Carl G. Maki

The levels of the tumor suppressor protein p53 are generally quite low in normal cells, due in part to its rapid turnover. Previous studies have implicated ubiquitin-dependent proteolysis in the turnover of wild-type p53 but have not established whether or not p53 is itself a substrate of the ubiquitin system. In this study, inhibitors of the 26S proteasome have been used to further explore the role of ubiquitin proteolysis in regulating p53 turnover. Increased levels of the tumor suppressor protein p53 were observed in normal cells, as well as in cells expressing the human papillomavirus 16 E6 oncoprotein, on exposure of the cells to proteasome inhibitors. Pulse-chase experiments indicated that the increased p53 levels resulted from stabilization of the protein. Furthermore, ubiquitin-p53 conjugates were detected in untreated as well as gamma-irradiated cells, indicating that ubiquitin-dependent proteolysis plays a role in the normal turnover of p53. Increased levels of the cyclin:cyclin-dependent kinase inhibitor p21, a downstream effector of p53 function, were also observed in proteasome inhibitor-treated cells, and this increase was due in part to an increase in p2l mRNA.

Levels of the tumor suppressor protein p53 are normally quite low due in part to its short half-life.p53 levels increase in cells exposed to DNA-damaging agents, such as radiation, and this increase is thought to be responsible for the radiation-induced G 1 cell cycle arrest or delay.The mechanisms by which radiation causes an increase in p53 are currently unknown.The purpose of this study was to compare the effects of gamma and UV radiation on the stability and ubiquitination of p53 in vivo.Ubiquitin-p53 conjugates could be detected in nonirradiated and gamma-irradiated cells but not in cells which were UV treated, despite the fact that both treatments resulted in the stabilization of the p53 protein.These results demonstrate that UV and gamma radiation have different effects on ubiquitinated p53 and suggest that the UV-induced stabilization of p53 results from a loss of p53 ubiquitination.Ubiquitinated forms of p21, an inhibitor of cyclin-dependent kinases, were detected in vivo, demonstrating that p21 is also a target for degradation by the ubiquitin-dependent proteolytic pathway.However, UV and gamma radiation had no effect on the stability or in vivo ubiquitination of p21, indicating that the radiation effects on p53 are specific.

Wild-type p53 is a stress-responsive tumor suppressor and potent growth inhibitor. Genotoxic stresses (for example, ionizing and ultraviolet radiation or chemotherapeutic drug treatment) can activate p53, but also induce mutations in the P53 gene, and thus select for p53-mutated cells. Nutlin-3a (Nutlin) is pre-clinical drug that activates p53 in a non-genotoxic manner. Nutlin occupies the p53-binding pocket of murine double minute 2 (MDM2), activating p53 by blocking the p53–MDM2 interaction. Because Nutlin neither binds p53 directly nor introduces DNA damage, we hypothesized Nutlin would not induce P53 mutations, and, therefore, not select for p53-mutated cells. To test this, populations of SJSA-1 (p53 wild-type) cancer cells were expanded that survived repeated Nutlin exposures, and individual clones were isolated. Group 1 clones were resistant to Nutlin-induced apoptosis, but still underwent growth arrest. Surprisingly, while some Group 1 clones retained wild-type p53, others acquired a heterozygous p53 mutation. Apoptosis resistance in Group 1 clones was associated with decreased PUMA induction and decreased caspase 3/7 activation. Group 2 clones were resistant to both apoptosis and growth arrest induced by Nutlin. Group 2 clones had acquired mutations in the p53-DNA-binding domain and expressed only mutant p53s that were induced by Nutlin treatment, but were unable to bind the P21 and PUMA gene promoters, and unable to activate transcription. These results demonstrate that non-genotoxic p53 activation (for example, by Nutlin treatment) can lead to the acquisition of somatic mutations in p53 and select for p53-mutated cells. These findings have implications for the potential clinical use of Nutlin and other small molecule MDM2 antagonists.

Wild-type p53 is a conformationally labile protein that undergoes nuclear-cytoplasmic shuttling. MDM2-mediated ubiquitination promotes p53 nuclear export by exposing or activating a nuclear export signal (NES) in the C terminus of p53. We observed that cancer-derived p53s with a mutant (primary antibody 1620-/pAb240+) conformation localized in the cytoplasm to a greater extent and displayed increased susceptibility to ubiquitination than p53s with a more wild-type (primary antibody 1620+/pAb240-) conformation. The cytoplasmic localization of mutant p53s required the C-terminal NES and an intact ubiquitination pathway. Mutant p53 ubiquitination occurred at lysines in both the DNA-binding domain (DBD) and C terminus. Interestingly, Lys to Arg mutations that inhibited ubiquitination restored nuclear localization to mutant p53 but had no apparent effect on p53 conformation. Further studies revealed that wild-type p53, like mutant p53, is ubiquitinated by MDM2 in both the DBD and C terminus and that ubiquitination in both regions contributes to its nuclear export. MDM2 binding can induce a conformational change in wild-type p53, but this conformational change is insufficient to promote p53 nuclear export in the absence of MDM2 ubiquitination activity. Taken together, these results support a stepwise model for mutant and wild-type p53 nuclear export. In this model, the conformational change induced by either the cancer-derived mutation or MDM2 binding precedes p53 ubiquitination. The addition of ubiquitin to DBD and C-terminal lysines then promotes nuclear export via the C-terminal NES. Wild-type p53 is a conformationally labile protein that undergoes nuclear-cytoplasmic shuttling. MDM2-mediated ubiquitination promotes p53 nuclear export by exposing or activating a nuclear export signal (NES) in the C terminus of p53. We observed that cancer-derived p53s with a mutant (primary antibody 1620-/pAb240+) conformation localized in the cytoplasm to a greater extent and displayed increased susceptibility to ubiquitination than p53s with a more wild-type (primary antibody 1620+/pAb240-) conformation. The cytoplasmic localization of mutant p53s required the C-terminal NES and an intact ubiquitination pathway. Mutant p53 ubiquitination occurred at lysines in both the DNA-binding domain (DBD) and C terminus. Interestingly, Lys to Arg mutations that inhibited ubiquitination restored nuclear localization to mutant p53 but had no apparent effect on p53 conformation. Further studies revealed that wild-type p53, like mutant p53, is ubiquitinated by MDM2 in both the DBD and C terminus and that ubiquitination in both regions contributes to its nuclear export. MDM2 binding can induce a conformational change in wild-type p53, but this conformational change is insufficient to promote p53 nuclear export in the absence of MDM2 ubiquitination activity. Taken together, these results support a stepwise model for mutant and wild-type p53 nuclear export. In this model, the conformational change induced by either the cancer-derived mutation or MDM2 binding precedes p53 ubiquitination. The addition of ubiquitin to DBD and C-terminal lysines then promotes nuclear export via the C-terminal NES. The tumor suppressor protein p53 is inactivated in the vast majority of human cancers, either through mutation, cytoplasmic sequestration, interaction with viral oncoproteins, or increased interactions with its negative regulator, MDM2 (1Vousden K.H. Lu X. Nat. Rev. Cancer. 2002; 2: 594-604Crossref PubMed Scopus (2694) Google Scholar). It is therefore important to determine how p53 is normally regulated and how this regulation is altered in cancer. Wild-type p53 is a short lived protein and is expressed at low levels in most normal cells (2Maki C.G. Howley P.M. Mol. Cell. Biol. 1997; 17: 355-363Crossref PubMed Scopus (298) Google Scholar, 3Maltzman W. Czyzyk L. Mol. Cell. Biol. 1984; 4: 1689-1694Crossref PubMed Scopus (813) Google Scholar). MDM2 is an E3 ubiquitin-protein ligase that can bind p53 and promote its rapid ubiquitin-mediated proteolysis (4Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3659) Google Scholar, 5Kubbutat M.H. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2814) Google Scholar). Importantly, MDM2 is the product of a p53-inducible gene, thus establishing a negative feedback loop in which p53 increases expression of its own inhibitor (6Momand J. Zambetti G.P. Olson D.C. George D. Levine A.J. Cell. 1992; 69: 1237-1245Abstract Full Text PDF PubMed Scopus (2776) Google Scholar, 7Oliner J.D. Kinzler K.W. Meltzer P.S. George D.L. Vogelstein B. Nature. 1992; 358: 80-83Crossref PubMed Scopus (1790) Google Scholar). The importance of MDM2 in regulating p53 has been revealed through genetic studies in which embryonic lethality in MDM2 knockout mice is rescued by simultaneous knock-out of p53 (8Montes de Oca Luna R. Wagner D.S. Lozano G. Nature. 1995; 378: 203-206Crossref PubMed Scopus (1196) Google Scholar). Recently, other ubiquitin-protein ligases have been identified that can also bind p53 and promote its degradation, including Pirh2, Cop1, and Chip (9Dornan D. Wertz I. Shimizu H. Arnott D. Frantz G.D. Dowd P. O'Rourke K. Koeppen H. Dixit V.M. Nature. 2004; 429: 86-92Crossref PubMed Scopus (585) Google Scholar, 10Esser C. Scheffner M. Hohfeld J. J. Biol. Chem. 2005; 280: 27443-27448Abstract Full Text Full Text PDF PubMed Scopus (218) Google Scholar, 11Leng R.P. Lin Y. Ma W. Wu H. Lemmers B. Chung S. Parant J.M. Lozano G. Hakem R. Benchimol S. Cell. 2003; 112: 779-791Abstract Full Text Full Text PDF PubMed Scopus (597) Google Scholar). At least some of these (PirH2 and Cop1) have been identified as p53-responsive gene products, similar to MDM2. The relative importance of these ligases and the context in which they may regulate p53 have not been fully clarified.MDM2, in addition to promoting p53 degradation, can also affect the localization of p53. Two nuclear export signals (NES) 3The abbreviations used are: NES, nuclear export signal; DBD, DNA-binding domain; DAPI, 4,6-diamidino-2-phenylindole; pAb, primary antibody; TEV, tobacco etch virus; HA, hemagglutinin; WT, wild type; DKO, double knockout; Ub, ubiquitin. 3The abbreviations used are: NES, nuclear export signal; DBD, DNA-binding domain; DAPI, 4,6-diamidino-2-phenylindole; pAb, primary antibody; TEV, tobacco etch virus; HA, hemagglutinin; WT, wild type; DKO, double knockout; Ub, ubiquitin. have been identified in p53, one located within the C-terminal oligomerization domain and the other located in the N terminus (12Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (601) Google Scholar, 13Zhang Y. Xiong Y. Science. 2001; 292: 1910-1915Crossref PubMed Scopus (310) Google Scholar). MDM2 promoted wild-type p53 nuclear export in cells transiently co-expressing both proteins (14Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 2: 569-573Crossref PubMed Scopus (296) Google Scholar, 15Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (285) Google Scholar). This effect required the C-terminal NES of p53 and was not observed with an MDM2 mutant that lacks its ability to promote p53 ubiquitination. It was also reported that mutation of the six C-terminal lysines in p53 inhibited its nuclear export by MDM2 (16Gu J. Nie L. Wiederschain D. Yuan Z.M. Mol. Cell. Biol. 2001; 21: 8533-8546Crossref PubMed Scopus (76) Google Scholar, 17Lohrum M.A. Woods D.B. Ludwig R.L. Balint E. Vousden K.H. Mol. Cell. Biol. 2001; 21: 8521-8532Crossref PubMed Scopus (194) Google Scholar). These findings supported a model in which MDM2-mediated ubiquitination of one or more lysines in the p53 C terminus promotes p53 nuclear export by exposing or activating the C-terminal NES. In this regard, it is worth noting studies in which wild-type p53 that is sequestered in the cytoplasm of breast, liver, and neuroblastoma cancer cell lines shuttled back into the nucleus upon treatment with either MDM2 antisense oligonucleotides, or the nuclear export inhibitor leptomycin-B (12Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (601) Google Scholar, 18Lu W. Pochampally R. Chen L. Traidej M. Wang Y. Chen J. Oncogene. 2000; 19: 232-240Crossref PubMed Scopus (69) Google Scholar, 19Rodriguez-Lopez A.M. Xenaki D. Eden T.O. Hickman J.A. Chresta C.M. Mol. Pharmacol. 2001; 59: 135-143Crossref PubMed Scopus (46) Google Scholar). These findings suggested cytoplasmic localization of p53 in these cancers is MDM2-dependent and results from excessive nuclear export.Over 50% of human cancers harbor missense mutations in the p53 gene (20Hollstein M. Sidransky D. Vogelstein B. Harris C.C. Science. 1991; 253: 49-53Crossref PubMed Scopus (7412) Google Scholar). These mutations are found almost exclusively in the DNA-binding domain (21Soussi T. Dehouche K. Beroud C. Hum. Mutat. 2000; 15: 105-113Crossref PubMed Scopus (246) Google Scholar, 22Olivier M. Eeles R. Hollstein M. Khan M.A. Harris C.C. Hainaut P. Hum. Mutat. 2002; 19: 607-614Crossref PubMed Scopus (1015) Google Scholar) and inhibit the ability of p53 to activate expression of its downstream target genes. Cancer-derived p53 mutations also affect the conformation and localization of p53 to varying extents. Changes in p53 conformation can be monitored by reactivity with conformation-specific antibodies that recognize p53 in either a wild-type (pAb1620) or mutant (pAb240) conformation (23Milner J. Cook A. Sheldon M. Oncogene. 1987; 1: 453-455PubMed Google Scholar, 24Gannon J.V. Greaves R. Iggo R. Lane D.P. EMBO J. 1990; 9: 1595-1602Crossref PubMed Scopus (936) Google Scholar). Notwithstanding changes in conformation, a number of other unique properties have been ascribed to mutant p53s that can distinguish them from the wild-type protein. Most obvious among these is the pronounced stability exhibited by mutant p53s. This stability may result from either association of mutant p53s with stabilizing complexes, some of which include Hsp90 (25Peng Y. Chen L. Li C. Lu W. Chen J. J. Biol. Chem. 2001; 276: 40583-40590Abstract Full Text Full Text PDF PubMed Scopus (138) Google Scholar), or from an inability of mutant p53s to activate expression of proteins like MDM2, PirH2, or Cop1 that could promote its degradation. Mutant p53s are also susceptible to various post-translational modifications to which wild-type p53 may be relatively resistant, such as ribosylation and ubiquitination (26Wesierska-Gadek J. Bugajska-Schretter A. Cerni C. J. Cell. Biochem. 1996; 62: 90-101Crossref PubMed Scopus (79) Google Scholar, 27Shimizu H. Saliba D. Wallace M. Finlan L. Langridge-Smith P.R. Hupp T.R. Biochem. J. 2006; 397: 355-367Crossref PubMed Scopus (28) Google Scholar). Finally, a number of oncogenic and growth-promoting properties have been ascribed to mutant p53. Included among these is the ability to inhibit the transcriptional activity of wild-type p53, and the p53 family members p73 and p63, in a dominant-negative fashion (28Koutsodontis G. Vasilaki E. Chou W.C. Papakosta P. Kardassis D. Biochem. J. 2005; 389: 443-455Crossref PubMed Scopus (61) Google Scholar). Such oncogenic properties may explain the selective retention of mutant p53s in cancer (29Irwin M.S. Kondo K. Marin M.C. Cheng L.S. Hahn W.C. Kaelin Jr., W.G. Cancer Cell. 2003; 3: 403-410Abstract Full Text Full Text PDF PubMed Scopus (360) Google Scholar, 30Irwin M.S. Cell Cycle. 2004; 3: 319-323Crossref PubMed Google Scholar).In this study, we observed that certain cancer-derived p53s with a mutant (pAb1620-/pAb240+) conformation localized in the cytoplasm and displayed an increased susceptibility to ubiquitination. The cytoplasmic localization of mutant p53s depended on the C-terminal NES and an intact ubiquitination pathway. Ubiquitination of mutant p53 occurred at lysines in the DBD and the C terminus. Interestingly, Lys to Arg mutations that inhibited ubiquitination also restored nuclear localization to mutant p53 but had no apparent effect on p53 conformation. These results suggested that conformational change could expose lysines in mutant p53 for ubiquitination, and ubiquitination of these lysines promotes nuclear export. Wild-type p53, like mutant p53, is ubiquitinated by MDM2 in both the DBD and C terminus, and ubiquitination in both regions contributes to its nuclear export. MDM2 binding induces a conformational change in wild-type p53, but this conformational change is insufficient to promote p53 nuclear export in the absence of MDM2 ubiquitination activity. Based on these results, we suggest a model in which MDM2-binding induces a conformational change in wild-type p53 that exposes lysines for ubiquitination. Ubiquitination, in turn, exposes the C-terminal NES for nuclear export.EXPERIMENTAL PROCEDURESCell Culture and Transfections—Saos-2 (p53-null) and U2OS (p53 wild-type) are osteosarcoma cell lines. p53/MDM2 double knock-out (DKO) mouse embryo fibroblasts were from Rudy Alarcon (Stanford University). These cells were maintained at 37 °C in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and 100 μg/ml penicillin and streptomycin. ts-20 cells were from Harvey Ozer (University of Medicine and Dentistry, New Jersey) and harbor a temperature-sensitive mutation in the E1 ubiquitin-activating enzyme system (31Chowdary D.R. Dermody J.J. Jha K.K. Ozer H.L. Mol. Cell. Biol. 1994; 14: 1997-2003Crossref PubMed Scopus (266) Google Scholar). ts-20 cells were maintained at 32 or 39 °C, as indicated in the text. Transfections were done using FuGENE 6 transfection reagent (Roche Applied Science) according to the manufacturer’s protocol when cells were ∼60% confluent. Briefly, cells were transfected with 0.5-1.0 μg of FLAG p53 DNA alone or with 1.0 μg of DNA encoding MDM2 and/or Myc-tagged ubiquitin (myc-Ub). Total DNA in each transfection was equalized by the addition of empty plasmid. 100 μl of serum and antibiotic-free Dulbecco’s modified Eagle’s medium were mixed with 3 μl of FuGENE 6, incubated at room temperature for 5 min, and then mixed with the appropriate DNAs. Following 30 min of incubation at room temperature, the mixture was added to cells to initiate transfection. Cell lysates were harvested 20-24 h later.Plasmid DNAs—FLAG-tagged wild-type p53 has been described previously (32Gu J. Chen D. Rosenblum J. Rubin R.M. Yuan Z.M. Mol. Cell. Biol. 2000; 20: 1243-1253Crossref PubMed Scopus (53) Google Scholar) and was from Zhi-min Yuan (Harvard School of Public Health). This DNA contains wild-type p53 sequences cloned into BamHI and XbaI sites downstream of the FLAG epitope. Myc-tagged ubiquitin DNA (33Ward C.L. Omura S. Kopito R.R. Cell. 1995; 83: 121-127Abstract Full Text PDF PubMed Scopus (1127) Google Scholar) was from Ron Kopito (Stanford University). DNAs encoding untagged p53 mutants V143A, R248W, and H179E were from Peter Howley (Harvard Medical School). DNAs encoding wild-type MDM2 and HA-tagged p53 C135Y were from Steve Grossman (University of Massachusetts Medical School). Untagged p53 mutant DNAs were amplified by PCR to contain a BamHI site at their N termini and an EcoRI site at their C termini and were then cloned into the BamHI and EcoRI sites downstream of the FLAG epitope. NES mutants of FLAG p53 C135Y and FLAG p53 V143A were generated using the QuikChange site-directed mutagenesis kit (Stratagene) with the following primer and its complement: 5′-GAGCTGAATGAGGCCGCAGAAGCCAAGGATGCCCAGGCTG-3′. Lysine to arginine mutants of FLAG p53 WT and FLAG p53 C135Y were also generated using the QuikChange mutagenesis kit using FLAG p53 (WT or C135Y) as the template and the following primers and their complements: for the K372R,K373R mutation, 5′-CAGCCACCTGAAGTCCAGAAGGGGTCAGTCTACCTCC-3′; for the K370R mutation, 5′-CACTCCAGCCACCTGAGGTCCAGAAGGGGTCAG-3′; for the K381R,K382R mutation, 5′-CTACCTCCCGCCATAGGAGGCTCATGTTCAAG-3′; for the K386R mutation, 5′-CTCATGTTCAGGACAGAAGG-3′; for the K357R mutation, 5′-GCCCAGGCTGGGAGGGAGCCAGGG-3′; for the K351R mutation, 5′-CCTTGGAACTCAGGGATGCCCAG-3′; for the K319R,K320R,K321R mutation, 5′-CCTCTCCCCAGCCAAGGAGGAGACCACTGGATGGAG-3′; for the K305R mutation, 5′-GGAGCACTAGGCGAGCACTG-3′; for the K292R,K293R mutation, 5′-CTCCGCAGGAGAGGGGAGCCTC-3′; for K164R mutation, 5′-GCCATCTACAGGCAGTCACAGC-3′; for the K139R mutation, 5′-CAACTGGCCAGGACCTGCCCTG-3′; for the K132R mutation, 5′-GCCCTCAACAGGATGTTTTACC-3′; for the K120R mutation, 5′-GGGACAGCCAGGTCTGTGACTTG-3′; for the K101R mutation, 5′-CCTTCCCAGAGAACCTACCAG-3′; and for the K24R mutation, 5′-GACCTATGGAGACTACTTCCTG-3′. p53-(Δ101-195) was generated by two-step PCR using the following primer and its complement: 5′-GTCCCTTCCCAGCGAGTGGAAGG-3′.DNAs Encoding TEV-cleavable p53—The TEV protease cleavage site is 7 amino acids long (ENLYFQG). p53 DNAs encoding a TEV protease cleavage site at different positions were generated by two-step PCR. To introduce the TEV site at position 364, the following two primers were used: 5′-GGGAGCAGGGCTGAGAATCTCTACTTCCAGGGACACTCCAGCCA-3′ and 5′-GTGGCTGGAGTGTCCCTGGAAGTAGAGATTCTCAGCCCTGCTCCC-3′. To introduce the TEV site at position 294, the following two primers were used: 5′-CGCAAGAAAGGGGAGAATCTCTACTTCCAGGGAGAGCCTCACCAC-3′ and 5′-GTGGTGAGGCTCTCCCTGGAAGTAGAGATTCTCCCCTTTCTTGCG-3′. To introduce the TEV site at position 290, the following two primers were used: 5′-GGAAGAGAATCTCTACTTCCAGGGACGCAAGAAAGGG-3′ and 5′-CCCTTTCTTGCGTCCCTGGAAGTAGAGATTCTCTTCC-3′. An HA tag was introduced to the C terminus of p53 (TEV 290) by PCR using a C-terminal primer that encodes the HA tag 5′-CGGAATTCCTCAAGCGTAATCTGGAACATCGTATGGGTACATGTCTGAGTCAGGCCCTTC-3′.Immunoprecipitations, Immunoblotting, and TEV Cleavage—To harvest cell lysates, cells were rinsed with 2 ml of phosphate-buffered saline and then scraped into 500 μl of lysis buffer (50 mm Tris, pH 7.5, 150 mm NaCl, 0.5% Nonidet P-40, phenylmethylsulfonyl fluoride, leupeptin) and transferred to microcentrifuge tubes. The cells were then incubated on ice for 30 min with occasional vortexing and spun at 4 °C at 14,000 rpm in a microcentrifuge. For immunoprecipitations, the resulting supernatant was mixed for 1 h with 30 μl of protein A-agarose beads to pre-clear the lysate. The supernatant from this pre-clear was immunoprecipitated for 12-15 h at 4 °C with 2 μl of anti-FLAG polyclonal antibody (F-7145, Sigma) or 1.75 μl of p53 wild-type conformation-specific antibody (pAb1620, Ab-5, Calbiochem) or mutant conformation-specific antibody (pAb240, Ab-3, Calbiochem). Immunoprecipitations were incubated with 30 μl of protein A-agarose beads for 1 h, and the beads were isolated by centrifugation for 10 s at 13,000 rpm. For direct immunoblot analysis without TEV cleavage, the beads were washed twice with 1 ml of ice-cold lysis buffer and boiled for 10 min. For TEV cleavage, the beads were washed twice with 1 ml of ice-cold phosphate-buffered saline and once with ice-cold TEV buffer (50 mm Tris, pH 7.5, 0.5 mm EDTA, 1 mm dithiothreitol). The beads were then resuspended in 25 μl of TEV buffer, and 1 μl of TEV protease was added. The beads were rotated in the presence of TEV protease for 3 h at room temperature, and the beads were pelleted by centrifugation for 10 s at 13,000 rpm. The supernatant contained the TEV cleavage products and was boiled for 10 min. Products were resolved by SDS-PAGE and transferred to polyvinylidene difluoride membranes for immunoblotting. Antibodies used in immunoblotting to detect p53 included the sheep polyclonal antibody Ab-7 (Oncogene Science), monoclonal p53 antibody 1801 (Oncogene Science), and the FLAG monoclonal antibody Ab-5 (Sigma). MDM2 antibody was SMP-14 (Santa Cruz Biotechnology).Immunofluorescence—Immunofluorescence staining was carried out as described previously (34Inoue T. Stuart J. Leno R. Maki C.G. J. Biol. Chem. 2002; 277: 15053-15060Abstract Full Text Full Text PDF PubMed Scopus (46) Google Scholar). Briefly, cells were transfected on glass coverslips in 6-well dishes. Cells were fixed 20-24 h later by incubation in 4% paraformaldehyde for 45 min. Cells were blocked by two 5-min incubations in the presence of 1% bovine serum albumin, 0.1% Triton X-100. FLAG p53s were detected with the anti-FLAG p53 polyclonal antibody F-7145 (Sigma) as the primary antibody, and with rhodamine-conjugated anti-rabbit antibody (The Jackson Laboratory) as the secondary antibody. DNA was stained with DAPI. Cells were visualized using a fluorescence microscope. Merged images showing FLAG p53 localization, and DNA stainings were obtained. The staining pattern for p53 was scored for 100-150 cells in two or three separate experiments.RESULTSMutant p53s Are Cytoplasmic and Dependent on Their C-terminal NES and an Intact Ubiquitination Pathway—Cancer-associated mutations in p53 occur almost exclusively in the DNA-binding domain (DBD) and alter the conformation and localization of p53 to varying extents. p53 conformation can be monitored by assessing reactivity with the conformation-specific antibodies pAb1620 (wild-type specific) and pAb240 (mutant specific) (23Milner J. Cook A. Sheldon M. Oncogene. 1987; 1: 453-455PubMed Google Scholar, 24Gannon J.V. Greaves R. Iggo R. Lane D.P. EMBO J. 1990; 9: 1595-1602Crossref PubMed Scopus (936) Google Scholar). In our first experiment, Saos-2 cells (p53 null) were transfected with DNAs encoding FLAG-tagged p53 that was either wild-type or harbored different cancer-associated mutations. Transfected cell lysates were then immunoprecipitated with wild-type (pAb1620) or mutant (pAb240) antibodies, followed by immunoblotting for p53. The relative amount of p53 immunoprecipitated by the wild-type or mutant-specific antibodies is an indication of p53 conformation. As shown in Fig. 1C, wild-type (WT) p53 and p53 R248W displayed a mostly wild-type conformation, and p53 C135Y, H179E, and V143A were all mostly mutant in their conformation. Next, we monitored localization of the different p53 proteins by immunofluorescence staining. As shown in Fig. 1, A and B, wild-type p53 and p53 R248W displayed a mostly nuclear localization, whereas p53 C135Y, V143A, and H179E localized throughout the nucleus and cytoplasm in most cells in which they were expressed. These results support a correlation between the conformation and localization of p53. Specifically, p53s with a mostly mutant conformation (such as V143A, C135Y, and H179E) localize in the cytoplasm to a greater extent than p53s with a more wild-type conformation (such as R248W).Wild-type p53 contains an NES in its C terminus that is required for MDM2-dependent nuclear export (14Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 2: 569-573Crossref PubMed Scopus (296) Google Scholar, 15Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (285) Google Scholar). We reasoned that if cytoplasmic localization of cancer-derived p53 mutants involves nuclear export, then mutation of this NES would cause the mutants to assume a more nuclear localization. To test this, we mutated the C-terminal NES in p53 C135Y and p53 V143A and monitored their localization in transfected cells. As shown in Fig. 2, A and B, nonmutated p53 C135Y and p53 V143A displayed largely cytoplasmic localizations, whereas the p53 C135Y NES and p53 V143A NES mutants were re-localized almost completely to the nucleus. This indicates that cytoplasmic localization of these mutants requires an intact NES in the p53 C terminus. Importantly, the NES mutations had no apparent effect on conformation of p53 C135Y and p53 V143A, at least to the extent the wild-type and mutant-specific antibodies can recognize changes in p53 conformation (Fig. 2C). This suggests that nuclear accumulation of the NES mutants was not due to a change in their conformation. In total, these results suggest cytoplasmic localization of mutant p53s involves nuclear export via the p53 C-terminal NES. It should also be noted that the NES mutant of p53 C135Y was still ubiquitinated in cells when co-expressed with myc-Ub (Fig. 4B), indicating the nuclear accumulation of p53 C135Y NES was not due to an inability to be ubiquitinated.FIGURE 2Cytoplasmic localization of mutant p53s requires an intact NES in the C terminus. A, U2OS cells were transfected with DNAs encoding the indicated FLAG-tagged p53s. p53 localization was monitored by immunofluorescence staining with an anti-FLAG antibody (red) and DNA was visualized by DAPI staining (blue). Merged and representative pictures are shown. B, localization of the indicated p53 proteins was scored as either nuclear only or mostly nuclear (N, N > C) or nuclear equal to cytoplasmic or mostly cytoplasmic (N = C, C > N). The graph shows the percent cells with the indicated p53 localization (± S.E.). C, conformation of p53 C135Y, p53 C135Y NES, p53 V143A, and p53 V143A NES was monitored in transfected cell lysates by immunoprecipitation with p53 wild-type (w) and mutant (m) conformation-specific antibodies, followed by immunoblotting with a FLAG monoclonal antibody. The upper band indicated by the arrow is the FLAG-tagged p53 protein. Ab indicates detection of the antibody heavy chain used in the immunoprecipitation.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 4Cancer-derived p53 mutants display increased susceptibility to ubiquitination. A, U2OS cells were transfected with DNA encoding the indicated FLAG p53 alone, or with DNA encoding myc-Ub (1 μg each). Lysates were examined by immunoblotting with an anti-FLAG antibody. The position of nonubiquitinated p53 is indicated. Arrows (right) indicate ubiquitin-modified forms of mutant p53s that were evident with myc-Ub co-expression. B, cells were transfected with DNAs encoding p53 C135Y, p53 C135Y Δ42N, or p53 C135Y NES DNA either alone or with myc-Ub DNA. Lysates were immunoprecipitated (IP) with an anti-Myc antibody, followed by immunoblotting (IB) with a FLAG monoclonal antibody. The ladder of bands are ubiquitin-modified forms of each p53 C135Y protein. C, p53/MDM2 DKO cells were transfected with DNA encoding FLAG p53 C135Y and myc-Ub, as indicated. Lysates were immunoprecipitated with a FLAG polyclonal antibody, followed by immunoblotting with a FLAG monoclonal antibody. The arrows indicate ubiquitin-modified p53 C135Y.View Large Image Figure ViewerDownload Hi-res image Download (PPT)MDM2-dependent nuclear export of wild-type p53 requires an intact ubiquitination pathway. Support for this comes from studies in which p53 nuclear export by MDM2 was inhibited at the nonpermissive temperature in ts-20 cells (15Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (285) Google Scholar), which harbor a temperature-sensitive mutation in the ubiquitin-activating enzyme. These cells maintain ubiquitination activity at 32 °C but lose ubiquitination activity at 39 °C (35Zeng G.C. Donegan J. Ozer H.L. Hand R. Mol. Cell. Biol. 1984; 4: 1815-1822Crossref PubMed Scopus (16) Google Scholar). To test whether an intact ubiquitination system is required for mutant p53 nuclear export, we monitored p53 C135Y localization in ts-20 cells at 32 °C and nonpermissive 39 °C. We also monitored wild-type p53 nuclear export at both temperatures as a control for the experiment. As shown in Fig. 3A, wild-type p53 was mostly nuclear when expressed alone, but re-localized to the cytoplasm (was exported) when co-expressed with MDM2 in ts-20 cells that were maintained at 32 °C. In contrast, wild-type p53 remained largely nuclear when expressed alone or with MDM2 in ts-20 cells that were grown at 39 °C to inhibit ubiquitination activity. This is consistent with previous findings that ubiquitination activity is required for MDM2 to promote p53 nuclear export (15Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (285) Google Scholar). Mutant p53 (C135Y) was mostly cytoplasmic in ts-20 cells at 32 °C, but it accumulated in the nucleus in ts-20 cells at 39 °C (Fig. 3B). This indicates that nuclear export of mutant p53 (C135Y) also depends, at least in part, on an intact ubiquitination pathway. p53 C135Y displayed a mostly cytoplasmic localization at both 32 and 39 °C in U2OS cells, indicating that nuclear accumulation of p53 C135Y at 39 °C is only seen in cells (ts-20) where ubiquitination activity can be inhibited at elevated temperature.FIGURE 3Nuclear export of mutant p53s requires an intact ubiquitination system. A, ts-20 cells were grown at 37 °C and transfected with DNAs encoding FLAG-tagged WT p53 and MDM2 (1 μg each). 3-4 h after transfection, the cells were switched to either 32 or 39 °C for 20 h. p53 localization was monitored by immunofluorescence staining in cells in which it was co-expressed with MDM2, and p53 localization was scored. The graph shows the percent cells with the indicated p53 localization. Average results from two separate experiments are shown. MDM2 displayed a nuclear only localization in the majority of cells. Cells in which MDM2 was not completely nuclear were excluded from the analysis. B, ts-20 cells and U2OS cells were transfected with DNA encoding FLAG-tagged p53 C135Y (1 μg). The cells were then either maintained at 32 °C or shifted to 39 °C for 20 h. p53 C135Y localization was monitored by immunofluorescence staining with an anti-FLAG polyclonal antibody, and p53 C135Y localization was scored. The graph shows the percent cells with the indicated p53 C135Y localization. Average results from two separate experiments are shown.View Large

Restoring p53 activity by inhibiting the interaction between p53 and MDM2 represents an attractive approach for cancer therapy. To this end, a number of small-molecule p53-MDM2 binding inhibitors have been developed during the past several years. Nutlin-3 is a potent and selective small-molecule MDM2 antagonist that has shown considerable promise in pre-clinical studies. This review will highlight recent advances in the development of small-molecule MDM2 antagonists as potential cancer therapeutics, with special emphasis on Nutlin-3.

Wild-type p53 is degraded in part through the ubiquitin proteolysis pathway. Recent studies indicate that MDM2 can bind p53 and promote its rapid degradation although the molecular basis for this degradation has not been clarified. This report demonstrates that MDM2 can promote the ubiquitination of wild-type p53 and cancer-derived p53 mutants in transiently transfected cells. Deletion mutants that disrupted the oligomerization domain of p53 displayed low binding affinity for MDM2 and were poor substrates for ubiquitination. However, efficient MDM2 binding and ubiquitination were restored when an oligomerization-deficient p53 mutant was fused to the dimerization domain from another protein. These results indicate that oligomerization is required for p53 to efficiently bind and be ubiquitinated by MDM2. p53 ubiquitination was inhibited in cells exposed to UV radiation, and this inhibition coincided with a decrease in MDM2 protein levels and p53·MDM2 complex formation. In contrast, p53 dimerization was unaffected following UV treatment. These results suggest that UV radiation may stabilize p53 by blocking the ubiquitination and degradation of p53 mediated by MDM2. Wild-type p53 is degraded in part through the ubiquitin proteolysis pathway. Recent studies indicate that MDM2 can bind p53 and promote its rapid degradation although the molecular basis for this degradation has not been clarified. This report demonstrates that MDM2 can promote the ubiquitination of wild-type p53 and cancer-derived p53 mutants in transiently transfected cells. Deletion mutants that disrupted the oligomerization domain of p53 displayed low binding affinity for MDM2 and were poor substrates for ubiquitination. However, efficient MDM2 binding and ubiquitination were restored when an oligomerization-deficient p53 mutant was fused to the dimerization domain from another protein. These results indicate that oligomerization is required for p53 to efficiently bind and be ubiquitinated by MDM2. p53 ubiquitination was inhibited in cells exposed to UV radiation, and this inhibition coincided with a decrease in MDM2 protein levels and p53·MDM2 complex formation. In contrast, p53 dimerization was unaffected following UV treatment. These results suggest that UV radiation may stabilize p53 by blocking the ubiquitination and degradation of p53 mediated by MDM2. Inactivation of p53 is considered an important step in the development of many human cancers. It is therefore important to determine how p53 levels are normally regulated and how this regulation is altered in cancer. The activity most associated with the tumor suppressor function of p53 is its ability to bind DNA and activate gene transcription (1Funk W. Pak D.T. Karas R.H. Wright W.E. Shay J.W. Mol. Cell. Biol. 1992; 12: 2866-2871Crossref PubMed Scopus (677) Google Scholar, 2Kern S.E. Pietenpol J.A. Thiagalingam S. Seymour A. Kinzler K.W. Vogelstein B. Science. 1992; 256: 827-830Crossref PubMed Scopus (889) Google Scholar, 3Pietenpol J.A. Tokino T. Thiagalingam S. El-Deiry W.S. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1988-2002Crossref Scopus (382) Google Scholar). This activity increases in response to DNA damage because of stabilization of the p53 protein (4Maltzman W. Czyzyk L. Mol. Cell. Biol. 1984; 4: 1689-1694Crossref PubMed Scopus (815) Google Scholar, 5Maki C.G. Howley P.M. Mol. Cell. Biol. 1997; 17: 355-363Crossref PubMed Scopus (299) Google Scholar). The effect of increasing p53 is to stop cell proliferation, either through a G1-phase cell cycle arrest or apoptotic cell death (6Lane D.P. Nature. 1992; 358: 15-16Crossref PubMed Scopus (4487) Google Scholar, 7Levine A.J. Cell. 1997; 88: 323-331Abstract Full Text Full Text PDF PubMed Scopus (6727) Google Scholar). Current models suggest that p53 is part of a DNA damage checkpoint pathway that monitors the genome integrity and protects cells from accumulating genetic damage. p53 carries out this function by temporarily halting cell proliferation to allow DNA repair, or, in the case of irreparable damage, by inducing cell death through apoptosis. Two proteolytic pathways have been implicated in p53 degradation: the calpain proteolytic pathway (8Kubbutat M.H. Vousden K.H. Mol. Cell. Biol. 1997; 17: 460-468Crossref PubMed Scopus (275) Google Scholar, 9Pariat M. Carillo S. Molinari M. Salvat C. Debussche L. Bracco L. Milner J. Piechaczyk M. Mol. Cell. Biol. 1997; 17: 2806-2815Crossref PubMed Scopus (147) Google Scholar) and the ubiquitin proteolytic pathway (10Chowdary D.R. Bermody J.J. Jha K.K. Ozer H.L. Mol. Cell. Biol. 1994; 14: 1997-2003Crossref PubMed Scopus (266) Google Scholar, 11Maki C.G. Huibregtse J.M. Howley P.M. Cancer Res. 1996; 56: 2649-2654PubMed Google Scholar). The relative contribution of these two pathways to p53 turnover has not been clarified. The hallmark of the ubiquitin pathway is the covalent attachment of ubiquitin (an 8-kDa protein) to a substrate, which “marks” that substrate for degradation (reviewed in Ref. 12Hochstrasser M. Annu. Rev. Genet. 1996; 30: 405-439Crossref PubMed Scopus (1458) Google Scholar). Ubiquitin is first sequentially transferred through a series of ubiquitin system enzymes, designated E1, E2, and E3. The E3 enzyme then transfers the ubiquitin molecule to one or more lysine residues in the substrate (13Scheffner M. Nuber U. Huibregtse J.M. Nature. 1995; 373: 81-83Crossref PubMed Scopus (743) Google Scholar). Multiple ubiquitins are attached to one another to form ubiquitin chains, and the multi-ubiquitinated substrate is degraded by the 26 S proteasome. Proof that p53 is a ubiquitin-system target came with the demonstration of wild-type p53:ubiquitin conjugates in vivo (11Maki C.G. Huibregtse J.M. Howley P.M. Cancer Res. 1996; 56: 2649-2654PubMed Google Scholar). Factors that regulate and/or participate in p53 ubiquitination have not been fully characterized. Increasing evidence suggests that MDM2 can regulate p53 stability. MDM2 forms an autoregulatory feedback loop in which p53 activates MDM2 transcription, and increased levels of MDM2 protein then bind p53 and inhibit its transcriptional activity (14Momand J. Zambetti G.P. Olson D. George D. Levine A.J. Cell. 1992; 69: 1237-1245Abstract Full Text PDF PubMed Scopus (2787) Google Scholar, 15Oliner J.D. Kinzler K.W. Meltzer P.S. George D. Vogelstein B. Nature. 1992; 358: 80-83Crossref PubMed Scopus (1796) Google Scholar). DNA-damaging agents that stabilize p53 can promote p53 phosphorylation at serines 15 and 37 (16Shieh S.Y. Ikeda M. Taya Y. Prives C. Cell. 1997; 91: 325-334Abstract Full Text Full Text PDF PubMed Scopus (1752) Google Scholar). Interestingly, MDM2 was unable to inhibit the activity of p53 when p53 was phosphorylated at these sites. This could result if MDM2 is unable to bind p53 phosphorylated at Ser-15 and Ser-37. Other studies demonstrated that MDM2 can promote p53 degradation in transient transfection assays (17Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3705) Google Scholar, 18Kubbutat M.H.G. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2839) Google Scholar). Though the basis of this degradation was not clarified, Honda et al. (19Honda R. Tanaka H. Yasuda H. FEBS Lett. 1997; 420: 25-27Crossref PubMed Scopus (1597) Google Scholar) reported that MDM2 could promote p53 ubiquitination in vitro in the presence of E1 and E2 ubiquitin system enzymes. Further, MDM2 formed a thioester bond with ubiquitin, a characteristic of E1, E2, and E3 enzymes. Mutations in MDM2 that abrogated thioester bond formation also abrogated p53 ubiquitination, suggesting that MDM2 functions as an E3 enzyme in p53 ubiquitination. Taken together, these studies provide a provocative model for the regulation of p53 stability. According to this model, MDM2 binds p53 under normal conditions and promotes its ubiquitination and subsequent degradation by the proteasome. In response to DNA damage, p53 is phosphorylated at Ser-15 and Ser-37, preventing MDM2 binding and thus stabilizing p53. The stabilized p53 can then promote transcription of its downstream target genes, resulting in cell cycle arrest or apoptosis. This report demonstrates the presence of p53:ubiquitin conjugates in cells transiently transfected with p53 expression DNAs. High levels of p53 ubiquitination were observed when cells were cotransfected with MDM2, providing evidence that MDM2 can promote p53 ubiquitinationin vivo. Deletion mutants that disrupted the oligomerization domain of p53 had low MDM2 binding affinity and were poor substrates for ubiquitination. However, efficient MDM2 binding and ubiquitination were restored when oligomerization-deficient p53 mutants were fused to a heterologous dimerization domain. Finally, p53 ubiquitination was inhibited in UV-irradiated cells, and this coincided with decreased MDM2 protein levels and p53·MDM2 complex formation. UV radiation may stabilize p53 by inhibiting the ubiquitination of p53 mediated by MDM2. Expression DNAs encoding wild-type p53, mutant p53s, and Myc-tagged ubiquitin were from Peter Howley (Harvard Medical School). HA-tagged p53 expression DNA was from Christine Jost (Dana Farber Cancer Institute). DNAs encoding p53-(1–363) and -(1–333) (20Pellegata N.S. Cajot J.-F. Stanbridge E.J. Oncogene. 1995; 11: 337-349PubMed Google Scholar) were from Eric Stanbridge (University of California-Irvine). DNAs encoding p53-(1–353) and p53–333CC (3Pietenpol J.A. Tokino T. Thiagalingam S. El-Deiry W.S. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1988-2002Crossref Scopus (382) Google Scholar) were from Jennifer Pietenpol (Vanderbilt University). Human MDM2 expression DNA was from Steve Grossman (Dana Farber Cancer Institute). Human osteosarcoma cell lines Saos-2 (p53-null) and U2OS (wild-type p53) were grown in Dulbecco's modified Eagle's media (DMEM) 1The abbreviations used are: DMEM, Dulbecco's modified Eagle's medium; RIPA, radioimmune precipitation buffer. supplemented with 10% fetal bovine serum and 100 μg/ml each of penicillin and streptomycin. Transfections were done using the calcium-phosphate method (5Maki C.G. Howley P.M. Mol. Cell. Biol. 1997; 17: 355-363Crossref PubMed Scopus (299) Google Scholar) in 60- or 100-mm dishes with cells approximately 80% confluent. For 60-mm dishes, 4–5 μg of each p53 plasmid was transfected with an equal quantity of MDM2 plasmid, and the final DNA amount was adjusted to 12–15 micrograms with herring sperm DNA. For 100-mm dishes, 10 μg of p53 plasmid was transfected with 10 μg of MDM2, and the final DNA amount was adjusted to 25 micrograms. Saos-2 cells were washed twice with DMEM minus serum 6–8 h after addition of the DNA precipitate and then refed with DMEM plus 10% fetal bovine serum. Cell extracts were prepared 30–36 h later. U2OS cells were washed and refed 16 h after addition of the DNA precipitate. Where indicated, U2OS cells were UV irradiated (5Maki C.G. Howley P.M. Mol. Cell. Biol. 1997; 17: 355-363Crossref PubMed Scopus (299) Google Scholar) and extracts prepared 3–7 h later. For detection of p53:ubiquitin conjugates, cells were rinsed with phosphate-buffered saline and scraped into 800-μl radioimmunoprecipitation buffer (RIPA) (2 mm Tris, pH 7.5, 5 mm EDTA, 150 mm NaCl, 1.0% Nonidet P-40, 1.0% deoxycholate, 0.025% SDS, 1 mm phenylmethylsulfonyl fluoride). Cells were then sonicated for 10 pulses at setting 5, 50% output, with a Branson 450 sonifier, and spun at 15,000 ×g for 15 min. One-twentieth (40 μl) of the resulting supernatant was examined directly by immunoblotting. p53 was immunoprecipitated from the remaining supernatant using the p53 antibody Ab-6 (Oncogene Science). For co-immunoprecipitation experiments, cells were rinsed with phosphate-buffered saline, scraped into 750 μl of lysis buffer (50 mm Tris, pH 7.5, 5 mm EDTA, 150 mm NaCl, 0.5% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride), and placed on ice for 30 min. Cells were then spun at 15,000 × g for 15 min, and the supernatant was immunoprecipitated with either the p53 antibody 1801 (Oncogene Science) or the anti-HA polyclonal antibody HA.11 (Babco). Immunoprecipitates from RIPA or lysis buffer were resolved by SDS-polyacrylamide gel electrophoresis and transferred to an Immobilon-P membrane. For detection of p53:ubiquitin conjugates, the membrane was autoclaved in water for 15 min prior to blocking with milk and probing with the p53 antibody Ab-6. MDM2 was detected in p53 immunoprecipitates using the MDM2 polyclonal antibody N-20 (Santa Cruz Biotechnology). MDM2 can promote p53 degradation in transfected cells (17Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3705) Google Scholar, 18Kubbutat M.H.G. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2839) Google Scholar). The purpose of this study was to determine the basis for this degradation and the amino acid determinants in p53 required for this effect. Saos-2 cells (p53 null) were transfected with expression DNAs encoding p53, MDM2, and myc-tagged ubiquitin. p53 was then immunoprecipitated and examined by immunoblotting with the p53 antibody Ab-6 (Fig. 1 A). A ladder of protein bands with molecular weights larger than p53 were recognized when p53 was coexpressed with MDM2. These bands ranged in size from ∼63 to 90 kDa, consistent with the addition of one to five ubiquitin moieties to p53. When Myc-tagged ubiquitin was coexpressed with p53 and MDM2, these bands shifted to a slightly larger molecular weight, consistent with the additional Myc-tag. To confirm these bands as p53:ubiquitin conjugates, cells were transfected with epitope-tagged p53 (HA-p53) and Myc-tagged ubiquitin. p53 was then immunoprecipitated with an anti-HA antibody and examined by immunoblotting for the myc epitope. The myc antibody recognized a ladder of bands in the immunoprecipitates, and these same bands were recognized by the p53 antibody Ab-6 (Fig. 1 B). These results prove that the ladder of bands is ubiquitinated p53 and thus prove that MDM2 can promote p53 ubiquitination. Cancer-derived p53 point mutants were also tested for MDM2-mediated ubiquitination (Fig. 2). The p53 mutants V143A and R248W were ubiquitinated to approximately equal levels when coexpressed with MDM2, while the R273H mutant was ubiquitinated to a much lesser extent. R273H ubiquitination could be seen on long gel exposures, but the extent of R273H ubiquitination was consistently lower than that of either V143A or R248W. This suggests that specific p53 mutations can affect the susceptibility of p53 to MDM2-mediated ubiquitination. The relative ability of each p53 mutant to bind MDM2 was assessed to determine whether the lower ubiquitination of R273H was because of a decreased ability to bind MDM2. This involved immunoprecipitation of mutant p53 from transfected cells, followed by immunoblotting for MDM2 (Fig. 3). Approximately equal levels of MDM2 were detected in V143A and R273H immunoprecipitates, while slightly lower MDM2 levels were detected in R248W immunoprecipitates. These results suggest that the decreased ubiquitination of R273H is not because of a decreased ability to bind MDM2.Figure 3MDM2 binding by mutant p53s. Saos-2 cells were transfected with the indicated p53 mutant alone, or cotransfected with MDM2, and cell lysates were prepared. A, p53 was immunoprecipitated with the p53 antibody 1801, and the immunoprecipitates were examined by immunoblotting with the MDM2 antibody N20. B, 50 micrograms of protein extract were examined without prior immunoprecipitation by immunoblotting for p53 and MDM2.View Large Image Figure ViewerDownload (PPT) Deletion analysis was used to identify p53 regions required for MDM2-mediated ubiquitination (Fig. 4). p53 contains four main functional domains (21Ko L.J. Prives C. Genes Dev. 1996; 10: 1054-1072Crossref PubMed Scopus (2288) Google Scholar). Amino acids 1–42 comprise the transcriptional activation domain, and it is this region that binds MDM2. Residues102–292 encode the sequence-specific DNA binding domain. p53 binds DNA as a tetramer, and oligomerization is mediated by residues 324–355. The carboxyl terminus of p53 (residues 367–393) binds DNA nonspecifically and can allosterically regulate DNA binding by the central region. p53 proteins lacking 30 (p53-(1–363)), 40 (p53-(1–353)), or 60 (p53-(1–333)) C-terminal amino acids were tested for MDM2-mediated ubiquitination. p53-(1–363) and p53-(1–353) maintain the oligomerization function of p53, while oligomerization is lost in p53-(1–333) (22Marston N.J. Jenkins J.R. Vousden K.H. Oncogene. 1995; 10: 1709-1715PubMed Google Scholar). All three deletion mutants maintain the major nuclear localization signal (NLSI, residues 316–325) of p53 (23Shaulsky G. Goldfinger N. Ben-Ze'ev A. Rotter V. Mol. Cell. Biol. 1990; 10: 6565-6577Crossref PubMed Scopus (292) Google Scholar). Wild-type p53 and the deletion mutants p53-(1–363) and p53-(1–353) were efficiently ubiquitinated by MDM2 (Fig. 4), indicating that sequences between 353 and 393 are not critical for ubiquitination. In contrast, ubiquitination was drastically reduced in p53-(1–333), indicating that sequences between 333 and 353 are required for efficient ubiquitination. There are three possible explanations for these results. First, deletion of residues 333 to 353 may have removed critical lysine residues that are sites of p53 ubiquitination. There is one lysine (position 351) between residues 333 and 353, and a p53 protein with this site mutated to isoleucine was efficiently ubiquitinated by MDM2 (not shown). Second, deletion of residues 333 to 353 may have abrogated MDM2 binding. Third, p53 oligomerization may be required for ubiquitination by MDM2, and deleting this function in p53-(1–333) may have thus prevented ubiquitination. Coimmunoprecipitation experiments were done to determine the relative ability of the p53 deletion mutants to bind MDM2 (Fig.5). High levels of MDM2 were detected in immunoprecipitates of wild-type p53, p53-(1–363), and p53-(1–353). In contrast, very low levels of MDM2 coimmunoprecipitated with p53-(1–333). These results establish a correlation between MDM2 binding and p53 ubiquitination and suggest that deletion of residues 333 to 353 abrogated p53 ubiquitination by diminishing the ability of p53 to bind MDM2. To determine whether oligomerization affected either p53 ubiquitination or p53·MDM2 binding, the effect of replacing the oligomerization domain of p53 with the dimerization domain from another protein was determined (Fig. 6). p53–333CC contains amino acids 1–333 of p53 fused to the dimerization domain from the yeast transcription factor GCN4 (3Pietenpol J.A. Tokino T. Thiagalingam S. El-Deiry W.S. Kinzler K.W. Vogelstein B. Proc. Natl. Acad. Sci. U. S. A. 1994; 91: 1988-2002Crossref Scopus (382) Google Scholar). As shown in Fig. 6 A, wild-type p53 and p53–333CC were efficiently ubiquitinated by MDM2, while p53-(1–333) was not. Further, MDM2 co-immunoprecipitated with wild-type p53 and p53–333CC to comparable levels but did not coimmunoprecipitate with p53-(1–333) (Fig. 6 B). These results indicate that a heterologous dimerization domain can restore MDM2 binding and MDM2-mediated ubiquitination to an oligomerization-deficient p53. This is consistent with the findings of Karen Vousden and co-workers (24Kubbutat M.H.G. Ludwig R.L. Ashcroft M. Vousden K.H. Mol. Cell. Biol. 1998; 18: 5690-5698Crossref PubMed Scopus (171) Google Scholar) who recently reported that p53 proteins with disrupted oligomerization function displayed decreased MDM2 binding affinity and lower susceptibility to MDM2-mediated degradation. We conclude that the ability to oligomerize is required for p53 to efficiently bind MDM2 and be targeted for ubiquitination. DNA-damaging agents stabilize p53 through an unknown mechanism. Given that p53 is targeted for ubiquitination by MDM2, one possibility is that MDM2-mediated ubiquitination of p53 is inhibited in DNA-damaged cells. To test this possibility, cells were transfected with p53 alone, or in combination with MDM2, and subsequently DNA-damaged by exposure to UV light. The effect of UV exposure on p53 ubiquitination, p53·MDM2 complex formation, and p53 dimerization was then assessed (Fig. 7). U2OS cells were used for these experiments because p53 could be ubiquitinated in these cells in the absence of MDM2 coexpression. p53 ubiquitination was inhibited in the transfected cells between 1 and 7 h after UV treatment (Fig.7 A). This decrease in ubiquitination coincided with decreased MDM2 protein levels, and a corresponding decrease in p53·MDM2 complexes (Fig. 7 B). The effect of UV radiation on p53 dimerization was also assessed. Cells were cotransfected with DNAs encoding epitope-tagged p53-(HA-p53) and nontagged p53 and subsequently were exposed to UV radiation. Lysates were immunoprecipitated with an anti-HA antibody, followed by immunoblot analysis for p53. The ability of HA-tagged p53 to immunoprecipitate nontagged p53 was used as a measure of p53 dimerization in UV-irradiated and nonirradiated cells. As shown in Fig. 7 C, HA-tagged p53 could dimerize nontagged p53 in transfected cells, and this dimerization was not diminished after UV exposure. These results indicate that the decrease in p53·MDM2 complex formation following UV treatment did not involve a decrease in the ability of p53 to homodimerize. The activity of wild-type p53 is regulated in large part through changes in protein stability. It is of interest therefore to identify cellular factors that regulate p53 turnover. The most compelling evidence that MDM2 normally regulates p53 levels comes from David Lane and colleagues (25Bottger V. Bottger A. Howard S.F. Picksley S.M. Chene P. Garcia-Echeverria C. Hochkeppel H.K. Lane D.P. Oncogene. 1996; 13: 2141-2147PubMed Google Scholar, 26Bottger A. Bottger V. Sparks A. Liu W.L. Howard S.F. Lane D.P. Curr. Biol. 1997; 7: 860-869Abstract Full Text Full Text PDF PubMed Scopus (353) Google Scholar). Phage-display was used in these studies to identify a 12-amino acid peptide that mimics the MDM2 binding site in p53 and blocks p53·MDM2 binding. When expressed in cells containing low p53 levels, this peptide caused an accumulation of p53, activation of p53-responsive genes, and a cell cycle arrest. In contrast, a mutant peptide unable to block p53·MDM2 binding had no effect. These results provided strong evidence that p53 levels and activity are normally regulated by MDM2 interaction. Other studies demonstrated that MDM2 can promote p53 degradation in transient transfection assays (17Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3705) Google Scholar, 18Kubbutat M.H.G. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2839) Google Scholar) although the basis of this degradation was not fully clarified. The current report demonstrates that MDM2 can promote the formation of p53:ubiquitin conjugates in vivo. These results are consistent with those of Honda et al. (19Honda R. Tanaka H. Yasuda H. FEBS Lett. 1997; 420: 25-27Crossref PubMed Scopus (1597) Google Scholar), which suggested that MDM2 functions as an E3 ubiquitin protein ligase in p53 ubiquitination. Cancer-derived p53 mutant proteins varied in their susceptibility to MDM2-mediated ubiquitination, with the V143A and R248W mutants being more prone to ubiquitination than the R273H mutant. This did not appear to result from a lower ability of R273H to bind MDM2, suggesting that factors other than MDM2 binding can affect p53 ubiquitination. One possibility is that these p53 mutants vary in their subcellular localization, and this accounts for their differences in ubiquitination. It has been suggested that p53 ubiquitination by MDM2 occurs in the nucleus (27Freedman D.A. Levine A.J. Mol. Cell. Biol. 1998; 18: 7288-7293Crossref PubMed Scopus (458) Google Scholar), and certain p53 mutants may be retained in the cytoplasm (28Martinez J. Georgoff I. Martinez J. Levine A.J. Genes Dev. 1991; 5: 151-159Crossref PubMed Scopus (493) Google Scholar) where they may not be ubiquitinated. The conformation of p53 might also affect its susceptibility to ubiquitination. It is worth noting that the V143A and R248W p53 mutants were more highly ubiquitinated than either wild-type p53 or R273H. Perhaps R273H adopts a more wild-type conformation than V143A or R248W and so is less susceptible to ubiquitination. Deletion analyses indicated that the C-terminal oligomerization domain of p53 was required for efficient MDM2 binding and ubiquitination. This is perhaps surprising given that the MDM2 binding site in p53 is located in the N terminus of p53 (29Chen J. Marechal V. Levine A.J. Mol. Cell. Biol. 1993; 13: 4107-4114Crossref PubMed Scopus (622) Google Scholar). Further, MDM2 can interact with peptides from the N terminus of p53, indicating that C-terminal sequences are not essential for the interaction to occur. Perhaps the MDM2 binding domain in p53 assumes a more complex tertiary structure when p53 is oligomerized, which enhances its affinity for MDM2. These results are consistent with those of Karen Vousden and her coworkers (24Kubbutat M.H.G. Ludwig R.L. Ashcroft M. Vousden K.H. Mol. Cell. Biol. 1998; 18: 5690-5698Crossref PubMed Scopus (171) Google Scholar) who recently demonstrated that p53 proteins with disrupted oligomerization function displayed decreased binding affinity for MDM2 and were less susceptible to MDM2-mediated degradation. p53 is stabilized in response to various DNA damaging agents, including ionizing radiation (5Maki C.G. Howley P.M. Mol. Cell. Biol. 1997; 17: 355-363Crossref PubMed Scopus (299) Google Scholar), UV radiation (5Maki C.G. Howley P.M. Mol. Cell. Biol. 1997; 17: 355-363Crossref PubMed Scopus (299) Google Scholar), actinomycin D (30Kessis T.D. Slebos R.J. Nelson W.G. Kastan M.B. Plunkett B.S. Han S.M. Lorincz A.T. Hedrick L. Cho K.R. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 3988-3992Crossref PubMed Scopus (505) Google Scholar), and cisplatin (31Perego P. Giarola M. Righetti S.C. Supino R. Caserini C. Delia D. Pierotti M.A. Miyashita T. Reed J.C. Zunino F. Cancer Res. 1996; 56: 556-562PubMed Google Scholar). The molecular basis of this stabilization is unknown. Two proteolytic pathways have been implicated in p53 degradation; the calpain proteolysis system (8Kubbutat M.H. Vousden K.H. Mol. Cell. Biol. 1997; 17: 460-468Crossref PubMed Scopus (275) Google Scholar, 9Pariat M. Carillo S. Molinari M. Salvat C. Debussche L. Bracco L. Milner J. Piechaczyk M. Mol. Cell. Biol. 1997; 17: 2806-2815Crossref PubMed Scopus (147) Google Scholar) and the ubiquitin proteolysis system (10Chowdary D.R. Bermody J.J. Jha K.K. Ozer H.L. Mol. Cell. Biol. 1994; 14: 1997-2003Crossref PubMed Scopus (266) Google Scholar, 11Maki C.G. Huibregtse J.M. Howley P.M. Cancer Res. 1996; 56: 2649-2654PubMed Google Scholar). Given that p53 is degraded through these two pathways, one possibility is that DNA damaging agents signal a repression of p53 degradation through the calpain system, the ubiquitin system, or both. This report demonstrates that p53 ubiquitination is inhibited in response to UV radiation. This inhibition coincided with decreased expression of MDM2, and a decrease in p53·MDM2 complexes. This suggests that UV radiation may stabilize p53, at least in part, by inhibiting MDM2 expression and thus blocking the ubiquitination and degradation of p53. DNA-damaging agents can promote p53 phosphorylation, and it has been suggested that this phosphorylation could stabilize p53 by blocking p53·MDM2 complex formation (16Shieh S.Y. Ikeda M. Taya Y. Prives C. Cell. 1997; 91: 325-334Abstract Full Text Full Text PDF PubMed Scopus (1752) Google Scholar). It remains possible that such post-translational modifications might also contribute to the UV-induced loss of p53 ubiquitination observed in the current report. Current models suggest that p53 functions in a pathway that monitors the DNA and protects cells from accumulating genetic damage. p53 carries out this function in response to DNA damage by temporarily halting cell proliferation to allow DNA repair or by eliminating the damaged cell through apoptosis (6Lane D.P. Nature. 1992; 358: 15-16Crossref PubMed Scopus (4487) Google Scholar, 7Levine A.J. Cell. 1997; 88: 323-331Abstract Full Text Full Text PDF PubMed Scopus (6727) Google Scholar). This model predicts that p53 inactivation would be necessary for cells to resume cycling following repair of the damaged DNA. In this regard, it is worth noting the studies of Perry et al. (32Perry M.E. Piette J. Zawadzki J.A. Harvey D. Levine A.J. Proc. Natl. Acad. Sci. U. S. A. 1993; 90: 11623-11627Crossref PubMed Scopus (241) Google Scholar) in which the kinetics of MDM2 and p53 induction were examined in UV-irradiated cells. Three important findings emerged: 1) the induction of MDM2 was delayed in UV-treated cells even though p53 levels rose almost immediately; 2) MDM2 induction was delayed for longer periods of time with increasingly larger UV doses; and 3) the time of MDM2 induction was correlated with the recovery of normal rates of DNA synthesis, presumably after DNA repair. Based on these results, it is reasonable to speculate that MDM2 expression may be inhibited in UV-irradiated cells to allow an accumulation of p53 and a subsequent cell cycle arrest and DNA repair. Once DNA repair is completed, the induction of MDM2 may then allow for p53 ubiquitination and degradation and for continued cell cycle progression. It will be of interest to determine whether MDM2 induction following UV radiation is coincident with repair of the UV-induced DNA lesions. This would suggest that MDM2-mediated ubiquitination and degradation of p53 is important for cells to resume cycling after DNA damage.

Wild-type p53 is stabilized and accumulates in the nucleus of DNA damaged cells. The effect of stabilizing p53 is to inhibit cell growth, either through a G1 cell cycle arrest or apoptotic cell death. MDM2 can inhibit p53 activity, in part, by promoting its rapid degradation through the ubiquitin proteolysis pathway. In the current study, MDM2-mediated degradation of p53 was partially inhibited in cells treated with leptomycin B (LMB), a specific inhibitor of nuclear export. In contrast, levels of ubiquitinated p53 increased in LMB-treated cells, indicating that nuclear export is not required for p53 ubiquitination. To investigate this further, p53 mutants were generated which localize to either the nucleus or cytoplasm, and their susceptibility to MDM2-mediated ubiquitination was assessed. p53 mutants that localized to either the nucleus or the cytoplasm were efficiently ubiquitinated, and their steady-state levels decreased, when coexpressed with MDM2. In addition, an MDM2-mutant that localized to the cytoplasm was able to ubiquitinate and degrade a p53 mutant which was similarly localized in the cytoplasm. Our results indicate that nuclear export is not required for p53 ubiquitination, and that p53 proteins that localize to either the nucleus or cytoplasm can be ubiquitinated and degraded by MDM2.

Acetyl-CoA synthetases ACSS1 and ACSS2 promote conversion of acetate to acetyl-CoA for use in lipid synthesis, protein acetylation, and energy production. These enzymes are elevated in some cancers and important for cell survival under hypoxia and nutrient stress. 4-hydroxytamoxifen (4-OHT) can induce metabolic changes that increase cancer cell survival. An effect of 4-OHT on expression of ACSS1 or ACSS2 has not been reported. We found ACSS1 and ACSS2 are increased by 4-OHT in estrogen receptor-α positive (ER+) breast cancer cells and 4-OHT resistant derivative cells. ERα knockdown blocked ACSS1 induction by 4-OHT but not ACSS2. 4-OHT also induced ACSS2 but not ACSS1 expression in triple negative breast cancer cells. Long-term estrogen deprivation (LTED) is a model for acquired resistance to aromatase inhibitors. We found LTED cells and tumors express elevated levels of ACSS1 and/or ACSS2 and are especially sensitive to viability loss caused by depletion of ACSS1 and ACSS2 or treatment with an ACSS2-specific inhibitor. ACSS2 inhibitor also increased toxicity in cells treated with 4-OHT. We conclude ACSS1 and ACSS2 are 4-OHT regulated factors important for breast cancer cell survival in 4-OHT-treated and long-term estrogen deprived cells.

Hypoxia, a result of DNA-damaging agents such as ionizing radiation, induces the nuclear accumulation of the p53 tumor suppressor protein. However, unlike the effect in ionizing radiation, hypoxia readily induces the nuclear accumulation of p53 in HPV E6-infected cells. In HPV-infected cells, a key regulator of p53 protein levels is the E6 oncoprotein. In association with the endogenous cellular protein E6-associated protein (E6AP), E6 can accelerate the degradation of p53 under aerobic conditions. To better define the mechanism of p53 induction in E6-infected cells by hypoxia, we studied the expression and association of E6 and E6AP with p53 in vivo. We found that hypoxia did not alter the protein levels of E6 or E6AP as compared with those found under aerobic growth conditions, indicating that protein inhibition of E6 or E6AP alone is not sufficient to explain the increased accumulation of p53 under hypoxic conditions. However, p53 did fail to coprecipitate with E6AP under hypoxia, indicating that hypoxia uncouples the interaction of p53 with E6 and E6AP. We also present evidence to indicate that hypoxia decreases the expression of the endogenous cellular regulator of p53 protein, the human MDM2 protein, resulting in an inhibition of p53 export from the nucleus to the cytoplasm for degradation. Taken together, these results suggest that the hypoxic induction of p53 is attributable to the down-regulation of MDM2 protein levels and uncoupling of p53 from its interaction with the E6/E6AP complex.

p53 Activity is controlled in large part by MDM2, an E3 ubiquitin ligase that binds p53 and promotes its degradation. The MDM2 antagonist Nutlin-3a stabilizes p53 by blocking its interaction with MDM2. Several studies have supported the potential use of Nutlin-3a in cancer therapy. Two different p53 wild-type cancer cell lines (U2OS and HCT116) treated with Nutlin-3a for 24 hours accumulated 2N and 4N DNA content, suggestive of G(1) and G(2) phase cell cycle arrest. This coincided with increased p53 and p21 expression, hypophosphorylation of pRb, and depletion of Cyclin B1, Cyclin A, and CDC2. Upon removal of Nutlin-3a, 4N cells entered S phase and re-replicated their DNA without an intervening mitotic division, a process known as endoreduplication. p53-p21 pathway activation was required for the depletion of Cyclin B1, Cyclin A, and CDC2 in Nutlin-3a-treated cells and for endoreduplication after Nutlin-3a removal. Stable tetraploid clones could be isolated from Nutlin-3a treated cells, and these tetraploid clones were more resistant to ionizing radiation and cisplatin-induced apoptosis than diploid counterparts. These data indicate that transient Nutlin-3a treatment of p53 wild-type cancer cells can promote endoreduplication and the generation of therapy-resistant tetraploid cells. These findings have important implications regarding the use of Nutlin-3a in cancer therapy

// Lei Duan 1 , Ricardo E. Perez 1 , Batzaya Davaadelger 1 , Elena N. Dedkova 2 , Lothar A. Blatter 2 and Carl G. Maki 1 1 Department of Anatomy and Cell Biology, Rush University Medical Center, Chicago IL, USA 2 Department of Molecular Biophysics and Physiology, Rush University Medical Center, Chicago, IL, USA Correspondence to: Carl G. Maki, email: // Keywords : p53, Nutlin-3a, glycolysis, autophagy Received : May 26, 2015 Accepted : August 07, 2015 Published : August 25, 2015 Abstract The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis.

The tumor suppressor protein PML and oncoprotein MDM2 have opposing effects on p53. PML stimulates p53 activity by recruiting it to nuclear foci termed PML nuclear bodies. In contrast, MDM2 inhibits p53 by promoting its degradation. To date, neither a physical nor functional relationship between PML and MDM2 has been described. In this study, we report an in vivo and in vitro interaction between PML and MDM2 which is independent of p53. Two separate regions of PML are recognized which can interact with MDM2. The C-terminal half of PML, encoded by residues 300–633, can interact with the central region of MDM2 which includes the MDM2 acidic domain. In addition, PML amino acids 1–200, which encode the RING-finger and most of the B box zinc binding motifs, can interact with the C-terminal, RING-finger containing region of MDM2. Interestingly, PML mutants in which sumoylation at lysine 160 was inhibited displayed an increased association with MDM2, suggesting that sumoylation at this site may be a determinant of PML-MDM2 binding. Coexpression with MDM2 caused a redistribution of PML from the nucleus to the cytoplasm, and this required the PML N terminus and the MDM2 RING-finger domain. These results suggest that interaction between the PML N terminus and MDM2 C terminus can promote PML nuclear exclusion. Wild-type MDM2 inhibited the ability of PML to stimulate the transcriptional activity of a GAL4-CBP fusion protein. This inhibition required the central, acidic region of MDM2, but did not require the MDM2 C terminus. Taken together, these studies demonstrate that MDM2 and PML can interact through at least two separate protein regions, and that these interactions can have specific effects on the activity and/or localization of PML. The tumor suppressor protein PML and oncoprotein MDM2 have opposing effects on p53. PML stimulates p53 activity by recruiting it to nuclear foci termed PML nuclear bodies. In contrast, MDM2 inhibits p53 by promoting its degradation. To date, neither a physical nor functional relationship between PML and MDM2 has been described. In this study, we report an in vivo and in vitro interaction between PML and MDM2 which is independent of p53. Two separate regions of PML are recognized which can interact with MDM2. The C-terminal half of PML, encoded by residues 300–633, can interact with the central region of MDM2 which includes the MDM2 acidic domain. In addition, PML amino acids 1–200, which encode the RING-finger and most of the B box zinc binding motifs, can interact with the C-terminal, RING-finger containing region of MDM2. Interestingly, PML mutants in which sumoylation at lysine 160 was inhibited displayed an increased association with MDM2, suggesting that sumoylation at this site may be a determinant of PML-MDM2 binding. Coexpression with MDM2 caused a redistribution of PML from the nucleus to the cytoplasm, and this required the PML N terminus and the MDM2 RING-finger domain. These results suggest that interaction between the PML N terminus and MDM2 C terminus can promote PML nuclear exclusion. Wild-type MDM2 inhibited the ability of PML to stimulate the transcriptional activity of a GAL4-CBP fusion protein. This inhibition required the central, acidic region of MDM2, but did not require the MDM2 C terminus. Taken together, these studies demonstrate that MDM2 and PML can interact through at least two separate protein regions, and that these interactions can have specific effects on the activity and/or localization of PML. Wild-type PML is a tumor suppressor and ubiquitously expressed nuclear phosphoprotein. The PML gene was originally identified as a result of a reciprocal translocation t(15:17) associated with acute promyelocytic leukemia (1de The H. Lavau C. Marchio A. Chomienne C. Degos L. Dejean A. Cell. 1991; 66: 675-684Abstract Full Text PDF PubMed Scopus (1192) Google Scholar, 2Goddard A.D. Borrow J. Freemont P.S. Solomon E. Science. 1991; 254: 1371-1374Crossref PubMed Scopus (435) Google Scholar, 3Kakizuka A. Miller Jr., W.H. Umesono K. Warrell Jr., R.P. Frankel S.R. Murty V.V. Dmitrovsky E. Evans R.M. Cell. 1991; 66: 663-674Abstract Full Text PDF PubMed Scopus (1288) Google Scholar, 4Pandolfi P.P. Grignani F. Alcalay M. Mencarelli A. Biondi A. LoCoco F. Grignani F. Pelicci P.G. Oncogene. 1991; 6: 1285-1292PubMed Google Scholar). The t(15:17) translocation disrupts the PML gene on chromosome 15 and the retinoic acid receptor (RAR) 1The abbreviations used are: RAR, retinoic acid receptor; CBP, CREB-binding protein; CREB, cAMP enhancer-binding protein; GST, glutathione S-transferase; HA, hemagglutinin; NB, nuclear body; NLS, nuclear localization signal; wt, wild-type.1The abbreviations used are: RAR, retinoic acid receptor; CBP, CREB-binding protein; CREB, cAMP enhancer-binding protein; GST, glutathione S-transferase; HA, hemagglutinin; NB, nuclear body; NLS, nuclear localization signal; wt, wild-type. α (RARα) gene on chromosome 17 and is reciprocal in nature, resulting in the generation of novel fusion proteins PML-RARα and RARα-PML (5Pandolfi P.P. Hum. Mol. Genet. 2001; 10: 769-775Crossref PubMed Scopus (83) Google Scholar). The most striking feature of wild-type PML is its localization to distinct nuclear foci that have been termed PML nuclear bodies (PML-NBs), Kremer bodies, ND10 or PODs (for PML oncogenic domains). These PML-NBs are multiprotein complexes that are 0.1–0.2 μm in diameter, and cells typically contain 10–30 PML-NBs/nucleus, although their number and size can vary during the cell cycle (6Koken M.H. Linares-Cruz G. Quignon F. Viron A. Chelbi-Alix M.K. Sobczak-Thepot J. Juhlin L. Degos L. Calvo F. de The H. Oncogene. 1995; 10: 1315-1324PubMed Google Scholar, 7Everett R.D. Lomonte P. Sternsdorf T. van Driel R. Orr A. J. Cell Sci. 1999; 112: 4581-4588Crossref PubMed Google Scholar). In acute promyelocytic leukemia cells, expression of PML-RARα causes disruption of PML-NBs and a redistribution of PML to a microspeckled nuclear localization pattern (8Dyck J.A. Maul G.G. Miller Jr., W.H. Chen J.D. Kakizuka A. Evans R.M. Cell. 1994; 76: 333-343Abstract Full Text PDF PubMed Scopus (723) Google Scholar, 9Koken M.H. Puvion-Dutilleul F. Guillemin M.C. Viron A. Linares-Cruz G. Stuurman N. de Jong L. Szostecki C. Calvo F. Chomienne C. EMBO J. 1994; 13: 1073-1083Crossref PubMed Scopus (449) Google Scholar, 10Weis K. Rambaud S. Lavau C. Jansen J. Carvalho T. Carmo-Fonseca M. Lamond A. Dejean A. Cell. 1994; 76: 345-356Abstract Full Text PDF PubMed Scopus (620) Google Scholar). PML-RARα can form heterodimers with wild-type PML (8Dyck J.A. Maul G.G. Miller Jr., W.H. Chen J.D. Kakizuka A. Evans R.M. Cell. 1994; 76: 333-343Abstract Full Text PDF PubMed Scopus (723) Google Scholar, 10Weis K. Rambaud S. Lavau C. Jansen J. Carvalho T. Carmo-Fonseca M. Lamond A. Dejean A. Cell. 1994; 76: 345-356Abstract Full Text PDF PubMed Scopus (620) Google Scholar) as well as retinoid X receptor, another retinoic acid receptor family member (11Perez A. Kastner P. Sethi S. Lutz Y. Reibel C. Chambon P. EMBO J. 1993; 8: 3171-3182Crossref Scopus (286) Google Scholar). Current models suggest that sequestration of normal PML by PML-RARα inhibits the growth suppressive activity of PML, whereas sequestration of retinoid X receptor prevents the induction of differentiation (5Pandolfi P.P. Hum. Mol. Genet. 2001; 10: 769-775Crossref PubMed Scopus (83) Google Scholar). Inhibition of both of these pathways may be necessary for leukemogenesis.The PML protein contains well characterized zinc binding domains in its N-terminal half, including a RING-finger adjacent to two cysteine/histidine-rich motifs known as B boxes. These domains, together with an α-helical coiled-coil domain, comprise a conserved motif known as RBCC (12Jensen K. Shiels C. Freemont P.S. Oncogene. 2001; 49: 7223-7233Crossref Scopus (380) Google Scholar). PML is covalently modified by SUMO-1, a small ubiquitin-like polypeptide also known as sentrin-1, UBL-1, or PIC-1 (13Boddy M.N. Howe K. Etkin L.D. Solomon E. Freemont P.S. Oncogene. 1996; 13: 971-982PubMed Google Scholar). Like ubiquitin, SUMO-1 is linked covalently to lysine residues on PML and other target proteins in an ATP-dependent manner (14Seeler J.S. Dejean A. Oncogene. 2001; 20: 7243-7249Crossref PubMed Scopus (135) Google Scholar). However, SUMO-1 modification seems to modulate the localization of its target proteins rather than induce their degradation. Three major sites for SUMO-1 modification were identified in PML: Lys-65 in the RING-finger, Lys-160 in the first B box, and Lys-490 in the nuclear localization signal (15Kamitani T. Kito K. Nguyen H.P. Wada H. Fukuda-Kamitani T. Yeh E.T. J. Biol. Chem. 1998; 273: 26675-26682Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar, 16Duprez E. Saurin A.J. Desterro J.M. Lallemand-Breitenbach V. Howe K. Boddy M.N. Solomon E. de The H. Hay R.T. Freemont P.S. J. Cell Sci. 1999; 112: 381-393Crossref PubMed Google Scholar). Sumoylation of PML is essential for formation of PML-NBs and for its ability to recruit NB-associated proteins (17Muller S. Matunis M.J. Dejean A. EMBO J. 1998; 17: 61-70Crossref PubMed Scopus (577) Google Scholar, 18Zhong S. Hu P. Ye T.Z. Stan R. Ellis N.A. Pandolfi P.P. Oncogene. 1999; 56: 7941-7947Crossref Scopus (194) Google Scholar). Sumoylation was also thought to be required for PML-dependent growth suppression. However, this latter hypothesis was challenged by a recent study in which a mutant PML deficient in sumoylation maintained its ability to inhibit growth when overexpressed (19Bischof O. Kirsh O. Pearson M. Itahana K. Pelicci P.G. Dejean A. EMBO J. 2002; 13: 3358-3369Crossref Scopus (179) Google Scholar).The mechanisms by which PML functions as a tumor suppressor and inhibits growth have not been fully clarified. Mice with a targeted disruption of the PML locus (PML–/–) display an increased incidence of carcinomas after treatment with tumor-promoting agents (20Wang Z.G. Delva L. Gaboli M. Rivi R. Giorgio M. Cordon-Cardo C. Grosveld F. Pandolfi P.P. Science. 1998; 279: 1547-1551Crossref PubMed Scopus (453) Google Scholar). Further, cells derived from PML–/– mice are resistant to apoptosis in response to various apoptotic stimuli (21Wang Z.G. Ruggero D. Ronchetti S. Zhong S. Gaboli M. Rivi R. Pandolfi P.P. Nat. Genet. 1998; 20: 266-272Crossref PubMed Scopus (97) Google Scholar). These results suggest that PML plays a central role in apoptosis signaling. A relationship between PML and p53 was suggested by the finding that p53 could interact directly with PML and was recruited by PML into PML-NBs (22Fogal V. Gostissa M. Sandy P. Zacchi P. Sternsdorf T. Jensen K. Pandolfi P.P. Will H. Schneider C. Del Sal G. EMBO J. 2000; 19: 6185-6195Crossref PubMed Scopus (320) Google Scholar). Subsequent studies have shown that PML corecruits both p53 and CBP/p300 to PML-NBs. CBP/p300 then promotes the acetylation of p53, which increases p53 DNA binding affinity and thus leads to an activation of p53-responsive genes (23Pearson M. Carbone R. Sebastiani C. Cioce M. Fagioli M. Saito S. Higashimoto Y. Appella E. Minucci S. Pandolfi P.P. Pelicci P.G. Nature. 2000; 406: 207-210Crossref PubMed Scopus (1120) Google Scholar, 24Ferbeyre G. de Stanchina E. Querido E. Baptiste N. Prives C. Lowe S.W. Genes Dev. 2000; 14: 2015-2027Crossref PubMed Google Scholar). Perhaps the most compelling evidence that links the PML and p53 growth-suppressive pathways comes from studies of oncogene-induced senescence. In these studies, p53 activity was measured in PML+/+ and PML–/– cells infected with retroviruses expressing an activated ras oncogene (Ras V12). Ras V12 expression in PML+/+ cells resulted in the activation of p53, recruitment of p53 into PML-NBs, and the induction of premature senescence. In contrast, p53 was neither activated nor recruited into PML-NBs in PML–/– cells, and the cells were resistant to ras-induced senescence (23Pearson M. Carbone R. Sebastiani C. Cioce M. Fagioli M. Saito S. Higashimoto Y. Appella E. Minucci S. Pandolfi P.P. Pelicci P.G. Nature. 2000; 406: 207-210Crossref PubMed Scopus (1120) Google Scholar, 24Ferbeyre G. de Stanchina E. Querido E. Baptiste N. Prives C. Lowe S.W. Genes Dev. 2000; 14: 2015-2027Crossref PubMed Google Scholar). These studies provide strong evidence that PML is required for the efficient activation of p53 in response to aberrant oncogene signaling.p53 levels and activity are controlled in large part by MDM2, the product of a p53-inducible gene. MDM2 binds to the N terminus of p53 and inhibits the activity of p53 as a transcription factor (25Momand J. Zambetti G.P. Olson D. George D. Levine A.J. Cell. 1992; 69: 1237-1245Abstract Full Text PDF PubMed Scopus (2776) Google Scholar, 26Oliner J.D. Kinzler K.W. Meltzer P.S. George D. Vogelstein B. Nature. 1992; 358: 80-83Crossref PubMed Scopus (1790) Google Scholar). Importantly, MDM2 binding also promotes the ubiquitination of p53 and its subsequent degradation by the proteasome, as well as the export of p53 from the nucleus to the cytoplasm (27Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3658) Google Scholar, 28Kubbutat M.H. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2812) Google Scholar, 29Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 9: 563-568Crossref Scopus (285) Google Scholar, 30Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 9: 569-573Crossref Scopus (296) Google Scholar). Insofar as PML and MDM2 have opposing effects on p53 activity, it is of interest to investigate the functional relationship between PML and MDM2. However, to date neither a physical nor functional interaction between PML and MDM2 has been described. The current report demonstrates an in vivo and in vitro interaction between PML and MDM2 which can occur independent of p53. Mapping studies indicate that PML and MDM2 can interact through at least two separate protein regions and that these interactions can affect both the localization and activity of PML.EXPERIMENTAL PROCEDURESPlasmid DNAs—FLAG-tagged PML expression DNA was obtained from Zhi-Min Yuan (Harvard School of Public Health). HA-tagged PML was generated from this clone by PCR. The 3′-primer for PCR was the SP6 primer (Promega), and the 5′-primer was 5′-GCGAATTCACCATGTACCCATACGATGTTCCAGATTACGCTGAGCCTGCACCCGCCCG-3′. The resulting PCR product was digested with EcoRI and XbaI restriction enzymes and cloned into the corresponding sites of pCDNA-3.1. All subsequent PML clones were generated by PCR using HA-PML wild-type as the template. N-terminal deletions of PML were generated using the SP6 primer as the 3′-primer, and the following 5′-primers: for HA-PML Δ100N, 5′-GCGAATTCACCATGTACCCATACGATGTTCCAGATTACGCTACACCCGCCCTGGATAACG-3′; for HA-PML Δ200N, 5′-GCGAATTCACCATGTACCCATACGATGTTCCAGATTACGCTAGCATCT ACTGCCGAGG-3′; for HA-PML Δ300N, 5′-GCGAATTCACCATGTACCCATACGATGTTCCAGATTACGCTGTGGACGCGCGGTACCAGC-3′; for HA-PML Δ400N, 5′-GCGAATTCACCATGTACCCATACGATGTTCCAGATTACGCTAAAGCCAGCCCAGAGGC-3′; PCR products were digested with EcoRI and XbaI restriction enzymes and cloned into the corresponding sites of pCDNA-3.1. Sumoylation site mutants of PML were generated using the QuikChange mutagenesis kit (Stratagene) and HA-PML wild-type as a template. For HA-PML (K65R), the following primer and its complement were used: 5′-GCGGAAGCCAGGTGCCCGAAGCTTCTGCCTTGTCTGC-3′. For HA-PML (K160R), the following primer and its complement were used in the PCR: 5′-CAGTGGTTCCTCAGGCTCGAGGCCCGGC-3′. For HA-PML (K490R), the following primer and its complement were used: 5′-GACCCAGTGCCCGCGGAAGGTCATCAGGATGGAGTCTGAGG-3′. C-terminal deletions of HA-PML (K160R) were generated using 5′-GCGAATTCACCATGTACCCATACGATGTTCCAGATTACGCTGAGCCTGCACCCGCC CG-3′ as the 5′-primer and the following 3′-primers: for HA-PML K160R (1–500), 5′-CCGTCTAGATCACCTTGCCTCCTTCCCCTCC-3′; for HA-PML K160R (1–400), 5′-CCGTCTAGATCACTTGGATACAGCTGCATC-3′; for HA-PML K160R (1–300), 5′-CCGTCTAGATCAAGCCTCCAGCAGCTCGCGC-3′; for HA-PML K160R (1–200), 5′-CCGTCTAGATCAGGTCAGCGTAGGGGTGCGG-3′. The resulting PCR products were digested with EcoRI and XbaI and cloned into the corresponding sites in pCDNA3.1. FLAG-tagged MDM2 DNAs were described (31Gu J. Nie L. Kawai H. Yuan Z.M. Cancer Res. 2001; 18: 6703-6707Google Scholar, 32Kawai H. Nie L. Wiederschain D. Yuan Z.M. J. Biol. Chem. 2001; 276: 45928-45932Abstract Full Text Full Text PDF PubMed Scopus (34) Google Scholar) and were obtained from Zhi-Min Yuan. FLAG-MDM2 ΔNT lacks 120 amino acids from the N terminus. DNAs encoding wild-type MDM2 and MDM2 Δ217–246 were obtained from Steve Grossman (Dana Farber Cancer Institute). FLAG-tagged MDM2 (2–202), (100–304) and (301–488) were generated by PCR using wild-type MDM2 DNA as a template. For MDM2 (301–488) the 5′-primer was 5′-CCGGGATCCCCAAAGAAGAAGAGGAAGGACTATTGGAAATGCACTTCATGC-3′, and the 3′-primer was 5′-CCGTCTAGATCAAGTTAGCACAATCATTTGAATTGG-3′. The resulting PCR products were digested with BamHI and XbaI and cloned downstream and in-frame with the FLAG epitope in pCDNA3.1. MDM2 (301–488) contains the SV40 large-T antigen NLS encoded within the 5′-primer. For MDM2 (2–202) the 5′-primer was 5′-CCGGGATCCTGCAATACCAACATGTCTGTACC-3′, and the 3′-primer was 5′-CCGGAATTCTCATATTACACACAGAGCCAGGC-3′. For MDM2 (100–304) the 5′-primer was 5′-CCGGGATCCTATACCATGATCTACAGGAACTTGG-3′, and the 3′-primer was 5′-CCGGAATTCTCATTTCCAATAGTCAGCTAAGG-3′. The resulting PCR products were digested with BamHI and EcoRI and cloned downstream and in-frame with the FLAG epitope in pCDNA3.1. MDM2 (6–339) was obtained from Arnold Levine.Tissue Culture, Immunoblots, Immunoprecipitation—Human osteosarcoma cell lines Saos-2 cells (p53-null) and U2OS (p53 wild-type), and 35-2 cells (murine p53 and MDM2 double knockout) were grown in minimum essential medium supplemented with 10% fetal bovine serum, 100 μg/ml penicillin and streptomycin. Transfections in Saos-2 and U2OS cells were done using the calcium phosphate method in 35-mm dishes when the cells were ∼80% confluent. 16–20 h after addition of the DNA precipitate, cells were washed twice with minimum essential medium minus serum and refed with minimum essential medium plus 10% fetal bovine serum. Cell extracts were prepared 8–10 h later. Transfections in 35-2 cells were done using FuGENE-6 (Roche Applied Science), according to the manufacturer's instructions. For immunoblot analysis and coimmunoprecipitations, cells were rinsed with phosphate-buffered saline and scraped into 500 μl of lysis buffer (50 mm Tris, pH 7.5, 5 mm EDTA, 150 mm NaCl, 0.5% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride, 2 μg/ml aprotinin, 5 μg/ml leupeptin). The scraped cells were lysed on ice for 30 min with occasional light vortexing, followed by a 15-min centrifugation to remove cellular debris. Protein extracts were then either immunoprecipitated or resolved by SDS-PAGE, and transferred to a PolyScreen polyvinylidene difluoride transfer membrane (PerkinElmer Life Sciences). Antibodies used for immunoblotting were the anti-HA monoclonal antibody (HA.11 from Babco), an anti-MDM2 monoclonal antibody (SMP-14 from Santa Cruz), or an anti-FLAG monoclonal antibody (M5 from Sigma). For immunoprecipitations, 300 μg of transfected cell extract was immunoprecipitated with 0.6 μg of the anti-HA polyclonal antibody Y-11 (from Santa Cruz) or 0.2 μg of anti-MDM2 (SMP-14). To detect sumoylated PML species, cells were rinsed with phosphate-buffered saline and scraped into 500 μl of radioimmunoprecipitation assay buffer (20 mm Tris, pH 7.5, 2 mm EDTA, 150 mm NaCl, 0.25% SDS, 1% Nonidet P-40, 1% deoxycholic acid), and then sonicated for 10 pulses (setting 5, 50% output) using a Branson-450 sonifier. Lysates were centrifuged for 15 min prior to analysis to remove cellular debris.Immunofluorescence Staining—For immunofluorescence staining, cells were plated on glass coverslips and transfected, washed, and refed as described above. 24 h after transfection, cells were rinsed with phosphate-buffered saline plus 0.1 mm CaCl2 and1mm MgCl2 and fixed with 4% paraformaldehyde for 30 min at 4 °C. Paraformaldehyde was then replaced with 50 mm NH4Cl for 5 min, and cells were permeabilized with 0.1% Triton X-100 plus 0.2% bovine serum albumin. PML staining was carried out using the anti-HA monoclonal antibody HA.11 (Babco) as the primary antibody and rhodamine red-conjugated anti-mouse antibody (Jackson Labs) as the secondary antibody. MDM2 staining was carried out using the anti-MDM2 polyclonal antibody N-20 (Santa Cruz) as the primary antibody, and either 7-amino-4-methylcoumarin-3-acetic acid-conjugated anti-rabbit antibody, or fluorescein isothiocyanate-conjugated anti-rabbit antibody (Jackson Labs) as the secondary antibody. Specimens were then examined under a fluorescent microscope.GST Fusion Protein Production—GST-tagged PML wild-type DNA was generated by PCR using HA-PML wild-type as a template. The 3′-primer for PCR was 5′-GGCGCGGCCGCCTCACCAGGAGAACCCACTTTCATTG-3′, and the 5′-primer was 5′-CCGGGATCCGAGCCTGCACCCGCCCGATCTCCG-3′. The resulting PCR product was digested with BamHI and NotI restriction enzymes and cloned into the corresponding sites of pGEX-4T-3. GST-tagged PML K160R DNA was generated by PCR using the same primers but HA-PML K160R as a template. DNAs encoding GST alone or GST-PML were used to transform BL-21 bacterial cells, and transformed cells were grown at 37 °C until reaching log phase. GST protein expression was induced by incubation in 0.2 mm isopropyl-1-thio-β-galactopyranoside for 3 h. To purify the GST proteins, cells were lysed by sonication in lysis buffer (10 mm Tris-HCl, pH 7.5, 1 mm EDTA, 0.1% Triton X-100, 150 mm NaCl), and the resulting lysate was incubated for 12 h at 4 °C with glutathione-Sepharose beads. The beads were pelleted by centrifugation and washed with lysis buffer. For MDM2 binding, the GST-tagged proteins bound to beads were incubated with MDM2 protein in 300 μl of lysis buffer for 5–6 h. Unbound MDM2 protein was removed by five washes (1 ml each) with lysis buffer. Bound proteins were eluted by boiling for 10 min in 1 × loading buffer, resolved by SDS-PAGE, and examined by immunoblot analysis with the anti-MDM2 antibody SMP-14.Expression and Isolation of MDM2 from Insect Cells—DNA encoding FLAG-tagged MDM2 that was either wild-type, lacked amino acids 217–246 (MDM2 Δp300BD), or lacked the C-terminal RING domain between residues 443 and 491 (MDM2 ΔCT) was cloned into a baculovirus expression system and used for expression in insect cells. MDM2 protein was isolated by passing insect cell lysate over a column of Sepharose beads conjugated to an anti-FLAG antibody. Bound proteins were washed several times and eluted with a peptide encoding the FLAG epitope.RESULTSPML protein levels increase upon exposure of cells to interferons (IFNs) through direct transcriptional activation of the PML gene. To test for an in vivo interaction between PML and MDM2, H1299 cells (p53-null) were exposed to IFN-γ for 48 h to induce endogenous PML expression, and the cells were then examined by immunofluorescence staining and confocal microscopy with antibodies against MDM2 and PML. These studies revealed colocalization between the endogenous PML and MDM2 proteins in IFN-γ–treated H1299 cells (Fig. 1A). Because H1299 cells lack p53 expression, these results suggest that MDM2 and PML can form an endogenous complex, either directly or indirectly, in the absence of p53. We also attempted to coimmunoprecipitate PML and MDM2 from IFN-γ-treated H1299 cells (not shown). However, we have been unable to immunoprecipitate large amounts of endogenous PML using our normal cell lysis conditions because the PML protein is insoluble under these conditions. We can solubilize PML under relatively harsh lysis conditions (high detergent), but these conditions are denaturing and therefore destroy any putative PML-MDM2 interactions. To examine the PML-MDM2 interaction further, Saos-2 cells (p53-null) were transfected with DNAs encoding MDM2 and epitope-tagged (HA-tagged) PML. Cell lysates were then immunoprecipitated with an anti-HA antibody and examined by immunoblotting with an antibody against MDM2. As shown in Fig. 1B, MDM2 coimmunoprecipitated with HA-PML in Saos-2 cells, again demonstrating that MDM2 and PML can interact in the absence of p53. To test the possibility that MDM2 and PML may interact directly, wild-type PML protein fused to GST was generated in bacteria, purified on glutathione-agarose beads, and mixed with partially purified, recombinant MDM2 protein produced in insect cells. Association between PML and MDM2 was then assessed in GST pull-down assays. As shown in Fig. 1C, wild-type (wt) MDM2 formed a complex with GST-PML wt, whereas no complex was observed between MDM2 and the GST protein alone. These results indicate that MDM2 and PML can interact with each other and suggest that this may be a direct interaction. An MDM2 protein lacking the C-terminal amino acids 443–491 (MDM2 ΔCT) also formed a complex with GST-PML wt but not with the GST protein control, indicating that this in vitro binding between PML and MDM2 does not require the MDM2 C terminus.We next wished to identify the regions of PML and MDM2 required for their interaction. PML contains several well characterized protein domains, including a RING-finger, two B boxes, and an α-helical coiled-coil (Fig. 2A) (for review, see Ref. 12Jensen K. Shiels C. Freemont P.S. Oncogene. 2001; 49: 7223-7233Crossref Scopus (380) Google Scholar). To map the regions of PML required for MDM2 binding, N-terminal deletion mutants of HA-PML were expressed with MDM2 in transiently transfected cells. Cell lysates were then immunoprecipitated with an anti-HA antibody and examined by immunoblotting with an antibody against MDM2. As shown in Fig. 2B, MDM2 coimmunoprecipitated with HA-tagged wild-type PML, consistent with the results of Fig. 1. Interestingly, deletion mutants of PML lacking 100 or 200 amino acids from the N terminus displayed a much stronger interaction with MDM2 compared with wild-type PML, whereas a PML deletion mutant lacking 400 amino acids from the N terminus was unable to bind MDM2. Similar binding results were obtained in the reciprocal coimmunoprecipitation, which involved first immunoprecipitating with an anti-MDM2 antibody, followed by immunoblotting with an anti-HA antibody (Fig. 2C). In these studies, wild-type PML again displayed relatively weak binding to MDM2, whereas mutants lacking 100, 200, or 300 amino acids from the PML N terminus displayed stronger association with MDM2, and a mutant lacking 400 amino acids from the N terminus failed to bind MDM2. These results indicate that the C-terminal region of PML between residues 300 and 633 can form a complex with MDM2 and suggest that sequences within the N terminus of PML may be inhibitory to this PML-MDM2 complex formation.Fig. 2Binding of PML deletion mutants to MDM2. A, schematic of the PML protein showing the positions of the RING-finger domain (R), the two B box zinc binding domains (B1, B2), the predicted α-helical coiled-coil, and the three sites of sumoylation. B, U2OS cells were transfected with DNAs encoding wild-type MDM2 and either wild-type PML or the indicated deletion mutant of PML. PML protein was precipitated with an anti-HA antibody, and the immunoprecipitates (IP) were examined with an antibody against MDM2 (top panel). Steady-state levels of HA-PML and MDM2 were monitored by immunobloting (IB) of lysates without prior immunoprecipitation (middle and lower panels). The molecular mass (mw) in kDa of protein standard is indicated next to each blot. C, U2OS cells were transfected with DNAs encoding either wild-type MDM2 or an MDM2 mutant that localizes in the cytoplasm (MDM2 NLS-), and the indicated form of HA-PML. MDM2 protein was precipitated with an anti-MDM2 antibody, and the immunoprecipitates were examined with an antibody against HA (top panel). Steady-state levels of HA-PML and MDM2 were monitored by immunobloting of lysates without prior immunoprecipitation (middle and lower panels).View Large Image Figure ViewerDownload Hi-res image Download (PPT)Wild-type PML is post-translationally modified by the covalent attachment of SUMO, a small ubiquitin-like molecule, at three separate lysine residues in the PML sequence (Lys-65, Lys-160, and Lys-490; Fig. 2A) (13Boddy M.N. Howe K. Etkin L.D. Solomon E. Freemont P.S. Oncogene. 1996; 13: 971-982PubMed Google Scholar, 15Kamitani T. Kito K. Nguyen H.P. Wada H. Fukuda-Kamitani T. Yeh E.T. J. Biol. Chem. 1998; 273: 26675-26682Abstract Full Text Full Text PDF PubMed Scopus (274) Google Scholar, 16Duprez E. Saurin A.J. Desterro J.M. Lallemand-Breitenbach V. Howe K. Boddy M.N. Solomon E. de The H. Hay R.T. Freemont P.S. J. Cell Sci. 1999; 112: 381-393Crossref PubMed Google Scholar). Sumoylation is mediated by the sumo-conjugating enzyme Ubc9 and requires interaction between Ubc9 and the RING-finger domain within the first 100 amino acids of PML (16Duprez E. Saurin A.J. Desterro J.M. Lallemand-Breitenbach V. Howe K. Boddy M.N. Solomon E. de The H. Hay R.T. Freemont P.S. J. Cell Sci. 1999; 112: 381-393Crossref PubMed Google Scholar). The finding that PML mutants lacking the first 100 amino acids displayed an increased association with MDM2 suggested that sumoylation of PML may be inhibitory to PML-MDM2 binding. To investigate this possibility, PML mutants were generated in which each sumo site lysine was converted to arginine either singly or in combination, and association between these mutants and MDM2 was monitored by coimmunoprecipitation. As shown in Fig. 3A, MDM2 coimmunoprecipitated with wild-type PML to a relatively small extent in cells transiently expressing both proteins. MDM2 also coimmunoprecipitated with

p53 protein conformation is an important determinant of its localization and activity. Changes in p53 conformation can be monitored by reactivity with wild-type conformation-specific (pAb-1620) or mutant conformation-specific (pAb-240) p53 antibodies. Wild-type p53 accumulated in a mutant (pAb-240 reactive) form when its proteasome-dependent degradation was blocked during recovery from stress treatment and in cells co-expressing p53 and MDM2. This suggests that conformational change precedes wild-type p53 degradation by the proteasome. MDM2 binding to the p53 N terminus could induce a conformational change in wild-type p53. Interestingly, this conformational change was opposed by heat-shock protein 90 and did not require the MDM2 RING-finger domain and p53 ubiquitination. Finally, ubiquitinated p53 accumulated in a pAb-240 reactive form when p53 degradation was blocked by proteasome inhibition, and a p53-ubiquitin fusion protein displayed a mutant-only conformation in MDM2-null cells. These results support a model in which MDM2 binding induces a conformational change that is opposed by heat-shock protein 90 and precedes p53 ubiquitination. The covalent attachment of ubiquitin may “lock” p53 in a mutant conformation in the absence of MDM2-binding and prior to its degradation by the proteasome. p53 protein conformation is an important determinant of its localization and activity. Changes in p53 conformation can be monitored by reactivity with wild-type conformation-specific (pAb-1620) or mutant conformation-specific (pAb-240) p53 antibodies. Wild-type p53 accumulated in a mutant (pAb-240 reactive) form when its proteasome-dependent degradation was blocked during recovery from stress treatment and in cells co-expressing p53 and MDM2. This suggests that conformational change precedes wild-type p53 degradation by the proteasome. MDM2 binding to the p53 N terminus could induce a conformational change in wild-type p53. Interestingly, this conformational change was opposed by heat-shock protein 90 and did not require the MDM2 RING-finger domain and p53 ubiquitination. Finally, ubiquitinated p53 accumulated in a pAb-240 reactive form when p53 degradation was blocked by proteasome inhibition, and a p53-ubiquitin fusion protein displayed a mutant-only conformation in MDM2-null cells. These results support a model in which MDM2 binding induces a conformational change that is opposed by heat-shock protein 90 and precedes p53 ubiquitination. The covalent attachment of ubiquitin may “lock” p53 in a mutant conformation in the absence of MDM2-binding and prior to its degradation by the proteasome. Inactivation of p53 is considered essential for the development of most or all human cancers (1Hollstein M. Sidransky D. Vogelstein B. Harris C.C. Science. 1991; 253: 49-53Crossref PubMed Scopus (7412) Google Scholar). More than 50% of human cancers harbor inactivating mutations in the p53 gene, and in cancers that retain wild-type p53, other defects in the p53 tumor suppressor pathway are observed. Cancer-associated p53 mutations are found almost exclusively in the DNA binding domain and inhibit the ability of p53 to activate expression of its downstream target genes (2Soussi T. Dehouche K. Beroud C. Hum. Mutat. 2000; 15: 105-113Crossref PubMed Scopus (246) Google Scholar, 3Olivier M. Eeles R. Hollstein M. Khan M.A. Harris C.C. Hainaut P. Hum. Mutat. 2002; 19: 607-614Crossref PubMed Scopus (1015) Google Scholar). These cancer-associated mutations also alter p53 protein conformation to varying extents. Changes in p53 conformation can be assessed by monitoring reactivity with conformation-specific antibodies that recognize p53 in either a wild-type (pAb-1620) 3The abbreviations used are: pAb, primary antibody; Hsp90, heat-shock protein 90; GA, geldanamycin; 17-AAG, 17-allylamino-17-demethoxygeldanamycin; Myc-Ub, Myc-tagged ubiquitin; wt, wild type. 3The abbreviations used are: pAb, primary antibody; Hsp90, heat-shock protein 90; GA, geldanamycin; 17-AAG, 17-allylamino-17-demethoxygeldanamycin; Myc-Ub, Myc-tagged ubiquitin; wt, wild type. or mutant (pAb-240) conformation (4Milner J. Cook A. Sheldon M. Oncogene. 1987; 1: 453-455PubMed Google Scholar, 5Gannon J.V. Greaves R. Iggo R. Lane D.P. EMBO J. 1990; 9: 1595-1602Crossref PubMed Scopus (936) Google Scholar). Wild-type p53 is a flexible and conformationally labile protein, and conditions that can alter its conformation have been examined. For example, Milner and Watson (6Milner J. Watson J.V. Oncogene. 1990; 5: 1683-1690PubMed Google Scholar) reported that wild-type p53 switched to a mutant conformation in serum-stimulated murine fibroblasts. In addition, Milner and Medcalf (7Milner J. Medcalf E.A. Cell. 1991; 65: 765-774Abstract Full Text PDF PubMed Scopus (533) Google Scholar) demonstrated that formation of hetero-oligomers of wild-type and mutant p53 proteins could drive the wild-type protein in to a mutant conformation. Regulated changes in p53 protein conformation are likely to be important determinants of p53 activity.Heat-shock protein 90 (Hsp90) is a molecular chaperone that plays an essential role in the conformational maturation of numerous proteins, including nuclear receptors, transcription factors, and protein kinases (8Calderwood S.K. Khaleque M.A. Sawyer D.B. Ciocca D.R. Trends Biochem. Sci. 2006; 31: 164-172Abstract Full Text Full Text PDF PubMed Scopus (742) Google Scholar). It is believed that Hsp90 maintains these proteins in an active conformation that can be rapidly triggered after stimulus. Hsp90 also functions in the folding of newly synthesized proteins and their refolding after conditions of denaturing stress. Functions of Hsp90 may be modulated by association with co-chaperones such as Hsc70, Hsp40, and Hop (8Calderwood S.K. Khaleque M.A. Sawyer D.B. Ciocca D.R. Trends Biochem. Sci. 2006; 31: 164-172Abstract Full Text Full Text PDF PubMed Scopus (742) Google Scholar, 9Beliakoff J. Whitesell L. Anticancer Drugs. 2004; 15: 651-662Crossref PubMed Scopus (128) Google Scholar). Complexes between Hsp90 and wild-type p53 have been recognized, and it is currently believed that Hsp90 is a positive regulator of p53. For example, the Hsp90 inhibitor geldanamycin (GA) diminished the stress-induced accumulation and activation of p53 in a campothecin-treated human fibroblast cell line (10Walerych D. Kudla G. Gutkowska M. Wawrzynow B. Muller L. King F.W. Helwak A. Boros J. Zylicz A. Zylicz M. J. Biol. Chem. 2004; 279: 48836-48845Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar) and in cells exposed to heat shock (11Wang C. Chen J. J. Biol. Chem. 2003; 278: 2066-2071Abstract Full Text Full Text PDF PubMed Scopus (59) Google Scholar). Hsp90 inhibition was also reported to block the nuclear accumulation and reactivation of p53 when cells harboring a temperature-sensitive p53 mutant were shifted to the permissive temperature (12Muller P. Ceskova P. Vojtesek B. J. Biol. Chem. 2005; 280: 6682-6691Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar, 13Galigniana M.D. Harrell J.M. O'Hagen H.M. Ljungman M. Pratt W.B. J. Biol. Chem. 2004; 279: 22483-22489Abstract Full Text Full Text PDF PubMed Scopus (127) Google Scholar). And finally, purified Hsp90 protein maintained p53 in a wild-type, DNA binding conformation at elevated temperatures in vitro (10Walerych D. Kudla G. Gutkowska M. Wawrzynow B. Muller L. King F.W. Helwak A. Boros J. Zylicz A. Zylicz M. J. Biol. Chem. 2004; 279: 48836-48845Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar). Together, these results support a role for Hsp90 in maintaining the levels, activity, and conformation of wild-type p53.MDM2 is the product of a p53-inducible gene and can bind the N terminus of p53 and inhibit its transcriptional activity (14Momand J. Zambetti G.P. Olson D.C. George D. Levine A.J. Cell. 1992; 69: 1237-1245Abstract Full Text PDF PubMed Scopus (2776) Google Scholar, 15Oliner J.D. Kinzler K.W. Meltzer P.S. George D.L. Vogelstein B. Nature. 1992; 358: 80-83Crossref PubMed Scopus (1790) Google Scholar). Importantly, MDM2 binding can also promote the ubiquitination of p53 and its degradation by the proteasome (16Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3659) Google Scholar, 17Kubbutat M.H. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2814) Google Scholar). This may allow a more efficient inhibition of p53 activity than would result from MDM2 binding alone. Current models suggest MDM2 is an E3 ubiquitin-protein ligase that facilitates ubiquitin transfer to p53 (18Lavin M.F. Gueven N. Cell Death Differ. 2006; 13: 941-950Crossref PubMed Scopus (529) Google Scholar). Various reports have suggested a possible relationship between the conformation of p53 and its degradation by the proteasome. For example, El-Deiry and co-workers (19Wang W. Takimoto R. Rastinejad F. El-Deiry W.S. Mol. Cell. Biol. 2003; 23: 2171-2181Crossref PubMed Scopus (127) Google Scholar) reported that the drug CP-31398 could stabilize endogenous p53 in cultured cells. CP-31398 can maintain p53 in an active conformation and can drive some mutant p53s into a wild-type conformation (20Foster B.A. Coffey H.A. Morin M.J. Rastinejad F. Science. 1999; 286: 2507-2510Crossref PubMed Scopus (685) Google Scholar). The fact that it could block p53 degradation raised the possibility that wild-type p53 might assume a mutant conformation before its degradation. The plant alkaloid ellipticine can also maintain p53 in a wild-type conformation and can drive some mutant p53s into a wild-type conformation (21Peng Y. Li C. Chen L. Sebti S. Chen J. Oncogene. 2003; 22: 4478-4487Crossref PubMed Scopus (123) Google Scholar). Like CP-31398, ellipticine treatment stabilized endogenous wild-type p53 in cultured cells (21Peng Y. Li C. Chen L. Sebti S. Chen J. Oncogene. 2003; 22: 4478-4487Crossref PubMed Scopus (123) Google Scholar, 22Kuo P.L. Hsu Y.L. Chang C.H. Lin C.C. Cancer Lett. 2005; 223: 293-301Crossref PubMed Scopus (105) Google Scholar), supporting the possibility that wild-type p53 might assume a mutant conformation before degradation. In the current study we monitored p53 protein conformation under conditions in which its MDM2 and proteasome-dependent degradation was inhibited. Our results support a model in which MDM2 binding promotes a conformational change in p53 that is opposed by Hsp90 and precedes p53 ubiquitination and proteasomal degradation.EXPERIMENTAL PROCEDURESPlasmid DNAs—DNA encoding p53 Δ42N has been described (23Unger T. Mietz J.A. Scheffner M. Yee C.L. Howley P.M. Mol. Cell. Biol. 1993; 13: 5186-5194Crossref PubMed Scopus (128) Google Scholar) and was from Peter Howley (Harvard Medical School). FLAG-tagged wild-type p53 has been described (24Gu J. Chen D. Rosenblum J. Rubin R.M. Yuan Z.M. Mol. Cell. Biol. 2000; 20: 1243-1253Crossref PubMed Scopus (53) Google Scholar) and was from Zhimin Yuan (Harvard School of Public Health). This DNA contains wild-type p53 sequences cloned into BamHI and XbaI sites downstream of the FLAG epitope. DNAs encoding the untagged p53 and the p53-ubiquitin fusion protein were from Wei Gu (Columbia University) (25Li M. Brooks C.L. Wu-Baer F. Chen D. Baer R. Gu W. Science. 2003; 302: 1972-1975Crossref PubMed Scopus (628) Google Scholar). Myc-tagged ubiquitin DNA was from Ron Kopito (Stanford University) (26Ward C.L. Omura S. Kopito R.R. Cell. 1995; 83: 121-127Abstract Full Text PDF PubMed Scopus (1127) Google Scholar). MDM2 Δp53BD lacks residues 52-96 in the MDM2 N terminus. DNA encoding wild-type MDM2 and MDM2 Δp53BD were from Steve Grossman (University of Massachusetts Medical School). MDM2 ΔRING DNA encodes residues 6-339 (27Kubbutat M.H. Ludwig R.L. Levine A.J. Vousden K.H. Cell Growth Differ. 1999; 10: 87-92PubMed Google Scholar). This DNA was from Arnold Levine. DNA encoding FLAG-tagged Hsp90 was provided by Len Neckers (NCI, National Institutes of Health).Cell Culture and Transfections—MCF7 (breast cancer), U2OS (osteosarcoma), and HepG2 (liver cancer) cell lines all expresses wild-type p53. MDM2/p53 double knock-out mouse embryo fibroblasts were from Rudy Alarcon (Stanford University). All cell lines were maintained at 37 °C in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal bovine serum and antibiotics (1% penicillin and streptomycin). Control siRNA or siRNA against MDM2 (smart-pool) were from Dharmacon and were transfected to Hep3B cells using Dharmafect reagent, also from Dharmacon. Transfections in U2OS or MDM2/p53 double knock-out cells were done using FuGENE-6 transfection reagent (Roche Applied Science) according to the manufacturer’s protocol when cells were ∼60% confluent. Total DNA in each transfection was equalized by the addition of empty plasmid. Where indicated, the proteasome inhibitor MG132 (Boston Biochem) was added to a final concentration of 30 μm 18 h after transfection, and the cells were incubated for an additional 5-7 h before harvesting. MCF7 cells were treated with Hsp90 inhibitors at the following final concentrations: 17-AAG (10 μm), GA (10 μm), radicicol (0.5 μm). 17-AAG was from Ralph Weichselbaum (University of Chicago), GA was from A. G. Scientific, and radicicol was from Sigma.Immunoprecipitations and Immunoblotting—To harvest cell lysates for immunoblotting, cells were rinsed with 2 ml of phosphate-buffered saline and then scraped into 700 ml of lysis buffer (50 mm Tris, pH 7.5, 150 mm NaCl, 0.5% Nonidet P-40, phenylmethylsulfonyl fluoride, leupeptin) and transferred to microcentrifuge tubes. The cells were then incubated on ice for 30 min with occasional vortexing and spun at 4 °C, 14,000 rpm for 15 min to remove cellular debris. For immunoprecipitations using conformation-specific p53 antibodies, cell lysates were first mixed for 1 h with 30 μl of protein A-agarose beads to pre-clear the lysate. The lysate was then divided into equal halves, and each half was immunoprecipitated overnight with 1.75 μl of either the wild-type conformation-specific (pAb-1620, Invitrogen Ab-5) or mutant conformation-specific (pAb-240, Invitrogen Ab-3). Immunoprecipitates were captured by incubation with 30 μl of protein A-agarose beads for 1 h, and the beads were isolated by centrifugation for 10 s at 13,000 rpm. The beads were then washed twice with 1 ml of ice-cold lysis buffer, boiled for 10 min, and then resolved by SDS-PAGE and transferred to polyvinylidene difluoride membranes for immunoblotting. Antibodies used in immunoblotting to detect p53 included the sheep polyclonal antibody Ab-7 (Oncogene Science), monoclonal p53 antibody 1801 (Oncogene Science), and the FLAG monoclonal antibody Ab-5 (Sigma-Aldrich). MDM2 antibody was SMP-14 (Santa Cruz). Tubulin antibody Ab-1 was from Santa Cruz.RESULTSp53 Accumulates in a Mutant Conformation When Its Proteasome and MDM2-dependent Degradation Is Inhibited—We wished to test whether endogenous p53 undergoes a conformational change before degradation by the proteasome. Wild-type p53 is stabilized and its levels increase in cells after DNA-damaging stress, and cells undergo G1-or G2-phase cell cycle arrests and DNA repair (28Vousden K.H. Lu X. Nat. Rev. Cancer. 2002; 2: 594-604Crossref PubMed Scopus (2694) Google Scholar). p53 is subsequently degraded, and its levels decrease when DNA repair is complete and cells resume normal cell cycling (29Geyer R.K. Nagasawa H. Little J.B. Maki C.G. Cell Growth Differ. 2000; 11: 149-156PubMed Google Scholar, 30Joseph T.W. Zaika A. Moll U.M. FASEB J. 2003; 17: 1622-1630Crossref PubMed Scopus (40) Google Scholar). p53 degradation during stress recovery is believed to be MDM2-dependent (29Geyer R.K. Nagasawa H. Little J.B. Maki C.G. Cell Growth Differ. 2000; 11: 149-156PubMed Google Scholar, 30Joseph T.W. Zaika A. Moll U.M. FASEB J. 2003; 17: 1622-1630Crossref PubMed Scopus (40) Google Scholar). In preliminary experiments we first monitored p53 levels in MCF7 cells exposed to actinomycin D (ActD) for 4 h and then allowed them to recover from ActD treatment for various time periods (Fig. 1A). p53 levels were increased after 4 h of ActD treatment, remained elevated for 7 h after removal of ActD, and subsequently decreased at the 10, 12, 16, and 20 h time points. These results suggest p53 degradation resumes between 7 and 10 h after ActD removal. MDM2 levels were also increased in cells exposed to ActD for 4 h and remained elevated at all time points after removal of ActD with a peak at 7 h. Next, we tested whether the decrease in p53 levels after ActD removal could be blocked by proteasome inhibition. As shown in Fig. 1B, p53 levels were increased by ActD treatment for 3 h, remained elevated 6 h after ActD removal, and were decreased 12 h after ActD removal. In contrast, the decrease in p53 levels between 6-12 h after ActD removal was blocked in cells treated with the proteasome inhibitor MG132 (compare p53 levels in lanes 4 and 5, Fig. 1B). This indicates the decrease in p53 levels between 6 and 12 h after ActD removal is proteasome-dependent. Finally, we monitored p53 conformation in response to ActD treatment and during recovery in which it was undergoing proteasomal degradation. Treated cell lysates were immunoprecipitated with wild-type conformation-specific (pAb1620) or mutant conformation-specific (pAb240) p53 antibodies followed by immunoblotting with the p53 antibody Ab-7. p53 immunoprecipitated by each antibody in these experiments is an indicator of p53 conformation. As shown in Fig. 1C, p53 displayed a mostly wild-type conformation (recognized by the wild-type conformation-specific antibody but not the mutant conformation-specific antibody) in cells treated with ActD for 3 h and in cells 6 h after ActD removal. At the 12-h time point after ActD removal, when p53 levels were decreased, p53 appeared to be evenly distributed between a wild-type and mutant conformation. Strikingly, however, p53 accumulated in a mutant (pAb240-reactive) conformation when its proteasomal degradation between 6 and 12 h after ActD removal was blocked by MG132 treatment, and abundant MDM2 binding to p53 was also observed (Fig. 1C). This suggests p53 undergoing proteasomal degradation during recovery from stress treatment may assume a mutant conformation before degradation.Wild-type p53 undergoes proteasome-dependent degradation when co-expressed with excess MDM2. We monitored p53 conformation under conditions in which it was being targeted for degradation by MDM2 in co-transfected cells. U2OS cells were transfected with DNAs encoding FLAG-tagged p53 either alone or with excess MDM2. In some cases cells were treated with MG132 to inhibit the proteasome before harvesting, and p53 and MDM2 levels were assessed. As expected, p53 levels decreased with MDM2 co-expression, and this decrease was blocked by proteasome inhibitor treatment (Fig. 2A). This is consistent with MDM2 promoting p53 degradation in a proteasome-dependent manner. Next, we monitored p53 conformation in the transfected cell lysates. As shown in Fig. 2B, FLAG p53 maintained a mostly wild-type conformation when expressed alone and, whereas p53 levels decreased with co-expression of MDM2, there appeared to be a slight shift toward the mutant conformation. Importantly, blocking p53 degradation by proteasome inhibition caused an increase in mutant conformation p53 and decrease in wild-type conformation p53 (Fig. 2B), suggesting a shift from wild-type to mutant conformation before p53 degradation.FIGURE 2p53 accumulates in a mutant conformation when its MDM2-dependent degradation is blocked by proteasome inhibition. A, U2OS cells were transfected with DNA encoding FLAG p53 (100 ng) either alone or with MDM2 (1 μg). Where indicated cells were treated with MG132 (30 μm final concentration, 5.5 h treatment) 17 h after transfection. Transfected cell lysates were examined by immunoblotting with anti-FLAG (p53) and anti-MDM2 antibodies. B, transfected cell lysates were immunoprecipitated with wild-type conformation-specific (W, pAb1620) or mutant conformation-specific (M, pAb240) antibodies and examined by immunoblotting with an anti-FLAG monoclonal antibody and MDM2 antibody SMP-14. The lower band indicated by the asterisk is detection of the antibody heavy used in the immunoprecipitation. The upper band indicated by the arrow is FLAG p53.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Ubiquitinated p53 and a p53-Ubiquitin Fusion Protein Have a Mostly Mutant Conformation—MDM2 is an E3-ligase that can ubiquitinate p53 to promote its degradation. This led us to examine the conformation of wild-type p53 that is ubiquitinated by MDM2. To this end, U2OS cells were transfected with DNAs encoding FLAG p53, MDM2, and Myc-tagged ubiquitin (Myc-Ub), in different combinations (Fig. 3A). Myc-Ub was included in these experiments to facilitate detection of ubiquitinated p53 species. In some cases transfected cells were treated with MG132 to inhibit the proteasome before analysis. As shown in Fig. 3A, p53 levels decreased when co-expressed with MDM2 alone or MDM2 plus Myc-Ub, and this decrease was blocked by MG132. This is consistent with MDM2 promoting p53 degradation by the proteasome. Transfected cell lysates were then immunoprecipitated with wild-type (pAb1620) or mutant (pAb240) conformation-specific p53 antibodies and examined by immunoblotting with anti-FLAG antibody. FLAG p53 maintained a mostly wild-type conformation when expressed alone (Fig. 3B, middle panel). When p53 was co-expressed with excess MDM2 alone or MDM2 plus Myc-Ub, the p53 that remained appeared to be shifted slightly toward a more mutant conformation (Fig. 3B, middle panel). Consistent with Fig. 2, p53 again accumulated in a mutant conformation when its degradation by MDM2 alone or MDM2 plus Myc-Ub was blocked by proteasome inhibitor treatment (+MG132 samples, Fig. 3B, middle panel). Long exposures of the film in Fig. 3B, middle panel, were used to assess conformation of ubiquitinated p53 in higher molecular weight, p53-ubiquitin conjugates. In each case where ubiquitinated p53 could be observed, it displayed a mutant or mostly mutant conformation (Fig. 3B, upper panel). We noted in some, but not all experiments that ubiquitinated p53 levels were somewhat decreased with MG132 treatment (as example, compare ubiquitinated p53 levels with MDM2 and Myc-Ub alone versus MDM2, Myc-Ub, and MG132, Fig. 3B). This is consistent with reports that endogenous, ubiquitinated p53 levels decreased in MG132-treated cells (31Maki C.G. Huibregtse J.M. Howley P.M. Cancer Res. 1996; 56: 2649-2654PubMed Google Scholar). To examine the conformation of ubiquitinated p53 further, we made use of a p53-ubiquitin fusion protein (p53-Ub) believed to mimic mono-ubiquitination of the p53 C terminus (25Li M. Brooks C.L. Wu-Baer F. Chen D. Baer R. Gu W. Science. 2003; 302: 1972-1975Crossref PubMed Scopus (628) Google Scholar). p53/MDM2 double-null cells were transfected with DNAs encoding wild-type p53 or p53-Ub, and conformation of the expressed proteins was monitored. As shown in Fig. 4, wild-type p53 had a mostly wild-type conformation, whereas the p53-Ub fusion protein had a completely mutant (pAb240-reactive) conformation. These results were confirmed in duplicate experiments in Fig. 4 and support the idea that ubiquitinated wild-type p53 has a mutant conformation.FIGURE 3Ubiquitinated p53 accumulates in a mutant conformation after proteasome inhibition. A, U2OS cells were transfected with DNAs encoding FLAG p53 (100 ng), MDM2 (1 mg), and Myc-Ub (200 ng) as indicated. In some cases cells were treated with MG132 (30 μm final concentration, 5.5 h treatment) 17 h after transfection. FLAG p53 and MDM2 levels are shown. Tubulin is a loading control. B, transfected cell lysates were immunoprecipitated with wild-type conformation-specific (W, pAb1620) or mutant conformation-specific (M, pAb240) antibodies followed by immunoblotting with an anti-FLAG antibody or anti-MDM2 antibody. The lower band indicated by the asterisk is detection of the antibody heavy used in the immunoprecipitation. The upper band indicated by the arrow is FLAG p53. Shorter exposure of the FLAG blot (middle panel) shows conformation of the non-ubiquitinated p53 in each condition. Longer exposure (upper panel) allows detection of ubiquitinated p53.View Large Image Figure ViewerDownload Hi-res image Download (PPT)FIGURE 4p53 ubiquitin fusion protein has a mutant conformation. MDM2/p53 double-knock-out mouse embryo fibroblasts were transfected in duplicate with DNA encoding untagged wild-type p53 or a p53-ubiquitin (p53-Ub) fusion protein. Transfected cell lysates were immunoprecipitated with wild-type conformation-specific (W, pAb1620) or mutant conformation-specific (M, pAb240) antibodies, followed by immunoblotting with the anti-p53 polyclonal antibody Ab-7. The bands indicated by the arrows are full-length wild-type p53 and the p53-Ub fusion protein. The low molecular weight bands below the full-length proteins may represent an internal translation product of p53.View Large Image Figure ViewerDownload Hi-res image Download (PPT)MDM2 Binding Promotes a Conformational Change in p53—We noted that when p53 is stabilized by proteasome inhibition, it accumulates mostly as a full-length band that is not obviously modified (not ubiquitinated). This led us to suspect that conformational change in p53 may precede its ubiquitination by MDM2. Efficient p53 degradation requires MDM2 input amounts be in excess to p53 (25Li M. Brooks C.L. Wu-Baer F. Chen D. Baer R. Gu W. Science. 2003; 302: 1972-1975Crossref PubMed Scopus (628) Google Scholar). To test if MDM2 binding can affect p53 conformation, cells were transfected with equal amounts (1 μg of each) DNA encoding FLAG-tagged p53 and MDM2. p53 is not efficiently degraded by MDM2 under these conditions (25Li M. Brooks C.L. Wu-Baer F. Chen D. Baer R. Gu W. Science. 2003; 302: 1972-1975Crossref PubMed Scopus (628) Google Scholar), and we could, therefore, monitor its conformation while maintaining protein levels. p53 conformation was then monitored by IP with the conformation-specific antibodies followed by probing with anti-FLAG antibody. As shown in Fig. 5B, p53 wild type (wt) had a mostly wild-type conformation when expressed alone. However, co-expression with MDM2 caused an accumulation of p53 with a mutant conformation. This effect required MDM2 binding to the p53 N terminus since p53 Δ42N, which lacks the N-terminal MDM2 binding site, did not accumulate in a mutant conformation when expressed with MDM2 and did not bind MDM2 (Fig. 5B). We also tested if the MDM2 RING-finger domain was required for this effect. MDM2 ΔRING can bind p53 but is unable to promote p53 ubiquitination. As shown in Fig. 5B, co-expression with MDM2 ΔRING also caused an accumulation of p53 in a mutant conformation, indicating that MDM2 ubiquitination activity is not required. It is important that p53 levels remained comparable throughout this experiment or decreased slightly with expression of MDM2 wt (levels Fig. 5A). This indicates accumulation of mutant conformation p53 is not due to an overall increase in p53 levels. These results suggest MDM2 binding can promote a p53 conformational change, evidenced by exposure of the mutant (pAb240) epitope.FIGURE 5MDM2 binding exposes the mutant (pAb-240) epitope in wild-type p53. U2OS cells were transfected with DNA encoding FLAG p53 wt or FLAG p53 Δ42N either alone or with DNA encoding MDM2 that was wt or lacked the RING-finger domain that is required for ubiquitination activity (ΔRING). A, immunoblotting shows the levels of FLAG p53 and MDM2 proteins. Tubulin levels were used as a loading control. B, transfected cell lysates were immunoprecipitated (IP) with wild-type conformation-specific (W, pAb1620) or mutant conformation-specific (M, pAb240) antibodies followed by immunoblotting (IB) with anti-FLAG antibody and anti-MDM2 antibody.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Hsp90 Inhibition and MDM2 Cause Pronounced p53 Conformational Change—We noted that a significant portion of p53 remained in a wild-type conformation when expressed with MDM2, apparently resistant to conformational changes that might be caused by MDM2 binding. Based on this, we speculated one or more factors might associate with wild-type p53 and oppose conformational changes caused by MDM2. Hsp90 seemed a likely candidate since it has been reported to maintain wild-type p53 conformation and activity (10Walerych D. Kudla G. Gutkowska M. Wawrzynow B. Muller L. King F.W. Helwak A. Boros J. Zylicz A. Zylicz M. J. Biol. Chem. 2004; 279: 48836-48845Abstract Full Text Full Text PDF PubMed Scopus (131) Google Scholar, 12Muller P. Ceskova P. Vojtesek B. J. Biol. Chem. 2005; 280: 6682-6691Abstract Full Text Full Text PDF PubMed Scopus (55) Google Scholar). To examine the effects of MDM2 and Hsp90 on p53 conformation, and we made use of three different Hsp90 inhibitor compounds; the ansamycin antibiotic GA, 17-AAG (a derivative of GA), and radicicol. Radicicol is unrelated structurally to either GA or 17-AAG. Cells transfected with FLAG-tagged p53 and MDM2 DNA (1 μg each) were either untreated or treated with GA, 17-AAG, or radicicol to inhibit endogenous Hsp90 protein

Nutlin-3a is a preclinical drug that stabilizes p53 by blocking the interaction between p53 and MDM2. In our previous study, Nutlin-3a promoted a tetraploid G1 arrest in two p53 wild-type cell lines (HCT116 and U2OS), and both cell lines underwent endoreduplication after Nutlin-3a removal. Endoreduplication gave rise to stable tetraploid clones resistant to therapy-induced apoptosis. Prior knowledge of whether cells are susceptible to Nutlin-induced endoreduplication and therapy resistance could help direct Nutlin-3a-based therapies. In the present study, Nutlin-3a promoted a tetraploid G1 arrest in multiple p53 wild-type cell lines. However, some cell lines underwent endoreduplication to relatively high extents after Nutlin-3a removal whereas other cell lines did not. The resistance to endoreduplication observed in some cell lines was associated with a prolonged 4N arrest after Nutlin-3a removal. Knockdown of either p53 or p21 immediately after Nutlin-3a removal could drive endoreduplication in otherwise resistant 4N cells. Finally, 4N-arrested cells retained persistent p21 expression; expressed senescence-associated β-galactosidase; displayed an enlarged, flattened phenotype; and underwent a proliferation block that lasted at least 2 weeks after Nutlin-3a removal. These findings demonstrate that transient Nutlin-3a treatment can promote an apparently permanent proliferative block in 4N cells of certain cell lines associated with persistent p21 expression and resistance to endoreduplication. Nutlin-3a is a preclinical drug that stabilizes p53 by blocking the interaction between p53 and MDM2. In our previous study, Nutlin-3a promoted a tetraploid G1 arrest in two p53 wild-type cell lines (HCT116 and U2OS), and both cell lines underwent endoreduplication after Nutlin-3a removal. Endoreduplication gave rise to stable tetraploid clones resistant to therapy-induced apoptosis. Prior knowledge of whether cells are susceptible to Nutlin-induced endoreduplication and therapy resistance could help direct Nutlin-3a-based therapies. In the present study, Nutlin-3a promoted a tetraploid G1 arrest in multiple p53 wild-type cell lines. However, some cell lines underwent endoreduplication to relatively high extents after Nutlin-3a removal whereas other cell lines did not. The resistance to endoreduplication observed in some cell lines was associated with a prolonged 4N arrest after Nutlin-3a removal. Knockdown of either p53 or p21 immediately after Nutlin-3a removal could drive endoreduplication in otherwise resistant 4N cells. Finally, 4N-arrested cells retained persistent p21 expression; expressed senescence-associated β-galactosidase; displayed an enlarged, flattened phenotype; and underwent a proliferation block that lasted at least 2 weeks after Nutlin-3a removal. These findings demonstrate that transient Nutlin-3a treatment can promote an apparently permanent proliferative block in 4N cells of certain cell lines associated with persistent p21 expression and resistance to endoreduplication.

p21 is a member of the Cip/Kip family of cyclin-dependent kinase (CDK) inhibitors that includes p21, p27, and p57. Recent studies have suggested that Cdk2 activity may promote p21 degradation through a pathway similar to that for p27, although the mechanism by which this occurs has not been clarified. In the current report, co-expression with cyclin E and Cdk2 stabilized p21 in a manner that required the CDK-binding site of p21 and a cyclin-binding site (cy1) located in the p21 N terminus. Strikingly, however, a kinase-dead Cdk2 mutant stabilized p21 to a greater extent than did wild-type Cdk2, consistent with the notion that Cdk2 activity can destabilize p21. The ability of wild-type Cdk2 to destabilize p21 required a potential Cdk2 phosphorylation site in p21 at serine 130 and an intact cyclin-binding motif (cy2) in the p21 C terminus. Finally, p21 was phosphorylated by Cdk2 at Ser-130 <i>in vitro</i>, and this ability of Cdk2 to phosphorylate p21 was dependent, in large part, on the presence of cy2. These results support a model in which active Cdk2 destabilizes p21 via the cy2 cyclin-binding motif and p21 phosphorylation.

MDM2 can bind the N terminus of p53 and promote its ubiquitination and export from the nucleus to the cytoplasm, where p53 can then be degraded by cytoplasmic proteasomes. Several studies have reported that an intact MDM2 binding domain is necessary for p53 to be targeted for ubiquitination, nuclear export, and degradation by MDM2. In the current study, we examined whether the MDM2 binding domain of p53 could be provided in <i>trans</i>through oligomerization between two p53 molecules. p53 proteins mutated in their MDM2 binding domains were unable to bind MDM2 directly and were resistant to MDM2-mediated ubiquitination, nuclear export, and degradation when expressed with MDM2 alone. However, these same p53 mutants formed a complex with MDM2 and were efficiently ubiquitinated, exported from the nucleus, and degraded when co-expressed with MDM2 and wild-type p53. Moreover, this effect required MDM2 binding by wild-type p53 as well as oligomerization between wild-type p53 and the MDM2 binding-deficient p53 mutants. Taken together, these results support a model whereby MDM2 binding-deficient forms of p53 can bind MDM2 indirectly through oligomerization with wild-type p53 and are subsequently targeted for ubiquitination, nuclear export, and degradation. These findings may have important implications regarding the DNA damage response of p53.

The p53-family of proteins, including p53, p63, and p73, shares a high degree of structural similarity and can carry out some redundant functions. However, mechanisms that regulate the localization and activity of these proteins have not been fully clarified. In this study, a nuclear localization signal (NLS) was identified in p73, which is required for p73 nuclear import and which could promote the nuclear import of a heterologous, cytoplasmic protein. Mutants lacking the NLS localized to the cytoplasm and displayed diminished transcriptional activity. A nuclear export signal (NES) was also recognized in p73s C terminus, the deletion of which caused p73 to display a more nuclear localization pattern. This NES was sensitive to leptomycin B and could function as an independent export signal when fused to a heterologous protein. Interestingly, p73 mutant proteins lacking the NLS or the NES were more stable than wild-type p73, suggesting that nuclear import and nuclear export are required for efficient p73 degradation. Our results indicate that p73 localization is controlled by both nuclear import and export and suggest that the overall distribution of p73 is likely to result from the balance between these two processes. Proper control of nuclear import and export is likely to be an important regulatory determinant of p73. The p53-family of proteins, including p53, p63, and p73, shares a high degree of structural similarity and can carry out some redundant functions. However, mechanisms that regulate the localization and activity of these proteins have not been fully clarified. In this study, a nuclear localization signal (NLS) was identified in p73, which is required for p73 nuclear import and which could promote the nuclear import of a heterologous, cytoplasmic protein. Mutants lacking the NLS localized to the cytoplasm and displayed diminished transcriptional activity. A nuclear export signal (NES) was also recognized in p73s C terminus, the deletion of which caused p73 to display a more nuclear localization pattern. This NES was sensitive to leptomycin B and could function as an independent export signal when fused to a heterologous protein. Interestingly, p73 mutant proteins lacking the NLS or the NES were more stable than wild-type p73, suggesting that nuclear import and nuclear export are required for efficient p73 degradation. Our results indicate that p73 localization is controlled by both nuclear import and export and suggest that the overall distribution of p73 is likely to result from the balance between these two processes. Proper control of nuclear import and export is likely to be an important regulatory determinant of p73. The p53 family of proteins includes three members, p53, p63, and p73. Each of these three proteins share a high degree of amino acid sequence similarity and contain common functional domains, including an N-terminal transactivation domain, a central DNA binding domain, and a C-terminal oligomerization domain (1.Kaghad M. Bonnet H. Yang A. Creancier L. Biscan J.C. Valent A. Minty A. Chalon P. Lelias J.M. Dumont X. Ferrara P. McKeon F. Caput D. Cell. 1997; 90: 809-819Abstract Full Text Full Text PDF PubMed Scopus (1539) Google Scholar, 2.Yang A. Kaghad M. Wang Y. Gillett E. Fleming M.D. Dotsch V. Andrews N.C. Caput D. McKeon F. Mol. Cell. 1998; 2: 305-316Abstract Full Text Full Text PDF PubMed Scopus (1851) Google Scholar, 3.Osada M. Ohba M. Kawahara C. Ishioka C. Kanamaru R. Katoh I. Ikawa Y. Nimura Y. Nakagawara A. Obinata M. Ikawa S. Nat. Med. 1998; 4: 839-843Crossref PubMed Scopus (475) Google Scholar) (reviewed in Ref. 4.Yang A. McKeon F. Nat. Rev. Mol. Cell. Biol. 2000; 1: 199-207Crossref PubMed Scopus (426) Google Scholar). Given these similarities, it is of interest to determine whether members of the p53 family function in similar or distinct metabolic pathways. p53, p63, and p73 can each activate transcription from reporter genes harboring p53 responsive elements in transient expression assays (1.Kaghad M. Bonnet H. Yang A. Creancier L. Biscan J.C. Valent A. Minty A. Chalon P. Lelias J.M. Dumont X. Ferrara P. McKeon F. Caput D. Cell. 1997; 90: 809-819Abstract Full Text Full Text PDF PubMed Scopus (1539) Google Scholar, 3.Osada M. Ohba M. Kawahara C. Ishioka C. Kanamaru R. Katoh I. Ikawa Y. Nimura Y. Nakagawara A. Obinata M. Ikawa S. Nat. Med. 1998; 4: 839-843Crossref PubMed Scopus (475) Google Scholar,5.Jost C.A. Marin M.C. Kaelin Jr., W. Nature. 1997; 389: 191-194Crossref PubMed Scopus (903) Google Scholar, 6.Zeng X. Chen L. Jost C.A. Maya R. Keller D. Wang X. Kaelin Jr., W. Oren M. Chen J. Lu H. Mol. Cell. Biol. 1999; 19: 3257-3266Crossref PubMed Scopus (304) Google Scholar, 7.Strano S. Munarriz E. Rossi M. Castagnoli L. Shaul Y. Sacchi A. Oren M. Sudol M. Cesareni G. Blandino G. J. Biol. Chem. 2001; 276: 15164-15173Abstract Full Text Full Text PDF PubMed Scopus (358) Google Scholar). Further, each of the p53 family members can activate apoptosis when overexpressed, though to varying extents (2.Yang A. Kaghad M. Wang Y. Gillett E. Fleming M.D. Dotsch V. Andrews N.C. Caput D. McKeon F. Mol. Cell. 1998; 2: 305-316Abstract Full Text Full Text PDF PubMed Scopus (1851) Google Scholar, 5.Jost C.A. Marin M.C. Kaelin Jr., W. Nature. 1997; 389: 191-194Crossref PubMed Scopus (903) Google Scholar). These results suggest that p53 family members may carry out some redundant functions. Despite these similarities, the consequence of loss of p53, p63, and p73 on development and cancer susceptibility are strikingly different. p53 loss-of-function mutations are observed in over 50% of all human cancers, and p53-deficient mice are highly susceptible to the development of cancer (8.Donehower L.A. Harvey M. Slagle B.L. McArthur M.J. Montgomery Jr., C. Butel J.S. Bradley A. Nature. 1992; 356: 215-221Crossref PubMed Scopus (4054) Google Scholar, 9.Vogelstein B. Lane D. Levine A.J. Nature. 2000; 408: 307-310Crossref PubMed Scopus (5850) Google Scholar, 10.Ryan K.M. Phillips A.C. Vousden K.H. Curr. Opin. Cell Biol. 2001; 13: 332-337Crossref PubMed Scopus (583) Google Scholar). Further, Li-Fraumeni syndrome patients are born with germ line mutations in p53 and display an increased susceptibility to multiple cancers. These findings and others have confirmed the role of p53 as a bona fide tumor suppressor. In contrast, mutations in p63 and p73 are not commonly associated with cancer, and p63- and p73-deficient mice display various developmental deficiencies without an apparent increased cancer incidence. p63-deficient mice have severe defects in limb and skin development (11.Yang A. Schweitzer R. Sun D. Kaghad M. Walker N. Bronson R.T. Tabin C. Sharpe A. Caput D. Crum C. McKeon F. Nature. 1999; 398: 714-718Crossref PubMed Scopus (1927) Google Scholar), while p73 deficiency leads to neurological, pheromonal, and inflammatory defects (12.Yang A. Walker N. Bronson R. Kaghad M. Oosterwegel M. Bonnin J. Vagner C. Bonnet H. Dikkes P. Sharpe A. McKeon F. Caput D. Nature. 2000; 404: 99-103Crossref PubMed Scopus (888) Google Scholar). Germ line mutations in p63 have been causally linked to electrodactyly-ectodermal dysplasia-clefting and Hays-Wells syndrome in humans, syndromes characterized by ectrodactyly, ectodermal dysplasia, and facial clefts (13.Celli J. Duijf P. Hamel B.C. Bamshad M. Kramer B. Smits A.P. Newbury-Ecob R. Hennekam R.C. Van Buggenhout G. van Haeringen A. Woods C.G. van Essen A.J. de Waal R. Vriend G. Haber D.A. Yang A. McKeon F. Brunner H.G. van Bokhoven H. Cell. 1999; 99: 143-153Abstract Full Text Full Text PDF PubMed Scopus (581) Google Scholar, 14.McGrath J.A. Duijf P.H. Doetsch V. Irvine A.D. de Waal R. Vanmolkot K.R. Wessagowit V. Kelly A. Atherton D.J. Griffiths W.A. Orlow S.J. van Haeringen A. Ausems M.G. Yang A. McKeon F. Bamshad M.A. Brunner H.G. Hamel B.C. van Bokhoven H. Hum. Mol. Genet. 2001; 10: 221-229Crossref PubMed Scopus (314) Google Scholar). Thus, p63 and p73 appear to play distinct roles in development that are not attributed to p53. Mechanisms that regulate the levels and activity of p53 family members have not been fully clarified. Given their ability to function as transcription factors, one would predict the activity of the p53 family may be tightly correlated with their nuclear localization. Indeed, p53 contains three nuclear localization signals (NLSs) 1The abbreviations used are: NLS(s)nuclear localization signal(s)NES(s)nuclear export signal(s)MDMmurine double minuteLMBleptomycin BHAhemagglutininGFPgreen fluorescent proteinPKpyruvate kinaseCHXcycloheximideYFPyellow fluorescent protein located in the C terminus of the protein, and mutation or deletion of these NLSs leads to the cytoplasmic sequestration of p53 and a consequent decrease in p53 transcriptional activity (15.Liang S.H. Clarke M.F. Oncogene. 1999; 18: 2163-2166Crossref PubMed Scopus (42) Google Scholar, 16.Liang S.H. Clarke M.F. J. Biol. Chem. 1999; 274: 32699-32703Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar, 17.Shaulsky G. Goldfinger N. Ben-Ze'ev A. Rotter V. Mol. Cell. Biol. 1990; 10: 6565-6577Crossref PubMed Scopus (294) Google Scholar, 18.Shaulsky G. Goldfinger N. Tosky M.S. Levine A.J. Rotter V. Oncogene. 1991; 6: 2055-2065PubMed Google Scholar). In addition to nuclear import, the active export of p53 from the nucleus to the cytoplasm has also emerged as an important determinant of activity. p53 contains two nuclear export signals (NESs), one located in its C terminus and the other located in its N terminus (19.Zhang Y. Xiong Y. Science. 2001; 292: 1910-1915Crossref PubMed Scopus (310) Google Scholar, 20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar). Disruption of the C-terminal NES causes p53 to display a more pronounced nuclear localization (20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar). Murine double minute (MDM) 2, the product of a p53-inducible gene, can bind p53 and promote its ubiquitination and subsequent degradation by the proteasome (21.Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3750) Google Scholar, 22.Kubbutat M.H. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2860) Google Scholar). Recent studies indicate that the ability of MDM2 to ubiquitinate p53 promotes the export of p53 from the nucleus to the cytoplasm, where p53 can then be degraded by cytoplasmic proteasomes (23.Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 2: 569-573Crossref PubMed Scopus (297) Google Scholar, 24.Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (288) Google Scholar). In this case, the addition of ubiquitin moieties to p53 is thought to expose the C-terminal NES of p53 to the nuclear export machinery. Mechanisms that regulate the subcellular localization of other p53 family members have not been determined. nuclear localization signal(s) nuclear export signal(s) murine double minute leptomycin B hemagglutinin green fluorescent protein pyruvate kinase cycloheximide yellow fluorescent protein The purpose of the current study was to examine the nuclear import and export of p73. Toward this end, a bipartite NLS was identified in the C terminus of p73, which is required for p73 nuclear import and which can promote nuclear import when fused to a heterologous, cytoplasmic protein. Mutants lacking the NLS localized to the cytoplasm and displayed less transcriptional activity than wild-type p73 in transfected cells. An NES was also identified in the C terminus of p73, the deletion of which caused p73 to display a more nuclear localization pattern. This NES was sensitive to the nuclear export inhibitor leptomycin B (LMB) and could function as an independent export signal when fused to a heterologous protein. These results indicate that p73 localization is controlled by both nuclear import and nuclear export and suggest that the overall distribution of p73 results from the balance between these two processes. Interestingly, p73 mutant proteins lacking either the NLS or the NES were more stable compared with wild-type p73, suggesting that both nuclear import and nuclear export are required for efficient p73 degradation. Hemagglutinin (HA)-tagged wild-type p73α expression DNA was obtained from Frank McKeon (Harvard Medical School). Wild-type MDM2 DNA was obtained from Steve Grossmann (Dana Farber Cancer Institute). HA-tagged p73α Δ1–90 and HA p73α Δ1–138 were generated by PCR using HA wild-type p73α as a template. The 3′ primer for PCR was the SP6 primer, and the 5′ primers were 5′-GGCGGATCCATGTACCCTTACGATGTACCGGATTACGCAGCCAGCGTGCCCACCCACTCG-3′ for HA p73α Δ1–90 and 5′-GGCGGATCCATGTACCCTTACGATGTACCGGATTACGCATCAGCCACCTGGACGTACTCC-3′ for HA p73α Δ1–138. HA p73α 1–348 and HA p73α 1–344 were also made by PCR using HA wild-type p73α as a template. The 5′ primer for PCR was the T7 primer, and the 3′ primers were 5′-GGCTCTAGATCACCGCCGCTTCTTCACACCGG-3′ for HA p73α 1–348 and 5′-GGCTCTAGATCACACACCGGCACCAAGGGC-3′ for HA p73α 1–344. DNAs encoding HA p73α NNII (K345N, K346N, R347I, R348I) and HA p73α NES− (L375A, L377A) were generated using the QuikChange mutagenesis kit (Stratagene). HA wild-type p73α was used as a template, and the following oligonucleotides and their complementary oligonucleotides were used for the mutagenesis: for HA p73α NNII, 5′-GGTGCCGGTGTGAATAATATTATTCATGGAGACGAGGAC-3′; for HA p73α NES−, 5′-GCTGAAAGAGAGCGCTGAGGCGATGGAGTTGGTGC-3′. The double mutant HA p73α NNII NES− was similarly constructed using HA p73α NES− as a template and the same oligonucleotides used for making HA p73α NNII. To construct green fluorescent protein (GFP)-tagged wild-type p73α and p73α NES−, the HA wild-type p73α and HA p73α NES− DNAs were used as PCR templates with the following primers: 5′-GTACGCTAGCAGATCTACCATGGCCCAGTCCACCGCC-3′ as the 5′ primer and 5′-GGCGGATCCAAGTGGATCTCGGCCTCCG-3′ as the 3′ primer. The resulting PCR products were digested with BglII andBamHI and cloned into the corresponding sites in the pEGFP-N1 vector (CLONTECH laboratories). Myc-tagged chicken muscle PK expression DNA was obtained from Gideon Dreyfuss (Howard Hughes Medical Institute) (25.Siomi H. Dreyfuss G. J. Cell Biol. 1995; 129: 551-560Crossref PubMed Scopus (444) Google Scholar). DNA fragments corresponding to amino acids 327–348, 327–344, 329–348, and 91–138 of wild-type p73α were generated by PCR. The resulting PCR products were digested with KpnI and XbaI and subsequently cloned into the corresponding sites in the C terminus of the Myc-PK expression plasmid. The p2YFP vector was obtained from Yanping Zhang (University of Texas). DNA fragments corresponding to amino acids 337–355 of wild-type p53 or p53 NES− (L348A, L350A) (23.Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 2: 569-573Crossref PubMed Scopus (297) Google Scholar), amino acids 364–382 of wild-type p73α or p73α NES−, or amino acids 7–27 of wild-type p73α were made by PCR. The resulting PCR products were digested with NheI and AgeI and subcloned into the corresponding sites in the p2YFP vector. U2OS, Saos-2, or 35–2 cells were grown in minimum essential medium supplemented with 10% fetal bovine serum (FBS), 100 μg/ml penicillin and streptomycin. Transfections for U2OS and Saos-2 cells were done using the calcium phosphate method in 35 mm2 dishes when the cells were ∼80% confluent. Sixteen h after addition of the DNA precipitate, cells were washed and refed with minimum essential medium plus 10% fetal bovine serum. Cell extracts were prepared 8 h later. To measure p73 half-life, cycloheximide (CHX) was added to a final concentration of 25 μg/ml after washing and refeeding, and cell lysates were prepared at various time points after CHX addition. For immunofluorescence staining, cells were plated on glass coverslips and were transfected using the calcium phosphate method for U2OS and Saos-2 cells or using FuGENE 6 (Roche Molecular Biochemicals) for 35–2 cells according to the manufacturer's instruction. 16 h after transfection, cells were either untreated or treated with 30 ng/ml of LMB (Sigma) for 8 h. Cells were then fixed and stained as described previously (26.Inoue T. Geyer R.K. Howard D. Yu Z.K. Maki C.G. J. Biol. Chem. 2001; 276: 45255-45260Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Antibodies used for immunostaining of HA p73α and Myc-PK fusion proteins were the anti-HA monoclonal antibody HA.11 (Babco) and the anti-c-Myc monoclonal antibody Ab-1 (Calbiochem) as the primary antibody, respectively, and fluorescein isothiocyanate-conjugated anti-mouse antibody (Jackson Labs) as the secondary antibody. Antibodies used for MDM2 staining were the anti-MDM2 polyclonal antibody N-20 (Santa Cruz) as the primary antibody and rhodamine red-conjugated anti-rabbit antibody (Jackson Labs) as the secondary antibody. Cell lysates were prepared as described elsewhere (26.Inoue T. Geyer R.K. Howard D. Yu Z.K. Maki C.G. J. Biol. Chem. 2001; 276: 45255-45260Abstract Full Text Full Text PDF PubMed Scopus (49) Google Scholar). Protein extracts were resolved by SDS-PAGE and transferred to a PolyScreen polyvinylidene difluoride transfer membrane (PerkinElmer Life Sciences). The membrane was probed with either an anti-HA monoclonal antibody (HA.11 from Babco), an anti-MDM2 monoclonal antibody (SMP-14 from Santa Cruz), or an anti-p21 monoclonal antibody (PharMingen). Mechanisms that regulate the subcellular distribution of p73 have not been determined. To address this question, epitope-tagged (HA-tagged) wild-type p73 and various N- and C-terminal deletion mutants of p73 were transiently expressed in U2OS cells. Localization of the HA-tagged p73 proteins was then determined by immunofluorescence staining using an anti-HA antibody. As shown in Fig. 1 B, HA wild-type p73α localized exclusively to the nucleus in ∼75% of cells in which it was expressed, while in the majority of other cases HA wild-type p73α localized mostly to the nucleus with only weak cytoplasmic staining. To identify sequences that may affect p73 localization, we first examined the p73 primary amino acid sequence for the presence of a potential nuclear localization signal, characterized by a clustering of the basic residues arginine or lysine (Fig. 1 A). This analysis revealed a potential NLS (KKRR) located between residues 345 and 348 (Fig. 1 A). To test whether this sequence contributed to p73α nuclear import, two deletion mutants were generated that lacked the C-terminal amino acids 349–636 (HA p73α 1–348) or 345–636 (HA p73α 1–344), and their localization patterns were assessed. As shown in Fig. 1 B, HA p73α 1–348 localized almost exclusively to the nucleus, similar to wild-type p73α. In contrast, HA p73α 1–344 localized equally to both the nucleus and the cytoplasm. These results are consistent with the hypothesis that residues 345–348 contribute to p73 nuclear import. To test this further, the KKRR sequence between residues 345 and 348 were converted to asparagine and isoleucine to create the clone HA p73α NNII, and localization of this clone was examined. As shown in Fig. 1 B, HA p73α NNII localized exclusively to the cytoplasm of cells in which it was expressed, confirming a role for the KKRR sequence motif in p73 nuclear import. We also examined whether N-terminal sequences might affect p73 localization. Toward this end, deletion mutants of p73α were generated that lacked the N-terminal 90 (HA p73α Δ1–90) or 138 (HA p73α Δ1–138) amino acids, and the localization patterns of these mutants were tested. As shown in Fig. 1 B, HA p73α Δ1–90 localized almost exclusively to the nucleus, similar to HA wild-type p73α. In contrast, HA p73α Δ1–138 localized equally to both the nucleus and the cytoplasm. These results suggested that deletion of one or more sequence elements between residues 91 and 138 can inhibit proper p73 nuclear localization. However, amino acid analysis of residues 91–138 did not reveal any putative NLSs characterized by a clustering of basic amino acids. Recent studies indicate that the primary NLS of p53 is bipartite in structure and includes basic amino acid residues between positions 316–322, as well as basic residues at positions 305 and 306 (15.Liang S.H. Clarke M.F. Oncogene. 1999; 18: 2163-2166Crossref PubMed Scopus (42) Google Scholar, 16.Liang S.H. Clarke M.F. J. Biol. Chem. 1999; 274: 32699-32703Abstract Full Text Full Text PDF PubMed Scopus (110) Google Scholar). Alignment of the p53 and p73 sequences suggested that the p73 NLS may also have a bipartite structure that includes the basic residues between positions 345 and 348, as well as basic residues at positions 327 and 328 (Fig. 2 A). To test this possibility, p73 residues from 327–348 were fused to the cytoplasmic protein PK, and localization of the PK·p73 fusion proteins was determined. In these experiments, the PK·p73 fusion proteins were Myc-tagged, allowing analysis of their localization by immunofluorescence staining with antibodies against the Myc-epitope (25.Siomi H. Dreyfuss G. J. Cell Biol. 1995; 129: 551-560Crossref PubMed Scopus (444) Google Scholar). As shown in Fig. 2 B, Myc-tagged PK localized almost entirely to the cytoplasm of cells in which it was expressed. In contrast, the Myc-tagged PK protein was relocalized to the nucleus when fused to p73 residues 327–348. To test whether residues 345–348 were required for this effect, these residues were deleted from the Myc-PK·p73 fusion protein to generate the clone Myc-PK·p73-(327–344). As shown in Fig. 2 B, the Myc-PK·p73-(327–344) fusion protein failed to enter the nucleus, providing further proof that residues 345–348 are required for the function of the p73 NLS. To test whether residues 327 and 328 also contribute to p73 NLS function, these two residues were deleted from the PK·p73 fusion protein to generate the clone PK·p73-(329–348). As shown in Fig. 2 B, this fusion protein also failed to enter the nucleus. Taken together, these results confirm that residues 327–348 can function as an independent NLS when fused to the cytoplasmic protein PK and that residues 327 and 328, as well as residues 345–348, are required for this activity. The ability of residues 91–138 to function as an NLS when fused to PK was also tested. As shown in Fig. 2 B, the Myc-tagged PK protein remained cytoplasmic when fused to p73 residues 91–138. These results indicate that p73 residues 91–138 do not contain any independent nuclear import sequences. Given these results, we suspect that deletion of p73 residues between positions 91–138 may inadvertently affect p73 protein structure in such a way that inhibits its proper nuclear localization. p53 contains a leucine-rich NES located in its C terminus (20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar). Mutations within this NES inhibit p53 nuclear export, and thus mutants lacking the NES display a more pronounced nuclear localization (20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar, 23.Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 2: 569-573Crossref PubMed Scopus (297) Google Scholar,24.Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (288) Google Scholar). p73 contains a sequence similar to the p53 NES in its C terminus (Fig. 3 A). However, it has not yet been clarified whether p73 is subject to active nuclear export and whether this putative NES in p73 plays a role in this process. To address these questions, we utilized the nuclear export inhibitor LMB. First, U2OS cells were transfected with DNAs encoding either HA-tagged or GFP-tagged p73α and were subsequently untreated or exposed to LMB to inhibit nuclear export. Localization of the transfected p73 proteins was then determined by immunofluorescence staining. In these experiments, HA-tagged p73α localized exclusively to the nucleus in ∼60% of untreated cells in which it was expressed, and GFP-tagged p73α localized to the nucleus in ∼75% of transfected cells (Fig. 3 B). In contrast, the percentage of cells in which the HA-tagged p73α displayed an exclusively nuclear staining pattern increased to ∼80% following LMB treatment, and the percentage of cells in which GFP-tagged p73α localized to the nucleus only increased to ∼95%. These results suggested that p73α is actively exported from the nucleus to the cytoplasm and that this occurs in a LMB-sensitive manner. To investigate this further, the putative NES in the C terminus of p73 was mutated to generate the clone HA p73α NES−, and localization of the resulting mutant protein was monitored in transfected cells. As shown in Fig. 3 B, HA p73α NES− displayed a more pronounced nuclear staining pattern than did HA wild-type p73α (97% nuclear only for HA p73α NES−versus 62% nuclear only for HA wild-type p73α). Similarly, GFP p73α NES− also displayed a more nuclear staining pattern than did GFP wild-type p73α (99% versus 75%). These results suggested that p73 nuclear export requires an intact NES in the p73 C terminus. To gain further evidence for the role of the C-terminal NES in p73 nuclear export, we made use of the p73 mutant HA p73α NNII (Fig. 1 B), which localizes exclusively to the cytoplasm but maintains an intact NES. As shown in Fig. 3 C, the HA p73α NNII mutant localized almost exclusively to the cytoplasm when expressed in either U2OS or 35–2 (p53-null/MDM2-null) cells. In contrast, LMB-treatment caused a marked shift of this mutant toward a more nuclear localization pattern in both cell types. These results suggest that the cytoplasmic localization of HA p73α NNII results from both diminished nuclear import and continued nuclear export that is mediated by the NES. To test this further, we mutated the NES in the HA p73α NNII mutant, to generate the double-mutant HA p73α NNII NES−. As shown in Fig. 3 C, mutation of the NES also caused the HA p73α NNII mutant to shift toward a more nuclear localization pattern. Taken together, the results in Fig. 3 indicate that p73 undergoes active nuclear export in transfected cells and that this export depends on the p73 NES. We next wished to test whether the p73 NES can function as an autonomous export signal when fused to another protein. Toward this end, expression DNAs were generated in which wild-type or mutated NES sequences from p53 or p73 were fused to tandem copies of the YFP(2YFP) (19.Zhang Y. Xiong Y. Science. 2001; 292: 1910-1915Crossref PubMed Scopus (310) Google Scholar). Localization of the resulting fusion proteins was then examined in transiently transfected U2OS cells. As shown in Fig. 4, 2YFP alone displayed a diffuse localization pattern in both the nucleus and cytoplasm of individual cells, with slightly more nuclear accumulation. When residues 337–355 of wild-type p53 (p53 wild-type NES) was fused to 2YFP, this fusion protein was exported from the nucleus and relocalized to the cytoplasm in greater than 50% of cells in which it was expressed, consistent with previous studies (19.Zhang Y. Xiong Y. Science. 2001; 292: 1910-1915Crossref PubMed Scopus (310) Google Scholar). In contrast, a fusion protein of 2YFP with residues 337–355 of p53 in which leucines 348 and 350 were converted to alanines (p53 NES−) was not exported, confirming the importance of these two leucines in the functionality of the p53 C-terminal NES (20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar). Similarly, fusion of 2YFP with residues 364–382 of wild-type p73 (p73 wild-type NES) resulted in striking nuclear export of the fusion protein in greater than 80% of transfected cells (Fig. 4). In contrast, conversion of leucines 375 and 377 in the p73 NES to alanines inhibited export of the 2YFP fusion protein, and LMB treatment also inhibited export of the 2YFP·p73 NES fusion protein. Taken together, these results demonstrate that the p73 NES can function as an autonomous export signal when fused to 2YFP. Similar results were obtained using 35–2 cells (p53 null/MDM2 null), indicating that the autonomous activity of this p73 C-terminal NES requires neither p53 nor MDM2 (data not shown). A recent study demonstrated that p53 contains a second NES in its N terminus between residues 11 and 27 (19). We fused the corresponding region of p73 (residues 7–27) to 2YFP to test whether this region of p73 can also function as an autonomous NES. As shown in Fig. 4, the N-terminal residues 7–27 in p73 failed to promote nuclear export when fused to 2YFP, indicating that these residues cannot function as an autonomous NES. MDM2 can bind the N terminus of both p53 and p73 and has been shown to promote p53 nuclear export. Given that p73 undergoes active nuclear export, we wished to test the effect of MDM2 on the nuclear export of p73. Accordingly, U2OS cells were transfected with DNAs encoding HA wild-type p53 or HA wild-type p73α alone or co-transfected with DNAs encoding MDM2. p53 and p73 localization was then examined by immunofluorescence staining using an anti-HA antibody. As shown in Fig. 5 A, HA wild-type p53 was largely nuclear when expressed alone but was exported from the nucleus and relocalized to the cytoplasm with co-expression of MDM2. This effect was inhibited by treatment of transfected cells with LMB, consistent with previous reports (23.Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 2: 569-573Crossref PubMed Scopus (297) Google Scholar, 24.Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (288) Google Scholar). HA wild-type p73α also localized to the nucleus when expressed alone. Interestingly, however, HA p73α was relatively resistant to MDM2-mediated nuclear export, remaining mostly nuclear in cells in which it was expressed with MDM2 (Fig. 5 B). It should be noted that p73 and MDM2 could form a complex in cells expressing both proteins as determined by co-immunoprecipitation studies (data not shown), indicating that the resistance of p73 to nuclear export by MDM2 did not result from an inability of these two proteins to interact. In a high percentage of cells, HA p73α appeared to co-localize in nuclear aggregates with MDM2 (Fig. 5 B), consistent with previous studies (27.Gu J. Nie L. Kawai H. Yuan Z.M. Cancer Res. 2001; 61: 6703-6707PubMed Google Scholar). The significance of nuclear aggregate formation between p73 and MDM2 is unknown. Nonetheless, these results indicate that p73 is a relatively poor substrate for MDM2-dependent nuclear export when compared with p53 and suggests therefore that the nuclear export of p53 and p73 may be regulated through different mechanisms. Finally, we wished to determine whether the stability and/or activity of p73 was correlated with its subcellular localization. To examine p73 protein stability, U2OS cells were transfected with either HA wild-type p73α, HA p73α NES−, or HA p73α NNII. Transfected cells were then treated with CHX to inhibit de novo protein synthesis, and the steady-state levels of p73α were monitored at different time points after CHX addition. The rate at which p73 levels decrease under these conditions is a measure of protein stability. As shown in Fig. 6 A, the half-life (t 1/2) of HA wild-type p73α was less than 3 h, similar to previous studies which have reported the half-life of p73α to be between 0.5–2 h (28.Gong J.G. Costanzo A. Yang H.Q. Melino G. Kaelin Jr., W. Levrero M. Wang J.Y. Nature. 1999; 399: 806-809Crossref PubMed Scopus (837) Google Scholar, 29.Lee C.W. La Thangue N.B. Oncogene. 1999; 18: 4171-4181Crossref PubMed Scopus (128) Google Scholar). In contrast, HA p73α NES− and HA p73α NNII were more stable than HA wild-type p73α, with half-lives in each case between 6 and 9 h. The fact that both mutants are more stable than wild-type p73 suggests that nuclear import and nuclear export are both required for efficient p73 degradation. p73 can bind to p53-responsive elements and activate transcription of p53-responsive genes, including the genes encoding p21 and MDM2. Accordingly, p21 and MDM2 protein levels were monitored in cells expressing either HA wild-type p73α, HA p73α NES−, HA p73α NNII, or HA p73α NNII NES− to determine the relative ability of these nuclear and cytoplasm-localized HA p73α proteins to activate gene transcription. As shown in Fig. 6 B, p21 and MDM2 protein levels were low in mock-transfected cells. Expression of HA wild-type p73α induced the expression of p21 and MDM2, indicating that p73α could activate transcription of the endogenous p21 and MDM2 genes in these transfected cells. In contrast to wild-type p73α, HA p73α NNII localized largely to the cytoplasm (Fig. 1 B) and was markedly less able to induce p21 and MDM2 expression (Fig. 6 B). These results are consistent with nuclear localization being required for efficient p73α transactivation function. Interestingly, HA p73α NES− was also less active than HA wild-type p73α at inducing p21 and MDM2 expression (Fig. 6 B), despite the fact that HA p73α NES− had a more nuclear localization pattern (Fig. 3 B) and longer half-life (Fig. 6 A) than the wild-type p73 protein. The double mutant HA p73α NNII NES− was also less able to induce p21 and MDM2 expression than HA p73α NNII (Fig. 6 B), although HA p73α NNII NES− displayed a more nuclear localization than HA p73α NNII (Fig. 3 C). These results suggest that mutations in the NES of p73α may have a secondary effect on p73α transcriptional activity in addition to inhibiting nuclear export. Wild-type p53 is expressed at low levels in most normal cells and, at least in some cell types, is localized in the cytoplasm (20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar, 30.Zaika A. Marchenko N. Moll U.M. J. Biol. Chem. 1999; 274: 27474-27480Abstract Full Text Full Text PDF PubMed Scopus (70) Google Scholar). In response to DNA damage and various other stresses, p53 levels increase and the p53 protein accumulates in the nucleus. The stress-induced, nuclear accumulation of p53 is likely to result from both diminished nuclear export and continued nuclear import. Two NESs have been identified in p53, one located within the C-terminal oligomerization domain and the second located within the N-terminal MDM2-binding domain (19.Zhang Y. Xiong Y. Science. 2001; 292: 1910-1915Crossref PubMed Scopus (310) Google Scholar, 20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar). Various studies have suggested that each of these p53 NESs may be susceptible to inhibition following DNA damaging stress. For example, DNA damage-induced phosphorylations in the C terminus of p53 have been reported to increase the formation of p53 tetramers (31.Sakaguchi K. Sakamoto H. Lewis M.S. Anderson C.W. Erickson J.W. Appella E. Xie D. Biochemistry. 1997; 36: 10117-10124Crossref PubMed Scopus (228) Google Scholar). This tetramerization of p53, in turn, is predicted to render the C-terminal NES inaccessible to the export machinery and thus unable to promote nuclear export (20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar). More recent studies have demonstrated that amino acid residues within the N-terminal NES of p53 become phosphorylated following DNA damaging stress and that this phosphorylation inhibits the NES function (19.Zhang Y. Xiong Y. Science. 2001; 292: 1910-1915Crossref PubMed Scopus (310) Google Scholar). Taken together, these findings suggest that the nuclear accumulation of p53 following DNA damage may result, at least in part, from an inhibition of nuclear export mediated by either the N-terminal or C-terminal NESs. p73 is a member of the p53-family of proteins, and shares a high degree of amino acid sequence similarity with p53. Given the similarity between these two proteins, it is of interest to determine whether p73 and p53 are regulated through common or distinct pathways. Like p53, the p73 protein is stabilized and activated in response to certain DNA damaging agents. For example, p73 activation has been demonstrated following exposure to either cisplatin or ionizing radiation, and stabilization of the p73 protein has been reported in response to cisplatin treatment (28.Gong J.G. Costanzo A. Yang H.Q. Melino G. Kaelin Jr., W. Levrero M. Wang J.Y. Nature. 1999; 399: 806-809Crossref PubMed Scopus (837) Google Scholar, 32.Yuan Z.M. Shioya H. Ishiko T. Sun X. Gu J. Huang Y.Y. Lu H. Kharbanda S. Weichselbaum R. Kufe D. Nature. 1999; 399: 814-817Crossref PubMed Scopus (541) Google Scholar). The stabilization and activation of p73 in response to these treatments is thought to require its phosphorylation by the tyrosine kinase c-Abl (28.Gong J.G. Costanzo A. Yang H.Q. Melino G. Kaelin Jr., W. Levrero M. Wang J.Y. Nature. 1999; 399: 806-809Crossref PubMed Scopus (837) Google Scholar). In the current study, we identified a bipartite NLS, which is required for p73 nuclear localization and which can promote the nuclear localization of a normally cytoplasmic protein. In addition, we demonstrate that p73 undergoes active nuclear export and that this export is mediated, at least in part, by an NES located in the p73 C terminus. Presumably, p73 modifications that either promote nuclear import or inhibit nuclear export could also contribute to the activation of p73 in cisplatin or ionizing radiation-treated cells. In this regard, it will be interesting to determine whether the activation and stabilization of p73 in response to these agents is accompanied by its nuclear accumulation, as is the case for p53. Gu et al. (27.Gu J. Nie L. Kawai H. Yuan Z.M. Cancer Res. 2001; 61: 6703-6707PubMed Google Scholar) have generated p53·p73 chimeric proteins to examine the functional differences between various p53 and p73 protein domains. In that study, it was found that a p53·p73 chimera in which the C-terminal p53 NES was replaced by the p73 NES was resistant to MDM2-mediated nuclear export. Based on these findings it was proposed that the p73 NES is non-functional. In the current study, we find that p73 displays a more nuclear localization pattern when its C-terminal NES is disrupted by mutation or when nuclear export is inhibited by LMB treatment. We further show that the p73 C-terminal NES can function as an autonomous nuclear export signal when fused to a heterologous protein. In these experiments the p73 C-terminal NES was a stronger NES when compared with the C-terminal NES of p53 (Fig. 4). These results clearly demonstrate that the NES of p73 is functional and that the p73 protein is subject to active nuclear export. However, the factors and conditions which regulate nuclear export of p53 and p73 are likely to be different. For example, p53 is efficiently exported from the nucleus to the cytoplasm when expressed with MDM2, whereas p73 forms nuclear aggregates with MDM2 and is largely resistant to MDM2-mediated nuclear export (Fig. 5). Why p73 is resistant to nuclear export by MDM2 is not clear. In this regard, a recent study demonstrated that p53 contains a second NES located in its N terminus between residues 11 and 27. Mutations in this NES inhibited p53 nuclear export, and this NES could function as an autonomous export signal when fused to a heterologous protein (19.Zhang Y. Xiong Y. Science. 2001; 292: 1910-1915Crossref PubMed Scopus (310) Google Scholar). In contrast, the corresponding N-terminal region of p73 (residues 7–27) lacked nuclear export function when fused to 2YFP (Fig. 4). Therefore, lack of an active NES in the N terminus of p73 may account, at least in part, for the resistance of p73 to MDM2-mediated nuclear export. A second possibility is that nuclear aggregate formation between p73 and MDM2 may inhibit p73 nuclear export. In any event, the fact that MDM2 is relatively inefficient at promoting p73 nuclear export raises the possibility that the export of p73 is normally mediated by a novel, as yet unidentified factor. Given that p73 can function as a transcription factor, we considered that nuclear import and export might affect p73 transactivation function. Not surprisingly, a nuclear import-deficient form of p73 was less able to activate gene expression in transfected cells (Fig. 6). However, a p73 protein deficient in nuclear export displayed a more nuclear localization pattern but was less able to activate gene expression. These results indicate that mutations within the NES of p73 affect the transactivation function of p73 in addition to blocking nuclear export. p53 binds DNA as a tetramer, and mutations in the p53 NES also inhibit the transactivation function of p53 by blocking or preventing the efficient formation of p53 tetramers (20.Stommel J.M. Marchenko N.D. Jimenez G.S. Moll U.M. Hope T.J. Wahl G.M. EMBO J. 1999; 18: 1660-1672Crossref PubMed Scopus (607) Google Scholar). We suspect that mutations in the p73 NES probably have a similar inhibitory effect on p73 tetramerization and that this might account for the relatively low transcriptional activity of the p73 NES− mutant. We also considered that nuclear import and export may play an important role in regulating p73 protein stability. It has been suggested that p73α is degraded through the ubiquitin proteasome pathway, though factors which might promote p73α degradation through this pathway have not been recognized (29.Lee C.W. La Thangue N.B. Oncogene. 1999; 18: 4171-4181Crossref PubMed Scopus (128) Google Scholar). In the current study, p73 mutant proteins deficient in either nuclear import or nuclear export were more stable than wild-type p73. These results suggest that both nuclear import and nuclear export are required for efficient p73 protein degradation. This may be analogous to p53 in which it has been proposed that p53 is ubiquitinated in the nucleus and then exported to the cytoplasm for degradation by cytoplasmic proteasomes (23.Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 2: 569-573Crossref PubMed Scopus (297) Google Scholar, 24.Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (288) Google Scholar). p73 degradation may occur through a similar mechanism in which p73 enters the nucleus where it is ubiquitinated, followed by its export and degradation in the cytoplasm. Such a model may explain the requirement for nuclear import and nuclear export in p73 degradation. Our results indicate that p73 localization is controlled by both nuclear import and export signals and suggest that the overall distribution of p73 is likely to result from the balance between these two processes. Proper control of nuclear import and export is likely to be an important regulatory determinant of p73.

The effectiveness of DNA damaging chemotherapy drugs can be limited by activation of survival signaling pathways and cell cycle checkpoints that allow DNA repair. Targeting survival pathways and inhibiting cell cycle checkpoints may increase chemotherapy-induced cancer cell killing. AKT and Chk1 are survival and cell cycle checkpoint kinases, respectively, that can be activated by DNA damage. Cisplatin (CP) is a standard chemotherapy agent for osteosarcoma (OS). CP induced apoptosis to varying extents and activated AKT and Chk1 in multiple p53 wild-type and p53-null OS cell lines. A Chk1 inhibitor increased CP-induced apoptosis in all OS cell lines regardless of p53 status. In contrast, an AKT inhibitor increased CP-induced apoptosis only in p53 wild-type OS cells, but not p53 nulll cells. The increased apoptosis in p53 wild-type cells was coincident with decreased p53 protein levels, but increased expression of p53-responsive apoptotic genes Noxa and PUMA. Further studies revealed the inability of AKT inhibitor to CP-sensitize p53-null OS cells resulted from 2 things: 1) AKT inhibition stabilized/maintained p27 levels in CP-treated cells, which then mediated a protective G1-phase cell cycle arrest, 2) AKT inhibition increased the levels of activated Chk1. Finally, schedule dependent inhibition of AKT and Chk1 evaded the protective G1 arrest mediated by p27 and maximized CP-induced OS cell killing. These data demonstrate AKT and Chk1 activation promote survival in CP-treated OS cells, and that strategic, scheduled targeting of AKT and Chk1 can maximize OS cell killing by CP.

The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance.Multiple IGF-1R inhibitors have been developed as potential therapeutics.However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents.The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood.Cisplatin (CP) activated the IGF-1R/ AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells.p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53.These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP.Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status.In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival.In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival.These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival.Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic.

p53 that is activated in response to DNA-damaging stress can induce apoptosis or either transient or permanent cell cycle arrests. Apoptosis and permanent cell cycle arrest (senescence) are bona-fide tumor suppressor mechanisms through which p53 inhibits cancer cell survival. In contrast, transient cell cycle arrests induced by p53 can increase survival by allowing cells time to repair their DNA before proceeding with cell division. Mechanisms that control the choice of response to p53 (apoptosis vs arrest) are not fully understood. There is abundant crosstalk between p53 and the IGF-1R/AKT/mTORC1 signaling pathway. Recent studies indicate this crosstalk can determine the choice of response to p53. These findings have clear implications for the potential use of IGF-1R pathway inhibitors against p53 wild-type or p53-null or mutant cancers.

Abstract Tamoxifen (TAM) is the first-line endocrine therapy for estrogen receptor-positive (ER+) breast cancer (BC). However, acquired resistance occurs in ∼50% cases. Meanwhile, although the PI3K/AKT/mTOR pathway is a viable target for treatment of endocrine therapy-refractory patients, complex signaling feedback loops exist, which can counter the effectiveness of inhibitors of this pathway. Here, we analyzed signaling pathways and metabolism in ER+ MCF7 BC cell line and their TAM-resistant derivatives that are co-resistant to endoxifen using immunoblotting, quantitative polymerase chain reaction, and the Agilent Seahorse XF Analyzer. We found that activation of AKT and the energy-sensing kinase AMPK was increased in TAM and endoxifen-resistant cells. Furthermore, ERRα/PGC-1β and their target genes MCAD and CPT-1 were increased and regulated by AMPK, which coincided with increased fatty acid oxidation (FAO) and autophagy in TAM-resistant cells. Inhibition of AKT feedback-activates AMPK and ERRα/PGC-1β-MCAD/CPT-1 with a consequent increase in FAO and autophagy that counters the therapeutic effect of endoxifen and AKT inhibitors. Therefore, our results indicate increased activation of AKT and AMPK with metabolic reprogramming and increased autophagy in TAM-resistant cells. Simultaneous inhibition of AKT and FAO/autophagy is necessary to fully sensitize resistant cells to endoxifen.

Wild-type p53 is a stress-responsive transcription factor and potent tumor suppressor. P53 activates or represses genes involved in cell cycle progression or apoptosis in order to arrest the cell cycle or induce cell death. Transcription repression by p53 is indirect and requires repressive members of the RB-family (RB1, RBL1, RBL2) and formation of repressor complexes of RB1-E2F and RBL1/RBL2-DREAM. Many aurora kinase A/B (AURKA/B) pathway genes are repressed in a p53-DREAM-dependent manner. We found heightened expression of RBL2 and reduced expression of AURKA/B pathway genes is associated with improved outcomes in p53 wild-type but not p53 mutant non-small cell lung cancer (NSCLC) patients. Knockdown of p53, RBL2, or the DREAM component LIN37 increased AURKA/B pathway gene expression and reduced paclitaxel and radiation toxicity in NSCLC cells. In contrast, pharmacologic inhibition of AURKA/B or knockdown of AURKA/B pathway components increased paclitaxel and IR sensitivity. The results support a model in which p53-RBL2-DREAM-mediated repression of the AURKA/B pathway contributes to tumor suppression, improved tumor therapy responses, and better outcomes in p53 wild-type NSCLCs.

The Jumonji C domain-containing family of histone lysine demethylases (Jumonji KDMs) have emerged as promising cancer therapy targets. These enzymes remove methyl groups from various histone lysines and, in turn, regulate processes including chromatin compaction, gene transcription, and DNA repair. Small molecule inhibitors of Jumonji KDMs have shown promise in preclinical studies against non-small cell lung cancer (NSCLC) and other cancers. However, how these inhibitors influence cancer therapy responses and/or DNA repair is incompletely understood. In this study, we established cell line and PDX tumor model systems of cisplatin and paclitaxel-resistant NSCLC. We showed that resistant cells and tumors express high levels of Jumonji-KDMs. Knockdown of individual KDMs or treatment with a pan-Jumonji KDM inhibitor sensitized the cells and tumors to cisplatin and paclitaxel and blocked NSCLC in vivo tumor growth. Mechanistically, we found inhibition of Jumonji-KDMs triggers APC/Cdh1-dependent degradation of CtIP and PAF15, two DNA repair proteins that promote repair of cisplatin and paclitaxel-induced DNA lesions. Knockdown of CtIP and PAF15 sensitized resistant cells to cisplatin, indicating their degradation when Jumonji KDMs are inhibited contributes to cisplatin sensitivity. Our results support the idea that Jumonji-KDMs are a targetable barrier to effective therapy responses in NSCLC. Inhibition of Jumonji KDMs increases therapy (cisplatin/paclitaxel) sensitivity in NSCLC cells, at least in part, by promoting APC/Cdh1-dependent degradation of CtIP and PAF15.

Three widely studied cell lines were used to examine the nature of the G1 arrest induced in human tumor cells by ionizing radiation and its relation to p53 status. Cell lines MCF-7 and RKO express wild-type p53, whereas HT29 expresses mutant p53. Exponentially growing cells were irradiated with 6 Gy, and the progression of G1 cells into S phase was monitored at regular intervals by flow microfluorimetric and continuous labeling autoradiographic techniques. In some experiments, cells were incubated with Colcemid prior to irradiation in order to block them in mitosis and to prevent the accumulation of cells in the second post-irradiation G1 phase. No evidence of a significant arrest at the first post-irradiation G1-S checkpoint was observed in any of the three cell lines. These results suggest that p53 function alone does not control the progression of irradiated human tumor cells from G1 into S during the first post-irradiation cell cycle. In particular, we found no evidence that radiation induced a prolonged G1 arrest in tumor cells expressing wild-type p53 as has been reported by some investigators.

Abstract MDM2 is an E3 ubiquitin ligase that binds and ubiquitinates the tumor suppressor protein p53, leading to its proteasomal degradation. Nutlin-3a (Nutlin) is a preclinical drug that binds MDM2 and prevents the interaction between MDM2 and p53, leading to p53 stabilization and activation of p53 signaling events. Previous studies have reported that Nutlin promotes growth arrest and/or apoptosis in cancer cells that express wild-type p53. In the current study, Nutlin treatment caused a cytoskeletal rearrangement in p53 wild-type human cancer cells from multiple etiologies. Specifically, Nutlin decreased actin stress fibers and reduced the size and number of focal adhesions in treated cells. This process was dependent on p53 expression but was independent of p21 expression and growth arrest. Consistent with this, Nutlin-treated cells failed to form filamentous actin–based motility structures (lamellipodia) and displayed significantly decreased directional persistence in response to migratory cues. Finally, chemotactic assays showed a p53-dependent/p21-independent decrease in migratory and invasive capacity of Nutlin-treated cells. Taken together, these findings reveal that Nutlin treatment can inhibit the migration and invasion capacity of p53 wild-type cells, adding to the potential therapeutic benefit of Nutlin and other small molecule MDM2 inhibitors. Mol Cancer Ther; 9(4); 895–905. ©2010 AACR.

Glucocorticoid receptor (GR) is a ligand-dependent transcription factor that can promote apoptosis or survival in a cell-specific manner. Activated GR has been reported to inhibit apoptosis in mammary epithelial cells and breast cancer cells by increasing pro-survival gene expression. In this study, activated GR inhibited p53-dependent apoptosis in MCF10A cells and human mammary epithelial cells that overexpress the MYC oncogene. Specifically, GR agonists hydrocortisone or dexamethasone inhibited p53-dependent apoptosis induced by cisplatin, ionizing radiation, or the MDM2 antagonist Nutlin-3. In contrast, the GR antagonist RU486 sensitized the cells to apoptosis by these agents. Apoptosis inhibition was associated with maintenance of mitochondrial membrane potential, diminished caspase-3 and -7 activation, and increased expression at both the mRNA and protein level of the anti-apoptotic PKC family member PKCϵ. Knockdown of PKCϵ via siRNA targeting reversed the protective effect of dexamethasone and restored apoptosis sensitivity. These data provide evidence that activated GR can inhibit p53-dependent apoptosis through induction of the anti-apoptotic factor PKCϵ. Glucocorticoid receptor (GR) is a ligand-dependent transcription factor that can promote apoptosis or survival in a cell-specific manner. Activated GR has been reported to inhibit apoptosis in mammary epithelial cells and breast cancer cells by increasing pro-survival gene expression. In this study, activated GR inhibited p53-dependent apoptosis in MCF10A cells and human mammary epithelial cells that overexpress the MYC oncogene. Specifically, GR agonists hydrocortisone or dexamethasone inhibited p53-dependent apoptosis induced by cisplatin, ionizing radiation, or the MDM2 antagonist Nutlin-3. In contrast, the GR antagonist RU486 sensitized the cells to apoptosis by these agents. Apoptosis inhibition was associated with maintenance of mitochondrial membrane potential, diminished caspase-3 and -7 activation, and increased expression at both the mRNA and protein level of the anti-apoptotic PKC family member PKCϵ. Knockdown of PKCϵ via siRNA targeting reversed the protective effect of dexamethasone and restored apoptosis sensitivity. These data provide evidence that activated GR can inhibit p53-dependent apoptosis through induction of the anti-apoptotic factor PKCϵ.

Autophagy is a mechanism of tamoxifen (TAM) resistance in ER-positive (ER+) breast cancer cells. In this study, we showed in ER+ MCF7 cells that 4-hydroxytamoxifen (4OHTAM) induced cellular nitric oxide (NO) that negatively regulates cellular superoxide (O2-) and cytotoxicity. 4OHTAM stimulated LC3 lipidation and formation of monodansylcadaverine (MDC)-labeled autophagic vesicles dependent on O2-. Depletion of NO increased O2- and LC3 lipidation, yet reduced formation of MDC-labeled autophagic vesicles. Instead, NO-depleted cells formed remarkably large vacuoles with rims decorated by LC3. The vacuoles were not labeled by MDC or the acidic lysosome-specific fluorescence dye acridine orange (AO). The vacuoles were increased by the late stage autophagy inhibitor chloroquine, which also increased LC3 lipidation. These results suggest NO is required for proper autophagic vesicle formation or maturation at a step after LC3 lipidation. In addition, 4OHTAM induced O2--dependent activation of ERK, inhibition of which destabilized lysosomes/autolysosomes upon 4OHTAM treatment and together with depletion of NO led to necrotic cell death. These results suggest an essential role for endogenous NO and ERK activation in the completion of pro-survival autophagy.

Cisplatin is a platinum-based drug that is used for the treatment of a wide-variety of primary human cancers. However, the therapeutic efficacy of cisplatin is often limited by intrinsic or acquired drug resistance. An important goal, therefore, is to identify mechanisms that lead to cisplatin resistance in cancer, and then use this information to more effectively target resistant cells. Cisplatin-resistant clones of the HCT116 cell line underwent a prolonged G2 arrest after cisplatin treatment while sensitive clones did not. The staurosporine analog UCN-01 abrogated this G2 arrest and sensitized the resistant clones to cisplatin. At later time points, 4N arrested cells assumed a tetraploid G1 state that was characterized by depletion of Cyclin A, Cyclin B, and CDC2, and increased expression of p53 and p21, in 4N cells. siRNA-mediated knockdown of p21 abrogated the tetraploid G1 arrest and induced killing that was dependent on p53. The results identify two targetable 4N arrests that can contribute to cisplatin resistance: First, a prolonged G2 arrest that can be targeted by UCN-01, and second, a tetraploid G1 arrest that can be targeted by siRNA against p21.

p53 is stabilized in response to DNA damaging stress. This stabilization is thought to result from phosphorylation in the N-terminus of p53, which inhibits p53:MDM2 binding, and prevents MDM2 from promoting p53 ubiquitination. In this report, the DNA alkylating agents mitomycin C (MMC) and methylmethane sulfonate (MMS), as well as UV radiation, stabilized p53 in a manner independent of phosphorylation in p53 N-terminus. This stabilization coincided with decreased levels of MDM2 mRNA and protein, and a corresponding decrease in p53 ubiquitination. Importantly, MDM2 overexpression inhibited the stabilization of p53 and decrease in ubiquitination following MMC, MMS, and UV treatment. This indicates that downregulation of MDM2 contributes to the stabilization of p53 in response to these agents.

Wild‐type p53 accumulates in the nucleus following stress. Current models suggest this nuclear accumulation involves phosphorylation at p53 N‐terminal sites, and inhibition of murine double minute (MDM)2‐dependent nuclear export. We monitored the effects of stress on MDM2‐dependent nuclear export of wild‐type p53 and a mutant lacking N‐terminal phosphorylation sites. Etoposide and ionizing radiation inhibited nuclear export of wild‐type p53 and the phosphor‐mutant to comparable extents, indicating nuclear export inhibition does not require N‐terminal phosphorylation. Cytoplasmic p53 accumulated in the nucleus of transfected cells treated with the nuclear export‐inhibitor leptomycin B (LMB). Interestingly, LMB caused less p53 nuclear accumulation than stress treatment, suggesting stress‐induced nuclear accumulation of p53 does not result solely from inhibited nuclear export.

P53 wild-type and p53-null or mutant cells undergo a G2-phase cell-cycle arrest in response to ionizing radiation (IR). In this study we examined the effect of heat-shock protein 90 (HSP90) inhibitor, geldanamycin (GA), on IR-induced G2 arrest in human colon adenocarcinoma cells with different p53 status. We show that GA treatment abrogates IR-induced G2-phase arrest in cells null or mutant for p53. Specifically, GA treatment pushed irradiated p53 signaling-defective cells into a premature mitosis characterized by aberrant mitotic figures, increased γH2AX expression and formation of micronucleated cells. Cells expressing wild-type p53 were resistant to GA-induced G2 checkpoint abrogation. Notably, GA treatment decreased levels of G2 regulatory proteins Wee1 and Chk1, and inhibitory phosphorylation of Cdc2, independent of p53 status. Further investigation identified p21 as the potential downstream effector of p53 that mediates resistance to G2 checkpoint abrogation. Clonogenic survival studies demonstrated higher sensitivity to GA alone or combination IR plus GA treatment in p53 and p21-null cells. Collectively, these data demonstrate potential mechanisms through which HSP90 inhibition can enhance the effects of ionizing radiation in p53-compromised cancer cells. Combination IR plus HSP90 inhibitor therapies may be particularly useful in treating cancers that lack wild-type p53.

Wild-type p53 is normally expressed at low levels and inactive due to the action of MDM2, an E3 ubiquitin ligase that binds p53 and promotes its degradation [1,2]. However, p53 is stabilized in response to various stresses, such as DNA damage or inappropriate oncogene signaling, that might otherwise predispose a normal cell toward tumorigenesis [3]. The stress-induced stabilization of p53 results from disruption of p53-MDM2 binding. The majority of stabilized p53 accumulates in the nucleus where it functions as a transcription factor, activating expression of genes that induce either apoptosis or cell cycle arrests that can be either transient (quiescence) or permanent (senescence). Thus, p53 eliminates cells with potentially cancer-promoting lesions by inhibiting their growth or causing them to die. mTOR is a cytoplasmic kinase whose activity is often elevated in cancer [4]. mTOR converts signals from activated growth factor receptors into downstream events that promote cell proliferation and survival. Previous studies have demonstrated cross-talk between the p53 and mTOR signaling pathways. For example, p53 can activate expression of several genes, including TSC2, PTEN, IGF-BP3, and others, whose protein products can directly or indirectly inhibit mTOR activity [5]. These observations make sense given that p53 is a tumor suppressor and mTOR has more an oncogenic role in promoting cancer cell survival and proliferation. However, more recent studies indicate that the outcome of mTOR signaling can be context-dependent. Thus, while mTOR signaling promotes proliferation and survival under normal conditions, mTOR signaling can promote senescence under conditions in which the cell cycle is blocked [6,7]. These observations support mTOR as a hub for receipt of multiple inputs that ultimately determine cell fate. When conditions are favorable mTOR activation promotes proliferation and survival, however, in the context of conflicting signals (e.g. growth factor signaling vs. cell cycle arrest), the effect of mTOR activation is permanent cell cycle exit (senescence). P21 is a cyclin-cdk inhibitor, transcriptional target of p53, and potent inducer of senescence [8,9]. Blagosklonny and colleagues noted that in some cases p53 induction did not induce senescence while ectopic expression of p21 did [10]. This led to them to question the role of p53 in the senescence program, and whether p53 may actively suppress senescence. To address this, they used a cell line in which p21 was expressed from an inducible (IPTG-driven) promoter [11]. In this cell line, transient p21 expression induced by IPTG caused the cells to undergo a senescent arrest characterized by flat-cell phenotype, expression of senescence-associated beta galactosidase, and a complete loss of proliferative potential after IPTG removal [12]. To test the effect of p53 on this senescent arrest, the authors first induced p21 by IPTG, and then induced p53 expression in the same cells by addition of Nutlin-3a, a small molecule MDM2 antagonist and potent p53 stabilizer. Remarkably, cells in which p53 was induced by Nutlin-3a were able to resume cycling and fully recover after IPTG removal. These results indicated that p53 expression converted the senescence response in these cells to quiescence. The suppression of senescence they observed was associated with p53-dependent inhibition of mTOR activity [12]. In the current issue of Aging, Korotchkina et al. [13] demonstrate that shRNA-mediated knockdown of TSC2, a negative regulator of mTOR and p53 target gene [5], imposed senescence in these Nutlin-3a treated cells. The results support a model in which p53 can suppress senescence through upregulation of TSC2 and inhibition of mTOR.

Nutlin-3a is a MDM2 antagonist and preclinical drug that activates p53. Cells with MDM2 gene amplification are especially prone to Nutlin-3a-induced apoptosis, though the basis for this is unclear. Glucose metabolism can inhibit apoptosis in response to Nutlin-3a through mechanisms that are incompletely understood. Glucose metabolism through the pentose phosphate pathway (PPP) produces NADPH that can protect cells from potentially lethal reactive oxygen species (ROS). We compared apoptosis and glucose metabolism in cancer cells with and without MDM2 gene amplification treated with Nutlin-3a. Apoptosis in MDM2-amplified cells was associated with a reduction in glycolysis and the PPP, reduced NADPH, increased ROS, and depletion of the transcription factor SP1, which normally promotes PPP gene expression. In contrast, glycolysis and the PPP were maintained or increased in MDM2 non-amplified cells treated with Nutlin-3a. This was dependent on p53-mediated AKT activation and was associated with maintenance of SP1 and continued expression of PPP genes. Knockdown or inhibition of AKT, SP1, or the PPP sensitized MDM2-non-amplified cells to apoptosis. The data indicate that p53 promotes AKT and SP1-dependent activation of the PPP that protects cells from Nutlin-3a-induced apoptosis. These findings provide insight into how glucose metabolism reduces Nutlin-3a-induced apoptosis, and also provide a mechanism for the heightened sensitivity of MDM2-amplified cells to apoptosis in response to Nutlin-3a.

Triple negative breast cancer (TNBC) is an aggressive breast cancer sub-type with limited treatment options and poor prognosis. Currently, standard treatments for TNBC includes surgery, chemotherapy, and anti-PDL1 therapy. These therapies have limited efficacy in advanced stages. Myeloid-cell leukemia 1 (MCL1) is an anti-apoptotic BCL2 family protein. High expression of MCL1 contributes to chemotherapy resistance and is associated with worse prognosis in TNBC. MCL1 inhibitors are in clinical trials for TNBC, but response rates to these inhibitors can vary and predictive markers are lacking. Currently we identified a 4-member (AXL, ETS1, IL6, EFEMP1) gene signature (GS) that predicts MCL1 inhibitor sensitivity in TNBC cells. Factors encoded by these genes regulate signaling pathways to promote MCL1 inhibitor resistance. Small molecule inhibitors of the GS factors can overcome resistance and sensitize otherwise resistant TNBC cells to MCL1 inhibitor treatment. These findings offer insights into potential therapeutic strategies and tumor stratification for MCL1 inhibitor use in TNBC.

Mimecan is a small leucine-rich proteoglycan that can occur as either keratan sulfate proteoglycan in the cornea or as glycoprotein in many connective tissues. As yet, there is no information on its transcriptional regulation. Recently we demonstrated the presence of eight mimecan mRNA transcripts generated by alternative transcription initiation, alternative polyadenylation, and differential splicing, all of which encode an identical protein. Here we report a conserved consensus p53-binding DNA sequence in the first intron of bovine and human mimecan genes and show that wild-type p53 binds to this sequence in vitro. Co-transfections of Saos-2, HeLa, NIH 3T3, and primary bovine corneal keratocytes with bovine mimecan promoter/luciferase reporter constructs in combination with p53 expression vectors activate the second mimecan promoter through the p53-binding sequence. In addition, we show absence of mimecan expression in different tumors and cancer cell lines, where p53 frequently is inactivated/mutated. Thus, this work provides novel information that links mimecan to the p53 network.

p53 can be regulated through post-translational modifications and through interactions with positive and negative regulatory factors. MDM2 binding inhibits p53 and promotes its degradation by the proteasome, whereas promyelocytic leukemia (PML) activates p53 by recruiting it to multiprotein complexes termed PML-nuclear bodies. We reported previously an in vivo and in vitro interaction between PML and MDM2 that is independent of p53. In the current study, we investigated whether interaction between MDM2 and PML can indirectly affect p53 activity. Increasing amounts of MDM2 inhibited p53 activation by PML but could not inhibit PML-mediated activation of a p53 fusion protein that lacked the MDM2-binding domain. Conversely, increasing amounts of PML could overcome p53 inhibition by MDM2 but could not overcome MDM2-mediated inhibition of a p53 fusion protein that lacked the PML-binding domain. These results demonstrate that MDM2 and PML can antagonize each other through their direct interaction with p53 and suggest the combined effects of MDM2 and PML on p53 function are determined by the relative level of each protein. Furthermore, these results imply that interactions between MDM2 and PML by themselves have little or no effect on p53 activity. p53 can be regulated through post-translational modifications and through interactions with positive and negative regulatory factors. MDM2 binding inhibits p53 and promotes its degradation by the proteasome, whereas promyelocytic leukemia (PML) activates p53 by recruiting it to multiprotein complexes termed PML-nuclear bodies. We reported previously an in vivo and in vitro interaction between PML and MDM2 that is independent of p53. In the current study, we investigated whether interaction between MDM2 and PML can indirectly affect p53 activity. Increasing amounts of MDM2 inhibited p53 activation by PML but could not inhibit PML-mediated activation of a p53 fusion protein that lacked the MDM2-binding domain. Conversely, increasing amounts of PML could overcome p53 inhibition by MDM2 but could not overcome MDM2-mediated inhibition of a p53 fusion protein that lacked the PML-binding domain. These results demonstrate that MDM2 and PML can antagonize each other through their direct interaction with p53 and suggest the combined effects of MDM2 and PML on p53 function are determined by the relative level of each protein. Furthermore, these results imply that interactions between MDM2 and PML by themselves have little or no effect on p53 activity. MDM2 is an oncogene that is frequently overexpressed in various human cancers, including sarcomas, gliomas, melanomas, and breast cancers (1.Landers J.E. Cassel S.L. George D.L. Cancer Res. 1997; 57: 3562-3568PubMed Google Scholar). The primary function of MDM2 is to inhibit the activity of the p53 tumor suppressor protein. p53 inhibits cell proliferation in response to DNA damage and other stresses by activating the transcription of genes that mediate either cell cycle arrest or apoptosis (reviewed in Ref. 2.Ryan K.M. Phillips A.C. Vousden K.H. Curr. Opin. Cell Biol. 2001; 13: 332-337Crossref PubMed Scopus (570) Google Scholar). MDM2 can bind the transactivation domain of p53 and inhibit its ability to activate transcription, and at least three different mechanisms have been described by which this can occur. First, MDM2 binding can block the interaction between p53 and the basal transcription machinery (3.Momand J. Zambetti G.P. Olson D.C. George D. Levine A.J. Cell. 1992; 69: 1237-1245Abstract Full Text PDF PubMed Scopus (2776) Google Scholar, 4.Oliner J.D. Pietenpol J.A. Thiagalingam S. Gyuris J. Kinzler K.W. Vogelstein B. Nature. 1993; 362: 857-860Crossref PubMed Scopus (1297) Google Scholar). Second, MDM2 can promote the ubiquitination of p53 and its subsequent degradation by the proteasome, and there is some evidence that MDM2 functions as a ubiquitin-protein isopeptide ligase that can transfer ubiquitin moieties directly to p53 (5.Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3654) Google Scholar, 6.Honda R. Tanaka H. Yasuda H. FEBS Lett. 1997; 420: 25-27Crossref PubMed Scopus (1585) Google Scholar, 7.Kubbutat M.H. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2810) Google Scholar). Third, MDM2 binding can promote the export of p53 from the nucleus to the cytoplasm (8.Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (285) Google Scholar, 9.Geyer R.K. Yu Z.K. Maki C.G. Nat. Cell Biol. 2000; 2: 569-573Crossref PubMed Scopus (296) Google Scholar). In this case, it has been suggested that MDM2-mediated ubiquitination activates or exposes a nuclear export signal in the p53 C terminus, leading to the export of p53 from the nucleus to the cytoplasm.In addition to inhibiting p53, there is increasing evidence that MDM2 has p53-independent activities that may contribute to its oncogenic properties. This evidence includes the following. First, rare tumors harboring both p53 mutations and MDM2 gene amplifications have been described and are more aggressive than those with alterations in either gene alone (10.Cordon-Cardo C. Latres E. Drobnjak M. Oliva M.R. Pollack D. Woodruff J.M. Marechal V. Chen J. Brennan M.F. Levine A.J. Cancer Res. 1994; 54: 794-799PubMed Google Scholar). This suggests that MDM2 overexpression may accelerate tumor growth even in the absence of functional p53. Second, MDM2 overexpression has been reported to transform cells in culture in the absence of a functioning p53 (11.Dubs-Poterszman M.C. Tocque B. Wasylyk B. Oncogene. 1995; 11: 2445-2449PubMed Google Scholar). Third, targeted MDM2 overexpression in the mammary glands of mice leads to abnormal cell proliferation and mammary hypertrophy to a similar extent in both a p53+/+ and p53-/-background (12.Lundgren K. Montes de Oca Luna R. McNeil Y.B. Emerick E.P. Spencer B. Barfield C.R. Lozano G. Rosenberg M.P. Finlay C.A. Genes Dev. 1997; 11: 714-725Crossref PubMed Scopus (212) Google Scholar). Accordingly, considerable effort has been aimed at identifying targets other than p53 with which MDM2 can interact.The promyelocytic leukemia (PML) 1The abbreviations used are: PMLpromyelocytic leukemiaPML-NBsPML-nuclear bodiesGSTglutathione S-transferaseGFPgreen fluorescent proteinHAhemagglutinin.1The abbreviations used are: PMLpromyelocytic leukemiaPML-NBsPML-nuclear bodiesGSTglutathione S-transferaseGFPgreen fluorescent proteinHAhemagglutinin. protein is a tumor suppressor and the major component of multiprotein nuclear complexes that have been variably termed Kremer bodies, ND10, PODs (for PML oncogenic domains), and PML-nuclear bodies (PML-NBs). These PML-NBs appear as foci within the nucleus when visualized with antibodies against PML or other NB-associated factors (13.Maul G.G. Negorev D. Bell P. Ishov A.M. J. Struct. Biol. 2000; 129: 278-287Crossref PubMed Scopus (235) Google Scholar, 14.Borden K.L.B. Mol. Cell. Biol. 2002; 22: 5259-5269Crossref PubMed Scopus (262) Google Scholar). The PML protein has received considerable attention recently due, at least in part, to its ability to activate p53. PML binds directly with p53 and recruits it to PML-NBs (15.Fogal V. Gostissa M. Sandy P. Zacchi P. Sternsdorf T. Jensen K. Pandolfi P.P. Will H. Schneider C. Del Sal G. EMBO J. 2000; 19: 6185-6195Crossref PubMed Scopus (319) Google Scholar). Current models suggest that recruitment to PML-NBs activate p53 by bringing it in close proximity with CBP/p300 (16.Pearson M. Pelicci P.G. Oncogene. 2001; 49: 7250-7256Crossref Scopus (103) Google Scholar). Acetylation of p53 by CBP/p300 then increases p53 DNA binding affinity, leading to an activation of p53-responsive genes. This activation of p53 likely contributes to the tumor suppressor function of PML. We observed previously (17.Wei X. Yu Z.K. Ramalingam A. Grossman S.R. Yu J.H. Bloch D.B. Maki C.G. J. Biol. Chem. 2003; 278: 29288-29297Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) an interaction between PML and MDM2 that is independent of p53. In those studies, MDM2 could be immunoprecipitated with PML in cells transiently overexpressing both proteins, and recombinant MDM2 produced in insect cells formed a strong complex with a bacterially expressed GST-PML fusion protein. Moreover, confocal microscopy revealed a low level association between the endogenous PML and MDM2 proteins in cells. These results demonstrated that MDM2 and PML can interact with each other in a manner independent of p53 and suggested that this may be a direct interaction. The purpose of the current study was to investigate further the interaction between PML and MDM2, and to assess whether this interaction can indirectly influence p53 activity. The interaction between MDM2 and PML is complex and mediated by multiple regions of each protein. p53, MDM2, and PML can colocalize in PML-NBs with one another, and this can occur in the absence of p53:MDM2 binding. Finally, MDM2 and PML can antagonize each other through their direct interaction with p53.EXPERIMENTAL PROCEDURESPlasmid DNAs—Expression DNA encoding FLAG-tagged, full-length PML IVa (588 amino acids long) was obtained from Zhi-Min Yuan (Harvard School of Public Health). HA-tagged PML IVa was generated from the FLAG-tagged form by PCR. The 3′ primer for PCR was the SP6 primer (Promega), and the 5′ primer was 5′-GCGAATTCACCATGTACCCATACGATGTTCCAGATTACGCTGAGCCTGCACCCGCCCG-3′. DNA encoding GFP-tagged p53 has been described previously (8.Boyd S.D. Tsai K.Y. Jacks T. Nat. Cell Biol. 2000; 2: 563-568Crossref PubMed Scopus (285) Google Scholar) and was obtained from Tyler Jacks (Massachusetts Institute of Technology). DNA encoding wild-type MDM2 and MDM2 Δp53BD was obtained from Steve Grossmann (Dana Farber Cancer Institute). MDM2 Δp53BD lacks the MDM2-binding domain between residues 52 and 96. FLAG-tagged MDM2-(2–202), -(100–304), and -(300–488) were generated by PCR using wild-type MDM2 DNA as a template. For MDM2-(300–488) the 5′ primer was 5′-CCGGGATCCCCAAAGAAGAAGAGGAAGGACTATTGGAAATGCACTTCATGC-3′, and the 3′ primer was 5′-CCGTCTAGATCAAGTTAGCACAATCATTTGAATTGG-3′. The resulting PCR products were digested with BamHI and XbaI, and cloned downstream and in-frame with the FLAG epitope that had been cloned previously into pCDNA3.1. MDM2-(300–488) contains the SV40 large T-antigen nuclear localization signal encoded within the 5′ primer. For MDM2-(2–202) the 5′ primer was 5′-CCGGGATCCTGCAATACCAACATGTCTGTACC-3′ and the 3′ primer was 5′-CCGGAATTCTCATATTACACACAGAGCCAGGC-3′. For MDM2-(100–304) the 5′ primer was 5′-CCGGGATCCTATACCATGATCTACAGGAACTTGG-3′, and the 3′ primer was 5′-CCGGAATTCTCATTTCCAATAGTCAGCTAAGG-3′. The resulting PCR products were digested with BamHI and EcoRI and cloned downstream and in-frame with the FLAG epitope in pCDNA3.1. p53DN:VP16 TAD was generously provided by Jennifer Pietenpol (Vanderbilt University) and encodes the VP16 transactivation domain fused to p53 amino acids 80–393. GAL4 DBD-p53-(1–45) was generated by PCR using wild-type p53 as a template. The 5′ primer was 5′-ACGGGATCCCGTATGGAGGAGCCGCAG-3′, and the 3′ primer was 5′-CGCTCTAGAGCCTCACAGCATCAAATCATC-3′. The resulting PCR product was digested with BamHI and XbaI and cloned into the corresponding sites downstream of GAL4 in pCDNA3. The GAL4-luc reporter was generously provided by Donald Bloch (Massachusetts General Hospital) and contains GAL4 DNA-binding sites upstream of the luciferase gene. The p53-responsive luciferase reporter pG13-luc was a gift from Bert Vogelstein (The Johns Hopkins University).Tissue Culture, Immunoblots, and Immunoprecipitation—35-2 cells (p53 and MDM2 double knock-out) were grown in minimum essential medium supplemented with 10% fetal bovine serum and 100 μg/ml penicillin and streptomycin. U2OS cells (p53 wild-type) were similarly grown. Transfections were done using the FuGENE-6 transfection reagent (Roche Applied Science) according to the manufacturer's protocol. Sixteen to 20 h after starting the transfection, cells were either fixed for immunofluorescence staining or harvested for collection of whole cell lysates. To harvest whole cell extracts, cells were rinsed with phosphate-buffered saline and scraped into 500 μl of lysis buffer (50 mm Tris (pH 7.5), 5 mm EDTA, 150 mm NaCl, 0.5% Nonidet P-40, 1 mm phenylmethylsulfonyl fluoride, 2 μg/ml aprotinin, 5 μg/ml leupeptin). The scraped cells were lysed on ice for 30 min with occasional light vortexing, followed by 15 min of centrifugation to remove cellular debris. For coimmunoprecipitations from transfected cells, 300 μg of transfected cell extract was immunoprecipitated with 0.6 μg of polyclonal anti-FLAG polyclonal antibody (Sigma catalog number F7425). The immunoprecipitates were resolved by SDS-PAGE and transferred to a PolyScreen polyvinylidene difluoride transfer membrane (PerkinElmer Life Sciences). The membrane was probed with an anti-HA monoclonal antibody (HA.11 from Babco).Immunofluorescence Staining—For immunofluorescence staining, cells were plated on glass coverslips and subsequently transfected. The cells were then rinsed with phosphate-buffered saline plus 0.1 mm CaCl2 and 1 mm MgCl2 and fixed with 4% paraformaldehyde for 30 min at 4 °C. Paraformaldehyde was then replaced with 50 mm NH4Cl for 5 min, and cells were permeabilized with 0.1% Triton X-100 plus 0.2% bovine serum albumin. HA-PML staining was carried out using the anti-HA monoclonal antibody HA.11 (Babco) as the primary antibody, and rhodamine-conjugated anti-mouse antibody (The Jackson Laboratory) as the secondary antibody. MDM2 staining was carried out using the anti-MDM2 polyclonal antibody N-20 (Santa Cruz Biotechnology) as the primary antibody, and 7-amino-4-methylcoumarin-3-acetic acid-conjugated anti-rabbit antibody (The Jackson Laboratory) as the secondary antibody. GFP fluorescence was visualized without immunostaining. Specimens were examined under a fluorescence microscope.GST Fusion Protein Production—GST-tagged PML wild-type DNA was generated by PCR using HA-PML (wild-type) as a template. The 3′ primer for PCR was 5′-GGCGCGGCCGCCTCACCAGGAGAACCCACTTTCATTG-3′, and the 5′ primer was 5′-CCGGGATCCGAGCCTGCACCCGCCCGATCTCCG-3′. The resulting PCR product was digested with BamHI and NotI restriction enzymes and cloned into the corresponding sites of pGEX-4T-3. DNAs encoding the GST-tagged proteins were used to transform BL-21 bacterial cells and transformed cells grown at 37 °C until reaching log phase. GST protein expression was induced by incubation in 0.2 mm isopropyl-1-thio-β-galactopyranoside for 3 h. To purify the GST fusion proteins, cells were lysed by sonication in lysis buffer (10 mm Tris-HCl (pH 7.5), 1 mm EDTA, 0.1% Triton X-100, 150 mm NaCl), and the resulting lysate was incubated for 12 h at 4 °C with glutathione-Sepharose beads. The beads were pelleted by centrifugation and washed with lysis buffer. For MDM2 binding, the GST-tagged proteins bound to beads were incubated with 500 μl of whole cell lysate from transfected 35-2 cells for 5–6 h. Unbound MDM2 protein was removed by 5 washes (1 ml each) with lysis buffer. Bound proteins were eluted by boiling for 10 min in 1× loading buffer, resolved by SDS-PAGE, and examined by immunoblot analysis with anti-MDM2 or anti-FLAG antibodies.Luciferase Assays—Luciferase activity was monitored by using either the p53-responsive luciferase reporter gene pG13-luc or the GAL4-responsive luciferase reporter GAL4-luc. 35-2 cells were transfected with either of these two reporter genes and various combinations of p53, MDM2, and PML, as indicated in the text and figure legends. pRL-TK Renilla luciferase reporter DNA (5 ng) was included in all transfections and used to normalize the transfection efficiency. Cell lysates were prepared 20–24 h post-transfection, and luciferase activity was assessed using the dual luciferase assay reporter kit (Promega), according to the manufacturer's instructions.RESULTSThe activity most associated with PML is its ability to bind multiple different proteins and recruit them to PML-NBs (18.Negorev D. Maul G.G. Oncogene. 2001; 20: 7234-7242Crossref PubMed Scopus (232) Google Scholar). We reported recently (17.Wei X. Yu Z.K. Ramalingam A. Grossman S.R. Yu J.H. Bloch D.B. Maki C.G. J. Biol. Chem. 2003; 278: 29288-29297Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar) an in vivo and in vitro interaction between PML and MDM2 that is independent of p53. In that study, recombinant and partially purified human MDM2 protein formed a strong complex with a bacterially expressed GST-PML fusion protein. We wished to characterize the binding between MDM2 and GST-PML further. To this end, 35-2 cells (MDM2 and p53 double-null) were transfected with DNAs encoding either full-length wild-type MDM2 or FLAG-tagged forms of MDM2 that encompassed the N terminus (residues 2–202), central region (residues 100–304), or C terminus (residues 300–488). Transfected cell lysates were then mixed with either GST alone or the GST-PML fusion protein, and MDM2 binding was assessed in GST pull-down assays. As shown in Fig. 1A, wild-type MDM2 was bound by the GST-PML fusion protein but not by GST alone. This is consistent with our previous results and indicates that MDM2 can form a complex with PML. The FLAG-tagged N-terminal, central, and C-terminal regions of MDM2 were also bound by GST-PML but not with GST alone (Fig. 1B). This indicates that multiple regions of MDM2 are capable of interacting with PML, at least in these GST pull-down studies.Given that the function of PML, at least in part, is to interact with and recruit different proteins, it is perhaps not surprising that various regions of MDM2 may associate with one or more regions of PML. We used coimmunoprecipitation experiments to try to map the PML domains that interact with different regions of MDM2 (Fig. 2). Cells were again transfected with DNAs encoding FLAG-tagged MDM2s that encompassed the N terminus (residues 2–202), central region (residues 100–304), or C terminus (residues 300–488). However, in this case, the cells were cotransfected with DNAs encoding HA-tagged fragments of PML that encompassed portions of the N terminus, central region, and C terminus. Our previous results demonstrated that conversion of the lysine at position 160 in PML to arginine (K160R), which inhibits sumoylation at this site, allows a much stronger interaction between PML and wild-type MDM2 (17.Wei X. Yu Z.K. Ramalingam A. Grossman S.R. Yu J.H. Bloch D.B. Maki C.G. J. Biol. Chem. 2003; 278: 29288-29297Abstract Full Text Full Text PDF PubMed Scopus (61) Google Scholar). Therefore, we also included a form of PML that harbored the K160R mutation. Association between the MDM2 and PML fragments was assessed by immunoprecipitation with an anti-FLAG antibody, followed by immunoblotting with an anti-HA antibody. As shown in Fig. 2, the N-terminal portion of MDM2 (residues 2–202) displayed relatively weak binding to PML fragments encoding the N terminus (residues 1–200) and C terminus (residues 200–585 and 300–585) but not did not bind with the PML central region (residues 200–453). In these studies, binding of MDM2-(2–202) to the C-terminal fragments of PML was weaker than its binding to PML residues 1–200. Strikingly, much stronger binding was observed between MDM2-(2–202) and PML residues 1–200 that harbored the K160R mutation. Given that the K160R mutation inhibits sumoylation at this site, this suggests that sumoylation at Lys-160 may inhibit interaction between the MDM2 and PML N-terminal regions. Taken together, these results suggest that the MDM2 N terminus (residues 2–202) interacts primarily with residues 1–200 in non-sumoylated PML but may also interact to a low extent with the C-terminal portion of PML. The C terminus of MDM2 (residues 300–488) also displayed weak binding to PML fragments encoding the N terminus (residues 1–200) and C terminus (residues 200–585 and 300–585) and weaker binding with the PML central region (residues 200–453). However, MDM2-(300–488) displayed much stronger binding to PML residues 1–200 that harbored the K160R mutation, similar to MDM2-(2–202). This suggests that MDM2-(300–488) interacts primarily with residues 1–200 in non-sumoylated PML and to a lesser extent with the C-terminal and central PML regions. The central region of MDM2 (residues 100–304) coimmunoprecipitated with the C-terminal fragments of PML (residues 200–585 and 300–585) but not with PML fragments encoding either the N terminus (residues 1–200) or central (residues 200–453) regions. In these studies, interaction between the PML C terminus and MDM2-(100–304) was somewhat stronger than interaction between the PML C terminus and either the MDM2 N-terminal or C-terminal fragments. This suggests that interactions between MDM2 and the PML C terminus may occur mostly through the MDM2 central region. The fact that the MDM2 central region does not interact with PML residues 1–200 indicates that interaction with this region of PML is specific to the MDM2 N and C terminus. In total, these results indicate that the interactions between PML and MDM2 are complex and can occur through multiple regions of each protein.Fig. 2Coimmunoprecipitation of MDM2 and PML fragments. Cells were transfected with DNAs encoding FLAG-tagged MDM2 N terminus (residues 2–202), the central region (residues 100–304), and the C terminus (residues 301–488). In each case, the cells were cotransfected with DNAs encoding HA-tagged forms of PML that encoded the N terminus (residues 1–200 of wild-type PML or 1–200 the PML K160R mutant), central region (residue 200–453), or C terminus (residues 200–585 and 300–585). Transfected cell lysates were immunoprecipitated (IP) with an anti-FLAG polyclonal antibody, and the immunoprecipitates examined by immunoblotting (IB) with an anti-HA monoclonal antibody. In the upper panels, the arrows indicate the positions of the HA-PML fragments that coimmunoprecipitate with each FLAG-tagged MDM2, and the asterisk marks the antibody heavy chain used in the immunoprecipitation. In the lower panels, transfected cell lysates were examined by immunoblotting with anti-FLAG or anti-HA antibodies without prior immunoprecipitation.View Large Image Figure ViewerDownload Hi-res image Download (PPT)PML and MDM2 have opposing effects on p53. MDM2 binding inhibits p53 and promotes its degradation by the proteasome (5.Haupt Y. Maya R. Kazaz A. Oren M. Nature. 1997; 387: 296-299Crossref PubMed Scopus (3654) Google Scholar, 6.Honda R. Tanaka H. Yasuda H. FEBS Lett. 1997; 420: 25-27Crossref PubMed Scopus (1585) Google Scholar, 7.Kubbutat M.H. Jones S.N. Vousden K.H. Nature. 1997; 387: 299-303Crossref PubMed Scopus (2810) Google Scholar), whereas PML activates p53 by recruiting it into PML-NBs (reviewed in Ref. 16.Pearson M. Pelicci P.G. Oncogene. 2001; 49: 7250-7256Crossref Scopus (103) Google Scholar). To determine whether MDM2 can prevent p53 recruitment to PML-NBS, cells were transfected with DNAs encoding GFP-tagged p53, HA-tagged PML, and MDM2, and localization of the transfected proteins was monitored by immunofluorescence. p53 and MDM2 displayed a diffuse nuclear localization when expressed alone (Fig. 3A). In contrast, both p53 and MDM2 were recruited to PML-NBs in cells coexpressing p53, MDM2, and PML (Fig. 3B). This indicated that MDM2 did not prevent the recruitment of p53 to PML-NBs. To determine whether recruitment of MDM2 to PML-NBs required its interaction with p53, a similar experiment was performed with an MDM2 mutant that lacks the N-terminal p53-binding domain (MDM2 Δp53BD). As shown in Fig. 3B, MDM2 Δp53BD could also be recruited to PML-NBs with PML and wild-type p53, perhaps through interaction with one or more regions of PML. Together, these results indicate that p53, MDM2, and PML can associate in cells in the same PML-NBs and that this can occur in the absence of p53:MDM2 binding.Fig. 3Colocalization of PML, p53, and MDM2 in transfected cells.A, cells were transfected with DNAs encoding GFP-p53 or wild-type MDM2. Localization of MDM2 was monitored by immunofluorescence staining, and GFP-p53 localization was monitored by direct visualization with an immunofluorescence microscope. B, cells were transfected with DNAs encoding HA-PML, GFP-p53, and MDM2 that was either wild type (wt) or lacked the p53-binding domain (MDM2 Δp53BD). Localization of each protein was then examined by immunofluorescence staining. Representative pictures are shown. Both MDM2 wild type and MDM2 Δp53BD could colocalize HA-PML and GFP-p53.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Given these results, we wished to test whether PML and MDM2 can antagonize each other in their regulation of p53. First, cells were transfected with a p53-responsive luciferase gene alone, or with increasing amounts of DNA encoding MDM2 or PML. As shown in Fig. 4A, MDM2 inhibited p53 transcriptional activity in a dose-dependent manner. In these experiments, 40 ng of input MDM2 DNA was the minimal amount that caused a marked inhibition of p53 activity, whereas 80 and 200 ng of input MDM2 DNA caused a more robust inhibition of p53. In contrast, PML activated p53 in a dose-dependent manner, with 1000 ng of input PML DNA causing the most pronounced activation of p53 (Fig. 4B). To examine the combined effect of MDM2 and PML, p53 activity was monitored in cells transfected with increasing amounts of MDM2 DNA (40, 80, or 200 ng) and high amounts of PML (500 and 1000 ng). As shown in Fig. 4C, PML blocked p53 inhibition by MDM2 and activated p53 when 40 ng of MDM2 DNA was used in the transfection. PML also blocked p53 inhibition by MDM2 when 80 ng of MDM2 DNA was used, although under these conditions only slight activation of p53 was observed. In contrast, PML could not block p53 inhibition by MDM2 when 200 ng of MDM2 DNA was used in the transfection. These results indicate that the effects of MDM2 and PML on p53 activity are likely to depend on the relative levels of each protein. Namely, PML can overcome p53 inhibition by relatively low amounts of MDM2 but not high MDM2 amounts. In contrast, high amounts of MDM2 can inhibit the PML-mediated activation of p53.Fig. 4MDM2 and PML antagonize each other to regulate p53.A and B, 35-2 cells were transfected with a p53-responsive luciferase promoter DNA (pG13-luc, 200 ng), wild type p53 DNA (5 ng), and the indicated amounts of wild-type MDM2 (A) and HA PML (B). Luciferase activity was monitored in the transfected cell lysates 24 h post-transfection as a measure of p53 activity. C, 35-2 cells were transfected with the indicated amounts of MDM2 and HA PML DNA. Luciferase activity was monitored in the transfected cell lysates 24 h post-transfection as a measure of p53 activity. RLU, relative light units.View Large Image Figure ViewerDownload Hi-res image Download (PPT)Finally, we wished to test whether p53-independent interactions between PML and MDM2 may indirectly affect p53 activity. To this end, a fusion protein was generated (designated GAL4 DBD-p53-(1–45)) in which the p53 transactivation domain (residues 1–45) is fused to the GAL4 DNA-binding domain. This fusion protein maintains the MDM2-binding function of p53 but lacks the region of p53 (residues 120–290; see Ref. 19.Guo A. Salomoni P. Luo J. Shih A. Zhong S. Gu W. Pandolfi P.P. Nat. Cell Biol. 2000; 2: 730-736Crossref PubMed Scopus (383) Google Scholar) that binds PML. Cells were transfected with GAL4 DBD-p53-(1–45) and a GAL4-responsive luciferase reporter alone or with MDM2 and PML. As shown in Fig. 5, GAL4 DBD-p53-(1–45) activated the GAL4-responsive reporter, and this activation was inhibited in a dose-dependent manner by MDM2. Importantly, a high amount of PML (500 ng) had little to no effect on the ability of MDM2 to inhibit GAL4 DBD-p53-(1–45) under all conditions tested. These results demonstrate that p53-independent interactions between PML and MDM2 alone do not prevent MDM2 from inhibiting the p53 transactivation domain. Thus, PML must bind p53 directly to efficiently overcome the inhibition of p53 activity by MDM2.Fig. 5PML does not block MDM2-mediated inhibition of a GAL4-p53 fusion protein. 35-2 cells were transfected with a GAL4-responsive luciferase promoter DNA (GAL4-luc, 100 ng), GAL4 DBD-p53-(1–45) (200 ng), and the indicated amounts of wild-type MDM2 and HA PML. Luciferase activity was monitored in the transfected cell lysates 24 h post-transfection.View Large Image Figure ViewerDownload Hi-res image Download (PPT)We next tested whether MDM2 interaction with PML contributes to the ability of MDM2 to inhibit PML-mediated p53 activation. First, p53-dependent luciferase activity was monitored in cells transfected with the p53-responsive luciferase gene alone or with various combinations of p53, wild-type MDM2, MDM2 Δp53BD, and PML (Fig. 6A). As expected, high amounts of wild-type MDM2 DNA (200 and 500 ng) strongly inhibited p53 activity, whereas MDM2 Δp53BD failed to inhibit p53. These results indicate that MDM2 must bind p53 in order to inhibit its activity. Coexpression with PML stimulated the transcriptional activity of p53 by ∼3-fold when the proteins were expressed together in the absence of MDM2 (6B). Importantly, wild-type MDM2 efficiently

Promyelocytic Leukemia (PML) protein can interact with a multitude of cellular factors and has been implicated in the regulation of various processes, including protein sequestration, cell cycle regulation and DNA damage responses. Previous studies reported that misfolded proteins or proteins containing polyglutamine tracts form aggregates with PML, chaperones, and components of the proteasome, supporting a role for PML in misfolded protein degradation.In the current study, we have identified a reactive oxygen species (ROS) dependent aggregation of PML, small ubiquitin-like modifier 1 (SUMO-1), heat shock protein 70 (HSP70) and 20S proteasomes in human cell lines that have been transiently transfected with vectors expressing the puromycin resistance gene, puromycin n-acetyl transferase (pac). Immunofluorescent studies demonstrated that PML, SUMO-1, HSP70 and 20S proteasomes aggregated to form nuclear inclusions in multiple cell lines transfected with vectors expressing puromycin (puro) resistance in regions distinct from nucleoli. This effect does not occur in cells transfected with identical vectors expressing other antibiotic resistance genes or with vectors from which the pac sequence has been deleted. Furthermore, ROS scavengers were shown to ablate the effect of puro vectors on protein aggregation in transfected cells demonstrating a dependency of this effect on the redox state of transfected cells.Taken together we propose that puromycin vectors may elicit an unexpected misfolded protein response, associated with the formation of nuclear aggresome like structures in human cell lines. This effect has broad implications for cellular behavior and experimental design.

The phosphatidylinositol 3-kinase (PI3K)/protein kinase B (PKB/AKT)/mammalian target of rapamycin (mTOR) pathway conveys signals from receptor tyrosine kinases (RTKs) to regulate cell metabolism, proliferation, survival, and motility. Previously we found that prolylcarboxypeptidase (PRCP) regulate proliferation and survival in breast cancer cells. In this study, we found that PRCP and the related family member prolylendopeptidase (PREP) are essential for proliferation and survival of pancreatic cancer cells. Depletion/inhibition of PRCP and PREP-induced serine phosphorylation and degradation of IRS-1, leading to inactivation of the cellular PI3K and AKT. Notably, depletion/inhibition of PRCP/PREP destabilized IRS-1 in the cells treated with rapamycin, blocking the feedback activation PI3K/AKT. Consequently, inhibition of PRCP/PREP enhanced rapamycin-induced cytotoxicity. Thus, we have identified PRCP and PREP as a stabilizer of IRS-1 which is critical for PI3K/AKT/mTOR signaling in pancreatic cancer cells. The phosphatidylinositol 3-kinase (PI3K)/protein kinase B (PKB/AKT)/mammalian target of rapamycin (mTOR) pathway conveys signals from receptor tyrosine kinases (RTKs) to regulate cell metabolism, proliferation, survival, and motility. Previously we found that prolylcarboxypeptidase (PRCP) regulate proliferation and survival in breast cancer cells. In this study, we found that PRCP and the related family member prolylendopeptidase (PREP) are essential for proliferation and survival of pancreatic cancer cells. Depletion/inhibition of PRCP and PREP-induced serine phosphorylation and degradation of IRS-1, leading to inactivation of the cellular PI3K and AKT. Notably, depletion/inhibition of PRCP/PREP destabilized IRS-1 in the cells treated with rapamycin, blocking the feedback activation PI3K/AKT. Consequently, inhibition of PRCP/PREP enhanced rapamycin-induced cytotoxicity. Thus, we have identified PRCP and PREP as a stabilizer of IRS-1 which is critical for PI3K/AKT/mTOR signaling in pancreatic cancer cells.

p53 can play a key role in response to DNA damage by activating a G1 cell cycle arrest. However, the importance of p53 in the cell cycle response to UV radiation is unclear. In this study, we used normal and repair-deficient cells to examine the role and regulation of p53 in response to UV radiation. A dose-dependent G1 arrest was observed in normal and repair-deficient cells exposed to UV. Expression of HPV16-E6, or a dominant-negative p53 mutant that inactivates wildtype p53, caused cells to become resistant to this UV-induced G1 arrest. However, a G1 to S-phase delay was still observed after UV treatment of cells in which p53 was inactivated. These results indicate that UV can inhibit G1 to S-phase progression through p53-dependent and independent mechanisms. Cells deficient in the repair of UV-induced DNA damage were more susceptible to a G1 arrest after UV treatment than cells with normal repair capacity. Moreover, no G1 arrest was observed in cells that had completed DNA repair prior to monitoring their movement from G1 into S-phase. Finally, p53 was stabilized under conditions of a UV-induced G1 arrest and unstable when cells had completed DNA repair and progressed from G1 into S-phase. These results suggest that unrepaired DNA damage is the signal for the stabilization of p53, and a subsequent G1 phase cell cycle arrest in UV-irradiated cells.

The p53 family of proteins includes three members, p53, p63, and p73. The levels and stability of p53 are controlled in large part by MDM2, which can bind the p53 N-terminus and promote its degradation. Because the MDM2 gene is transcriptionally activated by p53, it forms part of an autoregulatory feedback loop that directly links the transcriptional activity of p53 with its degradation. In contrast, little is known about the mechanisms that control p63 or p73 stability. In the current study, p73 deletion or point mutants that lacked transactivation activity were stable compared to wild-type p73. A naturally occurring p73 variant (DeltaNp73) was also stable compared to wild-type p73. Finally, fusion of the VP16-transactivation domain to an inactive, stable p73 mutant restored transactivation function and rendered the mutant protein unstable. These results demonstrate that p73 transactivation activity is necessary for rapid p73 turnover, and suggest that one or more transcriptional targets of p73 may promote its degradation.

A human ribosomal protein S 17 cDNA [Chen et al., Proc. Natl. Acad.β Sci. USA 83 (1986) 6907–6911] was used as heterologous probe to isolate S17 clones from Drosophila genomic and cDNA recombinant libraries. Five S17 genomic clones were recognized; all contained overlapping regions of a single chromosomal site. Subsequently the Drosophila RPS17 gene was mapped by in situ hybridization to chromosome 3L, band 67B 1–5. The locus spans approximately 1000 bp of DNA and includes four exons. It is preceded by conventional CAAT and TATA RNA polymerase II promoter motifs. The 131 amino acid protein encoded within Drosophila RPS 17 is similar to ribosomal proteins from several other eukaryotes. Comparison of eukaryotic S17 proteins' primary structures as well as the number and location of their genes' intervening sequences suggest that S 17 is a relatively recent addition to the ribosomal protein family, probably post-dating divergence of eukaryotes and prokaryotes.

Tetraploid (4N) cells are considered important in cancer because they can display increased tumorigenicity, resistance to conventional therapies, and are believed to be precursors to whole chromosome aneuploidy. It is therefore important to determine how tetraploid cancer cells arise, and how to target them. P53 is a tumor suppressor protein and key regulator of tetraploidy. As part of the “tetraploidy checkpoint”, p53 inhibits tetraploid cell proliferation by promoting a G1-arrest in incipient tetraploid cells (referred to as a tetraploid G1 arrest). Nutlin-3a is a preclinical drug that stabilizes p53 by blocking the interaction between p53 and MDM2. In the current study, Nutlin-3a promoted a p53-dependent tetraploid G1 arrest in two diploid clones of the HCT116 colon cancer cell line. Both clones underwent endoreduplication after Nutlin removal, giving rise to stable tetraploid clones that showed increased resistance to ionizing radiation (IR) and cisplatin (CP)-induced apoptosis compared to their diploid precursors. These findings demonstrate that transient p53 activation by Nutlin can promote tetraploid cell formation from diploid precursors, and the resulting tetraploid cells are therapy (IR/CP) resistant. Importantly, the tetraploid clones selected after Nutlin treatment expressed approximately twice as much P53 and MDM2 mRNA as diploid precursors, expressed approximately twice as many p53-MDM2 protein complexes (by co-immunoprecipitation), and were more susceptible to p53-dependent apoptosis and growth arrest induced by Nutlin. Based on these findings, we propose that p53 plays novel roles in both the formation and targeting of tetraploid cells. Specifically, we propose that 1) transient p53 activation can promote a tetraploid-G1 arrest and, as a result, may inadvertently promote formation of therapy-resistant tetraploid cells, and 2) therapy-resistant tetraploid cells, by virtue of having higher P53 gene copy number and expressing twice as many p53-MDM2 complexes, are more sensitive to apoptosis and/or growth arrest by anti-cancer MDM2 antagonists (e.g. Nutlin).

Nutlin-3a is a small molecule MDM2 antagonist and potent activator of wild-type p53. Nutlin-3a disrupts MDM2 binding to p53, thus increasing p53 levels and allowing p53 to inhibit proliferation or induce cell death. Factors that control sensitivity to Nutlin-3a-induced apoptosis are incompletely understood. In this study we isolated cisplatin-resistant clones from MHM cells, an MDM2-amplified and p53 wild-type osteosarcoma cell line. Cisplatin resistance in these clones resulted in part from heightened activation of the IGF-1R/AKT pathway. Interestingly, these cisplatin resistant clones showed hyper-sensitivity to Nutlin-3a induced apoptosis. Increased Nutlin-3a sensitivity was associated with reduced authophagy flux and a greater increase in p53 levels in response to Nutlin-3a treatment. IGF-1R and AKT inhibitors further increased apoptosis by Nutlin-3a in parental MHM cells and the cisplatin-resistant clones, confirming IGF-1R/AKT signaling promotes apoptosis resistance. However, IGF-1R and AKT inhibitors also reduced p53 accumulation in Nutlin-3a treated cells and increased autophagy flux, which we showed can promote apoptosis resistance. We conclude the IGF-1R/AKT pathway has opposing effects on Nutlin-3a-induced apoptosis. First, it can inhibit apoptosis, consistent with its well-established role as a survival-signaling pathway. Second, it can enhance Nutlin-3a induced apoptosis through a combination of maintaining p53 levels and inhibiting pro-survival autophagy.

Activated p53 can promote apoptosis or cell cycle arrest. Differences in energy metabolism can influence cell fate in response to activated p53. Nutlin-3a is a preclinical drug and small molecule activator of p53. Alpha-ketoglutarate (αKG) levels were reduced in cells sensitive to Nutlin-3a-induced apoptosis and increased in cells resistant to this apoptosis. Add-back of a cell-permeable αKG analog (DMKG) rescued cells from apoptosis in response to Nutlin-3a. OGDH is a component of the αKGDH complex that converts αKG to succinate. OGDH knockdown increased endogenous αKG levels and also rescued cells from Nutlin-3a-induced apoptosis. We previously showed reduced autophagy and ATG gene expression contributes to Nutlin-3a-induced apoptosis. DMKG and OGDH knockdown restored autophagy and ATG gene expression in Nutlin-3a-treated cells. These studies indicate αKG levels, regulated by p53 and OGDH, determine autophagy and apoptosis in response to Nutlin-3a.

Autophagy promotes cancer cell survival in response to p53 activation by the anticancer agent Nutlin-3a (Nutlin). We reported previously that Nutlin kills MDM2-amplified cancer cells and that this killing is associated with an inhibition of glucose metabolism, reduced α-ketoglutarate (α-KG) levels, and reduced autophagy. In the current report, using SJSA1, U2OS, A549, and MHM cells, we found that Nutlin alters histone methylation in an MDM2 proto-oncogene–dependent manner and that this, in turn, regulates autophagy-related gene (ATG) expression and cell death. In MDM2-amplified cells, Nutlin increased histone (H) 3 lysine (K) 9 and K36 trimethylation (me3) coincident with reduced autophagy and increased apoptosis. Blocking histone methylation restored autophagy and rescued these cells from Nutlin-induced killing. In MDM2-nonamplified cells, H3K9me3 and H3K36me3 levels were either reduced or not changed by the Nutlin treatment, and this coincided with increased autophagy and cell survival. Blocking histone demethylation reduced autophagy and sensitized these cells to Nutlin-induced killing. Further experiments suggested that MDM2 amplification increases histone methylation in Nutlin-treated cells by causing depletion of the histone demethylase Jumonji domain-containing protein 2B (JMJD2B). Finally, JMJD2B knockdown or inhibition increased H3K9/K36me3 levels, decreased ATG gene expression and autophagy, and sensitized MDM2-nonamplified cells to apoptosis. Together, these results support a model in which MDM2- and JMJD2B-regulated histone methylation levels modulate ATG gene expression, autophagy, and cell fate in response to the MDM2 antagonist Nutlin-3a. Autophagy promotes cancer cell survival in response to p53 activation by the anticancer agent Nutlin-3a (Nutlin). We reported previously that Nutlin kills MDM2-amplified cancer cells and that this killing is associated with an inhibition of glucose metabolism, reduced α-ketoglutarate (α-KG) levels, and reduced autophagy. In the current report, using SJSA1, U2OS, A549, and MHM cells, we found that Nutlin alters histone methylation in an MDM2 proto-oncogene–dependent manner and that this, in turn, regulates autophagy-related gene (ATG) expression and cell death. In MDM2-amplified cells, Nutlin increased histone (H) 3 lysine (K) 9 and K36 trimethylation (me3) coincident with reduced autophagy and increased apoptosis. Blocking histone methylation restored autophagy and rescued these cells from Nutlin-induced killing. In MDM2-nonamplified cells, H3K9me3 and H3K36me3 levels were either reduced or not changed by the Nutlin treatment, and this coincided with increased autophagy and cell survival. Blocking histone demethylation reduced autophagy and sensitized these cells to Nutlin-induced killing. Further experiments suggested that MDM2 amplification increases histone methylation in Nutlin-treated cells by causing depletion of the histone demethylase Jumonji domain-containing protein 2B (JMJD2B). Finally, JMJD2B knockdown or inhibition increased H3K9/K36me3 levels, decreased ATG gene expression and autophagy, and sensitized MDM2-nonamplified cells to apoptosis. Together, these results support a model in which MDM2- and JMJD2B-regulated histone methylation levels modulate ATG gene expression, autophagy, and cell fate in response to the MDM2 antagonist Nutlin-3a.

It is well known that normal human diploid fibroblasts undergo a significant, p53-dependent arrest in the G1 phase of the cell cycle after exposure to ionizing radiation. The presence and magnitude of a G1 arrest in human tumor cell lines, however, has been controversial, particularly in cells derived from solid tumors and irradiated during exponential growth. To examine this question more precisely, we synchronized cells by mitotic selection and irradiated them in very early G1 prior to any of the described G1 checkpoints. Progression of cells from G1 into the S phase was monitored by autoradiographic measurement of cumulative labeling indices and by flow cytometric analysis. Three different human tumor cell lines confirmed as expressing normal p53 function were examined, i.e., lines derived from an adenocarcinoma of the colon (RKO), a breast cancer (MCF-7), and a squamous cell carcinoma (SCC61). Following irradiation with 4-8 Gy, there was a transient delay in progression from G1 into S phase, lasting approximately 2 h, and in two of the three cell lines (RKO and MCF-7), a small fraction of cells (5-8%) never entered the first S phase. Although there was no evidence for a prolonged G1 arrest, the expected G2 delay was observed in all three cell lines. When irradiated RKO cells were resynchronized at the next mitosis, approximately 30% of the cells did not enter the second S phase. This latter finding is consistent with earlier reports on the kinetics of radiation-induced reproductive failure in mammalian cells. These results indicate that cells derived from human solid tumors that express normal p53 may respond to irradiation quite differently than do normal cells in terms of G1 checkpoint control.

Promyelocytic leukemia nuclear bodies (PML-NBs) are multiprotein complexes that include PML protein and localize in nuclear foci. PML-NBs are implicated in multiple stress responses, including apoptosis, DNA repair, and p53-dependent growth inhibition. ALT-associated PML bodies (APBs) are specialized PML-NBs that include telomere-repeat binding-factor TRF1 and are exclusively in telomerase-negative tumors where telomere length is maintained through alternative (ALT) recombination mechanisms. We compared cell-cycle and p53 responses in ALT-positive cancer cells (U2OS) exposed to ionizing radiation (IR) or the p53 stabilizer Nutlin-3a. Both IR and Nutlin-3a caused growth arrest and comparable induction of p53. However, p21, whose gene p53 activates, displayed biphasic induction following IR and monophasic induction following Nutlin-3a. p53 was recruited to PML-NBs 3-4 days after IR, approximately coincident with the secondary p21 increase. These p53/PML-NBs marked sites of apparently unrepaired DNA double-strand breaks (DSBs), identified by colocalization with phosphorylated histone H2AX. Both Nutlin-3a and IR caused a large increase in APBs that was dependent on p53 and p21 expression. Moreover, p21, and to a lesser extent p53, was recruited to APBs in a fraction of Nutlin-3a-treated cells. These data indicate (1) p53 is recruited to PML-NBs after IR that likely mark unrepaired DSBs, suggesting p53 may either be further activated at these sites and/or function in their repair; (2) p53-p21 pathway activation increases the percentage of APB-positive cells, (3) p21 and p53 are recruited to ALT-associated PML-NBs after Nutlin-3a treatment, suggesting that they may play a previously unrecognized role in telomere maintenance.

MDM2 antagonists stabilize and activate wild-type p53, and histone methyltransferase (HMT) inhibitors reduce methylation on histone lysines and arginines. Both MDM2 antagonists and HMT inhibitors are being developed as cancer therapeutics. Wild-type p53 expressing HCT116 colon cancer cells were resistant to apoptosis in response to the MDM2 antagonist Nutlin-3a. However, co-treatment with the HMT inhibitor DZNep sensitized the cells to Nutlin-3a-induced apoptosis. This sensitization resulted from reduced activity of the Bcl-2 gene promoter and a reduction in Bcl-2 mRNA and protein. Surprisingly, DZNep reduced Bcl-2 expression in other colon cancer cell lines (RKO, SW48, and LoVo) but failed to sensitize them to Nutlin-3a. We found these cell lines express elevated levels of Bcl-2 or other Bcl-2-family proteins, including Bcl-xL, Mcl-1, and Bcl-w. Knockdown of Mcl-1 and/or treatment with specific or pan Bcl-2-family inhibitors (BH3 mimetics) sensitized RKO, SW48, and LoVo cells to apoptosis by Nutlin-3a. The results demonstrate 1) DZNep represses the Bcl-2 gene promoter and affects apoptosis sensitivity by reducing Bcl-2 protein expression, and 2) elevated expression of pro-survival Bcl-2 family members protects colon cancer cells from Nutlin-3a-induced apoptosis. Targeting Bcl-2 proteins via DZNep or BH3 mimetics could increase the therapeutic potential of MDM2-antagonists like Nutlin-3a in colon cancer.

Abstract P53 represses transcription by activating p21 expression and promoting formation of RB1-E2F1 and RBL1/RBL2-DREAM transcription repressor complexes. The DREAM complex is composed of DP1, RB-family proteins RBL1 or RBL2 (p107/p130), E2F4/5, and MuvB. We recently reported RBL2-DREAM contributes to improved therapy responses in p53 wild-type NSCLC cells and improved outcomes in NSCLC patients whose tumors express wild-type p53. In the current study we identified CSE1L as a novel inhibitor of the RBL2-DREAM pathway and target to activate RBL2-DREAM in NSCLC cells. CSE1L is an oncoprotein that maintains repression of genes that can be reactivated by HDAC inhibitors. Mocetinostat is a HDAC inhibitor in clinical trials with selectivity against HDACs 1 and 2. Knockdown of CSE1L in NSCLC cells or treatment with mocetinostat increased p21, activated RB1 and RBL2, repressed DREAM target genes, and induced toxicity in a manner that required wild-type p53. Lastly, we found high levels of CSE1L and specific DREAM-target genes are candidate markers to identify p53 wild-type NSCLCs most responsive to mocetinostat. Thus, we identified CSE1L as a critical negative regulator of the RB-DREAM pathway in p53 wild-type NSCLC that can be indirectly targeted with HDAC1/2 inhibitors (mocetinostat) in current clinical trials. High expression of CSE1L and DREAM target genes could serve as a biomarker to identify p53 wild-type NSCLCs most responsive to this HDAC1/2 inhibitor.

p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds. p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds.

We describe the isolation and nucleotide sequence of a cDNA encoding the human 40S ribosomal subunit protein (r-protein) S24 (Mr 15425). Human S24 is virtually identical to the r-protein encoded by a cloned Xenopus laevis cDNA previously identified as S19 [Amaldi et al., Gene 17 (1982) 311–316].

Inactivation of the p53 tumor suppressor pathway is essential for the development of most or all human cancers. Over 50% of cancers harbor missense mutations in p53 that destroy its normal function.1 In cancers that retain wild-type p53, the protein is often inactivated through other means, including being abnormally sequestered in the cytoplasm, over-expression of MDM2 (the key negative regulator of p53), and deletion of p14/Arf (which normally inhibits MDM2 function). P53 undergoes nuclear-cytoplasmic shuttling and, in most unstressed cells, is expressed at low levels localized in both the nucleus and the cytoplasm. In response to DNA damage and other stresses, p53 is subject to various post-translational modifications that result in its stabilization, accumulation in the nucleus, and activation as a transcription factor. While most p53 accumulates in the nucleus following stress, recent studies indicate a significant fraction remains in the cytoplasm, and that both nuclear and cytoplasmic p53 participate in its tumor suppressor program.2 Notably, certain post-translational modifications may direct p53 to specific sub-cellular locales (Table 1), and this appear to be important in unleashing p53’s full growth suppressive capabilities. For example, at least some nuclear p53 that accumulates following certain stresses is directed to sub-nuclear domains (PML bodies) where it is subjected to further activating modifications. Similarly, cytoplasmic p53 is directed to the mitochondria following stress where it interacts with pro- and anti-apoptotic members of the Bcl2 family, resulting in the release of factors from the mitochondria that drive apoptosis. This chapter will review studies of p53 localization control including its nuclear-cytoplasmic shuttling, movement to PML bodies and to the mitochondria.

Prolyl endopeptidase (PREP), also known as prolyl oligopeptidase (POP), is an enzyme that cleaves short peptides (<30 amino acids in length) on the C-terminal side of proline. PREP is highly expressed in multiple carcinomas and is a potential target for cancer therapy. A potent inhibitor of PREP, Y-29794, causes long-lasting inhibition of PREP in mouse tissues. However, there are no reports on Y-29794 effects on cancer cell and tumor proliferation. Using cell line models of aggressive triple-negative breast cancer (TNBC), we show here that Y-29794 inhibited proliferation and induced death in multiple TNBC cell lines. Cell death induced by Y-29794 coincided with inhibition of the IRS1-AKT-mTORC1 survival signaling pathway, although stable depletion of PREP alone was not sufficient to reduce IRS1-AKT-mTORC1 signaling or induce death. These results suggest that Y-29794 elicits its cancer cell killing effect by targeting other mechanisms in addition to PREP. Importantly, Y-29794 inhibited tumor growth when tested in xenograft models of TNBC in mice. Induction of cell death in culture and inhibition of xenograft tumor growth support the potential utility of Y-29794 or its derivatives as a treatment option for TNBC tumors.

Trastuzumab is the first-line therapy for human epidermal growth factor receptor 2-positive (HER2 + ) breast cancer, but often patients develop acquired resistance. Although other agents are in clinical use to treat trastuzumab-resistant (TR) breast cancer; still, the patients develop recurrent metastatic disease. One of the primary mechanisms of acquired resistance is the shedding/loss of the HER2 extracellular domain, where trastuzumab binds. We envisioned any new agent acting downstream of the HER2 should overcome trastuzumab resistance. The mixed lineage kinase 3 (MLK3) activation by trastuzumab is necessary for promoting cell death in HER2 + breast cancer. We designed nanoparticles loaded with MLK3 agonist ceramide (PPP-CNP) and tested their efficacy in sensitizing TR cell lines, patient-derived organoids, and patient-derived xenograft (PDX). The PPP-CNP activated MLK3, its downstream JNK kinase activity, and down-regulated AKT pathway signaling in TR cell lines and PDX. The activation of MLK3 and down-regulation of AKT signaling by PPP-CNP induced cell death and inhibited cellular proliferation in TR cells and PDX. The apoptosis in TR cells was dependent on increased CD70 protein expression and caspase-9 and caspase-3 activities by PPP-CNP. The PPP-CNP treatment alike increased the expression of CD70, CD27, cleaved caspase-9, and caspase-3 with a concurrent tumor burden reduction of TR PDX. Moreover, the expressions of CD70 and ceramide levels were lower in TR than sensitive HER2 + human breast tumors. Our in vitro and preclinical animal models suggest that activating the MLK3–CD70 axis by the PPP-CNP could sensitize/overcome trastuzumab resistance in HER2 + breast cancer.

Osteosarcoma (OS) is the most common bone cancer in children and young adults. The etiology of osteosarcoma is currently unknown. Besides the predominant osteoblasts, the presence of cartilage forming chondrocytes within its tumor tissues suggests a role of chondrogenesis in osteosarcoma development. Runx2 is a master transcription factor both for osteoblast differentiation and for chondrocyte maturation. Interestingly, RUNX2 has been shown to directly interact with p53 and Rb1, two genes essential for osteosarcoma development in mice. However the in vivo relevance of Runx2 during osteosarcoma progression has not been elucidated. We have recently shown that targeting Runx2 expression in hypertrophic chondrocytes delays chondrocyte maturation. It has also been shown that osteoblast-specific deletion of p53 and Rb1 genes developed osteosarcoma in mice. Here, we report our recent research findings using these osteosarcoma mouse models as well as human osteosarcoma tissues. We have detected high-level RUNX2 expression in human osteoblastic osteosarcoma, while chondroblastic osteosarcoma is predominant with chondroid matrix. To minimize the effect of strain difference, we have backcrossed osterix-Cre mice onto congenic FVB/N genetic background. We also detected low-GC content (36%) in sequence around the floxed Rb1 gene and demonstrated that addition of BSA into the reaction system increases the efficiency of PCR genotyping of floxed Rb1 gene. Finally, we successfully generated multiple osteosarcoma mouse models with or without Runx2 transgenic background. These mice showed heterogeneous osteosarcoma phenotypes and marker gene expression. Characterization of these mice will facilitate understanding the role of Runx2 in osteosarcoma pathogenesis and possibly, for osteosarcoma treatment.

p53 is a tumor suppressor and potent inhibitor of cell growth. P73 is highly similar to p53 at both the amino acid sequence and structural levels. Given their similarities, it is important to determine whether p53 and p73 function in similar or distinct pathways. There is abundant evidence for negative cross-talk between glucocorticoid receptor (GR) and p53. Neither physical nor functional interactions between GR and p73 have been reported. In this study, we examined the ability of p53 and p73 to interact with and inhibit GR transcriptional activity.We show that both p53 and p73 can bind GR, and that p53 and p73-mediated transcriptional activity is inhibited by GR co-expression. Wild-type p53 efficiently inhibited GR transcriptional activity in cells expressing both proteins. Surprisingly, however, p73 was either unable to efficiently inhibit GR, or increased GR activity slightly. To examine the basis for this difference, a series of p53:p73 chimeric proteins were generated in which corresponding regions of either protein have been swapped. Replacing N- and C-terminal sequences in p53 with the corresponding sequences from p73 prevented it from inhibiting GR. In contrast, replacing p73 N- and C-terminal sequences with the corresponding sequences from p53 allowed it to efficiently inhibit GR. Differences in GR inhibition were not related to differences in transcriptional activity of the p53:p73 chimeras or their ability to bind GR.Our results indicate that both N- and C-terminal regions of p53 and p73 contribute to their regulation of GR. The differential ability of p53 and p73 to inhibit GR is due, in part, to differences in their N-terminal and C-terminal sequences.

Supplementary Data from Nutlin-3a Induces Cytoskeletal Rearrangement and Inhibits the Migration and Invasion Capacity of p53 Wild-Type Cancer Cells

&lt;div&gt;Abstract&lt;p&gt;MDM2 is an E3 ubiquitin ligase that binds and ubiquitinates the tumor suppressor protein p53, leading to its proteasomal degradation. Nutlin-3a (Nutlin) is a preclinical drug that binds MDM2 and prevents the interaction between MDM2 and p53, leading to p53 stabilization and activation of p53 signaling events. Previous studies have reported that Nutlin promotes growth arrest and/or apoptosis in cancer cells that express wild-type p53. In the current study, Nutlin treatment caused a cytoskeletal rearrangement in p53 wild-type human cancer cells from multiple etiologies. Specifically, Nutlin decreased actin stress fibers and reduced the size and number of focal adhesions in treated cells. This process was dependent on p53 expression but was independent of p21 expression and growth arrest. Consistent with this, Nutlin-treated cells failed to form filamentous actin–based motility structures (lamellipodia) and displayed significantly decreased directional persistence in response to migratory cues. Finally, chemotactic assays showed a p53-dependent/p21-independent decrease in migratory and invasive capacity of Nutlin-treated cells. Taken together, these findings reveal that Nutlin treatment can inhibit the migration and invasion capacity of p53 wild-type cells, adding to the potential therapeutic benefit of Nutlin and other small molecule MDM2 inhibitors. Mol Cancer Ther; 9(4); 895–905. ©2010 AACR.&lt;/p&gt;&lt;/div&gt;

Supplementary Data from Nutlin-3a Induces Cytoskeletal Rearrangement and Inhibits the Migration and Invasion Capacity of p53 Wild-Type Cancer Cells

&lt;div&gt;Abstract&lt;p&gt;MDM2 is an E3 ubiquitin ligase that binds and ubiquitinates the tumor suppressor protein p53, leading to its proteasomal degradation. Nutlin-3a (Nutlin) is a preclinical drug that binds MDM2 and prevents the interaction between MDM2 and p53, leading to p53 stabilization and activation of p53 signaling events. Previous studies have reported that Nutlin promotes growth arrest and/or apoptosis in cancer cells that express wild-type p53. In the current study, Nutlin treatment caused a cytoskeletal rearrangement in p53 wild-type human cancer cells from multiple etiologies. Specifically, Nutlin decreased actin stress fibers and reduced the size and number of focal adhesions in treated cells. This process was dependent on p53 expression but was independent of p21 expression and growth arrest. Consistent with this, Nutlin-treated cells failed to form filamentous actin–based motility structures (lamellipodia) and displayed significantly decreased directional persistence in response to migratory cues. Finally, chemotactic assays showed a p53-dependent/p21-independent decrease in migratory and invasive capacity of Nutlin-treated cells. Taken together, these findings reveal that Nutlin treatment can inhibit the migration and invasion capacity of p53 wild-type cells, adding to the potential therapeutic benefit of Nutlin and other small molecule MDM2 inhibitors. Mol Cancer Ther; 9(4); 895–905. ©2010 AACR.&lt;/p&gt;&lt;/div&gt;

Supplementary Figure 1 from Transient Nutlin-3a Treatment Promotes Endoreduplication and the Generation of Therapy-Resistant Tetraploid Cells

Supplementary Figure 4 from Transient Nutlin-3a Treatment Promotes Endoreduplication and the Generation of Therapy-Resistant Tetraploid Cells

Supplementary Figure 3 from Transient Nutlin-3a Treatment Promotes Endoreduplication and the Generation of Therapy-Resistant Tetraploid Cells

Supplementary Figure 2 from Transient Nutlin-3a Treatment Promotes Endoreduplication and the Generation of Therapy-Resistant Tetraploid Cells

Supplementary Figure 1 from Transient Nutlin-3a Treatment Promotes Endoreduplication and the Generation of Therapy-Resistant Tetraploid Cells

Supplementary Figure 2 from Transient Nutlin-3a Treatment Promotes Endoreduplication and the Generation of Therapy-Resistant Tetraploid Cells

Supplementary Figure 3 from Transient Nutlin-3a Treatment Promotes Endoreduplication and the Generation of Therapy-Resistant Tetraploid Cells

Supplementary Figure 4 from Transient Nutlin-3a Treatment Promotes Endoreduplication and the Generation of Therapy-Resistant Tetraploid Cells

Abstract p53 represses transcription by activating p21 expression and promoting formation of RB1-E2F1 and RBL1/RBL2-DREAM transcription repressor complexes. The DREAM complex is composed of DP1, RB-family proteins RBL1 or RBL2 (p107/p130), E2F4/5, and MuvB. We recently reported RBL2-DREAM contributes to improved therapy responses in p53 wild-type NSCLC cells and improved outcomes in NSCLC patients whose tumors express wild-type p53. In the current study we identified CSE1L as a novel inhibitor of the RBL2-DREAM pathway and target to activate RBL2-DREAM in NSCLC cells. CSE1L is an oncoprotein that promotes nuclear accumulation of histone deacetylases HDACs 1, 2, and 8 to repress gene transcription. Mocetinostat is a HDAC inhibitor in clinical trials with selectivity against HDACs 1 and 2. Knockdown of CSE1L in NSCLC cells or treatment with mocetinostat increased p21, activated RB1 and RBL2, repressed DREAM target genes, and induced toxicity in a manner that required wild-type p53. Lastly, we found high levels of CSE1L and specific DREAM-target genes are candidate markers to identify p53 wild-type NSCLCs most responsive to mocetinostat. Thus, we identified CSE1L as a critical negative regulator of the RB-DREAM pathway in p53 wild-type NSCLC that can be indirectly targeted with HDAC1/2 inhibitors (mocetinostat) in current clinical trials. High expression of CSE1L and DREAM target genes could serve as a biomarker to identify p53 wild-type NSCLCs most responsive to this HDAC1/2 inhibitor.

&lt;div&gt;Abstract&lt;p&gt;p53 activity is controlled in large part by MDM2, an E3 ubiquitin ligase that binds p53 and promotes its degradation. The MDM2 antagonist Nutlin-3a stabilizes p53 by blocking its interaction with MDM2. Several studies have supported the potential use of Nutlin-3a in cancer therapy. Two different p53 wild-type cancer cell lines (U2OS and HCT116) treated with Nutlin-3a for 24 hours accumulated 2N and 4N DNA content, suggestive of G&lt;sub&gt;1&lt;/sub&gt; and G&lt;sub&gt;2&lt;/sub&gt; phase cell cycle arrest. This coincided with increased p53 and p21 expression, hypophosphorylation of pRb, and depletion of Cyclin B1, Cyclin A, and CDC2. Upon removal of Nutlin-3a, 4N cells entered S phase and re-replicated their DNA without an intervening mitotic division, a process known as endoreduplication. p53-p21 pathway activation was required for the depletion of Cyclin B1, Cyclin A, and CDC2 in Nutlin-3a–treated cells and for endoreduplication after Nutlin-3a removal. Stable tetraploid clones could be isolated from Nutlin-3a treated cells, and these tetraploid clones were more resistant to ionizing radiation and cisplatin-induced apoptosis than diploid counterparts. These data indicate that transient Nutlin-3a treatment of p53 wild-type cancer cells can promote endoreduplication and the generation of therapy-resistant tetraploid cells. These findings have important implications regarding the use of Nutlin-3a in cancer therapy.[Cancer Res 2008;68(20):8260–8]&lt;/p&gt;&lt;/div&gt;

&lt;div&gt;Abstract&lt;p&gt;p53 activity is controlled in large part by MDM2, an E3 ubiquitin ligase that binds p53 and promotes its degradation. The MDM2 antagonist Nutlin-3a stabilizes p53 by blocking its interaction with MDM2. Several studies have supported the potential use of Nutlin-3a in cancer therapy. Two different p53 wild-type cancer cell lines (U2OS and HCT116) treated with Nutlin-3a for 24 hours accumulated 2N and 4N DNA content, suggestive of G&lt;sub&gt;1&lt;/sub&gt; and G&lt;sub&gt;2&lt;/sub&gt; phase cell cycle arrest. This coincided with increased p53 and p21 expression, hypophosphorylation of pRb, and depletion of Cyclin B1, Cyclin A, and CDC2. Upon removal of Nutlin-3a, 4N cells entered S phase and re-replicated their DNA without an intervening mitotic division, a process known as endoreduplication. p53-p21 pathway activation was required for the depletion of Cyclin B1, Cyclin A, and CDC2 in Nutlin-3a–treated cells and for endoreduplication after Nutlin-3a removal. Stable tetraploid clones could be isolated from Nutlin-3a treated cells, and these tetraploid clones were more resistant to ionizing radiation and cisplatin-induced apoptosis than diploid counterparts. These data indicate that transient Nutlin-3a treatment of p53 wild-type cancer cells can promote endoreduplication and the generation of therapy-resistant tetraploid cells. These findings have important implications regarding the use of Nutlin-3a in cancer therapy.[Cancer Res 2008;68(20):8260–8]&lt;/p&gt;&lt;/div&gt;

TNBC is an aggressive cancer sub-type with limited treatment options and poor prognosis. New therapeutic targets are needed to improve outcomes in TNBC patients. PRCP is a lysosomal serine protease that cleaves peptide substrates when the penultimate amino acid is proline. A role for PRCP in TNBC or other cancers, and its potential as a therapy target has not yet been tested. In the current study, we found high tumor expression of PRCP associates with worse outcome and earlier recurrence in TNBC patients. Knockdown of PRCP or treatment with a small molecule PRCP inhibitor blocked proliferation and survival in TNBC cell lines and inhibited growth of TNBC tumors in mice. Mechanistically, we found PRCP maintains signaling from multiple receptor tyrosine kinases (RTKs), potentially by promoting crosstalk between RTKs and G-protein coupled receptors (GPCRs). Lastly, we found that the PRCP inhibitor caused synergistic killing of TNBC cells when combined with the EGFR and ErbB2 inhibitor lapatinib. Our results suggest that PRCP is potential prognostic marker for TNBC patient outcome and a novel therapeutic target for TNBC treatment.

Prolylcarboxypeptidase (PRCP) is a lysosomal serine protease that cleaves peptide substrates when the penultimate amino acid is proline. Previous studies have linked PRCP to blood-pressure and appetite control through its ability to cleave peptide substrates such as angiotensin II and α-MSH. A potential role for PRCP in cancer has to date not been widely appreciated. Endocrine therapy resistance in breast cancer is an enduring clinical problem mediated in part by aberrant receptor tyrosine kinase (RTK) signaling. We previously found PRCP overexpression promoted 4-hydroxytamoxifen (4-OHT) resistance in estrogen receptor-positive (ER+) breast cancer cells. Currently, we tested the potential association between PRCP with breast cancer patient outcome and RTK signaling, and tumor responsiveness to endocrine therapy. We found high PRCP protein levels in ER+ breast tumors associates with worse outcome and earlier recurrence in breast cancer patients, including patients treated with TAM. We found a PRCP specific inhibitor (PRCPi) enhanced the response of ER+ PDX tumors and MCF7 tumors to endoxifen, an active metabolite of TAM in mice. We found PRCP increased IGF1R/HER3 signaling and AKT activation in ER+ breast cancer cells that was blocked by PRCPi. Thus, PRCP is an adverse prognostic marker in breast cancer and a potential target to improve endocrine therapy in ER+ breast cancers.

A cDNA expression vector encoding Drosophila ribosomal protein S14 was transfected into cultured Chinese hamster ovary (CHO) cells that harbor a recessive RPS14 emetine resistance mutation. Transformants synthesized the insect mRNA and polypeptide and consequently displayed an emetine-sensitive phenotype. These observations indicate that the insect protein was accurately expressed and correctly assembled into functional mammalian 40S ribosomal subunits.

Abstract Glucocorticoid receptor (GR) is a ligand dependent transcription factor that can promote apoptosis or survival in a cell specific manner. Activated GR has been reported to inhibit apoptosis in mammary epithelial cells (MECs) and breast cancer cells by increasing expression of pro-survival genes. In the current report, activated GR inhibited p53-dependent apoptosis in MCF10Amyc cells, immortalized MECs that are p53 wild-type and overexpress the MYC oncogene. Specifically, GR agonists hydrocortisone or dexamethasone (Dex) inhibited p53- dependent apoptosis induced in these cells by Cisplatin (Cis), ionizing radiation (IR), or the MDM2 antagonist Nutlin-3. In contrast, the GR antagonist RU486 sensitized the cells to apoptosis by these agents. Apoptosis inhibition was associated with maintenance of mitochondria membrane potential, diminished caspase 3 and 7 activation, and increased expression at both the mRNA and protein level of the antiapoptotic PKC family member, PKCepsilon (PKCε). Knockdown of PKCε via siRNA targeting reversed the protective effect of Dex and restored sensitivity to Cis, IR, and Nutlin-3 (Nutlin)-induced apoptosis. These data provide strong evidence that activated GR can inhibit p53-dependent apoptosis through induction of the anti-apoptotic factor PKCε. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr LB-75. doi:1538-7445.AM2012-LB-75

A 52-year-old woman was admitted because of lower abdominal pain. Physical examination showed a 5-cm bulky barrel-shaped uterine cervix, a 10-week sized uterus and a 10-cm right adnexal mass. Colpo...

Abstract Triple negative breast cancer (TNBC) accounts for 15-20% of all breast cancer cases. Currently, the only effective treatment for TNBC is chemotherapy agents. A well-established characteristic of TNBC is the ability of these cells to become metastatic following chemotherapy treatment resulting in increased mortality. New forms of treatment which target TNBC are urgently needed. Insulin receptor substrate 1 (IRS1) has been extensively studied in the regulation of the insulin and insulin-like growth factor receptor signaling cascades, specifically in the induction of the intracellular PI3K/AKT/mTORC1 and MAP kinase pathways. The roles of such pathways in cancer are currently being studied and considered for therapeutic targeting. We previously showed that the stability and levels of IRS1 are maintained by prolylcarboxypeptidase proteins PRCP/PREP in pancreatic cancer cells. Our hypothesis is that PRCP/PREP are potential therapeutic targets in TNBC. Specifically, we hypothesize that blocking the expression or reducing the activity of PRCP/PREP will inhibit the PI3K/AKT/mTORC1 pathway in TNBC cells and, in turn, reduce growth and survival in these cells. To test this, we will be treating a number of TNBC cell lines with a PRCP/PREP inhibitor and determining IRS1/2 protein levels, AKT/mTORC1 signaling, and growth and survival. TNBC cells were screened for sensitivity against the PRCP/PREP inhibitor, Y-ox. Sensitive cells treated with Y-ox showed earlier reduction in the IRS1/AKT/mTORC1 signaling, as well as earlier loss of cell viability compared to those cells with relative resistance to Y-ox. Similarly, cells treated with the IRS1/2 inhibitor NT-157 and the AKT inhibitor, MK-2206 showed loss of cell viability similarly seen with the PRCP/PREP inhibitor, Y-ox. In conclusion, the results shown in this study show a possible new therapeutic target against triple negative breast cancer in the inhibition of PRCP/PREP leading to loss of cell proliferation and viability. Citation Format: Ricardo E. Perez, Lei Duan, Carl G. Maki. Determining the role of PRCP/PREP in triple negative breast cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2018; 2018 Apr 14-18; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2018;78(13 Suppl):Abstract nr 1897.

PAGE 14629: In Fig. 4 we reported that the p53-ubiquitin fusion protein has a mutant conformation (pAb1620-/pAb240+). This p53-ubiquitin fusion protein has been used to mimic p53 mono-ubiquitinated in its C terminus. Subsequent to our manuscript being accepted, we discovered that the p53-ubiquitin fusion protein we used has a deletion of valine 218 near the pAb240 epitope. We have subsequently generated a new p53-ubiquitin fusion protein with valine 218 intact and compared its conformation to that of wild-type p53. This involved immunoprecipitation with the wild-type (pAb1620) and mutant (pAb240) conformation-specific antibodies followed by immunoblotting for p53. We did not detect an appreciable difference in conformation between wild-type p53 and the p53-ubiquitin fusion in these subsequent experiments. Therefore, the observation that the p53-ubiquitin fusion protein has an altered conformation compared with wild-type p53 was made in error. It remains possible that MDM2-mediated ubiquitination of p53, particularly at lysines within the p53 DNA-binding domain, could alter p53 conformation. However, the suggestion that C-terminal mono-ubiquitination might hold p53 in a mutant conformation is not supported.

The ubiquitin-dependent proteolysis pathway constitutes a major pathway in the cell for selective protein degradation. The covalent attachment of multiple ubiquitin molecules to lysine residues of a target protein serves to signal its recognition and rapid degradation by the 26S proteasome. The process of ubiquitination requires the concerted action of three classes of cellular enzymes, designated E1, E2, and E3 (reviewed in refs. and ). Ubiquitin is first activated in an ATP-dependent manner through its covalent thio-ester linkage to the E1 ubiquitin-activating enzyme. The activated ubiquitin is then transferred to the E2 enzyme, also known as a ubiquitin conjugating enzyme (UBC), again in the form of a high-energy thio-ester bond. In some cases the E2 enzyme can transfer the ubiquitin directly to a substrate, while the E3 enzyme (also known as a ubiquitin protein ligase) assists in the recognition of the substrate (,). In other cases, the E2 enzyme transfers the ubiquitin to the E3, and the E3 then transfers the ubiquitin to the substrate protein (). In either case, the ubiquitin is transferred to the substrate through formation of an isopeptide bond between the carboxyl terminus of ubiquitin and the e-amino group of lysine residues on the target protein. Additional ubiquitin moieties may be linked sequentially to each other, leading to the formation of multiubiquitin chains. The precise nature of a multubiquitination reaction is unclear, though recent studies suggest the presence of yet a fourth enzymatic activity, designated E4, which may play a role in this process (). The multiubiquitinated substrate is then recognized and degraded by the 26S proteasome.

Cancer Drug Resistance is an open access journal, focusing on pharmacological aspects of drug resistance and its reversal, molecular mechanisms of drug resistance and drug classes, etc. Both clinical and experimental aspects of drug resistance in cancer are included.

Abstract Background Prolylcarboxypeptidase (PRCP) is a lysosomal serine protease that cleaves peptide substrates when the penultimate amino acid is proline. Previous studies have linked PRCP to blood-pressure and appetite control through its ability to cleave peptide substrates such as angiotensin II and a-MSH. A potential role for PRCP in cancer has to date not been widely appreciated. Endocrine therapy resistance in breast cancer is an enduring clinical problem mediated in part by aberrant receptor tyrosine kinase (RTK) signaling. We previously found PRCP overexpression promoted tamoxifen (TAM) resistance in estrogen receptor-positive (ER+) breast cancer cells. Currently we tested the potential association between PRCP with breast cancer patient outcome and RTK signaling, and tumor responsiveness to endocrine therapy. Methods We analyzed PRCP protein expression by IHC staining of ER+ breast cancer samples and PRCP gene expression in clinical databases and used Kaplan-Meier survival curves to determine the significance of PRCP expression correlation with recurrence free survival and overall survival. We analyzed PRCP-regulated IGF1R/HER3 signaling using immunoblotting in the ER+ MCF7 cell line. We analyzed the therapeutic effect of a PRCP specific inhibitor (PRCPi) and/or endoxifen on tumor growth of ER+ PDX tumors and MCF7 tumors in immunocompromised mice. ResultsWe found high PRCP protein levels in tumors associates with worse outcome and earlier recurrence in breast cancer patients, including patients treated with TAM. Analyses of clinical databases showed that PRCP expression correlates with IGF1 and NRG1 expression and their target genes and earlier recurrence in endocrine-treated ER+/HER2- breast cancer patients. Overexpression of PRCP increased IGF1R/HER3 signaling. PRCPi blocked IGF1R/HER3 signaling and enhanced the response of ER+ breast cancer tumors in mice to endoxifen, the active metabolite of TAM. ConclusionsPRCP is an adverse prognostic marker in breast cancer and a potential target to improve endocrine therapy in ER+ breast cancers.