Akira Andoh

Inflammatory bowel disease (IBD), including ulcerative colitis and Crohn’s disease, is a chronic and relapsing inflammatory disorder of the intestine. Although its incidence is increasing globally, the precise etiology remains unclear and a cure for IBD has yet to be discovered. The most accepted hypothesis of IBD pathogenesis is that complex interactions between genetics, environmental factors, and the host immune system lead to aberrant immune responses and chronic intestinal inflammation. The human gut harbors a complex and abundant aggregation of microbes, collectively referred to as the gut microbiota. The gut microbiota has physiological functions associated with nutrition, the immune system, and defense of the host. Recent advances in next-generation sequencing technology have identified alteration of the composition and function of the gut microbiota, which is referred to as dysbiosis, in IBD. Clinical and experimental data suggest dysbiosis may play a pivotal role in the pathogenesis of IBD. This review is focused on the physiological function of the gut microbiota and the association between the gut microbiota and pathogenesis in IBD. In addition, we review the therapeutic options for manipulating the altered gut microbiota, such as probiotics and fecal microbiota transplantation.

Expression of IL-22 is induced in several human inflammatory conditions, including inflammatory bowel disease (IBD). Expression of the IL-22 receptor is restricted to innate immune cells; however, the role of IL-22 in colitis has not yet been defined.We developed what we believe to be a novel microinjection-based local gene-delivery system that is capable of targeting the inflamed intestine.Using this approach, we demonstrated a therapeutic potency for IL-22-mediated activation of the innate immune pathway in a mouse model of Th2mediated colitis that induces disease with characteristics similar to that of IBD ulcerative colitis (UC).IL-22 gene delivery enhanced STAT3 activation specifically within colonic epithelial cells and induced both STAT3dependent expression of mucus-associated molecules and restitution of mucus-producing goblet cells.Importantly, IL-22 gene delivery led to rapid amelioration of local intestinal inflammation.The amelioration of disease by IL-22 was mediated by enhanced mucus production.In addition, local gene delivery was used to inhibit IL-22 activity through overexpression of IL-22-binding protein.Treatment with IL-22-binding protein suppressed goblet cell restitution during the recovery phase of a dextran sulfate sodium-induced model of acute colitis.These data demonstrate what we believe to be a novel function for IL-22 in the intestine and suggest the potency of a local IL-22 gene-delivery system for treating UC.

Interleukin-6 (IL-6) regulates immune response and inflammation. We carried out a pilot placebo-controlled study to investigate the efficacy, pharmacokinetics, and safety of MRA, a humanized monoclonal antibody to IL-6 receptor, in patients with active Crohn’s disease. Thirty-six patients with active Crohn’s disease (Crohn’s Disease Activity Index [CDAI] ≥150) were randomly assigned to receive biweekly intravenous infusion of either placebo, MRA, or MRA/placebo alternately for 12 weeks at a dose of 8 mg/kg. The study’s primary end point was a clinical response rate that was defined as a reduction of CDAI ≥70. At the final evaluation, 80% of the patients (8 of 10) given biweekly MRA had a clinical response as compared with 31% of the placebo-treated patients (4 of 13; P = 0.019). Twenty percent of the patients (2 of 10) on this regimen went into remission (CDAI <150), as compared with 0% of the placebo-treated patients (0 of 13). The clinical response rate of the every-4-week regimen was 42% (5 of 12). The serum concentrations of MRA were detected at 2 weeks after every infusion, at which time acute phase responses were completely suppressed; however, they were not suppressed at 4 weeks. Endoscopic and histologic examination showed no difference between MRA and placebo groups. The incidence of adverse events was similar in all the groups. This is the first clinical trial of humanized anti-IL-6 receptor monoclonal antibody in Crohn’s disease. A biweekly 8 mg/kg infusion of MRA was well tolerated, normalized the acute-phase responses, and suggests a clinical effect in active Crohn’s disease.

Curcumin is a biologically active phytochemical substance present in turmeric and has pharmacologic actions that might benefit patients with ulcerative colitis (UC). The aim in this trial was to assess the efficacy of curcumin as maintenance therapy in patients with quiescent ulcerative colitis (UC).Eighty-nine patients with quiescent UC were recruited for this randomized, double-blind, multicenter trial of curcumin in the prevention of relapse. Forty-five patients received curcumin, 1g after breakfast and 1g after the evening meal, plus sulfasalazine (SZ) or mesalamine, and 44 patients received placebo plus SZ or mesalamine for 6 months. Clinical activity index (CAI) and endoscopic index (EI) were determined at entry, every 2 months (CAI), at the conclusion of 6-month trial, and at the end of 6-month follow-up.Seven patients were protocol violators. Of 43 patients who received curcumin, 2 relapsed during 6 months of therapy (4.65%), whereas 8 of 39 patients (20.51%) in the placebo group relapsed (P=.040). Recurrence rates evaluated on the basis of intention to treat showed significant difference between curcumin and placebo (P=.049). Furthermore, curcumin improved both CAI (P=.038) and EI (P=.0001), thus suppressing the morbidity associated with UC. A 6-month follow-up was done during which patients in both groups were on SZ or mesalamine. Eight additional patients in the curcumin group and 6 patients in the placebo group relapsed.Curcumin seems to be a promising and safe medication for maintaining remission in patients with quiescent UC. Further studies on curcumin should strengthen our findings.

Background & Aims: Interleukin (IL)-22, a member of the IL-10 subfamily, is a recently identified T-cell-derived cytokine. We investigated IL-22 expression in the inflamed mucosa of patients with inflammatory bowel disease (IBD) and analyzed its biologic activities in human colonic subepithelial myofibroblasts (SEMFs). Methods: Mucosal IL-22 expression was evaluated by immunohistochemical procedures. The effects of IL-22 on colonic SEMFs were investigated by cDNA microarrays, Northern blots, enzyme-linked immunosorbent assay, and electrophoretic gel mobility shift assays (EMSAs). Results: IL-22 was not detectable in normal colonic mucosa. In IBD mucosa, IL-22 expression was detectable in CD4-positive T cells. IL-22-positive cells were increased in ulcerative colitis and even more so in Crohn’s disease. IL-22 receptor expression colocalized with a marker of SEMFs. IL-22 did not modulate SEMF proliferation and collagen synthesis. cDNA microarray analyses demonstrated that, in colonic SEMFs, IL-22 increased the messenger RNA (mRNA) expression of inflammatory cytokines (IL-6, IL-8, IL-11, and leukemia inhibitory factor [LIF]), chemokines, and matrix metalloproteinases. IL-22 induced an activation of nuclear factor (NF)-κB and activating protein (AP)-1 within 1 hour, and a blockade of NF-κB and AP-1 activation markedly reduced IL-22 induction of IL-6, IL-8, IL-11, and LIF mRNA. MAP-kinase inhibitors (PD98059, U0216, and SB202190) significantly reduced IL-22 induction of cytokine secretion. The combination of either IL-17 plus IL-22 or IL-19 plus IL-22 additively up-regulated cytokine secretion. Conclusions: IL-22 derived from activated T cells acts on SEMFs to elicit expression of proinflammatory cytokines and matrix-degrading molecules indicating proinflammatory/remodeling roles in IBD. Background & Aims: Interleukin (IL)-22, a member of the IL-10 subfamily, is a recently identified T-cell-derived cytokine. We investigated IL-22 expression in the inflamed mucosa of patients with inflammatory bowel disease (IBD) and analyzed its biologic activities in human colonic subepithelial myofibroblasts (SEMFs). Methods: Mucosal IL-22 expression was evaluated by immunohistochemical procedures. The effects of IL-22 on colonic SEMFs were investigated by cDNA microarrays, Northern blots, enzyme-linked immunosorbent assay, and electrophoretic gel mobility shift assays (EMSAs). Results: IL-22 was not detectable in normal colonic mucosa. In IBD mucosa, IL-22 expression was detectable in CD4-positive T cells. IL-22-positive cells were increased in ulcerative colitis and even more so in Crohn’s disease. IL-22 receptor expression colocalized with a marker of SEMFs. IL-22 did not modulate SEMF proliferation and collagen synthesis. cDNA microarray analyses demonstrated that, in colonic SEMFs, IL-22 increased the messenger RNA (mRNA) expression of inflammatory cytokines (IL-6, IL-8, IL-11, and leukemia inhibitory factor [LIF]), chemokines, and matrix metalloproteinases. IL-22 induced an activation of nuclear factor (NF)-κB and activating protein (AP)-1 within 1 hour, and a blockade of NF-κB and AP-1 activation markedly reduced IL-22 induction of IL-6, IL-8, IL-11, and LIF mRNA. MAP-kinase inhibitors (PD98059, U0216, and SB202190) significantly reduced IL-22 induction of cytokine secretion. The combination of either IL-17 plus IL-22 or IL-19 plus IL-22 additively up-regulated cytokine secretion. Conclusions: IL-22 derived from activated T cells acts on SEMFs to elicit expression of proinflammatory cytokines and matrix-degrading molecules indicating proinflammatory/remodeling roles in IBD. Inflammatory bowel disease (IBD), ulcerative colitis (UC), and Crohn’s disease (CD) are characterized by chronic inflammation in which a dysfunction of the host immunologic response against common antigens such as dietary factors and/or bacteria may be involved.1Podolsky D.K. Inflammatory bowel disease.N Engl J Med. 2002; 347: 417-429Crossref PubMed Scopus (3226) Google Scholar, 2Zareie M. Singh P.K. Irvine E.J. Sherman P.M. McKay D.M. Perdue M.H. Monocytes/macrophage activation by normal bacteria and bacterial products implications for altered epithelial function in Crohn’s disease.Am J Pathol. 2001; 158;: 1101-1109Abstract Full Text Full Text PDF PubMed Scopus (87) Google Scholar, 3Boirivant M. Marini M. DiFelice G. Pronio A.M. Montesani C. Tersigni R. Strober W. Lamina propria T cells in Crohn’s disease and other gastrointestinal inflammation show defective CD2 pathway-induced apoptosis.Gastroenterology. 1999; 116: 557-565Abstract Full Text Full Text PDF PubMed Scopus (238) Google Scholar, 4Saubermann L.J. Probert C.S.J. Christ A.D. Chott A. Turner J.R. Stevens A.C. Balk S.P. Blumberg R.S. Evidence of T cell receptor β-chain patterns in inflammatory and noninflammatory bowel disease states.Am J Physiol. 1999; 276: G613-G621PubMed Google Scholar Although the precise etiology of IBD remains unclear, the activation of T cells has been regarded as an important factor in the pathogenesis of IBD.1Podolsky D.K. Inflammatory bowel disease.N Engl J Med. 2002; 347: 417-429Crossref PubMed Scopus (3226) Google Scholar, 4Saubermann L.J. Probert C.S.J. Christ A.D. Chott A. Turner J.R. Stevens A.C. Balk S.P. Blumberg R.S. Evidence of T cell receptor β-chain patterns in inflammatory and noninflammatory bowel disease states.Am J Physiol. 1999; 276: G613-G621PubMed Google Scholar Interleukin (IL)-22 was originally described as an IL-9-induced gene and was termed “IL-10-related T-cell-derived-inducible factor” (IL-TIF).5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 6Pestka S. Krause C.D. Sarkar D. Walter M.R. Shi Y. Fisher P.B. Interleukin-10 and related cytokines and receptors.Annu Rev Immunol. 2004; 22: 929-979Crossref PubMed Scopus (966) Google Scholar, 7Conti P. Kempuraj D. Frydas S. Kandere K. Boucher W. Letourneau R. Madhappan B. Sagimoto K. Christodoulou S. Theoharides T.C. IL-10 subfamily members IL-19, IL-20, IL-22, IL-24 and IL-26.Immunol Lett. 2003; 88: 171-174Crossref PubMed Scopus (81) Google Scholar IL-22 has 22% amino acid identity with IL-10 and belongs to a family of cytokines with limited homology to IL-10, namely IL-19, IL-20, IL-22, IL-24, and IL-26.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 6Pestka S. Krause C.D. Sarkar D. Walter M.R. Shi Y. Fisher P.B. Interleukin-10 and related cytokines and receptors.Annu Rev Immunol. 2004; 22: 929-979Crossref PubMed Scopus (966) Google Scholar, 7Conti P. Kempuraj D. Frydas S. Kandere K. Boucher W. Letourneau R. Madhappan B. Sagimoto K. Christodoulou S. Theoharides T.C. IL-10 subfamily members IL-19, IL-20, IL-22, IL-24 and IL-26.Immunol Lett. 2003; 88: 171-174Crossref PubMed Scopus (81) Google Scholar Major sources of IL-22 are activated T cells, and IL-22 expression in other leukocyte populations such as monocytes, dendritic cells, natural killer (NK) cells, and neutrophils is negligible.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 8Wolk K. Kunz S. Asadullah K. Sabat R. Immune cells as sources and targets of the IL-10 family members?.J Immunol. 2002; 168: 5397-5402PubMed Google Scholar, 9Gurney A.L. IL-22, a Th1 cytokine that targets the pancreas and select other peripheral tissues.Int Immunopharmacol. 2004; 4: 669-677Crossref PubMed Scopus (103) Google Scholar The polarization of T cells toward a Th1 phenotype further increases activation-induced IL-22 expression, whereas polarization toward a Th2 or regulatory phenotype reduces it.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 8Wolk K. Kunz S. Asadullah K. Sabat R. Immune cells as sources and targets of the IL-10 family members?.J Immunol. 2002; 168: 5397-5402PubMed Google Scholar, 9Gurney A.L. IL-22, a Th1 cytokine that targets the pancreas and select other peripheral tissues.Int Immunopharmacol. 2004; 4: 669-677Crossref PubMed Scopus (103) Google Scholar Furthermore, IL-22 expression is confined to activated memory rather than activated naïve T cells.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 6Pestka S. Krause C.D. Sarkar D. Walter M.R. Shi Y. Fisher P.B. Interleukin-10 and related cytokines and receptors.Annu Rev Immunol. 2004; 22: 929-979Crossref PubMed Scopus (966) Google Scholar, 9Gurney A.L. IL-22, a Th1 cytokine that targets the pancreas and select other peripheral tissues.Int Immunopharmacol. 2004; 4: 669-677Crossref PubMed Scopus (103) Google Scholar Thus, IL-22 is a clear addition to the complement of cytokines produced by a Th1 response. IL-22 binds at the cell surface to a receptor complex composed of 2 chains belonging to the class II cytokine receptor family (CRF2): IL-22 receptor (R)1 and IL-10R2.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 6Pestka S. Krause C.D. Sarkar D. Walter M.R. Shi Y. Fisher P.B. Interleukin-10 and related cytokines and receptors.Annu Rev Immunol. 2004; 22: 929-979Crossref PubMed Scopus (966) Google Scholar, 7Conti P. Kempuraj D. Frydas S. Kandere K. Boucher W. Letourneau R. Madhappan B. Sagimoto K. Christodoulou S. Theoharides T.C. IL-10 subfamily members IL-19, IL-20, IL-22, IL-24 and IL-26.Immunol Lett. 2003; 88: 171-174Crossref PubMed Scopus (81) Google Scholar, 10Kotenko S.V. Izotova L.S. Mirochnitchenko O.V. Esterova E. Dickensheets H. Donnelly R.P. Pestka S. Identification of the functional interleukin-22 (IL-22) receptor complex the IL-10R2 chain (IL-10Rbeta) is a common chain of both the IL-10 and IL-22 (IL-10-related T-cell-derived inducible factor, IL-TIF) receptor complexes.J Biol Chem. 2001; 276: 2725-2732Crossref PubMed Scopus (364) Google Scholar The unique observation is that human immune cells such as T cells, B cells, monocytes, and NK cells lack IL-22R1 expression even under stimulated conditions,5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 6Pestka S. Krause C.D. Sarkar D. Walter M.R. Shi Y. Fisher P.B. Interleukin-10 and related cytokines and receptors.Annu Rev Immunol. 2004; 22: 929-979Crossref PubMed Scopus (966) Google Scholar although IL-10R2 is ubiquitously expressed in various cell types.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar Lack of IL-22R1 is supported by findings that IL-22 failed to stimulate immune cell functions such as cytokine secretion and surface marker expression.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar In contrast to immune cells, IL-22R1 is expressed in a limited number of tissues such as skin, liver, lung, kidney, and pancreas, whereas it is not detected in the bone marrow, thymus, and spleen.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 6Pestka S. Krause C.D. Sarkar D. Walter M.R. Shi Y. Fisher P.B. Interleukin-10 and related cytokines and receptors.Annu Rev Immunol. 2004; 22: 929-979Crossref PubMed Scopus (966) Google Scholar, 7Conti P. Kempuraj D. Frydas S. Kandere K. Boucher W. Letourneau R. Madhappan B. Sagimoto K. Christodoulou S. Theoharides T.C. IL-10 subfamily members IL-19, IL-20, IL-22, IL-24 and IL-26.Immunol Lett. 2003; 88: 171-174Crossref PubMed Scopus (81) Google Scholar, 9Gurney A.L. IL-22, a Th1 cytokine that targets the pancreas and select other peripheral tissues.Int Immunopharmacol. 2004; 4: 669-677Crossref PubMed Scopus (103) Google Scholar The high impact for gastroenterologists is that IL-22R1 is strongly expressed in the small intestine and colon,5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar, 9Gurney A.L. IL-22, a Th1 cytokine that targets the pancreas and select other peripheral tissues.Int Immunopharmacol. 2004; 4: 669-677Crossref PubMed Scopus (103) Google Scholar suggesting that IL-22 plays a role in the pathogenesis of IBD. To date, little is known about the signaling pathways downstream of IL-22 stimulation and its biologic activities. In the pancreas, IL-22 induces a rapid increase in mRNA for pancreatitis-associated protein-1.11Aggarwal S. Xie M.H. Maruoka M. Foster J. Gurney A.L. Acinar cells of the pancreas are a target of interleukin-22.J Interferon Cytokine Res. 2001; 21: 1047-1053Crossref PubMed Scopus (152) Google Scholar IL-22 has been reported to activate Janus kinase (JAK)1, Tyk2, and signal transducers and activators of transcription (STATs) as well as the major mitogen-activated protein (MAP)-kinases in rat hepatoma cell lines.12Lejeune D. Dumoutier L. Constantinescu S. Kruijer W. Schuringa J.J. Renauld J.C. Interleukin-22 (IL-22) activates the JAK/STAT, ERK, JNK, and p38 MAP kinase pathways in a rat hepatoma cell line. Pathways that are shared with and distinct from IL-10.J Biol Chem. 2002; 277: 33676-33682Crossref PubMed Scopus (403) Google Scholar IL-22 stimulates secretion of several acute phase proteins (serum amyloid A, α-antichymotrypsin, and haptoglobin) in HepG2 human hepatoma cells.13Dumoutier L. Van Roost E. Colau D. Renauld J.C. Human interleukin-10-related T-cell-derived inducible factor molecular cloning and functional characterization as an hepatocyte-stimulating factor.Proc Natl Acad Sci U S A. 2000; 97: 10144-10149Crossref PubMed Scopus (328) Google Scholar In Colo205 colon cancer cells, IL-22 stimulates IL-10 secretion.14Nagalakshmi M.L. Rascle A. Zurawski S. Menon S. de Waal Malefyt R. Interleukin-22 activates STAT3 and induces IL-10 by colon epithelial cells.Int Immunopharmacol. 2004; 4: 679-691Crossref PubMed Scopus (174) Google Scholar Furthermore, as a sole report in nontransformed cells, IL-22 activates STAT3 and up-regulates β-defensin expression in human keratinocytes.5Wolk K. Kunz S. Witte E. Friedrich M. Asadullah K. Sabat R. IL-22 increases the innate immunity of tissues.Immunity. 2004; 21: 241-254Abstract Full Text Full Text PDF PubMed Scopus (1173) Google Scholar However, it remains unclear whether IL-22 activates transcription factors, nuclear factor (NF)-κB and activating protein (AP)-1, which play a major role in the induction of proinflammatory cytokine and chemokine secretion. In this report, we investigated IL-22 expression in the inflamed mucosa of IBD patients. Furthermore, to characterize the biologic activities of IL-22 in colonic mucosa, we addressed the changes in mRNA expression in response to IL-22 in nontransformed human colonic subepithelial myofibroblasts (SEMFs) by cDNA microarrays. Based on our findings, we found that IL-22 up-regulates the expression of inflammatory genes such as IL-6, IL-8, IL-11, and leukemia inhibitory factor (LIF) in colonic SEMFs via NF-κB, AP-1, and MAP-kinase-dependent pathways. Recombinant human IL-19, IL-20, and IL-22 were obtained from PeproTech (Rocky Hill, NJ), and IL-24 was purchased from R&D Systems (Minneapolis, MN). All other reagents were purchased from Sigma Chemical Co. (St Louis, MO). Inhibitors of p42/44 MAP kinases (PD98059 and U0216), an inhibitor for p38 MAPK (SB203580), and a JAK2 inhibitor (AG490) were purchased from Cell Signaling Technology (Beverly, MA). The following primary antibodies were used in this study: goat anti-human IL-22 antibodies (Santa Cruz Biotechnology, Santa Cruz, CA), monoclonal mouse anti-human CD3, CD4, or CD8 antibodies (Novocastra, Dossenheim, Germany), FITC-labeled anti-α-smooth muscle actin (SMA) antibodies (Sigma Chemical Co., St Lous, MO), monoclonal mouse anti-human type I and IV collagen α1 subunits antibodies (Sigma), rabbit anti-human IL-22R1 antibodies and blocking peptide (Abcam, Cambridge, United Kingdom), anti-MAP kinase and STAT3 antibodies (Cell Signaling Technology), rabbit anti-human JAK1 (Bio-Source, Camarillo, CA), and goat anti-human MMP-3, IκBα, or c-Jun antibodies (Santa Cruz). Diagnosis for UC and CD was based on conventional clinical, endoscopic, and histopathologic criteria. Surgically obtained or biopsied specimens from 18 patients with UC (10 male and 8 female, mean 32 years) and 20 patients with CD (12 male and 8 female, mean 28 years) were used with informed consent. The ethics committee of Shiga University of Medical Science approved this project. During sample collection, all patients were clinically and endoscopically active with colitis activity index for UC15Rachmilewitz D. Coated mesalazine (5-aminosalicylic acid) versus sulphasalazine in the treatment of active ulcerative colitis a randomised trial.BMJ. 1989; 298: 82-86Crossref PubMed Scopus (992) Google Scholar and Crohn’s disease activity index.16Best W.R. Becktel J.M. Singleton J.W. Rederived values of the eight coefficients of the Crohn’s disease activity index (CDAI).Gastroenterology. 1979; 77: 843-846PubMed Scopus (519) Google Scholar Five UC and 4 CD patients received surgical operations because of resistance to medication or other complications (eg, massive bleeding, fistula formation, or perforation). Histologic examinations were performed in macroscopically and microscopically nonaffected (n = 15 in UC and n = 18 in CD) or affected (n = 18 in UC and n = 20 in CD) areas from each patient. All patients were treated with salicylates, and 12 of 18 UC and 10 of 20 CD patients received treatment with corticosteroids. Two UC patients were treated with azathioprine. Biopsy samples derived from infectious colitis (n = 8) were obtained by colonoscopy. Normal colorectal tissues were obtained by the surgical resection of colon cancer at distal tumor sites (n = 12). Immunohistochemical analyses were performed according to a method described in our previous report.17Fujino S. Andoh A. Bamba S. Ogawa A. Hata K. Araki Y. Bamba T. Fujiyama Y. Increased expression of interleukin 17 in inflammatory bowel disease.Gut. 2003; 52: 65-70Crossref PubMed Scopus (706) Google Scholar Briefly, goat polyclonal anti-human IL-22 antibodies (Santa Cruz Biotechnology) were used as the primary antibody. After incubation with the primary antibodies, the sections were treated with biotin-conjugated goat anti-rabbit IgG (Vector, Burlingame, CA) and avidin-biotin-peroxidase complexes (ABC; Vector). According to the method described by Middle et al,18Middel P. Reich K. Polzien F. Blaschke V. Hemmerlein B. Herms J. Korabiowska M. Radzum H.-J. Interleukin 16 expression and phenotype of interleukin 16 producing cells in Crohn’s disease.Gut. 2001; 49: 795-803Crossref PubMed Scopus (54) Google Scholar an evaluation of immunoreactivity was performed on sections for IL-22 by 2 blinded evaluators. Corresponding areas of sections were marked and high-power fields were counted at 400× magnification. The mean count from a total of 5 high-power fields per slide was used. For double-staining procedures with anti-IL-22 plus anti-CD3, CD4, or CD8 antibodies, anti-IL-22 antibodies (diluted 1:100) were applied and incubated overnight at 4°C in a humidified chamber. Subsequently, monoclonal mouse anti-human CD3, CD4, or CD8 antibodies (diluted 1:100 in PBS containing 5% skim milk; Novocastra) were applied and incubated overnight at 4°C. Rhodamine red-labeled anti-goat IgG (diluted 1:500 in PBS containing 1% skim milk and 0.1% Triton X-100; Rockland, Gilbertsville, PA) and fluorescein isothiocyanate (FITC)-labeled horse anti-mouse IgG (diluted 1:500; Vector) were applied for 60 minutes at room temperature. Images were obtained with a digital confocal laser scanning system MRC-600 (Bio-Rad, Hercules, CA). Double staining for α-smooth muscle actin (α-SMA) and IL-22R1 was performed with FITC-labeled anti-α-SMA antibodies (Sigma Chemical Co.) and rabbit anti-human IL-22R1 antibodies (Abcam, Cambridge, United Kingdom). Rhodamine red-labeled anti-rabbit IgGs were used as second antibodies. Primary SEMF cultures were prepared according to a method reported by Mahida et al.19Mahida Y.R. Beltinger J. Marh S. Goke M. Gray T. Podolsky D.K. Hawkey C.J. Adult human colonic subepithelial myofibroblasts express extracellular matrix proteins and cyclooxygenase-1 and -2.Am J Physiol. 1997; 273: G1341-G1348PubMed Google Scholar Samples from the human normal colonic mucosa were obtained from surgical specimens (>8 cm from the tumor margin) from patients undergoing a partial colectomy for carcinomas, with their informed consent. The cellular characteristics of these samples have been described in our previous reports.20Okuno T. Andoh A. Bamba S. Araki Y. Fujiyama Y. Fujiyama M. Bamba T. Interleukin-1β and tumor necrosis factor-α induce chemokine and matrix metalloproteinase gene expression in human colonic subepithelial myofibroblasts.Scand J Gastroenterol. 2002; 37: 317-324Crossref PubMed Scopus (91) Google Scholar, 21Bamba S. Andoh A. Yasui H. Makino J. Kim S. Fujiyama Y. Regulation of IL-11 expression in intestinal myofibroblasts role of c-Jun AP-1- and MAPK-dependent pathways.Am J Physiol Gastrointest Liver Physiol. 2003; 285: G529-G538Crossref PubMed Scopus (37) Google Scholar Cells were cultured in DMEM containing 10% FBS. Culture media were supplemented with 50 U/mL penicillin and 50 μg/mL streptomycin. Studies were performed on passage 3–6 myofibroblasts isolated from 5 surgically resected samples. Antigenic IL-6, IL-8, and LIF in samples were quantitated by sandwich enzyme-linked immunosorbent assay (ELISA) kits purchased from Bio-Source (Camarillo, CA). The IL-11 ELISA kit was purchased from R&D systems. The MMP-1 ELISA was purchased from Amersham (Arlington Heights, IL). IL-10R2 and IL-22R1 mRNA expression was assessed by reverse-transcription polymerase chain reaction (RT-PCR) analyses according to a method described in our previous report.22Andoh A. Fujiyama Y. Sumiyoshi K. Sakumoto H. Bamba T. Interleukin 4 acts as an inducer of decay-accelerating factor gene expression in human intestinal epithelial cells.Gastroenterology. 1996; 111: 911-918Abstract Full Text PDF PubMed Scopus (57) Google Scholar PCR products were ligated into TA cloning vectors (Promega, Madison, WI) and sequenced. Primers specific for human IL-10R2 were as follows: 5′ AAGTCTTTCCAAGTATGGTGACCAC (nucleotides 316–340, Gene bank accession No. BC001903)23Strausberg R.L. Feingold E.A. Grouse L.H. et al.Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences.Proc Natl Acad Sci U S A. 2002; 99: 16899-16903Crossref PubMed Scopus (1577) Google Scholar and 3′ GTGCTGTGGAAGAG-AATTCCTAGG (880–857). Primers for IL-22R1 were as follows: 5′ CTGTC-CGAGATCACCTACTTAGG (984–1,006, Gene bank accession No. AF286095)24Xie M.H. Aggarwal S. Ho W.H. Foster J. Zhang Z. Stinson J. Wood W.I. Goddard A.D. Gurney A.L. Interleukin (IL)-22, a novel human cytokine that signals through the interferon receptor-related proteins CRF2-4 and IL-22R.J Biol Chem. 2000; 275: 31335-31339Crossref PubMed Scopus (468) Google Scholar and 3′ GCACATTTGGGTCAGATGTTCTGTC (1,464–1,440). Human LIF probes were also prepared from a monolayer of human umbilical vein endothelial cells by RT-PCR. Primers and LIF sequences were as follows: 5′ CTGTA- CCGCATAGTCGTGTACCT (357–379, Gene bank accession No. X13967)25Moreau J.F. Donaldson D.D. Bennett F. Witek-Giannotti J. Clark S.C. Wong G.G. Leukaemia inhibitory factor is identical to the myeloid growth factor human interleukin for DA cells.Nature. 1988; 336: 690-692Crossref PubMed Scopus (264) Google Scholar and 3′ TTTCCACTCTGCTCAGCTTCATCA (844–821). Total cellular RNA was isolated by the acid guanidinium thiocyanate-phenol-chloroform method.26Chomczynski P. Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction.Anal Biochem. 1987; 162: 156-159Crossref PubMed Scopus (65695) Google Scholar Northern blots were performed according to a method previously described.22Andoh A. Fujiyama Y. Sumiyoshi K. Sakumoto H. Bamba T. Interleukin 4 acts as an inducer of decay-accelerating factor gene expression in human intestinal epithelial cells.Gastroenterology. 1996; 111: 911-918Abstract Full Text PDF PubMed Scopus (57) Google Scholar Hybridizations were performed with 32P-labeled human probes, generated by a random primed DNA-labeling kit (Amersham) and evaluated by autoradiography. Human IL-6, IL-8, and IL-11 cDNA probes were described in our previous reports.21Bamba S. Andoh A. Yasui H. Makino J. Kim S. Fujiyama Y. Regulation of IL-11 expression in intestinal myofibroblasts role of c-Jun AP-1- and MAPK-dependent pathways.Am J Physiol Gastrointest Liver Physiol. 2003; 285: G529-G538Crossref PubMed Scopus (37) Google Scholar, 27Shimada M. Andoh A. Hata K. Tasaki K. Araki Y. Fujiyama Y. Bamba T. IL-6 secretion by human pancreatic periacinar myofibroblasts in response to inflammatory mediators.J Immunol. 2002; 168: 861-868PubMed Google Scholar, 28Andoh A. Takaya H. Saotome T. Shimada M. Hata K. Araki Y. Nakamura F. Shintani Y. Fujiyama Y. Bamba T. Cytokine regulation of chemokine (IL-8, MCP-1, and RANTES) gene expression in human pancreatic periacinar myofibroblasts.Gastroenterology. 2000; 119: 211-219Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar Nuclear extracts were prepared from cells exposed to cytokines for 1 hour by the method of Dignam et al.29Dignam J.D. Lebovitz R.M. Roeder R.G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (10033) Google Scholar Consensus oligonucleotides for NF-κB (5′ AGTTGAGGGGACTTTCCCAGCC) and AP-1 (5′ CGCTTGATGAGTCAGCCGGAA) were purchased from Promega. The consensus binding sequence is underlined within each sequence. Oligonucleotides were 5′ end labeled with T4 polynucleotide kinase (Promega) and [γ-32P]ATP (Amersham). Binding reactions were performed according to previously described methods.27Shimada M. Andoh A. Hata K. Tasaki K. Araki Y. Fujiyama Y. Bamba T. IL-6 secretion by human pancreatic periacinar myofibroblasts in response to inflammatory mediators.J Immunol. 2002; 168: 861-868PubMed Google Scholar, 28Andoh A. Takaya H. Saotome T. Shimada M. Hata K. Araki Y. Nakamura F. Shintani Y. Fujiyama Y. Bamba T. Cytokine regulation of chemokine (IL-8, MCP-1, and RANTES) gene expression in human pancreatic periacinar myofibroblasts.Gastroenterology. 2000; 119: 211-219Abstract Full Text Full Text PDF PubMed Scopus (153) Google Scholar The human IL-8 promoter region, which contains NF-κB and AP-1-binding motifs, was amplified by PCR using human genomic DNA as a template with the following primers29Dignam J.D. Lebovitz R.M. Roeder R.G. Accurate transcription initiation by RNA polymerase II in a soluble extract from isolated mammalian nuclei.Nucleic Acids Res. 1983; 11: 1475-1489Crossref PubMed Scopus (10033) Google Scholar (Gene bank accession No. M28130) IL-8 (−143), AACAGATCTGA-AGTGTGATGACTCAGG; IL-8 (+55), CTTAAGCTTGAAGCTTGTGTGCTCTGC. The 5′ sequence of IL-8 (−143) was modified for a BglII restriction site (underlined), and the 5′ region of IL-8 (+66) was modified for a HindIII restriction site (underlined), respectively. These were ligated into BglII-HindIII sites of the luciferase reporter plasmids pGL3-Basic (Promega) to yield reporter constructs. Cloned inserts were sequences with an autosequencer. A reporter construct for the human IL-6 promoter was described in our previous report.31Andoh A. Shimada M. Bamba S. Okuno T. Araki Y. Fujiyama Y. Bamba T. Extracellular signal-regulated kinases 1 and 2 participate in interleukin-17 plus tumor necrosis factor-α-induced stabilization of interleukin-6 mRNA in human pancreatic myofibroblasts.Biochim Biophys Acta. 2002; 1591: 69-74Crossref PubMed Scopus (37) Google Scholar Transient transfections were performed using Lipofectamine Plus reagent (GIBCO BRL) according to the manufacture’s protocol. Twenty hours prior to transfection, 1 × 105 cells were plated in triplicate in 35-mm wells of a 6-well plate. For each well, 1 μg plasmid DNA and 0.2 μg β-galactosidase reporter vector pCMVβ (Clontech, Palo Alto, CA) were cotransfected and incubated for 24 hours. Next, the medium was changed, and cells were incubated in the presence of stimuli further for an additional 6 hours. Luciferase activity was measured by the Luciferase Assay System Kit (Promega) and expressed as relative activity normalized for β-galactosidase activity. The total cellular RNA (4 μg) extracted from human colonic SEMFs was converted to double-strand cDNA with a double-strand cDNA synthesis kit (Invitrogen) and oligo(dT) primers containing a T7 RNA polymerase promoter (Takara-Bio, Kyoto, Japan). Cy3- and Cy5-labeled cRNA were generated from cDNA samples by in vitro transcription with T7 RNA polymerase (Takara-Bio). Samples obtained

We evaluated the effects of rat anti-mouse IL-17 neutralizing monoclonal antibody (mAb) on the development of dextran sulfate sodium (DSS)-induced colitis. Tissue samples were evaluated by standard immunohistochemical procedure. The mucosal mRNA expression of cytokines was analyzed by reverse transcriptase-polymerase chain reaction (RT-PCR). In the mice treated with the anti-IL-17 mAb, the body weight was significantly lower, and anal prolapse and colon shortening were apparent. A histological analysis indicated that the anti-IL-17 mAb markedly enhanced the severity of colitis. The mucosal infiltration of CD4-positive helper T cells and CD11b-positive granulocytes-monocytes was increased in the anti-IL-17 mAb-treated mice. Treatment with the anti-IL-17 mAb increased the mucosal expression of mRNAs of tumor necrosis factor (TNF)-alpha, interferon (IFN)-gamma, IL-6, RANTES, and IP-10. Blocking of IL-17 activity in vivo using the anti-IL-17 mAb enhanced the development of DSS-colitis in mice. This suggests an inhibitory role for IL-17 in the development of DSS-colitis.

The global alteration of the gut microbial community (dysbiosis) plays an important role in the pathogenesis of inflammatory bowel diseases (IBDs). However, bacterial species that characterize dysbiosis in IBD remain unclear. In this study, we assessed the alteration of the fecal microbiota profile in patients with Crohn's disease (CD) using 16S rRNA sequencing.Fecal samples from 10 inactive CD patients and 10 healthy individuals were subjected to 16S rRNA sequencing. The V3-V4 hypervariable regions of 16S rRNA were sequenced by the Illumina MiSeq™II system. The average of 62,201 reads per CD sample was significantly lower than the average of 73,716 reads per control sample. The genera Bacteroides, Eubacterium, Faecalibacterium and Ruminococcus significantly decreased in CD patients as compared to healthy controls. In contrast, the genera Actinomyces and Bifidobacterium significantly increased in CD patients. At the species level, butyrate-producing bacterial species, such as Blautia faecis, Roseburia inulinivorans, Ruminococcus torques, Clostridium lavalense, Bacteroides uniformis and Faecalibacterium prausnitzii were significantly reduced in CD patients as compared to healthy individuals (p < 0.05). These results of 16S rRNA sequencing were confirmed in additional CD patients (n = 68) and in healthy controls (n = 46) using quantitative PCR. The abundance of Roseburia inulinivorans and Ruminococcus torques was significantly lower in C-reactive protein (CRP)-positive CD patients as compared to CRP-negative CD patients (p < 0.05).The dysbiosis of CD patients is characterized by reduced abundance of multiple butyrate-producing bacteria species.

The mucosa-associated gut microbiota directly modulates epithelial and mucosal function. In this study, we investigated the mucosa-associated microbial community in patients with inflammatory bowel disease (IBD), using endoscopic brush samples. A total of 174 mucus samples from 43 patients with ulcerative colitis (UC), 26 with Crohn’s disease (CD) and 14 non-IBD controls were obtained by gentle brushing of mucosal surfaces using endoscopic cytology brushes. The gut microbiome was analyzed using 16S rRNA gene sequencing. There were no significant differences in microbial structure among different anatomical sites (the ileum, cecum and sigmoid colon) within individuals. There was, however, a significant difference in microbial structure between CD, UC and non-IBD controls. The difference between CD and non-IBD controls was more marked than that between UC patients and non-IBD controls. α-Diversity was significantly lower in UC and CD patients than non-IBD controls. When comparing CD patients with non-IBD controls, the phylum Proteobacteria was significantly increased and the phyla Firmicutes and Bacteroidetes were significantly reduced. These included a significant increase in the genera Escherichia, Ruminococcus (R. gnavus), Cetobacterium, Actinobacillus and Enterococcus, and a significant decrease in the genera Faecalibacterium, Coprococcus, Prevotella and Roseburia. Comparisons between CD and UC patients revealed a greater abundance of the genera Escherichia, Ruminococcus (R. gnavus), Clostridium, Cetobacterium, Peptostreptococcus in CD patients, and the genera Faecalibacterium, Blautia, Bifidobacterium, Roseburia and Citrobacter in UC patients. Mucosa-associated dysbiosis was identified in IBD patients. CD and UC may be distinguishable from the mucosa-associated microbial community structure.

See also: Commentaire de travail de T. Tsujikawa et al., pp. 11Endoscopy 2008; 40(01): 89-89DOI: 10.1055/s-0032-1306800

Dysbiosis is thought to be relevant to the etiology and pathogenesis of Crohn's disease (CD). In this study, we investigated the abundance of Faecalibacterium prausnitzii, as well as Bilophila wadsworthia, in the gut microbiota of Japanese CD patients.Forty-seven CD patients and 20 healthy controls were enrolled. Abundance of F. prausnitzii in fecal samples was quantified by real-time polymerase chain reaction. The gut microbiota profile was evaluated by terminal restriction fragment length polymorphisms.The abundance of F. prausnitzii significantly decreased in CD patients compared with healthy subjects. B. wadsworthia was scarcely detected in the same samples. Among CD patients, the Crohn's Disease Activity Index, C-reactive protein levels, and erythrocyte sedimentation rate were significantly lower, and serum albumin levels were significantly higher in the high F. prausnitzii group compared with the low group. Terminal restriction fragment length polymorphisms analysis showed that fecal bacterial communities of CD patients differed from those of healthy individuals. The changes in simulated bacterial composition indicated that class Clostridia, including genus Faecalibacterium, was significantly less abundant in CD patients as compared with healthy individuals. The bacterial diversity measured by the Shannon Diversity Index was significantly reduced in CD patients compared with healthy individuals.The decreased abundance of class Clostridia, including F. prausnitzii, may translate into a reduction of commensal bacteria-mediated, anti-inflammatory activities in the mucosa, which are relevant to the pathophysiology of CD. In contrast, the role of B. wadsworthia was suspected to be minimal.

Altered gut microbial ecology contributes to the development of metabolic diseases including obesity. In this study, we performed 16S rRNA sequence analysis of the gut microbiota profiles of obese and lean Japanese populations. The V3–V4 hypervariable regions of 16S rRNA of fecal samples from 10 obese and 10 lean volunteers were sequenced using the Illumina MiSeqTMII system. The average body mass index of the obese and lean group were 38.1 and 16.6 kg/m2, respectively (p<0.01). The Shannon diversity index was significantly higher in the lean group than in the obese group (p<0.01). The phyla Firmicutes and Fusobacteria were significantly more abundant in obese people than in lean people. The abundance of the phylum Bacteroidetes and the Bacteroidetes/Firmicutes ratio were not different between the obese and lean groups. The genera Alistipes, Anaerococcus, Corpococcus, Fusobacterium and Parvimonas increased significantly in obese people, and the genera Bacteroides, Desulfovibrio, Faecalibacterium, Lachnoanaerobaculum and Olsenella increased significantly in lean people. Bacteria species possessing anti-inflammatory properties, such as Faecalibacterium prausnitzii, increased significantly in lean people, but bacteria species possessing pro-inflammatory properties increased in obese people. Obesity-associated gut microbiota in the Japanese population was different from that in Western people.

Corticosteroid has been established as the standard therapy for autoimmune pancreatitis (AIP), but the requirement for maintenance corticosteroid therapy is controversial. We conducted a randomised controlled trial to clarify the efficacy of maintenance corticosteroid therapy in patients with AIP.We conducted a multicentre, tertiary setting, randomised controlled trial. After the induction of remission with the initial oral prednisolone (PSL) treatment, maintenance therapy with PSL at 5-7.5 mg/day was continued for 3 years or withdrawn at 26 weeks. The primary endpoint was relapse-free survival over 3 years and the secondary endpoint was serious corticosteroid-related complications. All analyses were performed on an intention-to-treat basis.Between April 2009 and March 2012, 49 patients with AIP were randomly assigned to the maintenance therapy group (n=30) or the cessation group (n=19). Baseline characteristics were not different between the two groups. Relapses occurred within 3 years in 11 out of 19 (57.9%) patients assigned to the cessation group, and in 7 of 30 (23.3%) patients in the maintenance therapy group. The relapse rate over 3 years was significantly lower in the maintenance therapy group than that in the cessation group (p=0.011). The relapse-free survival was significantly longer in the maintenance therapy group than that in the cessation group (p=0.007). No serious corticosteroid-related complications requiring discontinuation of PSL were observed.Maintenance corticosteroid therapy for 3 years may decrease relapses in patients with AIP compared with those who discontinued the therapy at 26 weeks.UMIN000001818; Results.

Background and Aims Curcumin is a hydrophobic polyphenol derived from turmeric, a traditional Indian spice. Curcumin exhibits various biological functions, but its clinical application is limited due to its poor absorbability after oral administration. A newly developed nanoparticle curcumin shows improved absorbability in vivo. In this study, we examined the effects of nanoparticle curcumin (named Theracurmin) on experimental colitis in mice. Methods BALB/c mice were fed with 3% dextran sulfate sodium (DSS) in water. Mucosal cytokine expression and lymphocyte subpopulation were analyzed by real-time PCR and flow cytometry, respectively. The profile of the gut microbiota was analyzed by real-time PCR. Results Treatment with nanoparticle curcumin significantly attenuated body weight loss, disease activity index, histological colitis score and significantly improved mucosal permeability. Immunoblot analysis showed that NF-κB activation in colonic epithelial cells was significantly suppressed by treatment with nanoparticle curcumin. Mucosal mRNA expression of inflammatory mediators was significantly suppressed by treatment with nanoparticle curcumin. Treatment with nanoparticle curcumin increased the abundance of butyrate-producing bacteria and fecal butyrate level. This was accompanied by increased expansion of CD4+ Foxp3+ regulatory T cells and CD103+ CD8α− regulatory dendritic cells in the colonic mucosa. Conclusions Treatment with nanoparticle curcumin suppressed the development of DSS-induced colitis potentially via modulation of gut microbial structure. These responses were associated with induction of mucosal immune cells with regulatory properties. Nanoparticle curcumin is one of the promising candidates as a therapeutic option for the treatment of IBD.

Background & AimsIndigo naturalis (IN) is a traditional Chinese medicine that contains ligands for the aryl hydrocarbon receptor and promotes regeneration of the mucosa by inducing production of interleukin 22. IN might induce mucosal healing in patients with ulcerative colitis (UC). We performed a randomized controlled trial to investigate the safety and efficacy of IN in patients with UC.MethodsWe performed a multicenter, double-blind trial evaluating the safety of 86 patients in Japan with active UC (Mayo scores of 6 or more), enrolled from March 30 through December 27, 2016. Patients were randomly assigned to groups and given a daily dose of 0.5, 1.0, or 2.0 g IN or placebo (1:1:1:1 ratio) for 8 weeks. The primary endpoint was the rate of clinical response at week 8, defined as a 3-point decrease in the Mayo score and a decrease of at least 30% from baseline, with a decrease of at least 1 point for the rectal bleeding subscore or absolute rectal bleeding score of 0–1. The main secondary endpoint was the rate of clinical remission at week 8, defined as a Mayo score or ≤2 and no subscores with a value >1. Mucosal healing was also assessed at week 8.ResultsThe trial was terminated because of an external reason: a report of pulmonary arterial hypertension in a patient who used self-purchased IN for 6 months. In the intent-to-treat analysis, we observed a significant, dose-dependent linear trend in proportions of patients with clinical responses (13.6% with a clinical response to placebo; 69.6% to 0.5 g IN; 75.0% to 1.0 g IN; and 81.0% to 2.0 g IN) (Cochran-Armitage trend test P < .0001 compared with placebo). Proportions of patients in clinical remission at week 8 were significantly higher in the 1.0 g IN group (55.0%, P = .0004) and the 2.0 g IN group (38.1%, (P = .0093) than in the placebo group (4.5%). Proportions of patients with mucosal healing were 13.6% in the placebo group, 56.5% in the 0.5 g IN group, 60.0% in the 1.0 g IN group, and 47.6% in the 2.0 g IN group (P = .0278 compared with placebo). Although mild liver dysfunction was observed in 10 patients who received IN, no serious adverse events were observed.ConclusionsIn a randomized, placebo-controlled trial, we found 8 weeks of IN (0.5–2.0 g per day) to be effective in inducing a clinical response in patients with UC. However, IN should not yet be used because of the potential for adverse effects, including pulmonary arterial hypertension.Clinical Trials Registry no: UMIN000021439 (http://www.umin.ac.jp/ctr/). Indigo naturalis (IN) is a traditional Chinese medicine that contains ligands for the aryl hydrocarbon receptor and promotes regeneration of the mucosa by inducing production of interleukin 22. IN might induce mucosal healing in patients with ulcerative colitis (UC). We performed a randomized controlled trial to investigate the safety and efficacy of IN in patients with UC. We performed a multicenter, double-blind trial evaluating the safety of 86 patients in Japan with active UC (Mayo scores of 6 or more), enrolled from March 30 through December 27, 2016. Patients were randomly assigned to groups and given a daily dose of 0.5, 1.0, or 2.0 g IN or placebo (1:1:1:1 ratio) for 8 weeks. The primary endpoint was the rate of clinical response at week 8, defined as a 3-point decrease in the Mayo score and a decrease of at least 30% from baseline, with a decrease of at least 1 point for the rectal bleeding subscore or absolute rectal bleeding score of 0–1. The main secondary endpoint was the rate of clinical remission at week 8, defined as a Mayo score or ≤2 and no subscores with a value >1. Mucosal healing was also assessed at week 8. The trial was terminated because of an external reason: a report of pulmonary arterial hypertension in a patient who used self-purchased IN for 6 months. In the intent-to-treat analysis, we observed a significant, dose-dependent linear trend in proportions of patients with clinical responses (13.6% with a clinical response to placebo; 69.6% to 0.5 g IN; 75.0% to 1.0 g IN; and 81.0% to 2.0 g IN) (Cochran-Armitage trend test P < .0001 compared with placebo). Proportions of patients in clinical remission at week 8 were significantly higher in the 1.0 g IN group (55.0%, P = .0004) and the 2.0 g IN group (38.1%, (P = .0093) than in the placebo group (4.5%). Proportions of patients with mucosal healing were 13.6% in the placebo group, 56.5% in the 0.5 g IN group, 60.0% in the 1.0 g IN group, and 47.6% in the 2.0 g IN group (P = .0278 compared with placebo). Although mild liver dysfunction was observed in 10 patients who received IN, no serious adverse events were observed. In a randomized, placebo-controlled trial, we found 8 weeks of IN (0.5–2.0 g per day) to be effective in inducing a clinical response in patients with UC. However, IN should not yet be used because of the potential for adverse effects, including pulmonary arterial hypertension.

Recently, the risk of viral infection has dramatically increased owing to changes in human ecology such as global warming and an increased geographical movement of people and goods. However, the efficacy of vaccines and remedies for infectious diseases is limited by the high mutation rates of viruses, especially, RNA viruses. Here, we comprehensively review the effectiveness of several probiotics and paraprobiotics (sterilized probiotics) for the prevention or treatment of virally-induced infectious diseases. We discuss the unique roles of these agents in modulating the cross-talk between commensal bacteria and the mucosal immune system. In addition, we provide an overview of the unique mechanism by which viruses are eliminated through the stimulation of type 1 interferon production by probiotics and paraprobiotics via the activation of dendritic cells. Although further detailed research is necessary in the future, probiotics and/or paraprobiotics are expected to be among the rational adjunctive options for the treatment of various viral diseases.

Colonic subepithelial myofibroblasts (SEMFs) may play a role in the modulation of mucosal inflammatory responses. We investigated the effects of interleukin (IL)-17 on IL-6 and chemokine [IL-8 and monocyte chemoattractant protein (MCP)-1] secretion in colonic SEMFs. Cytokine expression was determined by ELISA and Northern blotting. Nuclear factor kappa B (NF-kappaB) DNA-binding activity was evaluated by electrophortetic gel mobility shift assay (EMSA). The activation of mitogen-activated protein kinase (MAPK) was assessed by immunoblotting. IL-6, IL-8, and MCP-1 secretions were rapidly induced by IL-17. IL-17 induced NF-kappaB activation within 45 min after stimulation. A blockade of NF-kappaB activation markedly reduced these responses. MAPK inhibitors (SB-203580, PD-98059, and U-0126) significantly reduced the IL-17-induced IL-6 and chemokine secretion. The combination of either IL-17 + IL-1beta or IL-17 + tumor necrosis factor (TNF)-alpha enhanced cytokine secretion; in particular, the effects of IL-17 + TNF-alpha on IL-6 secretion were much stronger than the other responses. This was dependent on the enhancement of IL-6 mRNA stability. In conclusion, human SEMFs secreted IL-6, IL-8, and MCP-1 in response to IL-17. These responses might play an important role in the pathogenesis of gut inflammation.

Interleukin (IL)-32 is a recently described proinflammatory cytokine, characterized by induction of nuclear factor (NF)-kappaB activation. We studied IL-32alpha expression in the inflamed mucosa of inflammatory bowel disease (IBD). We also investigated mechanisms regulating IL-32alpha expression. Tissue samples were obtained endoscopically or surgically from patients with ulcerative colitis (UC) (n = 10), Crohn's disease (CD) (n = 10), ischaemic colitis (n = 4) and normal colorectal tissues (n = 10). IL-32alpha expression was evaluated by standard immunohistochemical procedure. IL-32 mRNA expression was analysed by Northern blot. IL-32alpha was expressed weakly by colonic epithelial cells from normal individuals and subjects with ischaemic colitis. In the inflamed mucosa of IBD patients, epithelial IL-32alpha expression was increased markedly. In UC and CD patients, IL-32alpha expression was enhanced in affected mucosa compared to non-affected mucosa. In intestinal epithelial cell lines, expression of IL-32alpha mRNA and protein was enhanced by IL-1beta, interferon (IFN)-gamma and tumour necrosis factor (TNF)-alpha. A combination of TNF-alpha plus IFN-gamma exerted synergistic effects. IL-32alpha induction by IL-1beta and/or TNF-alpha was mediated by NF-kappaB activation. Epithelial IL-32alpha expression was increased in IBD patients, and in CD patients in particular. IL-32alpha might be involved in the pathophysiology of IBD as a proinflammatory cytokine and a mediator of innate immune response.

Luminal nutrition is important for maintenance of gastrointestinal mucosal structure and function. In particular, short chain fatty acids (SCFAs), metabolic products of anaerobic bacterial fermentation of dietary fiber and resistant starch, are particularly important as the preferred respiratory fuel of the colonocytes. A variety of biological effects of SCFAs have been reported, and there is now increasing number of experimental works showing new aspects of these molecules. For example, as the mechanisms mediating anti-inflammatory effects of SCFAs, several investigators identified the inhibitory effect of butyrate on proinflammatory cytokine-induced NF-kappaB activation. Various inflammatory responses are now discussed with the central role of NF-kappaB activation, and thus the inhibition of NF-kappaB activation represents the efficacy of dietary fiber and SCFAs in the treatment with inflammatory bowel disease. Furthermore, recent advance in molecular technology has identified mechanisms mediating anti-tumor effects of SCFAs. SCFAs modulate expression of cell cycle-regulating proteins and induce apoptosis in colon cancer cells. SCFAs increase the susceptibility of colon cancer cells to complement-mediated cell injury. In this review, new aspects of functions of SCFAs are focused and summarized.

Abstract IL-24 is a member of the IL-10 family of cytokines. In this study, we investigated IL-24 expression in the inflamed mucosa of patients with inflammatory bowel disease (IBD), and characterized the molecular mechanisms responsible for IL-24 expression in human colonic subepithelial myofibroblasts (SEMFs). IL-24 expression in the IBD mucosa was evaluated by immunohistochemical methods. IL-24 mRNA and protein expression was determined by real-time PCR and ELISA, respectively. AP-1 and C/EBP DNA-binding activity and IL-24 promoter activity were assessed by EMSA analysis and a reporter gene assay, respectively. IL-24 mRNA expression was significantly elevated in active lesions from patients who have ulcerative colitis and Crohn’s disease. Colonic SEMFs were identified as a major source of IL-24 in the mucosa. IL-1β, but not IL-17A, TNF-α, or IFN-γ, significantly enhanced IL-24 mRNA and protein expression in isolated colonic SEMFs. The IL-1β-induced IL-24 mRNA expression was mediated by the activation of the transcription factors, AP-1 and C/EBP-β. Induction of IL-24 mRNA stabilization was also involved in the effects of IL-1β. IL-24 induced JAK1/STAT-3 phosphorylation and SOCS3 expression in HT-29 colonic epithelial cells. IL-24 did not modulate the proliferation of HT-29 cells, but significantly increased the mRNA expression of membrane-bound mucins (MUC1, MUC3, and MUC4). IL-24 derived from colonic SEMFs acts on colonic epithelial cells to elicit JAK1/STAT-3 activation and the expression of SOCS3 and mucins, supporting their suppressive effects on mucosal inflammation in IBD.

Granulocyte and monocyte adsorptive apheresis (GMA) has shown efficacy in patients with active ulcerative colitis (UC). However, with routine weekly treatment, it may take several weeks to achieve remission, and to date, the efficacy of a more frequent treatment schedule remains unknown. The aim of this study was to assess the clinical efficacy and safety of intensive GMA treatment in patients with active UC.This was an open-label, prospective, randomized multicenter study to compare an intensive, two GMA sessions per week, with the routine, one GMA session per week. A total of 163 patients with mild-to-moderately active UC were randomly assigned to routine weekly treatment or intensive treatment. The maximum number of sessions of GMA permitted was 10. However, when patients achieved remission, GMA was discontinued. Remission rate at the end of the study, time to remission, and adverse events were assessed in both groups.Of the 163 patients, 149 were available for efficacy analysis as per protocol, 76 were in weekly GMA, and 73 were in intensive GMA. At the end of the study period, clinical remission was achieved in 41 of 76 patients (54.0%) in weekly GMA and in 52 of 73 patients (71.2%) in intensive GMA (P=0.029). The mean time to remission was 28.1+/-16.9 days in the weekly GMA treatment group and 14.9+/-9.5 days in the intensive GMA group (P<0.0001). Intensive GMA was well tolerated without GMA-related serious adverse side effects.Intensive GMA in patients with active UC seems to be more efficacious than weekly treatment, and significantly reduced the patients' morbidity time without increasing the incidence of side effects.

Interleukin (IL)-36 (IL-36α, IL-36β, and IL-36γ) is a recently reported member of the IL-1 cytokine family. In this study, we investigated IL-36 expression in the inflamed mucosa of patients with inflammatory bowel disease and characterized the proinflammatory actions of IL-36 cytokines in human colonic epithelial cells.IL-36 mRNA expression was evaluated using real-time PCR. IL-36 protein expression was analyzed using immunoblotting and immunohistochemical technique. Intracellular signaling pathways were evaluated by immunoblotting and by specific siRNA-transfected cells.The mRNA expression of IL-36α and IL-36γ, but not of IL-36β, was enhanced in the inflamed mucosa of patients with inflammatory bowel disease, in particular, in ulcerative colitis. Immunohistochemical analysis showed that T cells, monocytes, and plasma cells are the source of IL-36α and IL-36γ in colonic mucosa. DNA microarray analysis indicated that IL-36α induces the mRNA expression of CXC chemokines and acute phase proteins in intestinal epithelial cell line, HT-29 cells. IL-36α and IL-36γ dose-dependently and time-dependently induced the mRNA and protein expression of CXC chemokines (CXCL1, CXCL2, CXCL3 etc.) in HT-29 and Widr cells. Stimulation with IL-36α and IL-36γ assembled MyD88 adaptor proteins (MyD88, TRAF6, IRAK1, and TAK1) into a complex and induced the activation of NF-κB and AP-1 and also the phosphorylation of MAPKs. MAPK inhibitors and siRNAs specific for NF-κB and c-Jun AP-1 significantly reduced IL-36-induced CXC chemokine expression.IL-36α and IL-36γ may play a proinflammatory role in the pathophysiology of inflammatory bowel disease through induction of CXC chemokines and acute phase proteins.

Summary Interleukin (IL)-37 is a member of the IL-1 cytokine family. We investigated IL-37b expression in the inflamed mucosa of inflammatory bowel disease (IBD) patients. Furthermore, we analysed IL-37b expression in human colonic epithelial cells. The human colonic epithelial cell line T84 and human colonic subepithelial myofibroblasts (SEMFs) were used. IL-37b expression in the IBD mucosa was evaluated by immunohistochemistry. IL-37b mRNA and protein expression were determined by real time-polymerase chain reaction (PCR) and Western blotting, respectively. IL-37b was not detected in the normal colonic mucosa. In the inflamed mucosa of IBD patients, epithelial IL-37b expression was increased markedly. In ulcerative colitis (UC) and Crohn's disease (CD) patients, IL-37b expression was enhanced in the affected mucosa. In the intestinal epithelial cell line T84, the expression of IL-37b mRNA and protein was enhanced by tumour necrosis factor (TNF)-α. This IL-37b induction by TNF-α was mediated by nuclear factor (NF)-κB and activator protein (AP)-1 activation. Furthermore, IL-37b inhibited TNF-α-induced interferon-γ-inducible protein (IP)-10 expression significantly in human colonic SEMFs. Epithelial IL-37b expression was increased in IBD patients, especially UC patients. IL-37b may be involved in the pathophysiology of IBD as an anti-inflammatory cytokine and an inhibitor of both innate and acquired immune responses.

&lt;b&gt;&lt;i&gt;Background:&lt;/i&gt;&lt;/b&gt; The human body is colonized by an extremely complex and abundant aggregation of microbes, collectively referred to as the gut microbiota. Recent studies have focused on the link between these microbes and our health. &lt;b&gt;&lt;i&gt;Summary:&lt;/i&gt;&lt;/b&gt; Diet contributes to shaping the gut microbial structure and influences metabolic functions of the host. Alteration of the microbial structure and function (dysbiosis) is associated with the pathogenesis of various disorders. Fermentation is the process by which anaerobic bacteria (Firmicutes and Bacteroidetes) break down indigestible carbohydrates to short-chain fatty acids (SCFAs; acetate, propionate and butyrate), collaborating with species specialized in oligosaccharide fermentation (e.g. &lt;i&gt;Bifidobacteria&lt;/i&gt;). Butyrate and propionate can regulate intestinal physiology and immune function, while acetate acts as a substrate for lipogenesis and gluconeogenesis. The gut microbiota regulates immune homeostasis via the induction of regulatory T cells and Th17 cells. In addition, butyrate has strong anti-inflammatory effects possibly through the inhibition of histone deacetylase activity. Metabolic products generated by the gut microbiota, such as SCFAs, GABA, tryptophan, serotonin and catecholamine, transmit a signal to resident cells in the gut. &lt;b&gt;&lt;i&gt;Key Message:&lt;/i&gt;&lt;/b&gt; Advances made in the DNA sequencing technology and bioinformatics have revolutionized our understanding of the microbes in the gut.

The relationship between skeletal muscle volume and the prognosis of patients with inflammatory bowel disease (IBD) remains undetermined. We conducted a retrospective study of 72 IBD patients who were admitted to the hospital due to disease exacerbation. We enrolled IBD patients who had undergone abdominal computed tomography and assessed the nutritional indices, such as the Onodera’s prognostic nutritional index (O-PNI) and the controlling nutritional status (CONUT) index. The L3 skeletal muscle index (SMI), which is the ratio of the cross-sectional area of skeletal muscles at the level of the third lumbar (L3) vertebra to the height squared, was used to identify sarcopenia. Sarcopenia, defined as a low SMI, was observed in 42% of all IBD patients (37% with Crohn’s disease (CD) and 48% with ulcerative colitis (UC)). In UC patients, the O-PNI and CONUT values, height, and albumin levels were significantly lower than in CD patients. The SMI strongly correlated with sex, body weight, albumin level, and O-PNI in IBD patients. Multivariate analysis using the Cox regression model demonstrated that the presence of sarcopenia (P = 0.015) and disease type (CD or UC) (P = 0.007) were significant factors predicting intestinal resection. The cumulative operation-free survival rate was significantly lower for sarcopenic patients than in all IBD patients (P = 0.003) and a stratified analysis of CD patients (P = 0.001) using the Kaplan–Meier method and log-rank test. The L3 skeletal muscle area is a prognostic factor for intestinal resection in patients with CD.

Objective The Kyoto gastritis classification categorizes the endoscopic characteristics of Helicobacter pylori (H. pylori) infection-associated gastritis and identifies patterns associated with a high risk of gastric cancer. We investigated its efficacy, comparing scores in patients with H. pylori-associated gastritis and with gastric cancer. Methods A total of 1,200 patients with H. pylori-positive gastritis alone (n=932), early-stage H. pylori-positive gastric cancer (n=189), and successfully treated H. pylori-negative cancer (n=79) were endoscopically graded according to the Kyoto gastritis classification for atrophy, intestinal metaplasia, fold hypertrophy, nodularity, and diffuse redness. Results The prevalence of O-II/O-III-type atrophy according to the Kimura-Takemoto classification in early-stage H. pylori-positive gastric cancer and successfully treated H. pylori-negative cancer groups was 45.1%, which was significantly higher than in subjects with gastritis alone (12.7%, p<0.001). Kyoto gastritis scores of atrophy and intestinal metaplasia in the H. pylori-positive cancer group were significantly higher than in subjects with gastritis alone (all p<0.001). No significant differences were noted in the rates of gastric fold hypertrophy or diffuse redness between the two groups. In a multivariate analysis, the risks for H. pylori-positive gastric cancer increased with intestinal metaplasia (odds ratio: 4.453, 95% confidence interval: 3.332-5.950, <0.001) and male sex (1.737, 1.102-2.739, p=0.017). Conclusion Making an appropriate diagnosis and detecting patients at high risk is crucial for achieving total eradication of gastric cancer. The scores of intestinal metaplasia and atrophy of the scoring system in the Kyoto gastritis classification may thus be useful for detecting these patients.

Objective The underlying microbial basis, predictors of therapeutic outcome and active constituent(s) of faecal microbiota transplantation (FMT) mediating benefit remain unknown. An international panel of experts presented key elements that will shape forthcoming FMT research and practice. Design Systematic search was performed, FMT literature was critically appraised and a 1-day round-table discussion was conducted to derive expert consensus on key issues in FMT research. Results 16 experts convened and discussed five questions regarding (1) the role of donor and recipient microbial (bacteria, viruses, fungi) parameters in FMT; (2) methods to assess microbiota alterations; (3) concept of keystone species and microbial predictors of FMT, (4) influence of recipient profile and antibiotics pretreatment on FMT engraftment and maintenance and (5) new developments in FMT formulations and delivery. The panel considered that variable outcomes of FMT relate to compositional and functional differences in recipient’s microbiota, and likely donor-associated and recipient-associated physiological and genetic factors. Taxonomic composition of donor intestinal microbiota may influence the efficacy of FMT in recurrent Clostridioides difficile infections and UC. FMT not only alters bacteria composition but also establishes trans-kingdom equilibrium between gut fungi, viruses and bacteria to promote the recovery of microbial homeostasis. FMT is not a one size fits all and studies are required to identify microbial components that have specific effects in patients with different diseases. Conclusion FMT requires optimisation before their therapeutic promise can be evaluated for different diseases. This summary will guide future directions and priorities in advancement of the science and practice of FMT.

Despite NUDT15 variants showing significant association with thiopurine-induced adverse events (AEs) in Asians, it remains unclear which variants of NUDT15 or whether additional genetic variants should be tested to predict AEs. To clarify the best pharmacogenetic test to be used clinically, we performed association studies of NUDT15 variants and haplotypes with AEs, genome-wide association study (GWAS) to discover additional variants, and ROC analysis to select the model to predict severe AEs. Overall, 2630 patients with inflammatory bowel disease (IBD) were enrolled and genotyped for NUDT15 codon 139; 1291 patients were treated with thiopurines. diplotypes were analyzed in 970 patients, and GWASs of AEs were performed with 1221 patients using population-optimized genotyping array and imputation. We confirmed the association of NUDT15 p.Arg139Cys with leukopenia and alopecia (p = 2.20E−63, 1.32E−69, OR = 6.59, 12.1, respectively), and found a novel association with digestive symptoms (p = 6.39E−04, OR = 1.89). Time to leukopenia was significantly shorter, and when leukopenia was diagnosed, thiopurine doses were significantly lower in Arg/Cys and Cys/Cys than in Arg/Arg. In GWASs, no additional variants were found to be associated with thiopurine-induced AEs. Despite strong correlation of leukopenia frequency with estimated enzyme activities based on the diplotypes (r2 = 0.926, p = 0.0087), there were no significant differences in the AUCs of diplotypes from those of codon 139 to predict severe AEs (AUC = 0.916, 0.921, for acute severe leukopenia, AUC = 0.990, 0.991, for severe alopecia, respectively). Genotyping of NUDT15 codon 139 was sufficient to predict acute severe leukopenia and alopecia in Japanese patients with IBD.

Background: Gut dysbiosis associated with the use of proton-pump inhibitors (PPIs) has been found to lead to the occurrence of infectious and inflammatory adverse events. A longitudinal observational cohort study has demonstrated the heightened risk of death associated with PPI use. Summary: We evaluated meta-analyses to determine the association between PPI use and infectious and inflammatory diseases. Meta-analyses showed that PPI use is a potential risk for the development of enteric infections caused by Clostridium difficile, as well as small intestinal bacterial overgrowth, spontaneous bacterial peritonitis, community-acquired pneumonia, hepatic encephalopathy, and adverse outcomes in inflammatory bowel disease. We also examined changes in the composition and function of the gut microbiota with the use of PPIs. PPI use significantly increased the presence of Streptococcaceae and Enterococcaceae, which are risk factors for C. difficile infection, and decreased that of Faecalibacterium, a commensal anti-inflammatory microorganism. Key Message: High-throughput, microbial 16S rRNA gene sequencing has allowed us to investigate the association between the gut microbiome and PPI use. Future prospective comparison studies are necessary to confirm this association, and to develop new strategies to prevent complications of PPI use

We have previously isolated and characterized human pancreatic periacinar myofibroblasts. In this study, to define the role of these cells in the pathogenesis of acute pancreatitis, we investigated chemokine expression in them.Secretion of chemokines (interleukin [IL]-8, monocyte chemoattractant protein [MCP]-1, RANTES, and MIP [macrophage inflammatory protein]-1alpha) was evaluated by ELISA, Northern blotting, and nuclear run-on assays. The activation of NF-kappaB and NF-IL6 was assessed by an electrophoretic gel mobility shift assay.IL-8 and MCP-1 secretion was rapidly induced by both IL-1beta and tumor necrosis factor (TNF)-alpha. RANTES secretion was induced more slowly and was induced mainly by TNF-alpha. However, MIP-1alpha secretion was not induced by any stimuli. These responses were also observed at the messenger RNA level, and they were accompanied by an increase in transcriptional rate. The increase in transcriptional activation of chemokine genes correlated with the NF-kappaB and NF-IL6 activation. Furthermore, a blockade of NF-kappaB activation by PDTC and TPCK markedly reduced the IL-1beta- or TNF-alpha-induced chemokine gene expression.Chemokine secretion is differentially regulated in pancreatic periacinar myofibroblasts, suggesting a role for these cells in mediating the infiltration and accumulation of inflammatory cells in the pancreas.

We investigated the effects of pectin, a soluble dietary fiber, on the morphological parameters of the small intestine. In addition, we tested the effects of butyrate enemas on dextran sulfate sodium (DSS)-induced experimental colitis.Male Wistar rats were fed an elemental diet containing 2.5% pectin for 14 days, and several parameters were then determined. DSS-induced colitis was evoked by the oral administration of water containing 3% DSS for 10 days. The butyrate enema (3 mL of 100 mmol/L butyrate per day) was begun 7 days before the DSS treatment. Interleukin (IL)-8 secretion in the human intestinal epithelial cell line HT-29 was determined by enzyme-linked immunosorbent assay (ELISA).Pectin feeding induced a significant increase in the villus height and crypt depth in the small intestine. These effects correlated with a significant increase in plasma enteroglucagon levels. Pretreatment with a butyrate enema significantly blocked the development of DSS-induced experimental colitis. In the in vitro experiment, sodium butyrate dose-dependently inhibited tumor necrosis factor (TNF)-alpha-induced IL-8 secretion in HT-29 cells.A trophic effect due to dietary fiber was directly observed. The generation of short-chain fatty acids and the induction of enteroglucagon release might play an important role in this process. Butyrate, one of the major metabolites of dietary fiber, exerted a potent anti-inflammatory effect both in vivo and in vitro. Dietary fiber may therefore play important roles in the regulation of normal and pathological conditions in the intestine.

There is increasing evidence that IL-6 plays an important role in the pathophysiology of acute pancreatitis via its broad proinflammatory actions. To identify the local biosynthetic site for IL-6 in human pancreas, we investigated IL-6 secretion in human pancreatic periacinar myofibroblasts. IL-6 secretion was determined by ELISA and Northern blotting. The activation of NF-kappaB was assessed by EMSA. The activation of mitogen-activated protein kinase (MAPK) was assessed by immunoblotting. IL-6 secretion was rapidly induced by IL-17, IL-1beta, and TNF-alpha. EMSAs demonstrated that IL-17, IL-1beta, and TNF-alpha induced NF-kappaB activation within 1.5 h after stimulation, and a blockade of NF-kappaB activation by the pyrrolidine derivative of dithiocarbamate and tosyl-phe-chloromethylketone markedly reduced the IL-17-, IL-1beta-, or TNF-alpha-induced IL-6 gene expression. Furthermore, IL-17, IL-1beta, and TNF-alpha induced a rapid activation of extracellular signal-related kinase p42/44 and p38 MAPKs, and specific MAPK inhibitors (SB203580, PD98059, and U0216) significantly reduced IL-17-, IL-1beta-, or TNF-alpha-induced IL-6 secretion, indicating the role of MAPKs in the induction of IL-6. The combination of either IL-17 plus IL-1beta or IL-17 plus TNF-alpha enhanced IL-6 secretion and IL-6 mRNA expression; in particular, the effects of IL-17 plus TNF-alpha were much stronger than those induced by IL-17 plus IL-1beta. TNF-alpha-induced IL-6 mRNA degraded rapidly at any concentrations, and the combination of IL-17 and TNF-alpha markedly enhanced IL-6 mRNA stability. This indicates that the effects of IL-17 plus TNF-alpha were regulated at the post-transcriptional level. In conclusion, pancreatic periacinar myofibroblasts secreted a large amount of IL-6 in response to proinflammatory cytokines. These cells might play an important role in the pathogenesis of acute pancreatitis via IL-6 secretion.

Abstract In the intestinal tract, the local synthesis of C3 and components of both the classical (C4) and alternative (factor B) C activation pathway has previously been demonstrated in vivo. However, the cellular source of this local C synthesis has not been identified. In this study, we demonstrated the syntheses of C3, C4, and factor B in the human colonic adenocarcinoma cell line Caco-2, which is regarded as a good experimental model of normal human intestinal epithelial cells. The results of metabolic labeling experiments indicated that the intra- and extracellular molecular sizes and subunit structures of Caco-2-derived C3, C4, and factor B were compatible with previously reported values for these components in other cells. The functional activities of C3 and C4 in the supernatants were also demonstrated by hemolytic titration assay. Furthermore, C syntheses in this line were independently upregulated by several human cytokines: C3 synthesis was dose-dependently enhanced by the addition of IL-1 beta or TNF-alpha; C4 synthesis was enhanced by the addition of IL-6 or IFN-gamma in the same manner; and the addition of IL-1 beta or IL-6 also induced a dose-dependent increase in factor B synthesis. These enhancing effects were confirmed to be specific for individual cytokines by experiments using anti-human cytokine antibodies. It is likely that intestinal epithelial cells are local production sites of C3, C4, and factor B, and that local C syntheses in the intestine are independently regulated by several cytokines, derived from monocytes/macrophages and T cells resident in the mucosal microenvironment.

A germinated barley foodstuff (GBF) containing glutamine-rich protein and hemicellulose-rich fiber was made from brewer's spent grain, by physical isolation. Our previous studies demonstrated that GBF supported maintenance of epithelial cell populations, facilitated epithelial repair, and suppressed epithelial nuclear factor kappaB-DNA-binding activity through generating increased short-chain fatty acid (especially butyrate) production by luminal microflora, which includes Bifidobacterium and Eubacterium, thereby preventing experimental colonic injury. The fiber fraction also modulates stool water content because of its high water-holding capacity. The patients with mild to moderate active ulcerative colitis who had been unresponsive to or intolerant of standard treatment received 20-30 g GBF, feeding daily in a non-randomized, open-label fashion. At 4 weeks, this treatment resulted in a significant clinical and endoscopic improvement. The improvement was associated with an increase in stool butyrate concentrations. These results indicate that GBF feeding is a potentially new, attractive prebiotic treatment in patients with ulcerative colitis. The potency of GBF on modulating microflora, as well as the high water-holding capacity, may play an important role in treatment and prolongation of remission in ulcerative colitis.

Inflammatory bowel disease (IBD) is characterized by an ongoing mucosal inflammation caused by a dysfunctional host immune response to commensal microbiota and dietary factors. In the pathophysiology of IBD, mesenchymal cells such as intestinal subepithelial myofibroblasts (ISEMF) affect the recruitment, retention and activation of immune cells. Mesenchymal cells also promote resolution of inflammatory activity accompanied with balanced repair processes. The transient appearance of mesenchymal cells is a feature of normal wound healing, but the persistence of these cells is associated with tissue fibrosis. Recent studies suggest that mesenchymal cells derived from bone marrow (BM) stem cells play a crucial role in intestinal repair and fibrosis. This article focuses on recent knowledge about ISEMF in the field of immune response inflammation and repair. Two major topics were documented: interaction between interleukin (IL)-17-secreting CD4+ cells (Th-17 cells) and about role of BM-derived stem cells in mucosal regenerative response via differentiation to ISEMF. Recent therapeutic strategies targeting BM stem cells for IBD patients were also documented.

Germinated barley foodstuff (GBF) is a prebiotic which increases luminal butyrate production by modulating the microfloral distribution. GBF has been shown to reduce both clinical activity and mucosal damage in active ulcerative colitis (UC) with mild to moderate activity. However, the efficacy of GBF in patients with UC during the remission stage is unknown. The aim of this study was to investigate the efficacy of GBF as a maintenance therapy in patients with UC while in remission. Fifty-nine patients with UC in remission according to Rachmilewitz's clinical activity index (CAI) score of </=4 were enrolled and divided into two groups, control (n=37) and GBF (n=22). Patients in the control group were given conventional treatment alone for 12 months, while patients in the GBF group received conventional therapy plus 20 g of GBF daily. The response to treatments was assessed by monitoring the CAI and endoscopic score according to Matts. Significantly better CAI values were seen in the GBF group at 3, 6, and 12 months compared with the values in the control group. The cumulative recurrence rate in the GBF group with steroid tapering treatment was significantly lower compared with the value in the control group. No side effects related to GBF were observed. GBF appeared to be effective and safe as a maintenance therapy to taper steroid dose and prolong remission in patients with UC.

Inflammatory bowel disease (IBD), ulcerative colitis (UC) and Crohn's disease (CD) are characterized by ongoing mucosal inflammation in which dysfunction of the host immunologic response against dietary factors and commensal bacteria is involved. The chronic inflammatory process leads to disruption of the epithelial barrier, and the formation of epithelial ulceration. This permits easy access for the luminal microbiota and dietary antigens to cells resident in the lamina propria, and stimulates further pathological immune cell responses. Cytokines are essential mediators of the interactions between activated immune cells and non-immune cells, including epithelial and mesenchymal cells. The clinical efficacy of targeting TNF-alpha clearly indicates that cytokines are the therapeutic targets in IBD patients. In this manuscript, we focus on the biological activities of recently-reported cytokines [Interleukin (IL)-17 cytokine family, IL-31 and IL-32], which might play a role through interaction with TNF-alpha in the pathophysiology of IBD.

Recent studies have demonstrated that the complement system participates in the regulation of T cell functions. To address the local biosynthesis of complement components in inflammatory bowel disease (IBD) mucosa, we investigated C3 and interleukin (IL)-17 mRNA expression in mucosal samples obtained from patients with IBD. The molecular mechanisms underlying C3 induction were investigated in human colonic subepithelial myofibroblasts (SEMFs). IL-17 and C3 mRNA expressions in the IBD mucosa were evaluated by real-time polymerase chain reaction. The C3 levels in the supernatant were determined by enzyme-linked immunosorbent assay. IL-17 and C3 mRNA expressions were elevated significantly in the active lesions from ulcerative colitis (UC) and Crohn's disease (CD) patients. There was a significant positive correlation between IL-17 and C3 mRNA expression in the IBD mucosa. IL-17 stimulated a dose- and time-dependent increase in C3 mRNA expression and C3 secretion in colonic SEMFs. The C3 molecules secreted by colonic SEMFs were a 115-kDa alpha-chain linked to a 70-kDa beta-chain by disulphide bonds, which was identical to serum C3. The IL-17-induced C3 mRNA expression was blocked by p42/44 mitogen-activated protein kinase (MAPK) inhibitors (PD98059 and U0216) and a p38 MAPK inhibitor (SB203580). Furthermore, IL-17-induced C3 mRNA expression was inhibited by an adenovirus containing a stable mutant form of I kappaB alpha. C3 and IL-17 mRNA expressions are enhanced, with a strong correlation, in the inflamed mucosa of IBD patients. Part of these clinical findings was considered to be mediated by the colonic SEMF response to IL-17.

BackgroundTerminal restriction fragment length polymorphism (T-RFLP) analysis is a powerful tool to assess the diversity of complexed microbiota. This permits rapid comparison of microbiota from many samples. In this study, we performed T-RFLP analysis of the fecal microbiota from patients with ulcerative colitis (UC).

Interleukin (IL)-32 is a recently described proinflammatory cytokine characterized by the induction of nuclear factor (NF)-kappaB activation. We studied IL-32 expression in human pancreatic tissue and pancreatic cancer cell lines. Tissue samples were obtained surgically. IL-32 expression was evaluated by standard immunohistochemical procedures. IL-32 mRNA expression was analyzed by Northern blotting and real time PCR analyses. IL-32 was weakly immunoexpressed by pancreatic duct cells. In the inflamed lesions of chronic pancreas, the ductal expression of IL-32 was markedly increased. A strong expression of IL-32alpha was detected in the pancreatic cancer cells. In pancreatic cancer cell lines (PANC-1, MIA PaCa-2, and BxPC-3 cells), the expression of IL-32 mRNA and protein was enhanced by IL-1beta, interferon (IFN)-gamma, and tumor necrosis factor (TNF)-alpha. An inhibitor of phosphatidylinositol 3-kinase (LY294002) significantly suppressed the IL-1beta-, IFN-gamma- and TNF-alpha-induced IL-32 mRNA expression. The blockade of NF-kappaB and activated protein-1 activation markedly suppressed the IL-1beta-, IFN-gamma-, and/or TNF-alpha-induced IL-32 mRNA expression. Furthermore, IL-32-specific small interfering RNA significantly decreased the uptake of [3H]thymidine and increased the annexin V-positive population (apoptotic cells) in PANC-1 cells. IL-32 knockdown also suppressed the mRNA expression of antiapoptotic proteins (Bcl-2, Bcl-xL, and Mcl-1). Pancreatic duct cells are the local source of IL-32, and IL-32 may play an important role in inflammatory responses and pancreatic cancer growth.

Many host-factors are inducibly expressed during the development of inflammatory bowel disease (IBD), each having their unique properties, such as immune activation, bacterial clearance, and tissue repair/remodeling. Dysregulation/imbalance of these factors may have pathogenic effects that can contribute to colitis-associated cancer (CAC). Previous reports showed that IBD patients inducibly express colonic chitinase 3-like 1 (CHI3L1) that is further upregulated during CAC development. However, little is known about the direct pathogenic involvement of CHI3L1 in vivo. Here we demonstrate that CHI3L1 (aka Brp39) knockout (KO) mice treated with azoxymethane (AOM)/dextran sulphate sodium (DSS) developed severe colitis but lesser incidence of CAC as compared to that in wild-type (WT) mice. Highest CHI3L1 expression was found during the chronic phase of colitis, rather than the acute phase, and is essential to promote intestinal epithelial cell (IEC) proliferation in vivo. This CHI3L1-mediated cell proliferation/survival involves partial downregulation of the pro-apoptotic S100A9 protein that is highly expressed during the acute phase of colitis, by binding to the S100A9 receptor, RAGE (Receptor for Advanced Glycation End products). This interaction disrupts the S100A9-associated expression positive feedback loop during early immune activation, creating a CHI3L1hi S100A9low colonic environment, especially in the later phase of colitis, which promotes cell proliferation/survival of both normal IECs and tumor cells.

Endoscopic balloon dilation [EBD] is an alternative to surgery for Crohn's strictures. However, there have been no prospective studies of EBD for small bowel strictures in patients with Crohn's disease [CD]. The aim of this study was to clarify the efficacy and safety of EBD using balloon-assisted enteroscopy for small bowel strictures in CD.This was a nationwide, multi-centre, open-label, prospective cohort study. The subjects were CD patients with at least one symptom [abdominal pain, abdominal bloating, nausea] attributable to small bowel stricture. The primary endpoint related to short-term outcomes was the level of improvement of symptoms evaluated using a 10-cm visual analogue scale [VAS]. Cases in which VAS scores for all symptoms improved 4 weeks after EBD compared with baseline were considered to have short-term symptomatic improvement. Factors related to short-term treatment outcomes and safety were investigated as secondary endpoints.A total of 112 patients were enrolled. Seventeen were later excluded because they did not meet the criteria, and the analysis was conducted with the remaining 95 patients. Of these 95 patients, procedure failure occurred in six [6.3%], and short-term symptomatic improvement was achieved in 66 patients [69.5%]. Adverse events were seen in five patients [5%] and all of these improved with conservative treatment. A large dilation diameter of the balloon was a factor contributing to the success of EBD.EBD using balloon-assisted enteroscopy for small bowel strictures in CD patients was shown to be an effective and safe procedure.UMIN000005946.

We read with great interest two recent reports by Imhann et al 1 and Jackson et al .2 Through large population-cohort study, each group revealed that gastric acid inhibition by long-term use of proton pump inhibitors (PPIs) changes the gut microbiome to predispose to enteric infection including Clostridium difficile (CD) . Potassium-competitive acid blockers (P-CABs) have been reported to exert more potent gastric acid suppression than PPIs.3 ,4 The inhibitory effect of vonoprazan (TAK-438), a new P-CAB, on H+, K+-ATPase in vitro is approximately 400 times more potent than that of PPI (lansoprazole) (inhibitory concentration (IC)50 of vonoprazan 0.019 μM and lansoprazole 7.6 μM).5 We describe below that vonoprazan induces more complex alteration of the gut microbiome as compared with lansoprazole. We enrolled serum Helicobacter pylori IgG-negative healthy individuals to eliminate the influence of H. pylori infection on gastric acid secretion (see online supplementary table S1). The PPI group (n=11) took 30 mg of lansoprazole daily for 4 weeks, and the P-CAB group …

Proton pump inhibitors (PPIs) are mainly metabolized by cytochrome P450 2C19 (CYP2C19) and used as the first-line therapy for gastroesophageal reflux disease (GERD). However, while several studies have examined the influence of CYP2C19 polymorphism on GERD treatment with PPIs, most have had small sample sizes and were conducted in a single center. Here, we used meta-analysis to investigate whether or not the CYP2C19 rapid metabolizer (RM) genotype is a risk factor for GERD patients being refractory to PPI therapy.PubMed and other electronic databases were systematically searched up to August 2014 using the following terms: "GERD and CYP2C19", "esophagitis and CYP2C19", and "non-erosive reflux disease and CYP2C19." Searches were limited to publications in English, and two investigators evaluated eligible studies and extracted data.The total efficacy rate of PPIs for GERD, including reflux esophagitis (RE) and non-erosive reflux disease, was 56.4% (95% confidence interval [CI]; 53.9-58.9%, 870/1543) in intention-to-treat analysis and 63.8% (95%CI; 61.3-66.2%, 950/1489) in per-protocol analysis. Efficacy rates varied significantly between CYP2C19 genotypes (intention-to-treat analysis: RMs, 52.2% [315/604]; intermediate metabolizers, 56.7% [298/526]; poor metabolizers [PMs], 61.3% [138/225]; P = 0.047). Among RE patients, CYP2C19 RMs had an increased risk of being refractory to PPI therapy compared with PMs (odds ratio: 1.661, 95% CI: 1.023-2.659, P = 0.040).The present meta-analysis demonstrates that CYP2C19 RMs with RE have an increased risk of being refractory to PPI therapy compared with PMs. Individualized dosing regimen with PPIs based on CYP2C19 genotype might be a valid therapeutic strategy for overcoming insufficient gastric acid inhibition.

Abstract Inflammatory bowel disease (IBD) has increased in incidence and prevalence in Asian countries since the end of the 20th century. Moreover, differences in the cause, phenotypes, and natural history of IBD between the East and West have been recognized. Therefore, the Asian Organization for Crohn's and Colitis and the Asia Pacific Association of Gastroenterology have established recommendations on medical management of IBD in Asia. Initially, the committee members drafted 40 recommendations, which were then assessed according to Grading of Recommendations Assessment, Development and Evaluation. Eight statements were rejected as this indicated that consensus had not been reached. The recommendations encompass pretreatment evaluation; medical management of active IBD; medical management of IBD in remission; management of IBD during the periconception period and pregnancy; surveillance strategies for colitis‐associated cancer; monitoring side effects of thiopurines and methotrexate; and infections in IBD.

The new curcumin derivative Theracurmin® has a 27-fold higher absorption rate than natural curcumin powder. Theracurmin® is an inhibitor of nuclear factor-κB, which mediates the expression of inflammatory cytokines. The effect of Theracurmin® on inflammatory bowel disease in humans has not been explored; therefore, we investigated the efficacy and safety of Theracurmin® in patients with Crohn's disease.In this randomized, double-blinded study performed at 5 independent medical centers in Japan, Theracurmin® (360 mg/day, n = 20) or placebo (n = 10) was administered to patients with active mild-to-moderate Crohn's disease for 12 weeks. The agent's efficacy was assessed by evaluating clinical and endoscopic remission, healing of anal lesions, and blood levels of inflammatory markers.In the Theracurmin® group, a significant reduction in clinical disease activity was observed in week 12 relative to that in week 0 (p = 0.005). On intention-to-treat analysis, clinical remission rates were 35%, 40%, and 40% at weeks 4, 8, and 12, respectively, which were significantly higher than those in the placebo group (all 0%; p = 0.033, p = 0.020, and p = 0.020, respectively). Furthermore, reduction in endoscopic Crohn's disease severity (p = 0.032) was observed at week 12 in the Theracurmin® group. The endoscopic remission rates were 15% and 0% in the Theracurmin® and placebo groups, respectively. Significant healing of anal lesions (p = 0.017) was observed at week 8 in the Theracurmin® group. No serious adverse events were observed in either group throughout the study.Theracurmin® shows significant clinical and endoscopic efficacy together with a favorable safety profile in patients with active mild-to-moderate Crohn's disease.UMIN000015770.

Alteration of the gut microbial structure and function (dysbiosis) is associated with the pathogenesis of various disorders including inflammatory bowel disease (IBD).Under normal conditions, β-oxidation of butyrate consumes oxygen in colonocytes and maintains the anaerobic environment in the lumen. Depletion of butyrate-producing bacteria results in anaerobic glycolysis in colonocytes and increases oxygen diffusion into the lumen, leading to a luminal facultative anaerobe expansion. Dysbiosis in IBD is characterized by the reduced abundance of the phylum Firmicutes (e.g., Faecalibacterium, Roseburia, and Ruminococcus) and an increase of the phylum Proteobacteria (e.g., Enterobacteriaceae). The overall structure of the gut mycobiome differs markedly in IBD patients, particularly Crohn's disease (CD), compared with healthy individuals. An increase in the genus Candida is a major contributory factor in the alteration of the mycobiome in Japanese CD patients, but an increase in the genus Saccharomyces is characteristic in Western patients. The gut virome, which is mainly composed of bacteriophages (phages), influences gut homeostasis and pathogenic conditions via an interaction with the gut bacterial community. Alterations in the gut virome have been suggested in patients with IBD. This may alter either the immunogenicity of bacteria, thus affecting the bacteria-host interactions, or the bacterial functions such as antibiotic resistance and toxin synthesis.Advances in DNA sequencing technology and bioinformatics have revolutionized our understanding of the microbiome in the gut.

The gut microbiota differs between patients with coronary artery disease (CAD) and healthy controls; however, it currently remains unclear whether these differences exist prior to the onset of CAD. We herein investigated the gut microbiota associated with subclinical coronary artery calcification (CAC) in a Japanese population. A total of 663 Japanese men were enrolled in this cross-sectional study. Computed tomography and gut microbiology tests were performed, and CAC scores were calculated using the Agatston method. Participants were categorized into four groups based on their CAC scores: CAC = 0, 0 <CAC ≤100, 100 <CAC, and with a CAD history. The bacterial 16S ribosomal RNA gene was amplified, and DNA sequencing was conducted on a MiSeq System. QIIME2 and LEfSe were used to analyze the gut microbiota, and the results obtained were compared among the four CAC categories. The mean age of participants was 68.4 years (46-83 years). The numbers of participants in CAC = 0, 0 <CAC ≤100, 100 <CAC, and with a CAD history were 219, 200, 193, and 51, respectively. The medians of the Firmicutes to Bacteroidota ratio were 1.50, 1.52, 1.67, and 1.80 for each CAC category (P = 0.020). One standard deviation higher phylum Firmicutes, class Bacilli, and order Lactobacillales were associated with a 1.3- to 1.4-fold higher risk of CAD. These taxa were also associated with a higher CAC score category. The family Streptococcaceae and genus Streptococcus showed a higher risk of CAD. The order Enterobacterales and family Enterobacteriaceae correlated with CAC scores. The genus Blautia showed a preventive direction for CAD, but did not correlate with CAC scores. The gut microbiota significantly differed from the phylum to genus level in a manner that was dependent on CAC scores, even before the onset of CAD.

Germinated barley foodstuff (GBF), which mainly consists of dietary fiber and glutamine-rich protein, is a prebiotic for ulcerative colitis (UC). In our previous study, we carried out a clinical trial of GBF with mildly to moderately active UC patients and showed that GBF treatment was able to attenuate the symptoms of UC in a relatively short-term. The aim of this study was to investigate the efficacy of long-term administration of GBF in the treatment of UC in a multi-center open trial. Twenty-one patients with mildly to moderately active UC received 20-30 g of GBF for 24 weeks in an open-label protocol while baseline treatments (5-amino-salicyrate compounds and/or steroids) were continued. The response to the GBF treatment was evaluated using a clinical scoring and after 24 weeks of observation, the GBF group showed a significant decrease in clinical activity index (especially, the degree of visible blood in stools and the presence of nocturnal diarrhea) compared with the control group (p<0.05). No side effects related to GBF were observed. In conclusion, GBF can reduce the clinical activity of UC over long-term as well as short-term administration. Nutraceutical GBF therapy may have a place in long-term management of UC, but controlled studies are needed to demonstrate its efficacy in the treatment of this disorder.

Background: Colonic subepithelial myofibroblasts may play a role in the inflammatory responses and in extracellular matrix (ECM) metabolism. In this study, we investigated the effects of interleukin (IL)-1 β and tumor necrosis factor (TNF)- α on chemokine (IL-8 and monocyte chemoattractant protein (MCP)-1) and ECM turnover (proliferation of subepithelial myofibroblasts, and secretion of ECM and matrix metalloproteinases (MMPs) in colonic subepithelial myofibroblasts. Methods: Human colonic sub-epithelial myofibroblasts were isolated using the method described by Mahida et al. (4). Chemokine and MMP expressions were determined by ELISA and Northern blotting. Nuclear factor (NF)- &#115 B and NF-IL6 DNA binding activities were evaluated by electrophoretic gel mobility shift assays (EMSA). Results: IL-1 β and TNF- α did not affect the proliferation of subepithelial myofibroblasts, but stimulated the secretion of types I and IV collagens weakly. Unstimulated subepithelial myofibroblasts secreted a large amount of MMP-2, but a small amount of IL-8, MCP-1 and MMP-1. IL-1 β and TNF- α both induced a dose- and time-dependent increase in IL-8, MCP-1 and MMP-1 secretion, and weakly stimulated MMP-2 secretion. IL-1 β and TNF- α both rapidly evoked NF- &#115 B DNA-binding activity. The inhibition of NF- &#115 B activation markedly blocked both IL-1 β - and TNF- α -induced IL-8 and MCP-1 mRNA expression, but did not affect MMP-1 mRNA expression. Conclusions: These observations indicate that chemokine secretion and ECM metabolism are collectively regulated by the proinflammatory cytokines, IL-1 β and TNF- α , in colonic subepithelial myofibroblasts. Thus, colonic subepithelial myofibroblasts may play an important role in the pathophysiology of inflammation in the colon.

Because the intestinal microflora play an important role in the development of inflammatory bowel disease (IBD), there is currently some interest in the manipulation of the composition of the microflora towards a potentially more remedial community. This review summarizes the clinical and experimental efficacy of the manipulation of microflora by the use of prebiotics, probiotics, synbiotics, and antibiotics in IBD. Prebiotics, defined as nondigestible food ingredients that beneficially affect the host by selectively stimulating the growth or activity of one or a limited number of bacterial species already resident in the colon, can modulate the colonic microbiota by increasing the number of specific bacteria and thus changing the composition of the microbiota. Prebiotics for IBD include lactosucrose, oligofructose, inulin, bran, psyllium, and germinated barley foodstuff (GBF). GBF, which mainly consists of dietary fiber and glutamine-rich protein, is a prebiotic foodstuff for ulcerative colitis. GBF has shown to be converted into a preferential nutrient for colonocytes through Eubacterium and Bifidobacterium and also inactivate nuclear factor kappa B (NFkB). Moreover, it exhibits a potent water-holding capacity and bile-acid binding capacity. Probiotics, which are microbial food supplements that beneficially affect the host by improving the intestinal microbial balance, have been used to change the composition of colonic microbiota. The approaches for IBD include VSL#3, Nissle1917, Clostridium butyricum and Bifidobacterium-fermented milk. Use of Lactococci secreting IL-10 provides excellent results. The combination of prebiotics and probiotics in a synbiotic has not been studied in IBD but is promising. The use of antibiotics continues to be of interest. Although these strategies hold great promise and appear to be useful in some settings, more clinical study is needed to firmly establish the relevance of these therapies.

The barrier functions in epithelial and endothelial cells seem to be very important for maintaining normal biological homeostasis. However, it is unclear whether or how bile acids affect the epithelial barrier. We examined the bile acid-induced disruption of the epithelial barrier. We measured the transepithelial electrical resistance (TEER) of Caco-2 cells as a marker of disruption of the epithelial barrier. Reactive oxygen species (ROS) generation was also measured. Cholic acid (CA) decreased the TEER and increased intracellular ROS generation. PLA2 (phospholipase A2), COX (cyclooxygenase), PKC (protein kinase), ERK1/2 (extracellular signal-regulated kinase 1/2), PI3K (phosphatidylinositol 3-kinase), p38 MAPK (p38 mitogen-activated protein kinase), MLCK (myosin light-chain kinase), NADH dehydrogenase, and XO (xanthine oxidase) inhibitors or ROS scavengers prevented the CA-induced TEER decrease. PLA2, COX, PKC, NADH dehydrogenase, and XO inhibitors prevented the CA-induced ROS generation but not ERK1/2, PI3K, p38 MAPK, and MLCK inhibitors. If the cells were treated with ROS generators such as superoxide dismutase, the TEER decreased. ERK1/2, PI3K, p38 MAPK, and MLCK inhibitors prevent these ROS generators from inducing the TEER decrease. These results suggest that ROS play an important role. In addition, PLA2, COX, PKC, NADH dehydrogenase, and XO are located upstream of the ROS generation, but ERK1/2, PI3K, p38 MAPK, and MLCK are downstream during the signaling of CA-induced TEER alterations.

Neck clipping has generally been believed to be among the most reliable of the operative modalities for cerebral aneurysm. However, recurrences with catastrophic outcome have been known to occur. We recently treated two patients who each had a new aneurysm at the site of the initial clipping. In both cases, the recurrence was found several years after the aneurysm neck had been closed successfully with a silver clip, which had been confirmed by intraoperative inspection and by postoperative angiographic studies demonstrating disappearance of the aneurysm. Histological examination of the recurrent aneurysm showed that the arterial wall had apparently been damaged by the clip edge, which resulted in thinning and disruption of both the muscle layer and the internal elastic lamina. Therefore, local fragility of the arterial wall adjacent to the aneurysm seems to have been the cause of the formation of a new aneurysm. The need to reinforce the thin-walled parent artery and the usefulness of high resolution computed tomography for the early detection of recurrent aneurysms are emphasized.

Background. Enzyme-treated rice fiber (ERF) is a recently developed prebiotic product made from rice bran by heat-resistant amylase, protease and hemicellulase treatment. Although the detailed mechanism of inflammatory bowel disease (IBD) is still unclear, the role of the resident luminal bacteria and its interaction on the mucosal barrier seem to be an important factor in the development of IBD and its chronicity. With the objective of manipulating the intestinal microbiota in IBD, this study was carried out to evaluate the effects of ERF on IBD with using experimental colitis models. Methods. Three colitis models were used and they were induced by the oral administration of dextran sodium sulfate in male Sprague–Dawley rats or BALB/c mice and transferring CD4+ CD45RBhigh T cells to female SCID mice, sequentially their CD4+ T cells were retransferred to new SCID mice. The evaluation included the measurement of body weight, spleen weight, colon length, histological examination, serum and mucosal cytokine (tumor necrosis factor-alpha (TNF-α), an interferon-gamma (IFN-γ), interleukin-12 p70 (IL-12p70), IL-1β, IL-6, IL-4) analysis, mucosal serotonin (5HT), and organic acid production and a microbiota analysis of the cecal contents. The characteristics of T cell surface markers including CD4, CD69, CD45RB of spleen and mesenteric lymph nodes (MLN) were also analyzed. In addition, the effects of ERF on the change in the induction of dendritic cells (DCs) were evaluated. Results. The preventive effect of ERF on colitis was significantly superior to that of raw material rice bran or control group. An overexpression of inflammatory cytokine production was attenuated by ERF treatment, which was accompanied with a decrease in both the colonic mucosal damage and 5HT production. Furthermore, ERF significantly attenuated the T cell activation (CD4+CD69+) of spleen and MLN, and this characteristic was inherited by the retransferred mice. ERF significantly suppressed the growth of Clostiridium, and increased short-chain fatty acids (acetate, propionate and butyrate) content in colitis. The relatively hydrophilic fraction of ERF (ethanol–methanol soluble fraction) is therefore considered to have a potent ability to attenuate the induction of DCs. Conclusion. A new prebiotic, ERF, reduced inflammation by modulating the colonic environment and regulating immune cell differentiation. Although a more detailed study is required, this study showed the promising anti-inflammatory effects of an adjunctive prebiotic treatment for IBD.

<h3>Background & Aims</h3> T helper (Th) 17 cells produce the effector cytokine interleukin (IL)-17, along with IL-22, which stimulates colonic epithelial cells to produce a membrane-bound mucin, Muc1. Muc1 is a component of the colonic mucus, which functions as a lubricant and a physiologic barrier between luminal contents and mucosal surface. The gene <i>MUC1</i> has been associated with susceptibility to inflammatory bowel disease; we investigated the role of Muc1 in development of colitis in mice. <h3>Methods</h3> <i>Muc1</i> and <i>RAG1</i> were disrupted in mice (<i>Muc/RAG</i> double knockout mice); Th1-mediated colitis was induced by intravenous injection of CD4⁺CD45RB^high T cells. We also studied Th2-mediated colitis using mice with disruptions in <i>Muc1</i> and <i>T-cell receptor α chain</i> (<i>Muc/TCR</i> double knockout mice). <h3>Results</h3> Muc1 deficiency led to the development of more severe forms of Th1- and Th2-induced colitis than controls. Loss of Muc1 increased colonic permeability and the Th17-cell, but not Th2 or Th1 cell, response in the inflamed colon. Loss of Muc1 also promoted expansion of an innate lymphoid cell population (Lin⁻ ckit⁻ Thy1⁺ Sca1⁺) that produces IL-17. The expansion of Th17 adaptive immune cells and innate lymphoid cells required the commensal microbiota. <h3>Conclusions</h3> Muc1, which is up-regulated by Th17 signaling, functions in a negative feedback pathway that prevents an excessive Th17 cell response in inflamed colons of mice. Disruption of this negative feedback pathway, perhaps by variants in Muc1, might contribute to inflammatory bowel disease in patients.

Cigarette smoke has been known to affect the development of bowel disease. However it has not been fully elucidated how cigarette smoke has effects on the gut. In this context we evaluated not only caecal levels of organic acids but also populations of micro-flora and pH in caecal contents after exposing rats (n = 5) to cigarette smoke for a 4-week in order to investigate whether the gut environment is altered by cigarette smoke or not. After the exposure of cigarette smoke, caecal levels of organic acids such as acetic acid, propionic acid, butyric acid and valeric acid significantly decreased. Additionally the population of Bifidobacterium significantly decreased and the pH significantly elevated. In conclusion cigarette smoke changes caecal levels of certain organic acids, the population of Bifidobacterium and the pH in caecal contents of rats. These results suggest that cigarette smoke may alter the gut environment of rats.

Intestinal fibrosis is a clinically important issue in Crohn's disease (CD). Heat shock protein (HSP) 47 is a collagen-specific molecular chaperone involved in fibrotic diseases. The molecular mechanisms of HSP47 induction in intestinal fibrosis related to CD, however, remain unclear. Here we investigated the role of interleukin (IL)-17A-induced HSP47 expression in intestinal fibrosis in CD.Expressions of HSP47 and IL-17A in the intestinal tissues of patients with IBD were determined. HSP47 and collagen I expressions were assessed in intestinal subepithelial myofibroblasts (ISEMFs) isolated from patients with IBD and CCD-18Co cells treated with IL-17A. We examined the role of HSP47 in IL-17A-induced collagen I expression by administration of short hairpin RNA (shRNA) to HSP47 and investigated signalling pathways of IL-17A-induced HSP47 expression using specific inhibitors in CCD-18Co cells.Gene expressions of HSP47 and IL-17A were significantly elevated in the intestinal tissues of patients with active CD. Immunohistochemistry revealed HSP47 was expressed in α-smooth muscle actin (α-SMA)-positive cells and the number of HSP47-positive cells was significantly increased in the intestinal tissues of patients with active CD. IL-17A enhanced HSP47 and collagen I expressions in ISEMFs and CCD-18Co cells. Knockdown of HSP47 in these cells resulted in the inhibition of IL-17A-induced collagen I expression, and analysis of IL-17A signalling pathways revealed the involvement of c-Jun N-terminal kinase in IL-17A-induced HSP47 expression.IL-17A-induced HSP47 expression is involved in collagen I expression in ISEMFs, which might contribute to intestinal fibrosis in CD.

Abstract Objectives The effect of Helicobacter pylori eradication on the gut microbiota of teenagers is unknown; hence, this study aimed to assess changes in the gut microbiome after H. pylori eradication therapy in teenagers. Materials and Methods Changes in gut microbiota before and after H. pylori eradication were prospectively investigated in eight students without any underlying diseases, via next‐generation sequencing of 16S rDNA. Twenty‐four stool samples were collected, and operational taxonomic unit analysis was performed. As secondary analyses, alpha and beta diversity were evaluated. Furthermore, pre‐treatment microbiome compositions were compared with those 1 week and 2 months after treatment. Results Alpha diversity analysis revealed that both species richness and evenness were recovered to pre‐treatment levels at 2 months after eradication therapy. Slight but non‐significant differences were observed in bacterial species abundance between pre‐ and post‐treatment samples, upon beta diversity analysis. Although the relative abundance of Bacteroidetes tended to increase and that of Actinobacteria significantly decreased immediately after eradication therapy, the taxonomic composition was similar to that before treatment and at 2 months post‐eradication. However, two students showed significant changes in the gut microbiota in relative abundances at the level of the phylum, class, and order. Conclusions Although H. pylori eradication therapy caused short‐term dysbiosis, microbial diversity was restored in healthy teenagers. However, as the relative abundance of gut microbiota in some cases remained altered, the effect of H. pylori eradication therapy on the gut microbiome should be continuously monitored.

Background & AimsWe previously reported results from a prospective randomized controlled trial comparing the efficacy of adalimumab monotherapy versus combination with azathioprine for patients with Crohn’s disease (CD) who were naive to biologics and thiopurines. We performed a subanalysis of data from this study to evaluate factors associated with endoscopic response and mucosal healing in study participants.MethodsWe compared simple endoscopic scores for CD between patients with moderate to severe active CD randomly assigned groups that received adalimumab monotherapy (n = 85) or adalimumab in combination with azathioprine (n = 91), from June 2011 to June 2014 in Japan. We evaluated associations of simple endoscopic scores for CD with clinical factors and trough levels of adalimumab. Ultimately, 135 patients at Week 26 and 139 patients at Week 52 from 44 referral sites were analyzed for the present investigation.ResultsThe odds for endoscopic response were significantly higher in the combination group than in the monotherapy group at Week 26 (odds ratio [OR], 2.12; 95% confidence interval [CI], 1.04–4.32) but not at Week 52 (OR, 1.50; 95% CI, 0.77–2.94). The odds of mucosal healing did not differ significantly between groups at Weeks 26 or 52. Simple endoscopic scores for CD at Week 0 was significantly associated with mucosal healing at Week 26 (OR, 0.80; 95% CI, 0.72–0.90) and at Week 52 (OR, 0.91; 95% CI, 0.84–0.99). Higher adalimumab trough level at Week 26 associated with mucosal healing at Week 52 (OR, 1.34; 95% CI, 1.14–1.58; P for trend = .001) and was significantly higher in patients with endoscopic response than in patients without endoscopic response at Weeks 26 and 52 (P < .001).ConclusionsIn a post hoc analysis of data from a randomized controlled trial of patients with moderate to severe CD, we found that adalimumab in combination with azathioprine increased trough levels of adalimumab. Higher trough levels of adalimumab associated with endoscopic response and mucosal healing at Weeks 26 and 52. UMIN registration No: 000005146. We previously reported results from a prospective randomized controlled trial comparing the efficacy of adalimumab monotherapy versus combination with azathioprine for patients with Crohn’s disease (CD) who were naive to biologics and thiopurines. We performed a subanalysis of data from this study to evaluate factors associated with endoscopic response and mucosal healing in study participants. We compared simple endoscopic scores for CD between patients with moderate to severe active CD randomly assigned groups that received adalimumab monotherapy (n = 85) or adalimumab in combination with azathioprine (n = 91), from June 2011 to June 2014 in Japan. We evaluated associations of simple endoscopic scores for CD with clinical factors and trough levels of adalimumab. Ultimately, 135 patients at Week 26 and 139 patients at Week 52 from 44 referral sites were analyzed for the present investigation. The odds for endoscopic response were significantly higher in the combination group than in the monotherapy group at Week 26 (odds ratio [OR], 2.12; 95% confidence interval [CI], 1.04–4.32) but not at Week 52 (OR, 1.50; 95% CI, 0.77–2.94). The odds of mucosal healing did not differ significantly between groups at Weeks 26 or 52. Simple endoscopic scores for CD at Week 0 was significantly associated with mucosal healing at Week 26 (OR, 0.80; 95% CI, 0.72–0.90) and at Week 52 (OR, 0.91; 95% CI, 0.84–0.99). Higher adalimumab trough level at Week 26 associated with mucosal healing at Week 52 (OR, 1.34; 95% CI, 1.14–1.58; P for trend = .001) and was significantly higher in patients with endoscopic response than in patients without endoscopic response at Weeks 26 and 52 (P < .001). In a post hoc analysis of data from a randomized controlled trial of patients with moderate to severe CD, we found that adalimumab in combination with azathioprine increased trough levels of adalimumab. Higher trough levels of adalimumab associated with endoscopic response and mucosal healing at Weeks 26 and 52. UMIN registration No: 000005146.

Astaxanthin is a xanthophyll carotenoid, which possesses strong scavenging effect on reactive oxygen species. In this study, we examined the effect of astaxanthin on dextran sulfate sodium (DSS)-induced colitis in mice. Experimental colitis was induced by the oral administration of 4% w/v DSS in tap water in C57BL/6J mice. Astaxanthin was mixed with a normal rodent diet (0.02 or 0.04%). Astaxanthin significantly ameliorated DSS-induced body weight loss and reduced the disease activity index. The ameliorating effects was observed in a dose-dependent manner. Immunochemical analyses showed that astaxanthin markedly suppressed DSS-induced histological inflammatory changes (inflammatory cell infiltration, edematous changes and goblet cell depletion). Plasma levels of malondialdehyde and 8-hydroxy-2-deoxyguanosine were significantly reduced by the administration of 0.04% astaxanthin. Astaxanthin significantly suppressed the mucosal mRNA expression of IL-1β, IL-6, TNF-α, IL-36α and IL-36γ. Astaxanthin blocked the DSS-induced translocation of NF-κB p65 and AP-1 (c-Jun) into the nucleus of mucosal epithelial cells, and also suppressed DSS-induced mucosal activation of MAPKs (ERK1/2, p38 and JNK). In conclusion, astaxanthin prevented the development of DSS-induced colitis via the direct suppression of NF-κB, AP-1 and MAPK activation. These findings suggest that astaxanthin is a novel candidate as a therapeutic option for the treatment of inflammatory bowel disease.

Interleukin (IL)-38 exerts an anti-inflammatory function by binding to several cytokine receptors, including the IL-36 receptor. In this study, we evaluated IL-38 expression in the inflamed mucosa of patients with inflammatory bowel disease (IBD) and investigated its functions. IL-38 mRNA expression in endoscopic biopsy samples was evaluated using quantitative PCR. IL-38 protein expression was analyzed using immunohistochemical technique. Dextran sulfate sodium-induced colitis was induced in C57BL/6 background IL-38KO mice. The IL-38 mRNA and protein expression were enhanced in the active mucosa of ulcerative colitis, but not in Crohn's disease. The ratio of IL-36γ to IL-38 mRNA expression was significantly elevated in the active mucosa of UC patients. Immunofluorescence staining revealed that B cells are the major cellular source of IL-38 in the colonic mucosa. IL-38 dose-dependently suppressed the IL-36γ-induced mRNA expression of CXC chemokines (CXCL1, CXCL2, and CXCL8) in HT-29 and T84 cells. IL-38 inhibited the IL-36γ-induced activation of nuclear-factor kappa B (NF-κB) and mitogen-activated protein kinases in HT-29 cells. DSS-colitis was significantly exacerbated in IL-38KO mice compared to wild type mice. In conclusion, IL-38 may play an anti-inflammatory and protective role in the pathophysiology of IBD, in particular ulcerative colitis, through the suppression of IL-36-induced inflammatory responses.

SUMMARY The various biological activities of butyrate have been well documented. In this study, we tested the effects of butyrate on TNF-α-induced complement C3 and factor B biosynthesis in human intestinal epithelial cells. The biosynthesis of C3, factor B and IL-8 was evaluated at the protein and mRNA levels. To evaluate transcriptional activation, the nuclear run-on assay was performed. The transcription factor–DNA binding activity was assessed by an electrophoretic gel mobility shift assay (EMSA). In the intestinal epithelial cell lines HT-29, T84 and Caco-2, sodium butyrate enhanced TNF-α-induced C3 secretion, but suppressed TNF-α-induced factor B and IL-8 secretion. Nuclear run-on assay revealed that transcriptional regulatory mechanisms are involved in the effects of sodium butyrate. The EMSAs indicated that sodium butyrate suppressed TNF-α-induced nuclear factor (NF)-κB– and activation protein (AP)-1–DNA binding activity, but enhanced TNF-α-induced activation of CCAAT/enhancer-binding protein (C/EBP)β (NF-IL-6)–DNA binding activity. Sodium butyrate induced a counter-regulatory effect on TNF-α-induced C3 and factor B biosynthesis in human intestinal epithelial cells. Butyrate action has been discussed with its activity to induce histone hyperacetylation, but its counter-regulatory effect on complement biosynthesis may be closely associated with the modulation of transcription factor activation.

IL-11 inhibits the activation of NF-kappaB and induces the Th2 polarization of CD4+ T cells. The clinical utility of IL-11 is being investigated in Crohn's disease. However, physiological secretion of IL-11 in the intestine remains unclear. In this study, we investigated IL-11 secretion in human intestinal subepithelial myofibroblasts (SEMFs). Intestinal SEMFs were isolated from the human colonic mucosa. IL-11 secretion and mRNA expression were determined by ELISA and Northern blot analysis. The activating protein (AP)-1-DNA binding activity was evaluated by EMSA. IL-11 secretion was induced by IL-1beta and transforming growth factor (TGF)-beta1. These were also observed at the mRNA level. The EMSAs demonstrated that both IL-1beta and TGF-beta1 induced AP-1 activation within 2 h after stimulation, and a blockade of AP-1 activation by the recombinant adenovirus containing a dominant negative c-Jun markedly reduced the IL-1beta- and TGF-beta1-induced IL-11 mRNA expression. IL-1beta and TGF-beta1 induced an activation of ERK p42/44 and p38 MAP kinases, and the MAP kinase inhibitors (SB-202190, PD-98059, and U-0216) significantly reduced the IL-1beta- and TGF-beta1-induced IL-11 secretion. The upregulation of IL-11 mRNA by IL-1beta- and TGF-beta1 was also mediated by a p38 MAP kinase-mediated mRNA stabilization. The combination of IL-1beta and TGF-beta1 additively enhanced IL-11 secretion. Intestinal SEMFs secreted IL-11 in response to IL-1beta- and TGF-beta1. Mucosal IL-11 secretion might be important as an anti-inflammatory response in the pathogenesis of intestinal inflammation.

Ws/Ws rats have a small deletion of the c-kit gene, and are deficient in both mucosal-type mast cells (MMC) and connective tissue-type mast cells (CTMC). In the present study we investigated the role of intestinal MMC in the development of dextran sulphate sodium (DSS)-induced experimental colitis using Ws/Ws rats. Ws/Ws and control (+/+) rats were given a 3% DSS aqueous solution orally for 10 days, and the subsequent mucosal damage was evaluated macroscopically and histologically. The mucosal myeloperoxidase (MPO) activities and histamine levels were also measured. (i) DSS induced severe oedema and hyperaemia with sporadic erosions in the control (+/+) rats, but these changes were significantly attenuated in the Ws/Ws rats (P < 0.01). (ii) The microscopic mucosal damage score was lower in the Ws/Ws rats than in the control (+/+) rats (P = 0.06). (iii) There were no significant differences in mucosal MPO activity between the Ws/Ws and control (+/+) rats (P = 0.46). (iv) The mucosal histamine levels in the colon were significantly reduced in the Ws/Ws rats compared with the control (+/+) rats (P < 0.05). (v) Significant positive correlations were observed between mucosal histamine levels and the degree of mucosal oedema (calculated as colonic wet weight/protein content) (r = 0.778, P < 0.01), and between histamine levels and the macroscopic damage (r = 0.623, P < 0.05), respectively. (vi) DSS induced a local recruitment of MMC in the colonic mucosa of Ws/Ws rats, and mucosal damage gradually increased in accordance with this MMC recruitment. These results indicate that MMC play an important role in the development of DSS colitis.

We developed an Ultraflex-type stent by knitting polylactic acid monofilaments. The purpose of this study was to evaluate the stent’s clinical usefulness for treating benign stenoses in the gastrointestinal tract. The radial force of the biodegradable stent was compared with those of commercially available metallic stents. The measured radial force of the new biodegradable stent was higher than that of commercially available metallic stents. The biodegradable stents were applied in 2 patients with benign gastrointestinal stenoses. The first patient was a 19-year-old female with esophageal stenosis, due to drinking of caustic potash in an attempt to commit suicide. The second patient was a 75-year-old male who had a stenosis at the anastomotic site after esophageal cancer resection. In both cases, the placement of the stent was performed successfully, and the patients’ complaints improved immediately after stent placement. There were no complications during stent placement. The stenosis had not recurred at the six-month follow-up examination. In conclusion, the newly developed biodegradable stents were useful in treating benign stenoses of the alimentary tract.

Selenoprotein-P is a selenium-rich serum protein that carries more than 50% of serum selenium. We evaluated changes in serum selenoprotein-P levels in patients with inflammatory bowel disease. Serum selenoprotein-P levels were measured by enzyme-linked immunosorbent assay. Twenty healthy individuals (controls), 34 patients with ulcerative colitis, and 37 patients with Crohn’s disease (CD) were studied. A highly significant correlation was found between the serum selenium and selenoprotein-P levels. There was no significant difference in serum selenoprotein-P levels between healthy controls (average 3.4 ± 0.8 μg/mL, n = 20) and patients with ulcerative colitis (3.0 ± 1.0 μg/mL, n = 34). Serum selenoprotein-P levels were significantly lower in patients with CD (average 1.8 ± 0.5 μg/mL, n = 37). Serum selenoprotein-P levels were significantly lower in the elemental diet group of patients who had CD (average 1.4 ± 0.4 μg/mL, n = 17) than in the non-elemental diet group of patients who had CD (average 2.1 ± 0.3 μg/mL, n = 20). We found that the serum selenoprotein-P level is decreased in patients with CD. It may be a useful marker to monitor the systemic selenium status in various disorders.

IL-17 enhances the TNF-alpha-induced IL-6 and IL-8 secretion in human colonic subepithelial myofibroblasts. In this study, we investigated how IL-17 modulates RANTES secretion in these cells. TNF-alpha potently induced RANTES secretion, but IL-17 dose-dependently inhibited the TNF-alpha-induced RANTES secretion. This was also observed at the mRNA level. Even after pretreatment with TNF-alpha for 12 h, the inhibitory effect of IL-17 was detectable. IL-17 did not affect the TNF-alpha-induced stability of the RANTES gene. IL-17 significantly decreased the TNF-alpha-induced increase in RANTES promoter activity, and IL-17 actually blocked the TNF-alpha-induced RANTES gene transcription. EMSAs demonstrated that IL-17 did not modulate the TNF-alpha-induced NF-kappaB DNA-binding activity, but markedly decreased TNF-alpha-induced IFN regulatory factor-1 (IRF-1) DNA-binding activity. Because cooperation between NF-kappaB and IRF-1 is important in the TNF-alpha-induced RANTES gene expression, the major mechanism mediating the inhibitory effect of IL-17 may be achieved by the inhibition of IRF-1 DNA-binding activity.

OBJECTIVES Platelet-derived microparticles (PDMPs) are active molecules involved in the hemostatic and inflammatory responses. To evaluate the changes in the platelet function in patients with inflammatory bowel disease (IBD), we measured circulating PDMP levels. METHODS Twenty-five healthy controls, 44 patients with ulcerative colitis (UC), and 43 patients with Crohn's Disease (CD) were studied. The PDMP and soluble P-selectin (sP-selectin) levels were measured by enzyme-linked immunosorbent assay (ELISA). RESULTS In the healthy controls, the PDMP levels were 17.2 ± 6.2 U/mL. Significant differences were not observed between the healthy controls and inactive UC patients (20.8 ± 9.5 U/mL, n = 25) or between the healthy controls and inactive CD patients (17.6 ± 7.8 U/mL, n = 24). In contrast, the PDMP levels were significantly higher in both active UC (49.2 ± 33.6 U/mL, n = 19) and active CD (48.6 ± 42.8 U/mL, n = 19) patients than in the healthy controls. A significant correlation was found between the PDMP levels and the clinical activity indexes (CAI) of UC patients (r = 0.65, p < 0.01, n = 44), and between the PDMP levels and Crohn's disease activity indexes (CDAI) (r = 0.72, p < 0.01, n = 43). Elevated PDMP levels in active patients were significantly reduced after remission. A significant correlation was observed between the PDMP levels and the sP-selectin levels (r = 0.60, p < 0.01, n = 122). CONCLUSION Elevated circulating PDMPs in active IBD patients suggest a role for platelets in the pathogenesis of IBD.

To evaluate the therapeutic effects of the new synthetic sphingosine-1-phosphate (S1P) receptor modulator, FTY720, we investigated how FTY720 affects the development of dextran sulfate sodium (DSS)-induced colitis and CD4+CD62L+ T cell transfer colitis. BALB/c mice were fed a chow containing 3.5% (wt/wt) DSS to induce colitis. The CD4+CD62L+ T cell transfer colitis was induced by an intraperitoneal injection of CD4+CD62L+ spleen T cells into recipient CB17 SCID mice. The FTY720 was administered by lavage at a dose of 0.3 mg/kg/day. FTY720 was effective in preventing the body weight loss in the DSS-colitis model and the CD4+CD62L+ T cell transfer model. The disease activity index, histological colitis score, and MPO activity were all significantly lower in FTY720-treated mice than in the non-treated mice. Microscopically, mucosal edema, cellular infiltration and epithelial disruption were much more moderate in the FTY720-treated mice than in the non-treated mice. In both colitis models, FTY720 prevented the infiltration of CD4+ T cells into the inflamed colonic lamina propria. In conclusion, the development of DSS-colitis and CD4+CD62L+ T cell transfer colitis were significantly attenuated by FTY720. Since FTY720 is an immunosuppressive product that does not modulate T cell functions, it could be useful in the treatment of IBD patients.

Terminal restriction fragment length polymorphism (T-RFLP) analyses are powerful tools to assess the diversity of complex microbiota. T-RFLPs permit rapid comparisons of microbiota from many samples.To perform T-RFLP analyses of faecal microbiota in Crohn's disease (CD) patients to investigate potential alterations in faecal microbial communities and furthermore to analyse the effects of elemental diet on faecal microbiota profiles.Thirty-four patients with CD and 30 healthy individuals were enrolled in the study. DNA was extracted from stool samples and 16S rRNA genes were amplified by PCR. PCR products were digested with BslI restriction enzymes and T-RF lengths were determined.Faecal microbial communities were classified into seven clusters. Almost all healthy individuals (28/30) were included in cluster I, II and III, but the majority of CD patients (25/34) could be divided into another four clusters (cluster IV-VII). Prediction of bacteria based on the BslI-digested T-RFLP database showed a significant decrease in Clostridium cluster IV, Clostridium cluster XI and subcluster XIVa in CD patients. In contrast, Bacteroides significantly increased in CD patients. Significant increases in Enterobacteriales were also observed in CD patients. Furthermore, elemental diets modulated faecal bacterial communities in CD patients.Terminal restriction fragment length polymorphism analyses showed that the diversity of faecal microbiota in patients with CD differed from that of healthy individuals. Furthermore, elemental diets modulated faecal microbiota composition, and this effect may be involved in mechanisms of clinical effects of elemental diet.

Interleukin 33 (IL33) is a cytokine belonging to the IL1 family and it binds to a complex of the ST2L/IL1 receptor accessory protein (IL1RAcP). To define the role of IL33 in fibrogenesis of the pancreas, the expression of IL33, ST2L and IL1RAcP was examined in chronic pancreatitis tissues. The effects of IL33 on the functions of human pancreatic myofibroblasts were also investigated.Tissue samples were obtained surgically. The expression of IL33, ST2L and IL1RAcP was evaluated by standard immunohistochemical procedures. Messenger RNA expression for IL33, ST2L and IL1RAcP was analysed by northern blotting and real-time PCR analyses, and protein expression was assessed by western blotting and ELISA. Cell proliferation and migration were assessed by a (3)H-thymidine incorporation assay and the modified Boyden chamber assay, respectively.IL33, ST2L and IL1RAcP were expressed by alpha-SMA-positive myofibroblasts in the fibrosis of chronic pancreatitis. In human pancreatic myofibroblasts, IL33 was weakly immunoexpressed without any stimuli, and this was markedly enhanced by IL1beta, tumour necrosis factor alpha (TNFalpha) and lipopolysaccharide (LPS) via the mitogen-activated protein kinase (MAPK)-dependent AP-1 activation pathway. ST2L mRNA was weakly detected in unstimulated cells, and IL4 and interferon gamma (IFNgamma) strongly enhanced ST2L expression via STAT6 and STAT1 signalling, respectively. IL33 rapidly induced the phosphorylation of MAPKs and IkappaBalpha, and enhanced the expression of inflammatory mediators (IL6, IL8, IP-10, Gro-alpha, Gro-beta and MCP-1) in IL4- or IFNgamma-pretreated cells. IL33 stimulated the proliferation and migration of pancreatic myofibroblasts.IL33 and its receptor complex (ST2L and IL1RAcP) constitute a novel signalling system which may play an important role in the pathogenesis of chronic pancreatitis.

Aliment Pharmacol Ther 2011; 34: 941–948 Summary Background Chitinase 3-like-1 (CHI3L1) is up-regulated in the inflamed mucosa of inflammatory bowel disease (IBD). Aim To evaluate the usefulness of a faecal CHI3L1 assay, as a reliable marker for predicting the severity of paediatric IBD. Methods Faecal samples were obtained from ulcerative colitis (UC, n = 94), Crohn’s disease (CD, n = 87), and healthy individuals (n = 56). The faecal CHI3L1 and calprotectin levels were determined by ELISA. For endoscopic evaluation, the sum of the Matts’ score for UC and the simple endoscopic score for CD (SES-CD) were used. Ileal lesions were evaluated by ultrasonography. Results Faecal CHI3L1 levels were significantly elevated in active UC (median 366.6 ng/g, n = 44) and active CD (median 632.7 ng/g, n = 48) patients, as compared with healthy individuals (median 2.2 ng/g, n = 56). In UC patients, the faecal CHI3L1 levels were positively correlated with the sum of the Matts’ score (r = 0.73, P < 0.01, n = 42). In CD patients, there was a significant correlation between faecal CHI3L1 levels and endoscopic activity as determined by the SES-CD scoring system (r = 0.61, P < 0.01, n = 25). The faecal CHI3L1 levels of patients with wall thickening of their small intestine were significantly higher than those of healthy controls or patients without wall thickening. The cutoff value of 13.7 ng/g for fecal CHI3L1(the 95th percentile of the control value) predicted active lesions in IBD patients with a sensitivity of 84.7% and a specificity of 88.9%. Conclusion Faecal CHI3L1 assays may be useful for predicting the severity and activity of mucosal inflammation in IBD.

Objective In patients with ulcerative colitis (UC), the relationship between the initial endoscopic findings and the response to anti-tumor necrosis factor (TNF)-α antibodies remains unclear. We herein evaluated the potential of endoscopic assessment using the ulcerative colitis endoscopic index of severity (UCEIS) to predict the response to anti-TNF-α antibodies. Methods We enrolled 64 patients with UC undergoing anti-TNF-α maintenance therapy with infliximab (IFX) or adalimumab (ADA) between April 2010 and March 2015. Anti-TNF-α trough levels were determined by ELISA. Endoscopic disease activity was assessed using the UCEIS. Results The clinical response rate at 8 weeks was 77.4% for IFX and 66.7% for ADA. Serum albumin levels were significantly higher and the UCEIS bleeding descriptor before treatment was significantly lower in the responders than in the non-responders (p < 0.05 each). The CRP levels at 2 weeks were significantly lower in the responders (p < 0.001). The serum albumin levels before treatment were significantly higher and the UCEIS erosions and ulcers descriptor was significantly lower in the mucosal healing group than in the non-mucosal healing group (p < 0.05 each). A significant and negative correlation between the trough levels of anti-TNF-α antibodies and the UCEIS descriptors was observed. The trough levels of anti-TNF-α antibodies to achieve mucosal healing were 2.7 μg/mL for IFX and 10.3 μg/mL for ADA. Conclusions The UCEIS score, as well as some clinical markers (serum albumin and CRP levels), is useful for the prediction of the treatment outcome of UC patients in response to anti-TNF-α antibodies.

&lt;b&gt;&lt;i&gt;Background/Aims:&lt;/i&gt;&lt;/b&gt; Hospitalized patients with Crohn’s disease (CD) can develop severe nutritional deficits. However, the nutritional screening tools with the most utility for such patients are still unknown. &lt;b&gt;&lt;i&gt;Methods:&lt;/i&gt;&lt;/b&gt; Nutritional status of 40 CD patients was assessed on admission using several screening tools and laboratory tests. Their validity was evaluated in relation to length of hospital stay (LOS) and intestinal resection. Receiver operating characteristic analysis was performed to predict prolonged LOS (≥28 days). &lt;b&gt;&lt;i&gt;Results:&lt;/i&gt;&lt;/b&gt; Prolonged LOS was correlated with each of the following screening parameters: Subjective Global Assessment, Nutrition Risk Screening 2002 (NRS 2002), Onodera’s Prognostic Nutritional Index (O-PNI), Controlling Nutritional Status, serum albumin level, and weight loss. These parameters were not correlated with intestinal resection. Evaluation of prognostic yield showed cutoff values of serum albumin 3.3 g/dL (AUC 0.797, sensitivity 57.1%, specificity 89.5%) and O-PNI 36.5 (0.749, 71.4%, 73.7%). By combining the serum albumin cutoff value and NRS 2002 score, patients were divided into 4 groups, with a prolonged LOS rate of 68.2% in the group with the worst prognosis. &lt;b&gt;&lt;i&gt;Conclusions:&lt;/i&gt;&lt;/b&gt; A combination of serum albumin (given the simplicity of testing) and NRS 2002 as nutritional screening tools may be useful for hospitalized CD patients.

Endoscopic retrograde cholangiopancreatography (ERCP) often requires deep sedation. Dexmedetomidine, a highly selective α2-adrenoceptor agonist with sedative activity and minimal effects on respiration, has recently been widely used among patients in the intensive care unit. However, its use in endoscopic procedures in very elderly patients is unclear. In this study, we retrospectively investigated the safety and efficacy of dexmedetomidine sedation during ERCP.The study included 62 very elderly patients (aged over 80 years) who underwent ERCP from January 2014, with sedation involving dexmedetomidine (i.v. infusion at 3.0 μg/kg/h over 10 min followed by continuous infusion at 0.4 μg/kg/h) along with midazolam. For comparison, the study included 78 patients who underwent ERCP before January 2014, with midazolam alone. We considered additional administration of midazolam as needed to maintain a sedation level of 3-4, according to the Ramsay sedation scale. The outcome measures were amount of midazolam, adverse events associated with sedation, and hemodynamics.The incidence of decreased SpO2 and median dose of additional midazolam were significantly lower in the dexmedetomidine group than in the conventional group. The minimum systolic blood pressure and minimum heart rate during and after examination was significantly lower in the dexmedetomidine group than in the conventional group. However, serious acute heart failure or arrhythmia was not noted.Dexmedetomidine can decrease the incidence of respiratory complications and the total dose of other sedative agents. It can be used as an alternative to conventional methods with midazolam for adequate sedation during ERCP in very elderly patients.

Because anti-tumor necrosis factor (anti-TNF) therapy has become increasingly popular in many Asian countries, the risk of developing active tuberculosis (TB) among anti-TNF users may raise serious health problems in this region. Thus, the Asian Organization for Crohn's and Colitis and the Asia Pacific Association of Gastroenterology have developed a set of consensus statements about risk assessment, detection and prevention of latent TB infection, and management of active TB infection in patients with inflammatory bowel disease (IBD) receiving anti-TNF treatment. Twenty-three consensus statements were initially drafted and then discussed by the committee members. The quality of evidence and the strength of recommendations were assessed by using the Grading of Recommendations Assessment, Development, and Evaluation methodology. Web-based consensus voting was performed by 211 IBD specialists from 9 Asian countries concerning each statement. A consensus statement was accepted if at least 75% of the participants agreed. Part 1 of the statements comprised 2 parts: risk of TB infection Recommendaduring anti-TNF therapy, and screening for TB infection prior to commencing anti-TNF therapy. These consensus statements will help clinicians optimize patient outcomes by reducing the morbidity and mortality related to TB infections in patients with IBD receiving anti-TNF treatment.

Crosstalk between the gut microbiota and bile acid plays an important role in the pathogenesis of gastrointestinal disorders. We investigated the relationship between microbial structure and bile acid metabolism in the ileal mucosa of Crohn's disease (CD).Twelve non-CD controls and 38 CD patients in clinical remission were enrolled. Samples were collected from the distal ileum under balloon-assisted enteroscopy. Bile acid composition was analyzed by liquid chromatography-mass spectrometry. The gut microbiota was analyzed by 16S rRNA gene sequencing.The Shannon evenness index was significantly lower in endoscopically active lesions than in non-CD controls. β-Diversity, evaluated by the UniFrac metric, revealed a significant difference between the active lesions and non-CD controls (P=0.039). The relative abundance of Escherichia was significantly higher and that of Faecalibacterium and Roseburia was significantly lower in CD samples than in non-CD controls. The increased abundance of Escherichia was more prominent in active lesions than in inactive lesions. The proportion of conjugated bile acids was significantly higher in CD patients than in non-CD controls, but there was no difference in the proportion of primary or secondary bile acids. The genera Escherichia and Lactobacillus were positively correlated with the proportion of conjugated bile acids. On the other hand, Roseburia, Intestinibacter, and Faecalibacterium were negatively correlated with the proportion of conjugated bile acids.Mucosa-associated dysbiosis and the alteration of bile acid composition were identified in the ileum of CD patients. These may play a role in the pathophysiology of ileal lesions in CD patients.

Germinated barley foodstuff (GBF) contains protein and insoluble dietary fiber. We have previously shown in ulcerative colitis patients and a colitis model that GBF feeding attenuates mucosal damage by increasing luminal butyrate levels. However, the detailed mechanism remains unclear because of its heterogeneous nature. The present study was carried out to: (i) evaluate the active ingredient in GBF; and (ii) examine its effect on the repair process in colonic inflammation by using a dextran sulfate sodium (DSS) colitis model.Colitis was induced by feeding a diet containing 0.5-3.5% DSS to male Sprague-Dawley rats. (i) Active ingredient: GBF was fractionated enzymatically into fiber- and protein-rich fractions. Each fraction was administered to DSS-colitis rats. Clinical signs, cecal short chain fatty acid concentrations and serum alpha1-acid glycoprotein (AAG) levels were determined. (ii) Effect on mucosal repair: GBF with or without salazosulfapyridine (SASP), or SASP alone was administered to rats after the onset of colitis. Seven days after initial treatment, the number of epithelial cells in HE sections was evaluated morphologically in a blind fashion and serum AAG was determined.(i) Germinate barley foodstuff and GBF-fiber significantly attenuated the clinical signs of colitis and decreased serum AAG levels, with a significant increase in cecal butyrate production, while GBF-protein did not. (ii) Treatment with GBF alone and GBF plus SASP significantly accelerated colonic epithelial repair and improved clinical signs.These findings suggest that the fiber fraction of GBF may effectively enhance luminal butyrate production, and thereby accelerate colonic epithelial repair in colitis.

Germinated barley foodstuffs (GBF), which are derived from brewer's spent grain and are a highly safe food substance, increased butyrate production in the lower intestine and prevented mucosal damage and bloody diarrhoea in an acute experimental colitis model. As human histocompatibility leucocyte antigen (HLA)-B27 transgenic rats develop spontaneous and chronic intestinal inflammation resembling ulcerative colitis, we investigated the mechanisms underlying the preventive effects of GBF against a spontaneous and chronic colitis model. Specifically, the production of bacterial butyrate and the regulation of proinflammatory cytokine production were examined.A GBF diet and a cellulose (CE) diet were fed to HLA-B27 transgenic rats for 13 weeks. The presence of faecal occult blood, colonic mucosal protein, DNA and RNA content, colonic myeloperoxidase activity, nuclear factor kappa B (NFkappaB) DNA binding activity, the depth of the crypts and serum inflammatory parameters were then evaluated. Butyrate production in the caecal contents was also determined.Feeding GBF significantly increased bacterial butyrate production and simultaneously attenuated the presence of faecal occult blood and colonic mucosal hyperplasia. Colonic mucosal NFkappaB-DNA binding activity and the production of interleukin-8 were also suppressed by the butyrate produced from GBF.Germinated barley foodstuffs feeding promotes bacterial butyrate production and attenuated inflammation in both spontaneous and chronic colitis in HLA-B27 transgenic rats.

There is increasing evidence that intestinal microflora play an important role in the pathogenesis of ulcerative colitis. Therefore, modification of the microflora by prebiotics, probiotics, and antibiotics may be a rational approach for controlling intestinal inflammation. Germinated barley food-stuff (GBF) is an insoluble mixture of glutamine-rich protein and hemicellulose-rich dietary fiber. GBF is utilized efficiently by Bifidobacterium, Lactobacillus, and Eubacterium and converted by them into lactate, acetate, and butyrate. These bacterial organic acids preserve a favorable intestinal condition. We have previously shown that GBF has attenuated intestinal inflammation in patients with ulcerative colitis and experimental colitis models through prebiotic actions. The aim of this study was to compare the effect of GBF with that of probiotics and antibiotics in an experimental colitis model. Colitis was induced by feeding male SD rats with a diet containing 3.0-3.5% dextran sodium sulfate (DSS). The therapeutic effect of oral administration of a prebiotic (GBF), probiotics (mixture of Lactobacillus and Clostridium butyricum), antibiotics (vancomycin, metronidazole), and the vehicle was determined by assessing clinical and pathological scores on day 6 after initiation of colitis. Butyrate concentrations in the cecal content were also determined. GBF treatment significantly reduced colonic inflammation as assessed by clinical scores with an increase in cecal butyrate levels. Probiotic treatment with a mixture of Lactobacillus and Clostridium butyricum did not show such an effect. Both antibiotic treatments significantly attenuated clinical and pathological scores. However, in contrast to GBF, this treatment led to a significant decrease in cecal butyrate levels. These data suggest that modification of the intestinal microflora by prebiotics, including GBF, may serve as a useful adjunct in the treatment of ulcerative colitis as well as antibiotic treatment.