Do‐Hyung Kim

mTOR/RAFT1/FRAP is the target of the immunosuppressive drug rapamycin and the central component of a nutrient- and hormone-sensitive signaling pathway that regulates cell growth. We report that mTOR forms a stoichiometric complex with raptor, an evolutionarily conserved protein with at least two roles in the mTOR pathway. Raptor has a positive role in nutrient-stimulated signaling to the downstream effector S6K1, maintenance of cell size, and mTOR protein expression. The association of raptor with mTOR also negatively regulates the mTOR kinase activity. Conditions that repress the pathway, such as nutrient deprivation and mitochondrial uncoupling, stabilize the mTOR-raptor association and inhibit mTOR kinase activity. We propose that raptor is a missing component of the mTOR pathway that through its association with mTOR regulates cell size in response to nutrient levels.

The mammalian TOR (mTOR) pathway integrates nutrient- and growth factor-derived signals to regulate growth, the process whereby cells accumulate mass and increase in size. mTOR is a large protein kinase and the target of rapamycin, an immunosuppressant that also blocks vessel restenosis and has potential anticancer applications. mTOR interacts with the raptor and GbetaL proteins to form a complex that is the target of rapamycin. Here, we demonstrate that mTOR is also part of a distinct complex defined by the novel protein rictor (rapamycin-insensitive companion of mTOR). Rictor shares homology with the previously described pianissimo from D. discoidieum, STE20p from S. pombe, and AVO3p from S. cerevisiae. Interestingly, AVO3p is part of a rapamycin-insensitive TOR complex that does not contain the yeast homolog of raptor and signals to the actin cytoskeleton through PKC1. Consistent with this finding, the rictor-containing mTOR complex contains GbetaL but not raptor and it neither regulates the mTOR effector S6K1 nor is it bound by FKBP12-rapamycin. We find that the rictor-mTOR complex modulates the phosphorylation of Protein Kinase C alpha (PKCalpha) and the actin cytoskeleton, suggesting that this aspect of TOR signaling is conserved between yeast and mammals.

Nutrient starvation induces autophagy in eukaryotic cells through inhibition of TOR (target of rapamycin), an evolutionarily‐conserved protein kinase. TOR, as a central regulator of cell growth, plays a key role at the interface of the pathways that coordinately regulate the balance between cell growth and autophagy in response to nutritional status, growth factor and stress signals. Although TOR has been known as a key regulator of autophagy for more than a decade, the underlying regulatory mechanisms have not been clearly understood. This review discusses the recent advances in understanding of the mechanism by which TOR regulates autophagy with focus on mammalian TOR (mTOR) and its regulation of the autophagy machinery.

Autophagy, the starvation-induced degradation of bulky cytosolic components, is up-regulated in mammalian cells when nutrient supplies are limited. Although mammalian target of rapamycin (mTOR) is known as the key regulator of autophagy induction, the mechanism by which mTOR regulates autophagy has remained elusive. Here, we identify that mTOR phosphorylates a mammalian homologue of Atg13 and the mammalian Atg1 homologues ULK1 and ULK2. The mammalian Atg13 binds both ULK1 and ULK2 and mediates the interaction of the ULK proteins with FIP200. The binding of Atg13 stabilizes and activates ULK and facilitates the phosphorylation of FIP200 by ULK, whereas knockdown of Atg13 inhibits autophagosome formation. Inhibition of mTOR by rapamycin or leucine deprivation, the conditions that induce autophagy, leads to dephosphorylation of ULK1, ULK2, and Atg13 and activates ULK to phosphorylate FIP200. These findings demonstrate that the ULK-Atg13-FIP200 complexes are direct targets of mTOR and important regulators of autophagy in response to mTOR signaling.

mTOR and raptor are components of a signaling pathway that regulates mammalian cell growth in response to nutrients and growth factors. Here, we identify a member of this pathway, a protein named GbetaL that binds to the kinase domain of mTOR and stabilizes the interaction of raptor with mTOR. Like mTOR and raptor, GbetaL participates in nutrient- and growth factor-mediated signaling to S6K1, a downstream effector of mTOR, and in the control of cell size. The binding of GbetaL to mTOR strongly stimulates the kinase activity of mTOR toward S6K1 and 4E-BP1, an effect reversed by the stable interaction of raptor with mTOR. Interestingly, nutrients and rapamycin regulate the association between mTOR and raptor only in complexes that also contain GbetaL. Thus, we propose that the opposing effects on mTOR activity of the GbetaL- and raptor-mediated interactions regulate the mTOR pathway.

Abstract We developed a global, 30-m resolution dataset of percent tree cover by rescaling the 250-m MOderate-resolution Imaging Spectroradiometer (MODIS) Vegetation Continuous Fields (VCF) Tree Cover layer using circa- 2000 and 2005 Landsat images, incorporating the MODIS Cropland Layer to improve accuracy in agricultural areas. Resulting Landsat-based estimates maintained consistency with the MODIS VCF in both epochs (RMSE =8.6% in 2000 and 11.9% in 2005), but showed improved accuracy in agricultural areas and increased discrimination of small forest patches. Against lidar measurements, the Landsat-based estimates exhibited accuracy slightly less than that of the MODIS VCF (RMSE=16.8% for MODIS-based vs. 17.4% for Landsat-based estimates), but RMSE of Landsat estimates was 3.3 percentage points lower than that of the MODIS data in an agricultural region. The Landsat data retained the saturation artifact of the MODIS VCF at greater than or equal to 80% tree cover but showed greater potential for removal of errors through calibration to lidar, with post-calibration RMSE of 9.4% compared to 13.5% in MODIS estimates. Provided for free download at the Global Land Cover Facility (GLCF) website (www.landcover.org), the 30-m resolution GLCF tree cover dataset is the highest-resolution multi-temporal depiction of Earth's tree cover available to the Earth science community.

This review summarizes comprehensive recent studies on the removal of contaminants of emerging concern (CECs) by forward osmosis (FO), reverse osmosis (RO), nanofiltration (NF), and ultrafiltration (UF) membrane treatments, and describes important information on the applications of FO, RO, NF, and UF membranes in water and wastewater (WW) treatment. The main objective of this review was to synthesize findings on membrane treatments of CECs in water and WW, and to highlight upcoming research areas based on knowledge gaps. In particular, this review aimed to address several key parameters, including the physicochemical properties of CECs (solute molecular weight/size/geometry, charge, and hydrophobicity), water quality conditions (pH, solute concentration, temperature, background inorganics, and natural organic matter), and membrane properties and operating conditions (membrane fouling, membrane pore size, porosity, charge, and pressure) that influence the removal of CECs during membrane filtration. Future research directions regarding membrane treatment for the removal of CECs from water and WW are also discussed.

Autism spectrum disorders (ASDs) are neurodevelopmental disorders caused by various genetic and environmental factors that result in synaptic abnormalities. ASD development is suggested to involve microglia, which have a role in synaptic refinement during development. Autophagy and related pathways are also suggested to be involved in ASDs. However, the precise roles of microglial autophagy in synapses and ASDs are unknown. Here, we show that microglial autophagy is involved in synaptic refinement and neurobehavior regulation. We found that deletion of atg7, which is vital for autophagy, from myeloid cell-specific lysozyme M-Cre mice resulted in social behavioral defects and repetitive behaviors, characteristic features of ASDs. These mice also had increases in dendritic spines and synaptic markers and altered connectivity between brain regions, indicating defects in synaptic refinement. Synaptosome degradation was impaired in atg7-deficient microglia and immature dendritic filopodia were increased in neurons co-cultured with atg7-deficient microglia. To our knowledge, our results are the first to show the role of microglial autophagy in the regulation of the synapse and neurobehaviors. We anticipate our results to be a starting point for more comprehensive studies of microglial autophagy in ASDs and the development of putative therapeutics.

Carnobacterium maltaromaticum B26 and Carnobacterium divergens B33, which were isolated from the intestine of healthy rainbow trout (Oncorhynchus mykiss, Walbaum), were selected as being potentially useful as probiotics with effectiveness against Aeromonas salmonicida and Yersinia ruckeri. Thus, rainbow trout administered with feed supplemented with B26 or B33 dosed at >10(7) cells g(-1) feed conferred protection against challenge with virulent cultures of the pathogens. Moreover, both cultures persisted in the gut for up to 3 weeks after administration. The cultures enhanced the cellular and humoral immune responses. Specifically, fish fed with B26 demonstrated significantly increased phagocytic activity of the head kidney macrophages, whereas the use of B33 led to significant increases in respiratory burst and serum lysozyme activity. Also, the gut mucosal lysozyme activity for fish fed with both cultures was statistically higher than the controls.

ULK1 (unc-51 like autophagy activating kinase 1), the key mediator of MTORC1 signaling to autophagy, regulates early stages of autophagosome formation in response to starvation or MTORC1 inhibition. How ULK1 regulates the autophagy induction process remains elusive. Here, we identify that ATG13, a binding partner of ULK1, mediates interaction of ULK1 with the ATG14-containing PIK3C3/VPS34 complex, the key machinery for initiation of autophagosome formation. The interaction enables ULK1 to phosphorylate ATG14 in a manner dependent upon autophagy inducing conditions, such as nutrient starvation or MTORC1 inhibition. The ATG14 phosphorylation mimics nutrient deprivation through stimulating the kinase activity of the class III phosphatidylinositol 3-kinase (PtdIns3K) complex and facilitates phagophore and autophagosome formation. By monitoring the ATG14 phosphorylation, we determined that the ULK1 activity requires BECN1/Beclin 1 but not the phosphatidylethanolamine (PE)-conjugation machinery and the PIK3C3 kinase activity. Monitoring the phosphorylation also allowed us to identify that ATG9A is required to suppress the ULK1 activity under nutrient-enriched conditions. Furthermore, we determined that ATG14 phosphorylation depends on ULK1 and dietary conditions in vivo. These results define a key molecular event for the starvation-induced activation of the ATG14-containing PtdIns3K complex by ULK1, and demonstrate hierarchical relations between the ULK1 activation and other autophagy proteins involved in phagophore formation.

mTORC1 plays a key role in autophagy as a negative regulator. The currently known targets of mTORC1 in the autophagy pathway mainly function at early stages of autophagosome formation. Here, we identify that mTORC1 inhibits later stages of autophagy by phosphorylating UVRAG. Under nutrient-enriched conditions, mTORC1 binds and phosphorylates UVRAG. The phosphorylation positively regulates the association of UVRAG with RUBICON, thereby enhancing the antagonizing effect of RUBICON on UVRAG-mediated autophagosome maturation. Upon dephosphorylation, UVRAG is released from RUBICON to interact with the HOPS complex, a component for the late endosome and lysosome fusion machinery, and enhances autophagosome and endosome maturation. Consequently, the dephosphorylation of UVRAG facilitates the lysosomal degradation of epidermal growth factor receptor (EGFR), reduces EGFR signaling, and suppresses cancer cell proliferation and tumor growth. These results demonstrate that mTORC1 engages in late stages of autophagy and endosome maturation, defining a broader range of mTORC1 functions in the membrane-associated processes.

Autophagy, the primary recycling pathway of cells, plays a critical role in mitochondrial quality control under normal growth conditions and in the response to cellular stress. The Hsp90-Cdc37 chaperone complex coordinately regulates the activity of select kinases to orchestrate many facets of the stress response. Although both maintain mitochondrial integrity, the relationship between Hsp90-Cdc37 and autophagy has not been well characterized. Ulk1, one of the mammalian homologs of yeast Atg1, is a serine-threonine kinase required for mitophagy. Here we show that the interaction between Ulk1 and Hsp90-Cdc37 stabilizes and activates Ulk1, which in turn is required for the phosphorylation and release of Atg13 from Ulk1, and for the recruitment of Atg13 to damaged mitochondria. Hsp90-Cdc37, Ulk1, and Atg13 phosphorylation are all required for efficient mitochondrial clearance. These findings establish a direct pathway that integrates Ulk1- and Atg13-directed mitophagy with the stress response coordinated by Hsp90 and Cdc37.

Macroautophagy is an evolutionarily conserved cellular process involved in the clearance of proteins and organelles. Although the cytoplasmic machinery that orchestrates autophagy induction during starvation, hypoxia, or receptor stimulation has been widely studied, the key epigenetic events that initiate and maintain the autophagy process remain unknown. Here we show that the methyltransferase G9a coordinates the transcriptional activation of key regulators of autophagosome formation by remodeling the chromatin landscape. Pharmacological inhibition or RNA interference (RNAi)-mediated suppression of G9a induces LC3B expression and lipidation that is dependent on RNA synthesis, protein translation, and the methyltransferase activity of G9a. Under normal conditions, G9a associates with the LC3B, WIPI1, and DOR gene promoters, epigenetically repressing them. However, G9a and G9a-repressive histone marks are removed during starvation and receptor-stimulated activation of naive T cells, two physiological inducers of macroautophagy. Moreover, we show that the c-Jun N-terminal kinase (JNK) pathway is involved in the regulation of autophagy gene expression during naive-T-cell activation. Together, these findings reveal that G9a directly represses genes known to participate in the autophagic process and that inhibition of G9a-mediated epigenetic repression represents an important regulatory mechanism during autophagy.

Historical baselines of forest cover are needed to understand the causes and consequences of recent changes and to assess the effectiveness of land-use policies. However, historical assessment of the global distribution of forest cover and change has been lacking due to obstacles in image acquisition, computational demands, and lack of retrospective reference data for image classification. As limitations of access to imagery and computational power are overcome, the possibility is increased of an automated retrospective classification of forest cover. We used locally fit classification trees to relate hind-cast observations of “stable pixels” of forest and non-forest cover from circa-2000 to Landsat spectral measurements taken from the circa-1990 epoch of the Global Land Survey collection of Landsat images. Based on analysis of nearly 30,000 Landsat images, forest-cover change between 1990 and 2000 epochs was detected based on joint probabilities of cover in the two epochs. Assessed across a sample of areas with coincident reference data in the conterminous United States, the resulting maps achieved 93% accuracy for forest cover and 84% for forest-cover change—comparable or even higher than many previous national efforts. Global accuracy assessment likewise showed accuracy of 88% for forest-cover change. The maps depict the global distribution of gross gains and losses in forest cover, as well as their net change. The initial analysis showed strong effects of extant land use in temperate regions and land-use change in the tropics over the period, while wildfire dominated in the boreal zone. Regions of high net forest loss (e.g., Amazonia) were associated with land-use changes into agriculture, and regions of high gross gains and losses (e.g., southeastern US, Sweden) were associated with intensive forestry. These results, including the global forest cover and forest cover change datasets, will be a basis for the estimation of the efficacy of policies and analyzing correlation between forest cover change and socio-economic factors.

The aim of the current study was to evaluate the detection and diagnosis of three types of odontogenic cystic lesions (OCLs)-odontogenic keratocysts, dentigerous cysts, and periapical cysts-using dental panoramic radiography and cone beam computed tomographic (CBCT) images based on a deep convolutional neural network (CNN).The GoogLeNet Inception-v3 architecture was used to enhance the overall performance of the detection and diagnosis of OCLs based on transfer learning. Diagnostic indices (area under the ROC curve [AUC], sensitivity, specificity, and confusion matrix with and without normalization) were calculated and compared between pretrained models using panoramic and CBCT images.The pretrained model using CBCT images showed good diagnostic performance (AUC = 0.914, sensitivity = 96.1%, specificity = 77.1%), which was significantly greater than that achieved by other models using panoramic images (AUC = 0.847, sensitivity = 88.2%, specificity = 77.0%) (p = .014).This study demonstrated that panoramic and CBCT image datasets, comprising three types of odontogenic OCLs, are effectively detected and diagnosed based on the deep CNN architecture. In particular, we found that the deep CNN architecture trained with CBCT images achieved higher diagnostic performance than that trained with panoramic images.

In this study, we tested our hypothesis regarding mechanistic cross-talk between gastrointestinal inflammation and memory loss in a mouse model. Intrarectal injection of the colitis inducer 2,4,6-trinitrobenzenesulfonic acid (TNBS) in mice caused colitis via activation of nuclear factor (NF)-κB and increase in membrane permeability. TNBS treatment increased fecal and blood levels of lipopolysaccharide (LPS) and the number of Enterobacteriaceae, particularly Escherichia coli (EC), in the gut microbiota composition, but significantly reduced the number of Lactobacillus johnsonii (LJ). Indeed, we observed that the mice treated with TNBS displayed impaired memory, as assessed using the Y-maze and passive avoidance tasks. Furthermore, treatment with EC, which was isolated from the feces of mice with TNBS-induced colitis, caused memory impairment and colitis, and increased the absorption of orally administered LPS into the blood. Treatment with TNBS or EC induced NF-κB activation and tumor necrosis factor-α expression in the hippocampus of mice, as well as suppressed brain-derived neurotrophic factor expression. However, treatment with LJ restored the disturbed gut microbiota composition, lowered gut microbiota, and blood LPS levels, and attenuated both TNBS- and EC-induced memory impairment and colitis. These results suggest that the gut microbiota disturbance by extrinsic stresses can cause gastrointestinal inflammation, resulting in memory impairment.

ULK1 (unc51-like autophagy activating kinase 1) is a serine/threonine kinase that plays a key role in regulating macroautophagy/autophagy induction in response to amino acid starvation. Despite the recent progress in understanding ULK1 functions, the molecular mechanism by which ULK1 regulates the induction of autophagy remains elusive. In this study, we determined that ULK1 phosphorylates Ser30 of BECN1 (Beclin 1) in association with ATG14 (autophagy-related 14) but not with UVRAG (UV radiation resistance associated). The Ser30 phosphorylation was induced by deprivation of amino acids or treatments with Torin 1 or rapamycin, the conditions that inhibit MTORC1 (mechanistic target of rapamycin complex 1), and requires ATG13 and RB1CC1 (RB1 inducible coiled-coil 1), proteins that interact with ULK1. Hypoxia or glutamine deprivation, which inhibit MTORC1, was also able to increase the phosphorylation in a manner dependent upon ULK1 and ULK2. Blocking the BECN1 phosphorylation by replacing Ser30 with alanine suppressed the amino acid starvation-induced activation of the ATG14-containing PIK3C3/VPS34 (phosphatidylinositol 3-kinase catalytic subunit type 3) kinase, and reduced autophagy flux and the formation of phagophores and autophagosomes. The Ser30-to-Ala mutation did not affect the ULK1-mediated phosphorylations of BECN1 Ser15 or ATG14 Ser29, indicating that the BECN1 Ser30 phosphorylation might regulate autophagy independently of those 2 sites. Taken together, these results demonstrate that BECN1 Ser30 is a ULK1 target site whose phosphorylation activates the ATG14-containing PIK3C3 complex and stimulates autophagosome formation in response to amino acid starvation, hypoxia, and MTORC1 inhibition.

Imperfection originating from the ionic nature of organic inorganic hybrid perovskite (OIHP) is a major factor that degrades perovskite solar cells (PSCs) performance, and mitigating or removing it is essential for the implementation of high-performance PSCs. In this work, 2-hydroxyethyl acrylate (HEA), having both effective CO and O–H functional groups, is introduced as a functional additive that suppress imperfections by to control the crystallization process and passivate them at the same time, and the role of each function groups have been systematically investigated. We have found that O–H functional groups of HEA strongly interacts with organic cations (i.e., MABr, FAI) to form more stable organic cation-HEA complex selectively, delaying the crystallization process of perovskite. As a result, HEA improves crystallinity and grain size of perovskite and reduces charge trapping density by passivation and/or suppression of defect states. HEA raises average cell-efficiency from 17.37% to 19.01% and the maximum efficiency is reached to 21.01% for the inverted planar PSC. In addition, large-area (1.08 cm2) PSCs show an excellent efficiency of 20.40%, which is the highest efficiency in large-area inverted planar PSCs to date. PSCs with HEA also show long-term stability and better moisture resistance capabilities in ambient air conditions.

Abstract System x c − contributes to glutathione (GSH) synthesis and protects cells against ferroptosis by importing cystine and exchanging it with glutamate. Transforming growth factor β1 (TGF-β1) induces redox imbalance; however, its role in system x c − regulation remains poorly understood. The present study was the first to show that TGF-β1 repressed the protein and mRNA levels of xCT, a catalytic subunit of system x c − , in PLC/PRF/5, Huh7, Huh6, and HepG2 cells with an early TGF-β1 gene signature but not in SNU387, SNU449, SNU475, and SK-Hep1 cells with a late TGF-β1 gene signature. TGF-β1 treatment for 24 h reduced xCT expression in a dose-dependent manner but this TGF-β1-induced repression was blunted by pretreatment with a TGF-β1 receptor inhibitor. TGF-β1-mediated xCT repression was prevented by Smad3, but not Smad2 or Smad4, knockdown, whereas it was enhanced by Smad3 overexpression. TGF-β1 decreased GSH levels in control cells but not xCT-overexpressed cells. Furthermore, TGF-β1 increased reactive oxygen species (ROS) levels in PLC/PRF/5 cells and enhanced tert-butyl hydroperoxide-induced ROS levels in Huh7 cells; these changes were reversed by xCT overexpression. TGF-β1 treatment ultimately induced the ferrostatin-1- and deferoxamine-dependent lipid peroxidation after 2 days and 8 days in PLC/PRF/5 and Huh7 cells but not in SNU475 and SK-Hep1 cells. Pre-treatment of TGF-β1 for 2 days enhanced the reduction of cell viability induced by RSL3, a GSH peroxidase 4 (GPX4) inhibitor, in PLC/PRF/5 and Huh7 cells. In conclusion, TGF-β1 represses xCT expression via Smad3 activation and enhances lipid peroxidation in hepatocellular carcinoma cells with an early TGF-β1 signature, which would benefit from the targeting of GPX4.

In this study, we report on high performance semi-transparent perovskite solar cells (PSCs) with bidirectional transparent electrodes for use in building-integrated photovoltaics (BIPV). Using a typical magnetron sputtered InSnO (ITO) anode and a low energy sputtered InZnSnO (IZTO) cathode, we fabricated bidirectional transparent electrodes for semi-transparent PSCs. In particular, by the sequential sputtering of a thin buffer and then a thick dense IZTO layer (two-step sputtering), we fabricated a transparent IZTO cathode for a p-i-n planar type PSC without any plasma damage. Compared to the power conversion efficiency (PCE 3.43%) of PSCs with an ITO cathode prepared by typical DC magnetron sputtering, the PSC with a two-step sputtered IZTO cathode showed a much higher PCE (15.72%) due to the absence of plasma damage. The high PCE of the semi-transparent PSC with IZTO cathode is comparable to the PCE (17.04%) of an opaque PSC with opaque Ag cathode. Furthermore, with diluted perovskite solution, we able to achieve PCE of 13.61% and AVT of 24.70% both high enough to use as PSC for BIPV. These results demonstrate that the two-step linear facing target sputtering (FTS) process is a feasible approach to make high-quality transparent top cathodes for semi-transparent PSCs. Considering the mass-production of semi-transparent PSCs for BIPV, FTS-based two-step sputtering has great potential to become a key technique for producing smart windows that will replace typical solution coating or other complicated transfer processes.

Autophagy maintains cellular homeostasis during low energy states. According to the current understanding, glucose-depleted cells induce autophagy through AMPK, the primary energy-sensing kinase, to acquire energy for survival. However, contrary to the prevailing concept, our study demonstrates that AMPK inhibits ULK1, the kinase responsible for autophagy initiation, thereby suppressing autophagy. We found that glucose starvation suppresses amino acid starvation-induced stimulation of ULK1-Atg14-Vps34 signaling via AMPK activation. During an energy crisis caused by mitochondrial dysfunction, the LKB1-AMPK axis inhibits ULK1 activation and autophagy induction, even under amino acid starvation. Despite its inhibitory effect, AMPK protects the ULK1-associated autophagy machinery from caspase-mediated degradation during energy deficiency, preserving the cellular ability to initiate autophagy and restore homeostasis once the stress subsides. Our findings reveal that dual functions of AMPK, restraining abrupt induction of autophagy upon energy shortage while preserving essential autophagy components, are crucial to maintain cellular homeostasis and survival during energy stress.

Herein, we develop direct current-generating triboelectric nanogenerators (DC-TENGs) based on the tribovoltaic p-n junction using n-type perovskite (CsFAMA) and p-type conductive polymer (PEDOT:PSS); CsFAMA based DC-TENG is shown to generate a high DC power output of about 2.1 µA cm−2 (current) and 0.33 V (voltage). We also introduce choline chloride (ChCl) to passivate the defects inside CsFAMA to improve the power-generating performance of DC-TENG by increasing triboelectric charge density, carrier mobility, and built-in potential, which are the key factors that determine device performance. Due to the synergetic effect of reduced defect sites (5.0×1015 cm−3 to 1.0×1015 cm−3), enhanced electron mobilities (1.0×10−2 cm2 V−1 s−1 to 2.3×10−2 cm2 V−1 S−1), and modulated work function, the passivated CsFAMA-based DC-TENG generates an output current density of 11 µA cm−2 and an output voltage of 0.80 V. Our results are expected to contribute to the development of high-performance DC-TENGs by presenting a promising strategy that involves controlling the triboelectric semiconducting interface.

DNA transcription is initiated by a small regulatory region of transactivators known as the transactivation domain. In contrast to the rapid progress made on the functional aspect of this promiscuous domain, its structural feature is still poorly characterized. Here, our multidimensional NMR study reveals that an unbound <i>full-length</i> p53 transactivation domain, although similar to the recently discovered group of loosely folded proteins in that it does not have tertiary structure, is nevertheless populated by an amphipathic helix and two nascent turns. The helix is formed by residues Thr¹⁸–Leu²⁶(Thr-Phe-Ser-Asp-Leu-Trp-Lys-Leu-Leu), whereas the two turns are formed by residues Met⁴⁰–Met⁴⁴ and Asp⁴⁸–Trp⁵³, respectively. It is remarkable that these local secondary structures are selectively formed by functionally critical and positionally conserved hydrophobic residues present in several acidic transactivation domains. This observation suggests that such local structures are general features of acidic transactivation domains and may represent "specificity determinants" (Ptashne, M., and Gann, A. A. F. (1997),<i>Nature</i> 386, 569–577) that are important for transcriptional activity.

Microstructures and mechanical properties of Mg-Zn-Y alloys containing icosahedral phase (I-phase) as a secondary solidification phase have been investigated in the composition range where the total solute content (Zn and Y) is less than 10 wt.%. The optimum Zn / Y ratio for the formation of two-phase microstructure consisting of α-Mg and I-phase is 5∼7. The strength increases with increasing total solute content (Zn and Y), i.e. with increasing volume fraction of I-phase. In particular, the alloys containing I-phase exhibit high elongation to failure, > 25%, which is ascribed to the low interfacial energy between the I-phase particle and surrounding α-Mg crystalline matrix.

The protein kinase mammalian target of rapamycin (mTOR) plays an important role in the coordinate regulation of cellular responses to nutritional and growth factor conditions. mTOR achieves these roles through interacting with raptor and rictor to form two distinct protein complexes, mTORC1 and mTORC2. Previous studies have been focused on mTORC1 to elucidate the central roles of the complex in mediating nutritional and growth factor signals to the protein synthesis machinery. Functions of mTORC2, relative to mTORC1, have remained little understood. Here we report identification of a novel component of mTORC2 named PRR5 (PRoline-Rich protein 5), a protein encoded by a gene located on a chromosomal region frequently deleted during breast and colorectal carcinogenesis (Johnstone, C. N., Castellvi-Bel, S., Chang, L. M., Sung, R. K., Bowser, M. J., Pique, J. M., Castells, A., and Rustgi, A. K. (2005) Genomics 85, 338–351). PRR5 interacts with rictor, but not raptor, and the interaction is independent of mTOR and not disturbed under conditions that disrupt the mTOR-rictor interaction. PRR5, unlike Sin1, another component of mTORC2, is not important for the mTOR-rictor interaction and mTOR activity toward Akt phosphorylation. Despite no significant effect of PRR5 on mTORC2-mediated Akt phosphorylation, PRR5 silencing inhibits Akt and S6K1 phosphorylation and reduces cell proliferation rates, a result consistent with PRR5 roles in cell growth and tumorigenesis. The inhibition of Akt and S6K1 phosphorylation by PRR5 knock down correlates with reduction in the expression level of platelet-derived growth factor receptor β (PDGFRβ). PRR5 silencing impairs PDGF-stimulated phosphorylation of S6K1 and Akt but moderately reduces epidermal growth factor- and insulin-stimulated phosphorylation. These findings propose a potential role of mTORC2 in the cross-talk with the cellular machinery that regulates PDGFRβ expression and signaling. The protein kinase mammalian target of rapamycin (mTOR) plays an important role in the coordinate regulation of cellular responses to nutritional and growth factor conditions. mTOR achieves these roles through interacting with raptor and rictor to form two distinct protein complexes, mTORC1 and mTORC2. Previous studies have been focused on mTORC1 to elucidate the central roles of the complex in mediating nutritional and growth factor signals to the protein synthesis machinery. Functions of mTORC2, relative to mTORC1, have remained little understood. Here we report identification of a novel component of mTORC2 named PRR5 (PRoline-Rich protein 5), a protein encoded by a gene located on a chromosomal region frequently deleted during breast and colorectal carcinogenesis (Johnstone, C. N., Castellvi-Bel, S., Chang, L. M., Sung, R. K., Bowser, M. J., Pique, J. M., Castells, A., and Rustgi, A. K. (2005) Genomics 85, 338–351). PRR5 interacts with rictor, but not raptor, and the interaction is independent of mTOR and not disturbed under conditions that disrupt the mTOR-rictor interaction. PRR5, unlike Sin1, another component of mTORC2, is not important for the mTOR-rictor interaction and mTOR activity toward Akt phosphorylation. Despite no significant effect of PRR5 on mTORC2-mediated Akt phosphorylation, PRR5 silencing inhibits Akt and S6K1 phosphorylation and reduces cell proliferation rates, a result consistent with PRR5 roles in cell growth and tumorigenesis. The inhibition of Akt and S6K1 phosphorylation by PRR5 knock down correlates with reduction in the expression level of platelet-derived growth factor receptor β (PDGFRβ). PRR5 silencing impairs PDGF-stimulated phosphorylation of S6K1 and Akt but moderately reduces epidermal growth factor- and insulin-stimulated phosphorylation. These findings propose a potential role of mTORC2 in the cross-talk with the cellular machinery that regulates PDGFRβ expression and signaling. Cell growth relies on coordinated regulation of signaling pathways that integrate cellular physiological status in response to nutrient levels, growth factor signals, and environmental stress. Impairment of the coordinated regulation can lead to disastrous effects on cell physiology, resulting in cell death or uncontrolled growth. mTOR, 2The abbreviations used are:mTORmammalian target of rapamycinPDGFRplatelet-derived growth factor receptorEGFRepidermal growth factor receptorraptorregulatory-associated protein of mTORrictorrapamycin-insensitive companion of mTORmTORC1mTOR complex 1mTORC2mTOR complex 2PRAS40proline-rich Akt substrate 40 kDaGSTglutathione S-transferaseHEKhuman embryonic kidneyHAhemagglutininChaps3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acidshRNAshort hairpin RNA. a member of the phosphatidylinositol kinase-related kinase family, has been known as a central player in the signaling pathway that regulates cell growth in response to a variety of cellular signals derived from nutrient levels, growth factors, and environmental stress (2Brunn G.J. Hudson C.C. Sekulic A. Williams J.M. Hosoi H. Houghton P.J. Lawrence Jr., J.C. Abraham R.R. Science. 1997; 277: 99-101Crossref PubMed Scopus (814) Google Scholar, 3Dennis P.B. Jaeschke A. Saitoh M. Fowler B. Kozma S.C. Thomas G. Science. 2001; 294: 1102-1105Crossref PubMed Scopus (807) Google Scholar, 4Shimji A.F. Nghiem P. Schreiber S.L. Mol. Cell. 2003; 12: 271-280Abstract Full Text Full Text PDF PubMed Scopus (176) Google Scholar). mTOR plays a central role in the signaling network that regulates a variety of cellular processes including ribosome biogenesis, protein synthesis, autophagy, and actin cytoskeleton organization; human diseases such as cancer, diabetes, obesity, and harmatoma syndrome are associated with defects in mTOR signaling (5Gao X. Zhang Y. Arrazola P. Hino O. Kobayashi T. Yeung R.S. Ru B. Pan D. Nat. Cell Biol. 2002; 4: 699-704Crossref PubMed Scopus (577) Google Scholar, 6Corradetti M.N. Inoki K. Bardeesy N. Depinho R.A. Guan K.L. Genes Dev. 2004; 18: 1533-1538Crossref PubMed Scopus (470) Google Scholar, 7Um S.H. Frigerio F. Watanabe M. Picard F. Joaquin M. Sticker M. Fumagalli S. Allegrini P.R. Kozma S.C. Auwerx J. Thomas G. Nature. 2004; 431: 200-205Crossref PubMed Scopus (1376) Google Scholar, 8Kenerson H. Dundon T.A. Yeung R.S. Pediatr. Res. 2005; 57: 67-75Crossref PubMed Scopus (130) Google Scholar, 9Vellai T. Takacs-Vellai K. Zhang Y. Kovacs A.L. Orosz L. Muller F. Nature. 2003; 426: 620Crossref PubMed Scopus (847) Google Scholar). mammalian target of rapamycin platelet-derived growth factor receptor epidermal growth factor receptor regulatory-associated protein of mTOR rapamycin-insensitive companion of mTOR mTOR complex 1 mTOR complex 2 proline-rich Akt substrate 40 kDa glutathione S-transferase human embryonic kidney hemagglutinin 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonic acid short hairpin RNA. Recent years have seen discoveries of several mTOR effectors and binding proteins. mTOR exists in two multiprotein complexes, mTORC1 and mTORC2. mTORC1 consists of mTOR, raptor, GβL, and PRAS40, and it functions to regulate protein synthesis and cell growth in response to nutrient levels and growth factor signals (10Kim D-H. Sarbassov D.D. Ali S.M. King J.E. Latek R.R. Erdjument-Bromage H. Tempst P. Sabatini D.M. Cell. 2002; 110: 163-175Abstract Full Text Full Text PDF PubMed Scopus (2391) Google Scholar, 11Kim D-H. Sarbassov D.D. Ali S.M. Latek R.R. Kalyani V.P. Erdjument-Bromage H. Tempst P. Sabatini D.M. Mol. Cell. 2003; 11: 895-904Abstract Full Text Full Text PDF PubMed Scopus (774) Google Scholar, 12Hara K. Maruki Y. Long X. Yoshino K. Oshiro N. Hidayat S. Tokunaga C. Avruch J. Yonezawa K. Cell. 2002; 110: 177-189Abstract Full Text Full Text PDF PubMed Scopus (1458) Google Scholar, 13Loewith R. Jacinto E. Wullschleger S. Lorberg A. Crespo J.L. Bonenfant D. Oppliger W. Jenoe P. Hall M.N. Mol. Cell. 2002; 10: 457Abstract Full Text Full Text PDF PubMed Scopus (1484) Google Scholar, 14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar). mTORC1 regulates phosphorylations of at least two regulators of protein synthesis, S6K1 and 4E-BP1, and mediates nutrient and insulin signals to the cell growth machinery (2Brunn G.J. Hudson C.C. Sekulic A. Williams J.M. Hosoi H. Houghton P.J. Lawrence Jr., J.C. Abraham R.R. Science. 1997; 277: 99-101Crossref PubMed Scopus (814) Google Scholar, 15Burnett P.E. Barrow R.K. Cohen N.A. Snyder S.H. Sabatini D.M. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 1432-1437Crossref PubMed Scopus (947) Google Scholar). mTORC1 is regulated by TSC-Rheb (tuberous sclerosis complex-Ras homolog-enriched in brain) signaling (16Inoki K. Li Y. Zhu T. Wu J. Guan K.L. Nat. Cell Biol. 2002; 4: 648-657Crossref PubMed Scopus (2421) Google Scholar, 17Manning B.D. Tee A.R. Logsdon M.N. Blenis J. Cantley L.C. Mol. Cell. 2002; 10: 151-162Abstract Full Text Full Text PDF PubMed Scopus (1286) Google Scholar, 18Zhang Y. Gao X. Saucedo L.J. Ru B. Edgar B.A. Pan D. Nat. Cell Biol. 2003; 5: 578-581Crossref PubMed Scopus (720) Google Scholar, 19Long X. Lin Y. Ortiz-Vega S. Yonezawa K. Avruch J. Curr. Biol. 2005; 15: 702-713Abstract Full Text Full Text PDF PubMed Scopus (758) Google Scholar). mTORC2 consists of mTOR, rictor, GβL, and Sin1, and it does not likely bind rapamycin-FK506-binding protein 12 complex, which makes mTORC2 distinctive from mTORC1 (13Loewith R. Jacinto E. Wullschleger S. Lorberg A. Crespo J.L. Bonenfant D. Oppliger W. Jenoe P. Hall M.N. Mol. Cell. 2002; 10: 457Abstract Full Text Full Text PDF PubMed Scopus (1484) Google Scholar, 20Sarbassov D.D. Ali S.M. Kim D-H. Guertin D.A. Latek R.R. Erdjument-Bromage H. Tempst P. Sabatini D.M. Curr. Biol. 2004; 14: 1296-1302Abstract Full Text Full Text PDF PubMed Scopus (2177) Google Scholar, 21Jacinto E. Loewith R. Schmidt A. Lin S. Ruegg M.A. Hall A. Hall M.N. Nature Cell Biol. 2004; 6: 1122-1128Crossref PubMed Scopus (1701) Google Scholar). Saccharomyces cerevisiae TORC2 consists of TOR2, LST8, AVO1 (Sin1 ortholog), and AVO3 (rictor ortholog) and two other components, AVO2 and BIT61, whose homologues have not been identified in higher eukaryotes (13Loewith R. Jacinto E. Wullschleger S. Lorberg A. Crespo J.L. Bonenfant D. Oppliger W. Jenoe P. Hall M.N. Mol. Cell. 2002; 10: 457Abstract Full Text Full Text PDF PubMed Scopus (1484) Google Scholar, 22Wullschleger S. Loewith R. Oppliger W. Hall M.N. J. Biol. Chem. 2005; 280: 30697-30704Abstract Full Text Full Text PDF PubMed Scopus (190) Google Scholar, 23Wedaman K.P. Reinke A. Anderson S. Yates J. II I McCaffery J.M. Powers T. Mol. Biol. Cell. 2003; 14: 1204-1220Crossref PubMed Scopus (197) Google Scholar). Functions and regulatory mechanisms of mTORC2 remain largely unknown. Recent studies showed that mTORC2 regulates protein kinase C α phosphorylation, actin cytoskeleton organization, and Akt phosphorylation at Ser-473 (20Sarbassov D.D. Ali S.M. Kim D-H. Guertin D.A. Latek R.R. Erdjument-Bromage H. Tempst P. Sabatini D.M. Curr. Biol. 2004; 14: 1296-1302Abstract Full Text Full Text PDF PubMed Scopus (2177) Google Scholar, 21Jacinto E. Loewith R. Schmidt A. Lin S. Ruegg M.A. Hall A. Hall M.N. Nature Cell Biol. 2004; 6: 1122-1128Crossref PubMed Scopus (1701) Google Scholar, 24Sarbassov D.D. Guertin D.A. Ali S.M. Sabatini D.M. Science. 2005; 307: 1098-1101Crossref PubMed Scopus (5294) Google Scholar, 25Hresko R.C. Mueckler M. J. Biol. Chem. 2005; 280: 40406-40416Abstract Full Text Full Text PDF PubMed Scopus (513) Google Scholar). Recognizing the complex relationship between mTOR, S6K1, and Akt and knowing that we have not yet identified mammalian homologues of AVO2 and BIT61, we hypothesized that other unidentified mTOR-binding effector proteins may provide clues to the mechanism underlying mTORC2 signaling. In this study, we identified a novel component of mTORC2 named PRR5, a protein having an implicative function in tumorigenesis (1Johnstone C.N. Castellvi-Bel S. Chang L.M. Sung R.K. Bowser M.J. Pique J.M. Castells A. Rustgi A.K. Genomics. 2005; 85: 338-351Crossref PubMed Scopus (25) Google Scholar). We determined that PRR5 specifically interacts with rictor, but not raptor, and the interaction is tighter than the rictor-mTOR interaction and independent of mTOR. We identified PRR5 and rictor residues crucial for the PRR5-rictor interaction and determined that PRR5 is important for PDGFRβ expression and PDGF signaling to Akt and S6K1. Reagents and Antibodies—Anti-mTOR (sc-1549), epidermal growth factor receptor (EGFR) (sc-03), Fas (sc-20140), p21 (sc-397), tubulin (sc-12462), PDFGR (sc-432), glyceraldehyde-3-phosphate dehydrogenase (sc-25778), and 14-3-3 (sc-732) antibodies were purchased from Santa Cruz Biotechnology (Santa Cruz, CA). Polyclonal antibodies specific to human PRR5 were generated against full-length PRR5 fused with glutathione S-transferase and an epitope peptide near the C terminus containing a sequence RGSGMSDLEGSGGR from YenZym antibodies (Burlingame, CA). Raptor- and rictor-specific antibodies were described in our previous report (14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar). Antibodies against S6K1 (9202), phospho-S6K1 Thr-389 (p-S6K1; 9205), Akt (9272), phospho-Akt Ser-372 (p-Akt; 9271), 4E-BP1 (9452), phospho-4E-BP1 (2855), and insulin receptor β (3025) antibodies were from Cell Signaling Technology (Danvers, MA). Rabbit IgG TrueBlot (18–8816) used to detect PRR5 in immunoprecipitates was obtained from eBioscience (San Diego, CA). Anti-HA antibody (HA.11) was from Covance (Berkeley, CA). Anti-Myc 9E10 and growth factors EGF and PDGF were purchased from EMD Biosciences (San Diego, CA). Porcine insulin was purchased from Sigma. Glutathione 4B beads were from GE Healthcare. Identification of PRR5—The strategy that we described in our previous study (14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar) was used with modifications in steps of immunoprecipitation and preparation of trypsinized samples. mTOR immunoprecipitate was prepared from HEK293T cells as described previously (14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar) using a lysis buffer containing 40 mm Hepes, pH 7.4, 120 mm NaCl, 1 mm EDTA, 50 mm NaF, 1.5 mm Na3VO4, 10 mm β-glycerophosphate, 0.3% Chaps, and EDTA-free protease inhibitors (Roche Applied Science). mTOR immunoprecipitates were washed four times with the lysis buffer and twice with the lysis buffer without the detergent. mTOR-binding proteins were eluted from the immunoprecipitate in a buffer containing 0.075% SDS. The eluate was diluted with a trypsin digestion buffer (25 mm ammonium bicarbonate, 2.5 mm CaCl2, pH 8.0) and incubated with trypsin (2 μg) overnight. The trypsinized sample was diluted with 0.1% formic acid to obtain a pH below 3.0 and loaded onto a mixed mode cation exchange cartridge (MCX cartridge; Waters Inc., Milford, MA) to remove salt and detergent from the samples. Peptides bound to the resin were eluted with 5% ammonium hydroxide in methanol and lyophilized. Lyophilized samples were dissolved in 0.1% formic acid and analyzed by microcapillary electrospray tandem mass spectrometry on an electrospray linear ion trap mass spectrometer (ThermoElectron, Waltham, MA). Tandem mass spectrometry spectral data were analyzed as described in our previous study (14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar). Peptide sequence matches were filtered using a probabilistic scoring algorithm called Peptide Prophet (26Eng J.K. McCormack A.L. Yates J.R. J. Am. Soc. Mass. Spectrom. 1994; 5: 976-989Crossref PubMed Scopus (5472) Google Scholar, 27Keller A. Nesvizhskii A.I. Kolker E. Aebersold R. Anal. Chem. 2002; 74: 5383-5392Crossref PubMed Scopus (3912) Google Scholar) that assigns a value between 0 and 1 to peptide sequence matches, with a score of 1 representing the highest confidence match. Plasmid Constructions and Mutagenesis—PRR5 cDNAs for isoforms 1, 2, and 3 of human origin kindly provided by Dr. C. Johnstone and Dr. A. Rustgi at the University of Pennsylvania were cloned into prk5-myc and prk5-HA expression vectors by use of a PCR amplification kit (Roche Applied Science). The PRR5 and rictor DNA fragments used in Fig. 4, C and D, were generated by PCR amplification and subcloned into mammalian expression vector prk5-myc, and all the clones were confirmed by sequencing. pLKO shRNA vector (provided by Dr. S. Stewart, Washington University) was used for knockdown experiments. Target sequences were 5′-catgctgcaggccatcttcta-3′ (sh-PRR5 4), 5′-ggacaagattcgcttctatga-3′ (sh-PRR5 15), 5′-aaccctgcctttgtcatgcct-3′ (sh-mTOR), 5′-caccaccaaagcaacctatag-3′ (sh-rictor), and 5′-aacgtacgcggaatacttcga-3′ (scrambled shRNA). All other constructs used in the experiments have been previously described (10Kim D-H. Sarbassov D.D. Ali S.M. King J.E. Latek R.R. Erdjument-Bromage H. Tempst P. Sabatini D.M. Cell. 2002; 110: 163-175Abstract Full Text Full Text PDF PubMed Scopus (2391) Google Scholar, 11Kim D-H. Sarbassov D.D. Ali S.M. Latek R.R. Kalyani V.P. Erdjument-Bromage H. Tempst P. Sabatini D.M. Mol. Cell. 2003; 11: 895-904Abstract Full Text Full Text PDF PubMed Scopus (774) Google Scholar, 14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar). Cell Culture and Transfection—HEK293T, HeLa, HT1080, HepG2 cells, and other cancer cell lines were cultured in Dulbecco's modified Eagle's medium containing 10% fetal bovine serum and penicillin/streptomycin at 37 °C in 5% CO2. For transient expression, HEK293T cells were transfected with recombinant DNAs or shRNA plasmids using FuGENE 6 (Roche Applied Science) following the manufacturer's protocol. Cells were harvested 2 days post-transfection for co-immunoprecipitation assay. Recombinant Protein Production—GST-tagged PRR5 isoforms 1, 2, and 3 cloned in pGEX6T-2 (Amersham Biosciences) were expressed in BL21(DE3) cells (EMD Biosciences) by induction with 0.1 mm isopropyl-1-thio-β-d-galactopyranoside for 16 h and purified with glutathione-Sepharose 4B beads according to a standard protocol. Co-immunoprecipitation and Western Blotting—For co-immunoprecipitation studies, whole-cell extracts were prepared in 0.3% Chaps buffer and immunoprecipitated with the anti-mTOR, anti-raptor, anti-rictor, anti-PRR5, anti-HA, or anti-Myc antibodies. Precipitated proteins were washed four times in 0.3% Chaps buffer, loaded onto 8% Tris-glycine gels (Invitrogen), transferred for 4 h onto immunoblot polyvinylidene difluoride membranes (Bio-Rad), and detected with ECL Western blotting detection reagents (Perkin-Elmer). Lentiviral Preparation, Viral Infection, and Stable Cell Generation—A pLKO-shRNA plasmid encoding an shRNA that targets PRR5 or a scrambled sequence was transduced into HEK293T cells with lentiviral packaging vectors pHR′8.2ΔR and pCMV-VSV-G (provided by Dr. S. Stewart, Washington University) using FuGENE 6. Viruses were collected from the medium 60 h after transfection, and target cells were infected with the collected viruses four times over 15 h in the presence of polybrene. Cells were harvested 3 to 5 days post-infection or selected under puromycin for several days. Cell Proliferation Assay—HeLa cells transduced with lentiviral shRNAs were split into 6-cm plates at 20% confluence; the next day cells were trypsinized and diluted ten times with Dulbecco's modified Eagle's medium. One ml of diluted cell culture was loaded on a ViCell analyzer (Beckman Coulter Inc., Fullerton, CA). Real-time PCR Analysis—Total RNA was prepared from HeLa cells transduced by lentiviral shRNAs using TRIzol reagent (Invitrogen) according to the manufacturer's instructions. Single-stranded cDNA was synthesized from 5 μg of total RNA using the iScript cDNA synthesis kit for real-time PCR (Bio-Rad) and resuspended in diethylpyrocarbonate-treated water. PCR products were generated by PCR amplification using Lightcycler Faststart DNA Masterplus SYBR Green 1 (Bio-Rad). Amplification of human PDGFRβ cDNA was performed using a forward primer, 5′-tgtgacggagagtgtgaatgac-3′, paired with a reverse primer, 5′-agggtgcggttgtctttgaac-3′. Amplification of TATA box-binding protein cDNA was performed using a forward primer, 5′-taatcccaagcggtttgctg-3′, paired with a reverse primer, 5′-gcacaccattttcccagaactg-3′. Identification of PRR5 as an mTOR-binding Protein—In our recent study, we described an approach combining the electrospray linear ion trap mass spectrometer and mTOR immunoprecipitation to identify mTOR-binding proteins (14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar). This approach, without relying on SDS-PAGE separation of proteins, increased the sensitivity of detection and led us to identify PRAS40 and Sin1 that were barely detectable on Coomassie-stained gels. We modified sample preparative conditions for mass spectrometry as detailed under “Experimental Procedures.” In the new preparation, we identified three peptides of high scores of P value, a parameter of fidelity for MS/MS matches, that were detected from proteins isolated specifically in mTOR immunoprecipitate but not in control immunoprecipitates (supplemental Table 1) (14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar). The three identified peptides were derived from PRR5, a proline-rich protein that has an implicative role in tumorigenesis (1Johnstone C.N. Castellvi-Bel S. Chang L.M. Sung R.K. Bowser M.J. Pique J.M. Castells A. Rustgi A.K. Genomics. 2005; 85: 338-351Crossref PubMed Scopus (25) Google Scholar). The PRR5 gene is located on chromosome 22q13.31, a region that is frequently deleted during human breast and colorectal carcinogenesis. PRR5 was previously shown to exist as several isoforms of splicing variants (1Johnstone C.N. Castellvi-Bel S. Chang L.M. Sung R.K. Bowser M.J. Pique J.M. Castells A. Rustgi A.K. Genomics. 2005; 85: 338-351Crossref PubMed Scopus (25) Google Scholar). PRR5, containing a high content of proline residues (28 among 388 amino acids, 7.2%), is conserved in higher eukaryotes. BLAST search revealed that human PRR5 shares 33–86% identity with genes from amphibians, fishes, rodents, and primates but does not show similarity to genes from Drosophila melanogaster and Caenorhabditis elegans as well as BIT61 and AVO2, two TOR2-interacting proteins whose mammalian homologues have not been found (supplemental Fig. S1). PRR5 residues 91–169 share sequence similarity with the HbrB domain, a domain found in proteins involved in hyphal growth and polarity (28Gatherar I.M. Pollerman S. Dunn-Coleman N. Turner G. Fungal Genet. Biol. 2004; 41: 463-471Crossref PubMed Scopus (22) Google Scholar). The longest isoform (isoform 1) contains 388 amino acids with a proline-rich region near the C terminus (Fig. 1A). Isoforms 2 and 3 are 9 and 95 amino acids shorter than isoform 1 at the N terminus, respectively. To confirm that mTOR specifically interacts with PRR5, mTOR immunoprecipitate was obtained from HEK293T cells and the amount of transiently expressed PRR5 isoform 2, a highly expressed form of the three isoforms (Fig. 1A), was analyzed by Western blotting. Supporting the specific interaction between mTOR and PRR5, PRR5 was detected only in mTOR immunoprecipitate purified in the absence of an mTOR antibody-blocking peptide but not in the presence of the blocking peptide or in immunoprecipitates obtained using control antibodies (Fig. 1B). Consistent with the specific interaction between mTOR and PRR5, endogenous mTOR was isolated in immunoprecipitates of recombinant PRR5 but not in control immunoprecipitates (Fig. 1C). We generated polyclonal antibodies specific to human PRR5 using GST fusion PRR5 full-length protein or an epitope peptide near the C terminus as an antigen. The latter antibody was able to pull down endogenous PRR5 that is associated with endogenous mTOR (Fig. 1D). Using the PRR5-specific antibody, we confirmed that endogenous PRR5 is purified specifically by anti-mTOR immunoprecipitation but not control antibodies (Fig. 1E). Tissue distribution of human PRR5 mRNA had been reported previously (1Johnstone C.N. Castellvi-Bel S. Chang L.M. Sung R.K. Bowser M.J. Pique J.M. Castells A. Rustgi A.K. Genomics. 2005; 85: 338-351Crossref PubMed Scopus (25) Google Scholar). PRR5 mRNA is most abundant in kidney and liver. It is also highly detected in brain, spleen, testis, and placenta. Northern blot analysis had shown multiple different-sized bands evident in tissues including spleen, testis, and heart. We observed that PRR5 is expressed in different amounts in several human cell lines such as 293T, HeLa, HepG2, human fibrosarcoma cell line HT1080, and human breast cancer cell lines MCF-7, T47D, and MDA-MB-231 (Fig. 1F). In these cells, we observed that PRR5 is immunoprecipitated by mTOR antibody (Fig. 1G). MDA-MB-231 expresses little amount of isoforms 1 and 2, a result consistent with reverse transcription PCR data (1Johnstone C.N. Castellvi-Bel S. Chang L.M. Sung R.K. Bowser M.J. Pique J.M. Castells A. Rustgi A.K. Genomics. 2005; 85: 338-351Crossref PubMed Scopus (25) Google Scholar). PRR5 is most highly expressed in 293T cells, a cell line derived from the kidney where PRR5 mRNA level is most abundant (1Johnstone C.N. Castellvi-Bel S. Chang L.M. Sung R.K. Bowser M.J. Pique J.M. Castells A. Rustgi A.K. Genomics. 2005; 85: 338-351Crossref PubMed Scopus (25) Google Scholar). PRR5 Is a Component of mTORC2—Knowing that PRR5 is an interacting protein of mTOR, we questioned which mTOR complex contains PRR5. Importantly, PRR5 was detected in mTOR and rictor immunoprecipitates, but not in raptor immunoprecipitates, suggesting that PRR5 specifically targets mTORC2 (Fig. 2A). Supporting that a large proportion of the mTOR-rictor complex contains PRR5, a higher amount of Myc-tagged PRR5 was recovered bound to rictor than Myc-mTOR, although both Myc-tagged proteins were expressed at similar levels (Fig. 2B). We thought that a stronger association of rictor with PRR5 than mTOR might support a role of rictor in the mediation of the PRR5-mTOR interaction. To test the possibility that PRR5 binding to mTOR requires rictor, we knocked down rictor in 293T cells through a lentiviral shRNA transduction and determined the amount of PRR5 associated with mTOR in mTOR immunoprecipitate. Rictor silencing led to a significant reduction in the amount of PRR5 not only in mTOR immunoprecipitate but also in cell lysate, indicating that rictor is important for the stability of PRR5 (Fig. 3A). Sin1, another component of mTORC2, has been shown to be important for the mTOR-rictor interaction (14Vander Haar E. Lee S-I. Bandhakavi S. Griffin T.J. Kim D.-H. Nat. Cell Biol. 2007; 9: 316-323Crossref PubMed Scopus (936) Google Scholar, 29Frias M.A. Thoreen C.C. Jaffe J.D. Schroder W. Sculley T. Carr S.A. Sabatini D.M. Curr. Biol. 2006; 16: 1-6Abstract Full Text Full Text PDF PubMed Scopus (555) Google Scholar, 30Jacinto E. Facchinetti V. Liu D. Soto N. Wei S. Jung S.Y. Huang Q. Qin J. Su B. Cell. 2006; 126: 1-13Abstract Full Text Full Text PDF Google Scholar, 31Yang Q. Inoki K. Ikenoue T. Guan K.L. Genes Dev. 2006; 20: 2820-2832Crossref PubMed Scopus (410) Google Scholar). Unlike Sin1 silencing, PRR5 silencing did not lead to a change in the affinity of the interaction between mTOR and rictor, supporting that PRR5 is not important for the rictor-mTOR interaction (Fig. 3A). Consistent with this result, overexpression of PRR5 did not alter the affinity of the mTOR-rictor interaction, an interaction stabilized by Sin1 overexpression (Fig. 3B). Furthermore, the PRR5-mTOR interaction, but not the PRR5-rictor interaction, was destabilized in a lysis buffer containing Triton X-100 (Fig. 3, C and D), indicating that the PRR5-rictor interaction is resistant to the detergent condition that disrupts the mTOR-rictor interaction (10Kim D-H. Sarbassov D.D. Ali S.M. King J.E. Latek R.R. Erdjument-Bromage H. Tempst P. Sabatini D.M. Cell. 2002; 110: 163-175Abstract Full Text Full Text PDF PubMed Scopus (2391) Google Scholar). These results demonstrate that PRR5 binds rictor preferentially and independently of mTOR and rictor is important for the mTOR-PRR5 interaction. PRR5 Residues 10–95 and 188–218 Are Crucial for Binding Rictor—Knowing that PRR5 interacts with mTOR and rictor, we questioned whether all the isoforms interact with mTOR and rictor isoforms. We expressed HA-tagged isoforms in 293T cells and analyzed the amount of endogenous mTOR and rictor recovered with HA-PPR5 isoforms in HA immunoprecipitate. Supporting that isoforms 1 and 2 interact with mTOR and rictor, we observed that endogenous mTOR and rictor are immunoprecipitated with HA-tagged isoforms 1 and 2, but not with isoform 3 (Fig. 4A). Confirming the specific interaction of isoforms 1 and 2 with mTOR and rictor, only isoforms 1 and 2, but not isoform 3, expressed as GST fusion proteins in Escherichia coli pulled down endogenous mTOR and rictor (Fig. 4B). These results suggest that the N-terminal 95 amino acids contain residues important for binding mTOR and rictor. The N-terminal region of PRR5 overlaps with the residues conserved among higher eukaryotic genes (supplemental Fig. S1), supporting that the interaction with rictor is likely important during the evolution of higher eukaryotes. To search for C-terminal residues important for binding mTOR and rictor, we made C-terminal-truncated mutants of PRR5 and tested the mutants for their ability to bi

A simple method was developed to fabricate polyethylene glycol (PEG) nanostructures using capillary lithography mediated by ultraviolet (UV) exposure. Acrylate-containing PEG monomers, such as PEG dimethacrylate (PEG-DMA, MW = 330), were photo-cross-linked under UV exposure to generate patterned structures. In comparison to unpatterned PEG films, hydrophobicity of PEG nanostructure modified surfaces was significantly enhanced. This could be attributed to trapped air in the nanostructures as supported by water contact angle measurements. Proteins (fibronectin, immunoglobulin, and albumin) and cells (fibroblasts and P19 EC cells) were examined on the modified surfaces to test for the level of protein adsorption and cell adhesion. It was found that proteins and cells preferred to adhere on nanostructured PEG surfaces in comparison to unpatterned PEG films; however, this level of adhesion was significantly lower than that of glass controls. These results suggest that capillary lithography can be used to fabricate PEG nanostructures capable of modifying protein and cell adhesive properties of surfaces.

Presently, co-culture of human umbilical cord blood mesenchymal stem cells (hUCB-MSCs) with BV2 microglia under amyloid-β42 (Aβ42) exposure induced a reduction of Aβ42 in the medium as well as an overexpression of the Aβ-degrading enzyme neprilysin (NEP) in microglia. Cytokine array examinations of co-cultured media revealed elevated release of soluble intracellular adhesion molecule-1 (sICAM-1) from hUCB-MSCs. Administration of human recombinant ICAM-1 in BV2 cells and wild-type mice brains induced NEP expression in time- and dose-dependent manners. In co-culturing with BV2 cells under Aβ42 exposure, knockdown of ICAM-1 expression on hUCB-MSCs by small interfering RNA (siRNA) abolished the induction of NEP in BV2 cells as well as reduction of added Aβ42 in the co-cultured media. By contrast, siRNA-mediated inhibition of the sICAM-1 receptor, lymphocyte function-associated antigen-1 (LFA-1), on BV2 cells reduced NEP expression by ICAM-1 exposure. When hUCB-MSCs were transplanted into the hippocampus of a 10-month-old transgenic mouse model of Alzheimer's disease for 10, 20, or 40 days, NEP expression was increased in the mice brains. Moreover, Aβ42 plaques in the hippocampus and other regions were decreased by active migration of hUCB-MSCs toward Aβ deposits. These data suggest that hUCB-MSC-derived sICAM-1 decreases Aβ plaques by inducing NEP expression in microglia through the sICAM-1/LFA-1 signaling pathway.

The mammalian target of rapamycin (mTOR) interacts with raptor to form the protein complex mTORC1 (mTOR complex 1), which plays a central role in the regulation of cell growth in response to environmental cues. Given that glucose is a primary fuel source and a biosynthetic precursor, how mTORC1 signaling is coordinated with glucose metabolism has been an important question. Here, we found that the glycolytic enzyme glyceraldehyde-3-phosphate dehydrogenase (GAPDH) binds Rheb and inhibits mTORC1 signaling. Under low-glucose conditions, GAPDH prevents Rheb from binding to mTOR and thereby inhibits mTORC1 signaling. High glycolytic flux suppresses the interaction between GAPDH and Rheb and thus allows Rheb to activate mTORC1. Silencing of GAPDH or blocking of the Rheb-GAPDH interaction desensitizes mTORC1 signaling to changes in the level of glucose. The GAPDH-dependent regulation of mTORC1 in response to glucose availability occurred even in TSC1-deficient cells and AMPK-silenced cells, supporting the idea that the GAPDH-Rheb pathway functions independently of the AMPK axis. Furthermore, we show that glyceraldehyde-3-phosphate, a glycolytic intermediate that binds GAPDH, destabilizes the Rheb-GAPDH interaction even under low-glucose conditions, explaining how high-glucose flux suppresses the interaction and activates mTORC1 signaling. Taken together, our results suggest that the glycolytic flux regulates mTOR's access to Rheb by regulating the Rheb-GAPDH interaction, thereby allowing mTORC1 to coordinate cell growth with glucose availability.

ULK1 (Unc51-like kinase, hATG1) is a Ser/Thr kinase that plays a key role in inducing autophagy in response to starvation. ULK1 is phosphorylated and negatively regulated by the mammalian target of rapamycin complex 1 (mTORC1). Previous studies have shown that ULK1 is not only a downstream effector of mTORC1 but also a negative regulator of mTORC1 signaling.1-3 Here, we investigated how ULK1 regulates mTORC1 signaling, and found that ULK1 inhibits the kinase activity of mTORC1 and cell proliferation. Deficiency or knockdown of ULK1 or its homolog ULK2 enhanced mTORC1 signaling, cell proliferation rates and accumulation of cell mass, whereas overexpression of ULK1 had the opposite effect. Knockdown of Atg13, the binding partner of ULK1 and ULK2, mimicked the effects of ULK1 or ULK2 deficiency or knockdown. Both insulin and leucine stimulated mTORC1 signaling to a greater extent when ULK1 or ULK2 was deficient or knocked down. In contrast, Atg5 deficiency did not have a significant effect on mTORC1 signaling and cell proliferation. The stimulatory effect of ULK1 knockdown on mTORC1 signaling occurred even in the absence of tuberous sclerosis complex 2 (TSC2), the negative regulator of mTORC1 signaling. In addition, ULK1 was found to bind raptor, induce its phosphorylation, and inhibit the kinase activity of mTORC1. These results demonstrate that ULK1 negatively regulates the kinase activity of mTORC1 and cell proliferation in a manner independent of Atg5 and TSC2. The inhibition of mTORC1 by ULK1 may be important to coordinately regulate cell growth and autophagy with optimized utilization of cellular energy.

We examined the cause of a disease outbreak in juvenile and market-sized olive flounder Paralichthys olivaceus from aquaculture farms in the south sea of Korea in 2005. Principal signs included expanded abdomen, congested liver and enlarged spleen and kidney, with fish suffering heavy mortality (40 to 60%). Although no parasites or bacteria were isolated from diseased fish, tissue filtrates still produced cytopathic effects (CPE) in FHM, CHSE-214 and FSP cells. PCR reactions of tissue filtrates from diseased fish and supernatants of cell cultures showing CPE indicated specific 587 bp fragments from the glycoprotein (G) gene of the viral hemorrhagic septicemia virus (VHSV). Supporting this, the nucleotide sequences among three isolates had shown 100% homology, and 99.3% and 99.8% homology with the VHSV JY-0112 isolate from flounder in Korea and VHSV obama25 isolate from flounder in Japan, respectively. Experimental infection trials using supernatants of cell cultures showing CPE gave cumulative mortalities of 100% and 60% for virus-injected and virus-immersed flounder, respectively. The pathological signs shown were generally similar to those of naturally diseased fish. Results of this investigation indicate that VHSV was the causative agent of the natural epizootic.

Understanding how the various host cells respond to probiotic bacteria in vitro may provide important insight into elaborate immune responses triggered by beneficial bacteria. The aim of this study was to investigate the detailed pattern of the mRNA expression of cytokines (IL-1beta, IL-8, TNF-alpha and TGF-beta) in head kidney (HK) leucocytes and gut cells isolated from rainbow trout (Oncorhynchus mykiss Walbaum) after co-culturing with live probiotics. HK leucocytes and gut cells adjusted to 5 x 10(6) and 2 x 10(6) ml(-1), respectively, in L-15 medium containing 25% decomplemented FCS and 300 mg l(-1) L-glutamine were co-cultured with Carnobacterium maltaromaticum B26 and C. divergens B33 at an multiplicity of infection of 25 for 6 and 12 h. Quantitative real-time reverse transcriptase polymerase chain reaction using SYBR Green I was employed to determine the mRNA expression of studied genes. Although neither probiotic strains significantly induced mRNA of the cytokines in gut cells, expression ratios of IL-1beta and TNF-alpha of HK cells were significantly higher, suggesting that these bacteria can stimulate innate immunity in rainbow trout.

Statins, the inhibitors of 3-hydroxy-3-methylglutaryl coenzyme A (HMG-CoA) reductase, are widely used cholesterol-lowering drugs. Convincing evidence indicates that statins stimulate apoptotic cell death in several types of proliferating tumor cells in a cholesterol-lowering-independent manner. The objective here was to elucidate the molecular mechanism by which statins induce lymphoma cells death. Statins (atorvastatin, fluvastatin and simvastatin) treatment enhanced the DNA fragmentation and the activation of proapoptotic members such as caspase-3, PARP and Bax, but suppressed the activation of anti-apoptotic molecule Bcl-2 in lymphoma cells including A20 and EL4 cells, which was accompanied by inhibition of cell survival. Both increase in levels of reactive oxygen species (ROS) and activation of p38 MAPK and decrease in mitochondrial membrane potential and activation of Akt and Erk pathways were observed in statin-treated lymphoma cells. Statin-induced cytotoxic effects, DNA fragmentation and changes of activation of caspase-3, Akt, Erk and p38 were blocked by antioxidant (N-acetylcysteine) and metabolic products of the HMG-CoA reductase reaction, such as mevalonate, farnesyl pyrophosphate (FPP) and geranylgeranyl pyrophosphate (GGPP). These results suggests that HMG-CoA reductase inhibitors induce lymphoma cells apoptosis by increasing intracellular ROS generation and p38 activation and suppressing activation of Akt and Erk pathways, through inhibition of metabolic products of the HMG-CoA reductase reaction including mevalonate, FPP and GGPP.

To date, studies on the mobility of arsenic (As) in soil amended with biochar have primarily relied on broad empirical observations, resulting in a gap between the behavior of As in amended soil and the chemical mechanisms controlling that behavior. This study focuses on the influence of abiotic factors in As mobility in As-contaminated soils amended with biochar. In order to understand the leaching of DOC and phosphate across a range of biomass feedstock and pyrolysis temperature, rice straw and granular sludge from an anaerobic digester were pyrolyzed at 300, 550, and 700 °C, and subjected to leaching studies by mixing air dried soil with 10 wt% of biochar at a soil: water ratio of 1:1(w/v). The concentration of DOC in the presence of granular sludge biochar and rice straw biochar increased from 190 mg L-1 to 2605 mg L-1 and 1192 mg L-1, respectively, which considerable accelerated the mobilization of Fe and As. More specifically, DOC drove the reduction of Fe(III) to Fe(II). Our results suggest enhanced release of As via the reductive dissolution of iron oxides, including by the chelating-enhanced dissolution of Fe oxides, and competitive desorption by DOC and phosphate from biochar. The influence of DOC and phosphate was further evaluated using realistic application amounts (1, 3, and 5 wt%) of biochars derived from pyrolysis of granular sludge, rice straw and spent coffee ground at 300 and 550 °C. The results from these experiments further confirm that DOC is a key factor for influencing the mobility of As in the amendment of biochar to As-contaminated soil, which indicates that biochar having low levels of leachable carbon should be amended to As-contaminated soils, and with caution.

Various graphene-based nanoadsorbents, including graphenes, graphene oxides, reduced graphene oxides, and their nanocomposites, have been widely studied as potential adsorbents due to their unique physicochemical properties, such as structural variability, chemical strength, low density, and the possibility of large scale fabrication. Adsorption mechanisms are governed largely by the physicochemical properties of contaminants, the characteristics of nanoadsorbents, and background water quality conditions. This review summarizes recent comprehensive studies on the removal of various inorganic (mainly heavy metals) and organic contaminants by graphene-based nanoadsorbents, and also discusses valuable information for applications of these nanoadsorbents in water and wastewater treatment. In particular, the aqueous removal of various contaminants was reviewed to (i) summarize the general adsorption capacities of various graphene-based nanoadsorbents for the removal of different inorganic and organic contaminants, (ii) evaluate the effects of key water quality parameters such as pH, temperature, background major ions/ionic strength, and natural organic matter on adsorption, (iii) provide a comprehensive discussion of the mechanisms that influence adsorption on these nanoadsorbents, and (iv) discuss the potential regeneration and reusability of nanoadsorbents. In addition, current challenges and future research needs for the removal of contaminants by graphene-based nanoadsorbents in water treatment processes are discussed briefly.

Metal–organic frameworks (MOFs) have the potential to improve the electrochemical performance of Li–O2 batteries with high O2 accessibility and catalytic activity of the open metal sites. Here, we explored bimetallic MnCo-MOF-74 as a cathode catalyst in Li–O2 batteries. MnCo-MOF-74 was synthesized with the Mn to Co ratio of 1:4 by a simple hydrothermal reaction. Compared to monometallic Mn-MOF-74 and Co-MOF-74 with only single catalytic activity for LiOH formation or oxygen evolution reactions, bimetallic MnCo-MOF-74 demonstrated a capability to facilitate improved reversibility and efficiency during both discharge and charge cycles. Benefitting from the porous structure of the MOF as well as the complementary contribution from both Mn- and Co-metal clusters, MnCo-MOF-74 outperformed Mn-MOF-74 and Co-MOF-74. A high full discharge capacity of 11 150 mAh g–1 at 200 mA g–1 was achieved in MnCo-MOF-74. During the cycling test, MnCo-MOF-74 stably delivered a limited discharge capacity of 1000 mAh g–1 for 44 cycles at 200 mA g–1, which is remarkably longer than those of carbon black, Mn-MOF-74, and Co-MOF-74 with cycle lives of 8, 22, and 18 cycles, respectively.

This study investigates the suitability of the electrokinetic process for extracting heavy metals from dredged marine sediment. Marine sediments have unique characteristics such as high alkalinity, high buffering capacity, and a large fraction of fine particles and organic contents. The target heavy metals were nickel (Ni), copper (Cu), zinc (Zn), and lead (Pb). Tap water was circulated in the anode and various processing fluids such as 0.1 M of ethylenediamine tetraacetic acid (EDTA), citric acid (CA), HNO3, and HCl were circulated in the cathode under a constant voltage gradient of 1 V/cm for 15 days. Heavy metals were most efficiently extracted from the marine sediment with HCl, and the extraction efficiencies of Ni, Cu, Zn, and Pb were 71.5%, 68.6%, 62.4%, and 65.3%, respectively. In the case of citric acid, the extraction efficiencies of Ni, Cu, Zn, and Pb were 56.3%, 71.3%, 60.3%, and 54%, respectively. Even though HNO3 is a strong inorganic acid like HCl, extraction efficiency was lower than of HCl because chloride forms a metal–chloride complex and the complex formation enhances desorption from sediment surface or ionization at alkaline pH. On the basis of the experimental results, we conclude that the electrokinetic process, using citric acid or HCl, is suitable for extracting heavy metals from dredged marine sediment.

We report on the origin of threshold voltage shift with the thickness of amorphous InGaZnO channel layer deposited by rf magnetron sputter at room temperature, using density of states extracted from multi frequency method and falling rates of activation energy, which of trends are entirely consistent each other in respect of the reduction of total traps with increasing the channel thickness. Furthermore, we shows that the behavior of ΔVth under the positive gate bias stress and thermal stress can be explained by charge trapping mechanism based on total trap variation.

Heart rate variability (HRV) changes as a function of psychiatric illness. This study aimed to evaluate HRV among patients with various psychiatric disorders.

This paper summarizes the latest progress in the ITER blanket system design as it proceeds through its final design phase with the Final Design Review planned for Spring 2013. The blanket design is constrained by demanding and sometime conflicting design and interface requirements from the plasma and systems such as the vacuum vessel, in-vessel coils and blanket manifolds. This represents a major design challenge, which is highlighted in this paper with examples of design solutions to accommodate some of the key interface and integration requirements.

The use of probiotics is a strategy employed to improve host health status and to prevent infectious diseases. The current study was aimed at investigating the diversity of lactic acid bacteria (LAB) and Bacillus species in the gastrointestinal tracts of wild marine fishes, as well as the beneficial effects of Lactococcus lactis WFLU12 as a host-derived probiotics in olive flounder. In marine fishes, wild olive flounder and rock bream were shown to be good sources of LAB and Bacillus isolation, respectively. Some isolates, including the strain WFLU12, have shown stronger inhibitory activity against various aquatic bacterial pathogens and more tolerance to low pH and bile acids compared to some strains isolated from sources other than marine. Lc. lactis WFLU12 was found to confer to olive flounder protection against streptococcosis caused by Streptococcus parauberis through competitive exclusion and increased innate immune responses. Interestingly, the natural infection rate in the probiotic fed group (33% = 10/30) was significantly lower than that in the control group (60% = 18/30). None of the nisin Z and colicin V-producing probiotic-fed fish were naturally infected by S. parauberis during the feeding period. In addition, more importantly, this promising probiotic strain significantly promoted fish growth along with better feed conversion and specific growth rate. This study demonstrates that the use of host-derived probiotics can offer a significant advantage in terms of optimum survival and function in the gastrointestinal tract of the intended host. In this study, host-derived probiotic strain outperforms elimination of pathogen through competitive exclusion in the gastrointestinal tract and increased innate immune responses. More importantly, this promising probiotic strain significantly promoted fish growth along with better feed conversion. This study will provide insight into how optimal probiotics should be selected and developed. It might facilitate the replacement of commercial fish probiotic products originated from terrestrial sources with host-derived probiotics in the near future.

ULK1 (unc-51 like autophagy activating kinase 1) is the key mediator of MTORC1 signaling to macroautophagy/autophagy. ULK1 functions as a protein complex by interacting with ATG13, RB1CC1/FIP200, and ATG101. How the ULK1 complex is regulated to trigger autophagy induction remains unclear. In this study, we have determined roles of Atg8-family proteins (ATG8s) in regulating ULK1 activity and autophagy. Using human cells depleted of each subfamily of ATG8, we found that the GABARAP subfamily positively regulates ULK1 activity and phagophore and autophagosome formation in response to starvation. In contrast, the LC3 subfamily negatively regulates ULK1 activity and phagophore formation. By reconstituting ATG8-depleted cells with individual ATG8 members, we identified GABARAP and GABARAPL1 as positive and LC3B and LC3C as negative regulators of ULK1 activity. To address the role of ATG8 binding to ULK1, we mutated the LIR of endogenous ULK1 to disrupt the ATG8-ULK1 interaction by genome editing. The mutation drastically reduced the activity of ULK1, autophagic degradation of SQSTM1, and phagophore formation in response to starvation. The mutation also suppressed the formation and turnover of autophagosomes in response to starvation. Similar to the mutation of the ULK1 LIR, disruption of the ATG13-ATG8 interaction suppressed ULK1 activity and autophagosome formation. In contrast, RB1CC1 did not show any specific binding to ATG8s, and mutation of its LIR did not affect ULK1 activity. Together, this study demonstrates differential binding and opposite regulation of the ULK1 complex by GABARAPs and LC3s, and an important role of the ULK1- and ATG13-ATG8 interactions in autophagy induction.Abbreviations: ATG5: autophagy related 5; ATG7: autophagy related 7; ATG8: autophagy related 8; ATG13: autophagy related 13; ATG14: autophagy related 14; ATG16L1: autophagy related 16 like 1; ATG101: autophagy related 101; BAFA1: bafilomycin A1; BECN1: beclin 1; Cas9: CRISPR associated protein 9; CRISPR: clustered regularly interspaced short palindromic repeats; EBSS: earle’s balanced salt solution; DAPI: 4ʹ-6-diamidino-2-phenylindole; GABARAP: GABA type A receptor-associated protein; GABARAPL1: GABA type A receptor-associated protein like 1; GABARAPL2: GABA type A receptor-associated protein like 2; GAPDH: glyceraldehyde-3-phosphate dehydrogenase; GFP: green fluorescence protein; gRNA: guide RNA; KI: kinase inactive mutant; KO: knockout; LC3A: microtubule associated protein 1 light chain 3 alpha; LC3B: microtubule associated protein 1 light chain 3 beta; LC3C: microtubule associated protein 1 light chain 3 gamma; LIR: LC3-interacting region; MTORC1: mechanistic target of rapamycin kinase complex 1; PBS: phosphate buffered saline; PCR: polymerase chain reaction; PE: phosphatidylethanolamine; PtdIns3P: phosphatidylinositol-3-phosphate; qPCR: quantitative PCR; RB1CC1/FIP200: RB1 inducible coiled-coil 1; RPS6KB1: ribosomal protein S6 kinase B1; SEM: standard error of the mean; SQSTM1/p62: sequestosome 1; TALEN: transcription activator-like effector nuclease; TUBA: tubulin alpha; ULK1: unc-51 like autophagy activating kinase 1; WB: western blotting; WIPI2: WD repeat domain phosphoinositide interacting 2; WT: wild type.

Acute kidney injury (AKI) is a fatal medical episode caused by sudden kidney damage or failure, leading to the death of patients within a few hours or days. Previous studies demonstrated that exosomes derived from various mesenchymal stem/stromal cells (MSC-exosomes) have positive effects on renal injuries in multiple experimental animal models of kidney diseases including AKI. However, the mass production of exosomes is a challenge not only in preclinical studies with large animals but also for successful clinical applications. In this respect, tangential flow filtration (TFF) is suitable for good manufacturing practice (GMP)-compliant large-scale production of high-quality exosomes. Until now, no studies have been reported on the use of TFF, but rather ultracentrifugation has been almost exclusively used, to isolate exosomes for AKI therapeutic application in preclinical studies. Here, we demonstrated the reproducible large-scale production of exosomes derived from adipose tissue-derived MSC (ASC-exosomes) using TFF and the lifesaving effect of the ASC-exosomes in a lethal model of cisplatin-induced rat AKI. Our results suggest the possibility of large-scale stable production of ASC-exosomes without loss of function and their successful application in life-threatening diseases.

Gastroretentive (GR) systems are designed to prolong gastric residence time to allow sustained absorption and improve the oral bioavailability of drugs with a narrow absorption window in the upper part of the gastrointestinal tract. The present study aimed to develop a GR system for acyclovir using 3D printing technology and evaluate its in vivo pharmacokinetics after oral administration in Beagle dogs. The system consisted of a gastro-floating device, which can float in the gastric fluid, prepared by a fused deposition modeling 3D printer and conventional acyclovir sustained-release (SR) tablet. The acyclovir SR tablet was inserted to the floating device to allow sustained release of the drug in the stomach. The buoyancy and sustained-release property of the developed GR system were determined using an in vitro dissolution test, in vivo pharmacokinetic study, and abdominal X-ray imaging in Beagle dogs. The in vivo dissolution profiles of the GR system were also predicted based on the in vivo pharmacokinetic data using a population pharmacokinetic (POP-PK) model. In the dissolution test, the sustained-release characteristic of the GR system was identified with a time corresponding to 80% dissolution (T80) of 2.52 h. Following oral administration of the GR system, the time to reach the maximum concentration (Tmax) of acyclovir was significantly prolonged, whereas the maximum concentration (Cmax) decreased and the area under the curve increased compared with those obtained after the administration of immediate-release and SR tablets, indicating prolonged absorption. By X-ray imaging, we showed that the developed GR system stayed in the stomach for more than 12 h. The POP-PK model successfully described the observed plasma concentration-time data and predicted the in vivo biphasic dissolution profiles of the GR system, which was significantly different from the in vitro dissolution. The developed GR system could be applied to various drugs and had great prospects in the design and development of novel controlled-release formulations.

Crop type mapping currently represents an important problem in remote sensing. Accurate information on the extent and types of crops derived from remote sensing can help managing and improving agriculture especially for developing countries where such information is scarce. In this paper, high-resolution RGB drone images are the input data for the classification performed using a transfer learning (TL) approach. VGG16 and GoogLeNet, which are pre-trained convolutional neural networks (CNNs) used for classification tasks coming from computer vision, are considered for the mapping of the crop types. Thanks to the transferred knowledge, the proposed models can successfully classify the studied crop types with high overall accuracy for two considered cases, achieving up to almost 83% for the Malawi dataset and up to 90% for the Mozambique dataset. Notably, these results are comparable to the ones achieved by the same deep CNN architectures in many computer vision tasks. With regard to drone data analysis, application of deep CNN is very limited so far due to high requirements on the number of samples needed to train such complicated architectures. Our results demonstrate that the transfer learning is an efficient way to overcome this problem and take full advantage of the benefits of deep CNN architectures for drone-based crop type mapping. Moreover, based on experiments with different TL approaches we show that the number of frozen layers is an important parameter of TL and a fine-tuning of all the CNN weights results in significantly better performance than the approaches that apply fine-tuning only on some numbers of last layers.

Across the tropics, recent agricultural shifts have led to a rapid expansion of tree plantations, often into intact forests and grasslands. However, this expansion is poorly characterized. Here, we report tropical tree plantation expansion between 2000 and 2012, based on classifying nearly 7 million unique patches of observed tree cover gain using optical and radar satellite imagery. The resulting map was a subsample of all tree cover gain but we coupled it with an extensive random accuracy assessment (n = 4,269 points) to provide unbiased estimates of expansion. Most predicted gain patches (69.2%) consisted of small patches of natural regrowth (31.6 ± 11.9 Mha). However, expansion of tree plantations also dominated increases in tree cover across the tropics (32.2 ± 9.4 Mha) with 92% of predicted plantation expansion occurring in biodiversity hotspots and 14% in arid biomes. We estimate that tree plantations expanded into 9.2% of accessible protected areas across the humid tropics, most frequently in southeast Asia, west Africa and Brazil. Given international tree planting commitments, it is critical to understand how future tree plantation expansion will affect remaining natural ecosystems. Changes in agricultural practices have led to the expansion of tree plantations across the tropics, but this expansion is poorly characterized. Nearly 7 million unique patches of observed tree cover gain are classified through satellite imagery to report on tropical tree plantation expansion between 2000 and 2012.

Coffee waste is an abundant biomass that can be converted into high value chemical products, and is used in various renewable biological processes. In this study, oil was extracted from spent coffee grounds (SCGs) and used for polyhydroxyalkanoate (PHA) production through Pseudomonas resinovorans. The oil-extracted SCGs (OESCGs) were hydrolyzed and used for biohydrogen production through Clostridium butyricum DSM10702. The oil extraction yield through n-hexane was 14.4%, which accounted for 97% of the oil present in the SCGs. OESCG hydrolysate (OESCGH) had a sugar concentration of 32.26 g/L, which was 15.4% higher than that of the SCG hydrolysate (SCGH) (27.96 g/L). Hydrogen production using these substrates was 181.19 mL and 136.58 mL in OESCGH and SCGH media, respectively. The consumed sugar concentration was 6.77 g/L in OESCGH and 5.09 g/L in SCGH media. VFA production with OESCGH (3.58 g/L) increased by 40.9% compared with SCGH (2.54 g/L). In addition, in a fed-batch culture using the extracted oil, cell dry weight was 5.4 g/L, PHA was 1.6 g/L, and PHA contents were 29.5% at 24 h.

Biofilms consist of single or multiple species of bacteria embedded in extracellular polymeric substances (EPSs), which affect the increase in antibiotic resistance by restricting the transport of antibiotics to the bacterial cells. An alternative approach to treatment with antimicrobial agents is using biofilm inhibitors that regulate biofilm development without inhibiting bacterial growth. In this study, we found that citrus peel extract from Jeju Island (CPEJ) can inhibit bacterial biofilm formation. According to the results, CPEJ concentration-dependently reduces biofilm formation without affecting bacterial growth. Additionally, CPEJ decreased the production of extracellular polymeric substances but increased bacterial swarming motility. These results led to the hypothesis that CPEJ can reduce intracellular bis-(3′-5′)-cyclic dimeric guanosine monophosphate (c-di-GMP) concentration. The results showed that CPEJ significantly reduced the c-di-GMP level through increased phosphodiesterase activity. Altogether, these findings suggest that CPEJ as a biofilm inhibitor has new potential for pharmacological (e.g. drug and medication) and industrial applications (e.g. ship hulls, water pipes, and membrane processes biofouling control).

Macroautophagy/autophagy is a complex degradation process with a dual role in cell death that is influenced by the cell types that are involved and the stressors they are exposed to. Ferroptosis is an iron-dependent oxidative form of cell death characterized by unrestricted lipid peroxidation in the context of heterogeneous and plastic mechanisms. Recent studies have shed light on the involvement of specific types of autophagy (e.g. ferritinophagy, lipophagy, and clockophagy) in initiating or executing ferroptotic cell death through the selective degradation of anti-injury proteins or organelles. Conversely, other forms of selective autophagy (e.g. reticulophagy and lysophagy) enhance the cellular defense against ferroptotic damage. Dysregulated autophagy-dependent ferroptosis has implications for a diverse range of pathological conditions. This review aims to present an updated definition of autophagy-dependent ferroptosis, discuss influential substrates and receptors, outline experimental methods, and propose guidelines for interpreting the results.

The precursor of the non-Aβ component of Alzheimer's disease amyloid (NACP) is a presynaptic protein whose function has been suspected to be tightly involved in neuronal biogenesis including synaptic regulations. NACP was suggested to seed the neuritic plaque formation in the presence of Aβ during the development of Alzheimer's disease (AD). Recombinant NACP purified through heat treatment, DEAE-Sephacel anion-exchange, Sephacryl S-200 size-exclusion, and S-Sepharose cation-exchange chromatography steps appeared as a single band on SDS–PAGE withMrof 19 kDa. Its N-terminal amino acid sequence clearly confirmed that the protein was NACP. Interestingly, however, the protein was split into a doublet on a nondenaturing (ND)–PAGE with equal intensities. The doublet was located slightly above a 45-kDa marker protein on a 12.5% ND–PAGE. In addition, the size of NACP was more carefully estimated as 53 kDa with high-performance gel-permeation chromatography using a TSK G3000sw size-exclusion column. Recently, Lansbury and his colleagues (Biochemisty35, 13709–13715) have reported that NACP exists as an elongated “natively unfolded” structure which would make the protein more actively involved in protein–protein interactions and Kim (Mol. Cells7, 78–83) has also shown that the natively unfolded protein is extremely sensitive to proteases. Here, we report that the structure of NACP could be altered by certain environmental factors. Aluminum, a suspected risk factor for AD, converged the doublet of NACP into a singlet with slightly lower mobility on ND–PAGE. Spectroscopic analysis employing uv absorption, intrinsic fluorescence, and circular dichroism indicated that NACP experienced the structural alterations in the presence of aluminum such as the secondary structure transition to generate about 33% α-helix. This altered structure of NACP became resistant to proteases such as trypsin, α-chymotrypsin, and calpain. Therefore, it is suggested that aluminum, which influences two pathologically critical processes in AD such as the protein turnover and the protein aggregation via the structural modificaitons, could participate in the disease.

The cardiac muscarinic receptor stimulates a potassium-selective ionic current (IK.ACh) through activation of a guanine nucleotide-binding regulatory protein. Purified alpha and beta gamma subunits of the guanine nucleotide-binding regulatory protein have each been reported to open the K+ channel. We have reported that nanomolar concentrations of purified brain beta gamma subunits activated IK.ACh in chicken embryonic atrial patches. In contrast, J. Codina, A. Yatani, D. Grenet, A.M. Brown, and L. Birnbaumer [(1987) Science 236, 442-445] subsequently reported that picomolar concentrations of activated erythrocyte alpha subunits (i.e., the 40-kDa alpha subunit that the authors call alpha K) opened K+ channels in guinea pig atrial patches. In this paper, we further explore the specificity of various beta gamma and alpha subunits in embryonic chicken and neonatal rat atrial patches. Beta gamma subunits from either human placenta (beta 35 gamma) or bovine brain (beta 35,36 gamma) activated IK.ACh whereas transducin beta gamma (beta 36 gamma) did not. The beta gamma activation was consistent in rat and chicken patches [118 of 123 patches (97%)]. Beta gamma subunits opened K+ channels at concentrations greater than or equal to 200 pM and maximally activated the channel at 10 nM. Beta gamma or guanosine 5'-[gamma-thio]triphosphate (GTP[gamma-S]) channel activation could be reversed by alpha 41-GDP. The purified brain beta gamma preparation was contaminated with less than 0.01% unactivated alpha. The detergent (3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate; CHAPS), used to suspend the hydrophobic beta gamma, did not activate IK.ACh alone, with buffer, with heat-inactivated beta gamma, or with transducin beta gamma. Unactivated alpha subunits did not open K+ channels. Activated, alpha subunits purified from human erythrocytes (alpha 40-GTP[gamma-S]) or bovine brain (alpha 39-GTP[gamma-S]) at concentrations of 10 pM or higher (up to 1 nM) opened K+ channels less frequently in chicken atrial patches [5 of 27 patches (19%) and 9 of 35 patches (26%), respectively] than in rat atrial patches [5 of 11 patches (45%) and 11 of 19 patches (58%), respectively]. Negative results were not due to patch vesicle formation. Other experiments indicated that alpha and beta gamma activated the same population of channels. Activation of the channel by both beta gamma and alpha subunits implies a more complicated scheme for guanine nucleotide-binding regulatory protein action than previously proposed.

BackgroundThe Nuss procedure is a newly developed operative method for minimally invasive repair of pectus excavatum in pediatric patients. However, the surgical indication for this procedure has been extended into adult patients. The aim of this study was to assess the surgical outcome of the Nuss procedure in different age groups and to analyze its feasibility in the adult population.MethodsFrom December 1999 to March 2003, 51 patients (40 males and 11 females) with pectus excavatum underwent the Nuss procedure. We classified patients into three groups based on age (pediatric, adolescent, and adult), retrospectively analyzed demographic, intraoperative and postoperative data, and compared outcomes among each group.ResultsMean operation time was 52.0 ± 22.9 minutes, 80.4 ± 27.4 minutes, and 127.3 ± 44.9 minutes in the pediatric, adolescent, and adult groups, respectively (p < 0.001). Postoperative complications occurred in 3 of 27 patients (11.1%) in the pediatric group and in 7 of 12 patients (58.3%) in both the adolescent and adult groups (p = 0.002). Reoperations were performed due to complications in 1 of 27 patients (3.7%) in the pediatric group, 2 of 12 patients (16.6%) in the adolescent group, and 5 of 12 patients (41.7%) in the adult group (p = 0.001).ConclusionsThe Nuss procedure is highly recommended in pediatric patients with pectus excavatum. However, in adults it is necessary to select patients carefully because of the longer operation time and higher incidence of complications associated with the procedure in this population. The Nuss procedure is a newly developed operative method for minimally invasive repair of pectus excavatum in pediatric patients. However, the surgical indication for this procedure has been extended into adult patients. The aim of this study was to assess the surgical outcome of the Nuss procedure in different age groups and to analyze its feasibility in the adult population. From December 1999 to March 2003, 51 patients (40 males and 11 females) with pectus excavatum underwent the Nuss procedure. We classified patients into three groups based on age (pediatric, adolescent, and adult), retrospectively analyzed demographic, intraoperative and postoperative data, and compared outcomes among each group. Mean operation time was 52.0 ± 22.9 minutes, 80.4 ± 27.4 minutes, and 127.3 ± 44.9 minutes in the pediatric, adolescent, and adult groups, respectively (p < 0.001). Postoperative complications occurred in 3 of 27 patients (11.1%) in the pediatric group and in 7 of 12 patients (58.3%) in both the adolescent and adult groups (p = 0.002). Reoperations were performed due to complications in 1 of 27 patients (3.7%) in the pediatric group, 2 of 12 patients (16.6%) in the adolescent group, and 5 of 12 patients (41.7%) in the adult group (p = 0.001). The Nuss procedure is highly recommended in pediatric patients with pectus excavatum. However, in adults it is necessary to select patients carefully because of the longer operation time and higher incidence of complications associated with the procedure in this population.

Abstract Plant essential oils from 40 plant species were tested for their insecticidal activities against larvae of Lycoriella ingénue (Dufour) using a fumigation bioassay. Good insecticidal activity against larvae of L. ingenua was achieved with essential oils of Chenopodium ambrosioides L., Eucalyptus globulus Labill, Eucalyptus smithii RT Baker, horseradish, anise and garlic at 10 and 5 µL L −1 air. Horseradish, anise and garlic oils showed the most potent insecticidal activities among the plant essential oils. At 1.25 µL L −1 , horseradish, anise and garlic oils caused 100, 93.3 and 13.3% mortality, but at 0.625 µL L −1 air this decreased to 3.3, 0 and 0% respectively. Analysis by gas chromatography‐mass spectrometry led to the identification of one major compound from horseradish, and three each from anise and garlic oils. These seven compounds and m ‐anisaldehyde and o ‐anisaldehyde, two positional isomers of p ‐anisaldehyde, were tested individually for their insecticidal activities against larvae of L. ingenua . Allyl isothiocyanate was the most toxic, followed by trans ‐anethole, diallyl disulfide and p ‐anisaldehyde with LC 50 values of 0.15, 0.20, 0.87 and 1.47 µL L −1 respectively. Copyright © 2006 Society of Chemical Industry

Tumor suppressor protein p53 is a potent transcriptional activator and regulates cell growth negatively. To characterize the transcriptional activation domain (TAD) of p53, various point mutants were constructed in the context of Gal4 DNA binding domain and tested for their transactivation ability. Our results demonstrated that the positionally conserved hydrophobic residues shared with herpes simplex virus VP16 and other transactivators are essential for transactivation. Also, the negatively charged residues and proline residues are necessary for full activity, but not essential for the activity of p53 TAD. Deletion analyses showed that p53 TAD can be divided into two subdomains, amino acids 1-40 and 43-73. An in vitro glutathione S-transferase pull-down assay establishes a linear correlation between p53 TAD-mediated transactivation in vivo and the binding activity of p53 TAD to TATA-binding protein (TBP) in vitro. Mutations that diminish the transactivation ability of Gal4-p53 TAD also impair the binding activity to TBP severely. Our results suggest that at least TBP is a direct target for p53 TAD and that the binding strength of TAD to TBP (TFIID) is an important parameter controlling activity of p53 TAD. In addition, circular dichroism spectroscopy has shown that p53 TAD peptide lacks any regular secondary structure in solution and that there is no significant difference between the spectra of the wild type TAD and that of the transactivation-deficient mutant type. Tumor suppressor protein p53 is a potent transcriptional activator and regulates cell growth negatively. To characterize the transcriptional activation domain (TAD) of p53, various point mutants were constructed in the context of Gal4 DNA binding domain and tested for their transactivation ability. Our results demonstrated that the positionally conserved hydrophobic residues shared with herpes simplex virus VP16 and other transactivators are essential for transactivation. Also, the negatively charged residues and proline residues are necessary for full activity, but not essential for the activity of p53 TAD. Deletion analyses showed that p53 TAD can be divided into two subdomains, amino acids 1-40 and 43-73. An in vitro glutathione S-transferase pull-down assay establishes a linear correlation between p53 TAD-mediated transactivation in vivo and the binding activity of p53 TAD to TATA-binding protein (TBP) in vitro. Mutations that diminish the transactivation ability of Gal4-p53 TAD also impair the binding activity to TBP severely. Our results suggest that at least TBP is a direct target for p53 TAD and that the binding strength of TAD to TBP (TFIID) is an important parameter controlling activity of p53 TAD. In addition, circular dichroism spectroscopy has shown that p53 TAD peptide lacks any regular secondary structure in solution and that there is no significant difference between the spectra of the wild type TAD and that of the transactivation-deficient mutant type. INTRODUCTIONTranscriptional activators have been shown to stimulate in vitro the assembly of transcriptional preinitiation complexes (1Choy B. Green M.R. Nature. 1993; 366: 531-536Crossref PubMed Scopus (235) Google Scholar, 2Lin Y.S. Green M.R. Cell. 1991; 64: 971-981Abstract Full Text PDF PubMed Scopus (366) Google Scholar) as well as transcriptional elongation by RNA polymerase II(3Yankulov K. Blau J. Purton T. Roberts S. Bentley D.L. Cell. 1994; 77: 749-759Abstract Full Text PDF PubMed Scopus (207) Google Scholar). This stimulation is thought to depend on direct or indirect protein-protein interactions between transcriptional activators and the general transcriptional machinery and/or on relieving the inhibitory effects of chromatin(4Felsenfeld G. Nature. 1992; 355: 219-224Crossref PubMed Scopus (714) Google Scholar, 5Laybourn P.J. Kadonaga J.T. Science. 1991; 254: 238-245Crossref PubMed Scopus (292) Google Scholar). Transcriptional activators can be divided into at least two discrete functional domains(6Ptashne M. Nature. 1988; 335: 683-689Crossref PubMed Scopus (1167) Google Scholar); a DNA binding/targeting domain is required to direct the activator to the appropriate DNA sequence element and then the transcriptional activation domain (TAD) 1The abbreviations used are: TADtranscriptional activation domainTBPTATA-binding proteinTAFTBP-associated factorbpbase pair(s)GSTglutathione S-transferasePAGEpolyacrylamide gel electrophoresisTFEtrifluoroethanol. can induce the enhanced transcription of target genes. TADs have been divided into three major classes according to a predominance of particular amino acid residues: acidic, proline-rich, or glutamine-rich(7Mitchell P. Tjian R. Science. 1988; 245: 371-378Crossref Scopus (2185) Google Scholar). Of these classes, the acidic TADs appear to be unique in that they can apparently function universally in all eukaryotes tested from yeast to human(8Sadowski I. Ma J. Triezenberg S. Ptashne M. Nature. 1988; 335: 563-564Crossref PubMed Scopus (971) Google Scholar).Like other transcriptional activators, tumor suppressor protein p53 appears to have a modular domain structure; it contains an NH2-terminal region which functions as a TAD when coupled to a heterologous DNA binding domain(9Fields S. Jang S. Science. 1990; 249: 1046-1049Crossref PubMed Scopus (656) Google Scholar, 10Raycroft L. Wu H. Lozano G. Science. 1990; 249: 1049-1051Crossref PubMed Scopus (494) Google Scholar), a central site-specific DNA binding domain(11Bargonetti J. Friedman P.N. Kern S.E. Vogelstein B. Prives C. Cell. 1991; 65: 1063-1091Abstract Full Text PDF PubMed Scopus (282) Google Scholar, 12Kern S.E. Kinzler K.W. Bruskin A. Jarosz D. Friedman P. Prives C. Vogelstein B. Science. 1991; 252: 1708-1711Crossref PubMed Scopus (934) Google Scholar), an oligomerization domain(13Sturzbecher H.-W. Brain R. Addison C. Rudge K. Remm M. Grimaldi M. Keenan E. Jenkins J.R. Oncogene. 1992; 7: 1513-1523PubMed Google Scholar, 14Iwabuchi K. Li B. Bartel P. Fields S. Oncogene. 1993; 8: 1693-1696PubMed Google Scholar), and a basic COOH-terminal nuclear localization domain(15Addison C. Jenkins J. Sturzbecher H.-W. Oncogene. 1990; 5: 423-426PubMed Google Scholar). The NH2-terminal TAD of p53 is similar in size, net negative charge, and transactivating potency to the well defined TAD of herpes simplex virus virion protein 16 (HSV VP16)(16Cress D. Triezenberg S.J. Gene (Amst.). 1991; 103: 235-238Crossref PubMed Scopus (18) Google Scholar). This region is also rich in proline residues which are conserved through evolution(17Soussi T. Caron de Fromental C. May P. Oncogene. 1990; 5: 945-952PubMed Google Scholar). Like VP16 and a number of other transactivators, p53 is thought to be a transactivator of the acidic type(9Fields S. Jang S. Science. 1990; 249: 1046-1049Crossref PubMed Scopus (656) Google Scholar, 18Truant R. Xiao H. Ingles C.J. Greenblatt J. J. Biol. Chem. 1993; 268: 2284-2287Abstract Full Text PDF PubMed Google Scholar).Early studies suggested TFIID as the target for various activators(19Hirikoshi M. Carey M.F. Kakidani H. Roeder R.G. Cell. 1988; 54: 665-669Abstract Full Text PDF PubMed Scopus (185) Google Scholar, 20Hirikoshi M. Hai T. Lin Y.S. Green M.R. Roeder R.G. Cell. 1988; 54: 1033-1042Abstract Full Text PDF PubMed Scopus (268) Google Scholar). Subsequently, the TATA-binding proteins (TBP) of yeast and human were shown to bind in vitro to the strong TADs of such viral and cellular activators as VP16(21Stringer K.F. Ingles J. Greenblatt J. Nature. 1990; 345: 783-786Crossref PubMed Scopus (407) Google Scholar), E1A(22Lee W.S. Kao C.C. Bryant G.O. Liu X. Berk A.J. Cell. 1991; 67: 365-376Abstract Full Text PDF PubMed Scopus (272) Google Scholar), Zta(23Lieberman P.M. Berk A.J. Genes & Dev. 1991; 5: 2441-2454Crossref PubMed Scopus (162) Google Scholar), and p53(18Truant R. Xiao H. Ingles C.J. Greenblatt J. J. Biol. Chem. 1993; 268: 2284-2287Abstract Full Text PDF PubMed Google Scholar, 24Liu X. Miller C.W. Koettler D.H. Berk A.J. Mol. Cell. Biol. 1993; 13: 3291-3300Crossref PubMed Scopus (232) Google Scholar, 25Seto E. Usheva A. Zambetti G.P. Momand J. Hirikoshi N. Weinmann R. Levine A.J. Shenk T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 12028-12032Crossref PubMed Scopus (464) Google Scholar). It has also been shown that another general transcription factor, TFIIB, interacts with various transactivators such as VP16 (26Lin Y.S. Ha I. Maldonado E. Reinberg D. Green M.R. Nature. 1991; 353: 569-571Crossref PubMed Scopus (261) Google Scholar), Rel oncogene product(27Kerr L.D. Ransone L.J. Wamsley P. Schmitt M.J. Boyer T.G. Zhou Q. Berk A.J. Verma I.M. Nature. 1993; 365: 412-419Crossref PubMed Scopus (131) Google Scholar), and CTF(28Kim T.K. Roeder R.G. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 4170-4174Crossref PubMed Scopus (98) Google Scholar). Recent report showed that VP16 TAD and p53 TAD can also bind to TFIIH(29Xiao H. Pearson A. Coulombe B. Truant R. Zhang S. Regier J.L. Triezenberg S.J. Reinberg D. Flores O. Ingles J. Greenblatt G. Mol. Cell. Biol. 1994; 14: 7013-7024Crossref PubMed Scopus (327) Google Scholar). In addition to general transcription factors, coactivators or adaptors are required for transactivation in the in vitro transcription system. The best characterized proteins among adaptors are the TBP-associated factors (TAFs) of the Drosophila melanogaster and humans (30Dynlacht B.D. Hoey T. Tjian R. Cell. 1991; 66: 563-576Abstract Full Text PDF PubMed Scopus (483) Google Scholar, 31Pugh B.F. Tjian R. Genes & Dev. 1991; 5: 1935-1945Crossref PubMed Scopus (476) Google Scholar, 32Tanese N. Pugh B.F. Tjian R. Genes & Dev. 1991; 5: 2212-2224Crossref PubMed Scopus (241) Google Scholar, 33Zhou Q. Lieberman P.M. Boyer T.G. Berk A.J. Genes & Dev. 1992; 6: 1964-1974Crossref PubMed Scopus (288) Google Scholar). Recently, it was reported that p53 TAD can also interact with two subunits of the TFIID, TAFII40, and TAFII60(34Catherine J.T. Chen J.-L. Klemm R. Tjian R. Science. 1995; 267: 100-104Crossref PubMed Scopus (406) Google Scholar). Clearly, transcriptional activation appears to be more complicated than originally envisioned (6Ptashne M. Nature. 1988; 335: 683-689Crossref PubMed Scopus (1167) Google Scholar) and may involve multiple targets that make direct or indirect contacts in different spatial and temporal arrangements with TADs and the transcriptional machinery.Here, we demonstrate that p53 TAD is a complex activation domain composed of two subdomains, in which positionally conserved hydrophobic residues are critical for activating function. The negatively charged residues and proline residues are also necessary for full activity, but not essential for the activity of p53 TAD. Mutations that severely impair the function of p53 TAD in vivo have been shown to diminish binding activity to TBP in vitro, indicating that the observed in vitro interaction is biologically relevant. Circular dichroism (CD) spectroscopy demonstrates that p53 TAD peptide does not have any detectable secondary structure at physiological condition.MATERIALS AND METHODSPlasmid Constructions and MutagenesisGal4 DNA-binding domain expression plasmid, Gal4D, was constructed by inserting the 450-bp HindIII-XmaI fragment of pSG424 (8Sadowski I. Ma J. Triezenberg S. Ptashne M. Nature. 1988; 335: 563-564Crossref PubMed Scopus (971) Google Scholar) into the HindIII-BamHI site of pcDNA (Invitrogen) following by flushing XmaI and BamHI overhangs. A DNA fragment encoding amino acids 1-73 of p53 was amplified from the human cDNA of p53 with two primers (5′-GGTCGGATCCATGGAGGAGCCGCAGTCA and 3′-GGTGAAGCTTACACGGGGGGAGCAGCCTC; BamHI and HindIII sites are underlined) and digested with BamHI and HindIII. The resulting DNA fragment was ligated into the BamHI-HindIII site of pSK(-) (Stratagene), yielding pSK-p53 TAD. Gal4D-p53 TAD was generated by inserting the 210-bp BamHI-HindIII fragment of pSK-p53 TAD into the BamHI-EcoRV site of Gal4D after flushing the HindIII overhang (Fig. 1). Oligonucleotide-directed mutagenesis was performed as described (35Kunkel T.A. Roberts J.D. Zakour R.A. Methods Enzymol. 1987; 154: 367-382Crossref PubMed Scopus (4543) Google Scholar) using single-stranded DNA of pSK-p53 TAD. Mutations were identified by restriction endonuclease digestion and dideoxy sequencing. The specific amino acid changes introduced by mutagenic primers are listed in Table 1. The BamHI-HindIII DNA fragments of mutant derivatives were ligated into the same site of Gal4D except for M41 and M241 in which HincII site was used instead of HindIII site. The carboxyl-terminal deletion mutant, Gal4D-p53 (1-40), was generated by ligating the 120-bp BamHI-HindIII DNA fragment of pSK-p53 TAD M41 into the same site of Gal4D. Gal4D-p53 (43-73) was obtained by inserting the 90-bp HindIII-HindIII DNA fragment of pSK-p53 TAD M41 into the EcoRI site of Gal4D after filling in cohesive ends with Klenow fragment of DNA polymerase I. Gal4D-p53 (1-40) M22 was generated by introducing M22 mutation into Gal4D-p53 (1-40).Tabled 1View Large Image Figure ViewerDownload Hi-res image Download (PPT) Open table in a new tab The glutathione S-transferase (GST) fusion plasmids were made by using pGEX-KG which contains a GST gene under the control of tac promoter and a flanked polycloning site(36Gaun K.L. Dixon J.E. Anal. Biochem. 1991; 192: 262-267Crossref PubMed Scopus (1637) Google Scholar). pGEX-p53 TAD was constructed by inserting the 210-bp BamHI-HindIII DNA fragment of pSK-p53 TAD into the BamHI-HindIII site of pGEX-KG (Fig. 1). pGEX-p53 M2, M12, M19, M22, M23, M25, M31, M34, and M1234 were generated by the same method. pGEX-p53 M41 and M241 were made by inserting the BamHI-XhoI DNA fragments of pSK-p53 TAD M41 and M241 into the BamHI-XhoI sites of pGEX-KG, respectively. pGEX-p53(1-40) was generated by inserting the 120-bp BamHI-HindIII DNA fragment of pSK-p53 TAD M41 into the BamHI-HindIII site of pGEX-KG. The reporter plasmid, G5E1bCAT, was described previously(37Lee C.Q. Yun Y. Hoeffler J.P. Habener J.F. EMBO J. 1990; 9: 4455-4465Crossref PubMed Scopus (183) Google Scholar).Transfection and Chloramphenicol Acetyltransferase AssaysBHK-21 and COS-7 cells were grown in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum. Plasmid transfections were carried out by a DEAE-dextran method(38Queen C. Baltimore D. Cell. 1983; 33: 741-748Abstract Full Text PDF PubMed Scopus (389) Google Scholar). Cells (106) were seeded on a 100-mm dish 24 h before transfection and transfected with 1 μg of each of the reporter and activator plasmids. At 48 h after transfection, cells were harvested and chloramphenicol acetyltransferase activity was measured as described previously(39Lee C.W. Chang J. Lee K.J. Sung Y.C. J. Virol. 1994; 68: 2708-2719Crossref PubMed Google Scholar). To determine expression levels of the Gal4 fusions, COS-7 cells were transfected in parallel with 2 μg of activator plasmids. Nuclear extracts were prepared as described previously (40Schreiber E. Matthias P. Müller M. Schaffner W. Nucleic Acids Res. 1989; 17: 6419Crossref PubMed Scopus (3908) Google Scholar) and electrophoretic mobility shift assays were performed as described (41Gill G. Pascal E. Tseng Z. Tjian R. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 192-196Crossref PubMed Scopus (469) Google Scholar) with DNA fragment containing five Gal4 binding sites. The amount of probes shifted by each derivative was quantitated using a Fuji BAS2000 photoimager. The difference in transfection efficiency was normalized by using a second reporter plasmid, pGL2 (Promega), containing a luciferase gene. Luciferase activity was measured by using the luciferase assay system (Promega) according to supplier's recommendation. All chloramphenicol acetyltransferase assay data reported in this article were from points in the linear range of the assay.GST Pull-down ExperimentGST fusion proteins were expressed in Escherichia coli DH5α and were purified by using glutathione-Sepharose beads (Pharmacia Biotech Inc.) in accordance with the supplier's recommendation. 35S-Labeled human TBP was generated by using a coupled transcription-translation reticulocyte lysate (TNT system, Promega) with linearized pETHIID plasmid (42Kao C.C. Lieberman P.M. Schmidt M.C. Zhou Q. Pei R. Berk A.J. Science. 1990; 248: 1646-1650Crossref PubMed Scopus (224) Google Scholar) as a template. 200 ng of GST-p53 TAD and mutant derivatives coupled to 20 μl of glutathione-Sepharose beads was incubated at 4°C with 35S-labeled TBP in 600 μl of a buffer solution containing 40 mM HEPES-KOH, pH 7.5, 150 mM KCl, 0.5 mM EDTA, 5 mM MgCl2, 1 mM dithiothreitol, 1 mM phenylmethylsulfonyl fluoride, and 0.1% Nonidet P-40 for 1 h. To minimize potential bead losses during subsequent washes, the buffer was mixed with glutathione beads to adjust a total bead volume of 20 μl/reaction. Following this incubation, the beads were washed five times with the same buffer and bound proteins eluted with sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) loading buffer. The proteins were separated by 10% SDS-PAGE and visualized by autoradiography. Signals were quantitated on a Fuji BAS2000 photoimager and plotted to obtain a graphical representation of the results.Purification of p53 TAD PeptidesFor large scale production of p53 TAD, E. coli DH5α cells containing pGEX-p53 TAD were induced with 0.2 mM isopropyl-1-thio-β-D-galactopyranoside and harvested 4 h after induction. The fusion protein was purified from the soluble extract by use of binding affinity to glutathione-Sepharose beads. The p53 TAD peptide was released from the GST moiety in a buffer containing 100 mM NaCl and 2.5 mM CaCl2 using 1 μg of thrombin (Sigma)/1 mg of fusion protein. The peptide was further purified by gel filtration chromatography using Superose 12 (Pharmacia). The peptide after the gel filtration step was found to be homogeneous as judged by Coomassie Blue staining of the gel after SDS-PAGE. The identity of the peptide was determined by amino acid composition analysis. The M22 mutant derivative was also purified by the same method.CD SpectroscopyCD experiments were performed with a spectropolarimeter Jasco J-720. A cuvette with 0.1-cm of path length was used for all spectral measurements. Measurements were made at room temperature in 5 mM phosphate buffer. The concentrations of peptides were determined by absorbance at 280 nm in the phosphate buffer. The used peptide concentrations were 17 μM for wild type p53 TAD and 15 μM for the M22 mutant. All spectra were corrected for background using the phosphate buffer and averaged from the spectra of at least four scans. The pH values were measured with a microelectrode calibrated at two reference pH values.RESULTSMutational Analysis of p53 TADThe preponderance of acidic amino acids within p53 TAD suggests that negative charge is a critical component of the activation domain structure. To test whether activation function is simply related to the net negative charge, we constructed Gal4D-p53 TAD and replaced, in combination, the acidic amino acids within the activation domain with uncharged or positively charged residues (Fig. 1). From the relative activities of such mutants (Table 1), we infer that negative charge is necessary for the optimal activity of p53 TAD. The M41 mutant was less active than the M2 mutant, indicating that mutations of negatively charged residues, Glu-2 and Glu-3, had a less effect on the activity than mutations on Asp-41 and Asp-42 residues. The M241 mutant was less active than the M41 mutant, showing that replacement of increasing numbers of acidic residues with other residues led to a progressive decrease in transcriptional activation. It was reported previously that the acidic residues at the amino terminus of the p53 protein may influence, but are not critical for, the transcriptional activation (43Lin J. Chen J. Elenbaas B. Levine A.J. Genes & Dev. 1994; 8: 1235-1246Crossref PubMed Scopus (577) Google Scholar).The p53 TAD is also rich in proline residues (19.2%), which is a characteristic of another class of TAD, such as CTF/NF-1(44Mermod N. O'Neill E.A. Kelley T.J. Tjian R. Cell. 1989; 58: 741-753Abstract Full Text PDF PubMed Scopus (538) Google Scholar). When M12 and M34 mutants were tested, there were about 39 and 24% reduction in p53 TAD-mediated transactivation, respectively. As expected, the M1234 mutant containing mutations in four Pro residues was shown to be about 71% reduction in the transactivation (Table 1), indicating that there was additive effect with these mutations and that proline residues are also required for the optimal activity of p53 TAD.Previous studies on the VP16 TAD have suggested that the acidic residues contribute to its activity, but intervening hydrophobic residues are more important than other residues(45Cress W.D. Triezenberg S.J. Science. 1991; 251: 87-90Crossref PubMed Scopus (323) Google Scholar). TADs of a number of transactivators exhibit a conserved pattern of hydrophobic residues (45Cress W.D. Triezenberg S.J. Science. 1991; 251: 87-90Crossref PubMed Scopus (323) Google Scholar). Since p53 TAD also shows the similar pattern of positionally conserved hydrophobic residues (Fig. 2), we generated various mutants in which conserved hydrophobic amino acids were replaced with hydrophilic ones. When these mutants were tested for transactivation activity in BHK-21 and COS-7 cells, the activities of several mutants were significantly impaired (Table 1). Mutations on both residues Leu-22 and Trp-23 reduced p53 TAD-mediated transactivation by about 95%, whereas mutations on Leu-25 and Leu-26 resulted in approximately 88% loss of the activity. Also, single amino acid change on Phe-19 reduced the activity by about 85%. In contrast, mutations on both Val-31 and Leu-32, which are not positionally conserved, did not impair the transactivation function but rather enhance the activity. Therefore, we concluded that the positionally conserved hydrophobic residues, Phe-19, Leu-22, Trp-23, Leu-25, and Leu-26 are critical for transactivation function of p53 TAD. These residues are identical in all sequences of p53 protein from several species(17Soussi T. Caron de Fromental C. May P. Oncogene. 1990; 5: 945-952PubMed Google Scholar). The effect of mutations on Leu-22 and Trp-23 is consistent with a previous report(43Lin J. Chen J. Elenbaas B. Levine A.J. Genes & Dev. 1994; 8: 1235-1246Crossref PubMed Scopus (577) Google Scholar), but those of mutations on Phe-19 and on Leu-25 and Leu-26 do not exactly coincide with their results in which human p53 mutant protein containing the double mutation on Leu-14 and Phe-19 was observed to have a 50% reduction in chloramphenicol acetyltransferase activity compared with wild type p53. In addition, the Leu-25 and Leu-26 double mutant showed either enhanced or reduced activity in Saos-2 cells, depending on p53-responsive elements either from the creatine phosphokinase gene or from the mdm-2 gene(43Lin J. Chen J. Elenbaas B. Levine A.J. Genes & Dev. 1994; 8: 1235-1246Crossref PubMed Scopus (577) Google Scholar).Figure 2Comparison of the primary amino acid sequences of different TADs. The amino acid sequences of several TADs are aligned using the bulky hydrophobic residues (boxed) as reported by Cress and Triezenberg(45Cress W.D. Triezenberg S.J. Science. 1991; 251: 87-90Crossref PubMed Scopus (323) Google Scholar). Underlined letters of p53 TAD indicate identity in all sequences of p53 from several species(17Soussi T. Caron de Fromental C. May P. Oncogene. 1990; 5: 945-952PubMed Google Scholar). The residue numbers are given for p53 TAD sequence.View Large Image Figure ViewerDownload Hi-res image Download (PPT)To compare the expression level among different Gal4 fusion proteins, electrophoretic mobility shift assay was performed using a labeled DNA fragment containing five Gal4 binding sites and showed that there was no significant difference among them (data not shown). The difference in the chloramphenicol acetyltransferase activity is, therefore, due to the intrinsic biological activity of different Gal4 fusion proteins, but not by the different level of Gal4 fusion proteins in the transfected cells. Although the transactivating abilities of mutants constructed in the foregoing studies were severely impaired, residual activity still remained, suggesting that p53 TAD is composed of separable subdomains just like VP16 (46Triezenberg S.J. Kingsbury R.C. McKnight S.L. Genes & Dev. 1988; 2: 718-729Crossref PubMed Scopus (587) Google Scholar) and Epstein-Barr virus Rta transactivator(47Hardwick J.M. Tse L. Applegren N. Nicholas J. Veliuona M.A. J. Virol. 1992; 66: 5500-5508Crossref PubMed Google Scholar). It was previously shown that the minimal activation domain of p53 lies within the first 42 amino acids of the protein(48Unger T. Nau M.M. Segal S. Minna J.D. EMBO J. 1992; 11: 1383-1390Crossref PubMed Scopus (227) Google Scholar). Since Gal4D-p53(1-40) consistently showed about 30-38% activity of Gal4D-p53 TAD, which contains the residues 1-73, residues 43-73 appear to be necessary for the full p53 TAD-mediated transactivation. To be certain that residues of p53 from 43 to 73 also contain an autonomous TAD, Gal4D-p53 (43-73) was constructed and tested for the transactivating ability. The resulting plasmid showed about 6% activity of Gal4D-p53 TAD (Table 1), indicating that there is an autonomous TAD in this subregion. In the case of VP16, the truncated activation domain possesses approximately 50% of wild type activity, whereas the addition of COOH-terminal subdomain restored the full activity(46Triezenberg S.J. Kingsbury R.C. McKnight S.L. Genes & Dev. 1988; 2: 718-729Crossref PubMed Scopus (587) Google Scholar). Gal4D-p53(1-40) M22, which deletes the COOH-terminal subregion from M22 mutant, completely lost the residual activity of M22 mutant (Table 1), demonstrating that the residual activity comes from the separable COOH-terminal subdomain, and that Leu-22 and Trp-23 are absolutely required for the function of minimal activating region (residues 1-40) of p53.In Vitro TBP Binding Activity of p53 TAD and MutantsPrevious studies showed that p53 TAD interacts directly and specifically with yeast and human TBP(18Truant R. Xiao H. Ingles C.J. Greenblatt J. J. Biol. Chem. 1993; 268: 2284-2287Abstract Full Text PDF PubMed Google Scholar, 24Liu X. Miller C.W. Koettler D.H. Berk A.J. Mol. Cell. Biol. 1993; 13: 3291-3300Crossref PubMed Scopus (232) Google Scholar). The binding activities of wild type p53, mutant p53(R175H)(18Truant R. Xiao H. Ingles C.J. Greenblatt J. J. Biol. Chem. 1993; 268: 2284-2287Abstract Full Text PDF PubMed Google Scholar, 25Seto E. Usheva A. Zambetti G.P. Momand J. Hirikoshi N. Weinmann R. Levine A.J. Shenk T. Proc. Natl. Acad. Sci. U. S. A. 1992; 89: 12028-12032Crossref PubMed Scopus (464) Google Scholar), and Gal4-p53 fusion proteins (24Liu X. Miller C.W. Koettler D.H. Berk A.J. Mol. Cell. Biol. 1993; 13: 3291-3300Crossref PubMed Scopus (232) Google Scholar) to TBP were reported to correlate with their transactivation abilities in vivo, suggesting that p53 TAD activates transcription by directly interacting with TBP. In contrast, Lin et al.(43Lin J. Chen J. Elenbaas B. Levine A.J. Genes & Dev. 1994; 8: 1235-1246Crossref PubMed Scopus (577) Google Scholar) reported that wild type p53 and transactivation-deficient mutants, including R175H mutation, could bind equally well to human TBP when tested with immunoprecipitation and far-Western analysis. Thus, it remains controversial whether TBP is the target molecule of p53 TAD, and binding activity of p53 TAD to TBP is directly related to p53 TAD-mediated transactivation. To clarify this discrepancy, the residues of wild type p53 TAD from 1 to 73 and its derivatives were placed under the GST gene to generate pGEX-p53 TAD fusion constructs (Fig. 1). The GST-p53 TAD fusion protein and its derivatives were expressed in E. coli and purified by affinity chromatography (Fig. 3A). The purified fusion proteins were assayed for the activity to bind in vitro translated human TBP in a GST pull-down experiment. As shown in Fig. 3B and Table 1, the levels of TBP precipitated by GST-p53 TAD and mutant derivatives are linearly correlated with the ability of transactivation in vivo. Binding reactions were performed under nonsaturating condition, where GST-p53 TAD and mutant derivatives were a limiting factor. Under this condition, about 20% of input TBP bound to the GST-p53 TAD. We have repeated these binding assays at several times with different batches of fusion proteins and in vitro translated TBP. Relative binding activities were reproducible and resulted in the same relative order for TBP binding. This establishes a direct relationship between transactivation ability in vivo and the binding activity of the p53 TAD to TBP in vitro (Fig. 3C). The TBP binding activities of M22, M25, and M19 mutants lacking critical hydrophobic residues but bearing identical net negative charge were significantly decreased when compared with that of wild type p53 TAD, indicating that the binding of p53 TAD to TBP is not due to nonspecific ionic interaction between the positively charged region of TBP and negatively charged p53 TAD. These results do not agree well with previous report in which the binding ability of p53 protein to TBP was not affected by the mutations at residues 22 and 23 (43Lin J. Chen J. Elenbaas B. Levine A.J. Genes & Dev. 1994; 8: 1235-1246Crossref PubMed Scopus (577) Google

Slag, which consists of calcium oxide, aluminium oxide, and other metal oxides, is an abundant by-product in steel-making process. It has been used as adsorbents to remove various heavy metals and the major removal mechanisms are precipitation and adsorption on the surface of metal oxide. However, the relative contribution of two removal mechanisms has not reported. In this study, the removal characteristics of copper were investigated in terms of sorption kinetics and sorption isotherms. As initial pH of solution increased, the sorption capacity of slags increased dramatically. We evaluated the relative contribution of two mechanisms in the copper removal by steel-making slag. At above pH 3.0, contribution of adsorption to overall removal of copper was less than 12%. As a result, most of copper was removed by slag as a form or copper hydroxide.

Summary Background The impact of not referring sub‐centimetre polyps identified at CT colonography upon the efficacy of colorectal cancer screening remains uncertain. Aim To determine the distribution of advanced neoplasia according to polyp size in a screening setting. Methods Published studies reporting the distribution of advanced adenomas in asymptomatic screening cohorts according to polyp size were identified by MEDLINE and EMBASE searches. Predefined outputs were the screening rates of advanced adenomas represented by diminutive (≦5 mm), small (6–9 mm), sub‐centimetre (&lt;10 mm) and large (≧10 mm) polyp sizes. Results Data from four studies with 20 562 screening subjects met the primary inclusion criteria. Advanced adenomas were detected in 1155 (5.6%) subjects (95% CI = 5.3–5.9), corresponding to diminutive, small and large polyps in 4.6% (95% CI = 3.4–5.8), 7.9% (95% CI = 6.3–9.4) and 87.5% (95% CI = 86–89.4) of cases respectively. The frequency of advanced lesions among patients whose largest polyp was diminutive, small, sub‐centimetre and large in size was 0.9%, 4.9%, 1.7% and 73.5% respectively. Conclusions Based on this systematic review, a 6‐mm polyp size threshold for polypectomy referral would identify over 95% of subjects with advanced adenomas, whereas a 10‐mm threshold would identify 88% of cases. Aliment Pharmacol Ther 31 , 210–217

Feasibility of electrolyte conditioning with strong acidic or alkaline solution on electrokinetic remediation of arsenic-contaminated mine tailing was investigated in the laboratory. The mine tailing contained calcium oxide of more than 50%. At alkaline condition, arsenic was precipitated with calcium, and formed calcium arsenate which is very stable solid. Catholyte conditioning with strong acidic solution and anolyte conditioning with strong alkaline solution showed similar efficiency to remove arsenic. At 4mAcm(-2) of current density, the removal efficiency of arsenic was 62% after 28 days operation with catholyte conditioning with 0.1M nitric acid.

The feasibility of catholyte conditioning with the acidic solution and pre-treatment of soil with acidic solution was investigated with the electrokinetic remediation of Zn and Ni contaminated field soil. The extraction of Zn and Ni from soil increased with the decrease in pH of the extracting solution and nitric acid was very effective to extract Zn and Ni from the soil. Conventional electrokinetic treatment and acetate buffer circulation method were not effective to remove Zn and Ni from the soil. Pre-treatment of the soil with acidic solution enhanced the desorption of Zn and Ni and catholyte conditioning with this solution was effective in maintaining the overall soil pH within the electrokinetic cell. The catholyte conditioning and pre-treatment method enhanced the removal of Zn and Ni up to 41% and 40% after operation for 4 weeks. More than 96% of Zn and Ni removed by electrokinetic remediation were due to the electromigration. Catholyte conditioning and the pre-treatment method is effective in enhancing metal removal in electrokinetic remediation.

Human ChlR1 (hChlR1), a member of the DEAD/DEAH subfamily of helicases, was shown to interact with components of the cohesin complex and play a role in sister chromatid cohesion. In order to study the biochemical and biological properties of hChlR1, we purified the protein from 293 cells and demonstrated that hChlR1 possesses DNA-dependent ATPase and helicase activities. This helicase translocates on single-stranded DNA in the 5′ to 3′ direction in the presence of ATP and, to a lesser extent, dATP. Its unwinding activity requires a 5′-singlestranded region for helicase loading, since flush-ended duplex structures do not support unwinding. The helicase activity of hChlR1 is capable of displacing duplex regions up to 100 bp, which can be extended to 500 bp by RPA or the cohesion establishment factor, the Ctf18-RFC (replication factor C) complex. We show that hChlR1 interacts with the hCtf18-RFC complex, human proliferating cell nuclear antigen, and hFen1. The interactions between Fen1 and hChlR1 stimulate the flap endonuclease activity of Fen1. Selective depletion of either hChlR1 or Fen1 by targeted small interfering RNA treatment results in the precocious separation of sister chromatids. These findings are consistent with a role of hChlR1 in the establishment of sister chromatid cohesion and suggest that its action may contribute to lagging strand processing events important in cohesion. Human ChlR1 (hChlR1), a member of the DEAD/DEAH subfamily of helicases, was shown to interact with components of the cohesin complex and play a role in sister chromatid cohesion. In order to study the biochemical and biological properties of hChlR1, we purified the protein from 293 cells and demonstrated that hChlR1 possesses DNA-dependent ATPase and helicase activities. This helicase translocates on single-stranded DNA in the 5′ to 3′ direction in the presence of ATP and, to a lesser extent, dATP. Its unwinding activity requires a 5′-singlestranded region for helicase loading, since flush-ended duplex structures do not support unwinding. The helicase activity of hChlR1 is capable of displacing duplex regions up to 100 bp, which can be extended to 500 bp by RPA or the cohesion establishment factor, the Ctf18-RFC (replication factor C) complex. We show that hChlR1 interacts with the hCtf18-RFC complex, human proliferating cell nuclear antigen, and hFen1. The interactions between Fen1 and hChlR1 stimulate the flap endonuclease activity of Fen1. Selective depletion of either hChlR1 or Fen1 by targeted small interfering RNA treatment results in the precocious separation of sister chromatids. These findings are consistent with a role of hChlR1 in the establishment of sister chromatid cohesion and suggest that its action may contribute to lagging strand processing events important in cohesion. In order to maintain genomic integrity, the two sister chromosomes synthesized in S phase must be linked together physically by the cohesin complex until they are distributed to daughter cells in anaphase. Cohesion is mediated by cohesin, a ring-shaped protein complex composed of the four subunits, Smc1, Smc3, Scc3, and the kleisin Scc1/Mdc1/Rad21 (1Guacci V. Koshland D. Strunnikov A. Cell. 1997; 91: 47-57Abstract Full Text Full Text PDF PubMed Scopus (685) Google Scholar, 2Michaelis C. Ciosk R. Nasmyth K. Cell. 1997; 91: 35-45Abstract Full Text Full Text PDF PubMed Scopus (1168) Google Scholar, 3Losada A. Hirano M. Hirano T. Genes Dev. 1998; 12: 1986-1997Crossref PubMed Scopus (517) Google Scholar, 4Haering C.H. Lowe J. Hochwagen A. Nasmyth K. Mol. Cell. 2002; 9: 773-788Abstract Full Text Full Text PDF PubMed Scopus (559) Google Scholar). In budding yeast, cohesion establishment factors, which include minimally Chl1, Ctf7/Eco1/Eso1, Ctf4/Pob1/AND-1, Ctf18/Chl12, Dcc1, and Ctf8, are essential for cohesion, and all play some role in DNA replication (5Chestukhin A. Pfeffer C. Milligan S. DeCaprio J.A. Pellman D. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 4574-4579Crossref PubMed Scopus (64) Google Scholar, 6Hanna J.S. Kroll E.S. Lundblad V. Spencer F.A. Mol. Cell. Biol. 2001; 21: 3144-3158Crossref PubMed Scopus (263) Google Scholar, 7Mayer M.L. Gygi S.P. Aebersold R. Hieter P. Mol. Cell. 2001; 7: 959-970Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar, 8Skibbens R.V. Corson L.B. Koshland D. Hieter P. Genes Dev. 1999; 13: 307-319Crossref PubMed Scopus (384) Google Scholar, 9Tanaka K. Yonekawa T. Kawasaki Y. Kai M. Furuya K. Iwasaki M. Murakami H. Yanagida M. Okayama H. Mol. Cell. Biol. 2000; 20: 3459-3469Crossref PubMed Scopus (160) Google Scholar, 10Toth A. Ciosk R. Uhlmann F. Galova M. Schleiffer A. Nasmyth K. Genes Dev. 1999; 13: 320-333Crossref PubMed Scopus (499) Google Scholar, 11Williams D.R. McIntosh J.R. Eukaryot. Cell. 2002; 1: 758-773Crossref PubMed Scopus (48) Google Scholar, 12Kohler A. Schmidt-Zachmann M.S. Franke W.W. J. Cell Sci. 1997; 110: 1051-1062PubMed Google Scholar). The CHL1 (chromosome loss mutation) gene was first isolated in a screen in Saccharomyces cerevisiae for mutants exhibiting unusual mating phenotypes due to the loss of chromosome III (13Haber J.E. Genetics. 1974; 78: 843-858Crossref PubMed Google Scholar, 14Liras P. McCusker J. Mascioli S. Haber J.E. Genetics. 1978; 88: 651-671PubMed Google Scholar). Chl1 null mutants, although viable, show a G2/M cell cycle delay and ∼200-fold increase in the rate of chromosome III missegregation due to both sister chromatid loss and sister chromatid nondisjunction, confirming that the protein it encodes, Chl1p, is required for the maintenance of correct chromosome transmission (15Gerring S.L. Spencer F. Hieter P. EMBO J. 1990; 9: 4347-4358Crossref PubMed Scopus (122) Google Scholar). A functional ATP-binding motif in Chl1p is essential for normal chromosome segregation, since overexpression of Chl1p mutants defective in ATP binding interfere with high fidelity chromosome transmission (16Holloway S.L. Nucleic Acids Res. 2000; 28: 3056-3064Crossref PubMed Scopus (33) Google Scholar). Humans have two CHL1-related genes, DDX11 and DDX12, which encode the proteins ChlR1 and ChlR2, respectively. Although the function of ChlR2 is unclear, human ChlR1 (hChlR1), 3The abbreviations used are: hChlR1, human ChlR1; RFC, replication factor C; siRNA, small interfering RNA; HA, hemagglutinin; PCNA, proliferating cell nuclear antigen; FISH, fluorescence in situ hybridization; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; nt, nucleotide(s); AMP-PNP, 5′-adenylyl-β,γ-imidodiphosphate; ATPγS, adenosine 5′-O-(thiotriphosphate); ssDNA, single-stranded DNA. 3The abbreviations used are: hChlR1, human ChlR1; RFC, replication factor C; siRNA, small interfering RNA; HA, hemagglutinin; PCNA, proliferating cell nuclear antigen; FISH, fluorescence in situ hybridization; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride; nt, nucleotide(s); AMP-PNP, 5′-adenylyl-β,γ-imidodiphosphate; ATPγS, adenosine 5′-O-(thiotriphosphate); ssDNA, single-stranded DNA. a protein with a predicted molecular mass of 102 kDa, has 33% identity and 50% homology to Chl1p of budding yeast (17Amann J. Kidd V.J. Lahti J.M. J. Biol. Chem. 1997; 272: 3823-3832Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar). Although the exact role of Chl1p in cohesion establishment remains unclear, recent studies in yeast and higher eukaryotes have substantiated that Chl1p is involved in this process. In budding yeast, Chl1p associates physically with Ctf7p (18Skibbens R.V. Genetics. 2004; 166: 33-42Crossref PubMed Scopus (132) Google Scholar) and genetically with Ctf18, two proteins essential for the establishment of cohesion. Ctf7p is necessary for the establishment of cohesion during DNA replication but is not involved directly in holding sister chromatids together (8Skibbens R.V. Corson L.B. Koshland D. Hieter P. Genes Dev. 1999; 13: 307-319Crossref PubMed Scopus (384) Google Scholar, 10Toth A. Ciosk R. Uhlmann F. Galova M. Schleiffer A. Nasmyth K. Genes Dev. 1999; 13: 320-333Crossref PubMed Scopus (499) Google Scholar). Unlike Ctf7, Ctf18 is not essential in budding yeast, but in its absence, sister chromatid cohesion is compromised (6Hanna J.S. Kroll E.S. Lundblad V. Spencer F.A. Mol. Cell. Biol. 2001; 21: 3144-3158Crossref PubMed Scopus (263) Google Scholar, 7Mayer M.L. Gygi S.P. Aebersold R. Hieter P. Mol. Cell. 2001; 7: 959-970Abstract Full Text Full Text PDF PubMed Scopus (277) Google Scholar). Ctf18, Dcc1, and Ctf8 form a complex with the four small subunits of replication factor C (RFC) in yeast and humans. RFC is a five-subunit complex that catalyzes the loading of PCNA onto DNA, which confers processivity to both DNA polymerases δ and ϵ during DNA replication (reviewed in Ref. 19Waga S. Stillman B. Annu. Rev. Biochem. 1998; 67: 721-751Crossref PubMed Scopus (663) Google Scholar). In the Ctf18-RFC complex, the RFC1 subunit is replaced by Ctf18, Dcc1, and Ctf8. As observed with RFC, Ctf18-RFC also loads PCNA onto DNA (20Bermudez V.P. Maniwa Y. Tappin I. Ozato K. Yokomori K. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10237-10242Crossref PubMed Scopus (102) Google Scholar, 21Shiomi Y. Shinozaki A. Sugimoto K. Usukura J. Obuse C. Tsurimoto T. Genes Cells. 2004; 9: 279-290Crossref PubMed Scopus (37) Google Scholar, 22Bylund G.O. Burgers P.M. Mol. Cell. Biol. 2005; 25: 5445-5455Crossref PubMed Scopus (100) Google Scholar). Ctf18, together with Ctf7 and Ctf4, localize to the replication fork (23Lengronne A. McIntyre J. Katou Y. Kanoh Y. Hopfner K.P. Shirahige K. Uhlmann F. Mol. Cell. 2006; 23: 787-799Abstract Full Text Full Text PDF PubMed Scopus (227) Google Scholar), adding further evidence that cohesion is linked to DNA replication. Interestingly, deletion of either CTF8 or CHL1 results in abnormal sister chromatid cohesion (24Mayer M.L. Pot I. Chang M. Xu H. Aneliunas V. Kwok T. Newitt R. Aebersold R. Boone C. Brown G.W. Hieter P. Mol. Biol. Cell. 2004; 15: 1736-1745Crossref PubMed Scopus (200) Google Scholar, 25Petronczki M. Chwalla B. Siomos M.F. Yokobayashi S. Helmhart W. Deutschbauer A.M. Davis R.W. Watanabe Y. Nasmyth K. J. Cell Sci. 2004; 117: 3547-3559Crossref PubMed Scopus (120) Google Scholar), whereas deletion of both genes (as well as the simultaneous deletion of different pairs of establishment factors) is lethal (18Skibbens R.V. Genetics. 2004; 166: 33-42Crossref PubMed Scopus (132) Google Scholar, 24Mayer M.L. Pot I. Chang M. Xu H. Aneliunas V. Kwok T. Newitt R. Aebersold R. Boone C. Brown G.W. Hieter P. Mol. Biol. Cell. 2004; 15: 1736-1745Crossref PubMed Scopus (200) Google Scholar). In human cells, siRNA experiments revealed that hChlR1 interacts with cohesin components and is required for sister chromatid cohesion (26Parish J.L. Rosa J. Wang X. Lahti J.M. Doxsey S.J. Androphy E.J. J. Cell Sci. 2006; 119: 4857-4865Crossref PubMed Scopus (91) Google Scholar). Recently, it was reported that in Ddx11-/- mouse embryos, ChlR1 is necessary for the cohesion of both chromosome arms and centromeres (27Inoue A. Li T. Roby S.K. Valentine M.B. Inoue M. Boyd K. Kidd V.J. Lahti J.M. Cell Cycle. 2007; 6: 1646-1654Crossref PubMed Scopus (76) Google Scholar). In this report, we have purified hChlR1 and characterized its biochemical properties as an ATP-dependent DNA helicase. We also show that hChlR1 interacts with human Ctf18-RFC and Fen1. Biochemical analyses revealed that the length of the duplex region displaced by the helicase activity of hChlR1 was increased by Ctf18-RFC and that the flap endonuclease activity of Fen1 was increased by hChlR1. Furthermore, we show that siRNA depletion of hChlR1 in HeLa cells, as well as Fen1, leads to increased sister chromatid separation, similar to that observed following depletion of the cohesin subunit Scc1. We posit that the action of some of the establishment factors may involve the processing of lagging strands during cohesion. DNA, Nucleotides, Enzymes, and Antibodies—M13mp18(+) single-stranded circular DNA was purchased from New England Biolabs. The oligonucleotides used were synthesized commercially by Integrated DNA Technologies (Coralville, IA). Unlabeled dNTPs and NTPs were obtained from Roche Applied Science and Promega, respectively. Labeled dNTPs and NTPs were purchased from PerkinElmer Life Sciences. Human RPA, PCNA, Ctf18-RFC, and RFC complexes were isolated as described (20Bermudez V.P. Maniwa Y. Tappin I. Ozato K. Yokomori K. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10237-10242Crossref PubMed Scopus (102) Google Scholar, 28Ishiai M. Sanchez J.P. Amin A.A. Murakami Y. Hurwitz J. J. Biol. Chem. 1996; 271: 20868-20878Abstract Full Text Full Text PDF PubMed Scopus (30) Google Scholar). Mouse monoclonal M2 anti-FLAG and anti-HA antibodies were from Sigma. The rabbit polyclonal antiserum to the hChlR1 protein (Hel1) was obtained from J. M. Lahti (17Amann J. Kidd V.J. Lahti J.M. J. Biol. Chem. 1997; 272: 3823-3832Abstract Full Text Full Text PDF PubMed Scopus (33) Google Scholar), whereas rabbit antisera against hCtf18, Dcc1, and 37-kDa RFC subunits have been described (20Bermudez V.P. Maniwa Y. Tappin I. Ozato K. Yokomori K. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10237-10242Crossref PubMed Scopus (102) Google Scholar, 29Uhlmann F. Cai J. Flores-Rozas H. Dean F.B. Finkelstein J. O'Donnell M. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 6521-6526Crossref PubMed Scopus (50) Google Scholar). The RFC p140 monoclonal antibody was kindly supplied by B. Stillman. Mouse monoclonal against PCNA (PC-10) and α-tubulin were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) and Calbiochem, respectively; rabbit polyclonal Scc1 (Rad21 BL331) and Fen1 antibodies were purchased from Bethyl Laboratories and Novus Biologicals, respectively. Plasmids—Human ChlR1 cDNA in pcDNA3 (Invitrogen), obtained from Dr. J. M. Lahti (Department of Genetics and Tumor Cell Biology, St. Jude Children's Research Hospital, Memphis, TN), was subjected to PCR using primers ChlR1-NotI (5′-ATAAGAATGCGGCCGCCATGGCTAATGAAACACAGAAGG-3′) and ChlR1-NotI-M (5′-ATAGTTTAGCGGCCGCTCAGGAAGAGGCCGACTTCTC-3′), which amplified the gene devoid of the extra HA sequence, or with primers ChlR1-NotI and ChlR1-NotI-L (5′-ATAGTTTAGCGGCCGCTCAGGAAGAGGCCGACTTCTCCCGGTGAAACTTCTGCAC-3′), which amplified the gene and included the HA sequence. Both PCR products were subcloned into the NotI site of pIRESpuro2-His6-FLAG2 (Clontech). The sequences of the resulting plasmids, pIRESpuro2::His6-FLAG2-ChlR1 and pIRESpuro2::His6-FLAG2-ChlR1-HA, were verified. pIRESpuro2::His6-FLAG2-FEN1 was prepared as follows. The human FEN1 cDNA in pET-23d vector (Novagen) was amplified by PCR using primers 5′FEN1-NotI (5′-ATAAGAATGCGGCCGCGGGAATTCAAGGCCTGGCCA-3′) and 3′FEN1-NotI (5′-ATAGTTTAGCGGCCGCTTATTTTCCCCTTTTAAACTTCC-3′). PCR products were subcloned into the NotI site of pIRESpuro2-His6-FLAG2 (Clontech). The resulting plasmid, pIRESpuro2::His6-FLAG2-FEN1, was sequenced to verify that no mutations were introduced during PCR and cloning. hCtf18, Dcc1, and Ctf8 were subcloned into pIRESpuro2-His6-FLAG2 (Clontech), as described (20Bermudez V.P. Maniwa Y. Tappin I. Ozato K. Yokomori K. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 2003; 100: 10237-10242Crossref PubMed Scopus (102) Google Scholar). The plasmid containing the centromeric region of chromosome 9 was used as the probe in the FISH analyses (a gift from Dr. M. A. Laversha, Molecular Cytogenetics Core Facility, Memorial Sloan Kettering Cancer Center, New York, NY) and was previously described (30Rocchi M. Archidiacono N. Ward D.C. Baldini A. Genomics. 1991; 9: 517-523Crossref PubMed Scopus (79) Google Scholar). hChlR1 Expression and Purification— hChlR1 cDNA in pIRESpuro2::His6-FLAG2 plasmids was transfected into 293 cells using Lipofectamine 2000 (Invitrogen), as recommended by the manufacturer, and cells were grown and selected in Dulbecco's modified Eagle's medium containing 10% (v/v) fetal bovine serum and 2.5 μg/ml of puromycin for 2 weeks. Selected cells were analyzed for the expression of His-FLAG-ChlR1 by Western blot analyses. A single clone of 293 cells expressing His-FLAG-ChlR1 was grown in 4 liters of Joklik medium with 10% (v/v) fetal bovine serum and 2.5 μg/ml puromycin. Cells were harvested by centrifugation at 600 × g at 4 °C for 10 min. Packed cells (10 ml) were washed with ice-cold PBS and resuspended in 20 ml of hypotonic buffer (10 mm Tris·HCl, pH 7.4, 10 mm KCl, 1.5 mm MgCl2, 1 mm DTT, 0.5 mm phenylmethylsulfonylfluoride (PMSF), proteinase inhibitors (2 μg/ml aprotinin, 2 μg/ml leupeptin, 2 μg/ml antipain, and 0.1 mm benzamidine)) on ice for 15 min. Cells were lysed by Dounce homogenization (7 strokes), and the mixture was centrifuged at 4 °C for 30 min at 2,400 × g. The nuclear pellet was resuspended in 10 ml of 0.15 m NaCl buffer (20 mm Tris·HCl, pH 7.4, 0.15 m NaCl, 10% glycerol, 1.5 mm MgCl2, 0.2 mm EDTA, 1 mm DTT, 0.5 mm PMSF, proteinase inhibitors) and incubated with rocking at 4 °C for 30 min. The nuclear fraction was centrifuged at 4 °C for 30 min at 43,500 × g. Half of the supernatant (8 ml, 25 mg of protein) was incubated with 1 ml of FLAG-M2-agarose resin (Sigma) in FLAG buffer (20 mm Tris·HCl, pH 7.4, 0.15 m NaCl, 10% glycerol, 0.05% Nonidet P-40, 1.5 mm MgCl2, 0.2 mm EDTA, 0.5 mm PMSF, proteinase inhibitors) at 4 °C overnight. The resin was packed onto a column and washed three times with 10 ml of FLAG buffer, and bound proteins were eluted five times with 0.4 ml of FLAG buffer containing 1 mg/ml of FLAG3 peptide for 1 h at 4 °C (yielding 0.5 mg of protein). An aliquot of the pooled FLAG peptide-eluted fraction (0.2 ml; 50 μg of protein) was layered onto a 5-ml 15–40% glycerol gradient containing 25 mm Tris·HCl (pH 7.5), 1 mm EDTA, 0.15 m NaCl, 1 mm DTT, 0.01% Nonidet P-40, and proteinase inhibitors and centrifuged at 250,000 × g for 20 h at 4 °C, and fractions (0.15 ml each) collected from the bottom of the tube (yielding 10 μg of relatively pure protein). The His-FLAG-ChlR1 protein was detected by Coomassie staining and sedimented between aldolase (7.8 S) and bovine serum albumin (4.41 S). Preparation of Helicase Substrates—Oligonucleotides used for the preparation of the different helicase substrates are summarized in Table 1. The indicated oligonucleotides, 18mer-M13 and 39mer-M13, are complementary to nucleotides 6313–6330 and 6310–6348 of M13mp18(+) DNA, respectively. The helicase substrates were labeled (as indicated in the figures by an asterisk) at either the 3′- or the 5′-ends. For the preparation of substrates, 3′-end-labeled oligonucleotides (1 pmol) were annealed with 2.5 μg (1 pmol) of ssM13mp18 DNA in a buffer containing 50 mm NaCl and 1 mm EDTA by heating to 100 °C for 3 min followed by slow cooling to 25 °C. The 3′-end of the annealed oligonucleotides was labeled by an extension reaction using Klenow and [α-32P]dGTP (6,000 Ci/mmol). Excess labeled nucleotides and unannealed oligonucleotides were removed by Sepharose CL-4B column chromatography. 5′-End-labeled substrates were prepared with T4 polynucleotide kinase and [γ-32P]ATP (3000 Ci/mmol), and reactions were halted with EDTA (final concentration, 25 mm). Labeled oligonucleotides were hybridized to complementary oligonucleotides (at a 1:1 molar ratio) in 40 mm Hepes-NaOH (pH 7.5) and 50 mm NaCl by heating to 100 °C for 3 min, followed by slow cooling to 25 °C. Unincorporated [γ-32P]ATP and unannealed oligonucleotides were removed by electrophoresis through an 8% native polyacrylamide gel as described (31Shin J.H. Jiang Y. Grabowski B. Hurwitz J. Kelman Z. J. Biol. Chem. 2003; 278: 49053-49062Abstract Full Text Full Text PDF PubMed Scopus (66) Google Scholar).TABLE 1Oligonucleotides used in this studyOligonucleotideSequence (length of oligonucleotide)18mer-M135′–TTTTTTTTTTTTTTTTTTTTCAGGGTTTTCCCAGTCAC–3′ (38 nt)39mer-M135′–TTTTTTTTTTTTTTTTTTTTGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGAC–3′ (59 nt)39mer40dTM135′–TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGAC–3′ (79 nt)D505′–GGGACGCGTCGGCCTGGCACGTCGGCCGCTGCGGCCAGGCACCCGATGGC–3′ (50 nt)D75E5′–GGGACGCGTCGGCCTGGCACGTCGGCCGCTGCGGCCTAGCATATGCTAGCCCGCTGCGGCCAGGCACCCGATGGC–3′ (75 nt)D745′–GGGACGCGTCGGCCTGGCACGTCGGCCGCTGCGGCCAGGCACCCGATGGCGTTTGTTTGTTTGTTTGTTTGTTT–3′ (74 nt)D50-5′5′–CCGCTGCGGCCAGGCACCCGATGGCGGGACGCGTCGGCCTGGCACGTCGG–3′ (50 nt)D555′–CCGACGTGCCAGGCCGACGCGTCCCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTT–3′ (55 nt)D255′–GCCATCGGGTGCCTGGCCGCAGCGG–3′ (25 nt)D25F5′–CCGACGTGCCAGGCCGACGCGTCCC–3′ (25 nt)G495′–GCCATCGGGTGCCTGGCCGCAGCGGTTTGTTTGTTTGTTTGTTTGTTTG–3′ (49 nt)G455′–CATATGCTAGGCCGCAGCGGCCGACGTGCCAGGCCGACGCGTCCC–3′ (45 nt)G405′–GCTAGGCCGCAGCGGCCGACGTGCCAGGCCGACGCGTCCC–3′ (40 nt)7295′–CGAACAATTCAGCGGCTTTAACCGGACGCTCGACGCCATTAATAATGTTTTC–3′ (52 nt)5TY-15′–GAAAACATTATTAATGGCGTCGAGCTAGGCACAAGGCGAACTGCTAACGG–3′ (50 nt)5TBG5′–CCGTTAGCAGTTCGCCTTGTGCCTAG–3′ (26 nt) Open table in a new tab To determine the maximal length of duplex DNA displaced by the hChlR1 helicase, substrates containing longer duplex regions were prepared by elongating singly primed M13mp18 ssDNA (39mer40dT-M13) using Sequenase (U.S. Biochemical Corp.), as described (32Lee J.K. Hurwitz J. Proc. Natl. Acad. Sci. U. S. A. 2001; 98: 54-59Crossref PubMed Scopus (158) Google Scholar). DNA Helicase Assay—Helicase activity was measured in reactions (15 μl) containing 25 mm Hepes-NaOH (pH 7.5), 25 mm potassium acetate, 1 mm magnesium acetate, 1 mm ATP, 1 mm DTT, 100 μg/ml bovine serum albumin, 5 fmol of 32P-labeled substrate (3,000 cpm/fmol), and enzyme fractions, as indicated in figure legends. After incubation at 37 °C for 30 min, reactions were stopped with 3 μl of 6× stop solution (50 mm EDTA, 2% SDS, 40% glycerol, 0.3% bromphenol blue, and 0.3% xylene cyanol), and aliquots were loaded on a 12% polyacrylamide gel in 1× TBE and electrophoresed for 90 min at 55 V. Reaction mixtures from assays used to measure processivity were electrophoresed through a 2.5% agarose gel in 1× TBE at 120 V for 3 h. Displaced bands were visualized and quantitated by phosphorimaging. ATPase Assay—Reaction mixtures (20 μl) containing 25 mm Tris-HCl (pH 7.5), 3 mm magnesium acetate, 2 mm DTT, 200 μg/ml bovine serum albumin, 50 μm ATP, 30 nm [γ-32P]ATP (3000 Ci/mmol), 40 fmol of M13mp18 ssDNA, or other polynucleotides and varying levels of hChlR1 were incubated at 37 °C, as indicated. Aliquots (0.5 μl) were spotted onto polyethyleneimine-cellulose TLC plates (Merck) that were then developed in 0.5 m LiCl, 1.0 m formic acid. Products formed were analyzed using a PhosphorImager. Immunoprecipitations—293 cells or 293 cells constitutively expressing His-FLAG-ChlR1-HA were grown in a 100-mm dish and transfected with the indicated constructs using Lipofectamine 2000 (Invitrogen). Cells were washed once in PBS and incubated in 0.2 ml of hypotonic buffer (10 mm Tris·HCl (pH 7.5), 10 mm KCl, 1.5 mm MgCl2, 1 mm DTT, 0.5 mm PMSF, and proteinase inhibitors) for 15 min on ice. Nonidet P-40 was added (final concentration, 0.6%), and the lysate was centrifuged at 1,500 × g for 30 s at 4 °C. Nuclear pellets were resuspended in buffer C (20 mm Tris·HCl (pH 7.4), 150 mm NaCl, 0.05% Nonidet P-40, 10% glycerol, 1.5 mm MgCl2, 0.2 mm EDTA, 1 mm DTT, 0.5 mm PMSF, and proteinase inhibitors) with rocking for 30 min at 4 °C. After centrifugation at 38,000 × g, nuclear extracts were treated with 20 μg/ml DNase I and then incubated with anti-FLAG (M2) or anti-HA beads (20 μl) at 4 °C for 4 h. Alternatively, Ctf18 and Fen1 were immunoprecipitated with 1 μl of their respective antisera from lysates using the same conditions described above, and 20 μl of Protein A-agarose (Upstate Biotechnology) was added. After centrifugation, beads were washed three times with buffer C, and bound proteins were eluted with SDS loading buffer followed by SDS-PAGE separation on 4–20% gels (Ctf18, Ctf8, Dcc1, PCNA, and RFC1 co-immunoprecipitations) or 8% gels (Fen1 co-immunoprecipitations) and immunoblot analysis. siRNA Experiments—The 21-mer siRNAs with 3′ dT overhangs that targeted hChlR1, FEN1, SCC1, and a negative control, were synthesized by Qiagen and delivered into cells at a final concentration of 100 nm using Lipofectamine 2000 (Invitrogen). The nucleotides targeted by the siRNA were as follows: in hChlR1, 212–232; in FEN1, 1766–1786; in SCC1, 142–162. As a negative control, the random sequence targeted by the siRNA was 5′-AATTCTCCGAACGTGTCACGT-3′. Chromosome Spreads, FISH Analysis, and Microscopy— HeLa cells were transfected with siRNA oligonucleotides specific for hChlR1, Fen1, or Scc1 or with the negative control siRNA and incubated for 48 h. Cells were then blocked with 0.5 μg/ml nocodazole for 2 h and swelled in hypotonic buffer (75 mm KCl) for 15 min at 37 °C. Cells were fixed in 75% methanol, 25% acetic acid, and spreads were prepared by dropping suspended cells onto slides, which were then stained with 0.2 μg/ml 4′,6-diamidino-2-phenylindole or used for FISH analysis, as described (33Leversha M.A. Methods Mol. Biol. 2001; 175: 109-127PubMed Google Scholar). Images collected with an Olympus AX70 microscope were processed using MetaMorph software. Helicase and ATPase Activities of hChlR1—In order to study the biochemical properties and activities associated with hChlR1, we purified and characterized the recombinant protein. Initial efforts to express hChlR1 in bacteria or insect cells failed due to poor expression, extensive degradation, and/or aggregation. In contrast, expression of the protein in human cells yielded full-length and soluble hChlR1. To facilitate its production and isolation, stable 293 cell lines were generated that expressed His-FLAG-ChlR1 (or His-FLAG-ChlR1-HA, used in some co-immunoprecipitation experiments). His-FLAG-ChlR1 was purified by FLAG immunoprecipitation, followed by glycerol gradient sedimentation, as described under “Experimental Procedures.” We verified that the purified tagged protein was hChlR1 by Western blot analysis using either anti-ChlR1 (Fig. 1A) or anti-FLAG antibodies (data not shown). The protein detected had a molecular mass of ∼120 kDa, a size expected for the His-FLAG-hChlR1 fusion protein. Site-directed mutagenesis, which changed the lysine residue at amino acid 50 to arginine (the Walker A box of the ATP binding motif), generated an enzymatically inactive hChlR1 (KR mutant) protein, which was previously described (34Hirota Y. Lahti J.M. Nucleic Acids Res. 2000; 28: 917-924Crossref PubMed Google Scholar). The KR mutant of hChlR1 (hChlR1-KRm) was cloned into a mammalian expression vector, and a stable 293 cell line that expressed His-FLAG-ChlR1-KRm was established as described for the wild-type protein and purified as described under “Experimental Procedures” (Fig. 1A). The helicase activity associated with purified hChlR1 was evaluated using a 32P-labeled DNA substrate containing ssM13mp18 DNA hybridized to an 18-nt complementary labeled oligonucleotide with a 20-nt oligo(dT) tail at its 5′-end. This substrate was used to examine the activity of glycerol gradient fractions obtained in the purification of hChlR1 (Fig. 1B, top). Displacement of the 32P-labeled oligonucleotide showed that the helicase activity and hChlR1 protein both eluted coincidentally (Fig. 1B, middle, fractions 17–19). We also examined the glycerol gradient fractions for DNA-dependent ATPase activity. As shown (Fig. 1B, bottom), this activity peaked with both the protein and helicase activity of hChlR1. In contrast, the hChlR1-KRm protein lacked both helicase and ATPase activity (34Hirota Y. Lahti J.M. Nucleic Acids Res. 2000; 28: 917-924Crossref PubMed Google Scholar) (data not shown). Properties of hChlR1 Helicase Activity—We tested which nucleoside triphosphate supported hChlR1 helicase activity. As shown in Fig. 2A, this activity was observed with ATP and dATP but not with any other dNTPs (or NTPs; data not shown) tested. dATP supported the displacement of the 18-mer but not DNA substrates containing a duplex region of 39 nt. Furthermore, at low concentrations of hChlR1 (1–9 fmol), ATP was more effective than dATP in supporting the displacement of the 18-mer (Fig. 2B). DNA helicase activity of hChlR1 was not detected when ATP was replaced by nonhydrolyzable AMP-PNP or ATPγS (data not shown). We next examined some of the biochemical properties of the hChlR1 helicase. We noted that maximal activity with Mg2+ was observed at low concentrations (0.5–1 mm), whereas higher levels (5 mm and above) markedly inhibited hChlR1 helicase activity more than 75% (data not presented). We also tested the effects of various salts and found that the helicase activity was stimulated by 25–50 mm potassium acetate, stimulated to a lesser extent by 25 mm of ammonium acetate, and markedly inhibited by sodium acetate (Fig. 2C). Since both Mg2+ and salt concentrations appeared critical, especially in the unwinding of long duplex regions, all subsequent experiments were carried out using the 39mer-M13 substrate or substrates with longer duplex regions in the presence of 1 mm Mg2+ and 25 mm potassium acetate. Under these conditions, the displacement activity of hChlR1 was maximal at pH 7.5 (data not shown). Using these optimal conditions, the helicase activity (using 36 fmol of protein) with the 39-nt duplex substrate proceeded linearly for 5 min and then plateaued at ∼20 min (data not presented). Similar results were obtained with the 18-nt substrate (data not shown). In both cases, hChlR1 maximally displaced about 80% of the duplex substrates. Properties of the hChlR1 ATPase Activity—All ATPase experiments were carried out in the absence or presence of either circular ssM13mp18 DNA or the partial duplex DNA substrates used in the helicase assays (39mer-M13; data not shown). ATPase activity was observed only in the presence of ssDNA and not with double-stranded DNA (data not shown). As expected, the Walker A mutate

Non-ablative 1550-nm erbium-doped fractional photothermolysis systems (FPS) and 10 600-nm carbon dioxide fractional laser systems (CO(2) FS) have been effectively used to treat scars.We compared the efficacy and safety of single-session treatments of FPS and CO(2) FS for acne scars through a randomized, split-face, evaluator-blinded study.Eight patients with acne scars were enrolled in this study. Half of each subject's face was treated with FPS and the other half was treated with CO(2) FS. We used a quartile grading scale for evaluations.At 3 months after the treatment, the mean grade of improvement based on clinical assessment was 2.0 +/- 0.5 for FPS and 2.5 +/- 0.8 for CO(2) FS. On each side treated by FPS and CO(2) FS, the mean duration of post-therapy crusting and scaling was 2.3 and 7.4 days respectively and that of post-therapy erythema was 7.5 and 11.5 days respectively. The mean VAS pain score was 3.9 +/- 2.0 with the FPS and 7.0 +/- 2.0 with the CO(2) FS.We demonstrated the efficacy and safety of single-session acne scar treatment using FPS and CO(2) FS in East Asian patients. We believe that our study could be used as an essential reference when choosing laser modalities for scar treatment.

We evaluated the influence of electrode configuration on in situ electrokinetic remediation of As-, Cu-, and Pb-contaminated soil in a pilot-scale field application. Dense electrode configurations resulted in high current under a constant voltage gradient, the high current raised soil temperature, and it caused unnecessary electrical energy consumption. Additionally, temperature increase in soil transported pore water from bottom to top layer, which accumulated contaminants in the top soil layer because the mobilized contaminants was co-transported by the water flow. On the other hand, the groundwater flow, gravitational force, and electro-osmotic flow were combined together and affected complexly the transport of mobilized contaminants. Sequential extraction showed that electrokinetic treatment increased the residual fraction of As, the fraction of Cu bound to organic matter, and the fraction of Pb bound to organic matter and residual portion. This result implies that the groundwater flow and soil temperature should be monitored during the remediation and the configuration should be considered to minimized unnecessary transport of contaminants.

The valence and spin states of $\mathrm{Mn}{\mathrm{Fe}}_{2}{\mathrm{O}}_{4}$ spinel oxide have been investigated by employing soft x-ray absorption spectroscopy (XAS) and x-ray magnetic circular dichroism (XMCD). The measured $\mathrm{Mn}\phantom{\rule{0.2em}{0ex}}2p$ and $\mathrm{Fe}\phantom{\rule{0.2em}{0ex}}2p$ XAS spectra indicate that Mn and Fe ions are nearly divalent $({\mathrm{Mn}}^{2+})$ and trivalent $({\mathrm{Fe}}^{3+})$, respectively. Our XAS and XMCD spectra for $\mathrm{Mn}{\mathrm{Fe}}_{2}{\mathrm{O}}_{4}$ do not show clear evidence of mixed-valent states but provide evidence for the inversion of both Mn and Fe ions, with ${T}_{d}∕{O}_{h}\ensuremath{\sim}0.8∕0.2$ for Mn ions and ${T}_{d}∕{O}_{h}\ensuremath{\sim}0.1∕0.9$ for Fe ions, respectively. Based on our data, $\mathrm{Mn}{\mathrm{Fe}}_{2}{\mathrm{O}}_{4}$ can be described either by the single-valence states of ${({\mathrm{Mn}}_{0.8}^{2+}{\mathrm{Fe}}_{0.2}^{3+})}_{A}{[{\mathrm{Fe}}_{1.8}^{3+}{\mathrm{Mn}}_{0.2}^{2+}]}_{B}{\mathrm{O}}_{4}$ or by the mixed-valence states of ${({\mathrm{Mn}}_{0.8}^{2+}{\mathrm{Fe}}_{0.2}^{3+})}_{A}{[{\mathrm{Fe}}_{1.6}^{3+}{\mathrm{Fe}}_{0.2}^{2+}{\mathrm{Mn}}_{0.2}^{3+}]}_{B}{\mathrm{O}}_{4}$.

The feasibility of anolyte conditioning on electrokinetic remediation of fluorine-contaminated soil was investigated with a field soil. The initial concentration of fluorine, pH and water content in the soil were 414mg/kg, 8.91 and 15%, respectively. Because the extraction of fluorine generally increased with the soil pH, the pH of the anode compartment was controlled by circulating strong alkaline solution to enhance the extraction of fluorine during electrokinetic remediation. The removal of fluorine increased with the concentration of the alkaline solution and applied current density and fluorine removed up to 75.6% within 14 days. Additionally, anolyte conditioning sharply increased the electro-osmotic flow, which enhanced the removal of fluorine in this study. In many respects, anolyte conditioning in electrokinetic remediation of fluorine-contaminated soil will be a promising technology.

Polymeric micelles using amphiphilic macromolecules are promising vehicles for antitumor targeting. In this study, we prepared anticancer agent-incorporated polymeric micelles using novel block copolymer.We synthesized a block copolymer composed of dextran and poly (DL-lactide-co-glycolide) (DexbLG) for antitumor drug delivery. Doxorubicin was selected as the anticancer drug, and was incorporated into polymeric micelles by dialysis. Polymeric micelles were observed by transmission electron microscopy to be spherical and smaller than 100 nm, with a narrow size distribution. The particle size of doxorubicin-incorporated polymeric micelles increased with increasing drug content. Higher initial drug feeding also increased the drug content.During the drug-release study, an initial burst release of doxorubicin was observed for 10 hours, and doxorubicin was continuously released over 4 days. To investigate the in vitro anticancer effects of the polymeric micelles, doxorubicin-resistant HuCC-T1 cells were treated with a very high concentration of doxorubicin. In an antiproliferation study, the polymeric micelles showed higher cytotoxicity to doxorubicin-resistant HuCC-T1 cells than free doxorubicin, indicating that the polymeric micelles were effectively engulfed by tumor cells, while free doxorubicin hardly penetrated the tumor cell membrane. On confocal laser scanning microscopy, free doxorubicin expressed very weak fluorescence intensity, while the polymeric micelles expressed strong red fluorescence. Furthermore, in flow cytometric analysis, fluorescence intensity of polymeric micelles was almost twice as high than with free doxorubicin.DexbLG polymeric micelles incorporating doxorubicin are promising vehicles for antitumor drug targeting.

Amino acids stimulate cell growth and suppress autophagy through activation of mTORC1. The activation of mTORC1 by amino acids is mediated by Rag guanosine triphosphatase (GTPase) heterodimers on the lysosome. The molecular mechanism by which amino acids regulate the Rag GTPase heterodimers remains to be elucidated. Here, we identify SH3 domain-binding protein 4 (SH3BP4) as a binding protein and a negative regulator of Rag GTPase complex. SH3BP4 binds to the inactive Rag GTPase complex through its Src homology 3 (SH3) domain under conditions of amino acid starvation and inhibits the formation of active Rag GTPase complex. As a consequence, the binding abrogates the interaction of mTORC1 with Rag GTPase complex and the recruitment of mTORC1 to the lysosome, thus inhibiting amino acid-induced mTORC1 activation and cell growth and promoting autophagy. These results demonstrate that SH3BP4 is a negative regulator of the Rag GTPase complex and amino acid-dependent mTORC1 signaling.

ULK1 (unc-51 like kinase 1) is a serine/threonine protein kinase that plays a key role in regulating the induction of autophagy. Recent studies using autophagy-defective mouse models, such as atg5- or atg7-deficient mice, revealed an important function of autophagy in adipocyte differentiation. Suppression of adipogenesis in autophagy-defective conditions has made it difficult to study the roles of autophagy in metabolism of differentiated adipocytes. In this study, we established autophagy defective-differentiated 3T3-L1 adipocytes, and investigated the roles of Ulk1 and its close homolog Ulk2 in lipid and glucose metabolism using the established adipocytes. Through knockdown approaches, we determined that Ulk1 and Ulk2 are important for basal and MTORC1 inhibition-induced autophagy, basal lipolysis, and mitochondrial respiration. However, unlike other autophagy genes (Atg5, Atg13, Rb1cc1/Fip200, and Becn1) Ulk1 was dispensable for adipogenesis without affecting the expression of CCAAT/enhancer binding protein α (CEBPA) and peroxisome proliferation-activated receptor gamma (PPARG). Ulk1 knockdown reduced fatty acid oxidation and enhanced fatty acid uptake, the metabolic changes that could contribute to adipogenesis, whereas Ulk2 knockdown had opposing effects. We also found that the expression levels of insulin receptor (INSR), insulin receptor substrate 1 (IRS1), and glucose transporter 4 (SLC2A4/GLUT4) were increased in Ulk1-silenced adipocytes, which was accompanied by upregulation of insulin-stimulated glucose uptake. These results suggest that ULK1, albeit its important autophagic role, regulates lipid metabolism and glucose uptake in adipocytes distinctly from other autophagy proteins.

Extracorporeal membrane oxygenation (ECMO) is widely used to treat respiratory distress during cardiac or respiratory arrest; moreover, its use is being extended to a wide variety of clinical fields. In this study we assess the utility of ECMO in the management of airway obstruction.15 patients underwent ECMO for airway obstruction. We retrospectively analyzed and evaluated the feasibility of ECMO in the treatment of airway problems.Seven patients received ECMO to facilitate respiration and promote stability during trachea surgery. In six cases ECMO ceased immediately following the operation; in the remaining case ECMO cessation was delayed due to post-operative ARDS. In three cases emergency ECMO was used in response to respiratory arrest; two patients died. In five cases ECMO was emergently inserted to prevent death, following airway blockade by massive hemoptysis. One patient was not discharged from the intensive care unit. Another patient was transferred to a general ward but died from other causes.ECMO is useful during anesthesia in patients at high risk of airway blockade, for example due to endobronchial bleeding, and during complex thoracic surgery. ECMO confers a safer environment during airway surgery, and its complication rate is acceptable.

Since the 2008 opening of the USGS Landsat archive, research has focused on standardization and compositing of dense time series of Landsat images to increase measurement precision sufficiently for long-term and/or global land cover mapping. Most of these efforts rely on atmospherically corrected estimates of surface reflectance, some of which also incorporate corrections for effects of sun-target-sensor geometry. However, these effects have not yet been well-characterized in Landsat data. Using reflectance and Bidirectional Reflectance Distribution Function (BRDF) parameters derived from daily Moderate-resolution Imaging Spectroradiometer (MODIS) reflectance estimates and the sun-target-sensor geometry of the Landsat-5 orbit, we simulated the BRDF effects within the Landsat-5 data archive at three sites representing low, mid, and high latitudes. We found that bidirectional effects are prevalent in Landsat measurements, but their effect varies by latitude. Seasonal variations in illumination geometry affect reflectance as well as vegetation indices, adding spurious seasonality in otherwise stable evergreen phenology at a lower-latitude tropical forest site. The ±7.5° variation in View Zenith Angle (VZA), usually considered negligible, resulted in as much as 20% along-scan variation in reflectance at the lower latitude site. Although variation in Solar Zenith Angle (SZA) is less pronounced in the tropics than in the upper latitudes, its impact is most significant in the tropics due to the relative proximity of Landsat scans to the principle plane. For this reason, even small variations in viewing and illumination geometry have large impacts on reflectance and vegetation indices near the equator. In contrast, the amplitude of SZA and phenological variations have the greatest impact on reflectance estimates in mid-and upper latitudes, where interaction between phenological variation and Landsat’s 16-day orbital cycle can be greater than the combined effect of BRDF and orbital drift. Our analysis suggests that accounting or correction for BRDF effects will increase precision of land cover mapping and monitoring based on Landsat data alone or in combination with other sensors.

Reduction of translational fidelity often occurs in cells with high rates of protein synthesis, generating defective ribosomal products. If not removed, such aberrant proteins can be a major source of cellular stress causing human diseases. Here, we demonstrate that mTORC1 promotes the formation of immunoproteasomes for efficient turnover of defective proteins and cell survival. mTORC1 sequesters precursors of immunoproteasome β subunits via PRAS40. When activated, mTORC1 phosphorylates PRAS40 to enhance protein synthesis and simultaneously to facilitate the assembly of the β subunits for forming immunoproteasomes. Consequently, the PRAS40 phosphorylations play crucial roles in clearing aberrant proteins that accumulate due to mTORC1 activation. Mutations of RAS, PTEN, and TSC1, which cause mTORC1 hyperactivation, enhance immunoproteasome formation in cells and tissues. Those mutations increase cellular dependence on immunoproteasomes for stress response and survival. These results define a mechanism by which mTORC1 couples elevated protein synthesis with immunoproteasome biogenesis to protect cells against protein stress.

Mammalian target of rapamycin (mTOR) enhances translation from a subset of messenger RNAs containing distinct 5'-untranslated region (UTR) sequence features. Here we identify 3'-UTR shortening of mRNAs as an additional molecular signature of mTOR activation and show that 3'-UTR shortening enhances the translation of specific mRNAs. Using genetic or chemical modulations of mTOR activity in cells or mouse tissues, we show that cellular mTOR activity is crucial for 3'-UTR shortening. Although long 3'-UTR-containing transcripts minimally contribute to translation, 3-'UTR-shortened transcripts efficiently form polysomes in the mTOR-activated cells, leading to increased protein production. Strikingly, selected E2 and E3 components of ubiquitin ligase complexes are enriched by this mechanism, resulting in elevated levels of protein ubiquitination on mTOR activation. Together, these findings identify a previously uncharacterized role for mTOR in the selective regulation of protein synthesis by modulating 3'-UTR length of mRNAs.

Sonocatalytic degradation experiments were carried out to determine the effects of glass beads (GBs) and single-walled carbon nanotubes (SWNTs) on ibuprofen (IBP) and sulfamethoxazole (SMX) removal using low and high ultrasonic frequencies (28 and 1000kHz). In the absence of catalysts, the sonochemical degradation at pH 7, optimum power of 0.18WmL(-1), and a temperature of 15°C was higher (79% and 72%) at 1000kHz than at 28kHz (45% and 33%) for IBP and SMX, respectively. At the low frequency (28kHz) H2O2 production increased significantly, from 10μM (no GBs) to 86μM in the presence of GBs (0.1mm, 10gL(-1)); however, no enhancement was achieved at 1000kHz. In contrast, the H2O2 production increased from 10μM (no SWNTs) to 31μM at 28kHz and from 82μM (no SWNTs) to 111μM at 1000kHz in the presence of SWNTs (45mgL(-1)). Thus, maximum removals of IBP and SMX were obtained in the presence of a combination of GBs and SWNTs at the low frequency (94% and 88%) for 60min contact time; however, >99% and 97% removals were achieved for 40 and 60min contact times at the high frequency for IBP and SMX, respectively. The results indicate that both IBP and SMX degradation followed pseudo-first-order kinetics. Additionally, the enhanced removal of IBP and SMX in the presence of catalysts was because GBs and SWNTs increased the number of free OH radicals due to ultrasonic irradiation and the adsorption capacity increase with SWNT dispersion.

It is well known that fucoidan, a natural sulfated polysaccharide present in various brown algae, mediates anticancer effects through the induction of cell cycle arrest and apoptosis. Nevertheless, the role of tumor suppressor p53 in the mechanism action of fucoidan remains unclear. Here, we investigated the anticancer effect of fucoidan on two p53 isogenic HCT116 (p53+/+ and p53-/-) cell lines. Our results showed that inhibition of cell viability, induction of apoptosis and DNA damage by treatment with fucoidan were similar in two cell lines. Flow cytometric analysis revealed that fucoidan resulted in G1 arrest in the cell cycle progression, which correlated with the inhibition of phosphorylation of retinoblastoma protein (pRB) and concomitant association of pRB with the transcription factor E2Fs. Furthermore, treatment with fucoidan obviously upregulated the expression of cyclin-dependent kinase (CDK) inhibitors, such as p21WAF1/CIP1 and p27KIP1, which was paralleled by an enhanced binding with CDK2 and CDK4. These events also commonly occurred in both cell lines, suggesting that fucoidan triggered G1 arrest and apoptosis in HCT116 cells by a p53-independent mechanism. Thus, given that most tumors exhibit functional p53 inactivation, fucoidan could be a possible therapeutic option for cancer treatment regardless of the p53 status.

The structural design and synthesis of effective cathode catalysts are important concerns for achieving rechargeable Li-O2 batteries. In this study, hexagonal Co3O4 nanoplatelets coated with MnO2 were synthesized as bifunctional catalysts for Li-O2 batteries. The oxygen reduction reaction catalyst (MnO2) was closely integrated on the surface of the oxygen evolution reaction catalyst (hexagonal Co3O4) so that this hetero-structured catalyst (HSC) hybrid would show bifunctional catalytic activity in Li-O2 batteries. A facile synthesis route was developed to form a unique HSC structure, with {111} facet-exposed Co3O4 decorated with perpendicularly arranged MnO2 flakes. The catalytic activity of the HSCs was controlled by tuning the ratio of Co to Mn (the ratio of OER to ORR catalysts) in the hybrids. With the optimized Co3O4-to-MnO2 ratio of 5:3, a Li-O2 cell containing the HSC showed remarkably enhanced electrochemical performance, including discharge capacity, energy efficiency, and especially cycle performance, compared to cells with a monofunctional catalyst and a powder mixture of Co3O4 and MnO2. The results demonstrate the feasibility of reversible Li-O2 batteries with bifunctional catalyst hybrids.

Abstract It has been studied that mesenchymal stem cells (MSCs) have the capability to promote angiogenesis. Furthermore , there is strong evidence that hypoxic conditions can enhance angiogenesis and immune modulation mediated by MSCs, a notion that has been applied in many fields of clinical application. In the present study, we compared the efficacy of hypoxia preconditioned human umbilical cord‐derived mesenchymal stem cells (hUC‐MSCs) and normoxia conditioned hUC‐MSCs for the treatment of ischemic injury in hindlimbs of an immunodeficient mouse model. Expression of negative markers for MSC such as CD31, CD34, and CD45 or positive markers such as CD44, CD73, CD90, and CD105 was not significantly changed in hypoxia preconditioned hUC‐MSCs compared with hUC‐MSCs cultured in normoxic condition. Expression of angiogenesis‐related genes such as COX‐2 , VEGF , Tie‐2 , and TGF‐β1 was increased compared with hUC‐MSCs cultured in normoxic conditions. In the in vivo model, CD31 expression as a marker of angiogenesis was significantly increased in the ischemic limbs at 1 month after injection with hypoxic hUC‐MSCs. Angiogenesis‐related genes such as Ang‐1 , COX‐1 , PIGF , and MCP‐1 were significantly upregulated in the muscle of ischemic hindlimbs treated with hypoxic hUC‐MSCs than normoxic hUC‐MSCs. Expression of proinflammatory genes such as IL‐1 , and IL‐20 was reduced, whereas TGF‐β1 , which has an anti‐inflammatory effect, was strongly increased. In conclusion, hypoxic culture conditions could induce expression of angiogenesis related genes in hUC‐MSCs, and hypoxia preconditioned hUC‐MSCs showed enhancing effects by inducing angiogenesis and low inflammatory immune response compared with normoxic hUC‐MSCs in the ischemia injured hindlimb of immunodeficient mice.

Graphene oxides (GO) were coated on three different commercially available polyethersulfone (PES) ultrafiltration membranes (nominal molecular weight cutoffs; 5, 10, and 30 kDa) via a simple vacuum filtration process in our laboratory. The physicochemical properties of resultant membranes were analyzed by Fourier-transform infrared spectroscopy, Raman spectroscopy, field-emission scanning electron microscopy, confocal laser scanning microscopy, and water contact angle measurements. The GO-coated membranes appeared to be more hydrophilic, resulting in approximately 20% higher pure water flux than pristine PES membranes. It was also found that GO nanosheets were not easily damaged or detached from the PES membrane support by filtration or water rinsing due to strong hydrogen bonding interactions between the sulfone and carboxylic groups. Moreover, the humic acid rejection of GO-coated membranes (85.3–93.9%) was significantly higher by approximately 3.4 times depending on various pH and conductivity conditions than that of the pristine PES membranes (25.2–34.8%). Along with the increase in pH and conductivity, HA rejection was slightly increased for both pristine PES and GO-coated membranes: nevertheless, GO-coated membranes (5.3%) were less affected by high pH/conductivity conditions for the humic acid rejection than the pristine PES membranes (19.0%). In particular, it was relatively easier to remove foulant from the GO-coated membrane surface by water rinsing than from the pristine membranes, resulting in high membrane recovery and antifouling capabilities at various pH and conductivity conditions.

Background and purpose Although depression is a frequent psychiatric comorbidity in people with epilepsy (PWE), its prevalence has been underestimated. Comorbid depression has negative impacts on treatment outcomes and quality of life (QOL). It also causes various problems in PWE, such as fatigue, irritability, and suicidality. This meta-analysis was performed to estimate the frequency of major depression disorder (MDD) in clinics managing PWE. Methods We searched MEDLINE, EMBASE, Cochrane Library, Web of Science, and SCOPUS to identify studies. Hospital-based studies and original research presenting information regarding prevalence of MDD, determined using a gold standard diagnostic tool in adult PWE, were considered for inclusion. The prevalence of depression was examined by meta-analysis. In addition, subgroup analysis was performed based on the continent where the selected studies were conducted, the strictness of selection criteria, and gender. Strict selection criteria were defined as any mention of the use of exclusion criteria. Results A total of 6607 studies were identified by searching the five databases outlined above. After screening and rescreening, 35 studies were included in the meta-analysis. The total number of PWE was 5434. In the test for heterogeneity of the studies, I2 was 68.014, and the Cochran Q value was 106.296 (p < 0.01). As a pooled estimate, the point prevalence of MDD in PWE was 21.9% with a 95% confidence interval (CI) of 20.8–23.0 in a fixed effects model. In subgroup analyses, continent partly explained the heterogeneity among the selected studies, but the strictness of selection criteria did not. The prevalence of MDD was higher in females than in males (26.4% vs. 16.7%, respectively) with an odds ratio (OR) of 1.805 (95% CI: 1.443–2.258; p < 0.01). Conclusions The point prevalence of MDD is estimated at 21.9% among PWE in epilepsy clinics and is higher in females than in males. Based on this relatively high prevalence in PWE, measures are required to identify and resolve MDD. In addition, the female predominance of MDD among PWE indicates a need to pay greater attention to females. Such efforts may reduce the impact of depression in PWE and improve their QOL.

Compositions of gastrointestinal microorganisms are known to vary depending on surrounding environment, health status and diet. However, comprehensive analysis of composition and diversity of gut microbiota of fish after treatment with antibiotics has been limited. In this study, therefore, effects of oxytetracycline (OTC) or amoxicillin (AMX) administration on intestinal microbiota of olive flounder, Paralichthys olivaceus, were investigated. Fish were administered with AMX and OTC by oral (80 mg/kg of BW/day for 10 days) or intramuscular injection (12.5 mg/kg bw and 50 mg/kg bw) route. Culture-dependent method and metagenome analysis were performed using samples of gut mucus taken from fish at day 0, 5 and/or 10. A total of 23 and 26 species were isolated from gut mucus of fish in oral and injection groups, respectively. Virbio scophthalmi, V. harveyi and Photobacterium damselae, and V. scophthalmi and Streptococcus parauberis were dominantly isolated from oral and injection treatment groups, respectively. In metagenomics analysis, operating taxonomic unit (OTU) counts obtained from AMX and OTC oral treatment group were 42 and 78, respectively, which are much lower than 178 OTUs retrieved from the control group. OTU counts obtained from fish injected with AMX at day 5 were 22, remarkably lower than those of other samples in injection treatment groups. These results indicate that administration of antibiotics to fish can have great impact on gut microbial community by reducing its diversity and number. Our data also show that AMX might cause changes in microbial community greater than OTC. In some cases, it can lead to significant increase of opportunistic pathogen(s), causing dysbiosis.

Phosphoric acid (PA) leaching is one of the endurance issues for the use of PA-doped polymer electrolytes in high-temperature proton exchange membrane fuel cells (HT-PEMFCs). A chemical cross-linking approach is presented that adequately addresses this issue. The cross-linked membrane (XTPPO) was synthesized from poly (2,6-dimethyl-1,4-phenylene oxide) containing triazole groups (TPPO) on the side chains by in situ casting and click reaction with 1,7-octadiyne. XTPPO exhibited more than 90% of the membrane retained after gel fraction test. The cross-linked membrane showed high thermal stability with TD5% = 325 °C. Cross-linking also led to enhanced oxidative and mechanical stability. PA doping was controlled with the amount of triazole and the degree of cross-linking. The highest proton conductivity measured in the anhydrous condition was 64 mS/cm at 180 °C.

The electric power output of a piezoelectric nanogenerator (PENG) depends on the various physical parameters of the constituent materials, including the piezoelectric coefficient, Young's modulus, and dielectric constant. Herein, we report the mechanical and electrical properties of a poly(vinylidene fluoride)⁻BaTiO₃ (PVDF⁻BTO) composite-based PENG. Variation of the BTO nanoparticle (NP) content enabled the systematic tuning of the physical parameters that are related to power generation in the composite. The Young's modulus of the PVDF⁻BTO composite initially increased, and then eventually decreased, with the increasing BTO content, which was probably due to the clustering effect of the high modulus BTO NPs. The dielectric constant of the composite continuously increased as the BaTiO₃ content increased. The piezoelectric outputs were greatly enhanced at 10 wt% of BTO, where the Young's modulus was the highest. These results indicate that the Young's modulus plays an important role in the piezoelectric power generation of the composite-based PENGs.

To improve the efficiency of polymer electrolyte membrane water electrolyzers (PEMWEs), catalysts with high activity and stability in the oxygen evolution reaction (OER) have been extensively investigated. In this study, using a novel solution-reduction process, self-assembled Ir/IrOx OER catalysts are prepared, with a controlled Ir oxidation-state ratios. Spectroscopic and electron microscopic analyses confirm that these catalysts have a gradient oxidation state, which gradually decreases from the shell to the core. In half-cell tests, before and after the accelerated stress test (AST) at 10 mA cm−2, the optimized Ir/IrOx catalyst exhibits an overpotential change of approximately 21 mVRHE, which is 3.3 times lesser than that of the state-of-the-art IrO2 (approximately 69 mVRHE). Further, quantification of the dissolved Ir content during the AST shows that the Ir/IrOx catalyst has a strong corrosion resistance under acidic OER conditions. Single-cell testing of the as-prepared OER catalyst demonstrates a remarkable cell performance of 1.73 V at 1.0 A cm−2. After 48-h durability testing, the increase in the membrane electrode assembly cell voltage with the as-prepared OER catalyst is approximately 5.3 times lesser than that of the reference at 250 mA cm−2. The proposed novel catalyst with high activity and stability can aid the development of cost-effective PEMWE systems.

A conductive metal compound can be used as a catalyst for enhancing hydrogen production by dark fermentation. This study aimed to identify mechanisms of enhanced hydrogen production by magnetite supplementation. Experiments were performed with lactate and/or magnetite supplementation to confirm that the lactate-utilizing pathway is the key cause of enhanced hydrogen production. Also, ribonucleic acid sample was collected for monitoring gene regulation under each condition. Hydrogen production was significantly enhanced by approximately 25.6% and 58.9%, respectively, via magnetite alone and with lactate. Moreover, the expression of genes involved in hydrogen production, including pyruvate ferredoxin oxidoreductase, hydrogenase, and ferredoxin, via magnetite alone and with lactate was upregulated by 0.26, 0.71, and 3.50 and 1.06, 2.14, and 1.94 times, respectively.

In the membrane electrode assembly (MEA) of high-temperature polymer electrolyte membrane fuel cells (HT-PEMFCs), many types of resistance existed, but they have not been distinctly characterized in previous research. In this study, the distribution of relaxation times (DRT) methodology is employed, in conjunction with a home-built electrochemical electrode analysis system (EEAS), to figure out the specific resistance components in the cathode gas diffusion electrode (GDE). The impedance analysis by the DRT method was conducted using the electrochemical impedance spectrum obtained at different temperatures and current densities of the cathode only, isolated from the MEA environment. The four peaks (designated as Peak 0 to 3) were depicted at DRT plots of cathode GDE below 103 Hz. By comparing the DRT plots for different conditions and considering the EEAS structure, the four peaks were explained to be caused by distinct resistances occurring at the electrode and interface. The regions of each peak were distinguished according to their position changes with temperature and current density. Furthermore, by contrasting the DRT plots of the cathode GDE with those of MEA containing the same cathode, an additional peak (referred to as Peak 4) is identified between 103 Hz and 104 Hz, which was attributed to resistance originating from the anode. This study could provide a new approach for future research of new catalysts and electrodes utilizing the resistance analysis of MEA for HT-PEMFC.

The effect of argon ion irradiation on the field emission (FE) and luminescent properties of screen-printed carbon nanotubes (SP-CNTs) with square pixels was examined, to further improve field emission displays (FEDs) applications. Persistent problems associated with SP-CNTs such as bent or/and buried CNTs and the degradation of binder-residue-induced emission were improved as a result of the permanent straightening of CNTs and protruding CNTs from binders by the irradiation treatment, in addition to its surface cleaning effect. The findings here in suggest that ion irradiation treatment is an effective method for achieving uniform FE and for reducing the aging time of SP-CNTs.

Trichloroethylene (TCE) is a representative dense nonaqueous phase liquid (DNAPL) in groundwater. TCE as a form of free fluid has been treated by surfactant-enhanced aquifer remediation (SEAR). After application of SEAR, groundwater contains little amount of residual TCE and surfactant. Residual TCE could be treated by zero-valent iron (ZVI). However, surfactant might modify the surface property of ZVI. As a result, the reduction of TCE on the surface of ZVI might be affected by the presence of surfactant. In this study, the effect of surfactant types on reductive dechlorination of TCE was investigated using zero-valent iron. Cationic surfactant enhanced the dechlorination rate of TCE at a concentration below the critical micelle concentration (CMC) compared to pure ZVI. Electrostatic interaction between electronegative chloride group of TCE and positive head group of cationic surfactant was increased sorption of TCE on the surface of ZVI. However, anionic and nonionic surfactants inhibited the reductive dechlorination of TCE because of the decrease of TCE sorption on the surface of ZVI. The reduction rate of TCE in the presence of nonionic surfactant is dependent on the length of hydrophobic carbon chain in nonionic surfactant. Little amount of cationic surfactant could enhanced the reductive dechlorination rate of TCE. As a result, the time to treat TCE in groundwater will be shortened.

Reactive dyes are non-degradable and toxic to environments and human being, and their solutions have some color even after wastewater treatment. To remove toxic dyes, adsorption is common choice. In this study, to improve the adsorption capacity, the effect of cationic surfactant was studied to remove reactive black 5 (RB5) by activated carbon (AC) using cetylpyridinium chloride (CPC). Three different ACs were studied; pure AC, AC in CPC solution and precoated AC by CPC. Regardless of surfactant presence, the sorption kinetics followed pseudo-second-order kinetic model. Equilibrium adsorption capacities were determined by fittings experimental data to three well-known isotherm models; Langmuir, Freundlich and double scheme of Langmuir model. A double scheme of Langmuir model was more proper to explain experimental data than the conventional Langmuir and Freundlich model. Cationic surfactant could enhance sorption capacity of RB5 on activated carbon, and the extent of enhancement is highly dependent on pore size distribution of activated carbon.

Background/Aims Papillary thyroid cancer (PTC) is the most common malignancy of the thyroid gland. It involves several molecular mechanisms. The BRAF V600E mutation has been identified as the most common genetic abnormality in PTC. Moreover, it is known to be more prevalent in Korean PTC patients than in patients from other countries. We investigated distinct genetic profiles in Korean PTC through cDNA microarray analysis. Methods Transcriptional profiles of five PTC samples and five paired normal thyroid tissue samples were generated using cDNA microarrays. The tumors were genotyped for BRAF mutations. The results of the cDNA microarray gene expression analysis were confirmed by real-time PCR and immunohistochemistry analysis of 35 PTC patients. Results Four of the five patients whose PTC tissues were subjected to microarray analysis were found to carry the BRAF V600E mutation. Microarrays analysis of the five PTC tissue samples showed the expression of 96 genes to be increased and that of 16 genes decreased. Real-time reverse transcription-polymerase chain reaction (RT-PCR) confirmed increased expression of SLC34A2, TM7SF4, COMP, KLK7, and KCNJ2 and decreased expression of FOXA2, SLC4A4, LYVE-1, and TFCP2L1 in PTC compared with normal tissue. Of these genes, TFCP2L1, LYVE-1, and KLK7 were previously unidentified in PTC microarray analysis. Notably, Foxa2 activity in PTC was reduced, as shown by its cytoplasmic localization, in immunohistochemical analyses. Conclusions These findings demonstrate both similarities and differences between our results and previous reports. In Korean cases of PTC, Foxa2 activity was reduced with its cytoplasmic accumulation. Further studies are needed to confirm the relationship between FOXA2 and BRAF mutations in Korean cases of PTC.

Mesenchymal stem cells (MSCs) are multipotent adult stem cells that can differentiate into a variety of mesodermal-lineage cells. MSCs have significant potential in tissue engineering and therapeutic applications; however, the low differentiation and proliferation efficiencies of these cells in the laboratory are fundamental obstacles to their therapeutic use, mainly owing to the lack of information on the detailed signal-transduction mechanisms of differentiation into distinct lineages. With the aid of protein-tyrosine-phosphatase profiling studies, we show that the expression of leukocyte common antigen related (LAR) tyrosine phosphatase is significantly decreased during the early adipogenic stages of MSCs. Knockdown of endogenous LAR induced a dramatic increase in adipogenic differentiation, whereas its overexpression led to decreased adipogenic differentiation in both 3T3-L1 preadipocytes and MSCs. LAR reduces tyrosine phosphorylation of the insulin receptor, in turn leading to decreased phosphorylation of the adaptor protein IRS-1 and its downstream molecule Akt (also known as PKB). We propose that LAR functions as a negative regulator of adipogenesis. Furthermore, our data support the possibility that LAR controls the balance between osteoblast and adipocyte differentiation. Overall, our findings contribute to the clarification of the mechanisms underlying LAR activity in the differentiation of MSCs and suggest that LAR is a candidate target protein for the control of stem-cell differentiation.

The heterodimeric Rag GTPases consisting of RagA (or RagB) and RagC (or RagD) are the key regulator activating the target of rapamycin complex 1 (TORC1) in response to the level of amino acids. The heterodimer between GTP-loaded RagA/B and GDP-loaded RagC/D is the most active form that binds Raptor and leads to the activation of TORC1. Here, we present the crystal structure of Gtr1p(GTP)-Gtr2p(GDP), the active yeast Rag GTPase heterodimer. The structure reveals that GTP-to-GDP conversion on Gtr2p results in a large conformational transition of this subunit, including a large scale rearrangement of a long segment whose corresponding region in RagA is involved in binding to Raptor. In addition, the two GTPase domains of the heterodimer are brought to contact with each other, but without causing any conformational change of the Gtr1p subunit. These features explain how the nucleotide-bound statuses of the two GTPases subunits switch the Raptor binding affinity on and off.

The mammalian target of rapamycin complex 1 (mTORC1) is a molecular hub that regulates protein synthesis in response to a number of extracellular stimuli. Cyclic AMP (cAMP) is considered to be an important second messenger that controls mTOR; however, the signaling components of this pathway have not yet been elucidated. Here, we identify cAMP phosphodiesterase 4D (PDE4D) as a binding partner of Rheb that acts as a cAMP-specific negative regulator of mTORC1. Under basal conditions, PDE4D binds Rheb in a noncatalytic manner that does not require its cAMP-hydrolyzing activity and thereby inhibits the ability of Rheb to activate mTORC1. However, elevated cAMP levels disrupt the interaction of PDE4D with Rheb and increase the interaction between Rheb and mTOR. This enhanced Rheb-mTOR interaction induces the activation of mTORC1 and cap-dependent translation, a cellular function of mTORC1. Taken together, our results suggest a novel regulatory mechanism for mTORC1 in which the cAMP-determined dynamic interaction between Rheb and PDE4D provides a key, unique regulatory event. We also propose a new role for PDE4 as a molecular transducer for cAMP signaling.

This study was conducted to improve salt removal from saline soil in a pilot-scale electrokinetic (EK) system with the electrodes in a hexagonal configuration. The experiments were performed under a constant voltage gradient of 1 V/cm in an EK reactor (1 m × 1 m × 0.25 m) over 14 days. Chloride and nitrate were transported toward the anode by electromigration, and simultaneously moved toward the top layer from the bottom layer by pore-water evaporation. Nitrate removal was higher than chloride removal. Sulfate removal was uniform across all layers. Sulfate formed insoluble calcium sulfate, which reduced overall sulfate removal. The amount of exchangeable Mg was higher after treatment because the electrochemical reaction changed Mg fractionation. EK treatment resulted in the removal of approximately 30% of K and Ca from the system. Removal efficiency was enhanced because the hexagonal two-dimensional electrode configuration minimized the inactive area of the electric field, which was not the case in a one-dimensional rectangular system. However, the overall removal efficiency was not sufficiently high because of the relatively short operating time.

Sorafenib-incoporated nanoparticles were prepared using a block copolymer that is composed of dextran and poly(DL-lactide-co-glycolide) [DexbLG] for antitumor drug delivery. Sorafenib-incorporated nanoparticles were prepared by a nanoprecipitation-dialysis method. Sorafenib-incorporated DexbLG nanoparticles were uniformly distributed in an aqueous solution regardless of the content of sorafenib. Transmission electron microscopy of the sorafenib-incorporated DexbLG nanoparticles revealed a spherical shape with a diameter < 300 nm. Sorafenib-incorporated DexbLG nanoparticles at a polymer/drug weight ratio of 40:5 showed a relatively uniform size and morphology. Higher initial drug feeding was associated with increased drug content in nanoparticles and in nanoparticle size. A drug release study revealed a decreased drug release rate with increasing drug content. In an in vitro anti-proliferation assay using human cholangiocarcinoma cells, sorafenib-incorporated DexbLG nanoparticles showed a similar antitumor activity as sorafenib. Sorafenib-incorporated DexbLG nanoparticles are promising candidates as vehicles for antitumor drug targeting.

Methicillin-resistant Staphylococcus aureus (MRSA) is spreading worldwide, emphasizing the need to search for new antibiotics. The anti-MRSA activities of gallic acid-grafted-chitosans (GA-g-chitosans) were investigated against 2 MRSA standards and 10 MRSA clinical isolates by determining the minimum inhibitory concentrations (MICs). GA-g-chitosan (I), which has the highest gallic acid content, exhibited the strongest anti-MRSA activities, with MICs of 32-64 μg/mL. A time-kill investigation revealed that GA-g-chitosan (I) exhibited a bactericidal effect at twice the MIC, also demonstrating good thermal and pH stability. Investigation of cell envelope integrity showed the release of intracellular components with an increasing absorbance value at 260 nm, indicating cell envelope damage caused by the GA-g-chitosan (I), which was further confirmed by transmission electron microscopy. When GA-g-chitosans were combined with β-lactams, including ampicillin and penicillin, synergistic effects were observed on the 2 standard MRSA strains and on the 10 clinical isolates, with fractional inhibitory indices ranging from 0.125 to 0.625. In the time-kill dynamic confirmation test, synergistic bactericidal effects were observed for the combinations of GA-g-chitosans with β-lactams, and over 4.0 log CFU/mL reductions were observed after 24 h when combination treatment was used. These results may prove GA-g-chitosans to be a potent agent when combined with ampicillin and penicillin for the elimination of MRSA.

The Global Land Cover Facility (GLCF) global forest-cover and -change dataset is a multi-temporal depiction of long-term (multi-decadal), global forest dynamics at high (30-m) resolution. Based on per-pixel estimates of percentage tree cover and their associated uncertainty, the dataset currently represents binary forest cover in nominal 1990, 2000, and 2005 epochs, as well as gains and losses over time. A comprehensive accuracy assessment of the GLCF dataset was performed using a global, design-based sample of 27,988 independent, visually interpreted reference points collected through a two-stage, stratified sampling design wherein experts visually identified forest cover and change in each of the 3 epochs based on Landsat and high-resolution satellite images, vegetation index profiles, and field photos. Consistent across epochs, the overall accuracy of the static forest-cover layers was 91%, and the overall accuracy of forest-cover change was > 88% —among the highest accuracies reported for recent global forest- and land-cover data products. Both commission error (CE) and omission error (OE) were low for static forest cover in each epoch and for the stable classes between epochs (CE < 3%, OE < 22%), but errors were larger for forest loss (45% ≤ CE < 62%, 47% < OE < 55%) and gain (66% ≤ CE < 85%, 61% < OE < 84%). Accuracy was lower in sparse forests and savannahs, i.e., where tree cover was at or near the 30% threshold used to discriminate forest from non-forest cover. Discrimination of forest had a low rate of commission error and slight negative bias, especially in areas with low tree cover. After adjusting global area estimates to reference data, 39.28 ± 1.34 million km2 and 38.81 ± 1.34 million km2 of forest were respectively identified in 2000 and 2005 globally, and 33.16 ± 1.36 million km2 of forest were estimated in the available coverage of Landsat data circa-1990. Forest loss and gain were estimated to have been 0.73 ± 0.38 and 0.28 ± 0.26 million km2 between 2000 and 2005, and 1.08 ± 0.53 and 0.53 ± 0.47 million km2 between 1990 and 2000. These estimates of accuracy are required for rigorous use of the data in the Earth sciences (e.g., ecology, economics, hydrology, climatology) as well as for fusion with other records of global change. The GLCF forest -cover and -change dataset is available for free public download at the GLCF website (http://www.landcover.org).