip- and Gabarap-knockdown cells. The presence of unbound GABARAP, freed either by an interference peptide or by Prip silencing, in MIN6 cells enhanced the co-localization of insulin vesicles with microtubules and promoted vesicle mobility. Taken together, these data demonstrate that PRIP and GABARAP function in a complex to regulate KIF5B-mediated insulin secretion, providing new insights into insulin exocytic mechanisms.

Green fluorescent protein (GFP) is tremendously useful for investigating many cellular and intracellular events. The monomeric GFP mNeonGreen is about 3- to 5-times brighter than GFP and monomeric enhanced GFP and shows high photostability. The maturation half-time of mNeonGreen is about 3-fold faster than that of monomeric enhanced GFP. However, the cDNA sequence encoding mNeonGreen contains some codons that are rarely used in Homo sapiens. For better expression of mNeonGreen in human cells, we synthesized a human-optimized cDNA encoding mNeonGreen and generated an expression plasmid for humanized mNeonGreen under the control of the cytomegalovirus promoter. The resultant plasmid was introduced into HEK293 cells. The fluorescent intensity of humanized mNeonGreen was about 1.4-fold higher than that of the original mNeonGreen. The humanized mNeonGreen with a mitochondria-targeting signal showed mitochondrial distribution of mNeonGreen. We further generated an expression vector of humanized mNeonGreen with 3xFLAG tags at its carboxyl terminus as these tags are useful for immunological analyses. The 3xFLAG-tagged mNeonGreen was recognized well with an anti-FLAG-M2 antibody. These plasmids for the expression of humanized mNeonGreen and mNeonGreen-3xFLAG are useful tools for biological studies in mammalian cells using mNeonGreen.

Biotin ligases have been developed as proximity biotinylation enzymes for analyses of the interactome. However, there has been no report on the application of proximity labeling for in-resin correlative light-electron microscopy of Epon-embedded cells. In this study, we established a proximity-labeled in-resin CLEM of Epon-embedded cells using miniTurbo, a biotin ligase. Biotinylation by miniTurbo was observed in cells within 10 min following the addition of biotin to the medium. Using fluorophore-conjugated streptavidin, intracellular biotinylated proteins were labeled after fixation of cells with a mixture of paraformaldehyde and glutaraldehyde. Fluorescence of these proteins was resistant to osmium tetroxide staining and was detected in 100-nm ultrathin sections of Epon-embedded cells. Ultrastructures of organelles were preserved well in the same sections. Fluorescence in sections was about 14-fold brighter than that in the sections of Epon-embedded cells expressing mCherry2 and was detectable for 14 days. When mitochondria-localized miniTurbo was expressed in the cells, mitochondria-like fluorescent signals were detected in the sections, and ultrastructures of mitochondria were observed as fluorescence-positive structures in the same sections by scanning electron microscopy. Proximity labeling using miniTurbo led to more stable and brighter fluorescent signals in the ultrathin sections of Epon-embedded cells, resulting in better performance of in-resin CLEM.

A dynamic membrane rearrangement occurs in cells during autophagy to form autophagosomes. In this dynamic process, two ubiquitin-like modifications, Apg12p-conjugation and LC3-modification, are essential for the formation of autophagosomes. Apg7p and Apg10p catalyze the conjugation of Apg12p to Apg5p. The same Apg7p and Apg3p catalyze the processing of LC3 to a membrane-bound form, LC3-II. In this paper, we investigated whether Apg12p has an influence on the second LC3-modification system. A cross-linking experiment revealed that Apg3p interacts with the endogenous Apg12p · Apg5p conjugate. However, Apg3p itself interacts with free Apg12p more preferentially than the Apg12p · Apg5p conjugate, when free Apg12p exists. When Apg12p was overexpressed, LC3 processing was significantly enhanced in the presence of Apg7p. In contrast, when the Apg12p · Apg5p conjugate itself was accumulated by the overexpression of Apg12p and Apg5p, LC3 processing was dominantly inhibited, even in the presence of Apg7p. These results indicate that both Apg12p and the Apg12p · Apg5p conjugate are regulatory factors for LC3 processing.

Although a conjugation of overexpressed GABARAP to phospholipid has been reported to be activated during starvation-induced autophagy, it is unclear whether endogenous GABARAP-conjugation is also activated under starvation conditions. We observed that little GABARAP-phospholipid conjugate (GABARAP-PL) accumulated in mouse liver and kidney under starvation conditions, while endogenous LC3-phospholipid conjugate (LC3-II) accumulated. A small amount of endogenous GABARAP-PL was observed in the heart independent of starvation. In rapamycin-treated HEK293 cells, there was little accumulation of endogenous GABARAP-PL, even in the presence of lysosomal protease-inhibitors, whereas there was significant accumulation of endogenous LC3-II together with inactivation of the mTor kinase-signaling pathway. In HeLa, and C2C12 cells, the accumulation of GABARAP-PL in the presence of lysosomal protease inhibitors is independent of starvation-induced autophagy, whereas the accumulation of LC3-II in their presence is significantly activated during starvation-induced autophagy. Interestingly, we observed that the lysosomal turnover of GABARAP-PL is activated during the differentiation of C2C12 cells to myotubes. Under these conditions, S6 ribosomal protein is still phosphorylated, suggesting that mTor kinase-signaling pathway is active during the differentiation of C2C12 cells to myotubes, different from the case during starvation-induced autophagy. These results indicated that the lysosomal turnover of GABARAP-PL is activated during the differentiation of C2C12 cells to myotubes without inactivation of mTor kinase-signaling pathway, while little is activated during starvation-induced autophagy.

Cathepsin D is one of the major lysosomal aspartic proteases that is essential for the normal functioning of the autophagy-lysosomal system. In the kidney, cathepsin D is enriched in renal proximal tubular epithelial cells, and its levels increase during acute kidney injury. To investigate how cathepsin D-deficiency impacts renal proximal tubular cells, we employed a conditional knockout CtsDflox/−; Spink3Cre mouse. Immunohistochemical analyses using anti-cathepsin D antibody revealed that cathepsin D was significantly decreased in tubular epithelial cells of the cortico-medullary region, mainly in renal proximal tubular cells of this mouse. Cathepsin D-deficient renal proximal tubular cells showed an increase of microtubule-associated protein light chain 3 (LC3; a marker for autophagosome/autolysosome)-signals and an accumulation of abnormal autophagic structures. Renal ischemia/reperfusion injury resulted in an increase of early kidney injury marker, Kidney injury molecule 1 (Kim-1), in the cathepsin D-deficient renal tubular epithelial cells of the CtsDflox/−; Spink3Cre mouse. Inflammation marker was also increased in the cortico-medullary region of the CtsDflox/−; Spink3Cre mouse. Our results indicated that lack of cathepsin D in the renal tubular epithelial cells led to an increase of sensitivity against ischemia/reperfusion injury.

GABAA receptor-associated protein (GABARAP) was initially identified as a protein that interacts with GABAA receptor. Although LC3 (microtubule-associated protein 1 light chain 3), a GABARAP homolog, has been localized in the dendrites and cell bodies of neurons under normal conditions, the subcellular distribution of GABARAP in neurons remains unclear. Subcellular fractionation indicated that endogenous GABARAP was localized to the microsome-enriched and synaptic vesicle-enriched fractions of mouse brain as GABARAP-I, an unlipidated form. To investigate the distribution of GABARAP in neurons, we generated GFP-GABARAP transgenic mice. Immunohistochemistry in these transgenic mice showed that positive signals for GFP-GABARAP were widely distributed in neurons in various brain regions, including the hippocampus and cerebellum. Interestingly, intense diffuse and/or fibrillary expression of GFP-GABARAP was detected along the axonal initial segments (AIS) of hippocampal pyramidal neurons and cerebellar Purkinje cells, in addition to the cell bodies and dendrites of these neurons. In contrast, only slight amounts of LC3 were detected along the AIS of these neurons, while diffuse and/or fibrillary staining for LC3 was mainly detected in their cell bodies and dendrites. These results indicated that, compared with LC3, GABARAP is enriched in the AIS, in addition to the cell bodies and dendrites, of these hippocampal pyramidal neurons and cerebellar Purkinje cells.

Previously, we reported that coffee extract and its constituents, caffeic acid (CA) and p-coumaric acid, inhibit infection by the hepatitis C virus (HCV). In the present report, we identified another coffee-related compound, tannic acid (TA), which also inhibits HCV infection. We systematically evaluated which steps of the viral lifecycle were affected by CA and TA. TA substantially inhibits HCV RNA replication and egression, while CA does not. The infectivity of the HCV pretreated with CA or TA was almost lost. Cellular attachment of HCV particles and their interaction with apolipoprotein E, which is essential for HCV infectivity, were significantly reduced by CA. These results indicate that CA inhibits HCV entry via its direct effect on viral particles and TA inhibits HCV RNA replication and particle egression as well as entry into host cells. Taken together, our findings may provide insights into CA and TA as potential anti-HCV strategies.

Autophagy, a system for the bulk degradation of intracellular components, is essential for homeostasis and the healthy physiology and development of cells and tissues. Its deregulation is associated with human disease. Thus, methods to modulate autophagic activity are critical for analysis of its role in mammalian cells and tissues. Here we report a method to inhibit autophagy using a mutant variant of the protein ATG7, a ubiquitin E1-like enzyme essential for autophagosome formation. During autophagy, ATG7 activates the conjugation of LC3 (ATG8) with phosphatidylethanolamine (PE) and ATG12 with ATG5. Human ATG7 interactions with LC3 or ATG12 require a thioester bond involving the ATG7 cysteine residue at position 572. We generated TetOff cells expressing mutant ATG7 protein carrying a serine substitution of this critical cysteine residue (ATG7C572S). Because ATG7C572S forms stable intermediate complexes with LC3 or ATG12, its expression resulted in a strong blockage of the ATG-conjugation system and suppression of autophagosome formation. Consequently, ATG7C572S mutant protein can be used as an inhibitor of autophagy.

<h2>Summary</h2> Pneumolysin (Ply) is an indispensable cholesterol-dependent cytolysin for pneumococcal infection. Although Ply-induced disruption of pneumococci-containing endosomal vesicles is a prerequisite for the evasion of endolysosomal bacterial clearance, its potent activity can be a double-edged sword, having a detrimental effect on bacterial survivability by inducing severe endosomal disruption, bactericidal autophagy, and scaffold epithelial cell death. Thus, Ply activity must be maintained at optimal levels. We develop a highly sensitive assay to monitor endosomal disruption using NanoBiT-Nanobody, which shows that the pneumococcal sialidase NanA can fine-tune Ply activity by trimming sialic acid from cell-membrane-bound glycans. In addition, oseltamivir, an influenza A virus sialidase inhibitor, promotes Ply-induced endosomal disruption and cytotoxicity by inhibiting NanA activity <i>in vitro</i> and greater tissue damage and bacterial clearance <i>in vivo</i>. Our findings provide a foundation for innovative therapeutic strategies for severe pneumococcal infections by exploiting the duality of Ply activity.

Apg7p is a unique E1 enzyme which is essential for both the Apg12p- and Apg8p-modification systems, and plays indispensable roles in yeast autophagy. A cDNA encoding murine Apg7p homolog (mApg7p) was isolated from a mouse brain cDNA library. The predicted amino acid sequence of the clone shows a significant homology to human Apg7p and yeast Apg7p. Murine Apg12p as well as the three mammalian Apg8p homologs co-immunoprecipitate with mApg7p. Site-directed mutagenesis revealed that an active-site cysteine within mApg7p is Cys567, indicating that mApg7p is an authentic E1 enzyme for murine Apg12p and mammalian Apg8p homologs. The mutagenesis study also revealed that Apg12p has a substrate preference for mApg7p over the three Apg8p homologs, suggesting that the Apg12p conjugation by Apg7p occurs preferentially in mammalian cells compared with the modification of the three Apg8p homologs. We also report here on the ubiquitous expression of human APG7 mRNA in human adult and fetal tissues and of rat Apg7p in adult tissues.

The Golgi apparatus plays an indispensable role in posttranslational modification and transport of proteins to their target destinations. Although it is well established that the Golgi apparatus requires an acidic luminal pH for optimal activity, morphological and functional abnormalities at the neuronal circuit level because of perturbations in Golgi pH are not fully understood. In addition, morphological alteration of the Golgi apparatus is associated with several neurodegenerative diseases, including Parkinson's disease, Alzheimer's disease, and amyotrophic lateral sclerosis. Here, we used anatomical and electrophysiological approaches to characterize morphological and functional abnormalities of neuronal circuits in Golgi pH regulator (GPHR) conditional knock-out mice. Purkinje cells (PCs) from the mutant mice exhibited vesiculation and fragmentation of the Golgi apparatus, followed by axonal degeneration and progressive cell loss. Morphological analysis provided evidence for the disruption of basket cell (BC) terminals around PC soma, and electrophysiological recordings showed selective loss of large amplitude responses, suggesting BC terminal disassembly. In addition, the innervation of mutant PCs was altered such that climbing fiber (CF) terminals abnormally synapsed on the somatic spines of mutant PCs in the mature cerebellum. The combined results describe an essential role for luminal acidification of the Golgi apparatus in maintaining proper neuronal morphology and neuronal circuitry.

Autophagy is a process of cellular degradation, and its dysfunction elicits many pathological symptoms. However, the contribution of autophagy to kidney glomerular function has not been fully clarified. We previously reported that LC3, a promising executor of autophagy, played an important role in recovery from podocyte damage in an experimental nephrosis model (Asanuma K, Tanida I, Shirato I, Ueno T, Takahara H, Nishitani T, Kominami E, Tomino Y. FASEB J 17: 1165-1167, 2003). γ-Aminobutyric acid A receptor-associated protein (GABARAP), has recently been characterized as another homolog of LC3, although its precise role in autophagy remains unclear. We recently generated green fluorescent protein (GFP)-GABARAP transgenic mice, in which GFP-GABARAP is abundantly expressed in glomerular podocytes. We found that the transgenic mice showed no obvious phenotype, and podocytes isolated from these mice manifested autophagic activity almost equivalent to that of wild-type mice when measured in vitro. Surprisingly, a single injection of doxorubicin caused a greater increase in proteinuria and sclerotic glomeruli in transgenic mice compared with wild-type mice. Under these conditions, neither GFP-GABARAP nor endogenous GABARAP appeared to be recruited to autophagosomes, and both remained in the cytosol. Moreover, the cytosolic GFP-GABARAP was significantly colocalized with p62 to form aggregates. These results indicate that the GFP-GABARAP/p62 complex is responsible for impairment of glomerular function and that it retards recovery from the effects of doxorubicin.

Shiga toxin (STx) is a virulence factor produced by enterohemorrhagic <i>Escherichia coli.</i> STx is taken up by mammalian host cells by binding to the glycosphingolipid (GSL) globotriaosylceramide (Gb3; Galα1-4Galβ1-4Glc-ceramide) and causes cell death after its retrograde membrane transport. However, the contribution of the hydrophobic portion of Gb3 (ceramide) to STx transport remains unclear. In pigeons, blood group P1 glycan antigens (Galα1-4Galβ1-4GlcNAc-) are expressed on glycoproteins that are synthesized by α1,4-galactosyltransferase 2 (pA4GalT2). To examine whether these glycoproteins can also function as STx receptors, here we constructed glycan-remodeled HeLa cell variants lacking Gb3 expression but instead expressing pA4GalT2-synthesized P1 glycan antigens on glycoproteins. We compared STx binding and sensitivity of these variants with those of the parental, Gb3-expressing HeLa cells. The glycan-remodeled cells bound STx1 via <i>N</i>-glycans of glycoproteins and were sensitive to STx1 even without Gb3 expression, indicating that P1-containing glycoproteins also function as STx receptors. However, these variants were significantly less sensitive to STx than the parent cells. Fluorescence microscopy and correlative light EM revealed that the STx1 B subunit accumulates to lower levels in the Golgi apparatus after glycoprotein-mediated than after Gb3-mediated uptake but instead accumulates in vacuole-like structures probably derived from early endosomes. Furthermore, coexpression of Galα1-4Gal on both glycoproteins and GSLs reduced the sensitivity of cells to STx1 compared with those expressing Galα1-4Gal only on GSLs, probably because of competition for STx binding or internalization. We conclude that lipid-based receptors are much more effective in STx retrograde transport and mediate greater STx cytotoxicity than protein-based receptors.

We generated a new transgenic mouse model that expresses a pHluorin-mKate2 fluorescent protein fused with human LC3B (PK-LC3 mice) for monitoring autophagy activity in neurons of the central nervous system. Histological analysis revealed fluorescent puncta in neurons of the cerebral cortex, hippocampus, cerebellar Purkinje cells, and anterior spinal regions. Using CLEM analysis, we confirmed that PK-LC3-positive puncta in the perikarya of Purkinje cells correspond to autophagic structures. To validate the usability of PK-LC3 mice, we quantified PK-LC3 puncta in Purkinje cells of mice kept in normal feeding conditions and of mice starved for 24 hours. Our results showed a significant increase in autophagosome number and in individual puncta areal size following starvation. To confirm these results, we used morphometry at the electron microscopic level to analyze the volume densities of autophagosomes and lysosomes/autolysosomes in Purkinje cells of PK-LC3 mice. The results revealed that the volume densities of autophagic structures increase significantly after starvation. Together, our data show that PK-LC3 mice are suitable for monitoring autophagy flux in Purkinje cells of the cerebellum, and potentially other areas in the central nervous system.

Correlative fluorescent and electron microscopic images of the same section of epoxy (or other polymer)-embedded samples, hereafter referred to as 'in-resin CLEM', have been developed to improve the positional accuracy and Z-axis resolution limitations of conventional correlative light and electron microscopy (CLEM). High-pressure freezing and quick-freezing substitution result in in-resin CLEM of acrylic-based resin-embedded cells expressing green fluorescent protein, yellow fluorescent protein, mVenus and mCherry, which are sensitive to osmium tetroxide. The identification of osmium-resistant fluorescent proteins leads to the development of in-resin CLEM of Epon-embedded cells. Using subtraction-based fluorescence microscopy with a photoconvertible fluorescent protein, mEosEM-E, its green fluorescence can be observed in thin sections of Epon-embedded cells, and two-color in-resin CLEM using mEosEM-E and mScarlet-H can be performed. Green fluorescent proteins, CoGFP variant 0 and mWasabi, and far-red fluorescent proteins, mCherry2 and mKate2, are available for in-resin CLEM of Epon-embedded cells using the standard procedure for Epon-embedding with additional incubation. Proximity labeling is applied to in-resin CLEM to overcome the limitations of fluorescent proteins in epoxy resin. These approaches will contribute significantly to the future of CLEM analysis.

In this chapter, we introduce the usage of pHluorin-mKate2-human LC3 for monitoring autophagy. Using EGFP and RFP, tandem fluorescent protein-tagged LC3 has been generated for monitoring autophagic structures. A critical point for this purpose is the sensitivity of the green fluorescent protein to acidic pH. A super-ecliptic pHluorin is most sensitive to acidic pH among EGFP, mWasabi, and pHluorin, indicating pHluorin is most suitable for monitoring autophagic structures. During autophagy, green-positive and red-positive fluorescent puncta of pHluorin-mKate2-human LC3 indicate signals of preautophagosomes and autophagosomes. After fusion of autophagosomes with lysosomes to form autolysosomes, green fluorescence of this intraautophagosomal protein is abolished according to acidification of autolysosomes. Therefore, these green-negative and red-positive fluorescent puncta reflect autolysosomes, in which intraluminal proteins are finally degraded by lysosomal proteases. To monitor autophagic flux, the accumulation of its green-negative and red-positive fluorescent puncta is monitored by inhibiting major lysosomal proteases, cathepsins. In addition, a mutant pHluorin-mKate2-human LC3△G is also introduced as a negative control probe.

Autophagy is a mechanism of bulk protein degradation that plays an important role in regulating homeostasis in many organisms. Among several methods for evaluating its activity, a fluorescent reporter GFP-LC3-RFP-LC3ΔG, in which GFP-LC3 is cleaved by ATG4 following autophagic induction and degraded in lysosome, has been used for monitoring autophagic flux, which is the amount of lysosomal protein degradation. In this study, we modified this reporter by exchanging GFP for pHluorin, which is more sensitive to low pH, and RFP to mCherry, to construct pHluorin-LC3-mCherry reporter. Following starvation or mTOR inhibition, the increase of autophagic flux was detected by a decrease of the fluorescent ratio of pHluorin to mCherry; our reporter was also more sensitive to autophagy-inducing stimuli than the previous one. To establish monitoring cells for mouse genome-wide screening of regulators of autophagic flux based on CRISPR/Cas9 system, after evaluating knockout efficiency of clones of Cas9-expressing MEFs, we co-expressed our reporter and confirmed that autophagic flux was impaired in gRNA-mediated knockout of canonical autophagy genes. Finally, we performed genome-wide gRNA screening for genes inhibiting starvation-mediated autophagic flux and identified previously reported genes such as Atgs. Thus, we have successfully established a system for screening of genes regulating autophagic flux with our pHluorin-LC3-mCherry reporter in mice.

Abstract Neuronal ceroid lipofuscinosis is one of many neurodegenerative storage diseases characterized by excessive accumulation of lipofuscins. CLN10 disease, an early infantile neuronal ceroid lipofuscinosis, is associated with a gene that encodes cathepsin D (CtsD), one of the major lysosomal proteases. Whole body CtsD-knockout mice show neurodegenerative phenotypes with the accumulation of lipofuscins in the brain and also show defects in other tissues including intestinal necrosis. To clarify the precise role of CtsD in the central nervous system (CNS), we generated a CNS-specific CtsD-knockout mouse (CtsD-CKO). CtsD-CKO mice were born normally but developed seizures and their growth stunted at around postnatal day 23 ± 1. CtsD-CKO did not exhibit apparent intestinal symptoms as those observed in whole body knockout. Histologically, autofluorescent materials were detected in several areas of the CtsD-CKO mouse’s brain, including: thalamus, cerebral cortex, hippocampus, and cerebellum. Expression of ubiquitin and autophagy-associated proteins was also increased, suggesting that the autophagy-lysosome system was impaired. Microglia and astrocytes were activated in the CtsD-CKO thalamus, and inducible nitric oxide synthase (iNOS), an inflammation marker, was increased in the microglia. Interestingly, deposits of proteinopathy-related proteins, phosphorylated α-synuclein, and Tau protein were also increased in the thalamus of CtsD-CKO infant mice. Considering these results, we propose thatt the CtsD - CKO mouse is a useful mouse model to investigate the contribution of cathepsin D to the early phases of neurodegenerative diseases in relation to lipofuscins, proteinopathy-related proteins and activation of microglia and astrocytes.

In the yeast, Saccharomyces cerevisiae , two ubiquitin‐like modifications, Apg12 conjugation with Apg5 and Apg8 lipidation with phosphatidylethanolamine, are essential for autophagy and the cytoplasm‐to‐vacuole transport of aminopeptidase I (Cvt pathway). As a unique E1‐like enzyme, Apg7 activates two modifiers (Apg12 and Apg8) in an ATP‐dependent manner and, for this activity, the carboxyl terminal 40 amino acids are essential. For a better understanding of the function of the carboxyl terminus of Apg7, we performed a sequential deletion of the region. A mutant expressing Apg7ΔC17 protein, which lacks the carboxyl 17 amino acids of Apg7, showed defects in both the Cvt pathway and autophagy. Apg8 lipidation is inhibited in the mutant, while Apg12 conjugation occurs normally. A mutant expressing Apg7ΔC13 protein showed a defect in the Cvt pathway, but not autophagy, suggesting that the activity of Apg7 for Apg8 lipidation is more essential for the Cvt pathway than for autophagy. Mutant Apg7ΔC17 protein is still able to interact with Apg8, Apg12 and Apg3, and forms a homodimer, indicating that the deletion of the carboxyl terminal 17 amino acids has little effect on these interactions and Apg7 dimerization. These results suggest that the carboxyl terminal 17 amino acids of Apg7 play a specific role in Apg8 lipidation indispensable for the Cvt pathway and autophagy.

Autophagy is an intrinsic host defense system that recognizes and eliminates invading bacterial pathogens. We have identified microtubule-associated protein 1 light chain 3 (LC3), a hallmark of autophagy, as a binding partner of phospholipase C-related catalytically inactive protein (PRIP) that was originally identified as an inositol trisphosphate-binding protein. Here, we investigated the involvement of PRIP in the autophagic elimination of Staphylococcus aureus in infected mouse embryonic fibroblasts (MEFs). We observed significantly more LC3-positive autophagosome-like vacuoles enclosing an increased number of S. aureus cells in PRIP-deficient MEFs than control MEFs, 3 h and 4.5 h post infection, suggesting that S. aureus proliferates in LC3-positive autophagosome-like vacuoles in PRIP-deficient MEFs. We performed autophagic flux analysis using an mRFP-GFP-tagged LC3 plasmid and found that autophagosome maturation is significantly inhibited in PRIP-deficient MEFs. Furthermore, acidification of autophagosomes was significantly inhibited in PRIP-deficient MEFs compared to the wild-type MEFs, as determined by LysoTracker staining and time-lapse image analysis performed using mRFP-GFP-tagged LC3. Taken together, our data show that PRIP is required for the fusion of S. aureus-containing autophagosome-like vacuoles with lysosomes, indicating that PRIP is a novel modulator in the regulation of the innate immune system in non-professional phagocytic host cells.

Upon starvation, cells undergo autophagy, an intracellular bulk-degradation process, to provide the required nutrients. Here, we observed that phospholipase C-related catalytically inactive protein (PRIP) binds to microtubule-associated protein 1 light chain 3 (LC3), a mammalian autophagy-related initiator that regulates the autophagy pathway. Then, we examined the involvement of PRIP in the nutrient depletion-induced autophagy pathway. Enhanced colocalization of PRIP with LC3 was clearly seen in nutrient-starved mouse embryonic fibroblasts under a fluorescent microscope, and interaction of the proteins was revealed by immunoprecipitation experiments with an anti-LC3 antibody. Under starvation conditions, there were more green fluorescent protein fused-LC3 dots in mouse embryonic fibroblasts from PRIP-deficient mice than in fibroblasts from wild type cells. The formation of new dots in a single cell increased, as assessed by time-lapse microscopy. Furthermore, the increase in autophagosome formation in PRIP-deficient cells was notably inhibited by exogenously overexpressed PRIP. Taken together, PRIP is a novel LC3-binding protein that acts as a negative modulator of autophagosome formation.

ABSTRACT Transmissible spongiform encephalopathies are infectious and neurodegenerative disorders that cause neural deposition of aggregates of the disease‐associated form of PrP Sc . PrP Sc reproduces by recruiting and converting the cellular PrP C , and ScN2a cells support PrP Sc propagation. We found that incubation of ScN2a cells with a fibril peptide named P9, which comprises an intrinsic sequence of residues 167–184 of mouse PrP C , significantly reduced the amount of PrP Sc in 24 hr. P9 did not affect the rates of synthesis and degradation of PrP C . Interestingly, immunofluorescence analysis showed that the incubation of ScN2a cells with P9 induced colocalization of the accumulation of PrP with cathepsin D‐positive compartments, whereas the accumulation of PrP in the cells without P9 colocalized mainly with lysosomal associated membrane proteins (LAMP)‐1‐positive compartments but rarely with cathepsin D‐positive compartments in perinuclear regions. Lysosomal enzyme inhibitors attenuated the anti‐PrP Sc activity; however, a proteasome inhibitor did not impair P9 activity. In addition, P9 neither promoted the ubiquitination of cellular proteins nor caused the accumulation of LC3‐II, a biochemical marker of autophagy. These results indicate that P9 promotes PrP Sc redistribution from late endosomes to lysosomes, thereby attaining PrP Sc degradation.

During autophagy, autophagosomes are formed to engulf cytoplasmic contents. p62/SQSTM-1 is an autophagic adaptor protein that forms p62 bodies. A unique feature of p62 bodies is that they seem to directly associate with membranous structures. We first investigated the co-localization of mKate2-p62 bodies with phospholipids using click chemistry with propargyl-choline. Propargyl-choline-labeled phospholipids were detected inside the mKate2-p62 bodies, suggesting that phospholipids were present inside the bodies. To clarify whether or not p62 bodies come in contact with membranous structures directly, we investigated the ultrastructures of p62 bodies using in-resin correlative light and electron microscopy of the Epon-embedded cells expressing mKate2-p62. Fluorescent-positive p62 bodies were detected as uniformly lightly osmificated structures by electron microscopy. Membranous structures were detected on and inside the p62 bodies. In addition, multimembranous structures with rough endoplasmic reticulum-like structures that resembled autophagosomes directly came in contact with amorphous-shaped p62 bodies. These results suggested that p62 bodies are unique structures that can come in contact with membranous structures directly.

Postfixation with osmium tetroxide and Epon embedding are essential for the preservation and visualization of subcellular ultrastructures via electron microscopy. These chemical treatments diminish the fluorescent intensity of most fluorescent proteins in cells, creating a problem for the in-resin correlative light-electron microscopy (CLEM) of Epon-embedded mammalian cultured cells. We found that two green and two far-red fluorescent proteins retain their fluorescence after chemical fixation with glutaraldehyde, osmium tetroxide-staining, dehydration, and polymerization of Epon resins. Consequently, we could observe the fluorescence of fluorescent proteins in ultrathin sections of Epon-embedded cells via fluorescence microscopy, investigate ultrastructures of the cells in the same sections via electron microscopy, and correlate the fluorescent image with the electron microscopic image without chemical or physical distortion of the cells. In other words, referred as "in-resin CLEM" of Epon-embedded samples. This technique also improves the Z-axis resolution of fluorescent images. In this chapter, we introduce the detailed protocol for in-resin CLEM of Epon-embedded mammalian cultured cells using these fluorescent proteins.

Abstract Atg8 modifier in yeast is conjugated to phosphatidylethanolamine via ubiquitylation‐like reactions essential for autophagy. Mammalian Atg8 homologs (Atg8s) including LC3, GABARAP, and GATE‐16, are also ubiquitin‐like modifiers. The carboxyl termini of mammalian Atg8 homologs are cleaved by Atg4B, a cysteine protease, to expose carboxyl terminal Gly which is essential for this ubiquitylation‐like reaction. Thereafter, the Atg8 homologs are activated by Atg7, an E1‐like enzyme, to form unstable Atg7‐Atg8 E1‐substrate intermediates via a thioester bond. The activated Atg8 homologs are transferred to mammalian Atg3, an E2‐like enzyme, to form unstable Atg3‐Atg8 E2‐substrate intermediates via a thioester bond. Finally, Atg8 homologs are conjugated to phospholipids, phosphatidylethanolamine, and phosphatidylserine. Here, we describe a protocol for the reconstituted conjugation systems for mammalian Atg8 homologs in vitro using purified recombinant Atg proteins and liposomes. Curr. Protoc. Cell Biol . 64:11.20.1‐11.20.13. © 2014 by John Wiley &amp; Sons, Inc.

Many human proteins have homopolymeric amino acid (HPAA) tracts, but their physiological functions or cellular effects are not well understood. Previously, we expressed 20 HPAAs in mammalian cells and showed characteristic intracellular localization, in that hydrophobic HPAAs aggregated strongly and caused high cytotoxicity in proportion to their hydrophobicity. In the present study, we investigated the cytotoxicity of these aggregate‐prone hydrophobic HPAAs, assuming that the ubiquitin proteasome system is impaired in the same manner as other well‐known aggregate‐prone polyglutamine‐containing proteins. Some highly hydrophobic HPAAs caused a deficiency in the ubiquitin proteasome system and excess endoplasmic reticulum stress, leading to apoptosis. These results indicate that the property of causing excess endoplasmic reticulum stress by proteasome impairment may contribute to the strong cytotoxicity of highly hydrophobic HPAAs, and proteasome impairment and the resulting excess endoplasmic reticulum stress is not a common cytotoxic effect of aggregate‐prone proteins such as polyglutamine.

We have defined a 27-bp sequence in the promoter region of a rice (Oryza sativa, cv. IR36) α-amylase gene, Amy3c, that interacts with a gibberellin (GA)-induced protein. The relevant binding sequence, dCCTCCTTT-TTATCCT-CTTTT∗ AAATGAG, located between positions −168 and −142 upstream of the transcription start site, includes two copies of an 8-bp pyrimidine box (italics), starting with CCTC, followed by an imperfect palindrome (the star marks the border between a pyrimidine box and the center of the imperfect palindrome). Deletion of the sequence located between −225 and −49 in the promoter region of Amy3c eliminates GA3 responsiveness in transient assays. Removal of this sequence also eliminates binding of the GA3-induced protein in gel-retardation assays. Moreover, protein extracts from rice seeds treated with abscisic acid, a GA3 antagonist, no longer showed specific binding to the 5′ region of Amy3c. Protein extracts from seeds treated with XE1019 (a triazine derivative and a GA3 biosynthetic inhibitor) significantly reduced the amount of DNA-binding activity. The GA3-induced DNA-binding protein from rice seeds has been extensively purified. The size of the protein is approximately 22 kDa, as determined by gel-filtration chromatography and gel electrophoresis. In addition, the binding sequence is AT-rich and is sensitive to competition by poly d(A)-poly d(T) and poly[d(A-T)]. Thus, the GA3-induced DNA-binding protein resembles the high-mobility-group (HMG) chromosomal proteins.

Neuronal ceroid lipofuscinosis is a group of pediatric neurodegenerative diseases. One of their causative genes, CLN10/CtsD, encodes cathepsin D, a major lysosomal protease. Central nervous system (CNS)-specific CtsD-deficient mice exhibit a neurodegenerative disease phenotype with accumulation of ceroid lipofuscins, granular osmiophilic deposits, and SQSTM1/p62. We focused on activated astrocytes and microglia in this neurodegenerative mouse brain, since there are few studies on the relationship between these accumulators and lysosomes in these glial cells. Activated microglia and astrocytes in this mouse thalamus at p24 were increased by approximately 2.5- and 4.6-fold compared with the control, while neurons were decreased by approximately half. Granular osmiophilic deposits were detected in microglial cell bodies and extended their processes in the thalamus. LAMP1-positive lysosomes, but not SQSTM1/p62 aggregates, accumulated in microglia of this mouse thalamus, whereas both lysosomes and SQSTM1/p62 aggregates accumulated in its astrocytes. TUNEL-positive signals were observed mainly in microglia, but few were observed in neurons and astrocytes. These signals were fragmented DNA from degenerated neurons engulfed by microglia or in the lysosomes of microglia. Abnormal autophagic vacuoles also accumulated in the lysosomes of microglia. Granular osmiophilic deposit-like structures localized to LAMP1-positive lysosomes in CtsD-deficient astrocytes. SQSTM1/p62-positive but LAMP1-negative membranous structures also accumulated in the astrocytes and were less condensed than typical granular osmiophilic deposits. These results suggest that CtsD deficiency leads to intracellular abnormalities in activated microglia and astrocytes in addition to neuronal degeneration.

ATG9A is an important membrane protein in mammalian macroautophagy. The formation of autophagosomes and phagophores is blocked in atg9a KO cells. However, it remains possible that residual membrane formation activity exists in these cells. These precursor structures that precede phagophores are, if they exist, rare and may be difficult to find. Here, we introduce the modified volume correlative light and electron microscopy (CLEM) method to analyze these structures three-dimensionally. In addition to target proteins, mitochondria were labeled as a landmark for precise correlation of slice images by a confocal fluorescence microscope and a focused ion beam scanning electron microscope. We found phagophores and small membrane vesicles near SQSTM1/p62 aggregates in atg9a KO cells, indicating that phagophores could be formed in atg9a-deficient cells, although they were immature and inefficient. Furthermore, we found that RB1CC1/FIP200-positive structures formed clusters around SQSTM1/p62 with ferritin and TAX1BP1. Taken together, our method contributes to the understanding of undiscovered fine structures.

Mouse oocytes mature from the germinal vesicle (GV) to meiosis II (MII) stage and are fertilized by a single sperm. After fertilization, the embryo degrades parts of the maternal components via lysosomal degradation systems, including autophagy and endocytosis, as zygotic gene expression begins during embryogenesis. Here, we demonstrate that endosomal-lysosomal organelles form assembly structures (ELYSAs) in the periphery of the oocyte plasma membrane. Small ELYSA structures appeared in GV oocytes and combined to form large structures in MII oocytes. The ELYSA forms a large spherical structure with tubular-vesicular structures approximately 2–10 μm in diameter and includes cytosolic components at the MII stage. After fertilization, ELYSA structures are gradually disassembled, and immature endosomes and lysosomes appear at the early 2-cell stages. The V1-subunit of vacuolar ATPase is recruited to these endosomes and lysosomes and causes further acidification of endosomal-lysosomal organelles, suggesting that the ELYSA maintains endosomal-lysosomal activity in a static state in oocytes for timely activation during early development.

Energetic and intermediary metabolism was studied in a Pet − mutant of Saccharomyces cerevisiae with a calcium‐sensitive phenotype that shows an inability to grow when cultured in a medium containing non‐fermentable substrates. The perchloric acid extracts were prepared from suspensions of cls11 mutant and wild‐type cells incubated with [1,3‐ 13 C]glycerol or [2‐ 13 C]acetate, and analyzed by 31 P, 13 C and 1 H NMR. 31 P‐ and 1 H‐NMR spectra showed significant differences between cls11 and wild‐type cells at the level of amino acids, the storage carbohydrate trehalose (higher in mutant cells), and sugar phosphates (higher in wild‐type cells). 13 C‐NMR spectra revealed major differences in the steady‐state labelling of glutamate carbons. For incubations with [1,3‐ 13 C]glycerol, we estimated from the relative 13 C enrichment of glutamate carbons that acetyl‐CoA C2 is 43% C 13 labelled in wild‐type and 10% 13 C labelled in mutant cells, respectively. For incubations with [2‐ 13 C]acetate, we calculated that the ratio of the relative flux through the glyoxylate shunt versus oxidative reactions is 58% in wild‐type cells and 44% in the cls11 mutant cells. Again, a dilution of the relative enrichment of C2 of acetyl‐CoA was observed in the mutant cells (89%) compared to the wild‐type cells (97%). These results are discussed in terms of pleiotropic defects in non‐fermentable carbon metabolism in mutant cells.

Macroautophagy (here referred to simply as “autophagy”) is a bulk degradation system for cytosolic compartments including proteins, lipids, and organelles. Autophagy consists essentially of three steps of dynamic cellular events, autophagosome formation, autophagosome–lysosome fusion, and the degradation of intra-autophagosomal contents by lysosomal hydrolases. LC3 is considered a promising marker for autophagosomes and autolysosomes. During autophagosome formation, LC3-II (the LC3-phosphatidylethanolamine conjugated, membrane-bound form of LC3) is increased. In contrast, LC3-II is decreased during the last two steps of autophagy: autophagosome–lysosome fusion and cargo degradation. Therefore, the most important monitor of autophagy is the “lysosomal flux” of LC3-II, not the temporal amount of LC3-II. Here, we present basic concepts and key points for monitoring autophagy using immunoblotting and fluorescent microscopic analyses of endogenous LC3 and fluorescent protein-tagged LC3. In addition, step-by-step techniques for analyzing ultrastructures during autophagy using electron microscopy and immunoelectron microscopy are discussed.

Neutrophils play a key role in the control of <i>Burkholderia pseudomallei</i>, the pathogen that causes melioidosis. Here, we show that survival of intracellular <i>B. pseudomallei</i> was significantly increased in the presence of 3-methyladenine or lysosomal cathepsin inhibitors. The LC3-flux was increased in <i>B. pseudomallei</i>-infected neutrophils. Concordant with this result, confocal microscopy analyses using anti-LC3 antibodies revealed that <i>B. pseudomallei</i>-containing phagosomes partially overlapped with LC3-positive signal at 3 and 6 h postinfection. Electron microscopic analyses of <i>B. pseudomallei</i>-infected neutrophils at 3 h revealed <i>B. pseudomallei</i>-containing phagosomes that occasionally fused with phagophores or autophagosomes. Following infection with a <i>B. pseudomallei</i> mutant lacking the <i>Burkholderia</i> secretion apparatus Bsa Type III secretion system, neither this characteristic structure nor bacterial escape into the cytosol were observed. These findings indicate that human neutrophils are able to recruit autophagic machinery adjacent to <i>B. pseudomallei</i>-containing phagosomes in a Type III secretion system-dependent manner.

Neutrophils play a key role in the control of <i>Burkholderia pseudomallei</i>, the pathogen that causes melioidosis. Here, we show that survival of intracellular <i>B. pseudomallei</i> was significantly increased in the presence of 3-methyladenine or lysosomal cathepsin inhibitors. The LC3-flux was increased in <i>B. pseudomallei</i>-infected neutrophils. Concordant with this result, confocal microscopy analyses using anti-LC3 antibodies revealed that <i>B. pseudomallei</i>-containing phagosomes partially overlapped with LC3-positive signal at 3 and 6 h postinfection. Electron microscopic analyses of <i>B. pseudomallei</i>-infected neutrophils at 3 h revealed <i>B. pseudomallei</i>-containing phagosomes that occasionally fused with phagophores or autophagosomes. Following infection with a <i>B. pseudomallei</i> mutant lacking the <i>Burkholderia</i> secretion apparatus Bsa Type III secretion system, neither this characteristic structure nor bacterial escape into the cytosol were observed. These findings indicate that human neutrophils are able to recruit autophagic machinery adjacent to <i>B. pseudomallei</i>-containing phagosomes in a Type III secretion system-dependent manner.

Neutrophils play a key role in the control of <i>Burkholderia pseudomallei</i>, the pathogen that causes melioidosis. Here, we show that survival of intracellular <i>B. pseudomallei</i> was significantly increased in the presence of 3-methyladenine or lysosomal cathepsin inhibitors. The LC3-flux was increased in <i>B. pseudomallei</i>-infected neutrophils. Concordant with this result, confocal microscopy analyses using anti-LC3 antibodies revealed that <i>B. pseudomallei</i>-containing phagosomes partially overlapped with LC3-positive signal at 3 and 6 h postinfection. Electron microscopic analyses of <i>B. pseudomallei</i>-infected neutrophils at 3 h revealed <i>B. pseudomallei</i>-containing phagosomes that occasionally fused with phagophores or autophagosomes. Following infection with a <i>B. pseudomallei</i> mutant lacking the <i>Burkholderia</i> secretion apparatus Bsa Type III secretion system, neither this characteristic structure nor bacterial escape into the cytosol were observed. These findings indicate that human neutrophils are able to recruit autophagic machinery adjacent to <i>B. pseudomallei</i>-containing phagosomes in a Type III secretion system-dependent manner.