Dennis C. Sgroi

Fibroblasts often constitute the majority of the stromal cells within a breast carcinoma, yet the functional contributions of these cells to tumorigenesis are poorly understood. Using a coimplantation tumor xenograft model, we demonstrate that carcinoma-associated fibroblasts (CAFs) extracted from human breast carcinomas promote the growth of admixed breast carcinoma cells significantly more than do normal mammary fibroblasts derived from the same patients. The CAFs, which exhibit the traits of myofibroblasts, play a central role in promoting the growth of tumor cells through their ability to secrete stromal cell-derived factor 1 (SDF-1); CAFs promote angiogenesis by recruiting endothelial progenitor cells (EPCs) into carcinomas, an effect mediated in part by SDF-1. CAF-secreted SDF-1 also stimulates tumor growth directly, acting through the cognate receptor, CXCR4, which is expressed by carcinoma cells. Our findings indicate that fibroblasts within invasive breast carcinomas contribute to tumor promotion in large part through the secretion of SDF-1.

Epithelial-mesenchymal transition (EMT) of adherent epithelial cells to a migratory mesenchymal state has been implicated in tumor metastasis in preclinical models. To investigate its role in human cancer, we characterized EMT in circulating tumor cells (CTCs) from breast cancer patients. Rare primary tumor cells simultaneously expressed mesenchymal and epithelial markers, but mesenchymal cells were highly enriched in CTCs. Serial CTC monitoring in 11 patients suggested an association of mesenchymal CTCs with disease progression. In an index patient, reversible shifts between these cell fates accompanied each cycle of response to therapy and disease progression. Mesenchymal CTCs occurred as both single cells and multicellular clusters, expressing known EMT regulators, including transforming growth factor (TGF)-β pathway components and the FOXC1 transcription factor. These data support a role for EMT in the blood-borne dissemination of human breast cancer.

Breast carcinoma is the leading cause of cancer-related mortality in women worldwide, with an estimated 1.38 million new cases and 458,000 deaths in 2008 alone. This malignancy represents a heterogeneous group of tumours with characteristic molecular features, prognosis and responses to available therapy. Recurrent somatic alterations in breast cancer have been described, including mutations and copy number alterations, notably ERBB2 amplifications, the first successful therapy target defined by a genomic aberration. Previous DNA sequencing studies of breast cancer genomes have revealed additional candidate mutations and gene rearrangements. Here we report the whole-exome sequences of DNA from 103 human breast cancers of diverse subtypes from patients in Mexico and Vietnam compared to matched-normal DNA, together with whole-genome sequences of 22 breast cancer/normal pairs. Beyond confirming recurrent somatic mutations in PIK3CA, TP53, AKT1, GATA3 and MAP3K1, we discovered recurrent mutations in the CBFB transcription factor gene and deletions of its partner RUNX1. Furthermore, we have identified a recurrent MAGI3-AKT3 fusion enriched in triple-negative breast cancer lacking oestrogen and progesterone receptors and ERBB2 expression. The MAGI3-AKT3 fusion leads to constitutive activation of AKT kinase, which is abolished by treatment with an ATP-competitive AKT small-molecule inhibitor.

Tamoxifen significantly reduces tumor recurrence in certain patients with early-stage estrogen receptor-positive breast cancer, but markers predictive of treatment failure have not been identified. Here, we generated gene expression profiles of hormone receptor-positive primary breast cancers in a set of 60 patients treated with adjuvant tamoxifen monotherapy. An expression signature predictive of disease-free survival was reduced to a two-gene ratio, HOXB13 versus IL17BR, which outperformed existing biomarkers. Ectopic expression of HOXB13 in MCF10A breast epithelial cells enhances motility and invasion in vitro, and its expression is increased in both preinvasive and invasive primary breast cancer. The HOXB13:IL17BR expression ratio may be useful for identifying patients appropriate for alternative therapeutic regimens in early-stage breast cancer.

Purpose Cisplatin is a chemotherapeutic agent not used routinely for breast cancer treatment. As a DNA cross-linking agent, cisplatin may be effective treatment for hereditary BRCA1-mutated breast cancers. Because sporadic triple-negative breast cancer (TNBC) and BRCA1-associated breast cancer share features suggesting common pathogenesis, we conducted a neoadjuvant trial of cisplatin in TNBC and explored specific biomarkers to identify predictors of response. Patients and Methods Twenty-eight women with stage II or III breast cancers lacking estrogen and progesterone receptors and HER2/Neu (TNBC) were enrolled and treated with four cycles of cisplatin at 75 mg/m 2 every 21 days. After definitive surgery, patients received standard adjuvant chemotherapy and radiation therapy per their treating physicians. Clinical and pathologic treatment response were assessed, and pretreatment tumor samples were evaluated for selected biomarkers. Results Six (22%) of 28 patients achieved pathologic complete responses, including both patients with BRCA1 germline mutations;18 (64%) patients had a clinical complete or partial response. Fourteen (50%) patients showed good pathologic responses (Miller-Payne score of 3, 4, or 5), 10 had minor responses (Miller-Payne score of 1 or 2), and four (14%) progressed. All TNBCs clustered with reference basal-like tumors by hierarchical clustering. Factors associated with good cisplatin response include young age (P = .001), low BRCA1 mRNA expression (P = .03), BRCA1 promoter methylation (P = .04), p53 nonsense or frameshift mutations (P = .01), and a gene expression signature of E2F3 activation (P = .03). Conclusion Single-agent cisplatin induced response in a subset of patients with TNBC. Decreased BRCA1 expression may identify subsets of TNBCs that are cisplatin sensitive. Other biomarkers show promise in predicting cisplatin response.

In a screen for gene copy-number changes in mouse mammary tumors, we identified a tumor with a small 350-kb amplicon from a region that is syntenic to a much larger locus amplified in human cancers at chromosome 11q22. The mouse amplicon contains only one known gene, Yap , encoding the mammalian ortholog of Drosophila Yorkie (Yki), a downstream effector of the Hippo(Hpo)–Salvador(Sav)–Warts(Wts) signaling cascade, recently identified in flies as a critical regulator of cellular proliferation and apoptosis. In nontransformed mammary epithelial cells, overexpression of human YAP induces epithelial-to-mesenchymal transition, suppression of apoptosis, growth factor-independent proliferation, and anchorage-independent growth in soft agar. Together, these observations point to a potential oncogenic role for YAP in 11q22-amplified human cancers, and they suggest that this highly conserved signaling pathway identified in Drosophila regulates both cellular proliferation and apoptosis in mammalian epithelial cells.

Although distinct pathological stages of breast cancer have been described, the molecular differences among these stages are largely unknown. Here, through the combined use of laser capture microdissection and DNA microarrays, we have generated in situ gene expression profiles of the premalignant, preinvasive, and invasive stages of human breast cancer. Our data reveal extensive similarities at the transcriptome level among the distinct stages of progression and suggest that gene expression alterations conferring the potential for invasive growth are already present in the preinvasive stages. In contrast to tumor stage, different tumor grades are associated with distinct gene expression signatures. Furthermore, a subset of genes associated with high tumor grade is quantitatively correlated with the transition from preinvasive to invasive growth.

Circulating tumor cells (CTCs) are present at low concentrations in the peripheral blood of patients with solid tumors. It has been proposed that the isolation, ex vivo culture, and characterization of CTCs may provide an opportunity to noninvasively monitor the changing patterns of drug susceptibility in individual patients as their tumors acquire new mutations. In a proof-of-concept study, we established CTC cultures from six patients with estrogen receptor-positive breast cancer. Three of five CTC lines tested were tumorigenic in mice. Genome sequencing of the CTC lines revealed preexisting mutations in the PIK3CA gene and newly acquired mutations in the estrogen receptor gene (ESR1), PIK3CA gene, and fibroblast growth factor receptor gene (FGFR2), among others. Drug sensitivity testing of CTC lines with multiple mutations revealed potential new therapeutic targets. With optimization of CTC culture conditions, this strategy may help identify the best therapies for individual cancer patients over the course of their disease.

Custom-made zinc-finger nucleases (ZFNs) can induce targeted genome modifications with high efficiency in cell types including Drosophila, C. elegans, plants, and humans. A bottleneck in the application of ZFN technology has been the generation of highly specific engineered zinc-finger arrays. Here we describe OPEN (Oligomerized Pool ENgineering), a rapid, publicly available strategy for constructing multifinger arrays, which we show is more effective than the previously published modular assembly method. We used OPEN to construct 37 highly active ZFN pairs which induced targeted alterations with high efficiencies (1%-50%) at 11 different target sites located within three endogenous human genes (VEGF-A, HoxB13, and CFTR), an endogenous plant gene (tobacco SuRA), and a chromosomally integrated EGFP reporter gene. In summary, OPEN provides an "open-source" method for rapidly engineering highly active zinc-finger arrays, thereby enabling broader practice, development, and application of ZFN technology for biological research and gene therapy.

Hypoxia induces rapid and dramatic changes in cellular metabolism, in part through inhibition of target of rapamycin (TOR) kinase complex 1 (TORC1) activity. Genetic studies have shown the tuberous sclerosis tumor suppressors TSC1/2 and the REDD1 protein to be essential for hypoxia regulation of TORC1 activity in Drosophila and in mammalian cells. The molecular mechanism and physiologic significance of this effect of hypoxia remain unknown. Here, we demonstrate that hypoxia and REDD1 suppress mammalian TORC1 (mTORC1) activity by releasing TSC2 from its growth factor-induced association with inhibitory 14-3-3 proteins. Endogenous REDD1 is required for both dissociation of endogenous TSC2/14-3-3 and inhibition of mTORC1 in response to hypoxia. REDD1 mutants that fail to bind 14-3-3 are defective in eliciting TSC2/14-3-3 dissociation and mTORC1 inhibition, while TSC2 mutants that do not bind 14-3-3 are inactive in hypoxia signaling to mTORC1. In vitro, loss of REDD1 signaling promotes proliferation and anchorage-independent growth under hypoxia through mTORC1 dysregulation. In vivo, REDD1 loss elicits tumorigenesis in a mouse model, and down-regulation of REDD1 is observed in a subset of human cancers. Together, these findings define a molecular mechanism of signal integration by TSC1/2 that provides insight into the ability of REDD1 to function in a hypoxia-dependent tumor suppressor pathway.

BRCA1 interacts in vivo with a novel protein, BACH1, a member of the DEAH helicase family. BACH1 binds directly to the BRCT repeats of BRCA1. A BACH1 derivative, bearing a mutation in a residue that was essential for catalytic function in other helicases, interfered with normal double-strand break repair in a manner that was dependent on its BRCA1 binding function. Thus, BACH1/BRCA1 complex formation contributes to a key BRCA1 activity. In addition, germline BACH1 mutations affecting the helicase domain were detected in two early-onset breast cancer patients and not in 200 matched controls. Thus, it is conceivable that, like BRCA1, BACH1 is a target of germline cancer-inducing mutations.

Purpose Most cases of non–small-cell lung cancer (NSCLC) with dramatic responses to gefitinib have specific activating mutations in the epidermal growth factor receptor (EGFR), but the predictive value of these mutations has not been defined in large clinical trials. The goal of this study was to determine the contribution of molecular alterations in EGFR to response and survival within the phase II (IDEAL) and phase III (INTACT) trials of gefitinib. Patients and Methods We analyzed the frequency of EGFR mutations in lung cancer specimens from both the IDEAL and INTACT trials and compared it with EGFR gene amplification, another genetic abnormality in NSCLC. Results EGFR mutations correlated with previously identified clinical features of gefitinib response, including adenocarcinoma histology, absence of smoking history, female sex, and Asian ethnicity. No such association was seen in patients whose tumors had EGFR amplification, suggesting that these molecular markers identify different biologic subsets of NSCLC. In the IDEAL trials, responses to gefitinib were seen in six of 13 tumors (46%) with an EGFR mutation, two of seven tumors (29%) with amplification, and five of 56 tumors (9%) with neither mutation nor amplification (P = .001 for either EGFR mutation or amplification v neither abnormality). Analysis of the INTACT trials did not show a statistically significant difference in response to gefitinib plus chemotherapy according to EGFR genotype. Conclusion EGFR mutations and, to a lesser extent, amplification appear to identify distinct subsets of NSCLC with an increased response to gefitinib. The combination of gefitinib with chemotherapy does not improve survival in patients with these molecular markers.

The importance of the tumor microenvironment in breast cancer has been increasingly recognized. Critical molecular changes in the tumor stroma accompanying cancer progression, however, remain largely unknown. We conducted a comparative analysis of global gene expression changes in the stromal and epithelial compartments during breast cancer progression from normal to preinvasive to invasive ductal carcinoma. We combined laser capture microdissection and gene expression microarrays to analyze 14 patient-matched normal epithelium, normal stroma, tumor epithelium and tumor-associated stroma specimens. Differential gene expression and gene ontology analyses were performed. Tumor-associated stroma undergoes extensive gene expression changes during cancer progression, to a similar extent as that seen in the malignant epithelium. Highly upregulated genes in the tumor-associated stroma include constituents of the extracellular matrix and matrix metalloproteases, and cell-cycle-related genes. Decreased expression of cytoplasmic ribosomal proteins and increased expression of mitochondrial ribosomal proteins were observed in both the tumor epithelium and the stroma. The transition from preinvasive to invasive growth was accompanied by increased expression of several matrix metalloproteases (MMP2, MMP11 and MMP14). Furthermore, as observed in malignant epithelium, a gene expression signature of histological tumor grade also exists in the stroma, with high-grade tumors associated with increased expression of genes involved in immune response. Our results suggest that the tumor microenvironment participates in tumorigenesis even before tumor cells invade into stroma, and that it may play important roles in the transition from preinvasive to invasive growth. The immune cells in the tumor stroma may be exploited by the malignant epithelial cells in high-grade tumors for aggressive invasive growth.

Broad and deep tumour genome sequencing has shed new light on tumour heterogeneity and provided important insights into the evolution of metastases arising from different clones. There is an additional layer of complexity, in that tumour evolution may be influenced by selective pressure provided by therapy, in a similar fashion to that occurring in infectious diseases. Here we studied tumour genomic evolution in a patient (index patient) with metastatic breast cancer bearing an activating PIK3CA (phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha, PI(3)Kα) mutation. The patient was treated with the PI(3)Kα inhibitor BYL719, which achieved a lasting clinical response, but the patient eventually became resistant to this drug (emergence of lung metastases) and died shortly thereafter. A rapid autopsy was performed and material from a total of 14 metastatic sites was collected and sequenced. All metastatic lesions, when compared to the pre-treatment tumour, had a copy loss of PTEN (phosphatase and tensin homolog) and those lesions that became refractory to BYL719 had additional and different PTEN genetic alterations, resulting in the loss of PTEN expression. To put these results in context, we examined six other patients also treated with BYL719. Acquired bi-allelic loss of PTEN was found in one of these patients, whereas in two others PIK3CA mutations present in the primary tumour were no longer detected at the time of progression. To characterize our findings functionally, we examined the effects of PTEN knockdown in several preclinical models (both in cell lines intrinsically sensitive to BYL719 and in PTEN-null xenografts derived from our index patient), which we found resulted in resistance to BYL719, whereas simultaneous PI(3)K p110β blockade reverted this resistance phenotype. We conclude that parallel genetic evolution of separate metastatic sites with different PTEN genomic alterations leads to a convergent PTEN-null phenotype resistant to PI(3)Kα inhibition.

The success of molecular targeted therapy in cancer may depend on the selection of appropriate tumor types whose survival depends on the drug target, so-called "oncogene addiction." Preclinical approaches to defining drug-responsive subsets are needed if initial clinical trials are to be directed at the most susceptible patient population. Here, we show that gastric cancer cells with high-level stable chromosomal amplification of the growth factor receptor MET are extraordinarily susceptible to the selective inhibitor PHA-665752. Although MET activation has primarily been linked with tumor cell migration and invasiveness, the amplified wild-type MET in these cells is constitutively activated, and its continued signaling is required for cell survival. Treatment with PHA-665752 triggers massive apoptosis in 5 of 5 gastric cancer cell lines with MET amplification but in 0 of 12 without increased gene copy numbers (P = 0.00016). MET amplification may thus identify a subset of epithelial cancers that are uniquely sensitive to disruption of this pathway and define a patient group that is appropriate for clinical trials of targeted therapy using MET inhibitors.

Mutations in a germ-line allele of the BRCA1 gene contribute to the familial breast cancer syndrome. However, the prevalence of these mutations is unknown in women with breast cancer who do not have the features of this familial syndrome. We sought BRCA1 mutations in women who were given a diagnosis of breast cancer at an early age, because early onset is characteristic of a genetic predisposition to cancer.Clinical information and peripheral-blood mononuclear cells were obtained from 418 women from the Boston metropolitan area in whom breast cancer was diagnosed at or before the age of 40. A comprehensive BRCA1 mutational analysis, involving automated nucleotide sequencing and a protein-truncation assay, was undertaken in 30 of these women, who had breast cancer before the age of 30. In addition, the BRCA1 mutation 185delAG, which is prevalent in the Ashkenazi Jewish population, was sought with an allele-specific polymerase-chain-reaction assay in 39 Jewish women among the 418 women who had breast cancer at or before the age of 40.Among 30 women with breast cancer before the age of 30, 4 (13 percent) had definite, chain-terminating mutations and 1 had a missense mutation. Two of the four Jewish women in this cohort had the 185delAG mutation. Among the 39 Jewish women with breast cancer at or before the age of 40, 8 (21 percent) carried the 185delAG mutation (95 percent confidence interval, 9 to 36 percent).Germ-line BRCA1 mutations can be present in young women with breast cancer who do not belong to families with multiple affected members. The specific BRCA1 mutation known as 185delAG is strongly associated with the onset of breast cancer in Jewish women before the age of 40.

Non-communicable diseases, including cancer, are overtaking infectious disease as the leading health-care threat in middle-income and low-income countries. Latin American and Caribbean countries are struggling to respond to increasing morbidity and death from advanced disease. Health ministries and health-care systems in these countries face many challenges caring for patients with advanced cancer: inadequate funding; inequitable distribution of resources and services; inadequate numbers, training, and distribution of health-care personnel and equipment; lack of adequate care for many populations based on socioeconomic, geographic, ethnic, and other factors; and current systems geared toward the needs of wealthy, urban minorities at a cost to the entire population. This burgeoning cancer problem threatens to cause widespread suffering and economic peril to the countries of Latin America. Prompt and deliberate actions must be taken to avoid this scenario. Increasing efforts towards prevention of cancer and avoidance of advanced, stage IV disease will reduce suffering and mortality and will make overall cancer care more affordable. We hope the findings of our Commission and our recommendations will inspire Latin American stakeholders to redouble their efforts to address this increasing cancer burden and to prevent it from worsening and threatening their societies.

Endometrial cancer is the sixth most commonly diagnosed cancer in women worldwide, causing ~74,000 deaths annually. Serous endometrial cancers are a clinically aggressive subtype with a poorly defined genetic etiology. We used whole-exome sequencing to comprehensively search for somatic mutations within ~22,000 protein-encoding genes in 13 primary serous endometrial tumors. We subsequently resequenced 18 genes, which were mutated in more than 1 tumor and/or were components of an enriched functional grouping, from 40 additional serous tumors. We identified high frequencies of somatic mutations in CHD4 (17%), EP300 (8%), ARID1A (6%), TSPYL2 (6%), FBXW7 (29%), SPOP (8%), MAP3K4 (6%) and ABCC9 (6%). Overall, 36.5% of serous tumors had a mutated chromatin-remodeling gene, and 35% had a mutated ubiquitin ligase complex gene, implicating frequent mutational disruption of these processes in the molecular pathogenesis of one of the deadliest forms of endometrial cancer.

Abstract The current model of human breast cancer progression proposes a linear multi‐step process which initiates as flat epithelial atypia (FEA), progresses to atypical ductal hyperplasia (ADH), evolves into DCIS and culminates in the potentially lethal stage of invasive ductal carcinoma. For several decades a major challenge to human breast cancer research has been the identification of the molecular alterations associated with the different stages of breast cancer progression. Until recently, progress in attaining this goal has been hampered by technical limitations associated with applying advanced molecular technologies to the microscopic preinvasive stages of breast tumorigenesis. Recent advances in comprehensive, high‐throughput genetic, transcriptomic and epigenetic technologies in combination with advanced microdissection and ex vivo isolation techniques have provided for a more complete understanding of the complex molecular genetic and molecular biological inter‐relationships of the different stages of human breast cancer evolution. Here we review the molecular biological data suggesting that breast cancer develops and evolves along two distinct molecular genetic pathways. We also briefly review gene expression and epigenetic data that support the view of the tumour microenvironment as an important co‐conspirator rather than a passive bystander during human breast tumorigenesis. Copyright © 2010 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Patient-derived circulating tumour cells are used to characterize the dynamics and underlying plasticity of HER2 expression in non-HER2-amplified breast tumours. These authors characterize circulating tumour cells from patients with advanced estrogen-receptor-positive/HER2-negative breast cancer and find that they can interconvert between two different states. One subpopulation acquires HER2 expression, displays activation of multiple RTK signalling pathways and is highly proliferative. A second population lacks HER2 expression but has elevated Notch1 levels. The HER2-negative population is less proliferative; it is highly resistant to cytotoxic agents but sensitive to Notch1 inhibitors. The rapid interconversion between proliferative and drug-resistant circulating tumour cell subpopulations raises the possibility that simultaneous combination therapy may be of clinical value. Circulating tumour cells in women with advanced oestrogen-receptor (ER)-positive/human epidermal growth factor receptor 2 (HER2)-negative breast cancer acquire a HER2-positive subpopulation after multiple courses of therapy1,2. In contrast to HER2-amplified primary breast cancer, which is highly sensitive to HER2-targeted therapy, the clinical significance of acquired HER2 heterogeneity during the evolution of metastatic breast cancer is unknown. Here we analyse circulating tumour cells from 19 women with ER+/HER2− primary tumours, 84% of whom had acquired circulating tumour cells expressing HER2. Cultured circulating tumour cells maintain discrete HER2+ and HER2− subpopulations: HER2+ circulating tumour cells are more proliferative but not addicted to HER2, consistent with activation of multiple signalling pathways; HER2− circulating tumour cells show activation of Notch and DNA damage pathways, exhibiting resistance to cytotoxic chemotherapy, but sensitivity to Notch inhibition. HER2+ and HER2− circulating tumour cells interconvert spontaneously, with cells of one phenotype producing daughters of the opposite within four cell doublings. Although HER2+ and HER2− circulating tumour cells have comparable tumour initiating potential, differential proliferation favours the HER2+ state, while oxidative stress or cytotoxic chemotherapy enhances transition to the HER2− phenotype. Simultaneous treatment with paclitaxel and Notch inhibitors achieves sustained suppression of tumorigenesis in orthotopic circulating tumour cell-derived tumour models. Together, these results point to distinct yet interconverting phenotypes within patient-derived circulating tumour cells, contributing to progression of breast cancer and acquisition of drug resistance.

Functional maturation of B lymphocytes correlates with expression of the B lineage-specific cell surface glycoprotein CD22. Two CD22 polypeptides have been characterized and suggested to play a role in B cell-B cell interaction as well as in B cell adhesion to monocytes. In this work we provide evidence that CD22 is directly involved in the cognate interaction between B and T cells. One of the two CD22 polypeptides, CD22 beta, interacts with a specific ligand on a subpopulation of CD4+ T cells. Our results suggest that the T cell ligand of CD22 is CD45RO, an isoform of the leukocyte common antigen class of phosphotyrosine phosphatases associated with the helper T cell phenotype. We further demonstrate that CD22 recognizes a second ligand, CD75, expressed predominantly on activated B cells and shown to be a cell surface alpha 2-6 sialyltransferase.

Biomarkers to improve the risk-benefit of extended adjuvant endocrine therapy for late recurrence in patients with oestrogen-receptor-positive breast cancer would be clinically valuable. We compared the prognostic ability of the breast-cancer index (BCI) assay, 21-gene recurrence score (Oncotype DX), and an immunohistochemical prognostic model (IHC4) for both early and late recurrence in patients with oestrogen-receptor-positive, node-negative (N0) disease who took part in the Arimidex, Tamoxifen, Alone or in Combination (ATAC) clinical trial.In this prospective comparison study, we obtained archival tumour blocks from the TransATAC tissue bank from all postmenopausal patients with oestrogen-receptor-positive breast cancer from whom the 21-gene recurrence score and IHC4 values had already been derived. We did BCI analysis in matched samples with sufficient residual RNA using two BCI models-cubic (BCI-C) and linear (BCI-L)-using previously validated cutoffs. We assessed prognostic ability of BCI for distant recurrence over 10 years (the primary endpoint) and compared it with that of the 21-gene recurrence score and IHC4. We also tested the ability of the assays to predict early (0-5 years) and late (5-10 years) distant recurrence. To assess the ability of the biomarkers to predict recurrence beyond standard clinicopathological variables, we calculated the change in the likelihood-ratio χ(2) (LR-Δχ(2)) from Cox proportional hazards models.Suitable tissue was available from 665 patients with oestrogen-receptor-positive, N0 breast cancer for BCI analysis. The primary analysis showed significant differences in risk of distant recurrence over 10 years in the categorical BCI-C risk groups (p<0·0001) with 6·8% (95% CI 4·4-10·0) of patients in the low-risk group, 17·3% (12·0-24·7) in the intermediate group, and 22·2% (15·3-31·5) in the high-risk group having distant recurrence. The secondary analysis showed that BCI-L was a much stronger predictor for overall (0-10 year) distant recurrence compared with BCI-C (interquartile HR 2·30 [95% CI 1·62-3·27]; LR-Δχ(2)=22·69; p<0·0001). When compared with BCI-L, the 21-gene recurrence score was less predictive (HR 1·48 [95% CI 1·22-1·78]; LR-Δχ(2)=13·68; p=0·0002) and IHC4 was similar (HR 1·69 [95% CI 1·51-2·56]; LR-Δχ(2)=22·83; p<0·0001). All further analyses were done with the BCI-L model. In a multivariable analysis, all assays had significant prognostic ability for early distant recurrence (BCI-L HR 2·77 [95% CI 1·63-4·70], LR-Δχ(2)=15·42, p<0·0001; 21-gene recurrence score HR 1·80 [1·42-2·29], LR-Δχ(2)=18·48, p<0·0001; IHC4 HR 2·90 [2·01-4·18], LR-Δχ(2)=29·14, p<0·0001); however, only BCI-L was significant for late distant recurrence (BCI-L HR 1·95 [95% CI 1·22-3·14], LR-Δχ(2)=7·97, p=0·0048; 21-gene recurrence score HR 1·13 [0·82-1·56], LR-Δχ(2)=0·48, p=0·47; IHC4 HR 1·30 [0·88-1·94], LR-Δχ(2)=1·59, p=0·20).BCI-L was the only significant prognostic test for risk of both early and late distant recurrence and identified two risk populations for each timeframe. It could help to identify patients at high risk for late distant recurrence who might benefit from extended endocrine or other therapy.Avon Foundation, National Institutes of Health, Breast Cancer Foundation, US Department of Defense Breast Cancer Research Program, Susan G Komen for the Cure, Breakthrough Breast Cancer through the Mary-Jean Mitchell Green Foundation, AstraZeneca, Cancer Research UK, and the National Institute for Health Research Biomedical Research Centre at the Royal Marsden (London, UK).

Abstract Purpose: Histologic tumor grade is a well-established prognostic factor for breast cancer, and tumor grade–associated genes are the common denominator of many prognostic gene signatures. The objectives of this study are as follows: (a) to develop a simple gene expression index for tumor grade (molecular grade index or MGI), and (b) to determine whether MGI and our previously described HOXB13:IL17BR index together provide improved prognostic information. Experimental Design: From our previously published list of genes whose expression correlates with both tumor grade and tumor stage progression, we selected five cell cycle–related genes to build MGI and evaluated MGI in two publicly available microarray data sets totaling 410 patients. Using two additional cohorts (n = 323), we developed a real-time reverse transcription PCR assay for MGI, validated its prognostic utility, and examined its interaction with HOXB13:IL17BR. Results: MGI performed consistently as a strong prognostic factor and was comparable with a more complex 97-gene genomic grade index in multiple data sets. In patients treated with endocrine therapy, MGI and HOXB13:IL17BR modified each other's prognostic performance. High MGI was associated with significantly worse outcome only in combination with high HOXB13:IL17BR, and likewise, high HOXB13:IL17BR was significantly associated with poor outcome only in combination with high MGI. Conclusions: We developed and validated a five-gene reverse transcription PCR assay for MGI suitable for analyzing routine formalin-fixed paraffin-embedded clinical samples. The combination of MGI and HOXB13:IL17BR outperforms either alone and identifies a subgroup (∼30%) of early stage estrogen receptor–positive breast cancer patients with very poor outcome despite endocrine therapy.

Changes in gene expression in pancreatic beta-cells from type 2 diabetes (T2D) should provide insights into their abnormal insulin secretion and turnover.Frozen sections were obtained from cadaver pancreases of 10 control and 10 T2D human subjects. Beta-cell enriched samples were obtained by laser capture microdissection (LCM). RNA was extracted, amplified and subjected to microarray analysis. Further analysis was performed with DNA-Chip Analyzer (dChip) and Gene Set Enrichment Analysis (GSEA) software. There were changes in expression of genes linked to glucotoxicity. Evidence of oxidative stress was provided by upregulation of several metallothionein genes. There were few changes in the major genes associated with cell cycle, apoptosis or endoplasmic reticulum stress. There was differential expression of genes associated with pancreatic regeneration, most notably upregulation of members of the regenerating islet gene (REG) family and metalloproteinase 7 (MMP7). Some of the genes found in GWAS studies to be related to T2D were also found to be differentially expressed. IGF2BP2, TSPAN8, and HNF1B (TCF2) were upregulated while JAZF1 and SLC30A8 were downregulated.This study made possible by LCM has identified many novel changes in gene expression that enhance understanding of the pathogenesis of T2D.

<h3>Importance</h3> Multiple molecular signatures are available for managing estrogen receptor (ER)–positive breast cancer but with little direct comparative information to guide the patient’s choice. <h3>Objective</h3> To conduct a within-patient comparison of the prognostic value of 6 multigene signatures in women with early ER-positive breast cancer who received endocrine therapy for 5 years. <h3>Design, Setting, and Participants</h3> This retrospective biomarker analysis included 774 postmenopausal women with ER-positive<i>ERBB2</i>(formerly<i>HER2</i>)–negative breast cancer. This analysis was performed as a preplanned secondary study of data from the Anastrozole or Tamoxifen Alone or Combined randomized clinical trial comparing 5-year treatment with anastrozole vs tamoxifen with 10-year follow-up data. The signatures included the Oncotype Dx recurrence score, PAM50-based Prosigna risk of recurrence (ROR), Breast Cancer Index (BCI), EndoPredict (EPclin), Clinical Treatment Score, and 4-marker immunohistochemical score. Data were collected from January 2009, through April 2015. <h3>Main Outcomes and Measures</h3> The primary objective was to compare the prognostic value of these signatures in addition to the Clinical Treatment Score (nodal status, tumor size, grade, age, and endocrine treatment) for distant recurrence for 0 to 10 years and 5 to 10 years after diagnosis. Likelihood ratio (LR) statistics were used with the χ²test and C indexes to assess the prognostic value of each signature. <h3>Results</h3> In this study of 774 postmenopausal women with ER-positive,<i>ERBB2</i>-negative disease (mean [SD] age, 64.1 [8.1] years), 591 (mean [SD] age, 63.4 [7.9] years) had node-negative disease. The signatures providing the most prognostic information were the ROR (hazard ratio [HR], 2.56; 95% CI, 1.96-3.35), followed by the BCI (HR, 2.46; 95% CI, 1.88-3.23) and EPclin (HR, 2.14; 95% CI, 1.71-2.68). Each provided significantly more information than the Clinical Treatment Score (HR, 1.99; 95% CI, 1.58-2.50), the recurrence score (HR, 1.69; 95% CI, 1.40-2.03), and the 4-marker immunohistochemical score (HR, 1.95; 95% CI, 1.55-2.45). Substantially less information was provided by all 6 molecular tests for the 183 patients with 1 to 3 positive nodes, but the BCI (ΔLR χ² = 9.2) and EPclin (ΔLR χ² = 7.4) provided more additional prognostic information than the other signatures. <h3>Conclusions and Relevance</h3> For women with node-negative disease, the ROR, BCI, and EPclin were significantly more prognostic for overall and late distant recurrence. For women with 1 to 3 positive nodes, limited independent information was available from any test. These data might help oncologists and patients to choose the most appropriate test when considering chemotherapy use and/or extended endocrine therapy. <h3>Trial Registration</h3> isrctn.com Identifier: ISRCTN18233230

The molecular analysis of biomarkers in oncology is rapidly advancing, but the incorporation of new molecular tests into clinical practice will require a greater understanding of the genetic changes that drive malignancy, the assays used to measure the resulting phenotypes and genotypes, and the regulatory processes that new molecular biomarkers must face to be accepted for clinical use. To address these issues and provide an overview of current molecular testing in 6 major malignancies, including glioma, breast cancer, colon cancer, lung cancer, prostate cancer, and acute myelogenous leukemia, an NCCN Task Force was convened on the topic of evaluating the clinical utility of tumor markers in oncology. The output of this meeting, contained within this report, describes the ways biomarkers have been developed and used; defines common terminology, including prognostic, predictive, and companion diagnostic markers, and analytic validity, clinical validity, and clinical utility; and proposes the use of a combination level of evidence score to aid in the evaluation of novel biomarker tests as they arise. The current state of regulatory oversight and anticipated changes in the regulation of molecular testing are also addressed.

The goal of this study was to comprehensively define the incidence of mutations in all exons of PIK3CA in both endometrioid endometrial cancer (EEC) and nonendometrioid endometrial cancer (NEEC).We resequenced all coding exons of PIK3CA and PTEN, and exons 1 and 2 of KRAS, from 108 primary endometrial tumors. Somatic mutations were confirmed by sequencing matched normal DNAs. The biochemical properties of a subset of novel PIK3CA mutations were determined by exogenously expressing wild type and mutant constructs in U2OS cells and measuring levels of AKT(Ser473) phosphorylation.Somatic PIK3CA mutations were detected in 52.4% of 42 EECs and 33.3% of 66 NEECs. Half (29 of 58) of all nonsynonymous PIK3CA mutations were in exons 1-7 and half were in exons 9 and 20. The exons 1-7 mutations localized to the ABD, ABD-RBD linker and C2 domains of p110α. Within these regions, Arg88, Arg93, Gly106, Lys111, Glu365, and Glu453, were recurrently mutated; Arg88, Arg93, and Lys111 formed mutation hotspots. The p110α-R93W, -G106R, -G106V, -K111E, -delP449-L455, and -E453K mutants led to increased levels of phospho-AKT(Ser473) compared to wild-type p110α. Overall, 62% of exons 1-7 PIK3CA mutants and 64% of exons 9-20 PIK3CA mutants were activating; 72% of exon 1-7 mutations have not previously been reported in endometrial cancer.Our study identified a new subgroup of endometrial cancer patients with activating mutations in the amino-terminal domains of p110α; these patients might be appropriate for consideration in clinical trials of targeted therapies directed against the PI3K pathway.

Xenograft cell transplantation into immunodeficient mice has become the gold standard for assessing pre-clinical efficacy of cancer drugs, yet direct visualization of single-cell phenotypes is difficult. Here, we report an optically-clear prkdc-/-, il2rga-/- zebrafish that lacks adaptive and natural killer immune cells, can engraft a wide array of human cancers at 37°C, and permits the dynamic visualization of single engrafted cells. For example, photoconversion cell-lineage tracing identified migratory and proliferative cell states in human rhabdomyosarcoma, a pediatric cancer of muscle. Additional experiments identified the preclinical efficacy of combination olaparib PARP inhibitor and temozolomide DNA-damaging agent as an effective therapy for rhabdomyosarcoma and visualized therapeutic responses using a four-color FUCCI cell-cycle fluorescent reporter. These experiments identified that combination treatment arrested rhabdomyosarcoma cells in the G2 cell cycle prior to induction of apoptosis. Finally, patient-derived xenografts could be engrafted into our model, opening new avenues for developing personalized therapeutic approaches in the future.

Residual risk of relapse remains a substantial concern for patients with hormone receptor-positive breast cancer, with approximately half of all disease recurrences occurring after five years of adjuvant antiestrogen therapy.The objective of this study was to examine the prognostic performance of an optimized model of Breast Cancer Index (BCI), an algorithmic gene expression-based signature, for prediction of early (0-5 years) and late (>5 years) risk of distant recurrence in patients with estrogen receptor-positive (ER(+)), lymph node-negative (LN(-)) tumors. The BCI model was validated by retrospective analyses of tumor samples from tamoxifen-treated patients from a randomized prospective trial (Stockholm TAM, n = 317) and a multi-institutional cohort (n = 358).Within the Stockholm TAM cohort, BCI risk groups stratified the majority (∼65%) of patients as low risk with less than 3% distant recurrence rate for 0 to 5 years and 5 to 10 years. In the multi-institutional cohort, which had larger tumors, 55% of patients were classified as BCI low risk with less than 5% distant recurrence rate for 0 to 5 years and 5 to 10 years. For both cohorts, continuous BCI was the most significant prognostic factor beyond standard clinicopathologic factors for 0 to 5 years and more than five years.The prognostic sustainability of BCI to assess early- and late-distant recurrence risk at diagnosis has clinical use for decisions of chemotherapy at diagnosis and for decisions for extended adjuvant endocrine therapy beyond five years.

Biomarkers to optimize extended adjuvant endocrine therapy for women with estrogen receptor (ER)-positive breast cancer are limited. The HOXB13/IL17BR (H/I) biomarker predicts recurrence risk in ER-positive, lymph node-negative breast cancer patients. H/I was evaluated in MA.17 trial for prognostic performance for late recurrence and treatment benefit from extended adjuvant letrozole.A prospective-retrospective, nested case-control design of 83 recurrences matched to 166 nonrecurrences from letrozole- and placebo-treated patients within MA.17 was conducted. Expression of H/I within primary tumors was determined by reverse-transcription polymerase chain reaction with a prespecified cutpoint. The predictive ability of H/I for ascertaining benefit from letrozole was determined using multivariable conditional logistic regression including standard clinicopathological factors as covariates. All statistical tests were two-sided.High H/I was statistically significantly associated with a decrease in late recurrence in patients receiving extended letrozole therapy (odds ratio [OR] = 0.35; 95% confidence interval [CI] = 0.16 to 0.75; P = .007). In an adjusted model with standard clinicopathological factors, high H/I remained statistically significantly associated with patient benefit from letrozole (OR = 0.33; 95% CI = 0.15 to 0.73; P = .006). Reduction in the absolute risk of recurrence at 5 years was 16.5% for patients with high H/I (P = .007). The interaction between H/I and letrozole treatment was statistically significant (P = .03).In the absence of extended letrozole therapy, high H/I identifies a subgroup of ER-positive patients disease-free after 5 years of tamoxifen who are at risk for late recurrence. When extended endocrine therapy with letrozole is prescribed, high H/I predicts benefit from therapy and a decreased probability of late disease recurrence.

In cancer, the primary tumour's organ of origin and histopathology are the strongest determinants of its clinical behaviour, but in 3% of cases a patient presents with a metastatic tumour and no obvious primary. Here, as part of the ICGC/TCGA Pan-Cancer Analysis of Whole Genomes (PCAWG) Consortium, we train a deep learning classifier to predict cancer type based on patterns of somatic passenger mutations detected in whole genome sequencing (WGS) of 2606 tumours representing 24 common cancer types produced by the PCAWG Consortium. Our classifier achieves an accuracy of 91% on held-out tumor samples and 88% and 83% respectively on independent primary and metastatic samples, roughly double the accuracy of trained pathologists when presented with a metastatic tumour without knowledge of the primary. Surprisingly, adding information on driver mutations reduced accuracy. Our results have clinical applicability, underscore how patterns of somatic passenger mutations encode the state of the cell of origin, and can inform future strategies to detect the source of circulating tumour DNA.

BackgroundExtending the duration of adjuvant endocrine therapy reduces the risk of recurrence in a subset of women with early-stage hormone receptor-positive (HR+) breast cancer. Validated predictive biomarkers of endocrine response could significantly improve patient selection for extended therapy. Breast cancer index (BCI) [HOXB13/IL17BR ratio (H/I)] was evaluated for its ability to predict benefit from extended endocrine therapy in patients previously randomized in the Adjuvant Tamoxifen—To Offer More? (aTTom) trial.Patients and methodsTrans-aTTom is a multi-institutional, prospective–retrospective study in patients with available formalin-fixed paraffin-embedded primary tumor blocks. BCI testing and central determination of estrogen receptor (ER) and progesterone receptor (PR) status by immunohistochemistry were carried out blinded to clinical outcome. Survival endpoints were evaluated using Kaplan–Meier analysis and Cox regression with recurrence-free interval (RFI) as the primary endpoint. Interaction between extended endocrine therapy and BCI (H/I) was assessed using the likelihood ratio test.ResultsOf 583 HR+, N+ patients analyzed, 49% classified as BCI (H/I)-High derived a significant benefit from 10 versus 5 years of tamoxifen treatment [hazard ratio (HR): 0.35; 95% confidence interval (CI) 0.15–0.86; 10.2% absolute risk reduction based on RFI, P = 0.027]. BCI (H/I)-low patients showed no significant benefit from extended endocrine therapy (HR: 1.07; 95% CI 0.69–1.65; −0.2% absolute risk reduction; P = 0.768). Continuous BCI (H/I) levels predicted the magnitude of benefit from extended tamoxifen, whereas centralized ER and PR did not. Interaction between extended tamoxifen treatment and BCI (H/I) was statistically significant (P = 0.012), adjusting for clinicopathological factors.ConclusionBCI by high H/I expression was predictive of endocrine response and identified a subset of HR+, N+ patients with significant benefit from 10 versus 5 years of tamoxifen therapy. These data provide further validation, consistent with previous MA.17 data, establishing level 1B evidence for BCI as a predictive biomarker of benefit from extended endocrine therapy.Trial registrationISRCTN17222211; NCT00003678.

Breast cancers lacking estrogen and progesterone receptor expression and Her2 amplification exhibit distinct gene expression profiles and clinical features, and they comprise the majority of BRCA1-associated tumors. Here we demonstrated that the p53 family member p63 controls a pathway for p73-dependent cisplatin sensitivity specific to these "triple-negative" tumors. In vivo, DeltaNp63 and TAp73 isoforms were coexpressed exclusively within a subset of triple-negative primary breast cancers that commonly exhibited mutational inactivation of p53. The DeltaNp63alpha isoform promoted survival of breast cancer cells by binding TAp73 and thereby inhibiting its proapoptotic activity. Consequently, inhibition of p63 by RNA interference led to TAp73-dependent induction of proapoptotic Bcl-2 family members and apoptosis. Breast cancer cells expressing DeltaNp63alpha and TAp73 exhibited cisplatin sensitivity that was uniquely dependent on TAp73. Thus, in response to treatment with cisplatin, but not other chemotherapeutic agents, TAp73 underwent c-Abl-dependent phosphorylation, which promoted dissociation of the DeltaNp63alpha/TAp73 protein complex, TAp73-dependent transcription of proapoptotic Bcl-2 family members, and apoptosis. These findings define p63 as a survival factor in a subset of breast cancers; furthermore, they provide what we believe to be a novel mechanism for cisplatin sensitivity in these triple-negative cancers, and they suggest that such cancers may share the cisplatin sensitivity of BRCA1-associated tumors.

It has been hypothesized that wide excision alone with margins > or = 1 cm may be adequate treatment for small, grade 1 or 2 ductal carcinoma in situ (DCIS). To test this hypothesis, we conducted a prospective, single-arm trial.Entry criteria included DCIS of predominant grade 1 or 2 with a mammographic extent of < or = 2.5 cm treated with wide excision with final margins of > or = 1 cm or a re-excision without residual DCIS. Tamoxifen was not permitted. The accrual goal was 200 patients.In July 2002, the study closed to accrual at 158 patients because the number of local recurrences met the predetermined stopping rules. The median age was 51 and the median follow-up time was 40 months. Thirteen patients developed local recurrence as the first site of treatment failure 7 to 63 months after study entry. The rate of ipsilateral local recurrence as first site of treatment failure was 2.4% per patient-year, corresponding to a 5-year rate of 12%. Nine patients (69%) experienced recurrence of DCIS and four (31%) experienced recurrence with invasive disease. Twelve recurrences were detected mammographically and one was palpable. Ten were in the same quadrant as the initial DCIS and three were elsewhere within the ipsilateral breast. No patient had positive axillary nodes at recurrence or subsequent metastatic disease.Despite margins of > or = 1 cm, the local recurrence rate is substantial when patients with small, grade 1 or 2 DCIS are treated with wide excision alone. This risk should be considered in assessing the possible use of radiation therapy with or without tamoxifen in these patients.

The Notch family of cell surface receptors plays a key role in cell-fate determination and differentiation, functioning in a cell- and context-specific manner. In mammalian cells, Notch activation is generally thought to maintain stem cell potential and inhibit differentiation, thereby promoting carcinogenesis. However, in other contexts such as primary epithelial cells (keratinocytes), increased Notch activity causes exit from the cell cycle and/or commitment to differentiation. We now report that expression of the endogenous Notch1 gene is markedly reduced in a panel of cervical carcinoma cells whereas expression of Notch2 remains elevated, and Notch1 expression is similarly reduced or absent in invasive cervical cancers. Conversely, expression of activated Notch1 causes strong growth inhibition of HPV-positive, but not HPV-negative, cervical carcinoma cells, but exerts no such effects on other epithelial tumor cells. Increased Notch1 signaling, but not Notch2, causes a dramatic down-modulation of HPV-driven transcription of the E6/E7 viral genes, through suppression of AP-1 activity by up-regulation of the Fra-1 family member and decreased c-Fos expression. Thus, Notch1 exerts specific protective effects against HPV-induced transformation through suppression of E6/E7 expression, and down-modulation of Notch1 expression is likely to play an important role in late stages of HPV-induced carcinogenesis.

We previously identified three genes, HOXB13, IL17BR and CHDH, and the HOXB13:IL17BR ratio index in particular, that strongly predicted clinical outcome in breast cancer patients receiving tamoxifen monotherapy. Confirmation in larger independent patient cohorts was needed to fully validate their clinical utility.Expression of HOXB13, IL17BR, CHDH, estrogen receptor (ER) and progesterone receptor (PR) were quantified by real-time polymerase chain reaction in 852 formalin-fixed, paraffin-embedded primary breast cancers from 566 untreated and 286 tamoxifen-treated breast cancer patients. Gene expression and clinical variables were analyzed for association with relapse-free survival (RFS) by Cox proportional hazards regression models.ER and PR mRNA measurements were in close agreement with immunohistochemistry. In the entire cohort, expression of HOXB13 was associated with shorter RFS (P = .008), and expression of IL17BR and CHDH was associated with longer RFS (P < .0001 for IL17BR and P = .0002 for CHDH). In ER+ patients, the HOXB13:IL17BR index predicted clinical outcome independently of treatment, but more strongly in node-negative patients. In multivariate analysis of the ER+ node-negative subgroup including age, PR status, tumor size, S phase fraction, and tamoxifen treatment, the two-gene index remained a significant predictor of RFS (hazard ratio = 3.9; 95% CI, 1.5 to 10.3; P = .007).This tumor bank study demonstrated HOXB13:IL17BR index is a strong independent prognostic factor for ER+ node-negative patients irrespective of tamoxifen therapy.

The B lymphocyte cell surface receptor CD22 is an adhesion molecule that can mediate binding to several leukocyte subsets. The first CD22 ligand to be identified was the receptor-linked phosphotyrosine phosphatase CD45, but several lines of evidence suggest that CD22 may interact with multiple counter receptors on adjacent lymphocytes. In the present work, we show that in addition to CD45, a soluble CD22-immunoglobulin fusion protein (CD22Rg) recognizes several other distinct lymphocyte sialoglycoproteins. CD22-mediated adhesion is dependent upon the presence of sialic acids on ligands. CD22Rg is observed to bind specifically to a 115-kDa sialoglycoprotein in COS cells transfected with an alpha-2,6-sialyltransferase cDNA, but not in COS cells transfected with unrelated cDNA clones, indicating that at least some CD22-mediated interactions require presentation of sialic acid in an alpha-2,6 linkage by CD22 ligands. In all cases, truncation of the side chain of sialic acids by mild periodate oxidation abolishes recognition by CD22Rg. Direct binding of CD22Rg to lymphoid cells also requires sialic acids and their side chains. Taken together, these observations indicate that CD22 is a sialic acid-binding lectin and may define a novel functional subset of immunoglobulin superfamily adhesion molecules.

To assess pathologic complete response (pCR), clinical response, feasibility, safety, and potential predictors of response to preoperative trastuzumab plus vinorelbine in patients with operable, human epidermal growth factor receptor 2 (HER2)-positive breast cancer.Forty-eight patients received preoperative trastuzumab and vinorelbine weekly for 12 weeks. Single and multigene biomarker studies were done in an attempt to identify predictors of response.Eight of 40 (20%) patients achieved pCR (95% confidence interval, 9-36%). Of 9 additional patients recruited for protocol-defined toxicity analysis, 8 were evaluable; 42 of 48 (88%) patients had clinical response (16 patients, clinical complete response; 26 patients, clinical partial response). T(1) tumors more frequently exhibited clinical complete response (P = 0.05) and showed a trend to exhibit pCR (P = 0.07). Five (13%) patients experienced grade 1 cardiac dysfunction during preoperative treatment. Neither HER2 nor estrogen receptor status changed significantly after exposure to trastuzumab and vinorelbine. RNA profiling identified three top-level clusters by unsupervised analysis. Tumors with extremes of response [pCR (n = 3) versus nonresponse (n = 3)] fell into separate groups by hierarchical clustering. No predictive genes were identified in pCR tumors. Nonresponding tumors were more likely to be T(4) stage (P = 0.02) and express basal markers (P < 0.00001), growth factors, and growth factor receptors. Insulin-like growth factor-I receptor membrane expression was associated with a lower response rate (50% versus 97%; P = 0.001).Preoperative trastuzumab plus vinorelbine is active and well tolerated in patients with HER2-positive, operable, stage II/III breast cancer. HER2-overexpressing tumors with a basal-like phenotype, or with expression of insulin-like growth factor-I receptor and other proteins involved in growth factor pathways, are more likely to be resistant to this regimen.

The development and use of molecular-based therapy for breast cancer and other human malignancies will require a detailed molecular genetic analysis of patient tissues. The recent development of laser capture microdissection and high density cDNA arrays now provides a unique opportunity to generate gene expression profiles of cells from various stages of tumor progression as it occurs in the actual neoplastic tissue milieu. We report the combined use of laser capture microdissection and high-throughput cDNA microarrays to monitor in vivo gene expression levels in purified normal, invasive, and metastatic breast cell populations from a single patient. These in vivo gene expression profiles were verified by real-time quantitative PCR and immunohistochemistry. The combined use of laser capture microdissection and cDNA microarray analysis provides a powerful new approach to elucidate the in vivo molecular events surrounding the development and progression of breast cancer and is generally applicable to the study of malignancy.

CD22 beta is a glycoprotein found on the surface of B cells during restricted stages of development. It is believed to play a role in cell-cell interactions and B cell activation. The accompanying paper (Sgroi, D., Varki, A., Braesch-Andersen, S., and Stamenkovic, I. (1993) J. Biol. Chem. 268, 7011-7018) shows that CD22 beta recognizes multiple glycoproteins on the surfaces of T and B cells and that sialylation of these ligands is essential for binding. To identify the structure(s) of the sialylated oligosaccharide(s) recognized by CD22 beta, [3H]glucosamine-labeled glycoproteins were purified from Daudi cells by adsorption onto a CD22 beta recombinant immunoglobulin (CD22 beta Rg) chimera attached to protein A-Sepharose (PAS), and the N-linked oligosaccharides were released by peptide N-glycosidase F. These released oligosaccharides failed to bind to CD22 beta Rg-PAS under the conditions used initially to adsorb the glycoproteins, but their elution from a column of CD22 beta Rg-PAS was significantly retarded. Populations of oligosaccharides with different affinities could be identified by their order of elution. Specific sialidases were used to determine the content of alpha-2,3- and alpha-2,6-linked sialic acid in these different populations and their contribution to binding. Multiantennary oligosaccharides with one alpha-2,6-linked residue bound marginally, and those with two or more bound more tightly. alpha-2,3-Linked sialic acid residues were without effect. Binding did not require divalent cations and was abrogated by mild periodate oxidation of the outer side chain of sialic acid. No marked differences in size or fucose content were found between the populations of high and low affinity oligosaccharides. However, the low affinity population could be partially converted into higher affinity by treatment with beta-galactoside alpha-2,6 sialyltransferase and CMP-sialic acid. Thus, CD22 beta is a mammalian lectin that can recognize specific N-linked oligosaccharide structures containing alpha-2,6-linked sialic acids.

The process of invasion and metastasis during tumor progression is often reminiscent of cell migration events occurring during embryonic development. We hypothesized that genes controlling cellular changes in the Spemann organizer at gastrulation might be reactivated in tumors. The Goosecoid homeobox transcription factor is a known executer of cell migration from the Spemann organizer. We found that indeed Goosecoid is overexpressed in a majority of human breast tumors. Ectopic expression of Goosecoid in human breast cells generated invasion-associated cellular changes, including an epithelial–mesenchymal transition. TGF-β signaling, known to promote metastasis, induced Goosecoid expression in human breast cells. Moreover, Goosecoid significantly enhanced the ability of breast cancer cells to form pulmonary metastases in mice. These results demonstrate that Goosecoid promotes tumor cell malignancy and suggest that other conserved organizer genes may function similarly in human cancer.

Hypertrophy is one mechanism of pancreatic beta-cell growth and is seen as an important compensatory response to insulin resistance. We hypothesized that the induction of protective genes contributes to the survival of enlarged (hypertrophied) beta-cells. Here, we evaluated changes in stress gene expression that accompany beta-cell hypertrophy in islets from hyperglycemic rats 4 weeks after partial pancreatectomy (Px). A variety of protective genes were upregulated, with markedly increased expression of the antioxidant genes heme oxygenase-1 and glutathione peroxidase and the antiapoptotic gene A20. Cu/Zn-superoxide dismutase (SOD) and Mn-SOD were modestly induced, and Bcl-2 was modestly reduced; however, several other stress genes (catalase, heat shock protein 70, and p53) were unaltered. The increases in mRNA levels corresponded to the degree of hyperglycemia and were reversed in Px rats by 2-week treatment with phlorizin (treatment that normalized hyperglycemia), strongly suggesting the specificity of hyperglycemia in eliciting the response. Hyperglycemia in Px rats also led to activation of nuclear factor-kappaB in islets. The profound change in beta-cell phenotype of hyperglycemic Px rats resulted in a reduced sensitivity to the beta-cell toxin streptozotocin. Sensitivity to the toxin was restored, along with the beta-cell phenotype, in islets from phlorizin-treated Px rats. Furthermore, beta-cells of Px rats were not vulnerable to apoptosis when further challenged in vivo with dexamethasone, which increases insulin resistance. In conclusion, beta-cell adaptation to chronic hyperglycemia and, hence, increased insulin demand is accompanied by the induction of protective stress genes that may contribute to the survival of hypertrophied beta-cells.

Phosphoinositide 3-kinase (PI3K) is an important therapeutic target. Mutations in PIK3CA, which encodes p110α, the catalytic subunit of PI3K, occur in endometrioid endometrial cancers (EEC) and nonendometrioid endometrial cancers (NEEC). The goal of this study was to determine whether PIK3R1, which encodes p85α, the inhibitory subunit of PI3K, is mutated in endometrial carcinoma. We carried out exonic sequencing of PIK3R1 from 42 EECs and 66 NEECs. The pattern of PIK3R1 mutations was compared with the patterns of PIK3CA, PTEN, and KRAS mutations. The biochemical effect of seven PIK3R1 mutations was examined by stable expression in U2OS cells, followed by coimmunoprecipitation analysis of p110α, and Western blotting of phospho-AKT(Ser473) (p-AKT(Ser473)). We found that PIK3R1 was somatically mutated in 43% of EECs and 12% of NEECs. The majority of mutations (93.3%) were localized to the p85α-nSH2 and -iSH2 domains. Several mutations were recurrent. PIK3R1 mutations were significantly (P = 0.0015) more frequent in PIK3CA-wild type EECs (70%) than in PIK3CA mutant EECs (18%). Introduction of wild-type p85α into U2OS cells reduced the level of p-AKT(Ser473) compared with the vector control. Five p85α mutants, p85αdelH450-E451, p85αdelK459, p85αdelY463-L466, p85αdelR574-T576, and the p85αN564D positive control, were shown to bind p110α and led to increased levels of p-AKT(Ser473). The p85αR348X and p85αK511VfsX2 mutants did not bind p110α and showed no appreciable change in p-AKT(Ser473) levels. In conclusion, our study has revealed a new mode of PI3K alteration in primary endometrial tumors and warrants future studies to determine whether PIK3R1 mutations correlate with clinical outcome to targeted therapies directed against the PI3K pathway in EEC and NEEC.

In models of type 2 diabetes the expression of β-cell genes is altered, but these changes have not fully explained the impairment in β-cell function. We hypothesized that changes in β-cell phenotype and global alterations in both carbohydrate and lipid pathways are likely to contribute to secretory abnormalities. Therefore, expression of genes involved in carbohydrate and lipid metabolism were analyzed in islets 4 weeks after 85–95% partial pancreatectomy (Px) when β-cells have impaired glucose-induced insulin secretion and ATP synthesis. Px rats after 1 week developed mild to severe hyperglycemia that was stable for the next 3 weeks, whereas neither plasma triglyceride, non-esterified fatty acid, or islet triglyceride levels were altered. Expression of peroxisome proliferator-activated receptors (PPARs), with several target genes, were reciprocally regulated; PPARα was markedly reduced even at low level hyperglycemia, whereas PPARγ was progressively increased with increasing hyperglycemia. Uncoupling protein 2 (UCP-2) was increased as were other genes barely expressed in sham islets including lactate dehydrogenase-A (LDH-A), lactate (monocarboxylate) transporters, glucose-6-phosphatase, fructose-1,6-bisphosphatase, 12-lipoxygenase, and cyclooxygenase 2. On the other hand, the expression of β-cell-associated genes, insulin, and GLUT2 were decreased. Treating Px rats with phlorizin normalized hyperglycemia without effecting plasma fatty acids and reversed the changes in gene expression implicating the importance of hyperglycemia per se in the loss of β-cell phenotype. In addition, parallel changes were observed in β-cell-enriched tissue dissected by laser capture microdissection from the central core of islets. In conclusion, chronic hyperglycemia leads to a critical loss of β-cell differentiation with altered expression of genes involved in multiple metabolic pathways diversionary to normal β-cell glucose metabolism. This global maladaptation in gene expression at the time of increased secretory demand may contribute to the β-cell dysfunction found in diabetes. In models of type 2 diabetes the expression of β-cell genes is altered, but these changes have not fully explained the impairment in β-cell function. We hypothesized that changes in β-cell phenotype and global alterations in both carbohydrate and lipid pathways are likely to contribute to secretory abnormalities. Therefore, expression of genes involved in carbohydrate and lipid metabolism were analyzed in islets 4 weeks after 85–95% partial pancreatectomy (Px) when β-cells have impaired glucose-induced insulin secretion and ATP synthesis. Px rats after 1 week developed mild to severe hyperglycemia that was stable for the next 3 weeks, whereas neither plasma triglyceride, non-esterified fatty acid, or islet triglyceride levels were altered. Expression of peroxisome proliferator-activated receptors (PPARs), with several target genes, were reciprocally regulated; PPARα was markedly reduced even at low level hyperglycemia, whereas PPARγ was progressively increased with increasing hyperglycemia. Uncoupling protein 2 (UCP-2) was increased as were other genes barely expressed in sham islets including lactate dehydrogenase-A (LDH-A), lactate (monocarboxylate) transporters, glucose-6-phosphatase, fructose-1,6-bisphosphatase, 12-lipoxygenase, and cyclooxygenase 2. On the other hand, the expression of β-cell-associated genes, insulin, and GLUT2 were decreased. Treating Px rats with phlorizin normalized hyperglycemia without effecting plasma fatty acids and reversed the changes in gene expression implicating the importance of hyperglycemia per se in the loss of β-cell phenotype. In addition, parallel changes were observed in β-cell-enriched tissue dissected by laser capture microdissection from the central core of islets. In conclusion, chronic hyperglycemia leads to a critical loss of β-cell differentiation with altered expression of genes involved in multiple metabolic pathways diversionary to normal β-cell glucose metabolism. This global maladaptation in gene expression at the time of increased secretory demand may contribute to the β-cell dysfunction found in diabetes. Type 2 diabetes results from the failure of β-cells to adequately compensate for increased insulin secretory demand (1.Pick A. Clark J. Kubstrup C. Levisetti M. Pugh W. Bonner-Weir S. Polonsky K.S. Diabetes. 1998; 47: 358-364Crossref PubMed Scopus (475) Google Scholar, 2.Weir G.C. Laybutt D.R. Kaneto H. Bonner-Weir S. Sharma A. Diabetes. 2001; 50: S154-S159Crossref PubMed Google Scholar, 3.Weir G.C. Bonner-Weir S. LeRoith D. Taylor S.I. Olefsky J.M. Diabetes Mellitus. Lippincott, Williams, and Wilkins, Philadlphia, PA2000: 595-603Google Scholar). The loss of acute glucose-induced insulin secretion (GIIS) 1The abbreviations used are: GIISglucose-induced insulin secretionPxpancreatectomyLPxlow hyperglycemiaMPxmild hyperglycemiaHPxhigh hyperglycemiaSPxsevere hyperglycemiaMCTmonocarboxylate transporterRTreverse-transcribedTBPTATA-binding proteinNEFAnon-esterified fatty acidLCMlaser capture microdissectionPPAR(s)peroxisome proliferator-activated receptor(s)LDHacetate dehydrogenaseZDFZucker diabetic fatty is a functional defect that develops early during the progression to diabetes (2.Weir G.C. Laybutt D.R. Kaneto H. Bonner-Weir S. Sharma A. Diabetes. 2001; 50: S154-S159Crossref PubMed Google Scholar, 3.Weir G.C. Bonner-Weir S. LeRoith D. Taylor S.I. Olefsky J.M. Diabetes Mellitus. Lippincott, Williams, and Wilkins, Philadlphia, PA2000: 595-603Google Scholar, 4.Perley M. Kipnis D.M. Diabetes. 1966; 15: 867-874Crossref PubMed Scopus (217) Google Scholar, 5.Brunzell J.D. Robertson R.P. Lerner R.L. Hazzard W.R. Ensinck J.W. Bierman E.L. Porte D.J. J. Clin. Endocrinol. Metab. 1976; 42: 222-229Crossref PubMed Scopus (420) Google Scholar, 6.Leahy J.L. Bonner-Weir S. Weir G.C. Diabetes Care. 1992; 15: 442-455Crossref PubMed Scopus (364) Google Scholar). The unique ability of β-cells to secrete insulin in response to glucose is conferred by a specialized set of expressed genes. Important in this regard is the maintenance of pathways that optimize fuel metabolism for the generation of metabolic signals, such as ATP, that couple plasma glucose levels to insulin secretion (7.Newgard C.B. Matschinsky F.M. Jefferson L.S. Cherrington A.D. Handbook of Physiology, Section 7: The Endocrine System, Volume II, Endocrine Pancreas and Regulation of Metabolism. American Physiological Society, Oxford University Press, New York, NY2000: 125-151Google Scholar). Equally important for correct β-cell function is the suppression of genes that would interfere with the unique metabolism found in β-cells. Recent studies show that many β-cell-associated genes are down-regulated in models of diabetes, but no one defect can explain, in full, the impairment in β-cell function (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar, 9.Tokuyama Y. Sturis J. DePaoli A.M. Takeda J. Stoffel M. Tang J. Sun X. Polonsky K.S. Bell G.I. Diabetes. 1995; 44: 1447-1457Crossref PubMed Google Scholar). We have hypothesized that concomitant up-regulation of normally suppressed genes that regulate potentially diversionary pathways of β-cell metabolism contributes to a critical loss of β-cell differentiation and function (2.Weir G.C. Laybutt D.R. Kaneto H. Bonner-Weir S. Sharma A. Diabetes. 2001; 50: S154-S159Crossref PubMed Google Scholar, 8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar). glucose-induced insulin secretion pancreatectomy low hyperglycemia mild hyperglycemia high hyperglycemia severe hyperglycemia monocarboxylate transporter reverse-transcribed TATA-binding protein non-esterified fatty acid laser capture microdissection peroxisome proliferator-activated receptor(s) acetate dehydrogenase Zucker diabetic fatty In this study, we have extended our previous findings examining the influence of the diabetic milieu on β-cell differentiation in the rat 90% partial pancreatectomy (Px) model of diabetes (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar). The Px model is an especially useful model of type 2 and early type 1 diabetes as it avoids the potential artifacts and problems with interpretation that accompany genetic models and the use of β-cell toxins. The model is characterized by active regeneration of β-cells within the first 7–10 days, and thereafter, the diabetic milieu is associated with insulin secretory defects that resemble those found in human diabetes (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar, 10.Bonner-Weir S. Trent D.F. Weir G.C. J. Clin. Invest. 1983; 71: 1544-1553Crossref PubMed Scopus (414) Google Scholar). In this model, we examined the expression of transcription factors and enzymes that are important in both carbohydrate and lipid metabolism in β-cells and assessed the relative influence of hyperglycemia and circulating free fatty acids upon the altered β-cell phenotype. Male Sprague-Dawley rats (Taconic Farms, Germantown, NY), weighing 90–100 g, were anesthetized and submitted to 90% Px or sham-Px surgery as previously described (10.Bonner-Weir S. Trent D.F. Weir G.C. J. Clin. Invest. 1983; 71: 1544-1553Crossref PubMed Scopus (414) Google Scholar). Briefly, tissue removal was performed by gentle abrasion with cotton applicators leaving the pancreas within 1–2 mm of the common pancreatic bile duct and extending from the duct to the first part of the duodenum. Sham surgery involved an identical procedure except that the pancreatic tissue was only lightly rubbed instead of being removed. Animals were weighed and blood was obtained in heparinized microcapillary tubes from snipped tails of fed rats (9–10 a.m.) weekly for 4 weeks. Whole blood glucose levels were measured with a portable glucose meter (One Touch II glucometer, Lifescan, Milpitas, CA), and plasma insulin was measured by radioimmunoassay (Linco Research, St. Charles, MO). Note that blood glucose levels obtained with glucose meters are about 40% lower than plasma levels found with glucose oxidase techniques (11.Weitgasser R. Davalli A.M. Weir G.C. Diabetologia. 1999; 42: 256Crossref PubMed Scopus (23) Google Scholar). Four weeks after surgery, rats were anesthetized, and their islets isolated with collagenase digestion of the pancreatic remnant or sham pancreas followed by further separation with a Histopaque density gradient (Histopaque-1077, Sigma). The islets were handpicked under a stereomicroscope to ensure a pure islet preparation, and those of similar size were used for extraction of RNA. Most of the time, the islet yield after Px (about 50 islets) was sufficient for RNA extraction from islets of individual rats. However, in a few cases it was necessary to pool islets from two Px rats with similar glycemic levels. Animals were kept under conventional conditions with free access to water and standard pelleted food. All animal procedures were approved by the Joslin Diabetes Center Animal Care Committee. In one set of experiments, different degrees of hyperglycemia were induced by varying the proportion of the pancreas removed to generate 85–95% Px rats. Rats were classified according to their averaged 3- and 4-week-fed blood glucose levels that varied from low to severe hyperglycemia. Low hyperglycemia (LPx) was assigned to rats with fed blood glucose levels below 100 mg/dl, mild hyperglycemia (MPx) with blood glucose levels of 100–150 mg/dl, high hyperglycemia (HPx) within 151–250 mg/dl, and severe hyperglycemia (SPx) as above 250 mg/dl. To reverse hyperglycemia, Px rats were randomly assigned to receive phlorizin treatment or no treatment for the final 2 weeks of the 4-week study period. Phlorizin was dissolved in 1,2 propanediol and injected intraperitoneally twice a day (9 a.m. and 9 p.m.) at a dose of 0.8 g/kg/day. Sham animals were either untreated or received similar amounts of 1,2 propanediol as phlorizin-treated Px rats. Total RNA was extracted from islets using Ultraspec RNA isolation reagent according to manufacturer-suggested protocols (Biotecx Laboratories, Houston, TX). The extracted RNA was resuspended in DEPC (diethyl pyrocarbonate)-treated water and quantified by spectrophotometry. 500 ng of RNA was denatured for 3 min at 85 °C and then reverse-transcribed (RT) into cDNA in a final reaction solution of 25 μl containing the following: 1× (5 μl) Superscript first strand buffer (50 mm Tris-HCl, 75 mm KCl, and 3 mm MgCl2, Life Technologies, Grand Island, NY), 40 units of Rnasin (Promega, Madison, WI), 10 mm dithiothreitol, 1 mm dNTP, 50 ng of random hexamers, and 200 units of Superscript II Rnase H−reverse transcriptase (Invitrogen). Each tube was covered with a drop of mineral oil and heated for 10 min at 25 °C, 60 min at 42 °C, and 10 min at 95 °C. cDNA products were diluted with 50 μl of double-distilled H2O to a concentration corresponding to 10 ng of starting RNA per 1.5 μl and stored at −80 °C. PCR were carried out in a volume of 25 μl consisting of 1.5 μl of cDNA, 1× (2.5 μl) GeneAmp PCR Gold buffer (Applied Biosystems, Foster City, CA), 1.5 mmMgCl2, 80–160 μm dNTP, 80–800 nmol of oligonucleotide primers (Sigma), 1.25 μCi of [α-32P]dCTP (3000 Ci/mmol; New England Nuclear, Boston, MA) and 2.5 units of AmpliTaq Gold DNA Polymerase (Applied Biosystems). Table I shows specific concentrations of dNTP and oligonucleotide primers, along with multiplex PCR conditions for each gene tested. Oligonucleotide primers were designed with Eugene version 2.2 software (Daniben Systems, Cincinnati, OH). Oligonucleotide sequences for internal control genes (TATA-binding protein (TBP), α-tubulin and cyclophilin) were previously described (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar). A primer pair for 18 S rRNA (Ambion, Austin, TX) was used as an internal control for multiplex PCR analysis with primers for insulin and glucagon. All reactions were performed in a 9700 Thermocycler (Applied Biosystems) in which samples underwent a 10-min initial denaturing step to release DNA polymerase activity (hot start PCR), followed by the number of cycles indicated (Table I) of 1 min at 94 °C, 1 min at the annealing temperature indicated in Table I, and 1 min at 72 °C. The final extension step was 10 min at 72 °C. After un-incorporated [α-32P]dCTP were removed from the reaction product using Micro-Spin 30 gel columns (Bio-Rad Laboratories, Hercules, CA), PCR products were separated on a 6% polyacrylamide gel in Tris borate EDTA buffer. The gel was dried under vacuum at 80 °C for 1 h and exposed overnight to a PhosphorImager screen (Molecular Dynamics, Sunnyvale, CA). Band intensity was measured with a Storm 840 PhosphorImager and quantified with ImageQuant software (Molecular Dynamics). The average intensity of each product was expressed relative to the internal control gene (ratio of specific product/control gene). These ratios were then used to calculate the percent of sham expression for each Px animal in the same RT-PCR. PCR reactions were performed on RT-negative samples to exclude genomic DNA contamination for each cDNA preparation. To observe linear amplification of the multiplex PCR products for each set of primers, control experiments were performed to adjust the PCR conditions such that the number of cycles used was in the exponential phase of amplification for all products and that each PCR product in a multiplex reaction increased linearly with the amount of starting material (from 2.5 to 80 ng of RNA equivalents) as previously described in detail (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar).Table ISequences of oligonucleotide primers and PCR conditionsGene nameSize5′oligonucleotide3′oligonucleotideGenBankTMaccession no.dNTPPrimerAnnealingCyclesControl genebpμmnm°CPPAR α404GGTCCGATTCTTCCACTGCTCCCCTCCTGCAACTTCTCM88592160806228TBPPPAR γ (I and II)318TTCTGGCCCACCAACTTCCCCACAGACTCGGCACTCY128821608006228TBPPPAR β/δ457CATGTGTTCTACCGCTGCCAGAGGTACTGGCTGTCGGGU400641601006024TBPSREBP-1c315TGGGGGTGAGACAGGAGACCTGCACAGGTGGAGGAGGAF286470802005522α-tubulinAcetyl-CoA carboxylase246CGTGTGTGGAAGTGGACGTCTCTGCATAGCACTGGCCJ03808802005528TBPFatty acid synthase353CCCATCTTCCTGCCTGTGTGTGCTGTCTGCTCCTCGM76767801005528TBPCamitine palmitoyltransferase-1295GAGACACCAACCCCAACATCGTCTCTGTCCTCCCTTCTCGL07736802005528TBPAcyl-CoA oxidase245AGCTTCACGCCCTCACTGACCACCCACCAACTTCCCJ027521604005523α-tubulinHormone sensitive lipase322CTGCTTCTCCCTCTCGTCTGTCAGACACACTCCTGCGCX514151604006024TBPMalonyl-CoA decarboxylase248TGTTACTTCTTCTCCCACTGCTCAACTCCTTCTGCAGCTCCTTGAJ0077041604006024TBPUncoupling protein 2345ATTGCACGAGAGGAAGGGCAAGCGGAGGAAGGAAGGAB006613802005522CyclophilinATP synthase α subunit336TCGACTTCAGAAGACTGGCACGCATCAACTACACGGCCCJ05266802005524CyclophilinATP synthase β subunit247AACATCTTCCGCTTCACCCTAGCACGGGACAGCACAGM19044802005524CyclophilinLactate dehydrogenase-AaOligonucleotide primer sequences from Ref. 8.249ACAGTTGTTGGGGTTGGTGCCGGCTCTCTCCCTCTTGX01964802005924α-tubulinMonocarboxylate transporter 1303GGGTTCTGCATCTACGCGCTCCGCTTTCTGTTCTTTGGD63834804005928TBPMonocarboxylate transporter 2410ATCCGTCCACGAATCCAGTTCTTCCTCCTTGCTTTCTCTCU62316804005928TBPMonocarboxylate transporter 3441GACCCCACGTCCCCTATCAGTCCCTCTCAGCCTCCACAF059258804005928TBPMonocarboxylate transporter 4159TGCTCACCTCCTCCCTTGAGTGCTCCACCTCCCTCGU87627804005928TBPInsulin (I and II)aOligonucleotide primer sequences from Ref. 8.148TCTTCTACACACCCATGTCCCGGTGCAGCACTGATCCACJ00747–880200551518 SrRNAGlucagonaOligonucleotide primer sequences from Ref. 8.245ACCTAGACTCCCGCCGTGATGTCTGCGCCCAAGTTCK0280880200551518 SrRNAGLUT2aOligonucleotide primer sequences from Ref. 8.183TGGGTTCCTTCCAGTTCGAGGCGTCTGGTGTCGTATGJ03145802005520CyclophilinGlutamate dehydrogenase147TTGAGCCTCTCCTTCCCCCAGCGCCTTCACCTCATCX142231602005523α-tubulinGlucose-6-phosphatasebRef. 9.338ACATCCGGGGCATCTACAATGCCAAAAGAGATGCAGCAGGCCCAAU07993804006228TBPFructose-1,6-bisphosphatase 1366TTTGGTGGACAGGGATGTGACTGGTGCCTTCTGGTGGM86240804005532TBPFructose-1,6-bisphosphatase 2288ACAGGGCAAGGAGTGGATCTCTTCTGGTTGGCTGGGTACAJ005046804005532TBP12-LipoxygenasebRef. 9.312TGGGGCAACTGGAAGGATGGAGAGCGCTTCAGCACCATGGL060401602005926TBPCyclooxyganase-2417GCTACCATCTGGCTTCGGAACATTCCTTCCCCCAGCS677221604006134a Oligonucleotide primer sequences from Ref. 8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar.b Ref. 9.Tokuyama Y. Sturis J. DePaoli A.M. Takeda J. Stoffel M. Tang J. Sun X. Polonsky K.S. Bell G.I. Diabetes. 1995; 44: 1447-1457Crossref PubMed Google Scholar. Open table in a new tab Plasma lipids were measured from samples collected in ETDA/paraoxan (diethyl-para-nitrophenyl phosphate)-coated tubes to avoid activation of lipoprotein lipase by heparin (12.Zambon A. Hashimoto S.I. Brunzell J.D. J. Lipid Res. 1993; 34: 1021-1028Abstract Full Text PDF PubMed Google Scholar). Plasma non-esterified fatty acid (NEFA) were measured by a colorimetric method (Wako Chemicals, Neuss, Germany). Plasma triglyceride were measured with a triglyceride assay kit (GPO Trinder, Sigma) using glycerol as standard. For islet triglyceride determination, similar size islets isolated from sham and Px rats were counted (500 islets) and then suspended in a solution of 2 m NaCl, 2 mm EDTA, and 50 mm sodium phosphate buffer for the extraction of lipid as previously described (13.Lee Y. Hirose H. Zhou Y.T. Esser V. McGarry J.D. Unger R.H. Diabetes. 1997; 46: 408-413Crossref PubMed Scopus (176) Google Scholar). Triglyceride in the islet extract was measured using the triglyceride assay kit (GPO Trinder, Sigma). Further gene expression analysis was performed on the β-cell-enriched central core of islets excised from pancreas sections using the recently developed technique of laser capture microdissection (14.Emmert-Buck M.R. Bonner R.F. Smith P.D. Chuaqui R.F. Zhuang Z. Goldstein S.R. Weiss R.A. Liotta L.A. Science. 1996; 274: 998-1001Crossref PubMed Scopus (2155) Google Scholar). The pancreatic remnants of Px rats and the equivalent region of pancreases of sham rats were excised and embedded in TissueTek OCT medium (VWR Scientific Products Corporation, San Diego, CA) and frozen in chilled isopentane. Tissue was sectioned at 8–10 μm on a cryostat, mounted on uncoated glass slides, and frozen at −80 °C. The central core of islets with diameter >100 μm was microdissected using LCM as previously described (15.Sgroi D.C. Teng S. Robinson G. LeVangie R. Hudson J.R.J. Elkahloun A.G. Cancer Res. 1999; 59: 5656-5661PubMed Google Scholar). Total RNA from microdissected samples was extracted (15.Sgroi D.C. Teng S. Robinson G. LeVangie R. Hudson J.R.J. Elkahloun A.G. Cancer Res. 1999; 59: 5656-5661PubMed Google Scholar), amplified by T7-based RNA amplification as described (16.Luo L. Salunga R.C. Guo H. Bittner A. Joy K.C. Galindo J.E. Xiao H. Rogers K.E. Wan J.S. Jackson M.R. Erlander M.G. Nat. Med. 1999; 5: 117-122Crossref PubMed Scopus (645) Google Scholar), and analyzed by radioactive PCR as described above. Islets isolated from sham, Px, and phlorizin-treated Px rats were washed in Krebs Ringer HEPES buffer. Groups of five islets were incubated for 30 min at 37 °C in 1.5 ml of polypropylene tubes (Eppendorf) containing 1 ml of Krebs Ringer HEPES buffer with 2.8 and 16.7 mm glucose. Insulin was measured in an aliquot of the buffer by radioimmunoassay. Trichloroacetic acid was added to the tubes containing the islets to a final volume of 5%. After 5 min on ice, the tubes were centrifuged, and the supernatant was mixed with diethylether. The ether phase was discarded, and the extraction repeated three times. The extract was diluted in a buffer containing 20 mm HEPES and 3 mm MgCl2 (pH 7.75). ATP levels were measured by a luminometric method (Sigma). All results are presented as means ± S.E. Statistical analyses were performed using unpaired Student's t test or one-way analysis of variance with post test of Dunnet. The expression of transcription factors and enzymes that are important in both carbohydrate and lipid metabolism were measured in the 90% Px model. Fig. 1 shows representative gels from RT-PCR analysis comparing mRNAs in islets 4 weeks after sham or 90% Px. After normalization of the specific gene to an internal control gene (TBP, α-tubulin, cyclophilin, or 18 S rRNA), mRNA levels in Px islets were quantitated as a percent of sham. Px rats showed clear hyperglycemia; averaged 3- and 4-week blood glucose levels were 78 ± 2 mg/dl for sham rats and 251 ± 24 mg/dl for Px rats (n = 6 in each group, p < 0.001). In many tissues, peroxisome proliferator-activated receptors (PPARs) regulate the expression of target genes central to lipid homeostasis (17.Schoonjans K. Martin G. Staels B. Auwerx J. Curr. Opin. Lipidol. 1997; 8: 159-166Crossref PubMed Scopus (469) Google Scholar), PPARα in the regulation of genes involved in lipid catabolism, and PPARγ in lipogenesis. The function and target genes of the PPAR δ isoform (also called β, NUC-1 or FAAR) are not known. The expression of PPAR subtypes α, δ, and γ was evaluated in islets 4 weeks after Px. PPAR α and γ showed reciprocal regulation in islets after Px (Fig. 1); PPARα mRNA levels were markedly reduced, whereas PPARγ mRNA was increased 3-fold. The mRNA levels for PPAR δ tended to be increased in islets after Px although not significantly (p = 0.1). Another transcription factor that may act synergistically with the PPARs in the regulation of gene expression is sterol regulatory element binding protein (SREBP)-1c (also called adipocyte differentiation and determination factor 1, ADD-1); mRNA levels for SREBP-1c were significantly decreased in 90% Px islets (Fig. 1). Since PPAR and SREBP-1c transcription factors were altered in Px islets, expression levels of target genes in lipid metabolism were also evaluated (Fig. 1). Consistent with marked reduction in PPARα, a transcriptional target of it, the peroxisomal lipid oxidation enzyme acyl-CoA oxidase, was down-regulated. In contrast, several genes in lipid metabolism were up-regulated after Px in association with the induction of PPARγ. mRNA levels for lipogenic genes, acetyl-CoA carboxylase, and fatty acid synthase were increased in Px islets. Hormone sensitive lipase, the rate-limiting enzyme of triglyceride lipolysis in adipose tissue, is expressed and active in β-cells (18.Winzell M.S. Svensson H. Arner P. Ahren B. Holm C. Diabetes. 2001; 50: 2225-2230Crossref PubMed Scopus (36) Google Scholar, 19.Roduit R. Masiello P. Wang S.P. Li H. Mitchell G.A. Prentki M. Diabetes. 2001; 50: 1970-1975Crossref PubMed Scopus (102) Google Scholar). Here, hormone-sensitive lipase mRNA levels were increased in Px islets (Fig. 1). Expression of the mitochondrial lipid transport enzyme, carnitine palmitoyl transferase 1 (CPT-1), was also increased, whereas, malonyl-CoA decarboxylase mRNA levels were unchanged. Glucose-induced hyperpolarization of the mitochondrial membrane and ATP production are thought to play a key role in GIIS (7.Newgard C.B. Matschinsky F.M. Jefferson L.S. Cherrington A.D. Handbook of Physiology, Section 7: The Endocrine System, Volume II, Endocrine Pancreas and Regulation of Metabolism. American Physiological Society, Oxford University Press, New York, NY2000: 125-151Google Scholar). Uncoupling protein 2 (UCP-2) has been shown to have a negative effect on ATP production and GIIS by catalyzing a proton leak that dissipates membrane potential associated with mitochondrial respiration (20.De Chan C.B. Leo D. Joseph J.W. McQuaid T.S. Ha X.F. Xu F. Tsushima R.G. Pennefather P.S. Salapatek A.M. Wheeler M.B. Diabetes. 2001; 50: 1302-1310Crossref PubMed Scopus (318) Google Scholar, 21.Chan C.B. MacDonald P.E. Saleh M.C. Johns D.C. Marban E. Wheeler M.B. Diabetes. 1999; 48: 1482-1486Crossref PubMed Scopus (229) Google Scholar, 22.Zhang C.Y. Baffy G. Perret P. Krauss S. Peroni O. Grujic D. Hagen T. Vidal-Puig A.J. Boss O. Kim Y.B. Zheng X.X. Wheeler M.B. Shulman G.I. Chan C.B. Lowell B.B. Cell. 2001; 105: 745-755Abstract Full Text Full Text PDF PubMed Scopus (828) Google Scholar). We found increased UCP-2 mRNA levels in Px islets, whereas expression of ATP synthase α and β, part of the complex through which protons enter the mitochondria, were unchanged (Fig. 1). Expression of lactate dehydrogenase-A (LDH-A) and monocarboxylate (lactate) transporters in islets is normally low consistent with their low level production of lactate (23.Zhao C. Wilson M.C. Schuit F. Halestrap A.P. Rutter G.A. Diabetes. 2001; 50: 361-366Crossref PubMed Scopus (124) Google Scholar). The expression of LDH-A and monocarboxylate transporter (MCT) isoforms 1–4 were evaluated in Px islets. LDH-A mRNA levels were markedly increased in Px islets (Fig. 1) as previously found (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar). In addition, MCT1, MCT2, and MCT4 were increased in Px islets, whereas no MCT3 expression was detected. As previously reported (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar), chronic hyperglycemia induced by 90% Px was associated with decreased mRNA levels of insulin, whereas that of glucagon was unchanged (Fig. 1). Glucose transporter 2 (GLUT2) was reduced to a similar extent as insulin as previously reported (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar). In contrast, the amino acid metabolism gene, glutamate dehydrogenase, was unchanged (Fig. 1). Interestingly, glucose-6-phosphatase mRNA levels, which in sham islets were only about 5% of that found in the liver (not shown), were dramatically increased in Px islets. Similarly, there was increased mRNA levels for fructose-1,6-bisphosphatase, 12-lipoxygenase, and inducible cyclooxygenase (COX-2). No expression of fructose-1,6-bisphosphatase was detected in sham islets (n = 6), whereas PCR products for the liver (FBPase-1) and muscle (FBPase-2) isoforms were detected in Px islets (n = 6). Similarly, COX-2 was induced in Px islets compared with the minimal levels found in control islets. By varying the proportion of the pancreas removed (85–95%), rats were generated that had fed blood glucose levels ranging from low (LPx, <100 mg/dl), mild (MPx, 100–150 mg/dl), high (HPx, 151–250 mg/dl), and severe (SPx, >250 mg/dl) hyperglycemia. The time course changes in body weight and fed blood glucose in these animals are shown in Fig. 2. As previously described (8.Jonas J.C. Sharma A. Hasenkamp W. Ilkova H. Patane G. Laybutt R. Bonner-Weir S. Weir G.C. J. Biol. Chem. 1999; 274: 14112-14121Abstract Full Text Full Text PDF PubMed Scopus (481) Google Scholar, 10.Bonner-Weir S. Trent D.F. Weir G.C. J

Noninvasive imaging of differences between the molecular properties of cancer and normal tissue has the potential to enhance the detection of tumors. Because overexpression of endogenous transferrin receptor (TfR) has been qualitatively described for various cancers and is presumably due to malignant transformation of cells, TfR may represent a suitable target for application of molecular imaging technologies to increase detection of smaller tumors. In the work reported here, investigation into the biology of this receptor using electron microscopy has demonstrated that iron oxide particles targeted to TfR are internalized and accumulate in lysosomal vesicles within cells. Biochemical analysis of the interaction of imaging probes with cells overexpressing the TfR demonstrated that the extent of accumulation, and therefore probe efficacy, is dependent on the nature of the chemical cross-link between transferrin and the iron oxide particle. These data were utilized to design and synthesize an improved imaging probe. Experiments demonstrate that the novel magnetic resonance imaging (MRI) probe is sensitive enough to detect small differences in endogenous TfR expression in human cancer cell lines. Quantitative measurement of TfR overexpression in a panel of 27 human breast cancer patients demonstrated that 74% of patient cancer tissues overexpressed the TfR and that the sensitivity of the new imaging agent was suitable to detect TfR overexpression in greater than 40% of these cases. Based on a biochemical and cell biological approach, these studies have resulted in the synthesis and development of an improved MRI probe with the best in vitro and in vivo imaging properties reported to date.

PURPOSE: To quantify dynamic enhancement of breast lesions with echo-planar and conventional magnetic resonance (MR) imaging, to correlate these data with histologic findings and vessel density, and to evaluate MATERIALS AND METHODS: Twenty female patients with 22 breast lesions underwent conventional and MR echo-planar imaging T1 values, change in gadopentetate dimeglumine concentration, and extraction-flow products were calculated with echo-planar imaging data and were correlated with histologic findings and microvessel density. RESULTS: T1 values of cancers were not statistically significantly shorter. Cancers had more rapid uptake and higher extraction-flow products (P < .02). Sensitivity was 86% and specificity was 93% for diagnosis of malignancy. Microvessel density was higher for malignant lesions (P < .02) with an overall positive (not statistically significant) correlation between extraction-flow product and microvessel density. CONCLUSION: Echo-planar imaging appears promising for quantification of breast lesion enhancement. Microvessel data indicate that tumor angiogenesis affects enhancement.

Proteomic based approaches are beginning to be utilized to study the natural history and treatment of breast cancer. A variety of proteomics approaches are under study, and are summarized herein. Two-dimensional gel electrophoresis (2D-PAGE) is still the foundation of most proteomics studies. We present an analysis of 2D-PAGE studies reported to date in breast cancer, including those examining normal/tumor differences and selected populations of breast cells. Newer technologies such as laser capture microdissection and highly sensitive mass spectrometry methods are currently being used together to identify greater numbers of lower abundance proteins that are differentially expressed between defined cell populations. Novel technologies still in developmental phases will enable identification of validated targets in small biopsy specimens, including high density protein arrays, antibody arrays and lysate arrays. Surface-enhanced laser desorption/ionization time-of-flight (SELDI-TOF) analysis enables the high throughput characterization of lysates from very few tumor cells and may be best suited for clinical biomarker studies. We present SELDI-TOF data herein to show the accuracy of the method in a small cohort of breast tumors, as well as its potential discriminatory capability. Such technologies are expected to supplement our armamentarium of mRNA-based assays, and provide critical information on protein levels and post-translational modifications.

A dichotomous index combining two gene expression assays, HOXB13:IL17BR (H:I) and molecular grade index (MGI), was developed to assess risk of recurrence in breast cancer patients. The study objective was to demonstrate the prognostic utility of the combined index in early-stage breast cancer.In a blinded retrospective analysis of 588 ER-positive tamoxifen-treated and untreated breast cancer patients from the randomised prospective Stockholm trial, H:I and MGI were measured using real-time RT-PCR. Association with patient outcome was evaluated by Kaplan-Meier analysis and Cox proportional hazard regression. A continuous risk index was developed using Cox modelling.The dichotomous H:I+MGI was significantly associated with distant recurrence and breast cancer death. The >50% of tamoxifen-treated patients categorised as low-risk had <3% 10-year distant recurrence risk. A continuous risk model (Breast Cancer Index (BCI)) was developed with the tamoxifen-treated group and the prognostic performance tested in the untreated group was 53% of patients categorised as low risk with an 8.3% 10-year distant recurrence risk.Retrospective analysis of this randomised, prospective trial cohort validated the prognostic utility of H:I+MGI and was used to develop and test a continuous risk model that enables prediction of distant recurrence risk at the patient level.

Abstract Context.—Correct diagnosis of the tissue origin of a metastatic cancer is the first step in disease management, but it is frequently difficult using standard pathologic methods. Microarray-based gene expression profiling has shown great promise as a new tool to address this challenge. Objective.—Adoption of microarray technologies in the clinic remains limited. We aimed to bridge this technological gap by developing a real-time quantitative polymerase chain reaction (RT-PCR) assay. Design.—We constructed a microarray database of 466 frozen and 112 formalin-fixed, paraffin-embedded (FFPE) samples of both primary and metastatic tumors, measuring expression of 22 000 genes. From the microarray database, we used a genetic algorithm to search for gene combinations optimal for multitumor classification. A 92-gene RT-PCR assay was then designed and used to generate a database for 481 frozen and 119 FFPE tumor samples. Results.—The microarray-based K-nearest neighbor classifier demonstrated 84% accuracy in classifying 39 tumor types via cross-validation and 82% accuracy in predicting 112 independent FFPE samples. We successfully translated the microarray database to the RT-PCR platform, which allowed an overall success rate of 87% in classifying 32 different tumor classes in the validation set of 119 FFPE tumor samples. Conclusions.—The RT-PCR-based expression assay involving 92 genes represents a powerful tool for accurately and objectively identifying the site of origin for metastatic tumors, especially in the cases of cancer of unknown primary. The assay uses RT-PCR and routine FFPE samples, making it suitable for rapid clinical adoption.

The HIF family of hypoxia-inducible transcription factors are key mediators of the physiologic response to hypoxia, whose dysregulation promotes tumorigenesis. One important HIF-1 effector is the REDD1 protein, which is induced by HIF-1 and which functions as an essential regulator of TOR complex 1 (TORC1) activity in Drosophila and mammalian cells. Here we demonstrate a negative feedback loop for regulation of HIF-1 by REDD1, which plays a key role in tumor suppression. Genetic loss of REDD1 dramatically increases HIF-1 levels and HIF-regulated target gene expression in vitro and confers tumorigenicity in vivo. Increased HIF-1 in REDD1 −/− cells induces a shift to glycolytic metabolism and provides a growth advantage under hypoxic conditions, and HIF-1 knockdown abrogates this advantage and suppresses tumorigenesis. Surprisingly, however, HIF-1 up-regulation in REDD1 −/− cells is largely independent of mTORC1 activity. Instead, loss of REDD1 induces HIF-1 stabilization and tumorigenesis through a reactive oxygen species (ROS) -dependent mechanism. REDD1 −/− cells demonstrate a substantial elevation of mitochondrial ROS, and antioxidant treatment is sufficient to normalize HIF-1 levels and inhibit REDD1-dependent tumor formation. REDD1 likely functions as a direct regulator of mitochondrial metabolism, as endogenous REDD1 localizes to the mitochondria, and this localization is required for REDD1 to reduce ROS production. Finally, human primary breast cancers that have silenced REDD1 exhibit evidence of HIF activation. Together, these findings uncover a specific genetic mechanism for HIF induction through loss of REDD1. Furthermore, they define REDD1 as a key metabolic regulator that suppresses tumorigenesis through distinct effects on mTORC1 activity and mitochondrial function.

Mapping tumor cell protein networks in vivo will be critical for realizing the promise of patient-tailored molecular therapy. Cancer can be defined as a dysregulation or hyperactivity in the network of intracellular and extracellular signaling cascades. These protein signaling circuits are the ultimate targets of molecular therapy. Each patient's tumor may be driven by a distinct series of molecular pathogenic defects. Thus, for any single molecular targeted therapy, only a subset of cancer patients may respond. Individualization of therapy, which tailors a therapeutic regimen to a tumor molecular portrait, may be the solution to this dilemma. Until recently, the field lacked the technology for molecular profiling at the genomic and proteomic level. Emerging proteomic technology, used concomitantly with genomic analysis, promises to meet this need and bring to reality the clinical adoption of molecular stratification. The activation state of kinase-driven signal networks contains important information relative to cancer pathogenesis and therapeutic target selection. Proteomic technology offers a means to quantify the state of kinase pathways, and provides post-translational phosphorylation data not obtainable by gene arrays. Case studies using clinical research specimens are provided to show the feasibility of generating the critical information needed to individualize therapy. Such technology can reveal potential new pathway interconnections, including differences between primary and metastatic lesions. We provide a vision for individualized combinatorial therapy based on proteomic mapping of phosphorylation end points in clinical tissue material.

The goal of this study was the development of a method for quantitative expression proteomics on the limited sample amounts obtained through laser capture microdissection (LCM) of tissues, e.g., approximately 10 000 cells, which typically contain roughly 1-4 microg protein. The 16O/18O labeling method was selected as an approach to measure differential expression. A sample preparation protocol including lysis, digestion and 16O/18O labeling was first developed for LCM cell samples. The selected protocol was examined using two LCM caps of 10 000 cells from invasive ductal carcinoma of the breast and shown to be repeatable. A further test of LC-IT-MS/MS in combination with the 16O/18O post-digestion labeling method for studying low level samples was conducted first on a single protein (BSA) and then on a 5-standard protein mixture digest of different protein amounts, each with a total content approximately 1 microg. Next, protein expression was compared between 10 000 cells, each of microdissected normal ductal epithelium and metastatic ductal carcinoma, using the developed method. The proteins from the microdissected cells were extracted, precipitated, digested with trypsin and then 16O/18O labeled. The normal and metastatic cell samples were analyzed using reversed phase LC-ESI-MS/MS on the ion trap mass spectrometer. A total of 76 proteins were identified. Some, such as mitochondrial isocitrate dehydrogenase, actin and 14-3-3 protein xi/delta were found to be significantly up-regulated in the breast tumor cells.

Abstract Purpose: In the adjuvant treatment of estrogen receptor (ER)–positive breast cancer, additional markers are needed to identify women at high risk for recurrence. Experimental Design: We examined the association between the ratio of the homeobox 13 (HOXB13) to interleukin-17B receptor (IL-17BR) expression and the clinical outcomes of relapse and survival in women with ER-positive breast cancer enrolled onto a North Central Cancer Treatment Group adjuvant tamoxifen trial (NCCTG 89-30-52). Results: Tumor blocks were obtained from 211 of 256 eligible patients, and quantitative reverse transcription-PCR profiles for HOXB13 and IL-17BR were obtained from 206 patients. The cut point for the two-gene log 2(expression ratio) that best discriminated clinical outcome (recurrence and survival) was selected and identified women with significantly worse relapse-free survival (RFS), disease-free survival (DFS), and overall survival (OS), independent of standard prognostic markers. The cut point differed as a function of nodal status [node negative (59th percentile) versus node positive (90th percentile)]. In the node-positive cohort (n = 86), the HOXB13/IL-17BR ratio was not associated with relapse or survival. In contrast, in the node-negative cohort (n = 130), a high HOXB13/IL-17BR ratio was associated with significantly worse RFS [hazard ratio (HR), 1.98; P = 0.031], DFS (HR, 2.03; P = 0.015), and OS (HR, 2.4; P = 0.014), independent of standard prognostic markers. Conclusion: A high HOXB13/IL-17BR expression ratio is associated with increased relapse and death in patients with resected node-negative, ER-positive breast cancer treated with tamoxifen and may identify patients in whom alternative therapies should be studied.

Abstract Purpose: Specific activating mutations within the epidermal growth factor receptor (EGFR) identify a subset of non–small cell lung cancers with dramatic sensitivity to the specific tyrosine kinase inhibitors (TKI), gefitinib and erlotinib. Despite the abundant expression of EGFR protein in a broad range of epithelial cancers, EGFR mutations have not been reported in a substantial fraction of other cancers. Given recent reports of TKI-responsive cases of esophageal and pancreatic cancer, this study was designed to determine the prevalence of EGFR mutations in these gastrointestinal cancers. Experimental Design: We sequenced exons 18 to 21 of EGFR from 21 cases of Barrett's esophagus, 5 cases of high-grade esophageal dysplasia, 17 cases of esophageal adenocarcinoma, and 55 cases of pancreatic adenocarcinoma. Subsets of esophageal (n = 7) and pancreatic cancer cases (n = 5) were obtained from patients who were subsequently treated with gefitinib or erlotinib-capecitabine, respectively. Results: Mutations of EGFR were identified in two esophageal cancers (11.7%), three cases of Barrett's esophagus (14.2%), and two pancreatic cancers (3.6%). The mutations consisted of the recurrent missense L858R and in-frame deletion delE746-A750, previously characterized as activating EGFR mutations in non–small cell lung cancer. We also identified the TKI drug resistance–associated EGFR T790M mutation in an untreated case of Barrett's esophagus and the corresponding adenocarcinoma. Conclusion: The presence of activating mutations within EGFR in both esophageal and pancreatic adenocarcinomas defines a previously unrecognized subset of gastrointestinal tumors in which EGFR signaling may play an important biological role. EGFR mutations in premalignant lesions of Barrett's esophagus also point to these as an early event in transformation of the esophageal epithelium. The role of genotype-directed TKI therapy should be tested in prospective clinical trials.

The mechanisms underlying tumoral secretion of signaling molecules into the microenvironment, which modulates tumor cell fate, angiogenesis, invasion, and metastasis, are not well understood. Aberrant expression of transcription factors, which has been implicated in the tumorigenesis of several types of cancers, may provide a mechanism that induces the expression of growth and angiogenic factors in tumors, leading to their local increase in the tumor microenvironment, favoring tumor progression. In this report, we demonstrate that the transcription factor HOXB9 is overexpressed in breast carcinoma, where elevated expression correlates with high tumor grade. HOXB9 induces the expression of several angiogenic factors (VEGF, bFGF, IL-8, and ANGPTL-2), as well as ErbB (amphiregulin, epiregulin, and neuregulins) and TGF-ß, which activate their respective pathways, leading to increased cell motility and acquisition of mesenchymal phenotypes. In vivo, HOXB9 promotes the formation of large, well-vascularized tumors that metastasize to the lung. Thus, deregulated expression of HOXB9 contributes to breast cancer progression and lung metastasis by inducing several growth factors that alter tumor-specific cell fates and the tumor stromal microenvironment.

Abstract Purpose: Most node-negative breast cancer patients are older and postmenopausal and are increasingly being offered adjuvant chemotherapy despite their low overall risk of distant relapse. A molecular diagnostic test with high negative predictive value (NPV) for distant metastasis in this subgroup would spare many older breast cancer patients adjuvant treatment. Experimental Design: We determined the NPV and positive predictive value of the MammaPrint assay in breast cancer patients who were consecutively diagnosed and treated at the Massachusetts General Hospital between 1985 and 1997. Primary tumors from 100 patients with node-negative, invasive breast cancer (median age, 62.5 years; median follow-up, 11.3 years) were subjected to MammaPrint analysis and classified as being at either low or high risk for distant metastasis. Results: The MammaPrint 70-gene signature displayed excellent NPV as in previous studies, correctly identifying 100% of women at low risk for distant metastases at 5 years. However, this assay had a lower positive predictive value (12% at 5 years) than previously observed. Conclusions: The MammaPrint assay was originally designed to identify younger breast cancer patients at low risk for distant metastasis, who might consequently be spared systemic treatment. We show here that the same signature has a very high NPV for distant recurrence after adjuvant treatment in older breast cancer patients.

Fetal and neonatal beta cells have poor glucose-induced insulin secretion and only gain robust glucose responsiveness several weeks after birth. We hypothesise that this unresponsiveness is due to a generalised immaturity of the metabolic pathways normally found in beta cells rather than to a specific defect.Using laser-capture microdissection we excised beta cell-enriched cores of pancreatic islets from day 1 (P1) neonatal and young adult Sprague-Dawley rats in order to compare their gene-expression profiles using Affymetrix U34A microarrays (neonatal, n = 4; adult, n = 3).Using dChip software for analysis, 217 probe sets for genes/38 expressed sequence tags (ESTs) were significantly higher and 345 probe sets for genes/33 ESTs significantly lower in beta cell-enriched cores of neonatal islets compared with those of adult islets. Among the genes lower in the neonatal beta cells were key metabolic genes including mitochondrial shuttles (malate dehydrogenase, glycerol-3-phosphate dehydrogenase and glutamate oxalacetate transaminase), pyruvate carboxylase and carnitine palmitoyl transferase 2. Differential expression of these enzyme genes was confirmed by quantitative PCR on RNA from isolated neonatal (P2 until P28) and adult islets and with immunostaining of pancreas. Even by 28 days of age some of these genes were still expressed at lower levels than in adults.The lack of glucose responsiveness in neonatal islets is likely to be due to a generalised immaturity of the metabolic specialisation of pancreatic beta cells.

Multiple factors including long-term treatment with tamoxifen are involved in the development of selective estrogen receptor (ER) modulator resistance in ERα-positive breast cancer. Many underlying molecular events that confer resistance are known but a unifying theme is yet to be revealed. In this report, we provide evidence that HOXB7 overexpression renders MCF-7 cells resistant to tamoxifen via cross-talk between receptor tyrosine kinases and ERα signaling. HOXB7 is an ERα-responsive gene. Extended treatment of MCF-7 cells with tamoxifen resulted in progressively increasing levels of HOXB7 expression, along with EGFR and EGFR ligands. Up-regulation of EGFR occurs through direct binding of HOXB7 to the EGFR promoter, enhancing transcriptional activity. Finally, higher expression levels of HOXB7 in the tumor significantly correlated with poorer disease-free survival in ERα-positive patients with breast cancer on adjuvant tamoxifen monotherapy. These studies suggest that HOXB7 acts as a key regulator, orchestrating a major group of target molecules in the oncogenic hierarchy. Functional antagonism of HOXB7 could circumvent tamoxifen resistance.

mTOR and its downstream effectors the 4E-binding protein 1 (4EBP1) and the p70 ribosomal S6 kinases (S6K1 and S6K2) are frequently upregulated in breast cancer, and assumed to be driving forces in tumourigenesis, in close connection with oestrogen receptor (ER) networks. Here, we investigated these factors as clinical markers in five different cohorts of breast cancer patients.The prognostic significance of 4EBP1, S6K1 and S6K2 mRNA expression was assessed with real-time PCR in 93 tumours from the treatment randomised Stockholm trials, encompassing postmenopausal patients enrolled between 1976 and 1990. Three publicly available breast cancer cohorts were used to confirm the results. Furthermore, the predictive values of 4EBP1 and p4EBP1_S65 protein expression for both prognosis and endocrine treatment benefit were assessed by immunohistochemical analysis of 912 node-negative breast cancers from the Stockholm trials.S6K2 and 4EBP1 mRNA expression levels showed significant correlation and were associated with a poor outcome in all cohorts investigated. 4EBP1 protein was confirmed as an independent prognostic factor, especially in progesterone receptor (PgR)-expressing cancers. 4EBP1 protein expression was also associated with a poor response to endocrine treatment in the ER/PgR positive group. Cross-talk to genomic as well as non-genomic ER/PgR signalling may be involved and the results further support a combination of ER and mTOR signalling targeted therapies.This study suggests S6K2 and 4EBP1 as important factors for breast tumourigenesis, interplaying with hormone receptor signalling. We propose S6K2 and 4EBP1 as new potential clinical markers for prognosis and endocrine therapy response in breast cancer.

Abstract Molecular drivers underlying bone metastases in human cancer are not well understood, in part due to constraints in bone tissue sampling. Here, RNA sequencing was performed of circulating tumor cells (CTC) isolated from blood samples of women with metastatic estrogen receptor (ER)+ breast cancer, comparing cases with progression in bone versus visceral organs. Among the activated cellular pathways in CTCs from bone-predominant breast cancer is androgen receptor (AR) signaling. AR gene expression is evident, as is its constitutively active splice variant AR-v7. AR expression within CTCs is correlated with the duration of treatment with aromatase inhibitors, suggesting that it contributes to acquired resistance to endocrine therapy. In an established breast cancer xenograft model, a bone-tropic derivative displays increased AR expression, whose genetic or pharmacologic suppression reduces metastases to bone but not to lungs. Together, these observations identify AR signaling in CTCs from women with bone-predominant ER+ breast cancer, and provide a rationale for testing androgen inhibitors in this subset of patients. Implications: This study highlights a role for the AR in breast cancer bone metastasis, and suggests that therapeutic targeting of the AR may benefit patients with metastatic breast cancer. Mol Cancer Res; 16(4); 720–7. ©2018 AACR.

Sex differences have been observed in multiple facets of cancer epidemiology, treatment and biology, and in most cancers outside the sex organs. Efforts to link these clinical differences to specific molecular features have focused on somatic mutations within the coding regions of the genome. Here we report a pan-cancer analysis of sex differences in whole genomes of 1983 tumours of 28 subtypes as part of the ICGC/TCGA Pan-Cancer Analysis of Whole Genomes (PCAWG) Consortium. We both confirm the results of exome studies, and also uncover previously undescribed sex differences. These include sex-biases in coding and non-coding cancer drivers, mutation prevalence and strikingly, in mutational signatures related to underlying mutational processes. These results underline the pervasiveness of molecular sex differences and strengthen the call for increased consideration of sex in molecular cancer research.

To correlate quantitative echo-planar magnetic resonance (MR) imaging measures of gadopentetate dimeglumine tumor uptake with histologic diagnoses and microvessel density (MVD) and to compare dynamic echo-planar imaging of breast lesions with conventional dynamic MR imaging techniques.The study group comprised 63 patients (aged 13-70 years) with 71 breast lesions who underwent conventional and echo-planar MR imaging. The T1 values, change in gadopentetate dimeglumine concentration, and extraction-flow products were calculated with the echo-planar imaging data and were correlated with histologic findings and MVD estimates. Extraction-flow product data normalized to pectoral muscle gadopentetate dimeglumine concentration in invasive cancers was also correlated with MVD.On average, cancer T1 values were shorter than benign values, but there was substantial overlap between the two groups. Cancers had higher extraction-flow products than benign lesions (P < .001). Sensitivity, specificity, positive predictive value, and negative predictive value were 83%, 79%, 67%, and 90%, respectively. Receiver operating characteristic analysis showed improved performance with extraction-flow products than with percentages of signal intensity change. Among the invasive cancers, there was no significant correlation between extraction-flow product and MVD.The T1 value remains important in more precise quantitative estimation of gadopentetate dimeglumine uptake in breast tumors, which helps improve the specificity of dynamic imaging. Tumor MVD affects the contrast medium enhancement of breast lesions, but other factors contribute.

Abstract BACKGROUND It has long been known that both tumor size and the presence of malignant disease in the regional lymph nodes are indicators of outcome for patients with invasive breast carcinoma; however, the way in which these two characteristics could be integrated into an overall assessment of prognosis has not been obvious. METHODS Kaplan–Meier survival estimates (15 years) according to tumor size and lymph node status were obtained for women with invasive breast carcinoma who were observed at the University of Southern California/Van Nuys Breast Center (Van Nuys, California) or at Massachusetts General Hospital (Boston, Massachusetts). RESULTS To isolate the individual contributions to death made by tumor size and lymph node status, data were sorted according to both of these variables. For women with tumors of equivalent size, lethality increased with increasing number of positive lymph nodes, such that there was an extra ≈6% chance of death associated with each positive lymph node. For women with equivalent lymph node status, tumor size was associated with increased lethality, such that each millimeter of tumor diameter was associated with an additional ≈1% chance of death. The overall lethality was equal to the sum of the contribution from lymph node status and the contribution from tumor size, and this finding led to the creation of a new technique (the Size + Nodes method) for predicting outcome. CONCLUSIONS The Size + Nodes method was shown to be capable of accurately estimating the risk of death due to invasive breast carcinoma from information on the size of the primary tumor and the number of positive lymph nodes. In addition, this method was used to stratify women into groups according to breast carcinoma lethality. In contrast, classification of women according to lymph node positivity, T status, or disease stage created groups with wide and overlapping levels of lethality. Cancer 2003. © 2003 American Cancer Society.

To identify molecular alterations involved in the initiation and progression of breast carcinomas, we analyzed the global gene expression profiles of normal mammary epithelial cells and in situ, invasive, and metastatic breast carcinomas using serial analysis of gene expression (SAGE). We identified sets of genes expressed only or most abundantly in a specific stage of breast tumorigenesis or in a certain subtype of tumors through the pair-wise comparison and by hierarchical clustering analysis of these eight SAGE libraries (two/stage). On the basis of these comparisons, we made the following observations: Normal mammary epithelial cells showed the most distinct and least variable gene expression profiles. Many of the genes highly expressed in normal mammary epithelium and lost in carcinomas encoded secreted proteins, cytokines, and chemokines, implicating abnormal paracrine and autocrine signaling in the initiation of breast tumorigenesis. Very few genes were universally up-regulated in all tumors regardless of their stage and histological grade, indicating a high degree of diversity at the molecular level that likely reflects the clinical heterogeneity characteristic of breast carcinomas. Tumors of different histology type and stage had very distinct gene expression patterns. No genes seemed to be specific for metastatic or for in situ carcinomas. We found that the most dramatic and consistent phenotypic change occurred at the normal-to-in situ carcinoma transition. This observation, combined with the fact that many of the genes involved encode secreted, cell-nonautonomous factors, implies that the normal epithelium-to-in situ carcinoma transition may be the most promising target for cancer prevention and treatment.

Proper attachment to the extracellular matrix is essential for cell survival. Detachment from the extracellular matrix results in an apoptotic process termed anoikis. Anoikis induction in MCF-10A mammary epithelial cells is due not only to loss of survival signals following integrin disengagement, but also to consequent downregulation of epidermal growth factor (EGFR) and loss of EGFR-induced survival signals. Here we demonstrate that G(1)/S arrest by overexpression of the cyclin-dependent kinase inhibitors p16(INK4a), p21(Cip1), or p27(Kip1) or by treatment with mimosine or aphidicolin confers anoikis resistance in MCF-10A cells. G(1)/S arrest-mediated anoikis resistance involves suppression of the BH3-only protein Bim. Furthermore, in G(1)/S-arrested cells, Erk phosphorylation is maintained in suspension and is necessary for Bim suppression. Following G(1)/S arrest, known proteins upstream of Erk, including Raf and Mek, are not activated. However, retained Erk activation under conditions in which Raf and Mek activation is lost is observed, suggesting that G(1)/S arrest acts at the level of Erk dephosphorylation. Thus, anoikis resistance by G(1)/S arrest is mediated by a mechanism involving Bim suppression through maintenance of Erk activation. These results provide a novel link between cell cycle arrest and survival, and this mechanism could contribute to the survival of nonreplicating, dormant tumor cells that avert apoptosis during early stages of metastasis.

To identify molecular alterations implicated in the initiating steps of breast tumorogenesis, we compared the gene expression profiles of normal and ductal carcinoma in situ (DCIS) mammary epithelial cells by using serial analysis of gene expression (SAGE). Through the pair-wise comparison of normal and DCIS SAGE libraries, we identified several differentially expressed genes. Here, we report the characterization of one of these genes, HIN-1 (high in normal-1). HIN-1 expression is significantly down regulated in 94% of human breast carcinomas and in 95% of preinvasive lesions, such as ductal and lobular carcinoma in situ. This decrease in HIN-1 expression is accompanied by hypermethylation of its promoter in the majority of breast cancer cell lines (>90%) and primary tumors (74%). HIN-1 is a putative cytokine with no significant homology to known proteins. Reintroduction of HIN-1 into breast cancer cells inhibits cell growth. These results indicate that HIN-1 is a candidate tumor suppressor gene that is inactivated at high frequency in the earliest stages of breast tumorogenesis.

Small-molecule tyrosine kinase inhibitors (TKI) of the epidermal growth factor receptor (EGFR) have shown modest yet reproducible response rates in patients with squamous cell carcinoma of the head and neck (SCCHN). Somatic mutations in EGFR have recently been shown to be predictive of a clinical response in patients with non-small cell lung cancer (NSCLC) treated with these inhibitors. The objective of this study was to determine if such mutations, or recently reported mutations in ERBB2, also underlie EGFR-TKI responsiveness in SCCHN patients.We sequenced the kinase domain of EGFR and exon 20 of ERBB2 in tumor specimens from eight responsive patients. In addition, mutational analysis was done on tumor specimens from nine gefitinib nonresponders and 65 unselected cases of SCCHN.None of eight TKI-responsive specimens had mutations within the kinase domain of EGFR. EGFR amplification was also not associated with drug responsiveness. However, a single responsive case had a somatic missense mutation within exon 20 of ERBB2.Our data indicate that unlike NSCLC, EGFR kinase mutations are rare in unselected cases of SCCHN within the United States and are not linked to gefitinib or erlotinib responses in SCCHN. Alternative mechanisms, including ERBB2 mutations, may underlie responsiveness in this tumor type.

We report the first proteomic analysis of matched normal ductal/lobular units and ductal carcinoma in situ (DCIS) of the human breast. An understanding of the transition from normal epithelium to the first definable stage of cancer at the functional level of protein expression is hypothesized to contribute to improved detection, prevention, and treatment. Ten sets of two-dimensional gels were evaluated, containing either matched normal ductal/lobular units or DCIS from either whole tissue sections or up to 100,000 laser capture microdissected epithelial cells. Differential protein expression was confirmed by image analysis. Protein spots (315) were excised and subjected to mass spectrometry sequencing. Fifty-seven proteins were differentially expressed between normal ductal/lobular units and DCIS. Differences in overall protein expression levels and posttranslational processing were evident. Ten differentially expressed proteins were validated in independent DCIS specimens, and 14 of 15 proteomic trends from two-dimensional gel analyses were confirmed by standard immunohistochemical analysis using a limited independent tumor cohort. Many of the proteins identified were previously unconnected with breast cancer, including proteins regulating the intracellular trafficking of membranes, vesicles, cancer preventative agents, proteins, ions, and fatty acids. Other proteomic identifications related to cytoskeletal architecture, chaperone function, the microenvironment, apoptosis, and genomic instability. Proteomic analysis of DCIS revealed differential expression patterns distinct from previous nucleic acid-based studies and identified new facets of the earliest stage of breast cancer progression.

Abstract The DNA damage response pathway controlled by the breast cancer and Fanconi anemia (FA) genes can be disrupted by genetic or epigenetic mechanisms in breast cancer. Defects in this pathway may render the affected tumors hypersensitive to DNA-damaging agents. The identification of these defects poses a challenge because of the large number of genes involved in the FA/BRCA pathway. Many pathway components form subnuclear repair protein foci upon exposure to ionizing radiation in vitro, but it was unknown whether foci can be detected in live cancer tissues. Thus, the goal of this pilot study was to identify pathway defects by using a novel ex vivo foci biomarker assay on tumor biopsies. Fresh pretreatment biopsy specimens from patients with locally advanced sporadic breast cancer were irradiated or mock-treated in the laboratory (ex vivo). Foci formation of DNA repair proteins BRCA1, FANCD2, and RAD51 was detected by immunofluorescence microscopy. Three out of seven tumors showed intact radiation-induced foci formation, whereas the other four tumors exhibited a defective foci response. Notably, three of the foci-defective tumors were estrogen receptor/progesterone receptor/HER2–negative (triple-negative), a phenotype that has been associated with BRCA1 deficiency. In conclusion, in this pilot study, we report the successful detection of BRCA1, FANCD2, and RAD51 foci in breast cancer biopsies irradiated ex vivo. Our approach represents a potentially powerful biomarker assay for the detection of pre-existing and functionally important defects within the complex FA/BRCA pathway, which may ultimately allow us to tailor cancer treatment to the DNA repair profile of individual tumors. (Mol Cancer Res 2009;7(8):1304–9)

Deregulated expression of HOXB13 in a subset of estrogen receptor-positive breast cancer patients treated with tamoxifen monotherapy is associated with an aggressive clinical course and poor outcome. Because the ovary is another hormone-responsive organ, we investigated whether HOXB13 plays a role in ovarian cancer progression. We show that HOXB13 is expressed in multiple human ovarian cancer cell lines and tumors and that knockdown of endogenous HOXB13 by RNA interference in human ovarian cancer cell lines is associated with reduced cell proliferation. Ectopic expression of HOXB13 is capable of transforming p53(-/-) mouse embryonic fibroblasts and promotes cell proliferation and anchorage-independent growth in mouse ovarian cancer cell lines that contain genetic alterations in p53, myc, and ras. In this genetically defined cell line model of ovarian cancer, we demonstrate that HOXB13 collaborates with activated ras to markedly promote tumor growth in vivo and that HOXB13 confers resistance to tamoxifen-mediated apoptosis. Taken together, our results support a pro-proliferative and pro-survival role for HOXB13 in ovarian cancer.

Functional roles for the cancer cell-associated membrane type I matrix metalloproteinase (MT1-MMP) during early steps of the metastatic cascade in primary tumors remain unresolved. In an effort to determine its significance, we determined the in vivo effects of RNAi-mediated downregulation in mammary cancer cells on the migration, blood and lymphatic vessel invasion (LVI), and lymph node and lung metastasis. We also correlated the expression of cancer cell MT1-MMP with blood vessel invasion (BVI) in 102 breast cancer biopsies. MT1-MMP downregulation in cancer cells decreased lung metastasis without affecting primary tumor growth. The inhibition of lung metastasis correlated with reduced cancer cell migration and BVI. Furthermore, cancer cell-expressed MT1-MMP upregulated the expression of MT1-MMP in vascular endothelial cells, but did not affect MT1-MMP expression in lymphatic endothelial cells, LVI, or lymph node metastasis. Of clinical importance, we observed that elevated MT1-MMP expression correlated with BVI in biopsies from triple-negative breast cancers (TNBC), which have a poor prognosis and high incidence of distant metastasis, relative to other breast cancer subtypes. Together, our findings established that MT1-MMP activity in breast tumors is essential for BVI, but not LVI, and that MT1-MMP should be further explored as a predictor and therapeutic target of hematogenous metastasis in TNBC patients.

Preinvasive breast cancer accounts for approximately one-third of all newly diagnosed breast cancer cases in the United States and constitutes a spectrum of neoplastic lesions with varying degrees of differentiation and clinical behavior. High-throughput genetic, epigenetic, and gene-expression analyses have enhanced our understanding of the relationship of these early neoplastic lesions to normal breast tissue, and they strongly suggest that preinvasive breast cancer develops and evolves along two distinct molecular genetic and biological pathways that correlate with tumor grade. Although unique epigenetic and gene-expression changes are not observed in the tumor epithelial compartment during the transition from preinvasive to invasive disease, distinct molecular alterations are observed in the tumor-stromal and myoepithelial cells. This suggests that the stromal and myoepithelial microenvironment of preinvasive breast cancer actively participates in the transition from preinvasive to invasive disease. An improved understanding of the transition from preinvasive to invasive breast cancer will pave the way for novel preventative and therapeutic strategies.

ATAD5, the human ortholog of yeast Elg1, plays a role in PCNA deubiquitination. Since PCNA modification is important to regulate DNA damage bypass, ATAD5 may be important for suppression of genomic instability in mammals in vivo. To test this hypothesis, we generated heterozygous (Atad5(+/m)) mice that were haploinsuffficient for Atad5. Atad5(+/m) mice displayed high levels of genomic instability in vivo, and Atad5(+/m) mouse embryonic fibroblasts (MEFs) exhibited molecular defects in PCNA deubiquitination in response to DNA damage, as well as DNA damage hypersensitivity and high levels of genomic instability, apoptosis, and aneuploidy. Importantly, 90% of haploinsufficient Atad5(+/m) mice developed tumors, including sarcomas, carcinomas, and adenocarcinomas, between 11 and 20 months of age. High levels of genomic alterations were evident in tumors that arose in the Atad5(+/m) mice. Consistent with a role for Atad5 in suppressing tumorigenesis, we also identified somatic mutations of ATAD5 in 4.6% of sporadic human endometrial tumors, including two nonsense mutations that resulted in loss of proper ATAD5 function. Taken together, our findings indicate that loss-of-function mutations in mammalian Atad5 are sufficient to cause genomic instability and tumorigenesis.

Most breast cancers that occur in women with germline BRCA1 mutations are estrogen receptor-negative (ER-) and also typically lack expression of progesterone receptor (PR) and HER2 overexpression. We undertook a study to assess the clinical factors that predict for an estrogen receptor positive (ER+) breast cancer in BRCA1 mutation carriers and to characterize the pathologic features of these tumors. Clinical characteristics of BRCA1 carriers with 58 ER+ and 114 ER- first invasive breast cancers were compared. Pathologic features of BRCA1 ER+ cancers were compared to those of BRCA1 ER- cancers and to age-matched ER+ sporadic cancers. BRCA1 carriers aged ≥ 50 at diagnosis of first invasive breast cancer were more likely to have an ER+ cancer compared to those aged < 50 (57% vs 29%, P = 0.005). ER+ BRCA1 cancers were less likely than ER- BRCA1 cancers to have "BRCA-associated" features such as high mitotic activity, geographic necrosis/fibrotic focus, and pushing margins (RR 0.06, 0.22, 0.24; P < 0.001, 0.02, 0.03 respectively). When compared to sporadic ER+ cancers, ER+ BRCA1 cancers were more often of invasive ductal type (RR 2.4, P = 0.03), with a high mitotic rate (RR 5.0, P = 0.006) and absent or mild lymphocytic infiltrate (RR 10.2, P = 0.04). BRCA1 carriers who are older at first breast cancer diagnosis are more likely to have ER+ tumors than younger BRCA1 carriers. These ER+ cancers appear pathologically "intermediate" between ER- BRCA1 cancers and ER+ sporadic breast cancers raising the possibility that either some ER+ BRCA1 cancers are incidental or that there is a unique mechanism by which these cancers develop.

Identification of molecular signatures that allow detection of the transition from normal breast epithelial cells to malignant invasive cells is a critical component in the development of diagnostic, therapeutic, and preventative strategies for human breast cancer. Substantial efforts have been devoted to deciphering breast cancer etiology at the genome level, but only a limited number of studies have appeared at the proteome level. In this work, we compared individual in situ proteome profiles of nonpatient matched nine noncancerous, normal breast epithelial (NBE) samples with nine estrogen receptor (ER)-positive (luminal subtype), invasive malignant breast epithelial (MBE) samples by combining laser capture microdissection (LCM) and quantitative shotgun proteomics. A total of 12,970 unique peptides were identified from the 18 samples, and 1623 proteins were selected for quantitative analysis using spectral index (SpI) as a measure of protein abundance. A total of 298 proteins were differentially expressed between NBE and MBE at 95% confidence level, and this differential expression correlated well with immunohistochemistry (IHC) results reported in the Human Protein Atlas (HPA) database. To assess pathway level patterns in the observed expression changes, we developed protein set enrichment analysis (PSEA), a modification of a well-known approach in gene expression analysis, Gene Set Enrichment Analysis (GSEA). Unlike single gene-based functional term enrichment analyses that only examines pathway overrepresentation of proteins above a given significance threshold, PSEA applies a weighted running sum statistic to the entire expression data to discover significantly enriched protein groups. Application of PSEA to the expression data in this study revealed not only well-known ER-dependent and cellular morphology-dependent protein abundance changes, but also significant alterations of downstream targets for multiple transcription factors (TFs), suggesting a role for specific gene regulatory pathways in breast tumorigenesis. A parallel GOMiner analysis revealed both confirmatory and complementary data to PSEA. The combination of the two annotation approaches yielded extensive biological feature mapping for in depth analysis of the quantitative proteomic data. Identification of molecular signatures that allow detection of the transition from normal breast epithelial cells to malignant invasive cells is a critical component in the development of diagnostic, therapeutic, and preventative strategies for human breast cancer. Substantial efforts have been devoted to deciphering breast cancer etiology at the genome level, but only a limited number of studies have appeared at the proteome level. In this work, we compared individual in situ proteome profiles of nonpatient matched nine noncancerous, normal breast epithelial (NBE) samples with nine estrogen receptor (ER)-positive (luminal subtype), invasive malignant breast epithelial (MBE) samples by combining laser capture microdissection (LCM) and quantitative shotgun proteomics. A total of 12,970 unique peptides were identified from the 18 samples, and 1623 proteins were selected for quantitative analysis using spectral index (SpI) as a measure of protein abundance. A total of 298 proteins were differentially expressed between NBE and MBE at 95% confidence level, and this differential expression correlated well with immunohistochemistry (IHC) results reported in the Human Protein Atlas (HPA) database. To assess pathway level patterns in the observed expression changes, we developed protein set enrichment analysis (PSEA), a modification of a well-known approach in gene expression analysis, Gene Set Enrichment Analysis (GSEA). Unlike single gene-based functional term enrichment analyses that only examines pathway overrepresentation of proteins above a given significance threshold, PSEA applies a weighted running sum statistic to the entire expression data to discover significantly enriched protein groups. Application of PSEA to the expression data in this study revealed not only well-known ER-dependent and cellular morphology-dependent protein abundance changes, but also significant alterations of downstream targets for multiple transcription factors (TFs), suggesting a role for specific gene regulatory pathways in breast tumorigenesis. A parallel GOMiner analysis revealed both confirmatory and complementary data to PSEA. The combination of the two annotation approaches yielded extensive biological feature mapping for in depth analysis of the quantitative proteomic data. Breast cancer is a major health problem that each year affects the lives of millions of women worldwide. In 2008, in the United States alone, ∼180,000 women were diagnosed with invasive breast carcinoma (1Jemal A. Siegel R. Ward E. Hao Y. Xu J. Murray T. Thun M.J. Cancer statistics, 2008.CA-Cancer J. Clin. 2008; 58: 71-96Crossref PubMed Scopus (10172) Google Scholar). The use of high-throughput gene expression technologies applied to the study of human breast cancer has lead to the discovery of the “intrinsic gene signatures” that stratify human breast cancers into four subtypes that correlate remarkably well with clinically recognized breast cancer subtypes (2Sotiriou C. Wirapati P. Loi S. Harris A. Fox S. Smeds J. Nordgren H. Farmer P. Praz V. Haibe-Kains B. Desmedt C. Larsimont D. Cardoso F. Peterse H. Nuyten D. Buyse M. Van de Vijver M.J. Bergh J. Piccart M. Delorenzi M. Gene expression profiling in breast cancer: Understanding the molecular basis of histologic grade to improve prognosis.J. Natl. Cancer Inst. 2006; 98: 262-272Crossref PubMed Scopus (1534) Google Scholar, 3Sorlie T. Perou C.M. Tibshirani R. Aas T. Geisler S. Johnsen H. Hastie T. Eisen M.B. van de Rijn M. Jeffrey S.S. Thorsen T. Quist H. Matese J.C. Brown P.O. Botstein D. Lønning P. Eystein Børresen-Dale A.L. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications.Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 10869-10874Crossref PubMed Scopus (8426) Google Scholar, 4van't Veer L.J. Dai H. van de Vijver M.J. He Y.D. Hart A.A. Mao M. Peterse H.L. van der Kooy K. Marton M.J. Witteveen A.T. Schreiber G.J. Kerkhoven R.M. Roberts C. Linsley P.S. Bernards R. Friend S.H. Gene expression profiling predicts clinical outcome of breast cancer.Nature. 2002; 415: 530-536Crossref PubMed Scopus (7697) Google Scholar, 5Ma X.J. Wang Z. Ryan P.D. Isakoff S.J. Barmettler A. Fuller A. Muir B. Mohapatra G. Salunga R. Tuggle J.T. Tran Y. Tran D. Tassin A. Amon P. Wang W. Enright E. Stecker K. Estepa-Sabal E. Smith B. Younger J. Balis U. Michaelson J. Bhan A. Habin K. Baer T.M. Brugge J. Haber D.A. Erlander M.G. Sgroi D.C. A two-gene expression ratio predicts clinical outcome in breast cancer patients treated with tamoxifen.Cancer Cell. 2004; 5: 607-616Abstract Full Text Full Text PDF PubMed Scopus (789) Google Scholar, 6Perou C.M. Sørlie T. Eisen M.B. van de Rijn M. Jeffrey S.S. Rees C.A. Pollack J.R. Ross D.T. Johnsen H. Akslen L.A. Fluge O. Pergamenschikov A. Williams C. Zhu S.X. Lønning P.E. Børresen-Dale A.L. Brown P.O. Botstein D. Molecular portraits of human breast tumours.Nature. 2000; 406: 747-752Crossref PubMed Scopus (11499) Google Scholar). These subtypes include “HER2+,” “basal,” and “luminal A,” “luminal B” breast cancers. HER2+ tumors are most frequently estrogen receptor (ER)- 1The abbreviations used are:ERestrogen receptorEREestrogen response elementESenrichment scoreGOgene ontologyGSEAgene set enrichment analysisHPAHuman Protein AtlasIHCimmunohistochemistryLCMlaser capture microdissectionMBEmalignant breast epitheliumMSigDBthe molecular signatures databaseNBEnormal breast epitheliumPSEAprotein set enrichment analysisRSSrunning sum statisticSpIspectral indexTFtranscription factorFDRfalse discovery rateSRFserum response factorAP-1activator protein 1SREBP1sterol regulatory binding protein 1. 1The abbreviations used are:ERestrogen receptorEREestrogen response elementESenrichment scoreGOgene ontologyGSEAgene set enrichment analysisHPAHuman Protein AtlasIHCimmunohistochemistryLCMlaser capture microdissectionMBEmalignant breast epitheliumMSigDBthe molecular signatures databaseNBEnormal breast epitheliumPSEAprotein set enrichment analysisRSSrunning sum statisticSpIspectral indexTFtranscription factorFDRfalse discovery rateSRFserum response factorAP-1activator protein 1SREBP1sterol regulatory binding protein 1., express proliferation genes, as well as Her-2 and other genes linked to this latter locus. The basal tumors are most commonly ER negative, progesterone receptor negative and Her-2 negative. The luminal A and luminal B tumors express luminal cytokeratins, the estrogen receptor (ER), and trans-acting T-cell-specific transcription factor (GATA3).The luminal breast cancers (both A and B subtypes) constitute ∼70% of all human breast cancers diagnosed worldwide. In general, the luminal breast cancers are associated with favorable prognosis as compared with the HER2+ and basal subtypes. Nevertheless, luminal B tumors have a worse prognosis than luminal A tumors, and recent data suggest that luminal A tumors may be adequately treated with antihormonal therapy alone, whereas luminal B tumors may benefit from chemotherapy added to antihormonal therapy (7Brenton J.D. Carey L.A. Ahmed A.A. Caldas C. Molecular classification and molecular forecasting of breast cancer: Ready for clinical application?.J. Clin. Oncol. 2005; 23: 7350-7360Crossref PubMed Scopus (726) Google Scholar). Despite advances in the gene expression-based stratification of human breast cancer, the molecular basis of luminal breast tumorigenesis and luminal breast cancer clinical heterogeneity is still poorly understood. This gap in knowledge is due, in part, to the well-known limitations associated with gene expression, for it is the gene products, or the proteome, and not the genes themselves that are the biochemical determinants of cell growth and metabolism. Thus, increased knowledge of the proteomic alterations associated with luminal breast cancer tumorigenesis will help advance understanding of human breast cancer and facilitate tailored interventions in select luminal breast cancer patients.Over the past decade, research has been conducted to study the breast cancer proteome to increase the molecular understanding of breast cancer tumorigenesis beyond that from existing breast cancer gene expression data (8Hondermarck H. Breast cancer - When proteomics challenges biological complexity.Mol. Cell. Proteomics. 2003; 2: 281-291Abstract Full Text Full Text PDF PubMed Scopus (68) Google Scholar, 9Somiari R.I. Somiari S. Russell S. Shriver C.D. Proteomics of breast carcinoma.J. Chromatogr. B. 2005; 815: 215-225Crossref PubMed Scopus (88) Google Scholar, 10Bertucci F. Birnbaum D. Goncalves A. Proteomics of breast cancer - Principles and potential clinical applications.Mol. Cell. Proteomics. 2006; 5: 1772-1786Abstract Full Text Full Text PDF PubMed Scopus (72) Google Scholar). Global proteomic analyses of tumor biopsies, dissected cells, human breast milk and nipple aspirate fluid, cancer cell lines, and sera and plasma provide opportunities for unbiased characterization of protein expression in breast cancer (11Hondermarck H. Tastet C. El Yazidi-Belkoura I. Toillon R.A. Le Bourhis X. Proteomics of breast cancer: The quest for markers and therapeutic targets.J. Proteome Res. 2008; 7: 1403-1411Crossref PubMed Scopus (40) Google Scholar, 12Kulasingam V. Diamandis E.P. Tissue culture-based breast cancer biomarker discovery platform.Int. J. Cancer. 2008; 123: 2007-2012Crossref PubMed Scopus (64) Google Scholar). Tumor tissue is likely to be the most informative sample, since proteomic analysis is conducted directly on the sample where the disease resides. However, tumor analysis is challenging, given the heterogeneity of the breast cancer tissue and the limited number of cells generally available.Highly enriched cell populations can be obtained from heterogeneous samples by laser capture microdissection (LCM) (13Emmert-Buck M.R. Bonner R.F. Smith P.D. Chuaqui R.F. Zhuang Z. Goldstein S.R. Weiss R.A. Liotta L.A. Laser Capture Microdissection.Science. 1996; 274: 998-1001Crossref PubMed Scopus (2113) Google Scholar, 14Espina V. Wulfkuhle J.D. Calvert V.S. VanMeter A. Zhou W. Coukos G. Geho D.H. Petricoin 3rd, E.F. Liotta L.A. Laser-capture microdissection.Nat. Protoc. 2006; 1: 586-603Crossref PubMed Scopus (484) Google Scholar). Such sample analysis can lead to detailed proteomic portraits of tumor microenvironments and, importantly, correct for potential confounding effects of stromal contamination (15Ma X.J. Dahiya S. Richardson E. Erlander M. Sgroi D.C. Gene expression profiling of the tumor microenvironment during breast cancer progression.Breast Cancer Res. 2009; 11: R7Crossref PubMed Scopus (489) Google Scholar). Though such analyses are numerous in the world of gene expression studies, proteomic analyses of LCM breast tissue are limited (16Wulfkuhle J.D. Sgroi D.C. Krutzsch H. McLean K. McGarvey K. Knowlton M. Chen S. Shu H. Sahin A. Kurek R. Wallwiener D. Merino M.J. Petricoin 3rd, E.F. Zhao Y. Steeg P.S. Proteomics of human breast ductal carcinoma in situ.Cancer Res. 2002; 62: 6740-6749PubMed Google Scholar, 17Zang L. Palmer Toy D. Hancock W.S. Sgroi D.C. Karger B.L. Proteomic analysis of ductal carcinoma of the breast using laser capture microdissection, LC-MS, and O-16/O-18 isotopic labeling.J. Proteome Res. 2004; 3: 604-612Crossref PubMed Scopus (146) Google Scholar, 18Neubauer H. Clare S.E. Kurek R. Fehm T. Wallwiener D. Sotlar K. Nordheim A. Wozny W. Schwall G.P. Poznanović S. Sastri C. Hunzinger C. Stegmann W. Schrattenholz A. Cahill M.A. Breast cancer proteomics by laser capture microdissection, sample pooling, 54-cm IPG IEF, and differential iodine radioisotope detection.Electrophoresis. 2006; 27: 1840-1852Crossref PubMed Scopus (65) Google Scholar, 19Umar A. Luider T.M. Foekens J.A. Pasa-Tolic L. NanoLC-FT-ICR MS improves proteome coverage attainable for similar to 3000 laser-microdissected breast carcinoma cells.Proteomics. 2007; 7: 323-329Crossref PubMed Scopus (57) Google Scholar, 20Sanders M.E. Dias E.C. Xu B.J. Mobley J.A. Billheimer D. Roder H. Grigorieva J. Dowsett M. Arteaga C.L. Caprioli R.M. Differentiating proteomic biomarkers in breast cancer by laser capture microdissection and MALDI MS.J. Proteome Res. 2008; 7: 1500-1507Crossref PubMed Scopus (52) Google Scholar, 21Johann D.J. Rodriguez-Canales J. Mukherjee S. Prieto D.A. Hanson J.C. Emmert-Buck M. Blonder J. Approaching Solid Tumor Heterogeneity on a Cellular Basis by Tissue Proteomics Using Laser Capture Microdissection and Biological Mass Spectrometry.J. Proteome Res. 2009; 8: 2310-2318Crossref PubMed Scopus (70) Google Scholar). Recently, solid tumor heterogeneity at the protein level was assessed by comparing LCM-acquired breast tumor proper and stromal cells from a lymph node containing breast carcinoma (21Johann D.J. Rodriguez-Canales J. Mukherjee S. Prieto D.A. Hanson J.C. Emmert-Buck M. Blonder J. Approaching Solid Tumor Heterogeneity on a Cellular Basis by Tissue Proteomics Using Laser Capture Microdissection and Biological Mass Spectrometry.J. Proteome Res. 2009; 8: 2310-2318Crossref PubMed Scopus (70) Google Scholar), and differential proteome profiles according to tamoxifen therapy responsiveness were analyzed from ER+, primary tumor pooled LCM samples (22Umar A. Kang H. Timmermans A.M. Look M.P. Meijer-van Gelder M.E. den Bakker M.A. Jaitly N. Martens J.W. Luider T.M. Foekens J.A. Pasa-Tolić L. Identification of a Putative Protein Profile Associated with Tamoxifen Therapy Resistance in Breast Cancer.Mol. Cell. Proteomics. 2009; 8: 1278-1294Abstract Full Text Full Text PDF PubMed Scopus (83) Google Scholar).The combination of LCM enrichment and shotgun proteomics has the potential to reveal novel pathogenic pathways and networks by which normal breast epithelial cells progress to invasive malignant epithelial cells. Genomic and gene expression profiling of human breast cancer progression has already shown potential for the identification of molecular alterations that serve as prognostic and predictive biomarkers (2Sotiriou C. Wirapati P. Loi S. Harris A. Fox S. Smeds J. Nordgren H. Farmer P. Praz V. Haibe-Kains B. Desmedt C. Larsimont D. Cardoso F. Peterse H. Nuyten D. Buyse M. Van de Vijver M.J. Bergh J. Piccart M. Delorenzi M. Gene expression profiling in breast cancer: Understanding the molecular basis of histologic grade to improve prognosis.J. Natl. Cancer Inst. 2006; 98: 262-272Crossref PubMed Scopus (1534) Google Scholar, 3Sorlie T. Perou C.M. Tibshirani R. Aas T. Geisler S. Johnsen H. Hastie T. Eisen M.B. van de Rijn M. Jeffrey S.S. Thorsen T. Quist H. Matese J.C. Brown P.O. Botstein D. Lønning P. Eystein Børresen-Dale A.L. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications.Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 10869-10874Crossref PubMed Scopus (8426) Google Scholar, 4van't Veer L.J. Dai H. van de Vijver M.J. He Y.D. Hart A.A. Mao M. Peterse H.L. van der Kooy K. Marton M.J. Witteveen A.T. Schreiber G.J. Kerkhoven R.M. Roberts C. Linsley P.S. Bernards R. Friend S.H. Gene expression profiling predicts clinical outcome of breast cancer.Nature. 2002; 415: 530-536Crossref PubMed Scopus (7697) Google Scholar, 23Chin K. DeVries S. Fridlyand J. Spellman P.T. Roydasgupta R. Kuo W.L. Lapuk A. Neve R.M. Qian Z. Ryder T. Chen F. Feiler H. Tokuyasu T. Kingsley C. Dairkee S. Meng Z. Chew K. Pinkel D. Jain A. Ljung B.M. Esserman L. Albertson D.G. Waldman F.M. Gray J.W. Genomic and transcriptional aberrations linked to breast cancer pathophysiologies.Cancer Cell. 2006; 10: 529-541Abstract Full Text Full Text PDF PubMed Scopus (1010) Google Scholar). Comprehensive knowledge of proteomic patterns in normal epithelium, as compared with malignant breast epithelium, would be invaluable in providing a more complete picture of the molecular entities associated with breast cancer progression.In the present study, we performed comparative proteomic profiling of laser capture microdissected normal breast epithelium (NBE) from nine different noncancerous human mammoplasty specimens relative to microdissected malignant breast epithelium (MBE) from nine different human invasive luminal (ER positive) breast cancer specimens. Using only the limited amount of material collected by LCM (60,000 cells), a proteomic profile of each sample was separately acquired by label-free proteomics using our previously developed platform for analysis of LCM samples (24Gu Y. Wu S.L. Meyer J.L. Hancock W.S. Burg L.J. Linder J. Hanlon D.W. Karger B.L. Proteomic analysis of high-grade dysplastic cervical cells obtained from ThinPrep slides using laser capture microdissection and mass spectrometry.J. Proteome Res. 2007; 6: 4256-4268Crossref PubMed Scopus (35) Google Scholar). To the best of our knowledge, this is the most comprehensive global study that compares proteomic signatures of phenotypically normal and ER+ invasive malignant breast epithelial cells in multiple individual samples. For each protein, the spectral index (SpI) value (25Fu X. Gharib S.A. Green P.S. Aitken M.L. Frazer D.A. Park D.R. Vaisar T. Heinecke J.W. Spectral index for assessment of differential protein expression in shotgun proteomics.J. Proteome Res. 2008; 7: 845-854Crossref PubMed Scopus (86) Google Scholar) was used as a measure of relative abundance, with differentially abundant proteins between NBE and MBE being identified by employing permutation analysis. Importantly, a number of proteins highly enriched in MBE, including both well-known and novel proteins in the context of breast cancer, were verified to be up-regulated based on immunohistostaining profiles of normal and disease tissues available in the Human Protein Atlas (HPA) (26Berglund L. Björling E. Oksvold P. Fagerberg L. Asplund A. Szigyarto C.A. Persson A. Ottosson J. Wernérus H. Nilsson P. Lundberg E. Sivertsson A. Navani S. Wester K. Kampf C. Hober S. Pontén F. Uhlén M. A gene-centric human protein atlas for expression profiles based on antibodies.Mol. Cell. Proteomics. 2008; 7: 2019-2027Abstract Full Text Full Text PDF PubMed Scopus (492) Google Scholar).A challenge in all global expression profiling studies is to annotate the large number of observed molecular changes. Functional approaches employing DAVID or GOMiner have been used in the analysis of global proteomic profiling studies (27Dennis G. Sherman B.T. Hosack D.A. Yang J. Gao W. Lane H.C. Lempicki R.A. DAVID: Database for annotation, visualization, and integrated discovery.Genome Biol. 2003; 4: R60Crossref Google Scholar, 28Zeeberg B.R. Qin H. Narasimhan S. Sunshine M. Cao H. Kane D.W. Reimers M. Stephens R.M. Bryant D. Burt S.K. Elnekave E. Hari D.M. Wynn T.A. Cunningham-Rundles C. Stewart D.M. Nelson D. Weinstein J.N. High-Throughput GoMiner, an ‘industrial-strength’ integrative gene ontology tool for interpretation of multiple-microarray experiments, with application to studies of Common Variable Immune Deficiency (CVID).BMC Bioinformatics. 2005; 6: 168Crossref PubMed Scopus (231) Google Scholar). Though effective, these approaches rely on strict quantitative thresholds for selecting proteins to be included and ignore the level of expression differences when scoring enriched functional terms. Gene set enrichment analysis (GSEA) was developed in the gene expression field as a powerful approach for determining functional significance of differential expression results by taking into account the quantitative nature of expression correlation (29Subramanian A. Tamayo P. Mootha V.K. Mukherjee S. Ebert B.L. Gillette M.A. Paulovich A. Pomeroy S.L. Golub T.R. Lander E.S. Mesirov J.P. Gene set enrichment analysis: A knowledge-based approach for interpreting genome-wide expression profiles.Proc. Natl. Acad. Sci. U.S.A. 2005; 102: 15545-15550Crossref PubMed Scopus (25165) Google Scholar). Recently, GSEA has been applied, without modification, to proteome datasets to interpret global functional changes in dilated cardiomyopathy (30Ruth, I., Daniele, M., Rasoul, A.-K., Anthony, G., Gary, D. B., Andrew, E., Pathway analysis of dilated cardiomyopathy using global proteomic profiling and enrichment maps. Proteomics, 10, 1316–1327.Google Scholar).In the present study, we modified GSEA to be suitable for the analysis of label-free quantitative proteomic data in an approach termed Protein Set Enrichment Analysis (PSEA). PSEA takes into account the quantitative level of differential protein expression measured by spectral counts to highlight biologically related proteins with strong and highly concordant expression differences. PSEA of LCM-derived MBE samples revealed significant decreased expression of cytoskeletal proteins and of proteins that are consistently negatively correlated with ER+ human breast cancers. More importantly, many protein sets, representing proteins controlled by common transcription factors (TFs) were found, potentially suggesting a role of estrogen response element (ERE)-independent ER signaling in breast tumorigenesis. In addition, we performed a GOMiner analysis, which requires arbitrary thresholds for differentially abundant proteins, on the proteomic results. For differentially expressed proteins at the 95% confidence level, GOMiner analysis added unique biological features such as up-regulation of Golgi vesicle transport activity in MBE. Complementing PSEA with the results of standard GOMiner analysis, we are able to map extensively potential activators and targets for common TFs.CONCLUSIONSComparative proteomic analysis of breast epithelium was performed using a combination of LCM and shotgun proteomics. To our knowledge, this work is the most comprehensive study comparing direct proteome signatures obtained from homogeneous cell populations of phenotypically normal and ER+ invasive malignant breast epithelium. The key features of this study included separate processing of each sample, thus providing a measure of biological variability. Furthermore, consistent proteomic profiles across 18 samples were obtained using a robust shotgun proteomics protocol. Nine biological replicates for each phenotype proved to be a good balance between the statistical significance and time necessary for analysis.Highly MBE-enriched proteins were found to correlate well with tissue IHC profiles deposited in the Human Protein Atlas. This agreement suggest that our proteomics results may not be restricted to ER+ breast cancer samples, but may be generalized to all breast cancer subtypes, given the diversity of breast cancer subtype samples in the HPA database.Global changes in multiple protein signatures, according to breast epithelial malignancy, were functionally assessed by employing PSEA, an annotation method that uses the complete quantitative profiles of all identified proteins with no arbitrary cutoffs. PSEA of ER+ breast epithelium not only found many confirmatory biological findings but also revealed significant changes of downstream targets for a number of common transcription factors. This result suggests that ERE-independent ER signaling could be a key pathway in breast cancer progression. GOMiner analysis with 298 differentially abundant proteins at or above the 95% confidence level provided complementary results to PSEA, and the combination of the two approaches revealed extensive insights into the molecular participants involved in signaling cascades.PSEA is applicable to any quantitative proteome dataset, and the flexibility of PSEA allows exploration of proteome datasets in many different biological contexts. For example, PSEA using the proteome-unique sets, such as protein-protein interaction database, could provide biological insights that are distinguished from those by genome-based annotations. Furthermore, inclusion of all differentially abundant proteins or genes with PSEA will avoid missing possible important biological relationships behind target candidates (e.g. drug targets and biomarkers).Future studies will include correlation analysis between a previously reported transcriptome dataset (33Ma X.J. Salunga R. Tuggle J.T. Gaudet J. Enright E. McQuary P. Payette T. Pistone M. Stecker K. Zhang B.M. Zhou Y.X. Varnholt H. Smith B. Gadd M. Chatfield E. Kessler J. Baer T.M. Erlander M.G. Sgroi D.C. Gene expression profiles of human breast cancer progression.Proc. Natl. Acad. Sci. U.S.A. 2003; 100: 5974-5979Crossref PubMed Scopus (719) Google Scholar) and our proteome dataset, which can lead to significant additional protein networks and provide further insight into the biology of breast cancer progression. In addition, comparing proteome profiles of phenotypically normal epithelium in noncancerous and cancerous breast tissues from the same patient could be interesting, because normal tissue in close proximity to breast carcinoma has been known to lose its heterozygosity (31Deng G. Lu Y. Zlotnikov G. Thor A.D. Smith H.S. Loss of Heterozygosity in Normal Tissue Adjacent to Breast Carcinomas.Science. 1996; 274: 2057-2059Crossref PubMed Scopus (492) Google Scholar). Such findings should broaden our understanding of the molecular boundary between benign and malignant breast diseases. Breast cancer is a major health problem that each year affects the lives of millions of women worldwide. In 2008, in the United States alone, ∼180,000 women were diagnosed with invasive breast carcinoma (1Jemal A. Siegel R. Ward E. Hao Y. Xu J. Murray T. Thun M.J. Cancer statistics, 2008.CA-Cancer J. Clin. 2008; 58: 71-96Crossref PubMed Scopus (10172) Google Scholar). The use of high-throughput gene expression technologies applied to the study of human breast cancer has lead to the discovery of the “intrinsic gene signatures” that stratify human breast cancers into four subtypes that correlate remarkably well with clinically recognized breast cancer subtypes (2Sotiriou C. Wirapati P. Loi S. Harris A. Fox S. Smeds J. Nordgren H. Farmer P. Praz V. Haibe-Kains B. Desmedt C. Larsimont D. Cardoso F. Peterse H. Nuyten D. Buyse M. Van de Vijver M.J. Bergh J. Piccart M. Delorenzi M. Gene expression profiling in breast cancer: Understanding the molecular basis of histologic grade to improve prognosis.J. Natl. Cancer Inst. 2006; 98: 262-272Crossref PubMed Scopus (1534) Google Scholar, 3Sorlie T. Perou C.M. Tibshirani R. Aas T. Geisler S. Johnsen H. Hastie T. Eisen M.B. van de Rijn M. Jeffrey S.S. Thorsen T. Quist H. Matese J.C. Brown P.O. Botstein D. Lønning P. Eystein Børresen-Dale A.L. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications.Proc. Natl. Acad. Sci. U.S.A. 2001; 98: 10869-10874Crossref PubMed Scopus (8426) Google Scholar, 4van't Veer L.J. Dai H. van de Vijver M.J. He Y.D. Hart A.A. Mao M. Peterse H.L. van der Kooy K. Marton M.J. Witteveen A.T. Schreiber G.J. Kerkhoven R.M. Roberts C. Linsley P.S. Bernards R. Friend S.H. Gene expression profiling predicts clinical outcome of breast cancer.Nature. 2002; 415: 530-536Crossref PubMed Scopus (7697) Google Scholar, 5Ma X.J. Wang Z. Ryan P.D. Isakoff S.J. Barmettler A. Fuller A. Muir B. Mohapatra G. Salunga R. Tuggle J.T. Tran Y. Tran D. Tassin A. Amon P. Wang W. Enright E. Stecker K. Estepa-Sabal E. Smith B. Younger J. Balis U. Michaelson J. Bhan A. Habin K. Baer T.M. Brugge J. Haber D.A. Erlander M.G. Sgroi D.C. A two-gene expression ratio predicts clinical outcome in breast cancer patients treated with tamoxifen.Cancer Cell. 2004; 5: 607-616Abstract Full Text Full Text PDF PubMed Scopus (789) Google Scholar, 6Perou C.M. Sørlie T. Eisen M.B. van de Rijn M. Jeffrey S.S. Rees C.A. Pollack J.R. Ross D.T. Johnsen H. Akslen L.A. Fluge O. Pergamenschikov A. Williams C. Zhu S.X. Lønning P.E. Børresen-Dale A.L. Brown P.O. Botstein D. Molecular portraits of human breast tumours.Nature

BACKGROUND The molecular pathogenesis of clear cell endometrial cancer (CCEC), a tumor type with a relatively unfavorable prognosis, is not well defined. We searched exome‐wide for novel somatically mutated genes in CCEC and assessed the mutational spectrum of known and candidate driver genes in a large cohort of cases. METHODS We conducted whole exome sequencing of paired tumor‐normal DNAs from 16 cases of CCEC (12 CCECs and the CCEC components of 4 mixed histology tumors). Twenty‐two genes‐of‐interest were Sanger‐sequenced from another 47 cases of CCEC. Microsatellite instability (MSI) and microsatellite stability (MSS) were determined by genotyping 5 mononucleotide repeats. Results Two tumor exomes had relatively high mutational loads and MSI. The other 14 tumor exomes were MSS and had 236 validated nonsynonymous or splice junction somatic mutations among 222 protein‐encoding genes. Among the 63 cases of CCEC in this study, we identified frequent somatic mutations in TP53 (39.7%), PIK3CA (23.8%), PIK3R1 (15.9%), ARID1A (15.9%), PPP2R1A (15.9%), SPOP (14.3%), and TAF1 (9.5%), as well as MSI (11.3%). Five of 8 mutations in TAF1 , a gene with no known role in CCEC, localized to the putative histone acetyltransferase domain and included 2 recurrently mutated residues. Based on patterns of MSI and mutations in 7 genes, CCEC subsets molecularly resembled serous endometrial cancer (SEC) or endometrioid endometrial cancer (EEC). CONCLUSION Our findings demonstrate molecular similarities between CCEC and SEC and EEC and implicate TAF1 as a novel candidate CCEC driver gene. Cancer 2017;123:3261‐8 . © 2017 American Cancer Society .

Breast tumors contain tumorigenic cancer cells, termed "tumor-initiating cells" (TICs), which are capable of both replenishing themselves and giving rise to populations of nontumorigenic breast cancer cells (non-TICs). However, the molecular mechanisms responsible for breast tumor initiation remain poorly understood. Here we describe a chemical screening strategy to identify small molecules that enhance the effect of chemotherapeutic agents on TIC-enriched breast cancer cells. We identified proteins that interact with the lead compound C108, including the stress granule-associated protein, GTPase-activating protein (SH3 domain)-binding protein 2, G3BP2. G3BP2 regulates breast tumor initiation through the stabilization of Squamous cell carcinoma antigen recognized by T cells 3 (SART3) mRNA, which leads to increased expression of the pluripotency transcription factors Octamer-binding protein 4 (Oct-4) and Nanog Homeobox (Nanog). Our findings suggest that G3BP2 is important for the process of breast cancer initiation. Furthermore, these data suggest a possible connection between stress granule formation and tumor initiation in breast cancer cells.

While FGFR1 amplification has been described in breast cancer, the optimal treatment approach for FGFR1-amplified (FGFR1+) metastatic breast cancer (MBC) remains undefined.Experimental Design: We evaluated clinical response to endocrine and targeted therapies in a cohort of patients with hormone receptor-positive (HR+)/HER2- MBC and validated the functional role of FGFR1-amplification in mediating response/resistance to hormone therapy in vitro.In the clinical cohort (N = 110), we identified that patients with FGFR1+ tumors were more likely to have progesterone receptor (PR)-negative disease (47% vs. 20%; P = 0.005), coexisting TP53 mutations (41% vs. 21%; P = 0.05), and exhibited shorter time to progression with endocrine therapy alone and in combination with CDK4/6 inhibitor, but not with a mTOR inhibitor (everolimus), adjusting for key prognostic variables in multivariate analysis. Furthermore, mTOR-based therapy resulted in a sustained radiological and molecular response in an index case of FGFR1+ HR+/HER2- MBC. In preclinical models, estrogen receptor-positive (ER+)/FGFR1-amplified CAMA1 human breast cancer cells were only partially sensitive to fulvestrant, palbociclib, and alpelisib, but highly sensitive to everolimus. In addition, transduction of an FGFR1 expression vector into ER+ T47D cells induced resistance to fulvestrant that could be overcome by added TORC1 inhibition, but not PI3K or CDK4/6 inhibition.Collectively, these findings suggest that while FGFR1 amplification confers broad resistance to ER, PI3K, and CDK4/6 inhibitors, mTOR inhibitors might have a unique therapeutic role in the treatment of patients with ER+/FGFR1+ MBC.

Alternative polyadenylation (APA) is a process that changes the posttranscriptional regulation and translation potential of mRNAs via addition or deletion of 3' untranslated region (3' UTR) sequences. To identify posttranscriptional-regulatory events affected by APA in breast tumors, tumor datasets were analyzed for recurrent APA events. Motif mapping of the changed 3' UTR regions found that APA-mediated removal of Pumilio regulatory elements (PRE) was unusually common. Breast tumor subtype-specific APA profiling identified triple-negative breast tumors as having the highest levels of APA. To determine the frequency of these events, an independent cohort of triple-negative breast tumors and normal breast tissue was analyzed for APA. APA-mediated shortening of NRAS and c-JUN was seen frequently, and this correlated with changes in the expression of downstream targets. mRNA stability and luciferase assays demonstrated APA-dependent alterations in RNA and protein levels of affected candidate genes. Examination of clinical parameters of these tumors found those with APA of NRAS and c-JUN to be smaller and less proliferative, but more invasive than non-APA tumors. RT-PCR profiling identified elevated levels of polyadenylation factor CSTF3 in tumors with APA. Overexpression of CSTF3 was common in triple-negative breast cancer cell lines, and elevated CSTF3 levels were sufficient to induce APA of NRAS and c-JUN. Our results support the hypothesis that PRE-containing mRNAs are disproportionately affected by APA, primarily due to high sequence similarity in the motifs utilized by polyadenylation machinery and the PUM complex. Cancer Res; 76(24); 7231-41. ©2016 AACR.

Li Fraumeni Syndrome (LFS) is a multicancer phenotype, most commonly associated with germ-line mutations in TP53. In a kindred with LFS without an inherited TP53 mutation, we have previously reported a truncating mutation (1100delC) in CHK2, encoding a kinase that phosphorylates p53 on Ser(20). Here, we describe a CHK2 missense mutation (R145W) in another LFS family. This mutation destabilizes the encoded protein, reducing its half-life from >120 min to 30 min. This effect is abrogated by treatment of cells with a proteosome inhibitor, suggesting that CHK2(R145W) is targeted through this degradation pathway. Both 1100delC and R145W germ-line mutations in CHK2 are associated with loss of the wild-type allele in the corresponding tumor specimens, and neither tumor harbors a somatic TP53 mutation. Our observations support the functional significance of CHK2 mutations in rare cases of LFS and suggest that such mutations may substitute for inactivation of TP53.

The B-cell receptor CD22 binds sialic acid linked alpha-2-6 to terminal galactose residues on N-linked oligosaccharides associated with several cell-surface glycoproteins. The first of these sialoglycoproteins to be identified was the receptor-linked phosphotyrosine phosphatase CD45, which is required for antigen/CD3-induced T-cell activation. In the present work, we examine the effect of interaction between the extracellular domain of CD45 and CD22 on T-cell activation. Using soluble CD22-immunoglobulin fusion proteins and T cells expressing wild-type and chimeric CD45 forms, we show that engagement of CD45 by soluble CD22 can modulate early T-cell signals in antigen receptor/CD3-mediated stimulation. We also show that addition of sialic acid by beta-galactoside alpha-2,6-sialyltransferase to the CD22 molecule abrogates interactions between CD22 and its ligands. Together, these observations provide direct evidence for a functional role of the interaction between the extracellular domain of CD45 and a natural ligand and suggest another regulatory mechanism for CD22-mediated ligand engagement.

Abstract Purpose: We previously identified three genes, HOXB13, IL17BR, and CHDH, that strongly predict clinical outcome in estrogen receptor (ER)–positive breast cancer patients receiving tamoxifen monotherapy. The biological mechanisms linking these genes to estrogen signaling and tamoxifen response in breast cancer remain to be determined. Experimental Design: In a consecutive series of 148 ER-positive and ER-negative breast cancers, HOXB13, IL17BR, and CHDH gene expression was measured by quantitative real-time PCR and correlated with ER, PR, and HER2 expression. The role of estrogen and ER in the regulation of these three genes was assessed in several ER-positive and ER-negative breast cancer cell lines. Results: In primary breast tumors, HOXB13 expression correlated negatively, and IL17BR and CHDH expression correlated positively, with ER status, and all three genes exhibited an ER-dependent correlation pattern with HER2 status that differs from PR and PS2, two canonical estrogen-regulated genes. Results using breast cancer cell lines show that these genes are regulated by estradiol in an ER-dependent manner, and that this regulation is abrogated by tamoxifen. Conclusions: HOXB13, IL17BR, and CHDH are estrogen-regulated genes, but their pattern of correlation with known positive (ER, PR) and negative (HER2) predictors of tamoxifen response differs from canonical ER signature genes. These results provide a biological rationale for the prognostic utility of these three genes in early-stage ER-positive breast cancer and for their potential to predict anti-estrogen resistance.

Interaction between B lymphocytes and other cell types is mediated in part by the B-cell adhesion molecule CD22. Recent work has suggested one of the T-cell ligands of B cells to be CD45RO, an isoform of the receptor-linked phosphotyrosine phosphatase CD45. Here we demonstrate direct interaction between CD22 and several isoforms of CD45, including CD45RO, and propose that the interaction may participate in regulation of lymphocyte signaling. Cross-linking of CD3 and CD22 T-cell ligands with anti-CD3 antibody and soluble CD22 is shown to block anti-CD3-induced intracellular calcium increase and to inhibit tyrosine phosphorylation of phospholipase C gamma 1. These effects are consistent with those observed upon coligation of CD3 and CD45 with antibody, providing support to the possibility that ligand-mediated stimulation of CD45 may result in modulation of substrate phosphorylation and lymphocyte activation.

Abstract The CHEK2 ‐1100delC mutation is recurrent in the population and is a moderate risk factor for breast cancer. To identify additional CHEK2 mutations potentially contributing to breast cancer susceptibility, we sequenced 248 cases with early‐onset disease; functionally characterized new variants and conducted a population‐based case–control analysis to evaluate their contribution to breast cancer risk. We identified 1 additional null mutation and 5 missense variants in the germline of cancer patients. In vitro , the CHEK2 ‐H143Y variant resulted in gross protein destabilization, while others had variable suppression of in vitro kinase activity using BRCA1 as a substrate. The germline CHEK2 ‐1100delC mutation was present among 8/1,646 (0.5%) sporadic, 2/400 (0.5%) early‐onset and 3/302 (1%) familial breast cancer cases, but undetectable amongst 2,105 multiethnic controls, including 633 from the US. CHEK2‐positive breast cancer families also carried a deleterious BRCA1 mutation. 1100delC appears to be the only recurrent CHEK2 mutation associated with a potentially significant contribution to breast cancer risk in the general population. Another recurrent mutation with attenuated in vitro function, CHEK2 ‐P85L, is not associated with increased breast cancer susceptibility, but exhibits a striking difference in frequency across populations with different ancestral histories. These observations illustrate the importance of genotyping ethnically diverse groups when assessing the impact of low‐penetrance susceptibility alleles on population risk. Our findings highlight the notion that clinical testing for rare missense mutations within CHEK2 may have limited value in predicting breast cancer risk, but that testing for the 1100delC variant may be valuable in phenotypically‐ and geographically‐selected populations. © 2007 Wiley‐Liss, Inc.

Context: Human β-cell gene profiling is a powerful tool for understanding β-cell biology in normal and pathological conditions. Assessment is complicated when isolated islets are studied because of contamination by non-β-cells and the trauma of the isolation procedure.

In a genome-wide screen of 684 cancer cell lines, we identified homozygous intragenic microdeletions involving genes encoding components of the apical-basal cell polarity complexes. Among these, PARD3 is disrupted in cell lines and primary tumors from squamous carcinomas and glioblastomas. Reconstituting PARD3 expression in both cell types restores tight junctions and retards contact-dependent proliferation. Searching specifically for small intragenic microdeletions using high-resolution genomic arrays may be complementary to other genomic deletion screens and resequencing efforts in identifying new tumor suppressor genes.

NF-kappaB1 and Notch2 are both required for the development of marginal zone (MZ) B cells. Analysis of B lymphocyte development in mice that are doubly heterozygous at the Notch2 and NF-kappaB1 loci revealed synergism between Notch2 and NF-kappaB1 during MZ B cell development. Two known transcriptional targets of the Notch pathway, Hes-5 and Deltex-1, were found to be preferentially expressed in MZ B cells and regulated by NF-kappaB1. These studies provide in vivo evidence for a genetic interaction between the Notch and NF-kappaB pathways.

The progression from preinvasive lesion to invasive carcinoma is a critical step contributing to breast cancer lethality. We identified downregulation of milk fat globule-EGF factor 8 (MFG-E8) as a contributor to breast cancer progression using microarray analysis of laser capture microdissected (LCM) tissues. We first identified MFG-E8 downregulation in invasive lesions in transgenic mammary tumor models, which were confirmed in LCM-isolated human invasive ductal carcinomas compared with patient-matched normal tissues. In situ analyses of MFG-E8 expression in estrogen receptor (ER) positive cases confirmed its downregulation during breast cancer progression and small inhibitory MFG-E8 RNAs accelerated ER(+) breast cancer cell proliferation. MFG-E8 also decreased in erbB2(+) human cancers and erbB2 transgenic mice lacking MFG-E8 showed accelerated tumor formation. In contrast, MFG-E8 expression was present at high levels in triple-negative (ER(-), PgR(-), erbB2(-)) breast cancers, cell lines, and patient sera. Knockdown, chromatin immunoprecipitation, and reporter assays all showed that p63 regulates MFG-E8 expression, and MFG-E8 knockdowns sensitized triple-negative breast cancers to cisplatin treatment. Taken together, our results show that MFG-E8 is expressed in triple-negative breast cancers as a target gene of the p63 pathway, but may serve a suppressive function in ER(+) and erbB2(+) breast cancers. Its potential use as a serum biomarker that contributes to the pathogenesis of triple-negative breast cancers urges continued evaluation of its differential functions.

Precise proteomic profiling of limited levels of disease tissue represents an extremely challenging task. Here, we present an effective and reproducible microproteomic workflow for sample sizes of only 10,000 cells that integrates selective sample procurement via laser capture microdissection (LCM), sample clean-up and protein level fractionation using short-range SDS-PAGE, followed by ultrasensitive LC–MS/MS analysis using a 10 μm i.d. porous layer open tubular (PLOT) column. With 10,000 LCM captured mouse hepatocytes for method development and performance assessment, only 10% of the in-gel digest, equivalent to ∼1000 cells, was needed per LC–MS/MS analysis. The optimized workflow was applied to the differential proteomic analysis of 10,000 LCM collected primary and metastatic breast cancer cells from the same patient. More than 1100 proteins were identified from each injection with >1700 proteins identified from three LCM samples of 10,000 cells from the same patient (1123 with at least two unique peptides). Label free quantitation (spectral counting) was performed to identify differential protein expression between the primary and metastatic cell populations. Informatics analysis of the resulting data indicated that vesicular transport and extracellular remodeling processes were significantly altered between the two cell types. The ability to extract meaningful biological information from limited, but highly informative cell populations demonstrates the significant benefits of the described microproteomic workflow.

There is an unmet clinical need for biomarkers to identify breast cancer patients at an increased risk of developing brain metastases. The objective is to identify gene signatures and biological pathways associated with human epidermal growth factor receptor 2-positive (HER2+) brain metastasis.We combined laser capture microdissection and gene expression microarrays to analyze malignant epithelium from HER2+ breast cancer brain metastases with that from HER2+ nonmetastatic primary tumors. Differential gene expression was performed including gene set enrichment analysis (GSEA) using publicly available breast cancer gene expression data sets.In a cohort of HER2+ breast cancer brain metastases, we identified a gene expression signature that anti-correlates with overexpression of BRCA1. Sequence analysis of the HER2+ brain metastases revealed no pathogenic mutations of BRCA1, and therefore the aforementioned signature was designated BRCA1 Deficient-Like (BD-L). Evaluation of an independent cohort of breast cancer metastases demonstrated that BD-L values are significantly higher in brain metastases as compared to other metastatic sites. Although the BD-L signature is present in all subtypes of breast cancer, it is significantly higher in BRCA1 mutant primary tumors as compared with sporadic breast tumors. Additionally, BD-L signature values are significantly higher in HER2-/ER- primary tumors as compared with HER2+/ER + and HER2-/ER + tumors. The BD-L signature correlates with breast cancer cell line pharmacologic response to a combination of poly (ADP-ribose) polymerase (PARP) inhibitor and temozolomide, and the signature outperformed four published gene signatures of BRCA1/2 deficiency.A BD-L signature is enriched in HER2+ breast cancer brain metastases without pathogenic BRCA1 mutations. Unexpectedly, elevated BD-L values are found in a subset of primary tumors across all breast cancer subtypes. Evaluation of pharmacological sensitivity in breast cancer cell lines representing all breast cancer subtypes suggests the BD-L signature may serve as a biomarker to identify sporadic breast cancer patients who might benefit from a therapeutic combination of PARP inhibitor and temozolomide and may be indicative of a dysfunctional BRCA1-associated pathway.

Tumour-stromal interactions are a determining factor in cancer progression. In vivo, the interaction interface is associated with spatially resolved distributions of cancer and stromal phenotypes. Here, we establish a micropatterned tumour-stromal assay (μTSA) with laser capture microdissection to control the location of co-cultured cells and analyse bulk and interfacial tumour-stromal signalling in driving cancer progression. μTSA reveals a spatial distribution of phenotypes in concordance with human oestrogen receptor-positive (ER+) breast cancer samples, and heterogeneous drug activity relative to the tumour-stroma interface. Specifically, an unknown mechanism of reversine is shown in targeting tumour-stromal interfacial interactions using ER+ MCF-7 breast cancer and bone marrow-derived stromal cells. Reversine suppresses MCF-7 tumour growth and bone metastasis in vivo by reducing tumour stromalization including collagen deposition and recruitment of activated stromal cells. This study advocates μTSA as a platform for studying tumour microenvironmental interactions and cancer field effects with applications in drug discovery and development.

Biomarkers that can be used to accurately assess the residual risk of disease recurrence in women with hormone receptor-positive breast cancer are clinically valuable. We evaluated the prognostic value of the Breast Cancer Index (BCI), a continuous risk index based on a combination of HOXB13:IL17BR and molecular grade index, in women with early breast cancer treated with either tamoxifen alone or tamoxifen plus octreotide in the NCIC MA.14 phase III clinical trial (ClinicalTrials.gov Identifier NCT00002864; registered 1 November 1999).Gene expression analysis of BCI by real-time polymerase chain reaction was performed blinded to outcome on RNA extracted from archived formalin-fixed, paraffin-embedded tumor samples of 299 patients with both lymph node-negative (LN-) and lymph node-positive (LN+) disease enrolled in the MA.14 trial. Our primary objective was to determine the prognostic performance of BCI based on relapse-free survival (RFS). MA.14 patients experienced similar RFS on both treatment arms. Association of gene expression data with RFS was evaluated in univariate analysis with a stratified log-rank test statistic, depicted with a Kaplan-Meier plot and an adjusted Cox survivor plot. In the multivariate assessment, we used stratified Cox regression. The prognostic performance of an emerging, optimized linear BCI model was also assessed in a post hoc analysis.Of 299 samples, 292 were assessed successfully for BCI for 146 patients accrued in each MA.14 treatment arm. BCI risk groups had a significant univariate association with RFS (stratified log-rank p = 0.005, unstratified log-rank p = 0.007). Adjusted 10-year RFS in BCI low-, intermediate-, and high-risk groups was 87.5 %, 83.9 %, and 74.7 %, respectively. BCI had a significant prognostic effect [hazard ratio (HR) 2.34, 95 % confidence interval (CI) 1.33-4.11; p = 0.004], although not a predictive effect, on RFS in stratified multivariate analysis, adjusted for pathological tumor stage (HR 2.22, 95 % CI 1.22-4.07; p = 0.01). In the post hoc multivariate analysis, higher linear BCI was associated with shorter RFS (p = 0.002).BCI had a strong prognostic effect on RFS in patients with early-stage breast cancer treated with tamoxifen alone or with tamoxifen and octreotide. BCI was prognostic in both LN- and LN+ patients. This retrospective study is an independent validation of the prognostic performance of BCI in a prospective trial.

The vacuolar (H + )-ATPases (V-ATPases) are a family of ATP-driven proton pumps that acidify intracellular compartments and transport protons across the plasma membrane.Previous work has demonstrated that plasma membrane V-ATPases are important for breast cancer invasion in vitro and that the V-ATPase subunit a isoform a3 is upregulated in and critical for MDA-MB231 and MCF10CA1a breast cancer cell invasion.It has been proposed that subunit a3 is present on the plasma membrane of invasive breast cancer cells and is overexpressed in human breast cancer.To test this, we used an a3-specific antibody to assess localization in breast cancer cells.Subunit a3 localizes to the leading edge of migrating breast cancer cells, but not the plasma membrane of normal breast epithelial cells.Furthermore, invasive breast cancer cells express a3 throughout all intracellular compartments tested, including endosomes, the Golgi, and lysosomes.Moreover, subunit a3 knockdown in MB231 breast cancer cells reduces in vitro migration.This reduction is not enhanced upon addition of a V-ATPase inhibitor, suggesting that a3-containing V-ATPases are critical for breast cancer migration.Finally, we have tested a3 expression in human breast cancer tissue and mRNA prepared from normal and cancerous breast tissue.a3 mRNA was upregulated 2.5-47 fold in all breast tumor cDNA samples tested relative to normal tissue, with expression generally correlated to cancer stage.Furthermore, a3 protein expression was increased in invasive breast cancer tissue relative to noninvasive cancer and normal breast tissue.These studies suggest that subunit a3 plays an important role in invasive human breast cancer.

The link between carcinogen exposure and cancer immunogenicity is unclear. Single exposure to 12-dimethylbenz[a]anthracene (DMBA) at puberty accelerated spontaneous breast carcinogenesis in mouse mammary tumor virus-polyoma middle tumor-antigen transgenic (MMTV-PyMTtg or PyMT) and MMTV-Her2/neutg (Her2) mice. Paradoxically, DMBA-treated PyMT and Her2 animals were protected from metastasis. CD8+ T cells significantly infiltrated DMBA-exposed breast cancers. CD8+ T cell depletion resulted in severe lung and liver metastasis in DMBA-treated PyMT mice. Besides increasing tumor mutational burden, DMBA exposure up-regulated Chemokine (C-C motif) ligand 21 (CCL21) in cancer cells and heightened antigen presentation. CCL21 injection suppressed breast cancer growth, and CCL21 receptor deletion attenuated T cell immunity against cancer metastasis in DMBA-treated PyMT animals. CCL21 expression correlated with increased mutational burden and cytolytic activity across human cancers. Higher CCL21 levels correlated with increased CD8+ T cell infiltrates in human breast cancer and predicted lower breast cancer distant recurrence rate. Collectively, carcinogen exposure induces immune-activating factors within cancer cells that promote CD8+ T cell immunity against metastasis.

Abstract Cell migration and invasion are two critical cellular processes that are often deregulated during tumorigenesis. To identify factors that contribute to oncogenic progression by stimulating cell migration, we conducted a powerful retroviral based migration screen using an MCF7 cDNA library and the immortalized human breast epithelial cell line MCF-10A. We identified prostate derived Ets factor (PDEF), an Ets transcription factor that is overexpressed in both prostate and breast carcinoma, as a candidate promigratory gene from this screen. Whereas PDEF induced limited motility of MCF-10A cells, coexpression of PDEF with the receptor tyrosine kinases (RTK) ErbB2 and colony-stimulating factor receptor (CSF-1R)/CSF-1 significantly enhanced MCF-10A motility. Furthermore, cells coexpressing PDEF with either ErbB2 or CSF-1R/CSF-1 induced a dramatic invasive phenotype in three-dimensional cultures. Constitutive activation of the extracellular signal–regulated kinase (ERK) pathway also enhanced PDEF-induced motility and invasion, suggesting that activation of the ERK/mitogen-activated protein kinase by ErbB2 and CSF-1R/CSF-1 can cooperate with PDEF to promote motility and invasion. Furthermore, PDEF promoted anchorage-independent growth of ErbB2 and CSF-1R/CSF-1–expressing cells. Using laser capture microdissection, we also found that PDEF mRNA is overexpressed in breast tumor epithelia throughout tumor progression. Taken together, these findings suggest that the transcription factor PDEF may play an important role in breast tumorigenesis and that PDEF overexpression may be particularly significant in tumors that exhibit activation of oncogenic RTKs such as ErbB2 and CSF-1R. (Cancer Res 2005; 65(24): 11572-80)

Abstract Tumors can become lethal when they progress from preinvasive lesions to invasive carcinomas. Here, we identify candidate tumor progression genes using gene array analysis of preinvasive and invasive tumors from mice, which were then evaluated in human cancers. Immediate early response protein IEX-1, small stress protein 1 (HSPB8), and tumor necrosis factor-associated factor–interacting protein mRNAs displayed higher expression levels in invasive lesions than in preinvasive lesions using samples obtained by laser capture microdissection (LCM) from transgenic erbB2, ras, and cyclin D1 mice. LCM-isolated tissues from patient-matched normal, ductal carcinoma in situ, and invasive ductal carcinoma revealed similar increased expression in invasive human cancers compared with preinvasive and normal samples. These genes induced anchorage independence, increased cell proliferation, and protected against apoptosis, singly or in collaboration with erbB2. Surprisingly, they were all up-regulated by 17β-estradiol and cyclin D1, and cyclin D1 overexpression increased p300/CBP binding to their promoters, supporting the model that cyclin D1-estrogen receptor (ER) coactivator interactions may be important to its role in ER-positive breast cancer. Additionally, an irreversible dual kinase inhibitor of ErbB signaling inhibited expression of the same genes. The up-regulation of genes contributing to increased invasiveness of ER-positive cancers offers a novel explanation for the contribution of cyclin D1 to a worse prognosis in ER-positive cancers. As targets of estrogen, cyclin D1, and erbB2 signaling, these candidates offer insights into the nature of the second events involved in breast cancer progression, regulatory events contributing to invasion, and potential targets of combined inhibition of hormone and growth factor signaling pathways. (Cancer Res 2006; 66(24): 11649-58)

Abstract Context.—Correct diagnosis of the tissue origin of a metastatic cancer is the first step in disease management, but it is frequently difficult using standard pathologic methods. Microarray-based gene expression profiling has shown great promise as a new tool to address this challenge. Objective.—Adoption of microarray technologies in the clinic remains limited. We aimed to bridge this technological gap by developing a real-time quantitative polymerase chain reaction (RT-PCR) assay. Design.—We constructed a microarray database of 466 frozen and 112 formalin-fixed, paraffin-embedded (FFPE) samples of both primary and metastatic tumors, measuring expression of 22 000 genes. From the microarray database, we used a genetic algorithm to search for gene combinations optimal for multitumor classification. A 92-gene RT-PCR assay was then designed and used to generate a database for 481 frozen and 119 FFPE tumor samples. Results.—The microarray-based K-nearest neighbor classifier demonstrated 84% accuracy ...