Diane M. Ward

Hepcidin is a peptide hormone secreted by the liver in response to iron loading and inflammation. Decreased hepcidin leads to tissue iron overload, whereas hepcidin overproduction leads to hypoferremia and the anemia of inflammation. Ferroportin is an iron exporter present on the surface of absorptive enterocytes, macrophages, hepatocytes, and placental cells. Here we report that hepcidin bound to ferroportin in tissue culture cells. After binding, ferroportin was internalized and degraded, leading to decreased export of cellular iron. The posttranslational regulation of ferroportin by hepcidin may thus complete a homeostatic loop: Iron regulates the secretion of hepcidin, which in turn controls the concentration of ferroportin on the cell surface.

We sequenced the 29,751-base genome of the severe acute respiratory syndrome (SARS)-associated coronavirus known as the Tor2 isolate. The genome sequence reveals that this coronavirus is only moderately related to other known coronaviruses, including two human coronaviruses, HCoV-OC43 and HCoV-229E. Phylogenetic analysis of the predicted viral proteins indicates that the virus does not closely resemble any of the three previously known groups of coronaviruses. The genome sequence will aid in the diagnosis of SARS virus infection in humans and potential animal hosts (using polymerase chain reaction and immunological tests), in the development of antivirals (including neutralizing antibodies), and in the identification of putative epitopes for vaccine development.

HIV release requires TSG101, a cellular factor that sorts proteins into vesicles that bud into multivesicular bodies (MVB). To test whether other proteins involved in MVB biogenesis (the class E proteins) also participate in HIV release, we identified 22 candidate human class E proteins. These proteins were connected into a coherent network by 43 different protein-protein interactions, with AIP1 playing a key role in linking complexes that act early (TSG101/ESCRT-I) and late (CHMP4/ESCRT-III) in the pathway. AIP1 also binds the HIV-1 p6(Gag) and EIAV p9(Gag) proteins, indicating that it can function directly in virus budding. Human class E proteins were found in HIV-1 particles, and dominant-negative mutants of late-acting human class E proteins arrested HIV-1 budding through plasmal and endosomal membranes. These studies define a protein network required for human MVB biogenesis and indicate that the entire network participates in the release of HIV and probably many other viruses.

Chediak-Higashi syndrome, a rare autosomal recessive disorder, was described over 50 years ago. Patients show hypopigmentation, recurrent infections, mild coagulation defects and varying neurologic problems. Treatment is bone marrow transplant, which is effective in treating the hematologic and immune defects, however the neurologic problems persist. The CHS1/LYST gene was identified over 10 years ago and homologous CHS1/LYST genes are present in all eukaryotes. This review will discuss the advances made in understanding the clinical aspects of the syndrome and the function of CHS1/LYST/Beige.Clinical reports of Chediak-Higashi syndrome have identified mutations throughout the CHS1/LYST gene. The nature of the mutation can be a predictor of the severity of the disease. Over the past decade the CHS1/LYST family of proteins has been analyzed using model organisms, two-hybrid analysis, overexpression phenotypes and dominant negatives. These studies suggest that the CHS1/LYST protein is involved in either vesicle fusion or fission.Although CHS is a rare disease, the Chediak-like family of proteins is providing insight into the regulation of vesicle trafficking. Understanding the basic mechanisms that govern vesicle trafficking will provide essential information regarding how loss of CHS1/LYST affects hematologic, immunologic and neurologic processes.

The distinguishing feature between iron homeostasis in single versus multicellular organisms is the need for multicellular organisms to transfer iron from sites of absorption to sites of utilization and storage. Ferroportin is the only known iron exporter and ferroportin plays an essential role in the export of iron from cells to blood. Ferroportin can be regulated at many different levels including transcriptionally, post-transcriptionally, through mRNA stability and post-translationally, through protein turnover. Additionally, ferroportin may be regulated in both cell-dependent and cell-autonomous fashions. Regulation of ferroportin is critical for iron homeostasis as alterations in ferroportin may result in either iron deficiency or iron overload. This article is part of a Special Issue entitled: Cell Biology of Metals.

Adult humans have about 25 trillion red blood cells (RBCs), and each second we recycle about 5 million RBCs by erythrophagocytosis (EP) in macrophages of the reticuloendothelial system. Despite the central role for EP in mammalian iron metabolism, the molecules and pathways responsible for heme trafficking during EP remain unknown. Here, we show that the mammalian homolog of HRG1, a transmembrane heme permease in C. elegans, is essential for macrophage iron homeostasis and transports heme from the phagolysosome to the cytoplasm during EP. HRG1 is strongly expressed in macrophages of the reticuloendothelial system and specifically localizes to the phagolysosomal membranes during EP. Depletion of Hrg1 in mouse macrophages causes attenuation of heme transport from the phagolysosomal compartment. Importantly, missense polymorphisms in human HRG1 are defective in heme transport. Our results reveal HRG1 as the long-sought heme transporter for heme-iron recycling in macrophages and suggest that genetic variations in HRG1 could be modifiers of human iron metabolism.

The budding yeast <i>Saccharomyces cerevisiae</i> can grow for generations in the absence of exogenous iron, indicating a capacity to store intracellular iron. As cells can accumulate iron by endocytosis we studied iron metabolism in yeast that were defective in endocytosis. We demonstrated that endocytosis-defective yeast (<i>Δend4</i>) can store iron in the vacuole, indicating a transfer of iron from the cytosol to the vacuole. Using several different criteria we demonstrated that <i>CCC1</i>encodes a transporter that effects the accumulation of iron and Mn²⁺ in vacuoles. Overexpression of <i>CCC1,</i> which is localized to the vacuole<i>,</i> lowers cytosolic iron and increases vacuolar iron content. Conversely, deletion of<i>CCC1</i> results in decreased vacuolar iron content and decreased iron stores, which affect cytosolic iron levels and cell growth. Furthermore <i>Δccc1</i> cells show increased sensitivity to external iron. The sensitivity to iron is exacerbated by ectopic expression of the iron transporter <i>FET4</i>. These results indicate that yeast can store iron in the vacuole and that<i>CCC1</i> is involved in the transfer of iron from the cytosol to the vacuole.

Human Bocavirus was detected in 18 (1.5%) of 1,209 respiratory specimens collected in 2003 and 2004 in Canada. The main symptoms of affected patients were cough (78%), fever (67%), and sore throat (44%). Nine patients were hospitalized; of these, 8 (89%) were <5 years of age.

Mutations in the iron exporter ferroportin (Fpn) (IREG1, SLC40A1 , and MTP1) result in hemochromatosis type IV, a disorder with a dominant genetic pattern of inheritance and heterogeneous clinical presentation. Most patients develop iron loading of Kupffer cells with relatively low saturation of plasma transferrin, but others present with high transferrin saturation and iron-loaded hepatocytes. We show that known human mutations introduced into mouse Fpn-GFP generate proteins that either are defective in cell surface localization or have a decreased ability to be internalized and degraded in response to hepcidin. Studies using coimmunoprecipitation of epitope-tagged Fpn and size-exclusion chromatography demonstrated that Fpn is multimeric. Both WT and mutant Fpn participate in the multimer, and mutant Fpn can affect the localization of WT Fpn, its stability, and its response to hepcidin. The behavior of mutant Fpn in cell culture and the ability of mutant Fpn to act as a dominant negative explain the dominant inheritance of the disease as well as the different patient phenotypes.

All eukaryotes and most prokaryotes require transition metals. In recent years there has been an enormous advance in our understanding of how these metals are transported across the plasma membrane. Much of this understanding has resulted from studies on the budding yeast Saccharomyces cerevisiae. A variety of genetic and biochemical approaches have led to a detailed understanding of how transition metals such as iron, copper, manganese, and zinc are acquired by cells. The regulation of metal transport has been defined at both the transcriptional and posttranslational levels. Results from studies on S. cerevisiae have been used to understand metal transport in other species of yeast as well as in higher eukaryotes.

Ferritin is a cytosolic molecule comprised of subunits that self-assemble into a nanocage capable of containing up to 4500 iron atoms. Iron stored within ferritin can be mobilized for use within cells or exported from cells. Expression of ferroportin (Fpn) results in export of cytosolic iron and ferritin degradation. Fpn-mediated iron loss from ferritin occurs in the cytosol and precedes ferritin degradation by the proteasome. Depletion of ferritin iron induces the monoubiquitination of ferritin subunits. Ubiquitination is not required for iron release but is required for disassembly of ferritin nanocages, which is followed by degradation of ferritin by the proteasome. Specific mammalian machinery is not required to extract iron from ferritin. Iron can be removed from ferritin when ferritin is expressed in Saccharomyces cerevisiae, which does not have endogenous ferritin. Expressed ferritin is monoubiquitinated and degraded by the proteasome. Exposure of ubiquitination defective mammalian cells to the iron chelator desferrioxamine leads to degradation of ferritin in the lysosome, which can be prevented by inhibitors of autophagy. Thus, ferritin degradation can occur through two different mechanisms.

The nature of the connection between mitochondrial Fe-S cluster synthesis and the iron-sensitive transcription factor Aft1 in regulating the expression of the iron transport system in Saccharomyces cerevisiae is not known. Using a genetic screen, we identified two novel cytosolic proteins, Fra1 and Fra2, that are part of a complex that interprets the signal derived from mitochondrial Fe-S synthesis. We found that mutations in FRA1 (YLL029W) and FRA2 (YGL220W) led to an increase in transcription of the iron regulon. In cells incubated in high iron medium, deletion of either FRA gene results in the translocation of the low iron-sensing transcription factor Aft1 into the nucleus, where it occupies the FET3 promoter. Deletion of either FRA gene has the same effect on transcription as deletion of both genes and is not additive with activation of the iron regulon due to loss of mitochondrial Fe-S cluster synthesis. These observations suggest that the FRA proteins are in the same signal transduction pathway as Fe-S cluster synthesis. We show that Fra1 and Fra2 interact in the cytosol in an iron-independent fashion. The Fra1-Fra2 complex binds to Grx3 and Grx4, two cytosolic monothiol glutaredoxins, in an iron-independent fashion. These results show that the Fra-Grx complex is an intermediate between the production of mitochondrial Fe-S clusters and transcription of the iron regulon.

Mitoferrin-1 (Mfrn1; Slc25a37), a member of the solute carrier family localized in the mitochondrial inner membrane, functions as an essential iron importer for the synthesis of mitochondrial heme and iron-sulfur clusters in erythroblasts. The biochemistry of Mfrn1-mediated iron transport into the mitochondria, however, is poorly understood. Here, we used the strategy of in vivo epitope-tagging affinity purification and mass spectrometry to investigate Mfrn1-mediated mitochondrial iron homeostasis. Abcb10, a mitochondrial inner membrane ATP-binding cassette transporter highly induced during erythroid maturation in hematopoietic tissues, was found as one key protein that physically interacts with Mfrn1 during mouse erythroleukemia (MEL) cell differentiation. Mfrn1 was shown previously to have a longer protein half-life in differentiated MEL cells compared with undifferentiated cells. In this study, Abcb10 was found to enhance the stabilization of Mfrn1 protein in MEL cells and transfected heterologous COS7 cells. In undifferentiated MEL cells, cotransfected Abcb10 specifically interacts with Mfrn1 to enhance its protein stability and promote Mfrn1-dependent mitochondrial iron importation. The structural stabilization of the Mfrn1-Abcb10 complex demonstrates a previously uncharacterized function for Abcb10 in mitochondria. Furthermore, the binding domain of Mfrn1-Abcb10 interaction maps to the N terminus of Mfrn1. These results suggest the tight regulation of mitochondrial iron acquisition and heme synthesis in erythroblasts is mediated by both transcriptional and posttranslational mechanisms, whereby the high level of Mfrn1 is stabilized by oligomeric protein complexes.

Heme biosynthesis consists of a series of eight enzymatic reactions that originate in mitochondria and continue in the cytosol before returning to mitochondria. Although these core enzymes are well studied, additional mitochondrial transporters and regulatory factors are predicted to be required. To discover such unknown components, we utilized a large-scale computational screen to identify mitochondrial proteins whose transcripts consistently coexpress with the core machinery of heme biosynthesis. We identified SLC25A39, SLC22A4, and TMEM14C, which are putative mitochondrial transporters, as well as C1orf69 and ISCA1, which are iron-sulfur cluster proteins. Targeted knockdowns of all five genes in zebrafish resulted in profound anemia without impacting erythroid lineage specification. Moreover, silencing of Slc25a39 in murine erythroleukemia cells impaired iron incorporation into protoporphyrin IX, and vertebrate Slc25a39 complemented an iron homeostasis defect in the orthologous yeast mtm1Delta deletion mutant. Our results advance the molecular understanding of heme biosynthesis and offer promising candidate genes for inherited anemias.

Many intracellular pathogens infect macrophages and these pathogens require iron for growth. Here we demonstrate in vitro that the intracellular growth of Chlamydia psittaci, trachomatis, and Legionella pneumophila is regulated by the levels of intracellular iron. Macrophages that express cell surface ferroportin, the only known cellular iron exporter, limit the intracellular growth of these bacteria. Hepcidin is an antimicrobial peptide secreted by the liver in response to inflammation. Hepcidin binds to ferroportin mediating its internalization and degradation. Addition of hepcidin to infected macrophages enhanced the intracellular growth of these pathogens. Macrophages from flatiron mice, a strain heterozygous for a loss-of-function ferroportin mutation, showed enhanced intracellular bacterial growth independent of the presence of exogenous hepcidin. Macrophages, from wild-type or flatiron mice, incubated with the oral iron chelator deferriprone or desferasirox showed reduced intracellular bacterial growth suggesting that these chelators might be therapeutic in chronic intracellular bacterial infections.

The budding of many enveloped RNA viruses, including human immunodeficiency virus type 1 (HIV-1), requires some of the same cellular machinery as vesicle formation at the multivesicular body (MVB). In Saccharomyces cerevisiae, the ESCRT-II complex performs a central role in MVB protein sorting and vesicle formation, as it is recruited by the upstream ESCRT-I complex and nucleates assembly of the downstream ESCRT-III complex. Here, we report that the three subunits of human ESCRT-II, EAP20, EAP30, and EAP45, have a number of properties in common with their yeast orthologs. Specifically, EAP45 bound ubiquitin via its N-terminal GRAM-like ubiquitin-binding in EAP45 (GLUE) domain, both EAP45 and EAP30 bound the C-terminal domain of TSG101/ESCRT-I, and EAP20 bound the N-terminal half of CHMP6/ESCRT-III. Consistent with its expected role in MVB vesicle formation, (i) human ESCRT-II localized to endosomal membranes in a VPS4-dependent fashion and (ii) depletion of EAP20/ESCRT-II and CHMP6/ESCRT-III inhibited lysosomal targeting and downregulation of the epidermal growth factor receptor, albeit to a lesser extent than depletion of TSG101/ESCRT-I. Nevertheless, HIV-1 release and infectivity were not reduced by efficient small interfering RNA depletion of EAP20/ESCRT-II or CHMP6/ESCRT-III. These observations indicate that there are probably multiple pathways for protein sorting/MVB vesicle formation in human cells and that HIV-1 does not utilize an ESCRT-II-dependent pathway to leave the cell.

The ESCRT pathway mediates membrane remodeling during enveloped virus budding, cytokinesis, and intralumenal endosomal vesicle formation. Late in the pathway, a subset of membrane-associated ESCRT-III proteins display terminal amphipathic "MIM1" helices that bind and recruit VPS4 ATPases via their MIT domains. We now report that VPS4 MIT domains also bind a second, "MIM2" motif found in a different subset of ESCRT-III subunits. The solution structure of the VPS4 MIT-CHMP6 MIM2 complex revealed that MIM2 elements bind in extended conformations along the groove between the first and third helices of the MIT domain. Mutations that block VPS4 MIT-MIM2 interactions inhibit VPS4 recruitment, lysosomal protein targeting, and HIV-1 budding. MIT-MIM2 interactions appear to be common throughout the ESCRT pathway and possibly elsewhere, and we suggest how these interactions could contribute to a mechanism in which VPS4 and ESCRT-III proteins function together to constrict the necks of budding vesicles.

Deferoxamine (DFO) is a high-affinity Fe (III) chelator produced by Streptomyces pilosus. DFO is used clinically to remove iron from patients with iron overload disorders. Orally administered DFO cannot be absorbed, and therefore it must be injected. Here we show that DFO induces ferritin degradation in lysosomes through induction of autophagy. DFO-treated cells show cytosolic accumulation of LC3B, a critical protein involved in autophagosomal-lysosomal degradation. Treatment of cells with the oral iron chelators deferriprone and desferasirox did not show accumulation of LC3B, and degradation of ferritin occurred through the proteasome. Incubation of DFO-treated cells with 3-methyladenine, an autophagy inhibitor, resulted in degradation of ferritin by the proteasome. These results indicate that ferritin degradation occurs by 2 routes: a DFO-induced entry of ferritin into lysosomes and a cytosolic route in which iron is extracted from ferritin before degradation by the proteasome.

Hepcidin is a peptide hormone secreted by the liver that plays a central role in the regulation of iron homeostasis. Increased hepcidin levels result in anemia while decreased expression is the causative feature in most primary iron overload diseases. Mutations in hemochromatosis type 2 (HFE2), which encodes the protein hemojuvelin (HJV), result in the absence of hepcidin and an early-onset form of iron overload disease. HJV is a bone morphogenetic protein (BMP) coreceptor and HJV mutants have impaired BMP signaling. In this issue of the JCI, Babitt and colleagues show that BMPs are autocrine hormones that induce hepcidin expression (see the related article beginning on page 1933). Administration of a recombinant, soluble form of HJV decreased hepcidin expression and increased serum iron levels by mobilizing iron from splenic stores. These results demonstrate that recombinant HJV may be a useful therapeutic agent for treatment of the anemia of chronic disease, a disorder resulting from high levels of hepcidin expression.

Hepcidin is a hormone secreted in response to iron loading and inflammation. Hepcidin binds to the iron exporter ferroportin, inducing its degradation and thus preventing iron entry into plasma. We determined that hepcidin binding to ferroportin leads to the binding and activation of the protein Janus Kinase2 (Jak2), which is required for phosphorylation of ferroportin. Ferroportin is a dimer and both monomers must be capable of binding hepcidin for Jak2 to bind to ferroportin. Once Jak2 is bound to the ferroportin dimer, both ferroportin monomers must be functionally competent to activate Jak2 and for ferroportin to be phosphorylated. These results show that cooperativity between the ferroportin monomers is required for hepcidin-mediated Jak2 activation and ferroportin down-regulation. These results provide a molecular explanation for the dominant inheritance of hepcidin resistant iron overload disease.

Ferroportin (Fpn) is the only known iron exporter in vertebrate cells and plays a critical role in iron homeostasis regulating cytosolic iron levels and exporting iron to plasma. Ferroportin1 (FPN1) expression can be transcriptionally regulated by iron as well as other transition metals. Fpn can also be posttranslationally regulated by hepcidin-mediated internalization and degradation. We demonstrate that zinc and cadmium induce FPN1 transcription through the action of Metal Transcription Factor-1 (MTF-1). These transition metals induce MTF-1 translocation into the nucleus. Zinc leads to MTF-1 binding to the FPN1 promoter, while iron does not. Silencing of MTF-1 reduces FPN1 transcription in response to zinc but not in response to iron. The mouse FPN1 promoter contains 2 MTF-1 binding sites and mutation of those sites affects the zinc and cadmium-dependent expression of a FPN1 promoter reporter construct. We demonstrate that Fpn can transport zinc and can protect zinc sensitive cells from high zinc toxicity.

Sorting of endocytic ligands and receptors is critical for diverse cellular processes. The physiological significance of endosomal sorting proteins in vertebrates, however, remains largely unknown. Here we report that sorting nexin 3 (Snx3) facilitates the recycling of transferrin receptor (Tfrc) and thus is required for the proper delivery of iron to erythroid progenitors. Snx3 is highly expressed in vertebrate hematopoietic tissues. Silencing of Snx3 results in anemia and hemoglobin defects in vertebrates due to impaired transferrin (Tf)-mediated iron uptake and its accumulation in early endosomes. This impaired iron assimilation can be complemented with non-Tf iron chelates. We show that Snx3 and Vps35, a component of the retromer, interact with Tfrc to sort it to the recycling endosomes. Our findings uncover a role of Snx3 in regulating Tfrc recycling, iron homeostasis, and erythropoiesis. Thus, the identification of Snx3 provides a genetic tool for exploring erythropoiesis and disorders of iron metabolism.

ABSTRACT Human metapneumovirus (hMPV), a newly discovered paramyxovirus, has been associated with acute respiratory tract infections (ARIs) ranging from upper ARIs to severe bronchiolitis and pneumonia. Important questions remain on the contribution of hMPV to ARIs and its impact on public health. During the 2001-2002 season, we conducted a collaborative study with four provincial public health laboratories to study the prevalence of this new virus in the Canadian population. A total of 445 specimens were collected from patients of all age groups with ARIs and were tested for the presence of hMPV by reverse transcription-PCR. Of these, 66 (14.8%) tested positive for hMPV. Positive specimens were found in all age groups and in all four provinces studied. Virus activity peaked in February and March. The age range of the patients with hMPV infection was 2 months to 93 years (median age, 25 years), with similar numbers of females (35%) and males (41%). Thirty-three percent ( n = 22) of hMPV-infected patients were hospitalized; of these, 27% ( n = 6) had rhinitis and pneumonia, 23% ( n = 5) had bronchiolitis, and 9% ( n = 2) had bronchitis. The hospitalization rates were significantly higher among patients &lt;5 years of age ( P = 0.0005) and those &gt;50 years of age ( P = 0.0044) than among those 6 to 50 years of age. Phylogenetic analysis of the F gene showed that two hMPV genetic clusters were cocirculating in the 2001-2002 season, and comparison with earlier studies suggests a temporal evolutionary pattern of hMPV isolates. These results provide further evidence of the importance of hMPV in ARIs, particularly in young children and elderly individuals.

Chediak Higashi syndrome (CHS) is a rare, autosomal recessive disorder that affects multiple systems of the body. Patients with CHS exhibit hypopigmentation of the skin, eyes and hair, prolonged bleeding times, easy bruisability, recurrent infections, abnormal NK cell function and peripheral neuropathy. Morbidity results from patients succumbing to frequent bacterial infections or to an "accelerated phase" lymphoproliferation into the major organs of the body. Current treatment for the disorder is bone marrow transplant, which alleviates the immune problems and the accelerated phase, but does not inhibit the development of neurologic disorders that grow increasingly worse with age. There are several animal models of CHS, the beige mouse being the most characterized. Positional cloning and YAC complementation resulted in the identification of the Beige and CHS1/LYST genes. These genes encode a cytosolic protein of 430,000 Da. Sequence analysis identified three conserved regions in the protein: a HEAT repeat motif at the amino-terminus that contains several a helices, a BEACH domain containing the amino acid sequence WIDL, and a WD40 repeat motif, which is described as a protein-protein interaction domain. The presence of the BEACH and WD40 domains defines a family of genes that encode extremely large proteins.

Plasma membrane resealing is a Ca 2+ -dependent process that involves the exocytosis of intracellular vesicles next to the wound site. Recent studies revealed that conventional lysosomes behave as Ca 2+ -regulated secretory compartments and play a central role in membrane resealing. These findings raised the possibility that the complex pathology of lysosomal diseases might also include defects in plasma membrane repair. Here, we investigated the capacity for lysosomal exocytosis and membrane resealing of fibroblasts derived from Chediak–Higashi syndrome (CHS) patients, or from beige-J mice. By using a sensitive electroporation/fluorescence-activated cell sorter-based assay, we show that lysosomal exocytosis triggered by membrane wounding is impaired in both human Chediak–Higashi and mouse beige-J fibroblasts. Lysosomal exocytosis increased when the normal size of lysosomes was restored in beige-J cells by expression of the CHS/Beige protein. A similar effect was seen when the lysosomal enlargement in beige-J cells was reversed by treatment with E64d. In addition, the survival of Chediak–Higashi and beige-J fibroblasts after wounding was reduced, indicating that impaired lysosomal exocytosis inhibits membrane resealing in these mutant cells. Thus, the severe symptoms exhibited by CHS patients may also include defects in the ability of cells to repair plasma membrane lesions.

Chediak–Higashi Syndrome (CHS) is a rare autosomal recessive disorder characterized by severe immunologic defects including recurrent bacterial infections, impaired chemotaxis and abnormal natural killer (NK) cell function. Patients with this syndrome exhibit other symptoms such as an associated lymphoproliferative syndrome, bleeding tendencies, partial albinism and peripheral neuropathies. The classic diagnostic feature of CHS is the presence of huge lysosomes and cytoplasmic granules within cells. Similar defects are found in other mammals, the most well studied being the beige mouse and Aleutian mink. A positional cloning approach resulted in the identification of the Beige gene on chromosome 13 in mice and the CHS1/LYST gene on chromosome 1 in humans. The protein encoded by this gene is 3801 amino acids and is highly conserved throughout evolution. The identification of CHS1/Beige has defined a family of genes containing a common BEACH motif. The function of these proteins in vesicular trafficking remains unknown.

The complete nucleotide sequences of the nucleoprotein (N), phosphoprotein (P), matrix protein (M), and fusion protein (F) genes of 15 Canadian human metapneumovirus (hMPV) isolates were determined. Phylogenetic analysis revealed two distinct genetic clusters, or groups for each gene with additional sequence variability within the individual groups. Comparison of the deduced amino acid sequences for the N, M and F genes of the different isolates revealed that all three genes were well conserved with 94.1–97.6% identity between the two distinct clusters The P gene showed more diversity with 81.6–85.7% amino acid identity for isolates between the two clusters, and 94.6–100% for isolates within the same cluster.

The transporter Ccc1 imports iron into the vacuole, which is the major site of iron storage in fungi and plants. CCC1 mRNA is destabilized under low-iron conditions by the binding of Cth1 and Cth2 to the 3' untranslated region (S. Puig, E. Askeland, and D. J. Thiele, Cell 120:99-110, 2005). Here, we show that the transcription of CCC1 is stimulated by iron through a Yap consensus site in the CCC1 promoter. We identified YAP5 as being the iron-sensitive transcription factor and show that a yap5Delta strain is sensitive to high iron. Green fluorescent protein-tagged Yap5 is localized to the nucleus and occupies the CCC1 promoter independent of the iron concentration. Yap5 contains two cysteine-rich domains, and the mutation of the cysteines to alanines in each of the domains affects the transcription of CCC1 but not DNA binding. The fusion of the Yap5 cysteine-containing domains to a GAL4 DNA binding domain results in iron-sensitive GAL1-lacZ expression. Iron affects the sulfhydryl status of Yap5, which is indicative of the generation of intramolecular disulfide bonds. These results show that Yap5 is an iron-sensing transcription factor and that iron regulates transcriptional activation.

All eukaryotes require iron although iron is not readily bioavailable. Organisms expend much effort in acquiring iron and in response have evolved multiple mechanisms to acquire iron. Because iron is essential, organisms prioritize the iron use when iron is limiting; iron-sparing enzymes or metabolic pathways are utilized at the expense of iron-rich enzymes. A large percentage of cellular iron containing proteins is devoted to oxygen binding or metabolism, therefore, changes in oxygen availability affect iron usage. Transcriptional and post-transcriptional mechanisms have been shown to affect the concentration of iron-containing proteins under iron or oxygen limiting conditions. In this review, we describe how the budding yeast Saccharomyces cerevisiae utilizes multiple mechanisms to optimize iron usage under iron limiting conditions.

Abstract Ferroportin disease is caused by mutation of one allele of the iron exporter ferroportin (Fpn/IREG1/Slc40a1/MTP1). All reported human mutations are missense mutations and heterozygous null mutations in mouse Fpn do not recapitulate the human disease. Here we describe the flatiron (ffe) mouse with a missense mutation (H32R) in Fpn that affects its localization and iron export activity. Similar to human patients with classic ferroportin disease, heterozygous ffe/+ mice present with iron loading of Kupffer cells, high serum ferritin, and low transferrin saturation. In macrophages isolated from ffe/+ heterozygous mice and through the use of Fpn plasmids with the ffe mutation, we show that Fpnffe acts as a dominant negative, preventing wild-type Fpn from localizing on the cell surface and transporting iron. These results demonstrate that mutations in Fpn resulting in protein mislocalization act in a dominant-negative fashion to cause disease, and the Fpnffe mouse represents the first mouse model of ferroportin disease.

Chediak-Higashi syndrome is an autosomal recessive disorder that affects vesicle morphology. The Chs1/Lyst protein is a member of the BEige And CHediak family of proteins. The absence of Chs1/Lyst gives rise to enlarged lysosomes. Lysosome size is regulated by a balance between vesicle fusion and fission and can be reversibly altered by acidifying the cytoplasm using Acetate Ringer's or by incubating with the drug vacuolin-1. We took advantage of these procedures to determine rates of lysosome fusion and fission in the presence or absence of Chs1/Lyst. Here, we show by microscopy, flow cytometry and in vitro fusion that the absence of the Chs1/Lyst protein does not increase the rate of lysosome fusion. Rather, our data indicate that loss of this protein decreases the rate of lysosome fission. We further show that overexpression of the Chs1/Lyst protein gives rise to a faster rate of lysosome fission. These results indicate that Chs1/Lyst regulates lysosome size by affecting fission.

Atpif1, a mitochondrial ATPase inhibitor, was identified as a zebrafish anemic mutant, pinotage, providing an important link in our understanding of the relationship between mitochondrial homeostasis and haem synthesis and identifying a gene that may have a role in human iron, haem and mitochondrial diseases. Defects in haem biosynthesis in erythrocytes cause anaemia. Many of the enzymes and substrates involved in this important process are known, but it is still unclear how iron transport is regulated in the mitochondria and coordinated with haem homeostasis. Here, Barry Paw and colleagues report the cloning of mitochondrial ATPase inhibitor factor 1 (atpif1) from a zebrafish genetic screen. Atpif1 regulates ferrochelatase, the terminal enzyme in haem biosynthesis, through alteration of mitochondrial pH and redox potential in the presence of a [2Fe–2S] cluster as the iron supply. The authors show that the human orthologue of Atpif1 is vital for normal red-blood-cell differentiation, suggesting that its deficiency may contribute to human diseases such as congenital sideroblastic anaemias and other mitochondriopathies. Defects in the availability of haem substrates or the catalytic activity of the terminal enzyme in haem biosynthesis, ferrochelatase (Fech), impair haem synthesis and thus cause human congenital anaemias1,2. The interdependent functions of regulators of mitochondrial homeostasis and enzymes responsible for haem synthesis are largely unknown. To investigate this we used zebrafish genetic screens and cloned mitochondrial ATPase inhibitory factor 1 (atpif1) from a zebrafish mutant with profound anaemia, pinotage (pnt tq209 ). Here we describe a direct mechanism establishing that Atpif1 regulates the catalytic efficiency of vertebrate Fech to synthesize haem. The loss of Atpif1 impairs haemoglobin synthesis in zebrafish, mouse and human haematopoietic models as a consequence of diminished Fech activity and elevated mitochondrial pH. To understand the relationship between mitochondrial pH, redox potential, [2Fe–2S] clusters and Fech activity, we used genetic complementation studies of Fech constructs with or without [2Fe–2S] clusters in pnt, as well as pharmacological agents modulating mitochondrial pH and redox potential. The presence of [2Fe–2S] cluster renders vertebrate Fech vulnerable to perturbations in Atpif1-regulated mitochondrial pH and redox potential. Therefore, Atpif1 deficiency reduces the efficiency of vertebrate Fech to synthesize haem, resulting in anaemia. The identification of mitochondrial Atpif1 as a regulator of haem synthesis advances our understanding of the mechanisms regulating mitochondrial haem homeostasis and red blood cell development. An ATPIF1 deficiency may contribute to important human diseases, such as congenital sideroblastic anaemias and mitochondriopathies.

The facile ability of iron to gain and lose electrons has made iron an important participant in a wide variety of biochemical reactions. Binding of ligands to iron modifies its redox potential, thereby permitting iron to transfer electrons with greater or lesser facility. The ability to transfer electrons, coupled with its abundance, as iron is the fourth most abundant mineral in the earth's crust, have contributed to iron being an element required by almost all species in the six kingdoms of life. Iron became an essential element for both Eubacteria and Archeabacteria in the early oxygen-free stages of the earth's evolution. With the advent of an oxygen-rich environment, the redox properties of iron made it extremely useful, as much of iron utilization in eukaryotes is focused on oxygen metabolism, either as an oxygen carrier or as an electron carrier that can facilitate oxygen-based chemistry.

Iron storage in yeast requires the activity of the vacuolar iron transporter Ccc1. Yeast with an intact CCC1 are resistant to iron toxicity, but deletion of CCC1 renders yeast susceptible to iron toxicity. We used genetic and biochemical analysis to identify suppressors of high iron toxicity in Δccc1 cells to probe the mechanism of high iron toxicity. All genes identified as suppressors of high iron toxicity in aerobically grown Δccc1 cells encode organelle iron transporters including mitochondrial iron transporters MRS3, MRS4, and RIM2. Overexpression of MRS3 suppressed high iron toxicity by decreasing cytosolic iron through mitochondrial iron accumulation. Under anaerobic conditions, Δccc1 cells were still sensitive to high iron toxicity, but overexpression of MRS3 did not suppress iron toxicity and did not result in mitochondrial iron accumulation. We conclude that Mrs3/Mrs4 can sequester iron within mitochondria under aerobic conditions but not anaerobic conditions. We show that iron toxicity in Δccc1 cells occurred under both aerobic and anaerobic conditions. Microarray analysis showed no evidence of oxidative damage under anaerobic conditions, suggesting that iron toxicity may not be solely due to oxidative damage. Deletion of TSA1, which encodes a peroxiredoxin, exacerbated iron toxicity in Δccc1 cells under both aerobic and anaerobic conditions, suggesting a unique role for Tsa1 in iron toxicity.

Leishmania parasites infect macrophages, cells that play an important role in organismal iron homeostasis. By expressing ferroportin, a membrane protein specialized in iron export, macrophages release iron stored intracellularly into the circulation. Iron is essential for the intracellular replication of Leishmania, but how the parasites compete with the iron export function of their host cell is unknown. Here, we show that infection with Leishmania amazonensis inhibits ferroportin expression in macrophages. In a TLR4-dependent manner, infected macrophages upregulated transcription of hepcidin, a peptide hormone that triggers ferroportin degradation. Parasite replication was inhibited in hepcidin-deficient macrophages and in wild type macrophages overexpressing mutant ferroportin that is resistant to hepcidin-induced degradation. Conversely, intracellular growth was enhanced by exogenously added hepcidin, or by expression of dominant-negative ferroportin. Importantly, dominant-negative ferroportin and macrophages from flatiron mice, a mouse model for human type IV hereditary hemochromatosis, restored the infectivity of mutant parasite strains defective in iron acquisition. Thus, inhibition of ferroportin expression is a specific strategy used by L. amazonensis to inhibit iron export and promote their own intracellular growth.

Iron that is stored in macrophages as ferritin can be made bioavailable by degrading ferritin in the lysosome and releasing iron back into the cytosol. Iron stored in ferritin is found as Fe3+ and must be reduced to Fe2+ before it can be exported from the lysosome. Here we report that the lysosomal reductase Cyb561a3 (LcytB) and the endosomal reductase six-transmembrane epithelial antigen of prostate 3 (Steap3) act as lysosomal ferrireductases in the mouse macrophage cell line RAW264.7 converting Fe3+ to Fe2+ for iron recycling. We determined that when lysosomes were loaded with horse cationic ferritin, reductions or loss of LcytB or Steap3 using CRISPR/Cas9-mediated knockout technology resulted in decreased lysosomal iron export. Loss of both reductases was additive in decreasing lysosomal iron export. Decreased reductase activity resulted in increased transcripts for iron acquisition proteins DMT1 and transferrin receptor 1 (Tfrc1) suggesting that cells were iron limited. We show that transcript expression of LcytB and Steap3 is decreased in macrophages exposed to Escherichia coli pathogen UTI89, which supports a role for these reductases in regulating iron availability for pathogens. We further show that loss of LcytB and Steap3 in macrophages infected with UTI89 led to increased proliferation of intracellular UTI89 suggesting that the endolysosomal system is retaining Fe3+ that can be used for proliferation of intravesicular pathogens. Together, our findings reveal an important role for both LcytB and Steap3 in macrophage iron recycling and suggest that limiting iron recycling by decreasing expression of endolysosomal reductases is an innate immune response to protect against pathogen proliferation and sepsis.

Chediak–Higashi syndrome (CHS) is a rare autosomal recessive disorder of human, mouse ( beige ) and other mammalian species. The same genetic defect was found to result in the disease in all species identified, permitting a positional cloning approach using the mouse model beige to identify the responsible gene. The CHS gene was cloned and mutations identified in affected species. This review discusses the clinical features of CHS contrasting features seen in similar syndromes. The possible functions of the protein encoded by the CHS/beige gene are discussed, along with the alterations in cellular physiology seen in mutant cells.

We examined the function of LIP5 in mammalian cells, because the yeast homologue Vta1p was recently identified as a protein required for multivesicular body (MVB) formation. LIP5 is predominantly a cytosolic protein. Depletion of LIP5 by small inhibitory RNA (siRNA) does not affect the distribution or morphology of early endosomes, lysosomes, or Golgi but does reduce the degradation of internalized epidermal growth factor receptor (EGFR), with EGFR accumulating in intracellular vesicles. Depletion of LIP5 by siRNA also decreases human immunodeficiency virus type 1 (HIV-1) budding by 70%. We identify CHMP5 as a LIP5-binding protein and show that CHMP5 is primarily cytosolic. Depletion of CHMP5 by siRNA does not affect the distribution or morphology of early endosomes, lysosomes, or Golgi but does result in reduced degradation of the EGFR similar to silencing of LIP5. Surprisingly, CHMP5 depletion results in an increase in the release of infectious HIV-1 particles. Overexpression of CHMP5 with a large carboxyl-terminal epitope affects the distribution of both early and late endocytic compartments, whereas overexpression of LIP5 does not alter the endocytic pathway. Comparison of overexpression and siRNA phenotypes suggests that the roles of these proteins in MVB formation may be more specifically addressed using RNA interference and that both LIP5 and CHMP5 function in MVB sorting, whereas only LIP5 is required for HIV release. We examined the function of LIP5 in mammalian cells, because the yeast homologue Vta1p was recently identified as a protein required for multivesicular body (MVB) formation. LIP5 is predominantly a cytosolic protein. Depletion of LIP5 by small inhibitory RNA (siRNA) does not affect the distribution or morphology of early endosomes, lysosomes, or Golgi but does reduce the degradation of internalized epidermal growth factor receptor (EGFR), with EGFR accumulating in intracellular vesicles. Depletion of LIP5 by siRNA also decreases human immunodeficiency virus type 1 (HIV-1) budding by 70%. We identify CHMP5 as a LIP5-binding protein and show that CHMP5 is primarily cytosolic. Depletion of CHMP5 by siRNA does not affect the distribution or morphology of early endosomes, lysosomes, or Golgi but does result in reduced degradation of the EGFR similar to silencing of LIP5. Surprisingly, CHMP5 depletion results in an increase in the release of infectious HIV-1 particles. Overexpression of CHMP5 with a large carboxyl-terminal epitope affects the distribution of both early and late endocytic compartments, whereas overexpression of LIP5 does not alter the endocytic pathway. Comparison of overexpression and siRNA phenotypes suggests that the roles of these proteins in MVB formation may be more specifically addressed using RNA interference and that both LIP5 and CHMP5 function in MVB sorting, whereas only LIP5 is required for HIV release. Endosomes play a crucial role in transporting molecules from the plasma membrane to intracellular compartments as well as transporting molecules from the biosynthetic apparatus to their site of action (1Gruenberg J. Maxfield F.R. Curr. Opin. Cell Biol. 1995; 7: 552-563Crossref PubMed Scopus (554) Google Scholar, 2Clague M.J. Biochem. J. 1998; 336: 271-282Crossref PubMed Scopus (147) Google Scholar, 3Bishop N.E. Int. Rev. Cytol. 2003; 232: 1-57Crossref PubMed Scopus (41) Google Scholar). Several different endosomal compartments have been described based on morphology, constituents, and role within the endocytic apparatus. The multivesicular body (MVB) 1The abbreviations used are: MVB, multivesicular body; EGF, epidermal growth factor; EGFR, epidermal growth factor receptor; GST, glutathione S-transferase; HIV-1, human immunodeficiency virus type 1; PBS, phosphate-buffered saline; siRNA, small inhibitory RNA; VPS, vacuolar protein sorting; GFP, green fluorescent protein; HPLC, high pressure liquid chromatography; X-gal, 5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside; Tf, transferrin. is an endosomal compartment that serves to sort membrane proteins destined for degradation or routing to the lysosome (4Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1021) Google Scholar, 5Piper R.C. Luzio J.P. Traffic. 2001; 2: 612-621Crossref PubMed Scopus (164) Google Scholar, 6Raiborg C. Rusten T.E. Stenmark H. Curr. Opin. Cell Biol. 2003; 15: 446-455Crossref PubMed Scopus (408) Google Scholar). These proteins are internalized into vesicles that form by the invagination of the limiting membrane (forming intravesicular vesicles). The contents of the MVB are then transferred to lysosomes. The physiologic importance of MVBs has been shown through studies in organisms as diverse as yeast and humans (5Piper R.C. Luzio J.P. Traffic. 2001; 2: 612-621Crossref PubMed Scopus (164) Google Scholar, 7Katzmann D.J. Babst M. Emr S.D. Cell. 2001; 106: 145-155Abstract Full Text Full Text PDF PubMed Scopus (1130) Google Scholar, 8Futter C.E. Pearse A. Hewlett L.J. Hopkins C.R. J. Cell Biol. 1996; 132: 1011-1023Crossref PubMed Scopus (436) Google Scholar, 9Bishop N. Woodman P. Mol. Biol. Cell. 2000; 11: 227-239Crossref PubMed Scopus (214) Google Scholar, 10Pornillos O. Garrus J.E. Sundquist W.I. Trends Cell Biol. 2002; 12: 569-579Abstract Full Text Full Text PDF PubMed Scopus (240) Google Scholar, 11Morita E. Sundquist W.I. Annu. Rev. Cell Dev. Biol. 2004; PubMed Google Scholar). In yeast, the role of the MVB has been defined through the identification of mutations that alter protein sorting through the MVB (12Raymond C.K. Howald-Stevenson I. Vater C.A. Stevens T.H. Mol. Biol. Cell. 1992; 3: 1389-1402Crossref PubMed Scopus (680) Google Scholar). A specific class of sorting mutants, class E vacuolar protein sorting (VPS) mutations, results in the accumulation of transport cargo in a prevacuolar compartment and a selective deficit in the delivery of that cargo to vacuoles (7Katzmann D.J. Babst M. Emr S.D. Cell. 2001; 106: 145-155Abstract Full Text Full Text PDF PubMed Scopus (1130) Google Scholar, 13Odorizzi G. Babst M. Emr S.D. Cell. 1998; 95: 847-858Abstract Full Text Full Text PDF PubMed Scopus (554) Google Scholar, 14Bilodeau P.S. Urbanowski J.L. Winistorfer S.C. Piper R.C. Nat. Cell Biol. 2002; 4: 534-539Crossref PubMed Scopus (280) Google Scholar, 15Babst M. Katzmann D.J. Estepa-Sabal E.J. Meerloo T. Emr S.D. Dev. Cell. 2002; 3: 271-282Abstract Full Text Full Text PDF PubMed Scopus (693) Google Scholar, 16Babst M. Katzmann D.J. Snyder W.B. Wendland B. Emr S.D. Dev. Cell. 2002; 3: 283-289Abstract Full Text Full Text PDF PubMed Scopus (526) Google Scholar). The class E phenotype is described as an enlarged late endosomal compartment, which presumably arises because of an inability to invaginate the limiting membrane that would normally form the MVB. In higher eukaryotes, studies on the internalization and degradation of growth factor receptors as well as studies on viral budding have helped to elucidate the importance of MVBs, because many enveloped RNA viruses utilize components of the MVB to bud from cells (8Futter C.E. Pearse A. Hewlett L.J. Hopkins C.R. J. Cell Biol. 1996; 132: 1011-1023Crossref PubMed Scopus (436) Google Scholar, 11Morita E. Sundquist W.I. Annu. Rev. Cell Dev. Biol. 2004; PubMed Google Scholar). Recently, Vta1p was shown to play a role in MVB sorting in Saccharomyces cerevisiae, and it was shown that Vta1p interacts with Vps4p (17Yeo S.C. Xu L. Ren J. Boulton V.J. Wagle M.D. Liu C. Ren G. Wong P. Zahn R. Sasajala P. Yang H. Piper R.C. Munn A.L. J. Cell Sci. 2003; 116: 3957-3970Crossref PubMed Scopus (82) Google Scholar, 18Shiflett S.L. Ward D.M. Huynh D. Vaughn M.B. Simmons J.C. Kaplan J. J. Biol. Chem. 2004; 279: 10982-10990Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). Analysis of mammalian Vps4p/SKD1-interacting proteins identified a protein, SBP1 (19Fujita H. Umezuki Y. Imamura K. Ishikawa D. Uchimura S. Nara A. Yoshimori T. Hayashizaki Y. Kawai J. Ishidoh K. Tanaka Y. Himeno M. J. Cell Sci. 2004; 117: 2997-3009Crossref PubMed Scopus (41) Google Scholar). Examination of genomic data bases showed that SBP1 (or the data base gene name DRG-1) was homologous to Vta1p, with most of the homology in the carboxyl terminus of the reported sequence. A yeast two-hybrid screen identified LIP5 as a protein that interacted with CHS1/Lyst (20Tchernev V.T. Mansfield T.A. Giot L. Kumar A.M. Nandabalan K. Li Y. Mishra V.S. Detter J.C. Rothberg J.M. Wallace M.R. Southwick F.S. Kingsmore S.F. Mol. Med. 2002; 8: 56-64Crossref PubMed Google Scholar). LIP5 and DRG-1 are identical with the exception that the carboxyl terminus of LIP5 is distinct from that of DRG-1. Our sequencing of LIP5 cDNA is in accord with the suggestion of Fujita et al. (19Fujita H. Umezuki Y. Imamura K. Ishikawa D. Uchimura S. Nara A. Yoshimori T. Hayashizaki Y. Kawai J. Ishidoh K. Tanaka Y. Himeno M. J. Cell Sci. 2004; 117: 2997-3009Crossref PubMed Scopus (41) Google Scholar) that LIP5 is, in fact, the same as DRG-1. The sequence of LIP5/DRG-1 is homologous to Vta1p; the two proteins show 20.2% identity and 48.9% similarity. In this paper we demonstrate that LIP5 is homologous to Vta1p and like Vta1p functions in MVB sorting. Depletion of LIP5 by siRNA reduces the degradation of epidermal growth factor receptor (EGFR) and reduces HIV-1 budding. We further show that LIP5 specifically interacts with CHMP5/Hspc177, the homologue of the S. cerevisiae class E protein Vps60p (21Kranz A. Kinner A. Kolling R. Mol. Biol. Cell. 2001; 12: 711-723Crossref PubMed Scopus (61) Google Scholar). Depletion of CHMP5 by RNA interference alters the degradation of EGFR, but in contrast to LIP5, CHMP5 silencing leads to an increase in HIV particle release. Finally, we show that there are marked differences on the behavior of the endocytic apparatus in cells depleted for CHMP5 compared with cells in which CHMP5 with a large epitope is overexpressed. Cells and Reagents—HeLa cells, fibroblasts, HEK293T cells, and Cos-7 cells were maintained in Dulbecco's minimal essential medium (Invitrogen) supplemented with 10% fetal bovine serum (Hyclone, Logan, UT). Alexa 594-dextran, Alexa 594-transferrin, Alexa 594-phallodin, and epidermal growth factor (EGF) were purchased from Molecular Probes (Eugene, OR). Constructs—LIP5 and CHMP5 were PCR-amplified from I.M.A.G.E. Consortium clone 3961637 and GST-CHMP5 fusion clone (22von Schwedler U.K. Stuchell M. Muller B. Ward D.M. Chung H.Y. Morita E. Wang H.E. Davis T. He G.P. Cimbora D.M. Scott A. Krausslich H.G. Kaplan J. Morham S.G. Sundquist W.I. Cell. 2003; 114: 701-713Abstract Full Text Full Text PDF PubMed Scopus (697) Google Scholar) using primers listed in Table I. Sequencing of LIP5 cDNA indicated that the published sequence was incorrect. We suggested that the published sequence is incorrect because of a frameshift at position +263 resulting in an early stop codon. The I.M.A.G.E. Consortium cDNA encodes a larger protein of 307 amino acids. PCR products were cloned into either pEGFP (C1) or pDsRed (N1) (Clontech, Palo Alto, CA). LIP5-FLAG was PCR-amplified from the same I.M.A.G.E. Consortium clone and cloned into pcDNA 3.1(-) (Invitrogen). CHMP5-FLAG, CHMP4B-FLAG, and CHMP2A-FLAG were PCR-amplified from GST-CHMP fusion constructs and subsequently cloned into pcDNA 3.1(-) (Invitrogen). CHMP4B-DsRed, CHMP2A-DsRed, SKD1-DsRed, and SKD1(E235Q)-DsRed were generated as described previously (22von Schwedler U.K. Stuchell M. Muller B. Ward D.M. Chung H.Y. Morita E. Wang H.E. Davis T. He G.P. Cimbora D.M. Scott A. Krausslich H.G. Kaplan J. Morham S.G. Sundquist W.I. Cell. 2003; 114: 701-713Abstract Full Text Full Text PDF PubMed Scopus (697) Google Scholar). All other primers used in generating constructs are listed in Table I. All of the clone sequences were verified at the University of Utah Cores Sequencing Facility.Table IDNA and RNA oligonucleotides used in this studyNameSequenceDNA oligonucleotidesLIP5FpETCCGCTCGAGATGGCCGCGCTTGCACCGCLIP5RpETCGGGATCCCTATCATTCTCTGCCTGTCGTCAGLIP5FGAAGATCTATGGCCGCGCTTGCACCGCLIP5RFLAGGGGGTACCTACTACTTGTCATCGTCATCCTTGTAATCGCCGCCTTCTCTGACTGTCGTCAGChmp2FCGGAATTCATGGACCTATTGTTCGGChmp2RFLAGCGGGATCCCTACTACTTGTCATCGTCATCCTTGTAATCGCCGCCGTCCCTCCGCAGGTTCTTAChmp4FCGGAATTCATGAGTGGTCTCGGCChmp4RFLAGCGGGATCCCTACTACTTGTCATCGTCATCCTTGTAATCGCCGCCGGATACCCACTCAGCCAAChmp5FGGAATTCATGAACCGACTCTTCGGChmp5RCGGGATCCCCTGAAGCAGGGATCTGTGGCChmp5RFLAGCGGGATCCTACTACTTGTCATCGTCATCCTTGTAATCGCCGCCTGAAGCAGGGATCTGTGGCRNA oligosL5/D-006663-01GAATGAAGATCGATAGTAAL5/D-006663-02GCACAGGTGTAGCAAGTAAL5/D-006663-03GGAGAATTATGCTTTGAAAL5/D-006663-04GCAGTGCTTTGCAGTATGAC5/D-004697-01CAGAAAGCCTTGCGAGTTTC5/D-004697-02GAATTTGGATTGCCACAGAC5/D-004697-03GAAGGTGTTCCCACTGATAC5/D-004697-04GAGAGGGTCCTGCAAAGAAR/D-001206-13Dharmacon control RNA (pool of 4) Open table in a new tab Antibody Production—LIP5 was cloned into pET-16 (Stratagene, La Jolla, CA) and expressed as a LIP5-HIS fusion protein in Escherichia coli as per the manufacturer's instructions. LIP5 protein was purified on nickel-nitrilotriacetic acid columns (Qiagen). CHMP5 was cloned into pGEX-2T (Amersham Biosciences), expressed in E. coli as a CHMP5-GST fusion protein and purified without the GST as per the manufacturer's instructions. Purified LIP5 or CHMP5 proteins were emulsified with Freund's complete adjuvant (Sigma) and injected into host animals. Following subsequent immunizations with recombinant protein, serum was obtained and tested for immunoreactivity by Western analysis. Transient Transfections and Western Analysis—Cos-7, HeLa, and wild type fibroblast cells were plated onto tissue culture plates and allowed to grow for 24–48 h to 50–80% confluence. The cells were transfected with various constructs using GeneJammer (Stratagene) according to the manufacturer's directions. Protein expression was determined by solubilizing 2–4 × 106 cells in 1.0% Triton X-100 with phosphate buffered saline (PBS) plus 1× protease inhibitor mixture (Roche Applied Science) and 1.0 mm phenylmethylsulfonyl fluoride (Sigma), and the samples were analyzed by SDS-PAGE and Western blotting. To analyze membranes, Cos-7 cells were homogenized using a ball-bearing homogenizer. A post-nuclear supernatant was obtained from an 800 × g, 5-min centrifugation, and membrane and cytosolic fractions were obtained by centrifugation at 16,000 × g for 30 min. The samples were solubilized in 1.0% Triton X-100, and protein determinations were performed to normalize for protein using a BCA assay (Pierce) and 25 μg of protein/sample loaded onto SDS-PAGE gels. The proteins were transferred to nitrocellulose and probed with a 1:10,000 dilution of mouse anti-FLAG antibody (M2; Sigma) or mouse anti-GFP antibody (Covance, Berkeley, CA) followed by incubation in a 1:12,500 dilution of peroxidase-conjugated goat anti-mouse IgG (Jackson ImmunoResearch, West Grove, PA). Rabbit anti-LIP5 and rabbit anti-CHMP5 were used at a concentration of 1:500 followed by a peroxidase-conjugated goat anti-rabbit IgG (1:5000) (Jackson ImmunoResearch). The blots were developed using Western Lightning reagent (PerkinElmer Life Sciences). Fluorescence Microscopy—Transiently transfected Cos-7 cells, HeLa cells, or mouse fibroblasts expressing GFP or DsRed epitope-tagged proteins were imaged live using an epifluorescence Olympus microscope with a 100× oil immersion objective. The cells expressing GFP or DsRed epitope-tagged proteins were fixed using 3.7% formaldehyde with PBS, 2.0% paraformaldehyde, or -20 °C methanol. The cells were permeabilized in either 0.1% saponin with PBS or 0.2% Triton X-100, 1.0% bovine serum albumin and stained for either Lamp2 (1:200) (H4B4 or GL2A7 Developmental Hybridoma, Iowa City, IA), EGFR (1:200; NeoMarkers, Fremont CA), p230 (BD Bioscience, San Jose, CA), or mannose-6 phosphate receptor (1:1000, a gift from Dr. Peter Lobel). For detection of FLAG-tagged proteins, mouse anti-FLAG (Sigma) was used at a dilution of 1:750. The secondary antibodies included Alexa 488-conjugated goat anti-mouse IgG (1:750), Alexa 594-conjugated goat anti-mouse IgG (1:750), Alexa 647-conjugated goat-anti mouse IgG (1:750), Alexa 488-conjugated goat anti-rabbit IgG (1:750), and Alexa 594-conjugated goat anti-rabbit IgG (1:750) (Molecular Probes, Eugene, OR) diluted in 0.1% saponin with PBS and bovine serum albumin. The cells were visualized using an epifluorescence microscope (Olympus Inc., Melville, NY) with a 100× oil immersion objective. The images were acquired using Magnafire analysis software. For confocal microscopy, the images were collected at single wavelengths on an Olympus FVX confocal fluorescence microscope with a 60× Pianapo objective (1.4 numerical aperture oil) using Fluoview 2.0.39 software. Affinity Purification—Transfected cells were washed and scraped into PBS with 1× protease inhibitor cocktail and 1.0 mm phenylmethylsulfonyl fluoride and pelleted at 1,000 × g for 5 min. The cells were solubilized using 1.0% Triton X-100 with PBS plus 1× protease inhibitor cocktail plus 1.0 mm phenylmethylsulfonyl fluoride at 4 °C. The supernatants were obtained, and each supernatant was added to 100 μl of anti-FLAG (M2) agarose beads and rocked at 4 °C overnight. The beads were pelleted and washed 10 times with PBS. The beads were eluted three times with 1.0 mg/ml FLAG peptide and then eluted twice with 0.1 m glycine, pH 2.5. For Western analysis, the samples were run on 10% SDS-PAGE, transferred to nitrocellulose, and probed for proteins of interest. Mass Spectrometric Analysis of Proteins—For mass spectrometry analysis, the samples were separated on 10% SDS-PAGE and stained by Coomassie Blue. Bands of interest were excised and analyzed by the University of Utah Mass Spectrometry Core Facility. Each excised protein gel band was transferred to a 1.5-ml tube and destained. In-gel digestion was then performed by adding 100 mm ammonium bicarbonate containing modified trypsin (Promega, Madison, WI) at a 1:50 enzyme:substrate ratio and incubated at 37 °C overnight. Tryptic peptides were extracted twice in 100 μl extraction buffer (0.1% trifluoro-acetic acid, 50% acetonitrile, pH 2.5). Two extracted peptide solutions were combined and dried in a Speed-Vac device. Analysis was carried out using a Simadzu HPLC system interfaced to a Finnigan LCQ Deca ion trap mass spectrometer (Finnigan MAT, San Jose, CA) with electrospray ionization. Each tryptic peptide sample was reconstituted in 10 μl of 5% acetonitrile, 0.1% formic acid and was injected onto an HPLC column (Thermo Hypersil-Keystone, Bellefonte, PA; 100 × 0.32 mm, 5-μm particle size). A 53-min gradient of 10–80% solvent B (solvent A was 05% acetonitrile, 0.1% formic acid; solvent B was 80% acetonitrile, 0.1% formic acid) was selected for separation of peptides. The spectra were acquired in automated triple play mode for recording of mass and mass spectrometry/mass spectrometry data. The scan range for mass spectrometry mode was set at m/z 400–1800. Automated analysis of peptide tandem mass spectra was performed with SE-QUEST/MASCOT computer algorithms for protein identification. RNA Interference—siRNA pools matching selected regions of LIP5 and CHMP5 cDNA sequences and a random sequence pool were purchased from Dharmacon Research (Lafayette, CO). Individual RNA oligonucleotide sequences are listed in Table I. siRNA for TSG101 was as described (23Garrus J.E. von Schwedler U.K. Pornillos O.W. Morham S.G. Zavitz K.H. Wang H.E. Wettstein D.A. Stray K.M. Cote M. Rich R.L. Myszka D.G. Sundquist W.I. Cell. 2001; 107: 55-65Abstract Full Text Full Text PDF PubMed Scopus (1161) Google Scholar). Transfections were performed on HeLa cells or 293T plated at 50% confluence using OligofectAMINE reagent (Invitrogen) with siRNA pools at a final concentration of 100 nm. Twenty-four hours post-transfection, the cells were trypsinized and plated onto 100-mm plates. Forty-eight hours later the cells were either processed for immunofluorescence microscopy or solubilized in 1.0% Triton, PBS, protease inhibitor cocktail with phenylmethylsulfonyl fluoride followed by SDS-PAGE and Western analysis probing for either LIP5, CHMP5, TSG101, or EGFR. Viral Replication Assays—Human 293T cells in 6-well plates were transfected twice at 24-h intervals with 1.33 μg of siRNA using Lipofectamine 2000 (Invitrogen) as described previously (23Garrus J.E. von Schwedler U.K. Pornillos O.W. Morham S.G. Zavitz K.H. Wang H.E. Wettstein D.A. Stray K.M. Cote M. Rich R.L. Myszka D.G. Sundquist W.I. Cell. 2001; 107: 55-65Abstract Full Text Full Text PDF PubMed Scopus (1161) Google Scholar). The cells were cotransfected with an HIV-1 vector system comprising the following plasmids: 0.38 μg of pCMVΔR8.2 (24Naldini L. Blomer U. Gage F.H. Trono D. Verma I.M. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11382-11388Crossref PubMed Scopus (1272) Google Scholar), 0.12 μg of pRSV-Rev (25Dull T. Zufferey R. Kelly M. Mandel R.J. Nguyen M. Trono D. Naldini L. J. Virol. 1998; 72: 8463-8471Crossref PubMed Google Scholar), 0.12 μg of pMD.G (26Ory D.S. Neugeboren B.A. Mulligan R.C. Proc. Natl. Acad. Sci. U. S. A. 1996; 93: 11400-11406Crossref PubMed Scopus (801) Google Scholar), and 0.38 μg of pWPTS-nlsLacZ (www.tronolab.unige.ch) during the second transfection. Supernatants containing virions were harvested 48 h after the second transfection, and the cells were harvested at the same time for Western blot analyses. To measure titers, virus particles were diluted 1:100 in Dulbecco's minimal essential medium containing 10% fetal calf serum, l-glutamine, and 20 μg/ml DEAE-dextran, and infectivity was assayed by transducing human HeLa-M cells with the diluted vector in 96-well plates. After 24 h, the cells were fixed with 0.5% glutaraldehyde, washed twice with PBS, and stained with an X-gal staining solution containing 4 mm potassium ferrocyanide, 4 mm potassium ferricyanide, 2 mm MgCl2, and 0.4 mg/ml X-gal. For Western analysis the following primary antibodies were used: rabbit anti-HIV CA antibody from Hans-Georg Krausslich (Heidelberg, Germany; at 1:4000), rabbit anti-HIV MA from Didier Trono (Geneva, Switzerland; at 1:40,000), and murine monoclonal anti-TSG101–4A10 from GeneTex, Inc. (San Antonio, TX; at 1:1000). Characterization and Subcellular Distribution of LIP5—To examine the role of LIP5 in membrane trafficking in mammalian cells, we generated a polyclonal antibody directed against a bacterially expressed LIP5. The specificity of the LIP5 antibody was examined by SDS-PAGE and Western analysis. The antiserum detected recombinant LIP5 protein, and this interaction could be blocked by preincubation of anti-LIP5 antiserum with recombinant LIP5 (Fig. 1A). LIP5 has a predicted molecular mass of 34 kDa, but the recombinant protein showed an apparent molecular mass of 39 kDa on SDS-PAGE. The yeast LIP5 homologue, Vta1p, also migrates more slowly than predicted by its sequence (18Shiflett S.L. Ward D.M. Huynh D. Vaughn M.B. Simmons J.C. Kaplan J. J. Biol. Chem. 2004; 279: 10982-10990Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). To determine the subcellular location of LIP5 in vivo, Cos-7 cells were homogenized, a membrane fraction was obtained, and both membrane and cytosolic fractions were examined by SDS-PAGE and Western analysis. The LIP5 antibody detected two bands: a membrane bound protein of ∼65 kDa and a soluble protein of 39 kDa (Fig. 1B). To determine which band represented LIP5, we preabsorbed the anti-LIP5 antiserum with bacterially expressed recombinant LIP5. Only the 39-kDa band was not detected when the antibody was pretreated with recombinant LIP5; therefore, we believe that the larger band is a nonspecific protein detected by the rabbit antiserum. Although the antibody was able to detect LIP5 by Western analysis, it was unable to detect LIP5 by either immunofluorescence or immunoprecipitation. To characterize LIP5 further, we cloned the LIP5 cDNA into expression vectors with an amino-terminal GFP or a carboxyl-terminal FLAG epitope. The constructs were transiently expressed in Cos-7 cells or HeLa cells. Examination by fluorescence microscopy (Fig. 1C) and Western analysis (Fig. 1D) showed that overexpressed GFP-LIP5 or LIP5-FLAG (data not shown) was cytosolic. LIP5-GFP has a predicted molecular mass of 61 kDa but showed a slightly higher molecular mass when analyzed by SDS-PAGE. Overexpression of LIP5-GFP or LIP5-FLAG did not affect membrane trafficking in the endocytic or secretory pathways, as determined by localization of organelle specific markers including Alexa 594-Tf, Alexa 594-EGF, p230 (trans-Golgi marker),and Lamp2 (late endosome/lysosomal marker) (Fig. 2A). Similar results were observed for Tf receptor and EGFR (data not shown). The distribution of a fluid phase marker, Texas Red dextran, which is found in endosomes and lysosomes, was unaffected upon overexpression of GFP-LIP5 (Fig. 2B). Decreased expression of LIP5, however, revealed a role for LIP5 in MVB trafficking. Decreased expression of LIP5 was accomplished by transfecting HeLa cells with siRNA pools directed against LIP5. No loss of LIP5 protein was seen in cells transfected with a random siRNA pool (Fig. 3A) or siRNA directed against Lamin (data not shown). The average reduction in LIP5, as determined by Western analysis, was ∼85% (n > 10). The cells transfected with siRNA against LIP5 showed no alteration in the distribution of Alexa 594-Tf or Lamp2 (Fig. 3B). The yeast homologue of LIP5, Vta1p, plays a role in MVB formation, and deletion of VTA1 results in a marked decrease in the degradation of internalized plasma membrane proteins (17Yeo S.C. Xu L. Ren J. Boulton V.J. Wagle M.D. Liu C. Ren G. Wong P. Zahn R. Sasajala P. Yang H. Piper R.C. Munn A.L. J. Cell Sci. 2003; 116: 3957-3970Crossref PubMed Scopus (82) Google Scholar, 18Shiflett S.L. Ward D.M. Huynh D. Vaughn M.B. Simmons J.C. Kaplan J. J. Biol. Chem. 2004; 279: 10982-10990Abstract Full Text Full Text PDF PubMed Scopus (62) Google Scholar). To test whether the loss of LIP5 affects the degradation of plasma membrane proteins in mammalian cells, we examined the effect of LIP5 silencing on the internalization and degradation of EGFR. In control cells, either untransfected cells or cells transfected with a random siRNA pool, the addition of EGF resulted in the rapid degradation of EGFR (Fig. 3C). In contrast, the addition of EGF to LIP5 siRNA-treated cells led to decreased degradation with a 2-fold change in EGFR half-life. The addition of nonspecific RNA interference oligonucleotides had no effect on the rate of EGFR degradation. A change in EGFR degradation could reflect a decrease in proteolysis or a decrease in internalization of receptor from the cell surface. To distinguish between these possibilities we examined cells for EGFR distribution by immunofluorescence. EGFR is found predominantly on the cell surface (Fig. 3D). The addition of EGF to control cells or cells transfected with a random siRNA pool resulted in the disappearance of cell surface EGFR and a marked reduction in immunofluorescence throughout the cell. In cells depleted of LIP5, the addition of EGF resulted in the disappearance of EGFR from the cell surface and the accumulation of EGFR in large intracellular vesicles. The increased accumulation of EGFR was observed in 53% (n = 37/70) of the cells silenced for LIP5. Incubation with EGF did not affect transferrin receptor or Lamp2 distribution in LIP5 silenced cells (data not shown). These results demonstrate that LIP5 is involved in the sorting and down-regulation of the EGFR. In the absence of LIP5, the degradation of EGFR is reduced, and EGFR accumulates in intracellular vesicles. LIP5 Interacts with CHMP5—To determine whether LIP5 interacts with other proteins, we expressed GFP-LIP5-FLAG in Cos-7 cells, solubilized cells with detergent, and affinity-purified LIP5 using anti-FLAG beads followed by elution with FLAG peptide. SDS-PAGE/Coomassie analysis of the eluate revealed two bands, overexpressed GFP-LIP5-FLAG, and a second protein of ∼27 kDa (Fig. 4A), which was identified by mass spectrometry as Hspc177/CHMP5 (n = 3). This protein belongs to a family of small coiled-coil proteins (21Kranz A. Kinner A. Kolling R. Mol. Biol. Cell. 2001; 12: 711-723Crossref PubMed Scopus (61) Google Scholar). The S. cerevisiae homologue of CHMP5 is Vps60p, a class E Vps protein whose precise role in MVB formation has not been defined (4Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1021) Google Scholar). We generated a rabbit polyclonal antibody to bacterially expressed CHMP5. The antibody detected two prominent bands in bacterial lysates expressing GST-CHMP5, but a 27-kDa band was dramatically diminished when the antibody was preabsorbed with purified recombinant CHMP5 (Fig. 4B). Based on these data and silencing data discussed below, we conclude that the 27-kDa protein is CHMP5. Subcellular fractionation followed by Western analysis showed CHMP5 to be primarily cytosolic (Fig. 4C). The CHMP5 antibody did not work for immunofluorescence or immunoprecipitation. To examine CHMP5 localization in vivo, we generated a CHMP5 protein with either a carboxyl-terminal GFP or DsRed. CHMP5-DsRed or CHMP5-GFP was found on vesicles near the nucleus (Fig. 4D). Coexpression of CHMP5-DsRed and LIP5-GFP resulted in LIP5-GFP, a cytosolic protein, now associating with the CHMP5-DsRed vesicles. There are 10 mammalian CHMP proteins that exhibit a series of common features including a predicted coiled-coil motif. It is therefore possible that other CHMP proteins interact with LIP5 through conserved sequence or structural elements. To test this possibility, we generated FLAG-tagged CHMP2A, CHMP4B, and CHMP5 constructs, transfected the constructs into Cos-7 cells, purified the FLAG-tagged CHMP proteins using FLAG affinity resin,

Chlamydiae are obligate intracellular parasites which multiply within infected cells in a membrane-bound structure termed an inclusion. Newly internalized bacteria are surrounded by host plasma membrane; however, the source of membrane for the expansion of the inclusion is unknown. To determine if the membrane for the mature inclusion was derived by fusion with cellular organelles, we stained infected cells with fluorescent or electron-dense markers specific for organelles and examined inclusions for those markers. We observed no evidence for the presence of endoplasmic reticulum, Golgi, late endosomal, or lysosomal proteins in the inclusion. These data suggest that the expansion of the inclusion membrane, beginning 24 h postinoculation, does not occur by the addition of host proteins resulting from either de novo host synthesis or by fusion with preexisting membranes. To determine the source of the expanding inclusion membrane, antibodies were produced against isolated membranes from Chlamydia-infected mouse cells. The antibodies were demonstrated to be solely against Chlamydia-specified proteins by both immunoprecipitation of [35S]methionine-labeled extracts and Western blotting (immunoblotting). Techniques were used to semipermeabilize Chlamydia-infected cells without disrupting the permeability of the inclusion, allowing antibodies access to the outer surface of the inclusion membrane. Immunofluorescent staining demonstrated a ring-like fluorescence around inclusions in semipermeabilized cells, whereas Triton X-100-permeabilized cells showed staining throughout the inclusion. These studies demonstrate that the inclusion membrane is made up, in part, of Chlamydia-specified proteins and not of existing host membrane proteins.

Saccharomyces cerevisiae transcriptionally regulates the expression of the plasma membrane high affinity iron transport system in response to iron need. This transport system is comprised of the products of the FET3 and FTR1 genes. We show that Fet3p and Ftr1p are post-translationally regulated by iron. Incubation of cells in high iron leads to the internalization and degradation of both Fet3p and Ftr1p. Yeast strains defective in endocytosis (Δend4) show a reduced iron-induced loss of Fet3p-Ftr1p. In cells with a deletion in the vacuolar protease PEP4, high iron medium leads to the accumulation of Fet3p and Ftr1p in the vacuole. Iron-induced degradation of Fet3p-Ftr1p is significantly reduced in strains containing a deletion of a gene, VTA1, which is involved in multivesicular body (MVB) sorting in yeast. Sorting through the MVB can involve ubiquitination. We demonstrate that Ftr1p is ubiquitinated, whereas Fet3p is not ubiquitinated. Iron-induced internalization and degradation of Fet3p-Ftr1p occurs in a mutant strain of the E3 ubiquitin ligase RSP5 (rsp5-1), suggesting that Rsp5p is not required. Internalization of Fet3p-Ftr1p is specific for iron and requires both an active Fet3p and Ftr1p, indicating that it is the transport of iron through the iron permease Ftr1p that is responsible for the internalization and degradation of the Fet3p-Ftr1p complex. Saccharomyces cerevisiae transcriptionally regulates the expression of the plasma membrane high affinity iron transport system in response to iron need. This transport system is comprised of the products of the FET3 and FTR1 genes. We show that Fet3p and Ftr1p are post-translationally regulated by iron. Incubation of cells in high iron leads to the internalization and degradation of both Fet3p and Ftr1p. Yeast strains defective in endocytosis (Δend4) show a reduced iron-induced loss of Fet3p-Ftr1p. In cells with a deletion in the vacuolar protease PEP4, high iron medium leads to the accumulation of Fet3p and Ftr1p in the vacuole. Iron-induced degradation of Fet3p-Ftr1p is significantly reduced in strains containing a deletion of a gene, VTA1, which is involved in multivesicular body (MVB) sorting in yeast. Sorting through the MVB can involve ubiquitination. We demonstrate that Ftr1p is ubiquitinated, whereas Fet3p is not ubiquitinated. Iron-induced internalization and degradation of Fet3p-Ftr1p occurs in a mutant strain of the E3 ubiquitin ligase RSP5 (rsp5-1), suggesting that Rsp5p is not required. Internalization of Fet3p-Ftr1p is specific for iron and requires both an active Fet3p and Ftr1p, indicating that it is the transport of iron through the iron permease Ftr1p that is responsible for the internalization and degradation of the Fet3p-Ftr1p complex. Transition metals are essential for life, yet transition metals in high concentrations can be toxic. Both eukaryotes and prokaryotes tightly regulate the concentration of free intracellular metals by either regulating metal uptake or sequestration. High affinity iron transport in the budding yeast Saccharomyces cerevisiae requires the expression of two cell surface proteins, the multicopper oxidase Fet3p and the transmembrane permease Ftr1p (1Askwith C.C. de Silva D. Kaplan J. Mol. Microbiol. 1996; 20: 27-34Crossref PubMed Scopus (103) Google Scholar, 2Stearman R. Yuan D.S. Yamaguchi-Iwai Y. Klausner R.D. Dancis A. Science. 1996; 271: 1552-1557Crossref PubMed Scopus (584) Google Scholar). Transcription of these genes, as well as genes that encode proteins required for the processing of Fet3p, is regulated by the iron sensing transcription factor Aft1p (3Yamaguchi-Iwai Y. Dancis A. Klausner R.D. EMBO J. 1995; 14: 1231-1239Crossref PubMed Scopus (318) Google Scholar). In S. cerevisiae transporters for the transition metals copper and zinc are regulated post-translationally. High levels of zinc induce the internalization and vacuolar degradation of Zrt1p, the high affinity zinc transporter (4Gitan R.S. Luo H. Rodgers J. Broderius M. Eide D. J. Biol. Chem. 1998; 273: 28617-28624Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar). High levels of copper induce the degradation of Ctr1p, the high affinity copper transporter, whereas Ctr3p, another high affinity copper transporter, is not affected (5Ooi C.E. Rabinovich E. Dancis A. Bonifacino J.S. Klausner R.D. EMBO J. 1996; 15: 3515-3523Crossref PubMed Scopus (180) Google Scholar). A previous study from our laboratory suggested that regulation of the high affinity iron transport system was predominantly transcriptional (6Eide D. Davis-Kaplan S. Jordan I. Sipe D. Kaplan J. J. Biol. Chem. 1992; 267: 20774-20781Abstract Full Text PDF PubMed Google Scholar), although there is evidence that the activity of the iron transport system may be regulated by cAMP (7Lesuisse E. Horion B. Labbe P. Hilger F. Biochem. J. 1991; 280: 545-548Crossref PubMed Scopus (29) Google Scholar). Studies in Schizosaccharomyces pombe, however, suggested that the multicopper oxidase-based high affinity iron transport system might be regulated post-translationally. Incubation of S. pombe, expressing the high affinity transport system, with high concentrations of iron led to a rapid inhibition of iron transport (8Askwith C. Kaplan J. J. Biol. Chem. 1997; 272: 401-405Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). High levels of iron transport activity are seen when FET3/FTR1 are expressed using the iron-independent GAL10 promoter. There is a 50% reduction in transport activity when such cells are incubated in high iron as opposed to low iron medium (8Askwith C. Kaplan J. J. Biol. Chem. 1997; 272: 401-405Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). Based on these observations, we re-examined whether the Fet3p-Ftr1p transport system is post-translationally regulated. We demonstrate that high levels of iron induce the internalization and degradation of the Fet3p-Ftr1p transport system. Strains and Media—The S. cerevisiae strains used in this study are listed in Table I. The cells were grown in either medium containing yeast extract-peptone-dextrose (YPD) 1The abbreviations used are: YPD, yeast extract-peptone-dextrose; BPS, bathophenanthroline disulfonate; CM, complete media; GFP, green fluorescent protein; CFP, cyan fluorescent protein. or yeast nitrogen base synthetic complete medium (CM) with supplements as needed (9Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (590) Google Scholar). Low iron growth medium was made by adding 40 or 80 μm bathophenanthroline disulfonate (BPS), an iron chelator, to CM or YPD and then adding back varying amounts of FeSO4 (9Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (590) Google Scholar). Low iron medium used in this work is referred to as BPS (x), in which the media contains BPS and x equals the concentration in micromolar of added FeSO4.Table IStrains used in this studyStrainGenotypeRef.DY150MATa ade2, can1, his3, leu2, trp1, ura3(9Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (590) Google Scholar)DY1457MATα ade6, can1, his3, leu2, trp1, ura3(9Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (590) Google Scholar)DY150 (FET3-GFP)DY150, FET3-GFP::KanMXThis studyDY1457 (FTR1-CFP)DY1457, FTR1-CFP::KanMXThis studyΔend4DY150, Δend4::LEU2(37Li L. Chen O.S. McVey Ward D. Kaplan J. J. Biol. Chem. 2001; 276: 29515-29519Abstract Full Text Full Text PDF PubMed Scopus (280) Google Scholar)Δftr1 (42C)MAT a ade2, his3, leu2, lys2, trp1, Δftr1::TRP1This studyΔftr1 42C (FET3-GFP)Δftr1 (42C) FET3GFP::KanMX(38Spizzo T. Byersdorfer C. Duesterhoeft S. Eide D. Mol. Gen. Genet. 1997; 256: 547-556PubMed Google Scholar)Δpep4MATa ade2, can1, his3, leu2, trp1, ura3, Δpep4::URA3This studyΔpep4Δfet3MATa ade2, can1, his3, leu2, trp1, ura3, Δpep4::URA3, Δfet3:KanMXThis studyΔgef1MATα ade6, can1, his3, leu2, trp1, ura3(14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar)BY4742MATα his3 leu2 lys2 ura3(21Shiflett S.L. Ward D.M. Huynh D. Vaughn M.B. Simmons J.C. Kaplan J. J. Biol. Chem. 2004; 279: 10982-10990Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar)Δvta1-5aMATα his3 leu2 met 15 ura3, Δvta1::KanMX(21Shiflett S.L. Ward D.M. Huynh D. Vaughn M.B. Simmons J.C. Kaplan J. J. Biol. Chem. 2004; 279: 10982-10990Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar)OCY 354MATa ade2, can1, his3, leu2, trp1, ura3, HO::FET3 LacZThis study23344MATα, ura3(15Springael J.Y. Andre B. Mol. Biol. Cell. 1998; 9: 1253-1263Crossref PubMed Scopus (186) Google Scholar)27038 (rsp5)MATa, ura3, rsp5(15Springael J.Y. Andre B. Mol. Biol. Cell. 1998; 9: 1253-1263Crossref PubMed Scopus (186) Google Scholar)23344 (FET3-GFP)MATα, ura3, FET3-GFP::KanMXThis study27038 (rsp5) (FET3-GFP)MATa, ura3, rsp5, FET3-GFP::KanMXThis study23344 (FTR1-CFP)MATα, ura3, FTR1-CFP::KanMXThis study27038 (rsp5) (FTR1-CFP)MATa, ura3, rsp5, FTR1-CFP::KanMXThis studyLHY291His3, trp1, ade2, ura3, leu2, bar1(24Dunn R. Hicke L. Mol. Biol. Cell. 2001; 12: 421-435Crossref PubMed Scopus (120) Google Scholar)LHY23rsp5-1, ura3, leu2, trp1, bar1 GAL(24Dunn R. Hicke L. Mol. Biol. Cell. 2001; 12: 421-435Crossref PubMed Scopus (120) Google Scholar) Open table in a new tab S1 Nuclease Protection Analysis—Total RNA was isolated and analyzed using standard techniques (10Chen O.S. Hemenway S. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 16922-16927Crossref PubMed Scopus (38) Google Scholar). All samples were isolated from mid-log phase cultures grown in either CM or CM BPS (5Ooi C.E. Rabinovich E. Dancis A. Bonifacino J.S. Klausner R.D. EMBO J. 1996; 15: 3515-3523Crossref PubMed Scopus (180) Google Scholar). The 32P-labeled FET3 and CMD1 probes were generated. Preparation of Antisera against Fet3p—A secreted Fet3p (Fet3p lacking the transmembrane and cytoplasmic domains) was generated as described by Hasset et al. (11Hassett R.F. Yuan D.S. Kosman D.J. J. Biol. Chem. 1998; 273: 23274-23282Abstract Full Text Full Text PDF PubMed Scopus (97) Google Scholar). Procedures for the isolation and deglycosylation of secreted-Fet3p have been described previously (12Harris Z.L. Davis-Kaplan S.R. Gitlin J.D. Kaplan J. Blood. 2004; 103: 4672-4673Crossref PubMed Scopus (28) Google Scholar). The N-glycanase-treated Fet3p was injected into rabbits, and antisera were prepared. The soluble Fet3p was attached to an Amino-link gel using the manufacturer's instructions (Pierce Inc.). The antiserum was applied to the column, and the column was extensively washed with phosphate-buffered saline and eluted with 0.1 m glycine (pH 2.5) and immediately neutralized with 1.0 m Tris-HCl (pH 9.0). The purified antibody was useful for both immunofluorescence and Western analysis. Immunofluorescence—Cells were prepared for immunofluorescence as described previously (13Davis-Kaplan S.R. Ward D.M. Shiflett S.L. Kaplan J. J. Biol. Chem. 2004; 279: 4322-4329Abstract Full Text Full Text PDF PubMed Scopus (54) Google Scholar). For visualization of Fet3p, the rabbit anti-Fet3p antibody was used (1:500) followed by either an Alexa 594- or Alexa 488-conjugated goat anti-rabbit antibody (1:500). All of the fluorescent secondary antibodies were obtained from Molecular Probes. Western Analysis—Western blot analysis was performed on Fet3p-containing membrane fractions as described previously (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar) using our purified rabbit anti-Fet3p (1:1000). The only variation in protocol was that membranes (15 μg) were treated with endoglycosidase Hf per the manufacturer's protocol (New England Biolabs) before being analyzed by SDS-PAGE using 10% gels followed by Western analysis. For Western analysis of Gap1p-GFP or Ftr1p-CFP, membranes were isolated using a procedure described previously (15Springael J.Y. Andre B. Mol. Biol. Cell. 1998; 9: 1253-1263Crossref PubMed Scopus (186) Google Scholar) and analyzed on 10% SDS-PAGE, and proteins were transferred to nitrocellulose membranes. The membranes were blocked with milk and incubated with either a rabbit anti-Fet3p (1:1,000), rabbit anti-GFP (1:10,000) (Abcam #6556), or rabbit anti-Gas1p (1:30,000, the kind gift of Dr. Howard Riezman University of Basel), followed by peroxidase-conjugated goat anti-rabbit IgG (1:12,500, Jackson ImmunoResearch Laboratories). Proteins were visualized by using a Western Lightning chemiluminescent detection system (PerkinElmer Life Sciences). Immunoprecipitation—For immunoprecipitation of Fet3p-GFP, Gap1p-GFP, or Ftr1p-CFP, proteins were extracted as described for Western analysis. Following extractions, samples were incubated with rabbit anti-GFP antibody (1:10,000, Abcam #6556) and 40 μl of Sepharose-conjugated Protein A/G beads (Santa Cruz Biotechnology) overnight at 4 °C. Protein A/G beads were pelleted and washed ten times in extraction/lysis buffer, and samples were eluted in 2× SDS-PAGE sample buffer without β-mercaptoethanol. Immunoprecipitated samples were examined by SDS-PAGE followed by Western analysis using either rabbit anti-Fet3p, mouse anti-GFP (1:10,000, Covance), or mouse anti-ubiquitin (1:1,000, Covance) as the primary antibody and peroxidase-conjugated goat anti-mouse or rabbit IgG as the secondary antibody (1:10,000, Jackson ImmunoResearch Laboratories, Inc.). Atomic Absorption Assay—Cells were grown to log phase in low iron medium and then transferred to medium containing a range of FeSO4 for 2 h. Log phase cells were collected and washed by centrifugation with 50 mm Tris-HCl, pH 6.5, 10 mm EDTA. Cell pellets were digested in 200 μl of 5:2 nitric acid:perchloric acid at 80 °C for 1 h. After digestion, the samples were diluted to 1.0 ml with deionized water and then flamed in a PerkinElmer Life Sciences inductively coupled plasma atomic absorption spectrometer. All samples were measured in duplicate, and the experiment was performed at least twice. To determine if the Fet3p-Ftr1p transport system is post-transcriptionally regulated by iron, we exposed wild type cells expressing the transport system to high iron medium and then examined Fet3p levels by Western analysis. When cells were exposed to high iron medium there was a concentration-dependent decrease in Fet3p. Relative to Gas1p, employed as a loading control, exposure of cells to 1 mm FeSO4 resulted in the disappearance of 50% of Fet3p within 1 h (data not shown) and 80% within 2 h (Fig. 1A). It may be possible that the disappearance of surface Fet3p is the result of the steady-state turnover of Fet3p, as FET3 transcription is iron-sensitive (9Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (590) Google Scholar). We observed that FET3 mRNA levels were dramatically decreased when cells were incubated with as little as 10 μm iron (Fig. 1B). There was little further change in transcript level with increased medium iron. Examination of Fet3p levels revealed little decrement in Fet3p when cells were incubated with 10 μm iron for 2 h. Decreased protein levels were only seen at higher concentrations of iron (Fig. 1A). These results suggest that Fet3p levels may be regulated independently of FET3 mRNA. We confirmed this result using two different approaches. First, we measured Fet3 protein in cells treated with the protein synthesis inhibitor cycloheximide. Cells were grown in low iron medium, and cycloheximide was added at the same time as high iron. In the presence of cycloheximide, there was an iron-dependent decrease in Fet3p (Fig. 1C). Second, we examined changes in Fet3p levels in Δfet3 cells transformed with a plasmid containing GAL10FET3 (8Askwith C. Kaplan J. J. Biol. Chem. 1997; 272: 401-405Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). High affinity iron transport occurs under low iron conditions in the presence of galactose but not in the presence of glucose. Cells were exposed to galactose in low iron medium to induce the high affinity iron transport system. The cells were then incubated in glucose media to prevent transcription of FET3 mRNA. Addition of glucose leads to inhibition of transcription of galactose-regulated genes within 4 min (16Mason P.B. Struhl K. Mol. Cell. Biol. 2003; 23: 8323-8333Crossref PubMed Scopus (269) Google Scholar). Addition of iron to glucose media resulted in a concentration-dependent loss of Fet3p (Fig. 1D). These experiments demonstrate that iron has an effect on Fet3p independent of FET3 transcription. The post-translational regulation of the high affinity iron transport system was confirmed using immunofluorescence. Cells incubated in iron-depleted medium showed fluorescent staining of the cell surface, whereas Δfet3 cells stained with the same anti-Fet3p antibody showed no fluorescence (Fig. 2A). Addition of iron for 2 h resulted in the disappearance of Fet3p fluorescence. Expression of FET3 regulated by the GAL10 promoter leads to abundant Fet3p on the cell surface, and there was little change in the surface expression of Fet3p when galactose-grown cells were incubated in glucose-containing medium. Upon addition of iron, there was a dramatic decrease in fluorescence (data not shown). We generated strains containing an integrated FET3-GFP. As shown previously, addition of an epitope to either Fet3p or Ftr1p does not alter their ability to transport iron (17Severance S. Chakraborty S. Kosman D.J. Biochem. J. 2004; 380: 487-496Crossref PubMed Google Scholar). Addition of iron also resulted in the loss of surface fluorescence in cells that had a chromosomal copy of FET3 with a carboxyl-terminal GFP (Fig. 2B). The loss of Fet3p was confirmed by Western analysis. Both components of the high affinity iron transport system, Fet3p and Ftr1p, have to be synthesized simultaneously for appropriate cell surface targeting (2Stearman R. Yuan D.S. Yamaguchi-Iwai Y. Klausner R.D. Dancis A. Science. 1996; 271: 1552-1557Crossref PubMed Scopus (584) Google Scholar). In the absence of Fet3p, Ftr1p does not localize to the surface and is degraded, as is Fet3p in the absence of Ftr1p. These results suggest that Fet3p and Ftr1p form a complex. Based on the observation that iron induced the loss of Fet3p, we asked whether iron also induced the loss of Ftr1p. We generated strains containing an integrated FTR1-CFP, because published studies show the utility of this fusion protein (17Severance S. Chakraborty S. Kosman D.J. Biochem. J. 2004; 380: 487-496Crossref PubMed Google Scholar). Expression of Frt1p-CFP permitted those cells to grow on low iron media, indicating that the protein was functional. When Ftr1p-CFP-expressing cells were incubated with high iron there was a loss of cell surface Ftr1p-CFP fluorescence (Fig. 2C). The predicted molecular mass of Ftr1p is 45.7 kDa, and addition of CFP would add 27 kDa. Our data show Ftr1p-CFP migrating on SDS-PAGE with a predicted molecular mass of 70 kDa, which is close to the predicted size of the fusion protein. We took advantage of mutant cell lines to show that the loss of surface Fet3p was due to internalization and vacuolar degradation. A deletion of END4 attenuates but does not completely inhibit endocytosis, as shown by decreased uptake of the fluorescent dye FM4–64 (18Raths S. Rohrer J. Crausaz F. Riezman H. J. Cell Biol. 1993; 120: 55-65Crossref PubMed Scopus (319) Google Scholar). In Δend4 cells, the iron-induced loss of surface Fet3p was reduced (Fig. 3A). In cells that lack the vacuolar protease Pep4p, the iron-induced loss of cell surface fluorescence correlated with the appearance of fluorescence in the vacuole (Fig. 3B). The targeting of many cell surface proteins to the vacuoles requires their sorting in the multivesicular body (19Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1026) Google Scholar). Vta1p is a class E protein involved in multivesicular body sorting (20Yeo S.C. Xu L. Ren J. Boulton V.J. Wagle M.D. Liu C. Ren G. Wong P. Zahn R. Sasajala P. Yang H. Piper R.C. Munn A.L. J. Cell Sci. 2003; 116: 3957-3970Crossref PubMed Scopus (82) Google Scholar, 21Shiflett S.L. Ward D.M. Huynh D. Vaughn M.B. Simmons J.C. Kaplan J. J. Biol. Chem. 2004; 279: 10982-10990Abstract Full Text Full Text PDF PubMed Scopus (63) Google Scholar). In iron-exposed Δvta1 cells, Fet3p was not degraded and was found at the plasma membrane as well as in a class E prevacuolar compartment (Fig. 3C). The Fet3p-Ftr1p transport system is highly specific for iron and will not transport other transition metals. Cells with a deletion of PEP4 (Δpep4) were incubated overnight in low iron medium and then exposed to different transition metals. At a concentration of 50 μm, only iron led to the vacuolar accumulation of Fet3p. Incubation of cells in metals such as Cu+, Mn2+, and Zn2+ in concentrations as high as 50 μm did not lead to internalization of Fet3p (Fig. 4). These results show that internalization of surface Fet3p is specific for iron. Entry of most plasma membrane proteins into the vacuole through the multivesicular body is a consequence of their being ubiquitinated. We therefore examined whether either Fet3p or Ftr1p was ubiquitinated. Cells expressing either Fet3p-GFP or Ftr1p-CFP were incubated in the presence of iron for 2 h and harvested, and detergent extracts were immunoprecipitated with anti-GFP antibodies. Western blots of the immunoprecipitates were probed with an anti-ubiquitin antibody. No ubiquitin was seen in the immunoprecipitate from Fet3p-GFP-expressing cells, but ubiquitin was found in extracts from Ftr1p-CFP-expressing cells (Fig. 5A). Ubiquitin could be seen on Ftr1p-CFP from cells grown in low iron medium; however, the addition of iron resulted in a significant increase in ubiquitin levels. Immunoprecipitated Ftr1p (detected by Western analysis) had an apparent molecular mass of 45 kDa, much lower than that of Ftr1p-CFP seen in extracts of cells probed by Western analysis. We think that it is likely that the lower molecular mass results from proteolytic cleavage occurring during immunoprecipitation, because we did not observe this change in molecular mass prior to immunoprecipitation (compare Figs. 2B and 5A). We confirmed the presence of ubiquitin on Ftr1p by taking advantage of cells transformed with a plasmid containing a copper regulated (CUP1) ubiquitin with a carboxyl-terminal c-myc epitope. Cells were grown in high copper-containing medium to induce the expression of ubiquitin-c-myc, and detergent extracts were immunoprecipitated using antibodies to GFP. Again, no ubiquitin was seen in immunoprecipitates from Fet3p-GFP cells, but ubiquitin was seen in immunoprecipitates from Ftr1p-CFP cells (Fig. 5B). We observed that Ftr1p was ubiquitinated in both low and high iron medium with multiple ubiquitin-containing bands. Other plasma membrane proteins have been found to be hyper-ubiquitinated in cells overexpressing ubiquitin (15Springael J.Y. Andre B. Mol. Biol. Cell. 1998; 9: 1253-1263Crossref PubMed Scopus (186) Google Scholar). If ubiquitination of Ftr1p was responsible for the internalization of the Fet3p-Ftr1p complex, then we might expect increased internalization of hyper-ubiquitinated Ftr1p-CFP in low iron medium. In Fet3p-GFP- or Ftr1p-CFP-expressing cells incubated in low iron medium, fluorescence was found predominately on the cell surface. Under the same conditions, in cells expressing ubiquitin, fluorescence was now found in the vacuole. Addition of iron to cells overexpressing ubiquitin resulted in an increase in the rate of vacuolar accumulation of Fet3p-Ftr1p. These results suggest that ubiquitination of Ftr1p leads to internalization of the Fet3p-Ftr1p complex. Most plasma membrane transporters are ubiquitinated by the ubiquitin ligase Rsp5p (for reviews see Refs. 19Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1026) Google Scholar and 22Hicke L. Dunn R. Annu. Rev. Cell Dev. Biol. 2003; 19: 141-172Crossref PubMed Scopus (967) Google Scholar). To determine if Rsp5p is required for the iron-induced internalization of Fet3p-Ftr1p transport system, we utilized a yeast strain with a mutation in RSP5. We first confirmed that rsp5 cells showed a defect in ubiquitination by following the degradation of the high affinity amino acid transporter Gap1p. Wild type and rsp5 cells were transformed with a GAP1-GFP plasmid. In cells grown in ammonia-free (nitrogen-poor) media Gap1p is localized to the plasma membrane (15Springael J.Y. Andre B. Mol. Biol. Cell. 1998; 9: 1253-1263Crossref PubMed Scopus (186) Google Scholar, 23Soetens O. De Craene J.O. Andre B. J. Biol. Chem. 2001; 276: 43949-43957Abstract Full Text Full Text PDF PubMed Scopus (200) Google Scholar). Addition of ammonia results in the internalization of Gap1p-GFP and its localization in the vacuole, as seen by fluorescence or by the presence of cleaved GFP on Western blots. In the rsp5 cells, Gap1p-GFP is found at the plasma membrane and in a prevacuolar compartment (Fig. 6A). Western analysis of rsp5 extracts showed full-length Gap1p-GFP, whereas in wild type cells only GFP is seen, indicating that Gap1-GFP is degraded. Gitan and Eide (4Gitan R.S. Luo H. Rodgers J. Broderius M. Eide D. J. Biol. Chem. 1998; 273: 28617-28624Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar) reported a decrease in the Zn2+-mediated internalization and degradation of the high affinity zinc transporter Zrt1p in rsp5 cells. We confirmed that result, as shown in Fig. 6B. To determine if Rsp5 was necessary for the iron-induced degradation of Fet3p-Ftr1p, we generated an rsp5 strain with an integrated FET3-GFP or FTR1-CFP. We were surprised to find no reduction in iron-induced internalization or degradation of Fet3p or Ftr1p in rsp5 cells (Fig. 6C). It is possible that the rsp5 mutant retains sufficient activity to ubiquitinate Ftr1p. We therefore took advantage of a temperature-sensitive allele of RSP5 (rsp5-1), which shows a severe defect in ubiquitination (24Dunn R. Hicke L. Mol. Biol. Cell. 2001; 12: 421-435Crossref PubMed Scopus (120) Google Scholar). We confirmed that rsp5-1 has a temperature-sensitive defect in ubiquitination by showing a severe alteration in α-factor-mediated internalization of Ste2p-GFP (Fig. 6D). Fet3p-GFP showed no of iron-dependent loss in rsp5-1 cells at the restrictive temperature (Fig. 6E). These results suggest that Rsp5p is not required for the iron-induced loss of the high affinity iron transport system. We considered three mechanisms to explain how iron signals the internalization and degradation of Fet3p-Ftr1p: a signal generated by iron at the cell surface, a signal generated by iron inside the cell, or a signal generated as a consequence of movement of iron through the transport system. To test these possibilities, we transformed a Δfet3Δpep4 strain with a GAL10-regulated allele of FET3 that was unable to transport iron due to a mutation in one of the amino acids that ligate the Type 1 copper (25Askwith C.C. Kaplan J. J. Biol. Chem. 1998; 273: 22415-22419Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). Cells were grown in galactose to induce the expression of the mutant Fet3p. Although the inactive Fet3p is still translocated to the cell surface, incubation of cells with high levels of iron did not result in the degradation of the mutant Fet3p, as assessed by either Western blot analysis (data not shown) or by immunofluorescence (Fig. 7A). We then examined the effect of mutations in Ftr1p by expressing a form of Ftr1p that had defective iron transport. A mutation in the putative iron binding REXLE domain of Ftr1p does not prevent Ftr1p and Fet3p from being localized to the cell surface but reduces iron transport by ∼80% (17Severance S. Chakraborty S. Kosman D.J. Biochem. J. 2004; 380: 487-496Crossref PubMed Google Scholar). When exposed to high iron, the degradation of the transport system was reduced compared with wild type cells (Fig. 7B). The concentration of media iron in these experiments was high, because it was sufficient to support the growth of Δfet3 cells but was also sufficient to inhibit transcription of a FET3lacZ reporter construct in Δfet3 cells (data not shown). To further show that a Fet3-Ftr1p transport system is required for iron-induced internalization, we took advantage of cells with a deletion in the GEF1 gene. Gef1p is a voltage-regulated chloride channel present in the post-Golgi compartment in which apo-Fet3p is copper-loaded (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar, 26Gaxiola R.A. Yuan D.S. Klausner R.D. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4046-4050Crossref PubMed Scopus (152) Google Scholar). In the absence of Gef1p, apo-Fet3p is not copper-loaded but is still targeted to the cell surface. Cell surface apo-Fet3p, lacks multicopper oxidase activity and is unable to transport iron. Incubation of Δgef1 cells with iron did not lead to the degradation of apo-Fet3p (Fig. 8). Apo-Fet3p on the cell surface can be copper-loaded by incubation of cells at 0 °C in the presence of Cl–,Cu+, and reduced pH (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar). Copper loading of apo-Fet3p resulted in increased iron transport activity and increased multicopper oxidase activity. Once copper-loaded, addition of iron leads to the internalization and degradation of Fet3p. These results demonstrate that an active iron transport system is required for iron to induce the internalization of Fet3p-Ftr1p. Extracellular iron is not the signal for the internalization and degradation of the high affinity iron transport system. S. cerevisiae can acquire iron through the low affinity iron transport system, Fet4p, as well as through siderophore-iron transporters. There are two separate routes by which S. cerevisiae can acquire iron provided by iron-siderophore complexes (27Lesuisse E. Simon-Casteras M. Labbe P. Microbiology. 1998; 144: 3455-3462Crossref PubMed Scopus (130) Google Scholar, 28Yun C.W. Ferea T. Rashford J. Ardon O. Brown P.O. Botstein D. Kaplan J. Philpott C.C. J. Biol. Chem. 2000; 275: 10709-10715Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar). The first route involves reduction of siderophore-iron complexes at the cell surface followed by the uptake of iron by the Fet3p-Ftr1p transport system. The impermeable Fe(II) chelator BPS can inhibit uptake of iron by this route. The second route of uptake of siderophore iron involves transport of the siderophore iron complex through a siderophore transporter. This route of iron acquisition cannot be inhibited by BPS. In the presence of high concentrations of BPS, yeast can grow on siderophore-iron complexes (28Yun C.W. Ferea T. Rashford J. Ardon O. Brown P.O. Botstein D. Kaplan J. Philpott C.C. J. Biol. Chem. 2000; 275: 10709-10715Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar, 29Kosman D.J. Mol. Microbiol. 2003; 47: 1185-1197Crossref PubMed Scopus (265) Google Scholar). Addition of high concentrations of ferrioxamine-iron to cells grown in BPS did not lead to the internalization of Fet3p-Ftr1p (Fig. 9A). The same concentration of ferrioxamine-iron, however, can provide enough iron to support the growth of cells and to prevent the expression of a FET3lacZ reporter construct (Fig. 9B). It may be possible that the amount of siderophore-iron accumulated within cells may be enough to suppress the transcription of the iron-regulon but is insufficient to induce the internalization of Fet3p-Ftr1p. To examine the effect of intracellular iron on the degradation of Fet3p-Ftr1p, we took advantage of the observation that, in the absence of high affinity, iron transport system cells increase the expression of the low affinity transition metal transporter Fet4p (30Li L. Kaplan J. J. Biol. Chem. 1998; 273: 22181-22187Abstract Full Text Full Text PDF PubMed Scopus (135) Google Scholar). As shown above, Δgef1 cells do not internalize Fet3p-Ftr1p. At low concentrations of media iron wild type cells accumulated more iron than Δgef1 cells (Fig. 9C). This is expected, because Δgef1 cells do not have a functional high affinity iron transport system. As media iron increases, Δgef1 cells showed a greater accumulation of iron than wild type cells. Increased iron accumulation reflects the increased expression of the Fet4p low affinity iron transporter on Δgef1 cells and low levels of Fet4p on wild type cells. Even in the face of greater than wild type levels of cellular iron, no degradation of Fet3p-Ftr1p was observed (see Fig. 8). These results suggest that intracellular iron does not provide the signal for the internalization of Fet3p-Ftr1p. Transcriptional regulation of the high affinity iron transport system, comprising the products of the FET3 and FTR1 genes, by the transcription factor Aft1p has been well described (3Yamaguchi-Iwai Y. Dancis A. Klausner R.D. EMBO J. 1995; 14: 1231-1239Crossref PubMed Scopus (318) Google Scholar, 31Casas C. Aldea M. Espinet C. Gallego C. Gil R. Herrero E. Yeast. 1997; 13: 621-637Crossref PubMed Scopus (76) Google Scholar, 32Rutherford J.C. Jaron S. Winge D.R. J. Biol. Chem. 2003; 278: 27636-27643Abstract Full Text Full Text PDF PubMed Scopus (160) Google Scholar, 33Yamaguchi-Iwai Y. Stearman R. Dancis A. Klausner R.D. EMBO J. 1996; 15: 3377-3384Crossref PubMed Scopus (292) Google Scholar). We now demonstrate that Fet3p and Ftr1p are regulated post-translationally, as iron induces the internalization and degradation of both Fet3p and Ftr1p. The simultaneous synthesis of Fet3p and Ftr1p is required for their appropriate targeting to the cell surface suggesting that these molecules are in a complex (2Stearman R. Yuan D.S. Yamaguchi-Iwai Y. Klausner R.D. Dancis A. Science. 1996; 271: 1552-1557Crossref PubMed Scopus (584) Google Scholar, 8Askwith C. Kaplan J. J. Biol. Chem. 1997; 272: 401-405Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). The observation that iron induces the simultaneous internalization of both Fet3p and Ftr1p provides further support for the view that these two proteins exist in an obligate complex. Iron-induced internalization of the iron transport system is consistent with studies showing post-translational regulation of copper (5Ooi C.E. Rabinovich E. Dancis A. Bonifacino J.S. Klausner R.D. EMBO J. 1996; 15: 3515-3523Crossref PubMed Scopus (180) Google Scholar), zinc (4Gitan R.S. Luo H. Rodgers J. Broderius M. Eide D. J. Biol. Chem. 1998; 273: 28617-28624Abstract Full Text Full Text PDF PubMed Scopus (165) Google Scholar, 34Gitan R.S. Eide D.J. Biochem. J. 2000; 346: 329-336Crossref PubMed Scopus (147) Google Scholar), and manganese (35Liu X.F. Culotta V.C. J. Biol. Chem. 1999; 274: 4863-4868Abstract Full Text Full Text PDF PubMed Scopus (123) Google Scholar) transport systems. For both iron and zinc transport systems, transcriptional regulation is more sensitive than post-translational regulation. Iron, at concentrations as low as 10 μm, can reduce transcription of FET3 by >90%, whereas the same concentration only had minimal effects on protein levels. Ubiquitination is the signal that targets most membrane proteins for degradation (19Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1026) Google Scholar, 22Hicke L. Dunn R. Annu. Rev. Cell Dev. Biol. 2003; 19: 141-172Crossref PubMed Scopus (967) Google Scholar). Our data indicate that Ftr1p can be ubiquitinated and that ubiquitination is required for degradation, because deletions of genes required for sorting into the multivesicular body pathway prevent the vacuolar localization of Fet3p-Ftr1p. Most plasma membrane proteins are ubiquitinated by Rsp5p (22Hicke L. Dunn R. Annu. Rev. Cell Dev. Biol. 2003; 19: 141-172Crossref PubMed Scopus (967) Google Scholar). Rsp5p, in combination with Bsd2p, is responsible for ubiquitination of the Mn2+ transporter Smf1p in the biosynthetic pathway (36Hettema E.H. Valdez-Taubas J. Pelham H.R. EMBO J. 2004; 23: 1279-1288Crossref PubMed Scopus (128) Google Scholar). The rate of degradation of the amino acid transporter Gap1p and the zinc transporter Zrt1p was severely reduced in rsp5 cells. It was surprising to find that the iron-induced degradation of Fet3p-Ftr1p was not affected in rsp5 cells. Furthermore, no iron-induced change in surface Fet3p was seen at the restrictive temperature in cells that had temperature-sensitive allele of RSP5, although effects were seen on the internalization of Ste2p. These results suggest that a ubiquitin ligase other than Rsp5p is required for the ubiquitination of Ftr1p. Given that metals can induce the internalization of surface transporters via ubiquitination leading to transporter degradation, what is the signal that leads to ubiquitination? The metal-induced event that leads to Rsp5p-mediated ubiquitin addition in Smf1p may be a conformational change in the transporter resulting from transport of the metal (36Hettema E.H. Valdez-Taubas J. Pelham H.R. EMBO J. 2004; 23: 1279-1288Crossref PubMed Scopus (128) Google Scholar). Mutations that abolish transport activity for Smf1p abolish metal-induced internalization. These studies suggest that Rsp5p (in combination with Bsd2p) recognizes alterations in the hydrophobic domain of membrane proteins. Transport of substrate might be expected to lead to perturbation in the lipid bilayer resulting from movements in the transporter as substrate is passed through the bilayer. This is an attractive model for post-translational regulation of the iron transport system, because it would correlate transport activity with both cellular metal requirement and transcriptional regulation of the high affinity iron transporter. In conditions of iron sufficiency, iron transport will lead to degradation of the transporter. In the face of iron insufficiency, even though transport of iron increases the rate of degradation of the transporter, the increased degradation rate will be offset by increased transcription of the transporter. Linking transport activity to degradation rate provides a simple feedback mechanism that ensures tight control of cytosolic metal levels, as well as assuring the specificity of membrane targeting to the specific transporter. The demonstration that the Fet3p-Ftr1p transport system must be active to effect iron-induced internalization indicates that cell surface iron is not the signal for internalization/ubiquitination. There are two issues that must be resolved before accepting a model for iron-induced internalization in which the movement of iron through the channel is responsible for ubiquitination. First, why are high concentrations of iron required for post-translational regulation? The Km for the Fet3p-Ftr1p transport system is in the sub-micromolar (0.15–0.2 μm) range (9Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (590) Google Scholar), yet much higher concentrations of iron (>50 μm) are required for substantial rates of transporter degradation. Second, what is the ubiquitin ligase responsible for “marking” Ftr1p? We have ruled out Rsp5p, although it is formally possible that, even in the rsp5 mutant strain or the temperature-sensitive rsp5-1 strain, residual enzyme activity is sufficient to ubiquitinate Ftr1p. The best way to show that Rsp5p is not required is to identify the ubiquitin ligase that is required. Those studies are in progress. We thank Drs. David Eide (University of Wisconsin), Chris Kaiser (Massachusetts Institute of Technology), Linda Hicke (Northwestern), and Howard Riezman (University of Basel) for their generous gifts of plasmids, cells, and antibodies.

Systemic iron homeostasis is regulated by the interaction of the peptide hormone, hepcidin and the iron exporter, ferroportin. Mutations in FPN1, the gene that encodes ferroportin, result in iron-overload disease that shows dominant inheritance and variation in phenotype. The inheritance of ferroportin-linked disorders can be explained by the finding that ferroportin is a multimer and the product of the mutant allele participates in multimer formation. The nature of the ferroportin mutant can explain the variation in phenotype, which is due to either decreased iron export activity or decreased ability to be downregulated by hepcidin. Iron export through ferroportin is determined by the concentration of ferroportin in plasma membrane, which is the result of both synthetic and degradation events. Ferroportin degradation can occur by hepcidin-dependent and hepcidin-independent internalization. Ferroportin expression is regulated transcriptionally and posttranslationally.

Yeast respond to increased cytosolic iron by activating the transcription factor Yap5 increasing transcription of CCC1, which encodes a vacuolar iron importer. Using a genetic screen to identify genes involved in Yap5 iron sensing, we discovered that a mutation in SSQ1, which encodes a mitochondrial chaperone involved in iron-sulfur cluster synthesis, prevented expression of Yap5 target genes. We demonstrated that mutation or reduced expression of other genes involved in mitochondrial iron-sulfur cluster synthesis (YFH1, ISU1) prevented induction of the Yap5 response. We took advantage of the iron-dependent catalytic activity of Pseudaminobacter salicylatoxidans gentisate 1,2-dioxygenase expressed in yeast to measure changes in cytosolic iron. We determined that reductions in iron-sulfur cluster synthesis did not affect the activity of cytosolic gentisate 1,2-dioxygenase. We show that loss of activity of the cytosolic iron-sulfur cluster assembly complex proteins or deletion of cytosolic glutaredoxins did not reduce expression of Yap5 target genes. These results suggest that the high iron transcriptional response, as well as the low iron transcriptional response, senses iron-sulfur clusters. Yeast respond to increased cytosolic iron by activating the transcription factor Yap5 increasing transcription of CCC1, which encodes a vacuolar iron importer. Using a genetic screen to identify genes involved in Yap5 iron sensing, we discovered that a mutation in SSQ1, which encodes a mitochondrial chaperone involved in iron-sulfur cluster synthesis, prevented expression of Yap5 target genes. We demonstrated that mutation or reduced expression of other genes involved in mitochondrial iron-sulfur cluster synthesis (YFH1, ISU1) prevented induction of the Yap5 response. We took advantage of the iron-dependent catalytic activity of Pseudaminobacter salicylatoxidans gentisate 1,2-dioxygenase expressed in yeast to measure changes in cytosolic iron. We determined that reductions in iron-sulfur cluster synthesis did not affect the activity of cytosolic gentisate 1,2-dioxygenase. We show that loss of activity of the cytosolic iron-sulfur cluster assembly complex proteins or deletion of cytosolic glutaredoxins did not reduce expression of Yap5 target genes. These results suggest that the high iron transcriptional response, as well as the low iron transcriptional response, senses iron-sulfur clusters.

Mitochondrial iron import is essential for iron–sulfur cluster formation and heme biosynthesis. Two nuclear-encoded vertebrate mitochondrial high-affinity iron importers, mitoferrin1 (Mfrn1) and Mfrn2, have been identified in mammals. In mice, the gene encoding Mfrn1, <i>solute carrier family 25 member 37</i> (<i>Slc25a37</i>), is highly expressed in sites of erythropoiesis, and whole-body <i>Slc25a37</i> deletion leads to lethality. Here, we report that mice with a deletion of <i>Slc25a28</i> (encoding Mfrn2) are born at expected Mendelian ratios, but show decreased male fertility due to reduced sperm numbers and sperm motility. <i>Mfrn2</i>^−/− mice placed on a low-iron diet exhibited reduced mitochondrial manganese, cobalt, and zinc levels, but not reduced iron. Hepatocyte-specific loss of <i>Slc25a37</i> (encoding Mfrn1) in <i>Mfrn2</i>^−/− mice did not affect animal viability, but resulted in a 40% reduction in mitochondrial iron and reduced levels of oxidative phosphorylation proteins. Placing animals on a low-iron diet exaggerated the reduction in mitochondrial iron observed in liver-specific <i>Mfrn1/2</i>-knockout animals. <i>Mfrn1</i>^−/−/<i>Mfrn2</i>^−/− bone marrow–derived macrophages or skin fibroblasts <i>in vitro</i> were unable to proliferate, and overexpression of Mfrn1-GFP or Mfrn2-GFP prevented this proliferation defect. Loss of both mitoferrins in hepatocytes dramatically reduced regeneration in the adult mouse liver, further supporting the notion that both mitoferrins transport iron and that their absence limits proliferative capacity of mammalian cells. We conclude that Mfrn1 and Mfrn2 contribute to mitochondrial iron homeostasis and are required for high-affinity iron import during active proliferation of mammalian cells.

We identified VTA1 in a screen for mutations that result in altered vacuole morphology. Deletion of VTA1 resulted in delayed trafficking of the lipophilic dye FM4-64 to the vacuole and altered vacuolar morphology when cells were exposed to the dye 5-(and 6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA). Deletion of class E vacuolar protein sorting (VPS) genes, which encode proteins that affect multivesicular body formation, also showed altered vacuolar morphology upon exposure to high concentrations of CDCFDA. These results suggest a VPS defect for Δvta1 cells. Deletion of VTA1 did not affect growth on raffinose and only mildly affected carboxypeptidase S sorting. Turnover of the surface protein Ste3p, the a-factor receptor, was affected in Δvta1 cells with the protein accumulating on the vacuolar membrane. Likewise the α-factor receptor Ste2p accumulated on the vacuolar membrane in Δvta1 cells. We demonstrated that many class E VPS deletion strains are hyper-resistant to the cell wall disruption agent calcofluor white. Deletion of VTA1 or VPS60, another putative class E gene, resulted in calcofluor white hypersensitivity. A Vta1p-green fluorescent protein fusion protein transiently associated with a Pep12p-positive compartment. This localization was altered by deletion of many of the class E VPS genes, indicating that Vta1p binds to endosomes in a manner dependent on the assembly of the endosomal sorting complexes required for transport. Membrane-associated Vta1p co-purified with Vps60p, suggesting that Vta1p is a class E Vps protein that interacts with Vps60p on a prevacuolar compartment. We identified VTA1 in a screen for mutations that result in altered vacuole morphology. Deletion of VTA1 resulted in delayed trafficking of the lipophilic dye FM4-64 to the vacuole and altered vacuolar morphology when cells were exposed to the dye 5-(and 6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA). Deletion of class E vacuolar protein sorting (VPS) genes, which encode proteins that affect multivesicular body formation, also showed altered vacuolar morphology upon exposure to high concentrations of CDCFDA. These results suggest a VPS defect for Δvta1 cells. Deletion of VTA1 did not affect growth on raffinose and only mildly affected carboxypeptidase S sorting. Turnover of the surface protein Ste3p, the a-factor receptor, was affected in Δvta1 cells with the protein accumulating on the vacuolar membrane. Likewise the α-factor receptor Ste2p accumulated on the vacuolar membrane in Δvta1 cells. We demonstrated that many class E VPS deletion strains are hyper-resistant to the cell wall disruption agent calcofluor white. Deletion of VTA1 or VPS60, another putative class E gene, resulted in calcofluor white hypersensitivity. A Vta1p-green fluorescent protein fusion protein transiently associated with a Pep12p-positive compartment. This localization was altered by deletion of many of the class E VPS genes, indicating that Vta1p binds to endosomes in a manner dependent on the assembly of the endosomal sorting complexes required for transport. Membrane-associated Vta1p co-purified with Vps60p, suggesting that Vta1p is a class E Vps protein that interacts with Vps60p on a prevacuolar compartment. In Saccharomyces cerevisiae, the multivesicular body (MVB) 1The abbreviations used are: MVB, multivesicular body; CDCFDA, 5-(and 6)-carboxy-2′,7′-dichlorofluorescein diacetate; CPS, carboxypeptidase S; ESCRT, endosomal sorting complex required for transport; VPS, vacuolar protein sorting; GFP, green fluorescent protein; TAP, tandem affinity purification; HA, hemagglutinin. 1The abbreviations used are: MVB, multivesicular body; CDCFDA, 5-(and 6)-carboxy-2′,7′-dichlorofluorescein diacetate; CPS, carboxypeptidase S; ESCRT, endosomal sorting complex required for transport; VPS, vacuolar protein sorting; GFP, green fluorescent protein; TAP, tandem affinity purification; HA, hemagglutinin. has at least two functions: delivery of membrane proteins destined for degradation into the lumen of the vacuole and delivery of the vacuolar hydrolase CPS (1Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1009) Google Scholar). Proteins encoded by class E VPS genes are required for proper formation of the MVB. Membrane proteins destined for invagination into the MVB are monoubiquitinated and then bound to the ubiquitin-binding protein Vps27p (2Bilodeau P.S. Urbanowski J.L. Winistorfer S.C. Piper R.C. Nat. Cell Biol. 2002; 4: 534-539Crossref PubMed Scopus (278) Google Scholar). This is followed by the sequential recruitment of three cytosolic protein complexes referred to as endosomal sorting complex required for transport I (ESCRT I) (Vps23p, Vps28p, and Vps37p) (3Katzmann D.J. Babst M. Emr S.D. Cell. 2001; 106: 145-155Abstract Full Text Full Text PDF PubMed Scopus (1110) Google Scholar), ESCRT II (Vps22p, Vps25p, and Vps36p) (4Babst M. Katzmann D.J. Snyder W.B. Wendland B. Emr S.D. Dev. Cell. 2002; 3: 283-289Abstract Full Text Full Text PDF PubMed Scopus (516) Google Scholar), and ESCRT III (Vps20p, Snf7p, Vps24p, and Vps2p) (5Babst M. Katzmann D.J. Estepa-Sabal E.J. Meerloo T. Emr S.D. Dev. Cell. 2002; 3: 271-282Abstract Full Text Full Text PDF PubMed Scopus (677) Google Scholar). The membrane association of each complex is dependent on the presence of the preceding complex. ESCRT I and ESCRT II exist as complexes in the cytosol. The components of ESCRT III are monomeric in the cytosol and are recruited to the membrane in an ordered manner. Vps20p and Snf7p can associate with the membrane independently of the other members of ESCRT III, while Vps2p and Vps24p require the binding of Vps20p and Snf7p to membranes for their membrane association. Once bound to the membrane, the release of all three complexes to the cytosol is mediated by Vps4p, an AAA-type ATPase (6Babst M. Wendland B. Estepa E.J. Emr S.D. EMBO J. 1998; 17: 2982-2993Crossref PubMed Scopus (613) Google Scholar). Other proteins shown to be involved in the formation of the MVB include Vps60p (7Kranz A. Kinner A. Kolling R. Mol. Biol. Cell. 2001; 12: 711-723Crossref PubMed Scopus (61) Google Scholar), Did2p (8Amerik A.Y. Nowak J. Swaminathan S. Hochstrasser M. Mol. Biol. Cell. 2000; 11: 3365-3380Crossref PubMed Scopus (261) Google Scholar), Vps44p (9Bowers K. Levi B.P. Patel F.I. Stevens T.H. Mol. Biol. Cell. 2000; 11: 4277-4294Crossref PubMed Scopus (150) Google Scholar), and Vps31p/Bro1p (10Odorizzi G. Katzmann D.J. Babst M. Audhya A. Emr S.D. J. Cell Sci. 2003; 116: 1893-1903Crossref PubMed Scopus (173) Google Scholar). Vps44p is a Na+/H+ anti-porter on the late endosome. Vps31p/Bro1p was recently shown to interact with Snf7p, a component of ESCRT III. The roles of Vps60p and Did2p have yet to be defined, but they share significant sequence similarity with the ESCRT III proteins.We identified VTA1 in a screen for mutations that result in altered vacuole morphology. Here we present genetic and biochemical evidence that Vta1p is a class E Vps protein that specifically interacts with Vps60p. Vta1p was required for the sorting of the plasma membrane proteins Ste2p and Ste3p into the MVB, while the absence of Vta1p resulted in a kinetic delay in the delivery of the lipophilic dye FM4-64 to the vacuole and a mild missorting of the vacuolar hydrolase CPS. We also showed that Vta1p is a soluble protein that associates with a Pep12p-positive compartment in a manner dependent on the assembly of all three ESCRT complexes.MATERIALS AND METHODSYeast Strains and Media—Strains used in this study are listed in Table I. BY4743 and the homozygous diploid deletions derived from it were obtained from Research Genetics. vta1-5a was generated by dissecting the Research Genetics homozygous diploid deletion strain and twice backcrossing one of the derived haploids to the wild type haploid strain BY4741. The other haploid deletion strains were generated by PCR amplifying the DNA surrounding the deletion from the Research Genetics diploid and transforming it into BY4743. The transformants were plated on YPD (1% Bacto yeast extract, 2% bactopeptone, 2% dextrose) for 24 h and then replica-plated to YPD containing 200 μg/ml G418. The resulting strains were sporulated, dissected, and genotyped. All deletions were confirmed by PCR. To generate DY3444Δvta1 and DY4167Δvta1, a region surrounding the vta1::KANMX4 locus from the Research Genetics diploid strain was amplified by PCR and transformed to the diploid DY3466. The resulting heterozygote was sporulated, and the appropriate genotypes were selected. DY4167 VTA1-TAP was generated as described previously by homologous recombination with a PCR product derived from the plasmid pBS1479 (Cellzome) (11Puig O. Caspary F. Rigaut G. Rutz B. Bouveret E. Bragado-Nilsson E. Wilm M. Seraphin B. Methods. 2001; 24: 218-229Crossref PubMed Scopus (1415) Google Scholar). Yeast were grown either in CM (0.67% yeast nitrogen base without amino acids, 2% dextrose, and all amino acids except those required for plasmid maintenance) or in YPD. YEP raffinose differs from YPD solely in that dextrose is replaced with 2% raffinose. Solid media were made by adding 1.5% agar. Calcofluor white plates were made by adding calcofluor white (Sigma, fluorescent brightener 28) to a final concentration of 20–40 μg/ml into YPD.Table IYeast strains used in this studyStrainGenotypeRef.BY4743MATa/MATα his3/his3 ura3/ura3 leu2/leu2 lys2/+ met15/+27Brachmann C.B. Davies A. Cost G.J. Caputo E. Li J. Hieter P. Boeke J.D. Yeast. 1998; 14: 115-132Crossref PubMed Scopus (2572) Google ScholarΔvta1MATa/MATα his3/his3 ura3/ura3 leu2/leu2 lys2/+ met15/+ vta1::KanMX/vta1::KanMXResearch GeneticsΔvps20MATa/MATα his3/his3 ura3/ura3 leu2/leu2 lys2/+ met15/+ vps20::KanMX/vps20::KanMXResearch GeneticsBY4741MATa his3 leu2 met15 ura327Brachmann C.B. Davies A. Cost G.J. Caputo E. Li J. Hieter P. Boeke J.D. Yeast. 1998; 14: 115-132Crossref PubMed Scopus (2572) Google ScholarBY4742MATα his3 leu2 lys2 ura327Brachmann C.B. Davies A. Cost G.J. Caputo E. Li J. Hieter P. Boeke J.D. Yeast. 1998; 14: 115-132Crossref PubMed Scopus (2572) Google Scholarvta1-5aMATa his3 leu2 met15 ura3 vta1::KanMXThis studyvps20-7bMATα his3 leu2 lys2 ura3 vps20::KanMXThis studyvps4-3bMATa his3 leu2 ura3 vps4::KanMXThis studyvps60-5aMATα his3 leu2 lys2 ura3 vps60::KanMXThis studyvps23-2bMATa his3 leu2 met15 ura3 vps23::KanMXThis studyvps27-1dMATa his3 leu2 lys2 met15 ura3 vps27::KanMXThis studyvps28-1cMATa his3 leu2 lys2 met15 ura3 vps28::KanMXThis studyvps37-7aMATa his3 leu2 met15 ura3 vps37::KanMXThis studyvps22-3bMATa his3 leu2 met15 ura3 vps22::KanMXThis studyvps25-2dMATa his3 leu2 met15 ura3 vps25::KanMXThis studyvps36-9aMATa his3 leu2 lys2 met15 ura3 vps36::KanMXThis studydid2-8bMATa his3 leu2 met15 ura3 did2::KanMXThis studyvps20-7dMATa his3 leu2 met15 ura3 vps20::KanMXThis studyvps24-5aMATa his3 leu2 met15 ura3 vps24::KanMXThis studysnf7-2bMATa his3 leu2 lys2 met15 ura3 snf7::KanMXThis studyvps4-4aMATa his3 leu2 met15 ura3 vps4::KanMXThis studyvps60-1aMATa his3 leu2 met15 ura3 vps60::KanMXThis studyvps44-1cMATa his3 leu2 met15 ura3 vps44::KanMXThis studybro1-4bMATa his3 leu2 met15 ura3 bro1::KanMXThis studyvps20/vps4-1aMATα his3 leu2 ura3 vps20::KanMX vps4::KanMXThis studyvps20/vps4-4bMATa his3 leu2 met15 ura3 vps20::KanMX vps4::KanMXThis studyvps20/vps60-2aMATα his3 leu2 ura3 vps20::KanMX vps60::KanMXThis studyvps20/vps60-2bMATa his3 leu2 lys2 met15 ura3 vps20::KanMX vps60::KanMXThis studyvps24/vps60-1dMATa his3 leu2 met15 ura3 vps24::KanMX vps60::KanMXThis studyvps20/vta1-3bMATa his3 leu2 lys2 met15 ura3 vps20::KanMX vta1::KanMXThis studyvps60/vta1-4aMATa his3 leu2 ura3 vps60::KanMX vta1::KanMXThis studyDY4167MATa ade2 ade3 can1 ura3 leu2 his3 lys2 trp1D. Stillman, University of UtahDY3444Δvta1MATα ade2 can1 ura3 leu2 his3 met14 trp1 vta1::KanMXThis studyDY3444MATα ade2 can1 ura3 leu2 his3 met14 trp1D. Stillman, University of UtahDY3466DY4167 × DY3444This studyDY4167 VTA1-TAPMATa ade2 ade3 can1 ura3 leu2 his3 lys2 trp1 VTA1::TAP:TRP1This study Open table in a new tab Construction of Plasmids—VTA1, including the upstream promoter sequence, was amplified by PCR with or without a carboxyl-terminal c-Myc tag and inserted as an EcoRI/BamHI fragment into either pTF63 or YCp33 to generate p63VTAmyc, YCp33VTAmyc, p63VTA, and YCp33VTA. For construction of pMet3GFP, the EcoRV/PstI fragment from M2265 (obtained from D. Stillman, University of Utah) containing the MET3 promoter was inserted into YCp33 that had been cut with SalI, treated with Klenow polymerase, and then cut with PstI. The resulting plasmid (YCp33MET3) was digested with BamHI and KpnI and ligated to the BamHI/KpnI fragment from pGFP-c-fus (12Niedenthal R.K. Riles L. Johnston M. Hegemann J.H. Yeast. 1996; 12: 773-786Crossref PubMed Scopus (363) Google Scholar) containing the GFP open reading frame and the CYC1 terminator sequence. PCR-amplified VTA1, VPS20, and VPS60 were inserted as BamHI/SmaI fragments into pMET3GFP, resulting in pVTA1GFP, pVPS20GFP, and pVPS60GFP, respectively.Labeling of Vacuoles—FM4-64 staining was done as described previously (13Vida T.A. Emr S.D. J. Cell Biol. 1995; 128: 779-792Crossref PubMed Scopus (1127) Google Scholar). Briefly 5 OD units of cells were incubated in 1 ml of YPD containing 40 μm FM4-64 for 10 min at 30 °C, washed once with YPD, and further incubated in dye-free YPD at 30 °C. For 5-(and 6)-carboxy-2′,7′-dichlorofluorescein diacetate (CDCFDA) staining, cells were grown to midlog phase in YPD overnight or in CM-uracil overnight before shifting to YPD for 3 h. 10 OD units of cells were harvested, resuspended in 1 ml of CM with 1 μl of 200 mm CDCFDA, and incubated at 30 °C for 1 h. Cells were centrifuged and resuspended in 500 μl of CM. Cells were visualized by fluorescence microscopy and differential interference contrast optics.Sorting and Detection of CPS-GFP—The CPS-GFP construct was obtained from S. Emr (14Odorizzi G. Babst M. Emr S.D. Cell. 1998; 95: 847-858Abstract Full Text Full Text PDF PubMed Scopus (552) Google Scholar). For analysis of CPS trafficking, cells were grown to midlog phase, harvested, and disrupted by vortexing with glass beads in 20 mm Tris-HCl, pH 7.4, 150 mm NaCl with protease inhibitors (Complete™ protease inhibitor mixture (Roche Applied Science), 1 mm phenylmethylsulfonyl fluoride). Triton X-100 was added to the postnuclear supernatants to a final concentration of 1%. Samples were incubated on ice for 15 min and centrifuged at 16,000 × g for 15 min. 50 μg of protein was separated by SDS-PAGE, and GFP was detected by Western analysis with an anti-GFP antibody (Covance).Ste3p Localization and Degradation—pRS414 Ste3GFP and pRS414 Ste3HA were obtained from B. Horazdovsky (Mayo). DY3444 and DY3444Δvta1 expressing Ste3p-GFP were grown overnight in CM-Trp containing 70 μg/ml adenine to suppress vacuolar accumulation of the red pigment caused by the ade2 mutation. Localization was determined by fluorescence microscopy analysis of Ste3p-GFP using an Olympus epifluorescence microscope with 100× oil immersion objective. Ste3p degradation assays were done as described previously (15Davies B.A. Topp J.D. Sfeir A.J. Katzmann D.J. Carney D.S. Tall G.G. Friedberg A.S. Deng L. Chen Z. Horazdovsky B.F. J. Biol. Chem. 2003; 278: 19826-19833Abstract Full Text Full Text PDF PubMed Scopus (58) Google Scholar) except that cells were grown in CM-Trp overnight to A600 = 0.6 before addition of cycloheximide. Polyclonal HA antibody was obtained from T. Stevens (University of Oregon).Chitin Measurement—Chitin was measured as described previously (16Ketela T. Green R. Bussey H. J. Bacteriol. 1999; 181: 3330-3340Crossref PubMed Google Scholar).Protein Analysis—For Western analysis and purification of TAP-tagged proteins, cells were pelleted, washed, spheroplasted, and Dounce-homogenized in TBSM (50 mm Tris-HCl, pH 7.5, 150 mm NaCl, 600 mm mannitol) with protease inhibitors (Complete protease inhibitor mixture (Roche Applied Science), 1 mm phenylmethylsulfonyl fluoride). Homogenates were centrifuged at 700 × g for 5 min to obtain a post-nuclear supernatant. The postnuclear supernatant was then centrifuged at 16,000 × g for 30 min to obtain S16 and P16 fractions. TAP-tagged proteins were isolated as described previously (11Puig O. Caspary F. Rigaut G. Rutz B. Bouveret E. Bragado-Nilsson E. Wilm M. Seraphin B. Methods. 2001; 24: 218-229Crossref PubMed Scopus (1415) Google Scholar). Briefly the P16 fraction was solubilized in TBSM containing 1% Triton X-100. TAP-tagged proteins were purified using rabbit IgG-agarose beads (Sigma). Proteins, released by cleavage with tobacco etch virus protease, were then bound to a calmodulin column and eluted with EDTA. A similar protocol was used for TAP-tagged proteins present in the S16 fraction but without detergent. Western analysis was done using peroxidase-conjugated anti-peroxidase (Sigma), anti-GFP (Covance), or anti-c-Myc (9E10) (Covance) antibodies. For size exclusion chromatography, cells were Dounce-homogenized in 20 mm K+ Hepes, pH 7.9, 50 mm KCl, 0.2 mm EDTA, pH 8.0, 10% glycerol with protease inhibitors. The S16 fraction was isolated as above and combined with 19 volume of 100 mm Tris, pH 8.0, 1.5 m NaCl, 1% Nonidet P-40. One milliliter was loaded on a Superdex 200 fast protein liquid chromatography column. One-milliliter fractions were collected.Immunofluorescence—Wild type and Δvta1 strains were prepared for immunofluorescence as described previously (17Babcock M. de Silva D. Oaks R. Davis-Kaplan S. Jiralerspong S. Montermini L. Pandolfo M. Kaplan J. Science. 1997; 276: 1709-1712Crossref PubMed Scopus (815) Google Scholar). Antibody to Pep12p was obtained from Molecular Probes. Secondary antibody, Alexa 594-conjugated to goat anti-mouse IgG (Molecular Probes), was used at a dilution of 1:750. Images were collected as single wavelengths on an Olympus FVX confocal fluorescent microscope with a 60× Pianapo objective (1.4 numerical aperture oil) using Fluoview 2.0.39 software. Z sections (0.5 μm) are shown. Rabbit anti-Snf7p antibody was obtained from M. Babst (University of Utah). Cells were prepared for immunofluorescence as described previously (17Babcock M. de Silva D. Oaks R. Davis-Kaplan S. Jiralerspong S. Montermini L. Pandolfo M. Kaplan J. Science. 1997; 276: 1709-1712Crossref PubMed Scopus (815) Google Scholar) and imaged using an Olympus epifluorescence microscope.Vta1p-GFP and CPS-GFP Microscopy—Strains expressing either Vta1p-GFP or CPS-GFP were grown to midlog phase, mounted on slides, and imaged using an Olympus epifluorescence microscope as described above for Ste3p-GFP imaging.RESULTSIdentification of VTA1—We identified VTA1 (VPS twenty associated) in a screen for abnormal vacuolar morphology using the Research Genetics deletion collection of homozygous diploids. Wild type and Δvta1 cells incubated with a 10 μm concentration of the vacuolar dye CDCFDA showed normal multilobed vacuolar morphology (data not shown). When the concentration of the dye was increased to 200 μm, the Δvta1 cells, in contrast to wild type cells, exhibited a non-lobed vacuole (Fig. 1A). Greater than 85% of Δvta1 cells exhibited non-lobed vacuoles compared with only 10% of wild type cells. This phenotype was confirmed in a haploid strain, vta1-5a, generated by two rounds of backcrossing (data not shown). Staining with LysoSensor Green DND-189, a pH-dependent vacuolar dye, was not different in the Δvta1 strain compared with the wild type (data not shown).VTA1 has been classified as a class E VPS gene (18Yeo S.C. Xu L. Ren J. Boulton V.J. Wagle M.D. Liu C. Ren G. Wong P. Zahn R. Sasajala P. Yang H. Piper R.C. Munn A.L. J. Cell Sci. 2003; 116: 3957-3970Crossref PubMed Scopus (79) Google Scholar). Deletion of any of the other characterized class E VPS genes resulted in the same non-lobed vacuolar morphology in response to CDCFDA as seen in the Δvta1 strain (data not shown). This phenotype was seen in the Research Genetics homozygous diploid deletion strains and in haploid deletion strains generated in our laboratory. Deletion of VPS33 (class C), VPS39 (class B) (19Raymond C.K. Howald-Stevenson I. Vater C.A. Stevens T.H. Mol. Biol. Cell. 1992; 3: 1389-1402Crossref PubMed Scopus (671) Google Scholar), or non-VPS related genes did not result in the altered vacuolar morphology in response to CDCFDA (data not shown), suggesting that this is a phenotype specific to deletion of class E VPS genes.We examined the uptake of the membrane dye FM4-64 to determine whether endocytosis was altered in the Δvta1 strain. Inspection of Δvta1 cells revealed a kinetic delay in the trafficking of FM4-64 to the vacuole (Fig. 1B). This delay was most evident between 45 (as shown) and 90 min (data not shown) after internalization of the dye. The delay resulted in an accumulation of the dye in a prevacuolar compartment. As shown by the data presented below, this compartment is a class E vesicle.Phenotypes of a VTA1 Deletion Strain—Mutations in VPS genes often result in abnormal vacuole morphology as well as missorting of vacuolar hydrolases. To examine whether deletion of VTA1 affects sorting of CPS, we utilized a GFP-tagged CPS protein in which the GFP epitope was on the cytoplasmic tail of CPS. In wild type cells, the chimeric protein is sorted into the MVB and is then delivered to the lumen of the vacuole. Within the lumen of the vacuole CPS is released from the membrane as an active hydrolase (3Katzmann D.J. Babst M. Emr S.D. Cell. 2001; 106: 145-155Abstract Full Text Full Text PDF PubMed Scopus (1110) Google Scholar). The remainder of the molecule, GFP attached to the transmembrane domain of CPS, stays membrane-associated and is then further cleaved releasing a soluble GFP molecule of ∼27 kDa. If the protein is not sorted into the MVB, the GFP does not get released and remains membrane-bound. The CPS portion of the fusion protein can still be cleaved, but the GFP portion remains associated with the transmembrane domain as evidenced by the slightly larger band (∼33 kDa) seen by Western analysis using a GFP antibody (20Reggiori F. Pelham H.R. EMBO J. 2001; 20: 5176-5186Crossref PubMed Scopus (271) Google Scholar). The missorting of CPS-GFP can be followed by fluorescence microscopy analysis (Fig. 2A). In wild type cells, GFP fluorescence was found in the lumen of the vacuole. In most class E VPS mutants, fluorescence was not found in the vacuolar lumen but rather was associated with the vacuolar membrane and concentrated in the perivacuolar class E compartment. In Δvta1 cells, GFP fluorescence was found in the vacuolar lumen with a significant fraction still associated with the vacuolar membrane.Fig. 2CPS is partially missorted in Δvta1 and Δvps60 cells. A, wild type (BY4741) or the indicated deletion strains expressing CPS-GFP were analyzed by fluorescence microscopy. B, the indicated strains expressing a CPS-GFP fusion protein were homogenized and analyzed by Western analysis as described under “Materials and Methods.” The indicated bands represent GFP that has been cleaved from CPS. DIC, differential interference contrast.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Missorting of CPS-GFP in Δvta1 cells can also be shown through Western analysis (Fig. 2B). Deletion of class E genes results in the absence of soluble GFP, reflecting the defective processing of CPS-GFP. The missorting of CPS in Δvta1 cells contrasts with cells deleted for VPS20 or VPS4, which encode characterized class E Vps proteins (3Katzmann D.J. Babst M. Emr S.D. Cell. 2001; 106: 145-155Abstract Full Text Full Text PDF PubMed Scopus (1110) Google Scholar, 5Babst M. Katzmann D.J. Estepa-Sabal E.J. Meerloo T. Emr S.D. Dev. Cell. 2002; 3: 271-282Abstract Full Text Full Text PDF PubMed Scopus (677) Google Scholar). In Δvta1 cells, both soluble and membrane-bound GFP cleavage products were seen. We also examined the distribution of CPS-GFP in cells deleted for VPS60. VPS60 encodes a coiled-coil protein homologous to VPS32/SNF7 and other members of the ESCRT III complex (7Kranz A. Kinner A. Kolling R. Mol. Biol. Cell. 2001; 12: 711-723Crossref PubMed Scopus (61) Google Scholar). Deletion of VPS60 does not lead to a growth defect on raffinose but does lead to a delay in FM4-64 trafficking to the vacuole (7Kranz A. Kinner A. Kolling R. Mol. Biol. Cell. 2001; 12: 711-723Crossref PubMed Scopus (61) Google Scholar). By fluorescence, the distribution of CPS-GFP in Δvps60 cells appeared similar to that seen in Δvps4 and Δvps20 cells (Fig. 2A). By Western analysis, the misprocessing of CPS-GFP was similar to that seen in Δvta1 cells as both soluble and membrane-bound GFP cleavage products were seen (Fig. 2B).Plasma membrane proteins destined for degradation are also sorted through the MVB. Ste3p, the a-factor receptor, is present on the plasma membrane and is trafficked to the vacuole for degradation in a ubiquitin-dependent process (21Davis N.G. Horecka J.L. Sprague Jr., G.F. J. Cell Biol. 1993; 122: 53-65Crossref PubMed Scopus (190) Google Scholar, 22Roth A.F. Davis N.G. J. Cell Biol. 1996; 134: 661-674Crossref PubMed Scopus (145) Google Scholar). The half-life of Ste3p-HA was increased in Δvta1 cells compared with wild type cells (Fig. 3, A and B). Fluorescence microscopy revealed that in wild type cells, Ste3p-GFP was delivered to the lumen of the vacuole, while in Δvta1 cells, Ste3p-GFP accumulated in a prevacuolar structure and on the limiting membrane of the vacuole (Fig. 3C). The prevacuolar structure that contained Ste3p-GFP also accumulated FM4-64. A similar result was observed for Ste2p, the α-factor receptor (Fig. 4). The missorting of Ste2p in Δvta1 cells was evident but less severe than that seen in Δvps4 or Δvps20 cells. The pattern of missorting of Ste2p-GFP in Δvps60 cells was similar to that seen in Δvta1 cells.Fig. 3Analysis of Ste3p degradation and localization. A, 0, 20, 40, 60, 80, and 100 min after the addition of cycloheximide, lysates were generated from DY3444 (wild type) and DY3444Δvta1 strains expressing Ste3p-HA encoded on a plasmid as described under “Materials and Methods.” Protein was detected by Western analysis with a polyclonal HA antibody. B, quantification of the data in A. C, DY3444 and DY3444Δvta1 strains expressing Ste3p-GFP were labeled with FM4-64 as described under “Materials and Methods” and analyzed by fluorescence microscopy. DIC, differential interference contrast.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Fig. 4Analysis of Ste2p localization. The indicated strains expressing Ste2p-GFP were labeled with FM4-64 as described under “Materials and Methods” and analyzed by fluorescence microscopy. DIC, differential interference contrast.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Deletions in genes that lead to defective MVB formation can result in an inability to grow on raffinose and/or temperature sensitivity (7Kranz A. Kinner A. Kolling R. Mol. Biol. Cell. 2001; 12: 711-723Crossref PubMed Scopus (61) Google Scholar). Similar to Δvps60, Δvta1 cells were able to grow at both 37 °C and 39 °C and to grow on raffinose at 30 °C. A growth defect was only observed when the Δvta1 cells were grown on raffinose at 39 °C (Fig. 5A).Fig. 5Growth defects of Δvta1. A, BY4743 (wild type), Δvps20, and Δvta1 strains transformed with the indicated plasmid were grown in CM-uracil to midlog phase. Cells (104) were spotted on YEP raffinose plates and grown at 39 °C for 3 days. B, BY4743 and Δvta1 strains transformed with the indicated plasmids were grown in CM-uracil to midlog phase. Cells (104) were spotted on YPD containing 20 μg/ml calcofluor white and grown at 30 °C for 3 days.View Large Image Figure ViewerDownload Hi-res image Download (PPT)In the course of examining the role of VPS genes in cell wall biosynthesis, we observed that deletion of many of the class E genes results in altered sensitivity to calcofluor white, a chemical that affects cell viability by binding to chitin and destabilizing the cell wall (23Lussier M. White A.M. Sheraton J. di Paolo T. Treadwell J. Southard S.B. Horenstein C.I. Chen-Weiner J. Ram A.F. Kapteyn J.C. Roemer T.W. Vo D.H. Bondoc D.C. Hall J. Zhong W.W. Sdicu A.M. Davies J. Klis F.M. Robbins P.W. Bussey H. Genetics. 1997; 147: 435-450Crossref PubMed Google Scholar). A growth defect was seen when Δvta1 cells were grown with 20 μg/ml calcofluor white (Fig. 5B). To verify that this phenotype segregated as a single locus, we sporulated the Δvta1 diploid and backcrossed the haploid to the parental strain (BY4741). On each cross, calcofluor white hypersensitivity segregated 2:2 (n = 6) with deletion of VTA1 (data not shown). The severity of the calcofluor white pheno-type permitted us to examine the effect of complementing plasmids. Transformation of Δvta1 cells (S288c background) with either a high or low copy plasmid containing VTA1 resulted in complementation of both calcofluor white sensitivity (Fig. 5B) and growth on raffinose at 39 °C (Fig. 5A). Addition of carboxyl-terminal epitopes (c-Myc, TAP, and GFP) did not affect complementation (Fig. 5 and data not shown).In contrast to the calcofluor white sens

Abstract Ferroportin (Fpn) (IREG1, SLC40A1, MTP1) is an iron transporter, and mutations in Fpn result in a genetically dominant form of iron overload disease. Previously, we demonstrated that Fpn is a multimer and that mutations in Fpn are dominant negative. Other studies have suggested that Fpn is not a multimer and that overexpression or epitope tags might affect the localization, topology, or multimerization of Fpn. We generated wild-type Fpn with 3 different epitopes, GFP, FLAG, and c-myc, and expressed these constructs in cultured cells. Co-expression of any 2 different epitope-tagged proteins in the same cell resulted in their quantitative coimmunoprecipitation. Treatment of Fpn-GFP/Fpn-FLAG–expressing cells with crosslinking reagents resulted in the crosslinking of Fpn-GFP and Fpn-FLAG. Western analysis of rat glioma C6 cells or mouse bone marrow macrophages exposed to crosslinking reagents showed that endogenous Fpn is a dimer. These results support the hypothesis that the dominant inheritance of Fpn–iron overload disease is due to the dominant-negative effects of mutant Fpn proteins.

YIL023C encodes a member of the SLC39A, or ZIP, family, which we refer to as yeast KE4 (YKE4) after its mouse ortholog.Yke4p was localized to the endoplasmic reticulum (ER) membrane using Yke4p-specific antiserum.YKE4 is not an essential gene; however, deletion of YKE4 resulted in a sensitivity to calcofluor white and poor growth at 36 °C on respiratory substrates containing high zinc.Overexpression of transition metal transporters Zrc1p and Cot1p or the mouse orthologue mKe4 in ⌬yke4 suppressed the poor growth at 36 °C on respiratory substrates.We found that the role of Yke4p depends on the zinc status of the cells.In a zinc-adequate environment, Yke4p transports zinc into the secretory pathway, and the deletion of YKE4 leads to a zinc-suppressible cell wall defect.In high zinc medium, transport of zinc into the secretory pathway through Yke4p is a way to eliminate zinc from the cytosol, and deletion of YKE4 leads to toxic zinc accumulation in the cytosol.Under low cytosolic zinc conditions, however, Yke4p removes zinc from the secretory pathway, and deletion of YKE4 partially compensates for the loss of Msc2p, an ER zinc importer, and therefore helps to alleviate ER stress.In our model, Yke4p balances zinc levels between the cytosol and the secretory pathway, whereas the previously described Msc2p-Zrg17p ER zinc importer complex functions mainly in zinc-depleted conditions to ensure a ready supply of zinc essential for ER functions, such as phospholipid biosynthesis and unfolded protein response.Zinc is not redox-active; however, its ability to form multiple bonds has made it an important structural component in hundreds of different enzymes; about 3% of human genes are thought to encode zinc-binding proteins (1).Eukaryotic zinc transporters are grouped into two families, the cation diffusion family (CDF or SLC30) and the ZRT, IRT-like protein (ZIP or SLC39) family (2, 3).Members of the CDF family include the yeast Zrc1p, Cot1p, Msc2p, and Zrg17p proteins and the human and mouse ZNT1-8.These transporters are thought to be proton-metal antiporters.Based on sequence similarity, there are now hundreds of proteins in the current sequence data bases belonging to the ZIP family.

The intracellular protozoan Leishmania replicates in parasitophorous vacuoles (PV) that share many features with late endosomes/lysosomes. L. amazonensis PVs expand markedly during infections, but the impact of PV size on parasite intracellular survival is still unknown. Here we show that host cells infected with L. amazonensis upregulate transcription of LYST/Beige, which was previously shown to regulate lysosome size. Mutations in LYST/Beige caused further PV expansion and enhanced L. amazonensis replication. In contrast, LYST/Beige overexpression led to small PVs that did not sustain parasite growth. Treatment of LYST/Beige over-expressing cells with vacuolin-1 reversed this phenotype, expanding PVs and promoting parasite growth. The opposite was seen with E-64d, which reduced PV size in LYST-Beige mutant cells and inhibited L. amazonensis replication. Enlarged PVs appear to protect parasites from oxidative damage, since inhibition of nitric oxide synthase had no effect on L. amazonensis viability within large PVs, but enhanced their growth within LYST/Beige-induced small PVs. Thus, the upregulation of LYST/Beige in infected cells functions as a host innate response to limit parasite growth, by reducing PV volume and inhibiting intracellular survival.

Small-for-gestational-age (SGA) neonates, infants of diabetic mothers (IDM) and very-low-birth weight premature neonates (VLBW) are reported to have increased risk for developing iron deficiency and possibly associated neurocognitive delays.We conducted a pilot study to assess iron status at birth in at-risk neonates by measuring iron parameters in umbilical cord blood from SGA, IDM, VLBW and comparison neonates.Six of the 50 infants studied had biochemical evidence of iron deficiency at birth. Laboratory findings consistent with iron deficiency were found in one SGA, one IDM, three VLBW, and one comparison infant. None of the infants had evidence of iron deficiency anemia.Evidence of biochemical iron deficiency at birth was found in 17% of screened neonates. Studies are needed to determine whether these infants are at risk for developing iron-limited erythropoiesis, iron deficiency anemia or iron-deficient neurocognitive delay.

Erythropoietin (EPO) signaling is critical to many processes essential to terminal erythropoiesis. Despite the centrality of iron metabolism to erythropoiesis, the mechanisms by which EPO regulates iron status are not well-understood. To this end, here we profiled gene expression in EPO-treated 32D pro-B cells and developing fetal liver erythroid cells to identify additional iron regulatory genes. We determined that FAM210B, a mitochondrial inner-membrane protein, is essential for hemoglobinization, proliferation, and enucleation during terminal erythroid maturation. <i>Fam210b</i> deficiency led to defects in mitochondrial iron uptake, heme synthesis, and iron–sulfur cluster formation. These defects were corrected with a lipid-soluble, small-molecule iron transporter, hinokitiol, in <i>Fam210b</i>-deficient murine erythroid cells and zebrafish morphants. Genetic complementation experiments revealed that FAM210B is not a mitochondrial iron transporter but is required for adequate mitochondrial iron import to sustain heme synthesis and iron–sulfur cluster formation during erythroid differentiation. FAM210B was also required for maximal ferrochelatase activity in differentiating erythroid cells. We propose that FAM210B functions as an adaptor protein that facilitates the formation of an oligomeric mitochondrial iron transport complex, required for the increase in iron acquisition for heme synthesis during terminal erythropoiesis. Collectively, our results reveal a critical mechanism by which EPO signaling regulates terminal erythropoiesis and iron metabolism.

<i>Saccharomyces cerevisiae</i>can accumulate iron through the uptake of siderophore-iron. Siderophore-iron uptake can occur through the reduction of the complex and the subsequent uptake of iron by the high affinity iron transporter Fet3p/Ftr1p. Alternatively, specific siderophore transporters can take up the siderophore-iron complex. The pathogenic fungus <i>Candida albicans</i> can also take up siderophore-iron. Here we identify a<i>C. albicans</i> siderophore transporter, CaArn1p, and characterize its activity. <i>CaARN1</i> is transcriptionally regulated in response to iron. Through expression studies in <i>S. cerevisiae</i> strains lacking endogenous siderophore transporters, we demonstrate that CaArn1p specifically mediates the uptake of ferrichrome-iron. Iron-ferrichrome and gallium-ferrichrome, but not desferri-ferrichrome, could competitively inhibit the uptake of iron from ferrichrome. Uptake of siderophore-iron resulting from expression of <i>CaARN1</i> under the control of the<i>MET25</i>-promoter in <i>S. cerevisiae</i> was independent of the iron status of the cells and of Aft1p, the iron-sensing transcription factor. These studies demonstrate that the expression of CaArn1p is both necessary and sufficient for the nonreductive uptake of ferrichrome-iron and suggests that the transporter may be the only required component of the siderophore uptake system that is regulated by iron and Aft1p.

We conducted a genome-wide screen in the budding yeast Saccharomyces cerevisiae of 4,792 homozygous diploid deletions to identify genes that function in iron metabolism. Strains unable to grow on iron-restricted medium contained deletions of genes that encode the structural components of the high affinity iron transport system (FET3, FTR1), the iron-sensing transcription factor AFT1 or genes required for the assembly of the transport system. We also identified genes that were not previously known to play a role in iron metabolism. Deletion of the gene CWH36 resulted in a severe growth defect on iron-limited medium, as well as increased sensitivity to Congo red and calcofluor white. Iron transport studies demonstrated that Δcwh36 cells have an inability to copper load apoFet3p. Furthermore, Δcwh36 cells demonstrated additional phenotypes including distorted vacuole morphology and altered kinetics of FM4-64 trafficking. We show that Δcwh36 cells have a defect in vacuolar acidification through the use of the pH-sensitive dye LysoSensor Green DND-189. In Δcwh36 cells, the vacuolar H+-ATPase is not assembled and there are reduced levels of at least one subunit of the V0 complex. The open reading frame responsible for the Δcwh36 phenotypes is YCL005W-A. This gene contains two introns, has homologues in other Saccharomyces strains, and shows weak homology to a component of the vacuolar H+-ATPase found in organisms as diverse as insect and cow. We conducted a genome-wide screen in the budding yeast Saccharomyces cerevisiae of 4,792 homozygous diploid deletions to identify genes that function in iron metabolism. Strains unable to grow on iron-restricted medium contained deletions of genes that encode the structural components of the high affinity iron transport system (FET3, FTR1), the iron-sensing transcription factor AFT1 or genes required for the assembly of the transport system. We also identified genes that were not previously known to play a role in iron metabolism. Deletion of the gene CWH36 resulted in a severe growth defect on iron-limited medium, as well as increased sensitivity to Congo red and calcofluor white. Iron transport studies demonstrated that Δcwh36 cells have an inability to copper load apoFet3p. Furthermore, Δcwh36 cells demonstrated additional phenotypes including distorted vacuole morphology and altered kinetics of FM4-64 trafficking. We show that Δcwh36 cells have a defect in vacuolar acidification through the use of the pH-sensitive dye LysoSensor Green DND-189. In Δcwh36 cells, the vacuolar H+-ATPase is not assembled and there are reduced levels of at least one subunit of the V0 complex. The open reading frame responsible for the Δcwh36 phenotypes is YCL005W-A. This gene contains two introns, has homologues in other Saccharomyces strains, and shows weak homology to a component of the vacuolar H+-ATPase found in organisms as diverse as insect and cow. The ability of yeast to grow on iron-limited medium requires the activity of the high affinity iron transport system. This system is comprised of two plasma membrane proteins, the multicopper oxidase Fet3p and the transmembrane permease Ftr1p (1Askwith C.C. de Silva D. Kaplan J. Mol. Microbiol. 1996; 20: 27-34Crossref PubMed Scopus (103) Google Scholar, 2Dancis A. J. Pediatr. 1998; 132: S24-S29Abstract Full Text Full Text PDF PubMed Google Scholar). The genes that encode these proteins are under the control of the iron-sensing transcription factor Aft1p (3Yamaguchi-Iwai Y. Ueta R. Fukunaka A. Sasaki R. J. Biol. Chem. 2002; 277: 18914-18919Abstract Full Text Full Text PDF PubMed Scopus (143) Google Scholar). In the absence of iron, Aft1p translocates from the cytosol to the nucleus and induces the transcription of at least 15 different genes that comprise the iron-regulon. Fet3p and Ftr1p must be coordinately synthesized for both proteins to be properly targeted through the secretory apparatus to the cell surface (4Stearman R. Yuan D.S. Yamaguchi-Iwai Y. Klausner R.D. Dancis A. Science. 1996; 271: 1552-1557Crossref PubMed Scopus (582) Google Scholar, 5Askwith C. Kaplan J. J. Biol. Chem. 1997; 272: 401-405Abstract Full Text Full Text PDF PubMed Scopus (124) Google Scholar). The activity of the multicopper oxidase Fet3p requires copper and copper loading of apoFet3p is dependent upon the expression of genes involved in copper transport. Copper enters the cell via the cell surface copper transporters Ctr1p, Ctr3p, and can be transported into the post-Golgi compartment in which apoFet3p is loaded via the copper transporter Ccc2p (1Askwith C.C. de Silva D. Kaplan J. Mol. Microbiol. 1996; 20: 27-34Crossref PubMed Scopus (103) Google Scholar, 2Dancis A. J. Pediatr. 1998; 132: S24-S29Abstract Full Text Full Text PDF PubMed Google Scholar, 6Kosman D.J. Mol. Microbiol. 2003; 47: 1185-1197Crossref PubMed Scopus (259) Google Scholar). Proper targeting of the Fet3p/Ftr1p complex to the cell surface also requires genes involved in vesicular traffic. In the absence of proper copper homeostasis or appropriate vesicular trafficking, an inactive apoFet3/Ftr1p complex is translocated to the cell surface (7Radisky D.C. Snyder W.B. Emr S.D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5662-5666Crossref PubMed Scopus (78) Google Scholar, 8Yuan D.S. Dancis A. Klausner R.D. J. Biol. Chem. 1997; 272: 25787-25793Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar), and cells are unable to grow on low iron medium. To identify genes required for proper targeting/expression of Fet3p, we took advantage of the low iron growth phenotype of cells lacking a functional Fet3p. Using a genomic screen, which employed an arrayed collection of homozygous diploid deletion strains, we identified genes required for growth on iron-limited medium. In particular, we characterize a novel gene that when deleted leads to defective vacuolar acidification, failure to copper load apoFet3, and consequently defective iron transport. Media and Cells—The collection of homozygous diploids (Release 1 and Release 2) BY4743 (MATa/MATα his3Δ1/his3Δ1, ura3Δ0/ura3Δ0, leu2Δ0/leu2Δ0, lys2Δ0/+, met15Δ0/+) from Research Genetics was employed for the genetic screen. A 96-pin replicator was used to transfer 1 μl of a cell suspension from wells in a master plate to wells in a 96-well plate containing 100 μl of YPD (1% yeast extract, 2% peptone (Difco) 1.0% agarose, and 2.0% dextrose)/well. Cells were grown to saturation in a 30 °C incubator (usually 48 h). The volume in the well was then brought to ∼250 μl (outside wells lost more liquid due to evaporation). This plate became the stock for subsequent plating to solid media. A 96-pin replicator was used to plate cells (0.1 μl) from liquid stock plates to agarose plates containing selective agents. Before reuse the replicator was washed once in 3% bleach, three times in sterile H2O, once in 95% ethanol and then flamed and allowed to cool. The plates were incubated at 30 °C and examined 17–24 h after pinning. Growth was scored by a single observer using a subjective scale of 0–5, with 0 indicating no growth; 1, marginal growth; 2, medium growth; 3, good growth; 4, very good growth; 5, excellent growth. The media employed was YPD. For iron-limited plates, 40 μm BPS 1The abbreviations used are: BPSbathophenanthroline disulfonateCMD1calmodulinCMcomplete minimal mediaCPYcarboxypeptidase YCPScarboxypeptidase SGFPgreen fluorescent protein. (ICN) for CM or 90 μm BPS for YPD was used with the addition of either 2.5 μm FeSO4 or 5 μm FeSO4. Plates with additional metals had either 50 μm CuSO4 or 100 μm FeSO4. For growth of strains on Research Genetic plates numbering 370–372 and 380–381, 100 μm riboflavin was added to the various media. Strains of interest were re-screened to confirm the low iron growth phenotype. bathophenanthroline disulfonate calmodulin complete minimal media carboxypeptidase Y carboxypeptidase S green fluorescent protein. Calcofluor white plates were made by adding calcofluor white (Sigma, fluorescent brightener 28) to a final concentration of 0.001% in YPD. Congo red was added to a final concentration of 0.01% in YPD. Molecular Biology—DNA transformations of Escherichia coli and Saccharomyces cerevisiae were performed as per manufacturer's instructions (Promega) and standard procedures (9Jiang Y.W. Stillman D. Genetics. 1995; 140: 103-114Crossref PubMed Google Scholar). A deletion of CWH36/YCL007C was generated in a W303-derived strain by using primers FRDKanCWH36 and REVKanCWH36 to amplify the KanMX4 cassette in the BY4743 derived Δcwh36. The primers/oligonucleotides (oligos) are listed in Supplementary Table I. A wild-type W303-diploid (DY1640 MATa/MATα, ade2–1/ade2–1, his3–11/his3–11, leu2–3/leu2–112, trp1–1/trp1–1, ura3–52/ura3–52, can1–100(oc)/can1–100(oc)) was transformed with the PCR product, and transformants were selected for on G418 plates. Cells were sporulated, tetrads dissected, and the spores analyzed. A wild-type allele of CWH36 was cloned into both low and high copy plasmids. We also generated plasmids with CWH36 carrying a 3′-FLAG epitope. The wild-type allele was generated from genomic DNA (BY4743) using the following primers to produce inserts containing CWH36 with its own promoter plus and minus a C-terminal FLAG tag. The same forward primer FRDCWH36Flag was used for all constructs. To clone CWH36 into a high copy (pTF63) vector we used the reverse primer REVCWH36pTF63. The PCR product was inserted into pTF63 using the EcoRI and NotI sites. To generate a low copy plasmid containing CWH36 we used the reverse primer REVCWH36YCp33, and the PCR product was inserted into YCp33 at the EcoRI site. For a FLAG tag insertion into pTF63 (high copy) or YCp33, a PCR product was generated using REV2CWH36Flag. The PCR product was cloned into both vectors using EcoRI and BamHI. Miscellaneous Procedures—FM4-64 uptake was performed as described (10Vida T.A. Emr S.D. J. Cell Biol. 1995; 128: 779-792Crossref PubMed Scopus (1136) Google Scholar). Immunofluorescence was performed as described previously (11Li L. Chen O.S. McVey Ward D. Kaplan J. J. Biol. Chem. 2001; 276: 29515-29519Abstract Full Text Full Text PDF PubMed Scopus (273) Google Scholar) using primary antibodies directed against Fet3p (rabbit) generated in our laboratory, FLAG (M2, Sigma), Pep12p (Molecular Probes) and vacuolar H+-ATPase subunits (Molecular Probes). Secondary antibodies included Alexa 594-conjugated goat anti-rabbit and Alexa 488- or 594-conjugated goat anti-mouse (Molecular Probes). Images were captured at equivalent exposure times by an Olympus epifluorescent microscope using a ×100 objective and Magnafire software. CPY secretion was performed as described (12Rothman J.H. Stevens T.H. Cell. 1986; 47: 1041-1051Abstract Full Text PDF PubMed Scopus (298) Google Scholar) using Protran nitrocellulose membranes from Schleicher and Schuell. Missorting of CPS was determined using GFP-CPS as described (13Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1021) Google Scholar). Iron transport activity was performed as described (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar), with the following modifications. For the copper loading of apoFet3p cells (50 μl) were incubated at 0 °C with 200 μl of assay buffer in the presence or absence of ascorbate and copper. After 30 min of incubation, 250 μl of a copper-free buffer containing ascorbate and 59Fe was added, and iron uptake assayed as per published procedures (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar). Western blot analysis was performed as described (15Ardon O. Bussey H. Philpott C. Ward D.M. Davis-Kaplan S. Verroneau S. Jiang B. Kaplan J. J. Biol. Chem. 2001; 276: 43049-43055Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar) using polyvinylidene difluoride membranes probed with antibodies to the subunits of the vacuolar H+-ATPase (Molecular Probes, 1:1,000) followed by peroxidase-conjugated goat anti-mouse antibody (Jackson ImmunoResearch Laboratories Inc, 1:10,000). Western blots were developed using the chemiluminescence detection reagent Western Lightning (PerkinElmer Life Sciences) as per the manufacturer's instructions. Staining with LysoSensor Green DND-189 (Molecular Probes) was performed as described (16Perzov N. Padler-Karavani V. Nelson H. Nelson N. J. Exp. Biol. 2002; 205: 1209-1219Crossref PubMed Google Scholar). S1 analysis was performed as described (17Chen O.S. Hemenway S. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 2002; 99: 16922-16927Crossref PubMed Scopus (37) Google Scholar). RT-PCR was performed using RT-PCR Ready-to-Go Beads (Amersham Biosciences) using the manufacturer's directions and oligos listed in Supplementary Table I. We screened the yeast homozygous diploid deletion collection for their ability to grow on low-iron media (18Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (587) Google Scholar). Yeast that have a functional high affinity iron transport system can grow on low iron medium, while mutations in either the structural components of the transport system or in the assembly of the transport system result in impaired growth. Fig. 1A is an example of the original screen showing growth differences of two deletion strains ΔYCL005W and ΔYCL007C/Δcwh36. The majority of the deletion strains plated on low iron medium grew comparably to wild-type cells (data not shown). A large number of strains showed mild growth retardation on iron-limited medium (data not shown). At least 17 strains, however, showed a severe growth defect that could be suppressed by the addition of iron (data not shown). The validity of the screen was shown by the identification of deletion strains expected to grow poorly on low iron (Table I) including: deletion of the genes that encode the cell surface high affinity iron transport system (FET3 and FTR1), the iron-sensing transcription factor AFT1, genes required for copper assembly of the multicopper oxidase Fet3p (CTR1, CCC2, GEF1), and genes required for vesicular acidification (GEF2 also known as VMA3/CUP5). The screen also identified four genes (ZAP1, PKR1, BEM2, and CWH36) whose role in iron metabolism is unknown.Table IGenes required for growth on low iron The deletions strains in the table show poor or no growth on medium made iron-restricted through the addition of the iron chelator BPS. See text for details. The */** denotes opposing ORFs with identical plate phenotypes.Genes that encode iron transporters or regulatorsGenes required for the copper loading of Fet3pUnknownsFET3Copper transportZAP1FTR1CTR1*CWH36AFT1/RSC1CCC2PKR1GEF1BEM2Vacuolar acidificationYPR123C*VMA2YKL118W**VMA8VMA3/GEF2/CUP5VMA21VPH2/VMA12** Open table in a new tab Bem2p is a Rho-GTPase, that plays a role in actin-mediated vesicle movement and may affect vesicular traffic (19Wang T. Bretscher A. Mol. Biol. Cell. 1995; 6: 1011-1024Crossref PubMed Scopus (56) Google Scholar). Some strains that showed a severe iron defect could be accounted for by a deletion in a known gene that is encoded on the opposite strand of the annotated gene (Table I, asterisk). Phenotypes of Δcwh36 —We focused on CWH36 as little is known about this gene. It was originally identified in genetic screens selecting for calcofluor white hypersensitivity (20Ram A.F. Wolters A. Ten Hoopen R. Klis F.M. Yeast. 1994; 10: 1019-1030Crossref PubMed Scopus (272) Google Scholar, 21Lussier M. White A.M. Sheraton J. di Paolo T. Treadwell J. Southard S.B. Horenstein C.I. Chen-Weiner J. Ram A.F. Kapteyn J.C. Roemer T.W. Vo D.H. Bondoc D.C. Hall J. Zhong W.W. Sdicu A.M. Davies J. Klis F.M. Robbins P.W. Bussey H. Genetics. 1997; 147: 435-450Crossref PubMed Google Scholar). We confirmed the calcofluor white hypersensitivity of the Δcwh36 strain (Fig. 1B). Calcofluor white sensitivity usually results from alterations in the components of the cell wall (20Ram A.F. Wolters A. Ten Hoopen R. Klis F.M. Yeast. 1994; 10: 1019-1030Crossref PubMed Scopus (272) Google Scholar). Consistent with a cell wall defect, Δcwh36 cells are sensitive to Congo red, another agent that affects cell wall integrity (data not shown). Transformation of diploid Δcwh36 cells with either low (data not shown) or high copy CWH36 containing plasmids shows that the cell wall defects (Fig. 1B) and the low iron phenotype (Fig. 1C) are due to deletion of the same gene, as both phenotypes were complemented. Large scale deletion studies suggested that CWH36 is a non-essential gene, as a deletion in strain BY4743, which is derived from S288C, is viable. The conclusion, however, may be strain specific. We generated a Δcwh36 heterozygote in the diploid strain DY1640. Attempts to obtain tetrads were unsuccessful. Transformation of the heterozygote Δcwh36 strain with a plasmid containing CWH36 allowed for tetrad dissection and the isolation of spores. Further analysis of these spores showed that a deletion in CWH36 is lethal in the DY1640 background (data not shown). The Gene Responsible for the CWH36 Deletion Phenotype Contains Introns—Recent publications have suggested that the protein responsible for the CWH36 deletion phenotype is not the annotated protein but rather a protein encoded by an intron-containing gene on the opposite strand (YCL005W-A). This conclusion was based on an analysis of the genomes of six different Saccharomyces species (22Kellis M. Patterson N. Endrizzi M. Birren B. Lander E.S. Nature. 2003; 423: 241-254Crossref PubMed Scopus (1429) Google Scholar). A complete open reading frame encoded by CWH36 on the C-strand is only found in S. cerevisiae; the other species do not show a complete reading frame in a similar location. When the putative C-strand open reading frame was placed under the control of a MET3 promoter, which would disrupt the W-strand open reading frame, the ability to complement was lost (data not shown). This result suggests that the complementing gene is not encoded by the C-strand open reading frame. To identify which of the two strands encodes the responsible protein, we determined which of the two strands is transcribed into mRNA by S1 nuclease analysis. We obtained sequence information for YCL005W-A including the predicted splice sites and expected protein sequence. 2P. Cliften and M. Kellis, personal communication. We probed total RNA from wild-type cells with oligos specific to sequences in the putative open reading frame of the C-strand and specific to the predicted exons and introns of the W-strand. Signals were detected using oligos complementary to the first and second exon of the W-strand (Fig. 2, EXI, EXII/IIIA EXII/EXIIIB, EXIII). No signal was detected using oligos complementary to the C-strand (Fig. 2, lanes 4–7). As might be expected, probes to the putative introns did not give a signal (INI, lanes 10 and 11; and INII lanes 16 and 17). We also did not get a signal with a probe to the third exon (EXIII). This may reflect a problem with the probe or that the third exon results from a different splice site. To resolve this issue, we took advantage of the exon specific probes to do directed RT-PCR. Poly(A)+ mRNA was converted into cDNA using reverse transcriptase. Using both poly(dT) adapter primer, and an exon II-specific probe, we amplified a 362-base pair fragment. Analysis of the amplified fragment identified a sequence identical to that deduced from the genomic DNA and predicted splice sites (data not shown). The predicted protein sequence for the now annotated YCL005W-A, hereafter referred to as Cwh36p, encodes a protein of 8,381 Da. Data base analysis (BLAST) of Cwh36p reveals weak homology to a limited family of proteins in organisms as diverse as insect and cow (Fig. 3A). Two of these proteins were identified because they were co-purified with the H+-ATPase of insect vacuoles (23Merzendorfer H. Huss M. Schmid R. Harvey W.R. Wieczorek H. J. Biol. Chem. 1999; 274: 17372-17378Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar) and bovine Chromaffin granules (24Ludwig J. Kerscher S. Brandt U. Pfeiffer K. Getlawi F. Apps D.K. Schagger H. J. Biol. Chem. 1998; 273: 10939-10947Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar). These proteins show two hydrophobic domains and have a hydropathy plot similar to Cwh36p (Fig. 3B). We cloned CWH36 (YCL005W-A) with a C-terminal FLAG or Myc epitope. While the constructs were sequence-verified and able to complement the Δcwh36 phenotype, we were unable to detect a protein by Western analysis or immunofluorescence (data not shown).Fig. 3Sequence alignment and hydropathy plot of Cwh36p.A, data base analysis reveals that the protein encoded by YCL005W-A or Cwh36p has homology to proteins that are components of the vacuolar H+-ATPase of Manduca sextus (hornworm, accession number CAA06822) and the Bos taurus H+-ATPase (bovine, accession number NP_501636) from Chromaffin granules. The Homo sapiens (accession number CAA75571) and Caenorhabditis elegans (accession number P81103) proteins have not been characterized. The shading denotes homology and boxes denote identity. B, a Kyte-Doolittle hydropathy plot of Cwh36p compared with Manduca sextus (accession number CAA06822) and Bos taurus (bovine, accession number NP_501636).View Large Image Figure ViewerDownload Hi-res image Download (PPT) The Low Iron Phenotype of Δcwh36 Cells Results from Defective Copper Loading of ApoFet3p—We confirmed that the deletion strain showed a defect in iron transport by measuring 59Fe uptake. Cells with defects in the genes that encode structural elements of the iron transport system, such as Δfet3, show low iron transport activity when grown in low iron medium, and this defect cannot be overcome by incubation with copper (18Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (587) Google Scholar). In contrast, strains with defects in the assembly of holoFet3p show low levels of iron transport activity, which can be increased by addition of high copper (7Radisky D.C. Snyder W.B. Emr S.D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5662-5666Crossref PubMed Scopus (78) Google Scholar, 8Yuan D.S. Dancis A. Klausner R.D. J. Biol. Chem. 1997; 272: 25787-25793Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). When grown in iron-replete medium (YPD), Δcwh36 shows a low level of iron transport activity that is increased by preincubation of cells with copper (Fig. 4A). The level of transport is higher than in wild-type cells grown in YPD (open bars) suggesting that in iron-replete medium, Δcwh36 cells are iron-starved and respond by increasing the expression of FET3. When incubated in iron-deprived medium, Δcwh36 cells have very low levels of iron transport activity (dark gray bars), which can be increased when cells are exposed to copper (light gray bars). We observed that even in the presence of higher concentrations of copper, the level of transport activity in Δcwh36 does not reach wild-type levels (data not shown). To determine if the low iron phenotype is due to a defect in the expression of Fet3p, we examined Δcwh36 cells for the presence of Fet3p by Western analysis and immunofluorescence. Western analysis showed the presence of a normally glycosylated Fet3p (data not shown) and immunofluorescence showed the presence of Fet3p on the cell surface (Fig. 4B). The amount of fluorescence was less than in wild-type cells, consistent with the decreased amount of transport activity in the deletion strain. As the cell surface targeting of Fet3p requires Ftr1p, these results suggest that the two components of the surface transport system were both being made and that the low iron defect was not due to the absence of the Fet3p/Ftr1p complex. Strains that show defective iron transport activity can have morphologically aberrant vacuoles and a vacuolar protein sorting (VPS) phenotype (7Radisky D.C. Snyder W.B. Emr S.D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5662-5666Crossref PubMed Scopus (78) Google Scholar, 10Vida T.A. Emr S.D. J. Cell Biol. 1995; 128: 779-792Crossref PubMed Scopus (1136) Google Scholar). While the steady state size of the Δcwh36 vacuoles appeared normal, we observed a striking defect in the trafficking of the dye FM4-64. Both wild-type and Δcwh36 cells showed a similar ring of fluorescence in the plasma membrane when loaded FM4-64 at 0 °C (data not shown). Wild-type cells show accumulation of dye in vesicles and in some vacuoles as early as 10 min after internalization (Fig. 5). Following the 10-min pulse with dye, FM4-64 is found in vesicles of Δcwh36 cells; however, there is a clear difference in the amount of dye in the plasma membranes. Wild-type cells show a ring of fluorescence on the plasma membrane, whereas Δcwh36 cells do not. After a 45-min chase most of the FM4-64 in wild-type cells is localized to the vacuole. At the same time point, little dye is present in the vacuoles of Δcwh36 cells; dye is only seen in the vacuole with extended incubations (90–120 min, data not shown). Delays in FM4-64 delivery to the vacuole have been reported in a variety of mutants including vacuolar pH mutants (16Perzov N. Padler-Karavani V. Nelson H. Nelson N. J. Exp. Biol. 2002; 205: 1209-1219Crossref PubMed Google Scholar) and class E VPS mutants, which show a defect in the formation of multivesicular bodies (13Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1021) Google Scholar). Another phenotype associated with class E defects is aberrant processing of CPS (13Katzmann D.J. Odorizzi G. Emr S.D. Nat. Rev. Mol. Cell. Biol. 2002; 3: 893-905Crossref PubMed Scopus (1021) Google Scholar). We transformed Δcwh36 cells with a plasmid containing a CPS-GFP construct and observed no alterations in CPS processing (data not shown). We examined Δcwh36 for defects in CPY sorting and confirmed the observation that Δcwh36 cells have a weak CPY secretion phenotype (data not shown and Ref. 24Ludwig J. Kerscher S. Brandt U. Pfeiffer K. Getlawi F. Apps D.K. Schagger H. J. Biol. Chem. 1998; 273: 10939-10947Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar). To further delineate the defect in copper-loading of apoFet3p, we examined the localization of Gef1p-GFP in Δcwh36 cells. Gef1p is a voltage-gated chloride channel that is required for the copper-loading of apoFet3p (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar, 25Gaxiola R.A. Yuan D.S. Klausner R.D. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4046-4050Crossref PubMed Scopus (151) Google Scholar). It is localized to a post-Golgi compartment that also contains Ccc2p, an ATP-dependent copper transporter (25Gaxiola R.A. Yuan D.S. Klausner R.D. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4046-4050Crossref PubMed Scopus (151) Google Scholar). Both Gef1p and Ccc2p are required for copper loading of apoFet3p (26Yuan D.S. Stearman R. Dancis A. Dunn T. Beeler T. Klausner R.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2632-2636Crossref PubMed Scopus (393) Google Scholar). Examination of wild-type and Δcwh36 cells transformed with a GFP-tagged Gef1p showed punctate fluorescence limited to small vesicles (data not shown), similar to published studies (25Gaxiola R.A. Yuan D.S. Klausner R.D. Fink G.R. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 4046-4050Crossref PubMed Scopus (151) Google Scholar, 27Schwappach B. Stobrawa S. Hechenberger M. Steinmeyer K. Jentsch T.J. J. Biol. Chem. 1998; 273: 15110-15118Abstract Full Text Full Text PDF PubMed Scopus (109) Google Scholar). This result suggests that the defect in copper loading of apoFet3p cannot be ascribed to the mislocalization of Gef1p. Vacuolar Acidification Is Defective in Δcwh36 —The metallation of apoFet3p shows a clear pH dependence (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar). This pH dependence explains why many acidification mutants are unable to grow on respiratory substrates, as they cannot accumulate enough iron to satisfy increased mitochondrial demand for respiratory growth. These acidification mutants also do not grow on low iron medium and have apoFet3p on the cell surface (28Eide D.J. Bridgham J.T. Zhao Z. Mattoon J.R. Mol. Gen. Genet. 1993; 241: 447-456Crossref PubMed Scopus (82) Google Scholar). Struck by the similarity in iron transport and the low iron growth phenotype between Δvma8 (data not shown) and Δcwh36, we examined if other acidification mutants were calcofluor white sensitive. At least five different VMA mutants (VMA2, VMA3, VMA8, VMA12, VMA21) show increased sensitivity to calcofluor white (data not shown). A recent study reported that acidification mutants show impaired trafficking of FM4-64 (16Perzov N. Padler-Karavani V. Nelson H. Nelson N. J. Exp. Biol. 2002; 205: 1209-1219Crossref PubMed Google Scholar), similar to that seen in Δcwh36 cells. Based on these observations we examined vacuolar acidification in Δcwh36 using the pH-sensitive dye LysoSensor Green DND-189. Wild-type cells showed staining with LysoSensor Green, which highlights the vacuolar membrane (Fig. 6). Mutants defective in acidification, either in structural components of the vacuolar H+-ATPase (VMA8) or in proteins required for assembly of the vacuolar H+-ATPase (VPH2/VMA12), show essentially no vacuolar staining. Δcwh36 cells show no staining with LysoSensor Green DND-189, indicating a defect in vacuolar acidification. We postulated that the inability to develop a low vacuolar pH in Δcwh36 cells resulted from a defect in the assembly of the vacuolar H+-ATPase. To examine this possibility wild-type and Δcwh36 cells were stained with antibodies to either a subunit of the V0 membrane complex (Vph1p) or to subunits of the V1 complex (Vma1p, Vma2p). Wild-type cells showed robust staining of the vacuole with all antibodies (Fig. 7). No vacuolar staining was seen in Δcwh36 cells with any of the antibodies. Assembly of the vacuolar H+-ATPase is sequential, with the V0 subunit being required for the addition of the V1 subunit to the complex (15Ardon O. Bussey H. Philpott C. Ward D.M. Davis-Kaplan S. Verroneau S. Jiang B. Kaplan J. J. Biol. Chem. 2001; 276: 43049-43055Abstract Full Text Full Text PDF PubMed Scopus (53) Google Scholar). Examination of VMA subunits in Δcwh36 cells by Western analysis revealed a marked reduction in the amount of Vph1p, but the V1 subunits Vma1p and Vma2p were present (Fig. 8). These results suggest that the inability to develop a low vacuolar pH in Δcwh36 is due to decreased synthesis or increased turnover of the V0 subunit.Fig. 8Δcwh36 cells have decreased amounts of Vph1p. Protein extracts from BY4743, Δcwh36, Δvph1, or Δvma2 cells were normalized for cell number and examined for the presence of components of the vacuolar H+-ATPase by SDS-PAGE electrophoresis and Western blotting. The blots were probed with monoclonal antibodies against Vph1p and Gas1p (a control for loading) (A) or Vma1p and Vma2p (B), followed by a peroxidase-conjugated goat anti-mouse IgG.View Large Image Figure ViewerDownload Hi-res image Download (PPT) Analysis of iron transport in yeast has led to insights into diverse biological processes. High affinity iron transport requires the activity of two plasma membrane proteins Fet3p and Ftr1p. Fet3p is a multicopper oxidase and is copper loaded in an intracellular compartment. The proper function of Fet3p therefore requires both normal copper homeostasis and vesicular traffic. Defects in either of these processes result in the appearance of an apoFet3p on the cell surface and an inability to grow on low iron (1Askwith C.C. de Silva D. Kaplan J. Mol. Microbiol. 1996; 20: 27-34Crossref PubMed Scopus (103) Google Scholar, 2Dancis A. J. Pediatr. 1998; 132: S24-S29Abstract Full Text Full Text PDF PubMed Google Scholar). Analysis of mutants unable to grow on low iron led to the discovery of the structural components of the high affinity iron transport system as well as genes required for copper transport (29Dancis A. Haile D. Yuan D.S. Klausner R.D. J. Biol. Chem. 1994; 269: 25660-25667Abstract Full Text PDF PubMed Google Scholar), chloride transport (30Greene J.R. Brown N.H. DiDomenico B.J. Kaplan J. Eide D.J. Mol. Gen. Genet. 1993; 241: 542-553Crossref PubMed Scopus (105) Google Scholar), and vesicular traffic (8Yuan D.S. Dancis A. Klausner R.D. J. Biol. Chem. 1997; 272: 25787-25793Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar, 31Radisky D. Kaplan J. J. Biol. Chem. 1999; 274: 4481-4484Abstract Full Text Full Text PDF PubMed Scopus (137) Google Scholar). These genes were identified through genetic screens in which mutagenized cells were selected for their inability to grow on either low iron (18Askwith C. Eide D. Van Ho A. Bernard P.S. Li L. Davis-Kaplan S. Sipe D.M. Kaplan J. Cell. 1994; 76: 403-410Abstract Full Text PDF PubMed Scopus (587) Google Scholar), glycerol-ethanol media (30Greene J.R. Brown N.H. DiDomenico B.J. Kaplan J. Eide D.J. Mol. Gen. Genet. 1993; 241: 542-553Crossref PubMed Scopus (105) Google Scholar) or for the induction of iron-regulated genes (32Dancis A. Yuan D.S. Haile D. Askwith C. Eide D. Moehle C. Kaplan J. Klausner R.D. Cell. 1994; 76: 393-402Abstract Full Text PDF PubMed Scopus (567) Google Scholar). We have extended these studies using a genome-wide analysis of a homozygous diploid deletion collection. Most of the genes identified have recognizable roles in iron metabolism, as they encode either the structural components of the high affinity iron transport system or the iron-sensing transcription factor. Additionally, we also identified genes involved in copper-metabolism, CTR1 and CCC2. We identified four genes (ZAP1, CWH36, PKR1, BEM2) whose role in iron metabolism was unknown. Two of the genes have an ascribed function. BEM2 encodes a RHO-GTPase, which may be involved in vesicular traffic (19Wang T. Bretscher A. Mol. Biol. Cell. 1995; 6: 1011-1024Crossref PubMed Scopus (56) Google Scholar). A defect in vesicular traffic may lead to a defective copper loading of apoFet3p (7Radisky D.C. Snyder W.B. Emr S.D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1997; 94: 5662-5666Crossref PubMed Scopus (78) Google Scholar, 8Yuan D.S. Dancis A. Klausner R.D. J. Biol. Chem. 1997; 272: 25787-25793Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). ZAP1 encodes a transcription factor that controls the zinc-regulon (33Zhao H. Eide D.J. Mol. Cell. Biol. 1997; 17: 5044-5052Crossref PubMed Scopus (218) Google Scholar). While its role in iron metabolism is unclear, a recent study has suggested an interplay between iron and zinc, indicating that the zinc regulon may have effects on iron metabolism (34Santos R. Dancis A. Eide D. Camadro J.M. Lesuisse E. Biochem. J. 2003; 375: 247-254Crossref PubMed Google Scholar). Two of the genes, CWH36 and PKR1, had no assigned functions. We focused on analysis of CWH36 because the deletion strain had a profound inability to grow on low iron. Large-scale deletion studies suggested that CWH36 is a non-essential gene, as a deletion in strain BY4743, which is derived from S288C, is viable. Deletion of CWH36 is lethal in DY1640, which is derived from a W303 background. This result may explain why CWH36 has not been previously characterized to be important in iron metabolism or vacuolar acidification. Deletion of CWH36 was known to lead to calcofluor white hypersensitivity, although the reason for that was unknown (20Ram A.F. Wolters A. Ten Hoopen R. Klis F.M. Yeast. 1994; 10: 1019-1030Crossref PubMed Scopus (272) Google Scholar, 21Lussier M. White A.M. Sheraton J. di Paolo T. Treadwell J. Southard S.B. Horenstein C.I. Chen-Weiner J. Ram A.F. Kapteyn J.C. Roemer T.W. Vo D.H. Bondoc D.C. Hall J. Zhong W.W. Sdicu A.M. Davies J. Klis F.M. Robbins P.W. Bussey H. Genetics. 1997; 147: 435-450Crossref PubMed Google Scholar). Sequence analysis of several Saccharomyces strains (22Kellis M. Patterson N. Endrizzi M. Birren B. Lander E.S. Nature. 2003; 423: 241-254Crossref PubMed Scopus (1429) Google Scholar), as well as the experiments reported herein, demonstrate that Cwh36p is encoded by an intron-containing gene on the W-strand. The deduced protein shows homology to a small hydrophobic protein found in eukaryotes as diverse as insect (23Merzendorfer H. Huss M. Schmid R. Harvey W.R. Wieczorek H. J. Biol. Chem. 1999; 274: 17372-17378Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar) and cow (24Ludwig J. Kerscher S. Brandt U. Pfeiffer K. Getlawi F. Apps D.K. Schagger H. J. Biol. Chem. 1998; 273: 10939-10947Abstract Full Text Full Text PDF PubMed Scopus (253) Google Scholar). The protein was identified as a component of the H+-ATPase, although its function remains unknown. We demonstrated through the use of pH-sensitive dyes that Δcwh36 has a defect in vacuolar acidification. We were unable to detect a protein by epitope tagging, even though the epitope-tagged construct could complement all of the phenotypes of Δcwh36 cells. It may well be that the protein is expressed at low levels or that, if the protein is vacuolar, the C-terminal epitope is cleaved. Localization of the protein may require the generation of antibodies against the protein. Many of the phenotypes seen in Δcwh36 can be explained by defective acidification. The vacuolar H+-ATPase is responsible for acidification of post-Golgi vesicular compartments. Biochemical and genetic studies show that the copper loading of apoFet3p, which occurs in a post-Golgi compartment, requires an acidic pH (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar,23Merzendorfer H. Huss M. Schmid R. Harvey W.R. Wieczorek H. J. Biol. Chem. 1999; 274: 17372-17378Abstract Full Text Full Text PDF PubMed Scopus (39) Google Scholar 36). Defective copper loading of apoFet3p results in an apoFet3p on the cell surface. A cell surface apoFet3p results in other phenotypes seen in vacuolar acidification mutants: an inability to grow on low iron or glycerol ethanol, a delay in vacuolar staining by FM4-64, and calcofluor white sensitivity. We observed that acidification mutants, such as Δvma8 and Δvph2, are also calcofluor white and Congo red sensitive. These results suggest that defects in cell wall biosynthesis may be a common result of defective acidification. Many VPS mutants show calcofluor white sensitivity, although some class E VPS mutants are calcofluor white resistant. 3S. Shiflett, unpublished data. Incubation of Δcwh36 cells in iron-replete or iron-limited medium results in the appearance of apoFet3p on the cell surface. We noticed that the amount of Fet3p (apo or holo) in iron-starved Δcwh36 cells is less than seen in iron-starved wild-type cells. The presence of cell surface apoFet3p can be ascribed to defective copper loading as a consequence of reduced acidification of the vesicular apparatus. While defects in vacuolar pH also lead to missorting of secretory components (vacuolar protein sorting mutants), many of these mutants have normal levels of cell surface Fet3p, although much of it may be in the apo form (8Yuan D.S. Dancis A. Klausner R.D. J. Biol. Chem. 1997; 272: 25787-25793Abstract Full Text Full Text PDF PubMed Scopus (147) Google Scholar). Previous studies have shown that failure to copper-load apoFet3p results in wild-type or even higher than wild-type levels of cell surface apoFet3p. Such results were seen in mutants of the vesicular copper transporter CCC2 or the vesicular chloride transporter GEF1 (14Davis-Kaplan S.R. Askwith C.C. Bengtzen A.C. Radisky D. Kaplan J. Proc. Natl. Acad. Sci. U. S. A. 1998; 95: 13641-13645Crossref PubMed Scopus (112) Google Scholar, 26Yuan D.S. Stearman R. Dancis A. Dunn T. Beeler T. Klausner R.D. Proc. Natl. Acad. Sci. U. S. A. 1995; 92: 2632-2636Crossref PubMed Scopus (393) Google Scholar). However, we observed that deletion of CCC2 or GEF1 in diploid BY4743 cells also led to half-normal Fet3p levels when the cells were iron-starved (data not shown). Furthermore, deletion in this strain of other genes that encode subunits of the H+-ATPase also lead to less than wild-type levels of cell surface Fet3p. Therefore the decreased maximal induction of Fet3p is not unique to deletion of CWH36. Our data suggest that growth inhibition due to iron limitation affects the level of Fet3p in the diploid BY4743 strain. We thank Paul Cliften and Manolis Kellis for sending us the annotated sequence of CWH36. We thank Craig D. Kaplan and Opal Chen for their help in analyzing the mRNA for CWH36. We also wish to thank the members of the Kaplan laboratory for help in editing this manuscript. Support for use of Core facilities was provided through a National Institutes of Health Cancer Center Support Grant (NCI-CCSG P30CA 42014). Download .pdf (.01 MB) Help with pdf files

ABSTRACT Human metapneumovirus (hMPV) has been associated with respiratory illnesses like those caused by human respiratory syncytial virus (HRSV) infection. Similar to other pneumoviruses, genetic diversity has been reported for hMPV. Little information is currently available on the genetic variability of the G glycoprotein (G), which is the most variable gene in RSV and avian pneumovirus. The complete nucleotide sequences of the G open reading frame (ORF) of 24 Canadian hMPV isolates were determined. Phylogenetic analysis showed the existence of two major groups or clusters (1 and 2). All but one of the hMPV isolates that we examined belonged to cluster 1. Additional genetic variability was observed in cluster 1, which separated into two genetic subclusters. Within cluster 1 the nucleotide sequence identity for the G ORF was 74.2 to 100%, and the identity for the predicted amino acid sequence was 61.4 to 100%. The G genes of cluster 1 isolates were more divergent from the cluster 2 isolates, with 45.6 to 50.5% and 34.2 to 37.2% identity levels for the nucleotide and amino acid sequences, respectively. Sequence analysis also revealed changes in stop codon usage, resulting in G proteins of different lengths (217, 219, 228, and 236 residues). Western blot analysis with the use of hMPV-specific polyclonal antisera to each hMPV cluster showed significant antigenic divergence between the G proteins of clusters 1 and 2. These results suggest that the G protein of hMPV is continuously evolving and that the genetic diversity observed for the hMPV genes is reflected in the antigenic variability, similar to HRSV.

Early definitive treatment of burns facilitates optimal results by reducing the risk of subsequent hypertrophic scarring. Laser Doppler imaging (LDI) has been shown to assist in predicting burn wound healing potential. This study sought to determine whether use of LDI in pediatric burn patients has led to earlier decision making for grafting. The study cohort were patients who underwent a skin grafting procedure for a burn wound at a single institution, a state referral center for all major pediatric burns, between June 2006 and December 2007. Patients were divided into two groups: those who underwent LDI scanning and those who were only assessed clinically. Time of burn injury to time of decision making for the grafting procedure was calculated in days. Forty-nine percent of 196 patients underwent LDI. The mean time from the date of injury to decision making for graft procedure was 8.9 days in those patients who had an LDI scan vs 11.6 days in the group assessed by clinical observation alone. This trend for earlier decision for grafting procedure in the LDI group was statistically significant (P = .01). There was no significant difference between those patients who were scanned and those only assessed clinically in relation to gender, age, mechanism of injury, percentage BSA burnt, and wound culture results. There was a significant reduction in time to grafting decision in the LDI group. This would potentially lead to reduced length of stay, reduced number of hospital visits, and streamlined care for the patient and their family.

Mitochondrial iron is essential for the biosynthesis of heme and iron-sulfur ([Fe-S]) clusters in mammalian cells. In developing erythrocytes, iron is imported into the mitochondria by MFRN1 (mitoferrin-1, SLC25A37). Although loss of MFRN1 in zebrafish and mice leads to profound anemia, mutant animals showed no overt signs of porphyria, suggesting that mitochondrial iron deficiency does not result in an accumulation of protoporphyrins. Here, we developed a gene trap model to provide <i>in vitro</i> and <i>in vivo</i> evidence that iron regulatory protein-1 (IRP1) inhibits protoporphyrin accumulation. <i>Mfrn1</i>^+/<i>^gt</i>;<i>Irp1</i>^−/− erythroid cells exhibit a significant increase in protoporphyrin levels. IRP1 attenuates protoporphyrin biosynthesis by binding to the 5′-iron response element (IRE) of <i>alas2</i> mRNA, inhibiting its translation. Ectopic expression of <i>alas2</i> harboring a mutant IRE, preventing IRP1 binding, in <i>Mfrn1^gt/gt</i> cells mimics <i>Irp1</i> deficiency. Together, our data support a model whereby impaired mitochondrial [Fe-S] cluster biogenesis in <i>Mfrn1^gt/gt</i> cells results in elevated IRP1 RNA-binding that attenuates ALAS2 mRNA translation and protoporphyrin accumulation.

organisms.

The Chediak-Higashi Syndrome (CHS) and the orthologous murine disorder beige are characterized at the cellular level by the presence of giant lysosomes. The CHS1/Beige protein is a 3787 amino acid protein of unknown function. To determine functional domains of the CHS1/Beige protein, we generated truncated constructs of the gene/protein. These truncated proteins were transiently expressed in Cos-7 or HeLa cells and their effect on membrane trafficking was examined. Beige is apparently a cytosolic protein, as are most transiently expressed truncated Beige constructs. Expression of the Beige construct FM (amino acids 1-2037) in wild-type cells led to enlarged lysosomes. Similarly, expression of a 5.5-kb region (amino acids 2035-3787) of the carboxyl terminal of Beige (22B) also resulted in enlarged lysosomes. Expression of FM solely affected lysosome size, whereas expression of 22B led to alterations in lysosome size, changes in the Golgi and eventually cell death. The two constructs could be used to further dissect phenotypes resulting from loss of the Beige protein. CHS or beigej fibroblasts show an absence of nuclear staining using a monoclonal antibody directed against phosphatidylinositol 4,5 bisphosphate [PtdIns(4,5) P2]. Transformation of beige j fibroblasts with a YAC containing the full-length Beige gene resulted in the normalization of lysosome size and nuclear PtdIns(4,5)P2 staining. Expression of the carboxyl dominant negative construct 22B led to loss of nuclear PtdIns(4,5)P2 staining. Expression of the FM dominant negative clone did not alter nuclear PtdIns(4,5) P2 localization. These results suggest that the Beige protein interacts with at least two different partners and that the Beige protein affects cellular events, such as nuclear PtdIns(4,5)P2 localization, in addition to lysosome size.

Lysosomes are dynamic structures capable of fusing with endosomes as well as other lysosomes. We examined the biochemical requirements for homotypic lysosome fusion in vitro using lysosomes obtained from rabbit alveolar macrophages or the cultured macrophage-like cell line, J774E. The in vitro assay measures the formation of a biotinylated HRP-avidin conjugate, in which biotinylated HRP and avidin were accumulated in lysosomes by receptor-mediated endocytosis. We determined that lysosome fusion in vitro was time- and temperature-dependent and required ATP and an N-ethylmaleimide (NEM)-sensitive factor from cytosol. The NEM-sensitive factor was NSF as purified recombinant NSF could completely replace cytosol in the fusion assay whereas a dominant-negative mutant NSF inhibited fusion. Fusion in vitro was extensive; up to 30% of purified macrophage lysosomes were capable of self-fusion. Addition of GTPgammas to the in vitro assay inhibited fusion in a concentration-dependent manner. Purified GDP-dissociation inhibitor inhibited homotypic lysosome fusion suggesting the involvement of rabs. Fusion was also inhibited by the heterotrimeric G protein activator mastoparan, but not by its inactive analogue Mas-17. Pertussis toxin, a Galphai activator, inhibited in vitro lysosome fusion whereas cholera toxin, a Galphas activator did not inhibit the fusion reaction. Addition of agents that either promoted or disrupted microtubule function had little effect on either the extent or rate of lysosome fusion. The high value of homotypic fusion was supported by in vivo experiments examining lysosome fusion in heterokaryons formed between cells containing fluorescently labeled lysosomes. In both macrophages and J774E cells, almost complete mixing of the lysosome labels was observed within 1-3 h of UV sendai-mediated cell fusion. These studies provide a model system for identifying the components required for lysosome fusion.

The rate of movement of different receptors and ligands through the intracellular endocytic apparatus was studied in alveolar macrophages. Cells were exposed to iodinated alpha-macroglobulin-protease complexes, mannose terminal glycoproteins, diferric transferrin, and maleylated proteins. By use of the diaminobenzidine density shift procedure, we demonstrated that these ligands were internalized into the same endocytic vesicle. We then compared the rates of transfer to the lysosome or recycling to the cell surface of different ligands/receptors contained in the same endosome. We found that although the rate constant for degradation was ligand specific, the lag time prior to the initiation of degradation was the same for all three ligands. We also found that molecules taken up nonspecifically by fluid-phase pinocytosis had the same lag time prior to degradation as ligands internalized via receptor-mediated endocytosis. These data suggest that different molecules within the same endocytic compartment are transferred to the lysosome (or degradative compartment) at the same rate. We measured the rate of return of receptors to the cell surface by either inactivating surface receptors by protease treatment at 0 degrees C, or by incubating cells with saturating amounts of nonradioactive ligand at 37 degrees C. We then measured the rate of appearance of new receptors on the cell surface. Using these approaches, we found that three different receptors were transferred from internal pools to the cell surface at the same rate. The rate of transfer was independent of whether receptors were initially occupied or unoccupied. Our observations indicate that receptor/ligands, once inside alveolar macrophages, are transported by vesicles which transfer their contents as a cohort from one compartment to another. The rate of movement of these receptors is determined by the movement of vesicles and is independent of their content.

Background/AimsClinico-pathological manifestations of ferroportin (Fpn) disease (FD) are heterogeneous, with some patients presenting with iron overload predominantly in macrophages (“M” phenotype), others predominantly in hepatocytes (“H” phenotype). This appears to reflect functional heterogeneity of Fpn mutants, with loss-of-function generally resulting in the M type.MethodsTwo unrelated probands with “non-HFE” hemochromatosis were screened for Fpn mutations. Mutants were functionally characterized by immunofluorescence microscopy, evaluation of their ability to bind hepcidin and export iron, and by expressing them in zebrafish.ResultsTwo novel Fpn mutations were identified: I152F in patient-1, presenting with typical M phenotype; and L233P in patient-2, presenting with ambiguous features (massive overload in both macrophages and hepatocytes). Molecular studies suggested loss of function in both cases. The I152F, normally localized on cell membrane and internalized by hepcidin, showed a unique “primary” deficit of iron export capability. The L233P did not appropriately traffic to cell surface. Loss of function was confirmed by expressing both mutants in vivo in zebrafish, resulting in iron limited erythropoiesis. Clinical manifestations were likely enhanced in both patients by non-genetic factors (HCV, alcohol).ConclusionsThe combination of careful review of clinico-pathological data with molecular studies can yield compelling explanations for phenotype heterogeneity in FD. Clinico-pathological manifestations of ferroportin (Fpn) disease (FD) are heterogeneous, with some patients presenting with iron overload predominantly in macrophages (“M” phenotype), others predominantly in hepatocytes (“H” phenotype). This appears to reflect functional heterogeneity of Fpn mutants, with loss-of-function generally resulting in the M type. Two unrelated probands with “non-HFE” hemochromatosis were screened for Fpn mutations. Mutants were functionally characterized by immunofluorescence microscopy, evaluation of their ability to bind hepcidin and export iron, and by expressing them in zebrafish. Two novel Fpn mutations were identified: I152F in patient-1, presenting with typical M phenotype; and L233P in patient-2, presenting with ambiguous features (massive overload in both macrophages and hepatocytes). Molecular studies suggested loss of function in both cases. The I152F, normally localized on cell membrane and internalized by hepcidin, showed a unique “primary” deficit of iron export capability. The L233P did not appropriately traffic to cell surface. Loss of function was confirmed by expressing both mutants in vivo in zebrafish, resulting in iron limited erythropoiesis. Clinical manifestations were likely enhanced in both patients by non-genetic factors (HCV, alcohol). The combination of careful review of clinico-pathological data with molecular studies can yield compelling explanations for phenotype heterogeneity in FD.

The budding yeast Saccharomyces cerevisiae stores iron in the vacuole, which is a major resistance mechanism against iron toxicity. One key protein involved in vacuolar iron storage is the iron importer Ccc1, which facilitates iron entry into the vacuole. Transcription of the CCC1 gene is largely regulated by the binding of iron–sulfur clusters to the activator domain of the transcriptional activator Yap5. Additional evidence, however, suggests that Yap5-independent transcriptional activation of CCC1 also contributes to iron resistance. Here, we demonstrate that components of the signaling pathway involving the low-glucose sensor Snf1 regulate CCC1 transcription and iron resistance. We found that SNF1 deletion acts synergistically with YAP5 deletion to regulate CCC1 transcription and iron resistance. A kinase-dead mutation of Snf1 lowered iron resistance as did deletion of SNF4, which encodes a partner protein of Snf1. Deletion of all three alternative partners of Snf1 encoded by SIT1, SIT2, and GAL83 decreased both CCC1 transcription and iron resistance. The Snf1 complex is known to activate the general stress transcription factors Msn2 and Msn4. We show that Msn2 and Msn4 contribute to Snf1-mediated CCC1 transcription. Of note, SNF1 deletion in combination with MSN2 and MSN4 deletion resulted in additive effects on CCC1 transcription, suggesting that other activators contribute to the regulation of CCC1 transcription. In conclusion, we show that yeast have developed multiple transcriptional mechanisms to regulate Ccc1 expression and to protect against high cytosolic iron toxicity. The budding yeast Saccharomyces cerevisiae stores iron in the vacuole, which is a major resistance mechanism against iron toxicity. One key protein involved in vacuolar iron storage is the iron importer Ccc1, which facilitates iron entry into the vacuole. Transcription of the CCC1 gene is largely regulated by the binding of iron–sulfur clusters to the activator domain of the transcriptional activator Yap5. Additional evidence, however, suggests that Yap5-independent transcriptional activation of CCC1 also contributes to iron resistance. Here, we demonstrate that components of the signaling pathway involving the low-glucose sensor Snf1 regulate CCC1 transcription and iron resistance. We found that SNF1 deletion acts synergistically with YAP5 deletion to regulate CCC1 transcription and iron resistance. A kinase-dead mutation of Snf1 lowered iron resistance as did deletion of SNF4, which encodes a partner protein of Snf1. Deletion of all three alternative partners of Snf1 encoded by SIT1, SIT2, and GAL83 decreased both CCC1 transcription and iron resistance. The Snf1 complex is known to activate the general stress transcription factors Msn2 and Msn4. We show that Msn2 and Msn4 contribute to Snf1-mediated CCC1 transcription. Of note, SNF1 deletion in combination with MSN2 and MSN4 deletion resulted in additive effects on CCC1 transcription, suggesting that other activators contribute to the regulation of CCC1 transcription. In conclusion, we show that yeast have developed multiple transcriptional mechanisms to regulate Ccc1 expression and to protect against high cytosolic iron toxicity.

In a two-part process, we assessed elements of the principal hormonal pathway regulating iron homeostasis in human neonates. Part 1: Quantifying erythropoietin (Epo), erythroferrone (ERFE), hepcidin, and relevant serum and erythrocytic iron-related metrics in umbilical cord blood from term (n = 13) and preterm (n = 10) neonates, and from neonates born to mothers with diabetes and obesity (n = 13); Part 2: Quantifying serum Epo, ERFE, and hepcidin before and following darbepoetin administration. Part 1: We measured Epo, ERFE and hepcidin in all cord blood samples. Epo and ERFE levels did not differ between the three groups. Preterm neonates had the lowest hepcidin levels, while neonates born to diabetic women with a very high BMI had the lowest ferritin and RET-He levels. Part 2: Following darbepoetin dosing, ERFE levels generally increased (p < 0.05) and hepcidin levels generally fell (p < 0.05). Our observations suggest that the Epo/ERFE/hepcidin axis is intact in the newborn period.

Iron overload disease due to mutations in ferroportin has a dominant inheritance and a variable clinical phenotype, such that some patients show early Küpffer cell iron loading and low transferrin saturation, while others show hepatocyte iron loading and high transferrin saturation. Studies expressing ferroportin mutant proteins in cultured cells have shown that mutant proteins fall into two main classes; proteins that do not localize to the cell surface and are unable to export iron, and those that localize to the cell surface but are unable to respond to the antimicrobial peptide hepcidin. Patients with mutant ferroportin proteins that do not localize to the cell surface show typical ferroportin disease with low transferrin saturation and early Küpffer cell iron loading, while patients with mutant proteins unable to respond to hepcidin show high transferrin saturation and early hepatocyte iron loading similar to classic hereditary hemochromatosis. The dominant genetic transmission of ferroportin-linked disorders is explained by the in vitro data, which suggest that ferroportin is a multimer and that the behavior of the mutant protein can affect the behavior of the wild type protein.

Iron is an essential nutrient but in excess may damage cells by generating reactive oxygen species due to Fenton reaction or by substituting for other transition metals in essential proteins. The budding yeast <i>Saccharomyces cerevisiae</i> detoxifies cytosolic iron by storage in the vacuole. Deletion of <i>CCC1</i>, which encodes the vacuolar iron importer, results in high iron sensitivity due to increased cytosolic iron. We selected mutants that permitted Δ<i>ccc1</i> cells to grow under high iron conditions by UV mutagenesis. We identified a mutation (N44I) in the vacuolar zinc transporter <i>ZRC1</i> that changed the substrate specificity of the transporter from zinc to iron. <i>COT1</i>, a vacuolar zinc and cobalt transporter, is a homologue of <i>ZRC1</i> and both are members of the cation diffusion facilitator family. Mutation of the homologous amino acid (N45I) in <i>COT1</i> results in an increased ability to transport iron and decreased ability to transport cobalt. These mutations are within the second hydrophobic domain of the transporters and show the essential nature of this domain in the specificity of metal transport.

The iron exporter ferroportin (Fpn) is essential to transfer iron from cells to plasma. Systemic iron homeostasis in vertebrates is regulated by the hepcidin-mediated internalization of Fpn. Here, we demonstrate a second route for Fpn internalization; when cytosolic iron levels are low, Fpn is internalized in a hepcidin-independent manner dependent upon the E3 ubiquitin ligase Nedd4-2 and the Nedd4-2 binding protein Nfdip-1. Retention of cell-surface Fpn through reductions in Nedd4-2 results in cell death through depletion of cytosolic iron. Nedd4-2 is also required for internalization of Fpn in the absence of ferroxidase activity as well as for the entry of hepcidin-induced Fpn into the multivesicular body. C. elegans lacks hepcidin genes, and C. elegans Fpn expressed in mammalian cells is not internalized by hepcidin but is internalized in response to iron deprivation in a Nedd4-2-dependent manner, supporting the hypothesis that Nedd4-2-induced internalization of Fpn is evolutionarily conserved.

Ergosterol synthesis is essential for cellular growth and viability of the budding yeast Saccharomyces cerevisiae, and intracellular sterol distribution and homeostasis are therefore highly regulated in this species. Erg25 is an iron-containing C4-methyl sterol oxidase that contributes to the conversion of 4,4-dimethylzymosterol to zymosterol, a precursor of ergosterol. The ERG29 gene encodes an endoplasmic reticulum (ER)-associated protein, and here we identified a role for Erg29 in the methyl sterol oxidase step of ergosterol synthesis. ERG29 deletion resulted in lethality in respiring cells, but respiration-incompetent (Rho− or Rho0) cells survived, suggesting that Erg29 loss leads to accumulation of oxidized sterol metabolites that affect cell viability. Down-regulation of ERG29 expression in Δerg29 cells indeed led to accumulation of methyl sterol metabolites, resulting in increased mitochondrial oxidants and a decreased ability of mitochondria to synthesize iron–sulfur (Fe-S) clusters due to reduced levels of Yfh1, the mammalian frataxin homolog, which is involved in mitochondrial iron metabolism. Using a high-copy genomic library, we identified suppressor genes that permitted growth of Δerg29 cells on respiratory substrates, and these included genes encoding the mitochondrial proteins Yfh1, Mmt1, Mmt2, and Pet20, which reversed all phenotypes associated with loss of ERG29. Of note, loss of Erg25 also resulted in accumulation of methyl sterol metabolites and also increased mitochondrial oxidants and degradation of Yfh1. We propose that accumulation of toxic intermediates of the methyl sterol oxidase reaction increases mitochondrial oxidants, which affect Yfh1 protein stability. These results indicate an interaction between sterols generated by ER proteins and mitochondrial iron metabolism.

Serum ferritin reflects total body iron stores, thus a low serum ferritin is used as a parameter of iron deficiency. In healthy adults in Japan, urine ferritin levels were about 5% of serum ferritin levels, with a correlation coefficient of 0.79. It is not known whether a low urine ferritin could serve as a non-invasive screen for iron deficiency. If so, this might be useful for neonates and young children, avoiding phlebotomy to screen for iron deficiency. However, for urinary ferritin screening to be feasible, ferritin must be measurable in the urine and correlate with serum ferritin. Testing should also clarify whether the iron content of ferritin in serum and urine are similar. In this pilot feasibility study we measured ferritin in paired serum and urine samples of healthy adult males, healthy term neonates, growing preterm neonates, and children who had very high serum ferritin levels from liver disorders or iron overload. We detected ferritin in every urine sample, and found a correlation with paired serum ferritin (Spearman correlation coefficient 0.78 of log10-transformed values). These findings suggest merit in further studying urinary ferritin in select populations, as a potential non-invasive screen to assess iron stores.

Incubation of serum-growth HeLa cells in serum-free medium causes a rapid (t1/2 3 min) 30-60% decrease in the binding of 125I-diferric transferrin to the cell surface. Addition of fetal bovine serum to cells in serum-free medium results in a rapid (t1/2 3 min) and concentration-dependent increase in binding activity. The loss or gain in ligand binding is a result of changes in surface receptor number rather than an alteration in ligand-receptor affinity. A variety of hormones (insulin, insulin-like growth factor, interleukin 1 and platelet-derived factor) were found to mimic the effect of serum on receptor number. The alteration in surface receptor number was found to be calcium-dependent. Changes in surface receptor number were independent of either receptor biosynthetic rate or the absolute cellular content of receptors. The effect of insulin or serum on Hela cell transferrin receptor distribution was unaffected by the presence of transferrin, demonstrating that receptor distribution in this cell type is ligand-independent. The ability of serum or insulin to modify surface transferrin receptor number was also observed in mouse L-cells, human skin fibroblasts, and J774 macrophage tumour cells. However, transferrin receptors on K562 and Epstein-Barr virus-transformed human lymphoblasts were unaltered by these agents. The quantities of receptors whose distribution is predominantly on the surface (i.e. epidermal growth factor or low density lipoprotein receptor) were unaltered by addition of the mitogenic agents. These results extend our previous studies [H.S. Wiley & J. Kaplan (1984) Proc. Natl. Acad. Sci. U.S.A. 81, 7456-7460] demonstrating that mitogenic agents can induce redistribution of receptor pools in selected cell types.

Cation diffusion facilitator transporters are found in all three Kingdoms of life and are involved in transporting transition metals out of the cytosol. The metals they transport include Zn2+, Co2+, Fe2+, Cd2+, Ni2+ and Mn2+; however, no single transporter transports all metals. Previously we showed that a single amino acid mutation in the yeast vacuolar zinc transporter Zrc1 changed its substrate specificity from Zn2+ to Fe2+ and Mn2+ [Lin, Kumanovics, Nelson, Warner, Ward and Kaplan (2008) J. Biol. Chem. 283, 33865–33873]. Mutant Zrc1 that gained iron transport activity could protect cells with a deletion in the vacuolar iron transporter (CCC1) from high iron toxicity. Utilizing suppression of high iron toxicity and PCR mutagenesis of ZRC1, we identified other amino acid substitutions within ZRC1 that changed its metal specificity. All Zrc1 mutants that transported Fe2+ could also transport Mn2+. Some Zrc1 mutants lost the ability to transport Zn2+, but others retained the ability to transport Zn2+. All of the amino acid substitutions that resulted in a gain in Fe2+ transport activity were found in transmembrane domains. In addition to alteration of residues adjacent to the putative metal- binding site in two transmembrane domains, alteration of residues distant from the binding site affected substrate specificity. These results suggest that substrate selection involves co-operativity between transmembrane domains.

Laser Doppler Imaging (LDI) assists in prediction burn wound outcome. Previous data has validated this technique in children between 48 and 72 h after burn.To evaluate the ability of Laser Doppler Imaging (LDI) to predict burn wound outcome in paediatric patients prior to and after 48 h from the time of injury.A prospective evaluation was performed in 400 children over a 12-month period that presented to our burns clinic. Patients were divided into two groups: those that presented within 48 h of injury (n=160) and those that presented after 48 h (n=240). Patients were reviewed until healing had occurred or operative intervention was required.The median age of the patients was 2.4 years (range 0.1-15.9 years). For patients who presented within 48 h, the sensitivity and specificity of the LDI was 78% and 74% respectively compared to 75% and 85% for those scanned after 48 h. This difference was not statistically significant.LDI predicted burn wound outcome in children within 48 h of the burn wound. Moderate degrees of movement, infection, whether first aid was administered and type of dressing did not impact on the accuracy of LDI.

Ferritin is a multisubunit protein that is responsible for storing and detoxifying cytosolic iron. Ferritin can be found in serum but is relatively iron poor. Serum ferritin occurs in iron overload disorders, in inflammation, and in the genetic disorder hyperferritinemia with cataracts. We show that ferritin secretion results when cellular ferritin synthesis occurs in the relative absence of free cytosolic iron. In yeast and mammalian cells, newly synthesized ferritin monomers can be translocated into the endoplasmic reticulum and transits through the secretory apparatus. Ferritin chains can be translocated into the endoplasmic reticulum in an in vitro translation and membrane insertion system. The insertion of ferritin monomers into the ER occurs under low-free-iron conditions, as iron will induce the assembly of ferritin. Secretion of ferritin chains provides a mechanism that limits ferritin nanocage assembly and ferritin-mediated iron sequestration in the absence of the translational inhibition of ferritin synthesis.

All eukaryotes require the transition metal, iron, a redox active element that is an essential cofactor in many metabolic pathways, as well as an oxygen carrier. Iron can also react to generate oxygen radicals such as hydroxyl radicals and superoxide anions, which are highly toxic to cells. Therefore, organisms have developed intricate mechanisms to acquire iron as well as to protect themselves from the toxic effects of excess iron. In fungi and plants, iron is stored in the vacuole as a protective mechanism against iron toxicity. Iron storage in the vacuole is mediated predominantly by the vacuolar metal importer Ccc1 in yeast and the homologous transporter VIT1 in plants. Transcription of yeast CCC1 expression is tightly controlled primarily by the transcription factor Yap5, which sits on the CCC1 promoter and activates transcription through the binding of Fe-S clusters. A second mechanism that regulates CCC1 transcription is through the Snf1 signaling pathway involved in low-glucose sensing. Snf1 activates stress transcription factors Msn2 and Msn4 to mediate CCC1 transcription. Transcriptional regulation by Yap5 and Snf1 are completely independent and provide for a graded response in Ccc1 expression. The identification of multiple independent transcriptional pathways that regulate the levels of Ccc1 under high iron conditions accentuates the importance of protecting cells from the toxic effects of high iron.

Small for gestational age infants (SGA), infants of diabetic mothers (IDM), and very low birth weight infants (VLBW) are at risk for congenital iron deficiency. We evaluated the iron status of SGA, IDM, and VLBW neonates at birth and sought mechanistic explanations in those with iron deficiency. This was a prospective study. If congenital iron deficiency was present, maternal iron studies were obtained. When neonates were two weeks old, their iron status was reevaluated. Sixteen of 180 neonates screened were iron deficient at birth. The Body Mass Index of the 16 mothers was high. These mothers often had mild iron deficiency and measurable hepcidin levels. Two weeks after birth, neonates had improved iron measurements. Among SGA, IDM, and VLBW neonates, maternal obesity is a risk factor for congenital iron deficiency. We speculate that elevated hepcidin levels in obese pregnant women impede iron absorption and interfere with transplacental iron transfer.

Abcb10 is a mitochondrial membrane protein involved in hemoglobinization of red cells. Abcb10 topology and ATPase domain localization suggest it exports a substrate, likely biliverdin, out of mitochondria that is necessary for hemoglobinization. In this study, we generated <i>Abcb10</i> deletion cell lines in both mouse murine erythroleukemia and human erythroid precursor human myelogenous leukemia (K562) cells to better understand the consequences of Abcb10 loss. Loss of Abcb10 resulted in an inability to hemoglobinize upon differentiation in both K562 and mouse murine erythroleukemia cells with reduced heme and intermediate porphyrins and decreased levels of aminolevulinic acid synthase 2 activity. Metabolomic and transcriptional analyses revealed that Abcb10 loss gave rise to decreased cellular arginine levels, increased transcripts for cationic and neutral amino acid transporters with reduced levels of the citrulline to arginine converting enzymes argininosuccinate synthetase and argininosuccinate lyase. The reduced arginine levels in Abcb10-null cells gave rise to decreased proliferative capacity. Arginine supplementation improved both Abcb10-null proliferation and hemoglobinization upon differentiation. Abcb10-null cells showed increased phosphorylation of eukaryotic translation initiation factor 2 subunit alpha, increased expression of nutrient sensing transcription factor ATF4 and downstream targets DNA damage inducible transcript 3 (Chop), ChaC glutathione specific gamma-glutamylcyclotransferase 1 (Chac1), and arginyl-tRNA synthetase 1 (Rars). These results suggest that when the Abcb10 substrate is trapped in the mitochondria, the nutrient sensing machinery is turned on remodeling transcription to block protein synthesis necessary for proliferation and hemoglobin biosynthesis in erythroid models.

Previously we reported that internalized ligand-receptor complexes are transported within the alveolar macrophage at a rate that is independent of the ligand and/or receptor but is dependent on the endocytic apparatus (Ward, D. M., R. S. Ajioka, and J. Kaplan. 1989. J. Biol. Chem. 264:8164-8170). To probe the mechanism of intracellular vesicle transport, we examined the ability of vesicles internalized at different times to fuse. The mixing of ligands internalized at different times was studied using the 3,3'-diaminobenzidine/horseradish peroxidase density shift technique. The ability of internalized vesicles to fuse was dependent upon their location in the endocytic pathway. When ligands were administered as tandem pulses a significant amount of mixing (20-40%) of vesicular contents was observed. The pattern of mixing was independent of the ligands employed (transferrin, mannosylated BSA, or alpha macroglobulin), the order of ligand addition, and temperature (37 degrees C or 28 degrees C). Fusion was restricted to a brief period immediately after internalization. The amount of fusion in early endosomes did not increase when cells, given tandem pulses, were chased such that the ligands further traversed the early endocytic pathway. Little fusion, also, was seen when a chase was interposed between the two ligand pulses. The temporal segregation of vesicle contents seen in early endosomes was lost within late endosomes. Extensive mixing of vesicle contents was observed in the later portion of the endocytic pathway. This portion of the pathway is defined by the absence of internalized transferrin and is composed of ligands en route to lysosomes. Incubation of cells in iso-osmotic medium in which Na+ was replaced by K+ inhibited movement of internalized ligands to the lysosome, resulting in ligand accumulation within the late endocytic pathway. The accumulation of ligand was correlated with extensive mixing of sequentially internalized ligands. Although significant amounts of ligand degradation were observed, this compartment was devoid of conventional lysosomal markers such as acid glycosidases. These results indicate changing patterns of vesicle fusion within the endocytic pathway, with a complete loss of temporal ligand segregation in a prelysosomal compartment.

Deletion of the yeast gene PKR1 (YMR123W) results in an inability to grow on iron-limited medium. Pkr1p is localized to the membrane of the endoplasmic reticulum. Cells lacking Pkr1p show reduced levels of the V-ATPase subunit Vph1p due to increased turnover of the protein in mutant cells. Reduced levels of the V-ATPase lead to defective copper loading of Fet3p, a component of the high affinity iron transport system. Levels of Vph1p in cells lacking Pkr1p are similar to cells unable to assemble a functional V-ATPase due to lack of a V0 subunit or an endoplasmic reticulum (ER) assembly factor. However, unlike yeast mutants lacking a V0 subunit or a V-ATPase assembly factor, low levels of Vph1p present in cells lacking Pkr1p are assembled into a V-ATPase complex, which exits the ER and is present on the vacuolar membrane. The V-ATPase assembled in the absence of Pkr1p is fully functional because the mutant cells are able to weakly acidify their vacuoles. Finally, overexpression of the V-ATPase assembly factor Vma21p suppresses the growth and acidification defects of pkr1Δ cells. Our data indicate that Pkr1p functions together with the other V-ATPase assembly factors in the ER to efficiently assemble the V-ATPase membrane sector.

Rabbit alveolar macrophages which were treated at 0 degrees C with phenylarsine oxide and then incubated at 37 degrees C for 10 min exhibited a two- to threefold increase in surface receptor activity for macroglobulin.protease complexes, diferric transferrin, and mannose-terminal glycoproteins. Analysis of the concentration-dependence of ligand binding indicated that changes in ligand-binding activity were due to changes in receptor number rather than alterations in ligand-receptor affinity. Surface receptor number could also be increased by treatment of cells with three other sulfhydryl reagents, N-ethylmaleimide, p-chloromercurobenzoate, and iodoacetic acid. The increase in receptor activity was maximal after 10 min and decreased over the next hour. This decrease in cell-associated receptor activity was due to the release of large membrane vesicles which demonstrated a uniform buoyant density by isopycnic sucrose gradient centrifugation. Treatment of cells with phenylarsine oxide did not decrease the cellular content of lactate dehydrogenase or beta-galactosidase, indicating that cell integrity was maintained and lysosomal enzyme release did not occur. Our studies indicate that phenylarsine oxide treatment in the presence of extracellular Ca2+ results in the fusion of receptor-containing vesicles with the cell surface.

Abstract The term hemochromatosis represents a group of inherited disorders leading to iron overload. Mutations in HFE, HJV, and TfR2 cause autosomal-recessive forms of hemochromatosis. Mutations in ferroportin, however, result in dominantly inherited iron overload. Some mutations (H32R and N174I) in ferroportin lead to macrophage iron loading, while others (NI44H) lead to hepatocyte iron loading. Expression of H32R or N174I ferroportin cDNA in zebrafish leads to severe iron-limited erythropoiesis. Expression of wild-type ferroportin or hepcidin-resistant ferroportin (N144H) does not affect erythropoiesis. Zebrafish provides a facile way of identifying which ferroportin mutants may lead to macrophage iron loading.

1. The values of the protein, RNA and phospholipid concentrations within the total microsomal fractions obtained from different stages of embryonic chick liver are compared. 2. Only the phospholipid content increases significantly with increasing developmental age. 3. The lack of membranes in the early stages of development and the relative constancy of RNA values during development suggests that some of the protein present at the early developmental stages is of a non-membranous non-ribosomal nature. 4. Glucose 6-phosphatase, adenosine triphosphatase, NADH(2)-cytochrome c reductase and diaphorase all increased in activity as development progressed. 5. Comparisons of submicrosomal fractions with respect to their protein, RNA and phospholipid content showed that in all embryonic stages fraction II (rough-membrane fraction) contained more than 60% of the proteins, RNA and phospholipid of the microsomal fraction. 6. Glucose 6-phosphatase was shown to be present predominantly in fraction II, whereas adenosine triphosphatase was present predominantly in fraction Iab (smooth-membrane fraction). 7. The significance of the differences between the smooth- and rough-microsomal fractions is discussed.

Budding yeast (Saccharomyces cerevisiae) responds to low cytosolic iron by up-regulating the expression of iron import genes; iron import can reflect iron transport into the cytosol or mitochondria. Mmt1 and Mmt2 are nuclearly encoded mitochondrial proteins that export iron from the mitochondria into the cytosol. Here we report that MMT1 and MMT2 expression is transcriptionally regulated by two pathways: the low-iron-sensing transcription factor Aft1 and the oxidant-sensing transcription factor Yap1. We determined that MMT1 and MMT2 expression is increased under low-iron conditions and decreased when mitochondrial iron import is increased through overexpression of the high-affinity mitochondrial iron importer Mrs3. Moreover, loss of iron-sulfur cluster synthesis induced expression of MMT1 and MMT2 We show that exposure to the oxidant H2O2 induced MMT1 expression but not MMT2 expression and identified the transcription factor Yap1 as being involved in oxidant-mediated MMT1 expression. We defined Aft1- and Yap1-dependent transcriptional sites in the MMT1 promoter that are necessary for low-iron- or oxidant-mediated MMT1 expression. We also found that the MMT2 promoter contains domains that are important for regulating its expression under low-iron conditions, including an upstream region that appears to partially repress expression under low-iron conditions. Our findings reveal that MMT1 and MMT2 are induced under low-iron conditions and that the low-iron regulator Aft1 is required for this induction. We further uncover an Aft1-binding site in the MMT1 promoter sufficient for inducing MMT1 transcription and identify an MMT2 promoter region required for low iron induction.

Two iron regulatory proteins (IRP1 and IRP2) regulate translation and/or stability of mRNAs encoding proteins required for iron storage, acquisition and utilization. Rather than IRP2 directly sensing iron concentrations, iron has been shown to regulate the level of the SKP1-CUL1-FBXL5 E3 ubiquitin ligase protein complex, which is responsible for IRP2 degradation.

(Current Biology 23, R642–R646; August 5, 2013) As a result of a journal oversight in the originally published version of this Primer, the heme molecule in Figure 1B included an H2C group at the upper left that should have been an H3C group. This error has now been corrected in the article online. The journal apologizes for the error and any confusion that may have resulted. The essential nature of iron usage and regulationKaplan et al.Current BiologyAugust 05, 2013In BriefThe facile ability of iron to gain and lose electrons has made iron an important participant in a wide variety of biochemical reactions. Binding of ligands to iron modifies its redox potential, thereby permitting iron to transfer electrons with greater or lesser facility. The ability to transfer electrons, coupled with its abundance, as iron is the fourth most abundant mineral in the earth’s crust, have contributed to iron being an element required by almost all species in the six kingdoms of life. Full-Text PDF Open Archive

In an iron deficient child, oral iron repeatedly failed to improve the condition. Whole exome sequencing identified one previously reported plus two novel mutation in the TMPRSS6 gene, with no mutations in other iron-associated genes. We propose that these mutations result in a novel variety of iron-refractory iron deficiency anemia.

Abstract Background Immature reticulocytes (IRC) are the first cells to respond to changes in erythropoiesis. For antidoping applications, measurement of IRC may improve detection of blood doping practices. Unfortunately, this small cell population has limited stability in liquid blood samples and is difficult to measure with optimal precision. We developed a method to measure 3 IRC membrane proteins in dried blood spots (DBS) to monitor changes in erythropoiesis. Methods DBS spots were washed with buffers to remove soluble proteins, membrane proteins remaining in the spot were digested with trypsin, and one peptide for each protein was measured by LC-MS/MS. IRC protein concentration was determined using a DBS single point calibrator. Results Intraassay precision for IRC proteins was between 5%–15%. IRC proteins were stable in DBS for 29 days at room temperature. In a longitudinal study of 25 volunteers, the mean intraindividual variation for 3 IRC proteins was 17%, 20%, and 24% from capillary blood DBS. In comparison, the mean longitudinal variation for IRC counts measured on an automated hematology analyzer was 38%. IRC protein concentration from capillary blood DBS correlated well with venous blood DBS protein concentrations. Conclusions Measurement of IRC proteins in DBS samples provides a method to measure changes in erythropoiesis with improved analytical sensitivity, stability, and precision. When combined with the inherent advantages of capillary blood collection in the field, this method may substantially improve the detection of blood doping practices.

Incubation of alveolar macrophages in hypoosmotic K(+)-containing buffers results in persistent cell swelling and an inability to undergo regulatory volume decrease. We demonstrate that cells incubated in hypo-K+ show an inhibition of endocytosis without any observed alteration in recycling. The inhibition of endocytosis affected all forms of membrane internalization, receptor and fluid phase. Both increased cell volume and the inhibition of endocytosis could be released upon return of cells to iso-Na+ buffers. The ability to synchronize the endocytic apparatus allowed us to examine hypotheses regarding the origin and maturation of endocytic vesicles. Incubation in hypo-K+ buffers had no effect on the delivery of ligands to degradative compartments or on the return of previously internalized receptors to the cell surface. Thus, membrane recycling and movement of internalized components to lysosomes occurred in the absence of continued membrane influx. We also demonstrate that fluorescent lipids, that had been incorporated into early endosomes, returned to the cell surface upon exposure of cells to hypo-K+ buffers. These results indicate that the early sorting endosome is a transient structure, whose existence depends upon continued membrane internalization. Our data supports the hypothesis that the transfer of material to lysosomes can best be explained by the continuous maturation of endosomes.

Vps41p, the protein encoded by the yeast gene VPS41, has been shown to mediate formation of AP-3 transport vesicles from the Golgi apparatus and to facilitate the docking and fusion of lysosomal vesicles. Although both of these activities involve transient association with membrane structures, the mechanisms that mediate those interactions have not been determined. Orthologues of VPS41 have been identified in humans, Drosophila, tomato, and Arabidopsis; the degree of sequence similarity among these genes suggests a highly conserved function. Here we provide evidence that hVps41, the human homologue of Vps41p, is expressed in two isoforms that differ in that one contains a C-terminal RING-H2 sequence motif. Transient expression analysis suggests that this RING-H2 domain is responsible for membrane association. This observation was further supported by the cytosolic localization of site-specific mutants. A truncated construct containing only the hVps41 RING-H2 domain was found to associate with a class of intracellular vesicles that originated from the Golgi and showed partial coincidence with the delta subunit of the adaptor protein complex-3. Together with information from the homologous yeast system, these results suggest that hVps41 may also be involved in the formation and fusion of transport vesicles from the Golgi.

Mutations in the iron exporter ferroportin (Fpn) result in iron overload in macrophages or hepatocytes depending upon the mutation. Patients with Fpn mutation D157G show high serum ferritin and normal to slightly elevated transferrin saturation. Here, we show that Fpn(D157G)-green fluorescent protein (GFP) is down-regulated independent of hepcidin, and that this down-regulation is due to the constitutive binding of Jak2 and Fpn phosphorylation. Expression of Fpn(D157G)-GFP in Danio rerio results in a severe growth defect, which can be rescued by iron supplementation. These results identify a hepcidin-independent regulation of Fpn that can result in alterations in iron homeostasis.

Mutations in the Chediak–Higashi syndrome gene ( CHS1 ) and its murine homologue Beige result in the formation of enlarged lysosomes. BPH1 (Beige Protein Homologue 1) encodes the Saccharomyces cerevisiae homologue of CHS1/Beige. BPH1 is not essential and the encoded protein was found to be both cytosolic and peripherally bound to a membrane. Neither disruption nor overexpression of BPH1 affected vacuole morphology as assessed by fluorescence microscopy. The δ bph1 strain showed an impaired growth on defined synthetic media containing potassium acetate buffered below pH 4.25, increased sensitivity to calcofluor white, and increased agglutination in response to low pH. A library screen identified VPS9 , FLO1 , FLO9 , BTS1 and OKP1 as high copy suppressors of the growth defect of δ bph1 on both low pH potassium acetate and calcofluor white. The δ bph1 strain demonstrated a mild defect in sorting vacuolar components, including increased secretion of carboxypeptidase Y and missorting of alkaline phosphatase. Overexpression of VPS9 , BTS1 and OKP1 suppressed the carboxypeptidase Y secretion defect of δ bph1 . Overexpression of BPH1 was found to suppress the calcofluor white sensitivity of a class E VPS deletion strain, δ vta1 . Together, these data suggest that Bph1p associates with a membrane and is involved in protein sorting and cell wall formation.

In order to reduce iron deficiency in neonates at-risk for iron deficiency, we implemented a guideline to increase the consistency of early iron supplementation in infants of diabetic mothers, small for gestational age neonates and very low birthweight premature neonates. Three years following implementation we performed a retrospective analysis in order to assess adherence to the guideline and to compare timing of early iron supplementation and reticulocyte-hemoglobin (RET-He) values at one month of life in at-risk infants. Adherence with early iron supplementation guidelines was 73.4% (399/543) with 51% (275/543) having RET-He values obtained at one month. Despite good adherence, 16% (44/275) had RET-He <25 pg (5th percentile for gestational age). No infants receiving red blood cell transfusion (0/20) had RET-He <25 pg vs. 26.1% (40/153) of those treated with darbepoetin (p < 0.001). There was no evidence of increased feeding intolerance (episodes of emesis/day) with early iron supplementation.

Objective To create neonatal reference intervals for the MicroR and HYPO-He complete blood count (CBC) parameters and to test whether these parameters are sensitive early markers of disease at early stages of microcytic/hypochromic disorders while the CBC indices are still normal. Study design We retrospectively collected the CBC parameters MicroR and HYPO-He, along with the standard CBC parameters, from infants aged 0-90 days at Intermountain Healthcare hospitals using Sysmex hematology analyzers. We created reference intervals for these parameters by excluding values from neonates with proven microcytic disorders (ie, iron deficiency or alpha thalassemia) from the dataset. Result From >11 000 CBCs analyzed, we created reference intervals for MicroR and HYPO-He in neonates aged 0-90 days. The upper intervals are considerably higher in neonates than in adults, validating increased anisocytosis and polychromasia among neonates. Overall, 52% of neonates with iron deficiency (defined by reticulocyte hemoglobin equivalent <25 pg) had a MicroR >90% upper interval (relative risk, 4.14; 95% CI, 3.80-4.53; P < .001), and 68% had an HYPO-He >90% upper interval (relative risk, 6.64; 95% CI, 6.03-7.32; P < .001). These 2 new parameters were more sensitive than the red blood cell (RBC) indices (P < .001) in identifying 24 neonates with iron deficiency at birth. Conclusions We created neonatal reference intervals for MicroR and HYPO-He. Although Sysmex currently designates these as research use only in the US, they can be measured as part of a neonate’s CBC with no additional phlebotomy volume or run time and can identify microcytic and hypochromic disorders even when the RBC indices are normal. To create neonatal reference intervals for the MicroR and HYPO-He complete blood count (CBC) parameters and to test whether these parameters are sensitive early markers of disease at early stages of microcytic/hypochromic disorders while the CBC indices are still normal. We retrospectively collected the CBC parameters MicroR and HYPO-He, along with the standard CBC parameters, from infants aged 0-90 days at Intermountain Healthcare hospitals using Sysmex hematology analyzers. We created reference intervals for these parameters by excluding values from neonates with proven microcytic disorders (ie, iron deficiency or alpha thalassemia) from the dataset. From >11 000 CBCs analyzed, we created reference intervals for MicroR and HYPO-He in neonates aged 0-90 days. The upper intervals are considerably higher in neonates than in adults, validating increased anisocytosis and polychromasia among neonates. Overall, 52% of neonates with iron deficiency (defined by reticulocyte hemoglobin equivalent <25 pg) had a MicroR >90% upper interval (relative risk, 4.14; 95% CI, 3.80-4.53; P < .001), and 68% had an HYPO-He >90% upper interval (relative risk, 6.64; 95% CI, 6.03-7.32; P < .001). These 2 new parameters were more sensitive than the red blood cell (RBC) indices (P < .001) in identifying 24 neonates with iron deficiency at birth. We created neonatal reference intervals for MicroR and HYPO-He. Although Sysmex currently designates these as research use only in the US, they can be measured as part of a neonate’s CBC with no additional phlebotomy volume or run time and can identify microcytic and hypochromic disorders even when the RBC indices are normal.

The objective of this study was to determine the impact of burn wound dressings on Laser Doppler imaging assessment of a cutaneous injury model. A healthy volunteer was subjected to a standardized mechanical stimulus to produce a triple response. This was scanned under ideal conditions using the moor LDI2 before and after application of the following dressings: GLAD Wrap®, Bactigras®, Hypafix®, Omiderm®, DuoDERM®, Acticoat®, and Avance®. The triple response was readily and consistently detected on the LDI blood flow image. Glad Wrap, Bactigras, Hypafix, Omiderm, and DuoDERM all had minimal adverse impact on the Laser Doppler blood flow image. Acticoat and Avance prevented detection of the triple response. In addition, there was a false-positive blood flow image with the Acticoat dressing positioned with the silver colored surface uppermost. Dressings transparent to the near infrared spectrum allowed detection of a standardized cutaneous injury model under ideal conditions. Laser Doppler imaging might therefore be used to assess a burn wound without removal of such a dressing. This would have implications for the selection and use of dressings in the treatment of burn patients, especially in an ambulatory care setting.

AbstractFerritin is an iron storage molecule in vertebrates that stores iron in a redox inactive form. Ferritin is synthesized in response to high cellular iron levels and is degraded and iron released when iron demand is increased. Previously we determined that the turnover of ferritin occurs via the proteasome when the iron exporter ferroportin is expressed, and via the lysosome when the iron chelator deferoxamine is given to cells. Deferoxamine is used to treat hemochromatosis, a disease of iron accumulation that can be either genetic or acquired.Autophagy provides a mechanism by which cytosolic proteins gain access to the lumen of lysosomes. Our results suggest that entry of ferritin into lysosomes is highly specific and not a consequence of generalized engulfment of cytosolic compartments by lysosomes. Entry of ferritin is also independent of the presence of LAMP-2, which suggests that ferritin entry does not result from chaperone-mediated autophagy. In summary, in this study we identify a new route that links ferritin degradation to activation of autophagy. The identification of this pathway will help to understand the molecular events that lead to activation of deferoxamine-mediated ferritin degradation and may contribute to the design of new therapeutic strategies for iron chelation therapy.This article refers to:

Mon1a was originally identified as a modifier gene of vesicular traffic, as a mutant Mon1a allele resulted in increased localization of cell surface proteins, whereas reduced levels of Mon1a showed decreased secretory activity. Here we show that Mon1a affects different steps in the secretory pathway including endoplasmic reticulum-to-Golgi traffic. siRNA-dependent reduction of Mon1a levels resulted in a delay in the reformation of the Golgi apparatus after Brefeldin A treatment. Endoglycosidase H treatment of ts045VSVG-GFP confirmed that knockdown of Mon1a delayed endoplasmic reticulum-to-Golgi trafficking. Reductions in Mon1a also resulted in delayed trafficking from Golgi to the plasma membrane. Immunoprecipitation and mass spectrometry analysis showed that Mon1a associates with dynein intermediate chain. Reductions in Mon1a or dynein altered steady state Golgi morphology. Reductions in Mon1a delayed formation of ERGIC-53-positive vesicles, whereas reductions in dynein did not affect vesicle formation. These data provide strong evidence for a role for Mon1a in anterograde trafficking through the secretory apparatus.

Laser Doppler imaging (LDI) has been increasingly used to predict pediatric burn wound outcome. A majority of these wounds are scald, contact, or flame burns. No study has specifically evaluated the use of LDI in pediatric friction burns. Our objective was to critically evaluate LDI assessment of pediatric friction burns to determine its predictive value with this mechanism of injury. We conducted a retrospective review of all LDI scans performed on pediatric friction burns during a 2-year period. We identified 36 patients with a mean age of 3.6 years (range, 19 months to 15 years). LDI accurately predicted burn wound outcome in 23 (64%) cases. In 13 cases, LDI did not correctly predict burn wound outcome. Eight were expected to heal within 14 days, but six of those eight took an average of 20.3 days to heal (range, 18–29 days), and the other two required skin grafting. Of the remaining five incorrect predictions, four were caused by an inability to correlate the flux scan with the clinical appearance of the burn, and one was thought to take more than 21 days to heal but healed within this period. Our data suggest that LDI appears to be a less reliable tool in predicting the outcome of friction burns when compared to other mechanisms of burn injury in children. This may reflect the physical differences in the mechanism of friction burns as opposed to other forms of thermal injury.

Mutations in ferroportin (Fpn) result in iron overload. We correlate the behavior of three Fpn mutants in vitro with patients' phenotypes. Patients with Fpn mutations A77D or N174I showed macrophage iron loading. In cultured cells, FpnA77D did not reach the cell surface and cells did not export iron. Fpn mutant N174I showed plasma membrane and intracellular localization, and did not transport iron. Fpn mutation G80S was targeted to the cell surface and was transport competent, however patients showed macrophage iron. We suggest that FpnG80S represents a class of Fpn mutants whose behavior in vitro does not explain the patients' phenotype.