Alessandra Selbach Schnadelbach

Abstract We reconstructed phylogenetic relationships in Leguminosae subfam. Mimosoideae tribe Ingeae using 135 sequences from the nuclear (ITS) and 119 from the plastid (trnL–F) genome, representing 23 of the 36 currently recognized genera in the tribe with newly generated sequences of Blanchetiodendron, Guinetia, Macrosamanea, Thailentadopsis and Viguieranthus and an extensive sampling of Calliandra. Only two of the five Neotropical generic alliances of Barneby & Grimes (1996) were supported as monophyletic. Calliandra is resolved as monophyletic with the inclusion of Guinetia. The five previously proposed sections within Calliandra were not supported by our study. Nevertheless, based on these results, a new infrageneric classification is proposed for Calliandra, and the African species of the genus are assigned to a new genus, Afrocalliandra. Three new sections are proposed for Calliandra: (1) sect. Tsugoideae based on C. ser. Tsugoideae, with four species from northwestern South America; (2) sect. Septentrionales, with six species distributed in dry areas from the United States to Mexico and (3) sect. Monticola, which consists of species restricted to the Espinhaço range of Brazil; these latter species form a clade with low levels of sequence variation, a potential indicator of the recent diversification of this group.

The Asian citrus psyllid (ACP), Diaphorina citri Kuwayama, vectors Candidatus Liberibacter asiaticus and C. L. americanus, the causal agents of huanglongbing (HLB), the world's most serious citrus disease. There are no therapeutic treatments for HLB and chemical insecticides are the primary means of controlling ACP. Although insecticide applications reduce local ACP populations, HLB spread has continued unabated. Because of insecticides' inefficiency, cost, and associated regulatory issues, growers are looking for additional tools for ACP control. There has been a strong interest in identifying plant species and their associated volatile organic compounds (VOCs) that repel or attract ACP. Identification of effective behavioral modifiers is a necessary first step to developing highly efficient management tools for monitoring, repelling, and controlling ACP. While initial studies used olfactometry and analytical instruments, current investigations have grown in scope to include tools such genetic modification, RNAi, and olfactory binding proteins to provide a more comprehensive understanding of ACP olfactory perception and behavioral response to VOCs. Here we provide an overview of the plant species and their associated VOCs that have been implicated as ACP behavioral modifiers.

Abstract Chamaecrista Moench is a genus of caesalpinioid legumes with about 330 species mostly from the New World. The phylogeny of the genus was studied using sequence data from nuclear ITS and plastid trnL­F DNA spacers, representing all six sections of Chamaecrista . Separate and combined analyses recovered the same major clades with high bootstrap and posterior probabilities support, except for the subclades of representatives of sections Caliciopsis, Chamaecrista , and Xerocalyx . The monophyly of Chamaecrista was highly supported in all analyses. Sections Apoucouita and Xerocalyx were supported as monophyletic, sect. Absus was paraphyletic and subsect. Baseophyllum was resolved more closely related to species of sections Chamaecrista , Caliciopsis , and Xerocalyx than to subsect. Absus . The monotypic section Grimaldia was embedded within subsect. Absus . Section Chamaecrista was paraphyletic with respect to sections Caliciopsis and Xerocalyx . Our analyses suggest that the diversification patterns in Chamaecrista occurred through an initial shift from rainforest trees to a more diverse clade of savannah shrubs. Within the latter group, two main subclades were recovered: (1) a planaltine and high­mountain clade characterized by absence of extrafloral nectaries and the appearance of sticky glandular hairs; and (2) a mostly herbaceous clade with axillary fascicled inflorescences and reduced chromosome numbers. This last group is more diverse in open grassland areas and includes many colonizers of waste ground.

The plastid spacer trnD-trnT and the nuclear ribosomal internal transcribed spacer (ITS) were sequenced for 37 samples of herbaceous bamboos (Poaceae: Olyreae), including all Raddia species and allied genera, as well as two members of the woody bamboos (tribes Bambuseae and Arundinarieae), in order to examine their relationships. The sequences were analyzed using maximum parsimony and Bayesian inference. Both the individual and combined analyses of ITS and trnD-trnT supported Olyreae as a monophyletic group. All species of Raddia also formed a well-supported monophyletic group, and combined datasets allowed us to outline some relationships within this group. Individual analyses indicated incongruence regarding the sister group of Raddia, with ITS data weakly indicating Raddiella malmeana whereas trnD-trnT data supported Sucrea maculata in this position. However, the combined analysis supported Sucrea as sister to Raddia, although the monophyly of Sucrea is not well supported. Parodiolyra is paraphyletic to Raddiella in all analyses; Olyra is also paraphyletic, with species of Lithachne, Arberella and Cryptochloa nested within it. Eremitis and Pariana appeared as an isolated clade within Olyreae, and the position of the New Guinean Buergersiochloa remains uncertain within this tribe.

The simple and convergent morphologies of many red algae make these species difficult to identify using traditional morphological characters. Many cryptic species have been described in recent years based on molecular datasets, and this has led to the application of an integrative taxonomy approach in species delimitation. Here, we performed several species delimitation methods (mBGD, ABGD, SPN, PTP, GMYCs and GMYCm) based on two different loci (COI-5P and rbcL) in species of the Hypnea cornuta complex. These methods were combined with morphological and phylogenetic data, extensive sampling, analysis of topotype material, and historically relevant herbarium samples. Our findings demonstrate that the groups morphologically assigned to H. cornuta and H. stellulifera consist of five different cryptic species. H. cornuta is a polyphyletic taxon composed of three well-separated lineages, thus requiring sequencing of type or topotype specimens to determine which one is Hypnea cornuta sensu stricto. We have revealed that the distribution of H. stellulifera is limited to Asia, while the Brazilian specimens initially assigned to this species were clarified as a new endemic species: Hypnea cryptica sp. nov. Our results indicated that only an integrative approach combining several lines of evidence, including morphology, nomenclature history, molecular data, biogeography and ecology can correctly solve the taxonomic status of widely distributed cryptic species.

Hypnea has an intricate nomenclatural history due to a wide pantropical distribution and considerable morphological variation. Recent molecular studies have provided further clarification on the systematics of the genus; however, species of uncertain affinities remain due to flawed taxonomic identification. Detailed analyses coupled with literature review indicated a strong relationship among H. aspera, H. cervicornis, H. flexicaulis, and H. tenuis, suggesting a need for further taxonomic studies. Here, we analyzed sequences from two molecular markers (COI-5P and rbcL) and performed several DNA-based delimitation methods (mBGD, ABGD, SPN, PTP and GMYC). These molecular approaches were contrasted with morphological and phylogenetic evidence from type specimens and/or topotype collections of related species under a conservative approach. Our results demonstrate that H. aspera and H. flexicaulis represent heterotypic synonyms of H. cervicornis and indicate the existence of a misidentified Hypnea species, widely distributed on the Brazilian coast, described here as a new species: H. brasiliensis. Finally, inconsistencies observed among our results based on six different species delimitation methods evidence the need for adequate sampling and marker choice for different methods.

The Bulbophyllum exaltatum complex comprises 15 described taxa, and present a number of unresolved taxonomic questions, especially among populations found in the Brazilian campo rupestre vegetation. Allozymes were examined in 33 populations to determine the degree of genetic variability between them and their degree of differentiation to better define the taxa of this group. Additionally morphometric analyses were also performed on representatives of 24 populations. All of the populations examined demonstrated high levels of variability and none of the species formed distinct groups comprising all of the conspecific populations. However, the populations primarily grouped according to their regional occurrence, with a distinction between populations of the states of Minas Gerais and Bahia, which coincided with the geophysical disjunction of the mountain chains where they occur. It is probable that hybridization or incipient differentiation is contributing to the elevated genetic identity observed among the populations, generating a reticulated grouping pattern.

Journal Article Pleistocene climatic changes drove dispersal and isolation of Richterago discoidea (Asteraceae), an endemic plant of campos rupestres in the central and eastern Brazilian sky islands Get access Laia Barres, Laia Barres Instituto de Biologia, Universidade Federal da Bahia, Rua Barão de Jeremoabo, s.n., Ondina, Salvador, Bahia, Brazil Corresponding author. E-mail: laia.barres@gmail.com https://orcid.org/0000-0002-5618-5492 Search for other works by this author on: Oxford Academic Google Scholar Henrique Batalha-Filho, Henrique Batalha-Filho National Institute of Science and Technology in Interdisciplinary and Transdisciplinary Studies in Ecology and Evolution (INCT IN-TREE), Instituto de Biologia, Universidade Federal da Bahia, Rua Barão de Jeremoabo, s.n., Ondina, Salvador, Bahia, Brazil Search for other works by this author on: Oxford Academic Google Scholar Alessandra S Schnadelbach, Alessandra S Schnadelbach Instituto de Biologia, Universidade Federal da Bahia, Rua Barão de Jeremoabo, s.n., Ondina, Salvador, Bahia, Brazil Search for other works by this author on: Oxford Academic Google Scholar Nádia Roque Nádia Roque Instituto de Biologia, Universidade Federal da Bahia, Rua Barão de Jeremoabo, s.n., Ondina, Salvador, Bahia, Brazil Search for other works by this author on: Oxford Academic Google Scholar Botanical Journal of the Linnean Society, Volume 189, Issue 2, February 2019, Pages 132–152, https://doi.org/10.1093/botlinnean/boy080 Published: 25 January 2019 Article history Received: 17 April 2018 Revision received: 29 August 2018 Accepted: 19 November 2018 Published: 25 January 2019

Galeandra is a neotropical genus with its center of diversity in the Amazon region. It comprises approximately 18 species of epiphytic and terrestrial herbs that are easily recognizable by their funnel-shaped labellum. We examined the phylogenetic relationships among species of Galeandra inferred from nucleotide sequences from three plastid (psbA-trnH, rpoB-trnC, and trnS-trnG) and two nuclear (ITS and ETS) DNA regions. The five data matrices were analyzed individually and in combined analyses using parsimony and maximum likelihood. We found that the epiphytic species G. devoniana is sister to the remainder of the genus, and that the other species form two groups, one consisting of epiphytic species and the other composed of terrestrial species. Adaptation to the terrestrial environment from a probable epiphytic ancestor was of great importance in the evolution of Galeandra. The relationships found in this study do not support previous infrageneric classifications.

Echinolaena and Ichnanthus are two tropical grass genera distributed mostly in the Americas, characterized by the presence of rachilla appendages in the shape of convex swellings, scars or wings at the base of the upper anthecium. However, recent studies have shown that rachilla appendages arose several times independently in several groups within Paniceae and Paspaleae (Panicoideae). Thus, this study aimed to assess the monophyly of Echinolaena and Ichnanthus and their relationship to other genera of Paniceae and Paspaleae, especially those including species with rachilla appendages. Parsimony and Bayesian analyses of the cpDNA regions ndhF, rpl16, trnH-(rps19)-psbA, trnL-trnF, trnS-(psbZ)-trnG, and the rDNA ITS region included 29 of the 39 known species of Echinolaena and Ichnanthus, 23 of which were sampled for the first time. The multiple loci analyses indicated that Echinolaena and Ichnanthus are polyphyletic in their current circumscriptions, with species in four distinct lineages within subtribe Paspalinae, each one characterized by a single type of rachilla appendage. Thus, Echinolaena and Ichnanthus are each circumscribed in a narrow sense, and the other two lineages excluded from them are proposed as the new genera Hildaea and Oedochloa, resulting in 15 new combinations and the restablishment of I. oplismenoides Munro ex Döll.

Hypnea stellulifera was, until now, considered endemic to tropical Asia. Here, we report for the first time the expansion of its distribution to the Atlantic Ocean on the basis of collections from the northeast of Brazil. Comparison of morphological features of our specimens with Asian specimens of H. stellulifera and molecular data analysis allow us to confirm its identification. Samples analyzed in this study represent the first assessment of Hypnea sequences collected in a tropical area from South America. Among the three genes analyzed (the mitochondrial cox1 and the plastidial UPA and rbcL), UPA was the most conserved, and the cox1 was the most variable marker. Despite this, all three markers were efficient as DNA barcoding markers for Hypnea. In our phylogenetic analysis, H. stellulifera had a sister relationship with the clade that includes H. cornuta, H. musciformis, H. flagelliformis, and H. chordacea. Our results demonstrate that the analysis of Hypnea species collected at large geographic distances and/or in different tropical areas reveals a higher degree of intraspecific variation as well as decreased interspecific divergence among distinct species from closer areas. These findings corroborate the necessity of a combined analysis of morphology and different genetic markers for a better understanding of taxonomy and phylogeny of the genus Hypnea.

The effectiveness of different presowing treatments for removing hardseededness in Adenocarpus desertorum, Astragalus gines-lopezii and Hippocrepis grossi, three endemic and threatened perennial leguminous species of Spain, was evaluated. Untreated seeds of all three species were germinated over a range of constant (15, 20 and 25°C) and alternating temperatures (15/25 and 20/30°C) under a 16-hour light photoperiod. A considerable fraction of these seeds had physical dormancy caused by a water-impermeable seed coat. Germination was studied for seeds subjected to different presowing treatments: dry heat, hot water, ultra-low freezing, liquid nitrogen, freeze-thaw and mechanical scarification. The most effective method for promoting germination of Adenocarpus desertorum (two populations) and Astragalus gines-lopezii (two populations) was mechanical scarification with pliers. The highest germination percentages of H. grosii were reached by seeds mechanically scarified and also by seeds stored in an ultra-low freezer for 24 hours. Our data provided useful information in germination protocols for ex situ propagation of these three endemic and threatened species, being the first report on seed germination behaviour of Adenocarpus desertorum and Hippocrepis grosii.

This study evaluated the losses caused by meleira in the profitability of the papaya production in the extreme south of Bahia. The evaluation was based on the technical coefficients of the papaya system of integrated production for the south of Bahia, and information obtained from producers and technical consultants in the municipalities of Eunápolis, Itabela and Porto Seguro. The technical coefficients considered present the quantitative needed for one hectare of papaya, from Formosa and Hawaii groups under irrigated conditions. Based on these coefficients, the profitability analysis was performed. For calculations of the damage caused by meleira, losses of 5%, 10%, 20%, 30%, 40%, 50%, and 60% of eradicated plants were considered. The profitability indicators used were NPV, IRR and BCR. Considering the survey of average prices paid to the producer, the profitability indicators for the Hawaii papaya variety were positive for up to 50% of losses, while those in Formosa were up to 60% of losses.

The genus Aristolochia presents conserved features in its basic structural plan of trap flowers and in its pollination syndrome. Visitors, usually flies, are attracted to the rotting-meat scented flowers and remain trapped until the second day, when the protogynous flowers release them. Aristolochia gigantea Mart. and Zucc showed many of these floral traits but display a citronella-like odour, giving the opportunity to study the reproductive ecology in this atypical species. Characteristics and behavior of pollinators, coupled with the distances between individual plants and populations, are important factors in patterns of genetic diversity. Thus, our objectives were to study the flower visitors, reproductive success, and gene flow in A. gigantea in the Chapada Diamantina, Bahia, Brazil. Results suggest that pollination by flies remains as a conserved interaction within the genus Aristolochia. The main pollinators appeared to be Megaselia spp. (Phoridae), evidenced primarily by the frequency of their occurrence within flowers and the transference of compatible pollen. On the other hand, the moderate to low levels of intrapopulation genetic variability found in A. gigantea, combined with low effective pollination and its reproductive dependence on biotic vectors, indicate that this species may be suffering gene erosion in the remaining populations located at Chapada Diamantina.

Melocactus glaucescens is a cactus endemic to Brazil. In vitro shoot production represents a viable alternative to conventional propagation, since M. glaucescens grows slowly and requires about ten years to reach its reproductive phase. M. glaucescens can only reproduce by seed and does not ramify or emit lateral shoots. The present work evaluated the morphogenic potential of M. glaucescens by (i) using variations in explant fragmentation and orientation; (ii) the use of plant growth regulators (PGRs); (iii) and the occurrence of somaclonal variation. The results suggest that number of shoots decreased with greater explant fragmentation. Shoot induction can be achieved in culture media with or without PGRs. The evaluation of the morphogenic responses of M. glaucescens explants to PGRs revealed that, when combining naphthalene acetic acid (NAA) with benzylaminopurine (BAP) or kinetin (KIN), BAP yielded a greater number of shoots than KIN. However, with BAP concentrations of 4.44, 8.88, and 17.76 μM, shoots were morphologically different from the control plants. The ISSRs analysis showed polymorphisms in shoots produced with or without PGRs and suggests that other factors might affect the genetic stability of M. glaucescens. Our results indicate that M. glaucescens can be propagated using in vitro techniques with or without PGRs. Apical cladode segments can grow in PGR-free medium and can be used as a source of explants. The technique established in this work reduces the removal of seeds from natural populations, and therefore, does not interfere in the reproduction dynamics of this species in its natural habitat.

The aim of the present work was to clarify the origin and phylogenetic position of the species belonging to the genus Ilex (Aquifoliaceae), especially the South American species. Phylogenetic relationships of the genus Ilex were investigated using the plastid psbA-trnH intergenic spacer and parsimony and Bayesian analyses. The psbA-trnH intergenic spacer was shown to evolve slowly within Ilex, but a major gap present in this region was useful in the phylogenetic study of the genus. To obtain more potentially parsimonious characters, atpB-rbcL intergenic spacer data were combined with those for psbA-trnH. Many gaps present in the psbA-trnH region were useful in the phylogenetic study of the genus Ilex. The topology of the trees showed that, in general, the clades are strongly related to geographical areas, a fact especially evident in certain different Asian lineages.

The high endemism, the natural habitat degradation, and the over-collection for ornamental purposes have led some species such as Melocactus paucispinus and Melocactus glaucescens to be threatened with extinction. The use of in vitro conservation techniques, such as slow growth storage, promotes the preservation of genetic diversity with integrity. The goal of this study was to establish a strategy for in vitro conservation of apical segments of the cladode of M. paucispinus and M. glaucescens and evaluate the genetic diversity of individuals from in vitro germinated plants. For such purpose, different concentrations of the plant regulator ancymidol and the osmotic agent sucrose on the inhibition of the in vitro growth were tested, and the genetic diversity of M. paucispinus and M. glaucescens individuals stored in vitro was evaluated. Sucrose showed higher efficiency in the reduction of growth than ancymidol for both species. However, due to the reduction in survival percentage, the use of sucrose over 75 g L−1 in the in vitro conservation of both species for 360 days is not recommended. In the genetic diversity analysis, 76.92% of polymorphic loci (P), expected heterozygosity (He) = 0.276 and Shannon index (S) = 0.414 were observed for M. paucispinus. For M. glaucescens, the observed values were P = 95.38%, He = 0.228 and S = 0.369. These values observed here were higher than those previously found for the natural populations of these species, which demonstrated that this in vitro collection showed genetic diversity and can be used in management and reintroduction programs of these species.

The red algal genus Hypnea has a wide geographical distribution along the coast of Brazil, where it has economic and ecological importance. The relatively simple and plastic morphology, often influenced by the conditions of its habitat, complicates the identification of Hypnea species. In the past years, several studies dealing with the taxonomy of Hypnea on the coast of Brazil have changed considerably the known diversity of species in the region. Studies using molecular markers led to the description of new species, while other names were placed in synonymy. In this review, revaluation of the morphology and the addition of new sequences for COI-5P, UPA and rbcL-3P markers were used in order to better understand the diversity of Hypnea species and their range of distribution. An identification key is presented for eleven species of the genus Hypnea occurring on the coast of Brazil: H. brasiliensis P.B. Jesus, Nauer & J.M.C. Nunes, H. cervicornis J. Agardh, H. cornuta (Kützing) J. Agardh, H. cryptica P.B. Jesus & J.M.C. Nunes, H. edeniana Nauer, Cassano & M.C. Oliveira, H. flava Nauer, Cassano & M.C. Oliveira, H. pseudomusciformis Nauer, Cassano & M.C. Oliveira, H. platyclada P.B. Jesus & J.M.C. Nunes, H. spinella (C. Agardh) Kützing, H. yokoyana Nauer, Cassano & M.C. Oliveira and H. wynnei Nauer, Cassano & M.C. Oliveira. Of all taxonomic characteristics proposed by earlier studies, the only ones that have taxonomic value considering the species analyzed in this work were: (1) habit of the thallus, (2) main axis, (3) apex shape, (4) form of the branchlets and (5) tetrasporangial sori position in the branches. However, the identification of the species based only on morphological characteristics should be made with caution, once phenotypic plasticity and convergent morphologies are present in the group. The DNA barcode technique, especially the COI-5P marker, proved to be very effective in the identification and delimitation of the species, revealing scenarios that would go unnoticed by morphology alone.

Chitin synthase (CHS) is a glucosyltransferase that converts UDP-N-acetylglucosamine into chitin, one of the main components of fungal cell wall. Class III chitin synthases act directly in the formation of the cell wall. They catalyze the conversion of the immediate precursor of chitin and are responsible for the majority of chitin synthesis in fungi. As such, they are highly specific molecular targets for drugs that can inhibit the growth and development of fungal pathogens. In this work, we have identified and characterized a chitin synthase gene of Moniliophthora perniciosa (Mopchs) by primer walking. The complete gene sequence is 3,443 bp, interrupted by 13 small introns, and comprises a cDNA with an ORF with 2,739 bp, whose terminal region was experimentally determined, encoding a protein with 913 aa that harbors all the motifs and domains typically found in class III chitin synthases. This is the first report on the characterization of a chitin synthase gene, its mature transcription product, and its putative protein in basidioma and secondary mycelium stages of M. perniciosa, a basidiomycotan fungus that causes witches’ broom disease of cacao.

Many Fabaceae species have a hard and impermeable seed coat that requires scarification for germination. The variability within a batch and between batches of the same species can be very high, resulting in inefficient dormancy breaking. The main objectives of this study were to investigate the variability in hardseededness among four populations of the legume species Medicago polymorpha, Trifolium glomeratum and T. subterraneum, and to evaluate the effect of the best scarification treatments on the mechanical properties of the seed coat. These species have very small seeds that hinder scarification procedures. Different treatments, including sanding and temperature changes, were studied. Results varied among species, and the most efficient treatment for breaking dormancy was determined for each one. For each species, wide variability was observed in the best scarification treatment within and among populations. The effect of the best scarification treatment on the seed coat of each species was examined by means of scanning electronic microscopy (SEM). Evident differences were found in T. glomeratum, as the treatment used was sanding. In T. subterraneum, scarified seeds (by thermal treatment) showed wider hilum opening. No differences were observed in M. polymorpha seeds.

A detailed morpho-anatomical study of the genus Hypnea from the state of Bahia is presented. Eight species have been recognized: H. cenomyce, H. cervicornis, H. cornuta, H. musciformis, H. nigrescens, H. platyclada, H. spinella and H. valentiae. An identification key, as well as descriptions, illustrations, comparisons with related taxa and maps of distribution in Bahia for each species, are presented.

The phytopathogenic fungus Moniliophthora perniciosa (Stahel) Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11) that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR). Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.

Abstract Piresia, a small genus of herbaceous bamboos, has a geographical disjunction between the Caribbean and northern/western South America and the north-eastern Atlantic Forest in Brazil. Piresia leptophylla is reported from western Amazonia (WA) and the north-eastern Atlantic Forest (NAF), but its occurrence in western Amazonia is questionable. Using an integrative approach, we combined traditional morphological analysis, anatomy and niche modelling. The results revealed few macromorphological differences between WA and NAF specimens (only plant height, leaf length, lodicule dimensions, shape and position), contrasting with consistent differences in leaf anatomy (macrohairs and cruciform silica bodies in the costal zone of the adaxial/abaxial leaf surfaces, crenate silica bodies on the abaxial leaf surface, lack of panicoid hairs on the abaxial leaf surface, bicellular microhairs and lobed papillae over the abaxial leaf surface, and sparse but elongated fusoid cells in the mesophyll of WA specimens) and in niche patterns. The anatomical/micromorphological characters suggest environmental adaptations to the Amazonian and ‘restinga’ forests, respectively. We therefore propose the segregation of the WA populations into a new species, Piresia tenella sp. nov. We provide a formal description, photographs, a line illustration, a distribution map and discussion of the conservation status for the new species.

Abstract Hypnea is a monophyletic genus with a complex nomenclatural and taxonomic history, and is an important commercial source of carrageenan. Phylogenies of this genus have been accessed based primarily on Asian species; however, recent studies performed in South America revealed a great diversity of species, for which phylogenetic relationships need to be evaluated. Three infrageneric sections are recognized in the genus: Pulvinatae , Spinuligerae , and Virgatae ; however, morphological and molecular circumscriptions within each section lack clarity. In this study, we analyzed three distinct markers to establish phylogenetic relationships among Hypnea species. To assign each species to the correct section, morphological data were obtained from original descriptions, reference literature, and comparisons with type/topotype and herbaria specimens. Our analyses recovered robust phylogenies for the genus and provided new insights on the taxonomic status and relationships among and within Hypnea species. The combination of three genetic markers increased the resolution and support, resulting in the largest and best-resolved phylogeny of the genus to date. Single and combined analyses revealed that the three sections of the genus Hypnea are taxonomically irrelevant, as currently recognized. Morphological differences are not associated with monophyletic groups and similarities among clades could be better explained by convergent evolution in thallus habit.

Hypnea pseudomusciformis was recently described from South America, and has three morphological variants: “musciformis”, “nigrescens”, and “valentiae”. Information on the biology of these variants may help to explain this species’ wide morphological variation despite the absence of genetic divergence among variants. More morphological and ecological data has accumulated on the “musciformis” variant occurring on the Brazilian coast than for the others. In this study, we described the reproductive morphology of a tropical “nigrescens” population and investigated its phenology to provide crucial biological information about this taxon, and perhaps also assist in answering questions about the systematics of H. pseudomusciformis variants. The population analyzed showed no significant fluctuations in its total biomass throughout the year. All reproductive stages were frequently recorded during this study, which contributes greatly to our knowledge of the reproductive morphology of the “nigrescens” variant. Phenological variations were correlated with environment variables, such as air and sea-surface temperatures, insolation, precipitation, and humidity. Male gametophytes were frequently present, which has never been reported for the “musciformis” variant. We showed that, despite being members of the same genetic species, the “nigrescens” and “musciformis” morphological variants exhibit remarkable differences in their ecology and biology.

Abstract Anomochlooideae (Poaceae) represent the earliest-diverging extant lineage of grasses. One of the two genera is the monotypic Anomochloa, which is extremely rare and restricted to the Atlantic Forest of southern Bahia state in Brazil, where only two natural populations have been recorded to date. Knowledge of A. marantoidea is considered crucial to understanding evolutionary and diversification patterns in Poaceae. Despite this, knowledge of the biology and distribution of A. marantoidea remain incomplete, and thus the conservation of this poorly known species is problematic. We used niche modelling to estimate its current distribution and assess potential ranges in situ to explore new occurrences. In addition, genetic diversity and the factors that disrupt gene flow between populations of this species were estimated using molecular markers. Two new populations were documented; the modelled ecological niche indicates high climatic restriction, but also revealed suitable sites for the establishment of new populations. Genetic diversity is correlated to population size, and genetic structure analysis suggests recent fragmentation and low gene flow among the remaining populations, which exhibit high levels of inbreeding. These levels also indicate the capacity of A. marantoidea to respond favourably to selection and, thus, that a conservation plan could be designed to maintain the current genetic diversity.

Senecio coincyi (Asteraceae) is a threatened endemic plant of central and north western Spain with a very narrow occurrence. In this study, germination tests under controlled conditions of light and temperature were carried out to evaluate interpopulation variation in the germination patterns of S. coincyi cypselas from 12 populations. The effects of nitrate (1, 5, 10, 25 and 50 mM KNO3) on percentage and rate of germination were also determined. Untreated cypselas of S. coincyi reached very high germination percentages (83-94%, depending on population), and there was no significant differences depending on population. In contrast, there were significant differences among populations in germination velocity, both for untreated and treated seeds. For all studied populations, KNO3 concentrations from 1 to 50 mM did not significantly affect germination percentage. Similarly, there was not a significant effect of KNO3 at concentrations in the range of 1 to 25 mM on germination speed. Only the highest KNO3 concentration (50 mM) significantly decreased the germination speed of the cypselas from most of the populations.

Two Leptolyngbya-like cyanobacterial strains were isolated from two marine benthic environments on the Brazilian coast. These strains were cultured and characterized based on their morphology, molecular, and ultrastructural data. The two taxa were identified mainly by 16S rRNA gene phylogeny and 16S-23S ITS secondary structures since their morphology is similar to members of Leptolyngbya senso lato. The phylogenetic analysis indicated that our strains belong to Euryhalinema genus (Leptolyngbyaceae), with one strain close to type species E. mangrovii AP9F (MK402979), and the other described as a new species, E. epiphyticum sp. nov. Morphologically, both strains form green mats, had trichomes without sheath, and their thylakoid disposition is the same as described for Leptolyngbyaceae. The secondary structures Box B and D1-D1’ of the internal transcribed spacer (16S–23S ITS) also corroborated our proposal of the new species E. epiphyticum. These findings constitute the first description of a new-to-science species for this genus outside Indian marine environments. Also, it expands the knowledge on Euryhalinema systematic.

Abstract Piresia , a Neotropical herbaceous bamboo genus (Poaceae, Olyreae) including six described species, has a disjunct geographic distribution involving the Caribbean and north/western South America and the northeastern Atlantic Forest in Brazil. Its phylogenetic relationships are poorly known, especially with respect to certain monotypic genera within Olyrinae, such as Reitzia , endemic to the Atlantic forest of southern/south Brazil, and Piresiella , endemic to Cuba. In order to examine the evolutionary history of Piresia , we analyzed 36 samples, including known and possible new species of the genus, as well as members of Reitzia , Piresiella and other genera of subtribes Olyrinae, Parianinae and Buergersiochloinae as the ingroup, and selected woody bamboos and Lolium (Pooideae) as the outgroups. Five regions of plastid and nuclear non‐coding DNA spacers ( trnD‐trnT , trnS‐trnG , rpl32‐trnL , trnH‐psbA , ITS) were sequenced, and to estimate phylogenetic relationships, we used Bayesian inference, maximum likelihood and maximum parsimony considering the plastid regions (with and without gaps) and ITS separately. Surprisingly, Piresiella emerged as sister to the monotypic Buergersiochloa (Buergersiochloinae), endemic to New Guinea. Based on these results and morphological analysis, we discuss the implications for the biogeography of the herbaceous bamboos, formally transfer Ekmanochloa , Mniochloa and Piresiella to Buergersiochloinae, and provide an emended description of the subtribe. Three main lineages were recovered within Olyrinae, one of them comprising Piresia and Reitzia , with high support. Within this clade, the two main lineages are geographically distinct, and their evolutionary history seems to be complex and possibly related to adaptations to climatic conditions. We suggest new directions for future studies involving this clade, in order to better understand its evolutionary history and generic circumscription.

Caiman latirostris has a large geographic distribution, that includes Argentina, Bolivia, Brazil, Paraguay, and Uruguay. In Brazil illegal hunting and land use change have caused population decline, relatively well documented in the last three decades. Due to such circumstances, the estimate of species effective population size might help analyze its viability. Single-sample estimator was used to estimate current effective population size (Ne) of broad-snouted caiman populations in representative areas of the species range in Brazil. For the analyzes, genotypes previously obtained were used for subpopulations of the captive colony of the University of São Paulo (USP) and for wild subpopulations. The microsatellites used were Amiμ8, Amiμ11, Amiμ13, Amiμ20, Claμ2, Claμ5, Claμ6, Claμ7, Claμ8, Claμ9 and Claμ10. The 11 loci analyzed produced 18.27 alleles on average. Wild populations showed significant genic and genotypic differentiation among them (p < 0.01). Population structure analyses (Rho-statistics) at Genepop for all loci was 0.376. The effective number of population sizes (Ɵ, the Ne estimator of Migrate-n software) of Caiman latirostris populations from the captive colony at the USP was 117.1 (N = 7) for NRF, 115.2 (N = 4) for Fm1, and 107.5 (N = 4) for Fm5, on the oposite side, the mean value of theta (Ɵ) was 7.7 (N = 51) for the Atlantic SE basin wild population, 9.4 (N = 42) for the Atlantic N/NE basin wild population and 9.6 (N = 91) for the Paraná basin wild population. The mean number of migrants (M of Migrate-n software) varied from 1.7 to 1.9 estimated by migrate-n are comparable to 1.3 estimated by Genepop. It is observed that in most wild population only few adults effectively contribute to genetic variation. The following guidlines are proposed as management actions: (1) an update of population sampling; (2) redefinition, delimitation and conservation of natural habitats; and (3) new conservation genetic studies with special attention to genetic diversity recovery.

Ichnanthus hoffmannseggii is an annual panicoid grass that occurs in sandy and open areas of Brazil and currently includes I. piresii in its synonymy. However, herbarium and field work led us to question this circumscription. In a previous phylogenetic study, a specimen with morphological affinities to I. hoffmannseggii was recovered as more related to Echinolaena oplismenoides (currently I. oplismenoides). This study aimed to clarify the relationship between I. hoffmannseggii, I. oplismenoides, and I. piresii using molecular and macro- and micromorphological data. We recognize these three taxa as distinct species and provide characters for distinguishing them and related species, including descriptions, comments, illustrations, distribution maps, SEM images of the upper anthecium, and phylogenetic relationships.

O objetivo deste trabalho foi avaliar, por meio de marcadores SSR, a diversidade genética de Xylella fastidiosa no Estado da Bahia. Foram estudadas duas das principais regiões produtoras de citros no Estado, o Litoral Norte e o Recôncavo Sul. Para fins comparativos, utilizaram-se dez amostras provenientes do Estado de São Paulo. Foram empregados os seguintes iniciadores: ASSR20, OSSR9, OSSR17, CSSR4, CSSR12 e CSSR20, dos quais os quatro últimos permitiram identificar 22 loci polimórficos. As populações de X. fastidiosa presentes em citros no Estado da Bahia apresentam elevada diversidade genética, com base nos marcadores SSR, com pools gênicos distintos e agrupamento geográfico. No Litoral Norte, as populações do isolado apresentam maior diversidade genética do que as da região do Recôncavo Sul da Bahia.

Brazil’s Atlantic Ocean coast is approximately 7500 km long, with several coastal and oceanic islands. The cyanoflora of this area is not commonly included in published studies, resulting in an underestimated diversity. Here, we isolated and analysed through a polyphasic approach three strains of marine benthic homocyted cyanobacteria from Brazilian coastal islands with two distinct climates: ALCB 132761 and ALCB 132774 are from the tropics, and ALCB 132760 from the subtropics. These strains presented differences in their cell morphometry and presence/absence of sheath, but were similar in apical cell shape, colour, and form of the trichome. In the 16S rRNA phylogeny, Maximum likelihood (ML) and Bayesian posterior probability (PP) analyses placed our strains in two robust clades. We propose that Microlinema tropicalium gen. et sp. nov. (ALCB 132774) is placed in the Leptolyngbyaceae, and Insularia amadoi gen. et sp. nov. (ALCB 132761) and Salileptolyngbya insularis sp. nov. (ALCB 132760) in Pseudanabaenaceae. The 16S-23S Internal Transcribed Spacer (ITS) was used to reconstruct Box B and D1-D1’ secondary structures, which were treated as autapomorphic characters. The new thin homocyted benthic cyanobacterial taxa described here from marine coastal islands of Brazil help to disentangle the Leptolyngbyaceae and Pseudanabaenaceae.HIGHLIGHTS •Polyphasic description of two new Brazilian genera Insularia and Microlinema.•Expansion of Salileptolyngbya: recognition of one species for the Atlantic Ocean.•Elucidation of benthic genera in the Leptolyngbyaceae and Pseudanabaenaceae.

Abstract Currently, Huanglongbing (HLB) is the most devastating citrus disease in the world. Until the moment, there is no resistant variety to the disease pathogens and the management of the disease includes the chemical control of the insect vector, the Asian citrus psyllid Diaphorina citri (ACP). The goal of this study was to identify the attractiveness of citrus varieties to ACP using a four-arm olfactometer and to identify the volatile organic compounds emitted by the analyzed plants. The following varieties were used: 'Valencia', 'Westin' and 'Pera' sweet orange scions, also the rootstocks, 'Rangpur lime', 'Sunki Tropical', and 'HTR059' hybrid. The VOCs were extracted using the SPME technique and identified through GC-MS. 'Sunki Tropical', 'Rangpur lime' and 'Valencia' were more attractive to D. citri than the others varieties. The main compounds found in the least attractive varieties were β -pinene and linalol in 'Pera', β-pinene and decanol in 'Westin', β -caryophyllene and γ-elemene in 'HTR 059'. Therefore, 'HTR 059', 'Pera' and 'Westin' are the varieties indicated to implement actions to prevent the introduction and spread of the disease. 'Valencia', 'Sunki Tropical' and 'Rangpur lime' are the least suitable varieties for cultivation when HLB prevention is required.

Passion fruit woodiness disease, caused by the Cowpea aphid-borne mosaic virus (CABMV), is one of the leading phytosanitary challenges of passion fruit production. Passiflora cincinnata has been recognized for its potential in genetic improvement due to its highest resistance to CABMV and other phytopathogens. Metabolomic and histological alterations of P. cincinnata infected with CABMV were evaluated and searched for differential responses during the asymptomatic or symptomatic infection phases to correlate them with the mechanisms of metabolic defense. The metabolites of infected plants were analyzed by liquid chromatography-mass spectrometry. Based on the metabolomic profile, the times of infection were grouped into early or late infection phases. The metabolites related to CABMV infection were classified as alkaloids, saponins, phospholipids and acids. This study can assist agricultural institutions or farms in the early diagnosis and correct management of CABMV infection and contribute to the genetic improvement of the Passiflora genus against this disease.

Species delimitation in herbaceous bamboos has been complex and, in some genera, a great part of its diversity has been confirmed only based on genetic information, as is the case of the genus Raddia. It includes nine species, all occurring in Brazil, but only R. portoi predominates in dry forests of the Northeast associated with the Caatinga phytogeographic domain. This species is morphologically close to R. angustifolia, which is known for a single location in the Atlantic Forest in Southern Bahia, and is considered to be threatened by extinction. Besides problems with taxonomic focus, actions for its conservation are complicated because it is not certain if it must be considered an independent species or included in the more widespread R. portoi. In this study, we used coalescent multispecies (MSC) theory approaches combined with genetic structure analyses in an attempt to delimit these two species. Different analyses were congruent and the species delimitation using MSC inferred distinct lineages supporting their recognition as two species. These results solved the taxonomic doubts and also showed the power of these approaches to delimit species as lineages, even in groups with weak morphological divergence and low genetic variability, and also impacting our knowledge for conservation purposes.

This study aimed at selecting determinant morphoagronomic descriptors to characterize and evaluate Physalis angulata L. germplasm. Twelve quantitative and twenty-two qualitative descriptors were analyzed in six accessions of P. angulata coming from the physalis germplasm collection belonging to the State University of Feira de Santana-BA. The selection and discharge of quantitative descriptors was based on the direct selection and on the Singh method, while qualitative descriptors were analyzed through entropy. The statistic analyses were carried out using the GENES and R programs. Ten quantitative descriptors were excluded through direct selection and five through the Singh method. However, only four descriptors were considered redundant by both methods: east-west fruit, weight of five ripe fruits, width of leaf blade and total soluble solids. Although the total soluble solids descriptor was appointed for discharge, it was included in the group of descriptors selected due to its importance in the characterization of physalis fruit. The list of minimum descriptors to describe physalis accessions comprised 15 descriptors: plant height, stem diameter, north-south fruits, number of fruits per plant, leaf blade length, internode length, fruit longitudinal length, fruit transversal length, total soluble solids, growth habit, stem color, leaf margin shape, unripe calyx color, unripe fruit shape and color. These were nine quantitive and six qualitative descriptors, respectively. The discharge of 55.88% of the descriptors did not cause significant loss of information and might allow the reduction of time and resources spent to characterize and evaluate physalis germplasm.

Discocactus zehntneri subsp. petr-halfari, an endangered taxon, is represented by a single population in an anthropized area of Bahia, Brazil, where it is suffering due to extreme extractivism. Thus, information about this cactus, such as its reproductive patterns, is urgently needed to support conservation strategies. A population genetics approach was used to determine if this subspecies has a preferential pattern of reproduction. We sampled 18 individuals, both with and without connection to parental plants, from five clumps and assessed their diversity and genetic structure using five ISSR markers. The results revealed two clumps that are genetically supported by the presence of genetically equal individuals. The other three groups presented individuals that are genetically different and similar to individuals in other clumps. These findings suggest that this subspecies has sexual and clonal reproduction and that its environmental distribution might be shaped by events of dispersion. In addition, a possible hybrid origin may explain its rates of genetic diversity. Despite all these factors, this taxon is in danger and so the development of conservation strategies to preserve its population are urgently needed, including in situ and ex situ actions such as the micropropagation in vitro, living collections and cryopreservation.

&lt;!--[if gte mso 9]&gt;&lt;xml&gt; &lt;o:OfficeDocumentSettings&gt; &lt;o:AllowPNG /&gt; &lt;o:TargetScreenSize&gt;800x600&lt;/o:TargetScreenSize&gt; &lt;/o:OfficeDocumentSettings&gt; &lt;/xml&gt;&lt;![endif]--&gt;&lt;p&gt;&lt;strong&gt;Introdução&lt;/strong&gt;: a doença de Huntington (DH) é uma enfermidade neurodegenerativa e de desenvolvimento tardio, autossômica dominante. Declínio cognitivo, coréia, disfunção motora severa e óbito no estágio final, são sintomas que caracterizam a doença. Atualmente, testes moleculares para diagnóstico pré-sintomático estão acessíveis à população em risco, porém implicações éticas permeiam esse tipo de exames. &lt;strong&gt;Objetivo&lt;/strong&gt;: avaliar aspectos atuais da realização de testes genéticos para DH no Brasil por meio de estudo analítico de amostra de laboratórios. &lt;strong&gt;Metodologia&lt;/strong&gt;: foram utilizados questionários semiestruturados enviados a 19 laboratórios que ofereciam testes diagnósticos e preditivos para a doença em suas paginas virtuais, por meio de correio eletrônico, a fim de obter informações sobre a metodologia empregada para os testes, infraestrutura, composição da equipe técnica, sexo dos indivíduos atendidos, percentagem de resultados positivos e cuidados oferecidos ao indivíduo/família antes e após a realização dos exames. &lt;strong&gt;Resultados&lt;/strong&gt;: os laboratórios que aceitaram participar do estudo e responderam ao questionário informaram dispor de uma infraestrutura excelente, em termos de pessoal e equipamentos, atendendo aos requisitos básicos para a realização dos exames utilizando principalmente a técnica da Reação em Cadeia da Polimerase (PCR), na metodologia molecular. O percentual de resultado positivo para DH nos laboratórios pesquisados variou de 30 a 90%, sendo que este último percentual foi apresentado pelo laboratório vinculado a Instituto Público de Ensino Superior que era o único a oferecer acompanhamento psicológico e/ou psiquiátrico antes e após os exames. &lt;strong&gt;Conclusão: &lt;/strong&gt;para promover a ampliação do acesso a esse tipo de teste à população acometida pela doença de Huntington, deve ser estimulada a criação de laboratórios com tecnologia de ponta e a formação de recursos humanos especializados.&lt;/p&gt;&lt;!--[if gte mso 9]&gt;&lt;xml&gt; &lt;w:WordDocument&gt; &lt;w:View&gt;Normal&lt;/w:View&gt; &lt;w:Zoom&gt;0&lt;/w:Zoom&gt; &lt;w:TrackMoves /&gt; &lt;w:TrackFormatting /&gt; &lt;w:HyphenationZone&gt;21&lt;/w:HyphenationZone&gt; &lt;w:PunctuationKerning /&gt; &lt;w:ValidateAgainstSchemas /&gt; &lt;w:SaveIfXMLInvalid&gt;false&lt;/w:SaveIfXMLInvalid&gt; &lt;w:IgnoreMixedContent&gt;false&lt;/w:IgnoreMixedContent&gt; &lt;w:AlwaysShowPlaceholderText&gt;false&lt;/w:AlwaysShowPlaceholderText&gt; &lt;w:DoNotPromoteQF /&gt; &lt;w:LidThemeOther&gt;PT-BR&lt;/w:LidThemeOther&gt; &lt;w:LidThemeAsian&gt;X-NONE&lt;/w:LidThemeAsian&gt; &lt;w:LidThemeComplexScript&gt;X-NONE&lt;/w:LidThemeComplexScript&gt; &lt;w:Compatibility&gt; &lt;w:BreakWrappedTables /&gt; &lt;w:SnapToGridInCell /&gt; &lt;w:WrapTextWithPunct /&gt; &lt;w:UseAsianBreakRules /&gt; &lt;w:DontGrowAutofit /&gt; &lt;w:SplitPgBreakAndParaMark /&gt; &lt;w:EnableOpenTypeKerning /&gt; &lt;w:DontFlipMirrorIndents /&gt; &lt;w:OverrideTableStyleHps /&gt; &lt;/w:Compatibility&gt; &lt;m:mathPr&gt; &lt;m:mathFont m:val="Cambria Math" /&gt; &lt;m:brkBin m:val="before" /&gt; &lt;m:brkBinSub m:val=" " /&gt; &lt;m:smallFrac m:val="off" /&gt; &lt;m:dispDef /&gt; &lt;m:lMargin m:val="0" /&gt; &lt;m:rMargin m:val="0" /&gt; &lt;m:defJc m:val="centerGroup" /&gt; &lt;m:wrapIndent m:val="1440" /&gt; &lt;m:intLim m:val="subSup" /&gt; &lt;m:naryLim m:val="undOvr" /&gt; &lt;/m:mathPr&gt;&lt;/w:WordDocument&gt; &lt;/xml&gt;&lt;![endif]--&gt;&lt;!--[if gte mso 9]&gt;&lt;xml&gt; &lt;w:LatentStyles DefLockedState="false" DefUnhideWhenUsed="true" DefSemiHidden="true" DefQFormat="false" DefPriority="99" LatentStyleCount="267"&gt; &lt;w:LsdException Locked="false" Priority="0" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Normal" /&gt; &lt;w:LsdException Locked="false" Priority="9" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="heading 1" /&gt; &lt;w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 2" /&gt; &lt;w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 3" /&gt; &lt;w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 4" /&gt; &lt;w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 5" /&gt; &lt;w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 6" /&gt; &lt;w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 7" /&gt; &lt;w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 8" /&gt; &lt;w:LsdException Locked="false" Priority="9" QFormat="true" Name="heading 9" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 1" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 2" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 3" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 4" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 5" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 6" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 7" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 8" /&gt; &lt;w:LsdException Locked="false" Priority="39" Name="toc 9" /&gt; &lt;w:LsdException Locked="false" Priority="35" QFormat="true" Name="caption" /&gt; &lt;w:LsdException Locked="false" Priority="10" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Title" /&gt; &lt;w:LsdException Locked="false" Priority="1" Name="Default Paragraph Font" /&gt; &lt;w:LsdException Locked="false" Priority="11" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtitle" /&gt; &lt;w:LsdException Locked="false" Priority="22" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Strong" /&gt; &lt;w:LsdException Locked="false" Priority="20" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Emphasis" /&gt; &lt;w:LsdException Locked="false" Priority="59" SemiHidden="false" UnhideWhenUsed="false" Name="Table Grid" /&gt; &lt;w:LsdException Locked="false" UnhideWhenUsed="false" Name="Placeholder Text" /&gt; &lt;w:LsdException Locked="false" Priority="1" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="No Spacing" /&gt; &lt;w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading" /&gt; &lt;w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List" /&gt; &lt;w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid" /&gt; &lt;w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1" /&gt; &lt;w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2" /&gt; &lt;w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1" /&gt; &lt;w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2" /&gt; &lt;w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1" /&gt; &lt;w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2" /&gt; &lt;w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3" /&gt; &lt;w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List" /&gt; &lt;w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading" /&gt; &lt;w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List" /&gt; &lt;w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid" /&gt; &lt;w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 1" /&gt; &lt;w:LsdException Locked="false" UnhideWhenUsed="false" Name="Revision" /&gt; &lt;w:LsdException Locked="false" Priority="34" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="List Paragraph" /&gt; &lt;w:LsdException Locked="false" Priority="29" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Quote" /&gt; &lt;w:LsdException Locked="false" Priority="30" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Quote" /&gt; &lt;w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 1" /&gt; &lt;w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 2" /&gt; &lt;w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 3" /&gt; &lt;w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 4" /&gt; &lt;w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 5" /&gt; &lt;w:LsdException Locked="false" Priority="60" SemiHidden="false" UnhideWhenUsed="false" Name="Light Shading Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="61" SemiHidden="false" UnhideWhenUsed="false" Name="Light List Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="62" SemiHidden="false" UnhideWhenUsed="false" Name="Light Grid Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="63" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 1 Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="64" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Shading 2 Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="65" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 1 Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="66" SemiHidden="false" UnhideWhenUsed="false" Name="Medium List 2 Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="67" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 1 Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="68" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 2 Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="69" SemiHidden="false" UnhideWhenUsed="false" Name="Medium Grid 3 Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="70" SemiHidden="false" UnhideWhenUsed="false" Name="Dark List Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="71" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Shading Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="72" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful List Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="73" SemiHidden="false" UnhideWhenUsed="false" Name="Colorful Grid Accent 6" /&gt; &lt;w:LsdException Locked="false" Priority="19" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis" /&gt; &lt;w:LsdException Locked="false" Priority="21" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Emphasis" /&gt; &lt;w:LsdException Locked="false" Priority="31" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Reference" /&gt; &lt;w:LsdException Locked="false" Priority="32" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Intense Reference" /&gt; &lt;w:LsdException Locked="false" Priority="33" SemiHidden="false" UnhideWhenUsed="false" QFormat="true" Name="Book Title" /&gt; &lt;w:LsdException Locked="false" Priority="37" Name="Bibliography" /&gt; &lt;w:LsdException Locked="false" Priority="39" QFormat="true" Name="TOC Heading" /&gt; &lt;/w:LatentStyles&gt; &lt;/xml&gt;&lt;![endif]--&gt;&lt;!--[if gte mso 10]&gt; &lt;mce:style&gt;&lt;! /* Style Definitions */ table.MsoNormalTable {mso-style-name:"Tabela normal"; mso-tstyle-rowband-size:0; mso-tstyle-colband-size:0; mso-style-noshow:yes; mso-style-priority:99; mso-style-parent:""; mso-padding-alt:0cm 5.4pt 0cm 5.4pt; mso-para-margin:0cm; mso-para-margin-bottom:.0001pt; mso-pagination:widow-orphan; font-size:10.0pt; font-family:"Calibri","sans-serif";} --&gt; &lt;!--[endif] --&gt;

Bulbophyllum Thouars is a pantropical genus. It is one of the most species-rich genera of the Orchidaceae, with ca. 1.200 species (Dressler 1993). The genus pre- sents myophily (pollination by Diptera) as pollination syndrome. Because orchid species are mainly self- compatible, we expect that fly-pollinated orchids pre- sent low variability within the populations and high genetic differentiation among conspecific populations, due to the reduction of the gene flow (Borba &amp; Semir 1998, Borba et al. 2001). This could help to explain the high number of species in genera of fly-pollinated orchids, most of them with restricted distribution.

La gestion de los bancos de germoplasma mediante la conservacion de semillas se encuentra en ocasiones con dificultades tecnicas que pueden llegar a hacer su tarea poco eficiente. Una de esas dificultades puede ser el llevar a cabo los ensayos de viabilidad de las semillas de forma que los resultados se acerquen lo mas posible a la verdadera situacion de los lotes estudiados. Este aspecto tiene especial importancia en aquellos casos en los que las semillas presentan dormicion. Una caracteristica de las semillas de especies de la familia Fabaceae es presentar cubiertas duras. En estos casos la estrategia a aplicar se basa en utilizar tratamientos de escarificacion. Sin embargo, en ocasiones, la variabilidad dentro de un lote de semillas y entre lotes (por ejemplo distintas poblaciones de una misma especie) puede ser muy elevada. El objetivo de este trabajo fue estudiar la variabilidad de la dureza de las cubiertas seminales entre cuatro poblaciones de cada una de estas especies: Medicago polymorpha, Trifolium glomeratum y T. subterraneum. Estas especies presentan ademas semillas de muy pequeno tamano que dificultan los tratamientos de escarificacion. Se utilizaron diversos tratamientos de escarificacion que incluian el lijado de las semillas y tratamientos termicos (frio, calor o cambios bruscos de temperatura). Los mejores tratamientos variaron con las especies y se pudo determinar aquellos que dieron los mejores resultados en las cuatro poblaciones estudiadas, de forma que la germinacion aumento desde un 0-10 % de las semillas control a 84-100 % en las escarificadas. Mediante el equipo Texture Analyzer TAXTPLUS se midio la dureza de las semillas, en relacion a su resistencia a la rotura. Se observo una gran variabilidad dentro de cada poblacion y entre poblaciones. La contribucion en la reduccion de la dureza de las cubiertas del mejor tratamiento de escarificacion vario entre especies y entre poblaciones. Se discute la utilidad del estudio previo de la dureza de las semillas para determinar el mejor tratamiento a emplear. Agradecimientos: Proyecto RF2012-00014-C02-02

O maracujazeiro pertencente ao genero Passiflora L. possui grande diversidade de especies e distribuicao geografica no Brasil estando presente em todas as regioes do pais. Nas ultimas decadas, a cultura tem apresentado acentuada expansao despertando interesse dos fruticultures por apresentar rapido inicio de colheita e ter boa valorizacao no mercado interno e externo. A principal especie comercializada e o maracuja-amarelo ou azedo, P. edulis Sims f. flavicarpa O. Deg. Dentre os problemas fitossanitarios que afetam o cultivo do maracuja acarretando prejuizos economicos destaca-se a virose do endurecimento do fruto, causada pelo Cowpea aphidborne mosaic virus (CABMV). O maracuja-amarelo e suscetivel ao virus, mas existem algumas especies silvestres de Passiflora que sao mais resistentes, dentre as quais destaca-se P. setacea que pode ser utilizada no melhoramento genetico do maracuja comercial, por meio de hibridacoes interespecificas. A caracterizacao genetica de P. setacea e uma etapa importante para o desenvolvimento de estrategias de conservacao da especie bem como subsidiar programas de melhoramento.

A Clorose Variegada dos Citros (CVC), causada pela bacteria Xylella fastidiosa, e uma doenca de grande importância economica para a citricultura brasileira devido a reducao na producao e qualidade dos frutos.

A fusariose do maracujazeiro e causada por fungos das especies Fusarium oxysporum f. sp. passiflorae (FO) e F. solani (FS) e seus principais sintomas incluem a murcha e podridao das raizes, respectivamente.

O Brasil e o maior produtor mundial de maracuja amarelo (Passiflora edulis Sims f. flavicarpa Deg.) e o Estado da Bahia lidera a producao da fruta. A fusariose, incitada por Fusarium oxysporum f. sp. passiflorae (FO) e F. solani (FS), causa murcha e podridao de raizes, respectivamente, entre outros sintomas, e e um dos principais fatores responsaveis pelo baixo rendimento dos municipios baianos.

Passion fruit woodiness disease, caused by the Cowpea aphid-borne mosaic virus (CABMV), is one of the leading phytosanitary challenges of passion fruit production. Passiflora cincinnata has been recognized for its potential in genetic improvement due to its highest resistance to CABMV and other phytopathogens. Metabolomic and histological alterations of P. cincinnata infected with CABMV were evaluated and searched for differential responses during the asymptomatic or symptomatic infection phases to correlate them with the mechanisms of metabolic defense. The metabolites of infected plants were analyzed by liquid chromatography-mass spectrometry. Based on the metabolomic profile, the times of infection were grouped into early or late infection phases. The metabolites related to CABMV infection were classified as alkaloids, saponins, phospholipids and acids. This study can assist agricultural institutions or farms in the early diagnosis and correct management of CABMV infection and contribute to the genetic improvement of the Passiflora genus against this disease.

O maracujazeiro amarelo, Passiflora edulis Sims f. flavicarpa Deg., e uma fruteira de grande importância para a economia nacional, sendo o Brasil o principal produtor mundial. Um dos principais problemas sao as viroses, destacando-se a do endurecimento dos frutos, provocada pelo Cowpea aphid-borne mosaic virus (CABMV). Agricultores na Bahia vem utilizando fertilizantes foliares na tentativa de reduzir os danos causados pelo virus. Nesse trabalho, foram realizadas analises anatomicas de folhas de maracujazeiro amarelo infectado pelo CABMV e tratado com fertilizante foliar a base dos macronutrientes Ca, Mg e S e do micronutriente B. Para tanto, foi estabelecido um ensaio, no qual se avaliaram cinco tratamentos: T1 ? Plantas sem inoculacao e sem aplicacao de fertilizante foliar; T2 ? Plantas sem inoculacao e tratadas com fertilizante foliar; T3 ? Plantas inoculadas com o CABMV sem aplicacao de fertilizante foliar; T4 ? Plantas inoculadas com CABMV e posteriormente tratadas com fertilizante foliar; T5 ? Plantas inoculadas com CABMV e tratadas, antes e depois da inoculacao, com fertilizante foliar. Foram coletadas amostras foliares de plantas de todos os tratamentos para a realizacao de estudos histologicos de secoes paradermicas e transversais. Foram observadas diferencas significativas entre os tratamentos avaliados. Plantas infectadas pelo CABMV apresentaram grandes alteracoes na anatomia das folhas, como hipertrofia e hiperplasia do parenquima, e desorganizacao dos feixes vasculares, enquanto as tratadas com fertilizante foliar mostraram alteracoes menos intensas. Plantas infectadas pelo CABMV e tratadas com fertilizante foliar sofreram menores alteracoes nas caracteristicas histologicas, principalmente quando a aplicacao ocorreu antes da inoculacao.

ABSTRACT Hypnea pseudomusciformis was recently described from South America, and has three morphological variants: “musciformis”, “nigrescens”, and “valentiae”. Information on the biology of these variants may help to explain this species’ wide morphological variation despite the absence of genetic divergence among variants. More morphological and ecological data has accumulated on the “musciformis” variant occurring on the Brazilian coast than for the others. In this study, we described the reproductive morphology of a tropical “nigrescens” population and investigated its phenology to provide crucial biological information about this taxon, and perhaps also assist in answering questions about the systematics of H. pseudomusciformis variants. The population analyzed showed no significant fluctuations in its total biomass throughout the year. All reproductive stages were frequently recorded during this study, which contributes greatly to our knowledge of the reproductive morphology of the “nigrescens” variant. Phenological variations were correlated with environment variables, such as air and sea-surface temperatures, insolation, precipitation, and humidity. Male gametophytes were frequently present, which has never been reported for the “musciformis” variant. We showed that, despite being members of the same genetic species, the “nigrescens” and “musciformis” morphological variants exhibit remarkable differences in their ecology and biology.

ABSTRACT Discocactus zehntneri subsp. petr-halfari, an endangered taxon, is represented by a single population in an anthropized area of Bahia, Brazil, where it is suffering due to extreme extractivism. Thus, information about this cactus, such as its reproductive patterns, is urgently needed to support conservation strategies. A population genetics approach was used to determine if this subspecies has a preferential pattern of reproduction. We sampled 18 individuals, both with and without connection to parental plants, from five clumps and assessed their diversity and genetic structure using five ISSR markers. The results revealed two clumps that are genetically supported by the presence of genetically equal individuals. The other three groups presented individuals that are genetically different and similar to individuals in other clumps. These findings suggest that this subspecies has sexual and clonal reproduction and that its environmental distribution might be shaped by events of dispersion. In addition, a possible hybrid origin may explain its rates of genetic diversity. Despite all these factors, this taxon is in danger and so the development of conservation strategies to preserve its population are urgently needed, including in situ and ex situ actions such as the micropropagation in vitro, living collections and cryopreservation.

ABSTRACT Hypnea pseudomusciformis was recently described from South America, and has three morphological variants: “musciformis”, “nigrescens”, and “valentiae”. Information on the biology of these variants may help to explain this species’ wide morphological variation despite the absence of genetic divergence among variants. More morphological and ecological data has accumulated on the “musciformis” variant occurring on the Brazilian coast than for the others. In this study, we described the reproductive morphology of a tropical “nigrescens” population and investigated its phenology to provide crucial biological information about this taxon, and perhaps also assist in answering questions about the systematics of H. pseudomusciformis variants. The population analyzed showed no significant fluctuations in its total biomass throughout the year. All reproductive stages were frequently recorded during this study, which contributes greatly to our knowledge of the reproductive morphology of the “nigrescens” variant. Phenological variations were correlated with environment variables, such as air and sea-surface temperatures, insolation, precipitation, and humidity. Male gametophytes were frequently present, which has never been reported for the “musciformis” variant. We showed that, despite being members of the same genetic species, the “nigrescens” and “musciformis” morphological variants exhibit remarkable differences in their ecology and biology.

ABSTRACT Discocactus zehntneri subsp. petr-halfari, an endangered taxon, is represented by a single population in an anthropized area of Bahia, Brazil, where it is suffering due to extreme extractivism. Thus, information about this cactus, such as its reproductive patterns, is urgently needed to support conservation strategies. A population genetics approach was used to determine if this subspecies has a preferential pattern of reproduction. We sampled 18 individuals, both with and without connection to parental plants, from five clumps and assessed their diversity and genetic structure using five ISSR markers. The results revealed two clumps that are genetically supported by the presence of genetically equal individuals. The other three groups presented individuals that are genetically different and similar to individuals in other clumps. These findings suggest that this subspecies has sexual and clonal reproduction and that its environmental distribution might be shaped by events of dispersion. In addition, a possible hybrid origin may explain its rates of genetic diversity. Despite all these factors, this taxon is in danger and so the development of conservation strategies to preserve its population are urgently needed, including in situ and ex situ actions such as the micropropagation in vitro, living collections and cryopreservation.

A citricultura brasileira lidera o mercado de exportação mundial. A tristeza dos citros é uma doença endêmica causada pelo Citrus tristeza virus (CTV), que é transmitido pelo pulgão preto dos citros, Toxoptera citricida (Kirkaldy). O controle da tristeza é feito, principalmente, pela utilização de porta-enxertos tolerantes ao CTV. Este trabalho teve como objetivo avaliar o comportamento de 50 híbridos de porta-enxerto de citros, gerados pelo Programa de Melhoramento Genético de Citros da Embrapa Mandioca e Fruticultura, quanto à infecção natural pelo CTV. Amostras de cada híbrido foram coletadas no campo experimental e casas teladas da Embrapa em Cruz das Almas. A mostra estava composta por 10 ramos novos, coletados em diferentes quadrantes da planta, que foram avaliados quanto à presença de caneluras por escala de notas: 1. Ausência de caneluras; 2. Presença de caneluras esparsas; 3. Número intermediário de caneluras; 4. Várias caneluras superficiais ou poucas caneluras profundas; 5. Toda a superfície do ramo coberta por caneluras superficiais ou profundas. A avaliação da infecção pelo CTV foi realizada no Laboratório de Biologia Molecular do Campo Avançado da Embrapa no CETAB/Seagri-BA. As amostras inicialmente foram avaliadas por sorologia, utilizando a técnica de ELISA indireto, com antissoro policlonal contra o CTV. Entretanto, as amostras que apresentaram resultados negativos no teste sorológico, foram também avaliadas por RT-PCR. Para tanto, foi realizada a extração de dsRNA a partir da casca de ramos de cada amostra. A extração de dsRNA foi feita com nitrogênio líquido e o precipitado final foi ressuspendindo em 50ul de água livre de RNAse, tratados com DNAse (Promega®). Na reação de transcrição reversa (RT) foi utilizada a enzima M-MLV (Promega®), de acordo com as recomendações do fabricante. Utilizou-se nessa etapa 5ul do dsRNA obtido, primer randômico (250ng/ul), dNTP (10mM), tampão M-MLV, RNase out e M- MLV, totalizando um volume de 25ul. Para PCR, utilizou-se 3ul do DNA obtido na RT, dNTP (2,5mM), tampão Tris/KCl (10x), MgCl2 (50mM), Taq polimerase (5U/ul) e os primers específicos para o CTV F- CN119 (5’ AGATCTACCATGGACGACGAAACAAAG3’) e R-CN120 (5’ GAATTCGCGGCCGCTCAACGTGTGTTAAATTTCC 3’), para um volume final de 25ul. O ciclo de reação adotado foi de 94°C/2min, 55°C/30seg e 72°C/1min, respectivamente. A maioria dos híbridos avaliados foi suscetível ao CTV, mas não desenvolveram os sintomas de canelura, sendo considerados tolerantes ao patógeno. Significado e impacto do trabalho: Apesar de atualmente controlada, a tristeza dos citros constitui ainda uma ameaça aos produtores de citros, já que é endêmica no Brasil. Diante desse fato, a avaliação do comportamento de híbridos gerados pelo Programa de Melhoramento Genético de Citros da Embrapa em relação ao CTV, é uma etapa determinante na seleção de novas variedades.

? O estado da Bahia e o quarto maior produtor nacional de citros, cuja cultura e essencialmente familiar. Nos ultimos anos, pragas importantes tem afetado a citricultura baiana, a exemplo da mancha preta e da clorose variegada dos citros (CVC), sendo o manejo realizado com o uso de agrotoxicos. Entretanto, o controle biologico configura-se como uma alternativa sustentavel para o sistema citricola da regiao. Nesse contexto, especies do genero Trichoderma tem sido amplamente empregadas tendo em vista o controle de fitopatogenos em culturas de interesse economico. Dessa forma, o objetivo desse trabalho foi realizar o levantamento da comunidade de fungos e a prospeccao de especies de Trichoderma associadas a rizosfera de laranjeiras cv. ´Pera` cultivadas no estado da Bahia. Para tanto, foram realizadas coletas de amostras da rizosfera em quatro regioes de producao do Estado, quais sejam: Chapada Diamantina, Litoral Norte, Reconcavo Sul e Semiarido baiano. O metodo de isolamento envolveu a homogeneizacao das amostras de solo, diluicao 1:10, centrifugacao e distribuicao do sobrenadante em placas de Petri contendo os meios Dodine e Batata-Dextrose-Agar (BDA). Apos cinco a sete dias, as placas foram avaliadas quanto a presenca e aos aspectos das colonias. A identificacao em nivel de genero dos fungos recuperados foi realizada a partir de abordagens morfologicas. Ao todo, 415 isolados fungicos, distribuidos em sete generos, foram recuperados, destacando-se os generos Aspergillus, Fusarium e Penicillium, mais abundantes nos pomares avaliados. A identificacao molecular dos isolados de Trichoderma recuperados deu-se pela extracao do DNA total da massa micelial advinda de culturas monosporicas, amplificacao e sequenciamento da regiao do espacador interno transcrito do DNA ribossomal (ITS rDNA). As sequencias obtidas foram comparadas com as sequencias depositadas na plataforma Genbank, por meio da ferramenta BLASTn, e empregadas em analises filogeneticas sobo criterio de Maxima Verossimilhanca e Inferencia Bayesiana. T. asperellum foi a especie recuperada da rizosfera de laranjeiras cv. ?Pera? cultivadas nas quatro regioes baianas avaliadas no presente estudo.

RESUMO A meleira do mamoeiro é considerada um dos maiores problemas fitossanitários da cultura do mamoeiro, mas diversos aspectos da sua epidemiologia ainda são desconhecidos. O objetivo deste trabalho foi determinar o risco e o padrão espaço-temporal da meleira nas condições de cultivo da região extremo sul do estado da Bahia. Foi utilizada a regressão logística para identificar os fatores de riscos associados à ocorrência da meleira na região do extremo sul da Bahia. Para o estudo da distribuição espacial, foram aplicadas as seguintes análises: sequências ordinárias; teste t (student) e áreas isópatas. Os resultados da regressão logística mostraram que o risco de um pomar apresentar meleira sendo consorciado ou consorciado com a cultura do café é maior do que quando estes fatores estão ausentes. Em geral, a meleira evoluiu lentamente do primeiro até o sexto mês de avaliação, com média de até 17,2% de plantas infectadas no sexto mês e chegando até 88% das plantas infectadas em campo ao final da epidemia. Agregação de plantas doentes foi observada em menos da metade das áreas avaliadas. A análise de áreas isópatas indicou uma tendência para início das epidemias a partir das bordas dos pomares e a presença de focos secundários e isolados da doença.

Abstract The high endemism, the natural habitat degradation, and the over-collection for ornamental purposes have led some species such as Melocactus paucispinus and M. glaucescens to be threatened with extinction. The use of in vitro conservation techniques, such as slow growth storage, promotes the preservation of genetic diversity with integrity. The goal of this study was to establish a strategy for in vitro conservation of apical segments of the cladode of M. paucispinus and M. glaucescens and evaluate the genetic diversity of individuals from in vitro germinated plants. For such purpose, different concentrations of the plant regulator ancymidol and the osmotic agent sucrose on the inhibition of the in vitro growth were tested, and the genetic diversity of M. paucispinus and M. glaucescens individuals stored in vitro was evaluated. Sucrose showed higher efficiency in the reduction of growth than ancymidol for both species. However, due to the reduction in survival percentage, the use of sucrose over 75 g L − 1 in the in vitro conservation of both species for 360 days is not recommended. In the genetic diversity analysis, 76.92% of polymorphic loci (P), expected heterozygosity (He) = 0.276 and Shannon index (S) = 0.414 were observed for M. paucispinus . For M. glaucescens , the observed values were P = 95.38%, He = 0.228 and S = 0.369. These values observed here were higher than those previously found for the natural populations of these species, which demonstrated that this in vitro collection showed genetic diversity and can be used in management and reintroduction programs of these species.